Editable cell line

Abstract

The present disclosure provides these cell lines, including the use of gene editing proteins to produce editable cell lines. The editable cell lines can express antibody constant regions that can function as a platform for antibody variable regions to produce customized antibodies.

Description

Technical Field

[0001] The present disclosure provides these cell lines, including the use of gene editing proteins to produce editable cell lines. By preparing editable cell lines having the ability to be further modified to individually produce a desired antibody, the cost and time of the antibody manufacturing process can be reduced.

Background Art

[0002] As the clinical introduction of advanced antibody therapies accelerates, attention has focused on the manufacturing strategies that can underlie these therapies to benefit patients worldwide. Antibody therapies hold great clinical potential, but the high manufacturing costs compared to reimbursement rates pose a high barrier to commercialization.

[0003] One of the challenges faced by antibody therapies is the multi-step and complex manufacturing process for producing the desired antibody. Current manufacturing processes rely on introducing vectors to construct cell lines in order to express the gene of interest and obtain the desired antibody. This process requires gene transfer and pool recovery following vector construction for each new antibody to be expressed. This process further requires clone selection to find high-producing clones, which is time-consuming as each clone requires stability evaluation and introduces the potential for deviation and defects.

[0004] What is needed to overcome these challenges is a way to shorten and simplify the manufacturing process. Editable cell lines can express antibody constant regions and function as a platform for antibody variable regions, eliminating the need for vector construction and providing a reliable antibody manufacturing platform. The present invention meets these needs.

Summary of the Invention

[0005] In some embodiments, the present disclosure provides a cell comprising a genomic nucleic acid sequence, wherein the genomic nucleic acid sequence comprises a first sequence encoding constant regions 1, 2, and 3 of an antibody heavy chain on one strand of the genomic nucleic acid sequence, the first sequence not being adjacent to a sequence encoding an antibody heavy chain variable region, and a second sequence encoding constant region 1 of an antibody light chain on the opposite strand of the genomic nucleic acid sequence, the second sequence not being adjacent to a sequence encoding an antibody light chain variable region.

[0006] In a further embodiment, a method of producing an editable cell is provided, the method comprising introducing a first sequence encoding constant regions 1, 2, and 3 of an antibody heavy chain on one strand of the genomic nucleic acid sequence of the cell, and introducing a second sequence encoding constant region 1 of an antibody light chain on the opposite strand of the genomic nucleic acid sequence of the cell.

[0007] Also provided herein is a method of making an antibody for producing an editable cell, the method comprising providing a cell comprising a genomic nucleic acid sequence, wherein the genomic nucleic acid sequence comprises a first sequence encoding constant regions 1, 2, and 3 of an antibody heavy chain on one strand of the genomic nucleic acid sequence, the first sequence not being adjacent to a sequence encoding an antibody heavy chain variable region, and a second sequence encoding constant region 1 of an antibody light chain on the opposite strand of the genomic nucleic acid sequence, the second sequence not being adjacent to a sequence encoding an antibody light chain variable region; introducing a sequence encoding an antibody heavy chain variable region upstream of the first sequence of the antibody heavy chain constant region; and introducing a sequence encoding an antibody light chain variable region upstream of the second sequence of the antibody light chain constant region 1. BRIEF DESCRIPTION OF THE DRAWINGS

[0008]

Figure 1

Figure 2

Figure 3

Figure 4A

Figure 4B

Figure 4C

Figure 5A

Figure 5B

Figure 5C

Figure 6A

Figure 6B

Figure 7

Figure 8

Figure 9A

Figure 9B

Mode for Carrying Out the Invention

[0009] The words "a" or "an", when used in the claims and / or the specification together with the term "comprising", may mean "one", but may also be used in accordance with the meaning of "one or more", "at least one", and "one or more than one".

[0010] Throughout this application, the term "about" is used to indicate that a value includes the variability of error inherent in the method / device used to determine that value. Typically, the term means including a variation of about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20%, or less, depending on the circumstances.

[0011] The use of the term "or" in the claims is used to mean "and / or" unless explicitly indicated to refer to alternatives only or unless the alternatives are mutually exclusive, but this disclosure supports definitions that refer to alternatives only and "and / or".

[0012] As used in this specification and the claims (if any), the terms "comprising" (and any form of "comprising", such as "comprise" and "comprises"), "having" (and any form of "having", such as "have" and "has"), "including" (and any form of "including", such as "includes" and "include"), or "containing" (and any form of "containing", such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. It is contemplated that any embodiment discussed herein can be implemented with respect to any method, system, host cell, expression vector, and / or composition of the present invention. Further, the compositions, systems, cells, and / or nucleic acids of the present invention can be used to achieve any of the methods described herein.

[0013] As described throughout, the subject matter of the present disclosure is an editable cell line that is stable in some embodiments, high-producing in further embodiments, and capable of further modification to individually produce a desired customized antibody. The editable cell line involves the use of gene editing proteins to further modify the genomic sequence encoding the headless antibody structure. Since the headless antibody structure is an intermediate, the editable cell line may or may not express the headless antibody structure. However, when the editable cell line is fully modified in the antibody variable region, the cell line can be expressed to produce a fully customized antibody protein.

[0014] As used herein, "headless antibody" means an antibody protein that does not contain the antibody variable region but contains the constant heavy chain region and the constant light chain region. The antibody variable region includes the heavy chain variable region and the light chain variable region that define the antigen-binding site of the antibody protein. See, for example, FIG. 1 showing the representation of an antibody containing the heavy chain constant region and the light chain constant region. The headless antibody structure can be modified and is only an intermediate, and a customized antibody protein can be produced by introducing the antibody variable region.

[0015] As used herein, "genomic nucleic acid" or "genomic sequence" means a nucleic acid incorporated into the genome of a cell. The term "genome" refers to the complete set of genetic information in the chromosomes of a cell.

[0016] As used herein, "nucleic acid", "nucleic acid molecule", or "oligonucleotide" means a polymeric compound containing covalently linked nucleotides. The term "nucleic acid" includes polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), both of which can be single-stranded or double-stranded. DNA includes, but is not limited to, complementary DNA (cDNA), genomic DNA, plasmid or vector DNA, and synthetic DNA. RNA includes, but is not limited to, gRNA, mRNA, tRNA, rRNA, snRNA, microRNA, miRNA, or MIRNA.

[0017] As used herein, "gene" refers to an assembly of nucleotides encoding a polypeptide, including nucleic acid molecules of cDNA and genomic DNA. "Gene" also refers to a nucleic acid fragment that can function as regulatory sequences before (5' non-coding sequence) and after (3' non-coding sequence) the coding sequence. In some embodiments, the gene is incorporated in multiple copies. In some embodiments, the gene is incorporated at a predetermined copy number.

[0018] As used herein, "stable" means that a cell line can maintain the integrity of the cells by using commonly used preservation methods, and the cells can maintain the antibody production function during multiple cell division processes. In embodiments, the cell lines described herein are stable cell lines. As used herein, "high-producing" or "high-expressing" means producing the molecule of interest in an amount of at least about 1 g / L. The amount considered high-producing depends on the molecule of interest being produced and can be about 2 g / L, about 3 g / L, about 4 g / L, about 5 g / L, about 6 g / L, about 7 g / L, about 8 g / L, about 9 g / L, about 10 g / L, about 15 g / L, about 20 g / L or more. In embodiments, the cells provided herein are stable high-expressing cells.

[0019] Figure 1 shows a schematic diagram of how an intermediate headless antibody can be modified by the introduction of antibody variable regions to generate a desired customized antibody. In Figure 1, overlapping antibody structures represent those that are encoded and produced by expressing the DNA sequence. Thus, initially, this sequence represents a headless antibody. Next, the antibody variable regions are introduced into the genome. Finally, the complete structure of the customized antibody is expressed. Various methods for producing such headless antibody structures are described herein.

[0020] The editable cell lines of the present disclosure preferably do not require the use of DNA vectors for introducing gene sequences encoding antibodies for each antibody production. One commonly used method for producing antibodies requires the use of recombinant DNA vectors that are generated, cloned, and introduced into host cells for each antibody production cycle. However, this common method relies on the random / semi-random integration of DNA vectors into host cells.

[0021] Editable cell lines can reduce the time and cost of commonly used antibody production methods by eliminating the need to produce DNA vectors, introducing the vectors into host cells, and selecting host cells that have the DNA vectors present for antibody production. In the disclosed editable cell lines, the sequence encoding the headless antibody is integrated into the genomic sequence of the host cell. Thus, when the editable cell is modified to produce a full antibody, the cell can be selected and cloned to produce the antibody.

[0022] Editable cell lines can be produced by integrating a sequence encoding an antibody constant region into the genomic sequence of the cell and preferably selecting a stable and, in embodiments, high-expressing cell line. The resulting cells contain a sequence encoding a headless antibody.

[0023] In some embodiments, provided herein is a method of producing an editable cell, the method comprising introducing a first sequence encoding antibody heavy chain constant regions 1, 2, and 3 on one strand of the genomic nucleic acid sequence of the cell, and introducing a second sequence encoding antibody light chain constant region 1 on the opposite strand of the genomic nucleic acid sequence of the cell. In some embodiments, the first and second sequences are located on opposite strands relative to each other of the genomic nucleic acid within the same locus. In some embodiments, the first and second sequences are on opposite strands relative to each other within the same locus and are separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide base pairs. In some embodiments, the first and second sequences are located on different chromosomes.

[0024] In some embodiments, provided herein is a method of producing an editable cell that further comprises introducing a sequence encoding a gene editing protein into a genomic nucleic acid sequence and expressing the gene editing protein. In some embodiments, provided herein is a method of producing an editable cell that further comprises introducing a ribonucleoprotein (RNP) of a suitable gene editing protein. In some embodiments, provided herein is a method of producing an editable cell that further comprises introducing a plasmid comprising a sequence encoding a gene editing protein into a cell and expressing the gene editing protein sequence within the plasmid.

[0025] As used herein, the terms "engineered nuclease," "engineered gene editing protein," or "gene editing protein" refer to a nuclease that has been isolated, modified, mutated, and / or altered from its native state as a nuclease. A "nuclease" refers to an enzyme capable of cleaving a DNA molecule and / or an RNA molecule. By engineering a nuclease, a specific location of cleavage can be designed and tailored to a desired cell type and / or gene.

[0026] Exemplary engineered nucleases that can be inserted (either incorporated from genomic nucleic acids, viruses or other non-genomic nucleic acids, or produced as RNPs) into cells include, for example, meganucleases, methyltransferases, zinc finger nucleases, transcription activator-like effector-based nucleases (TALENs), FokI nucleases, and CRISPR-associated (Cas) nucleases. Generally, engineered nucleases use DNA-binding proteins that have both the desired catalytic activity and the ability to bind to a desired target sequence through protein-nucleic acid interactions in a manner similar to restriction enzymes. Examples include meganucleases, which are naturally occurring or engineered rare sequence cleavage enzymes, zinc finger nucleases (ZFNs) that include FokI catalytic nuclease subunits bound to modified DNA-binding domains, each capable of cleaving one predetermined sequence, or transcription activator-like nucleases (TALENs). In ZFNs, the binding domain consists of a chain of amino acids that folds into a customized zinc finger domain. Similarly, in TALENs, 34-amino acid repeats derived from transcription factors fold into a large DNA-binding domain. In gene targeting, these enzymes can cleave genomic DNA to form double-strand breaks (DSBs) or generate nicks, which can be repaired by one of two repair pathways: non-homologous end joining (NHEJ) or homologous recombination (HR). The NHEJ pathway can potentially result in specific mutation, deletion, insertion, or replacement events. The HR pathway results in replacement of the target sequence with a supplied donor sequence. Exemplary FokI and methyltransferase-based systems are described in U.S. Patent No. 10,220,052, the disclosure of which is incorporated herein by reference in its entirety.

[0027] Clustered regularly interspaced short palindromic repeats (CRISPR) and associated proteins (CRISPR-associated nucleases, or Cas proteins), including the CRISPR-Cas system, were first identified in selected bacterial species and form part of the prokaryotic adaptive immune system. See Sorek et al., “CRISPR-a widespread system that provides acquired resistance against phages in bacteria and archaea,” Nat. Rev. Microbiol. 6(3)181-6(2008) (incorporated herein by reference in its entirety). The CRISPR-Cas system is mainly classified into the following three types: type I, type II, and type III. The main defining features of the different types are the various cas genes used and the respective proteins they encode. The cas1 and cas2 genes appear to be universal across the three main types, while cas3, cas9, and cas10 are thought to be specific to type I, type II, and type III systems, respectively. See, for example, Barrangou, R. and Marraffini, L.A., “CRISPR-Cas systems: prokaryotes upgrade to adaptive immunity,” Mol. Cell. 54(2):234-44(2014) (incorporated herein by reference in its entirety).

[0028] Generally, the CRISPR-Cas system functions by capturing short regions of invading viral DNA or plasmid DNA, integrating the captured DNA into the host genome, and separating it by repetitive sequences within the CRISPR locus to form a so-called CRISPR array. Following the acquisition of this DNA into the CRISPR array, transcription and RNA processing occur.

[0029] Depending on the bacterial species, CRISPR RNA processing proceeds in different ways. For example, in the type II system first described in Streptococcus pyogenes, the transcribed RNA pairs with the trans-activating RNA (tracrRNA) and is then cleaved by RNase III to form individual CRISPR-RNAs (crRNAs). The crRNAs are further processed after binding of the Cas9 nuclease to produce mature crRNAs. The crRNA / Cas9 complex then binds to DNA containing a sequence complementary to the capture region (referred to as the protospacer). The Cas9 protein then cleaves both strands of the DNA in a site-specific manner to form a double-strand break (DSB). This provides DNA-based memory and results in the rapid degradation of viral or plasmid DNA upon repeated exposure and / or infection.

[0030] Since the initial discovery, multiple groups have conducted extensive research on the potential applications of the CRISPR system in genetic engineering, including gene editing (Jinek et al., “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity,” Science 337(6096):816-21(2012), Cong et al., “Multiplex genome engineering using CRISPR / Cas systems,” Science 339(6121):819-23 (2013), and Mali et al., “RNA-guided human genome engineering via Cas9,” Science 339(6121):823-26, each of which is incorporated herein by reference in its entirety). One major development has been the use of chimeric RNAs that target the Cas9 protein, designed around individual units from the CRISPR array fused to tracrRNA. This results in the production of a single RNA species called a small guide RNA (gRNA), and sequence modifications in the protospacer region can target the Cas9 protein site-specifically. Considerable research has been done to understand the nature of the base-pairing interactions between the chimeric RNA and the target site and its tolerance to mismatches, which is highly relevant for predicting and assessing off-target effects (see, for example, Fu et al., “Improving CRISPR-Cas nucleases using truncated guide RNAs,” Nature Biotechnology 32(3):279-84(2014) and the supporting materials, which are incorporated herein by reference in their entirety).

[0031] The CRISPR-Cas9 gene editing system has been successfully used in a wide range of organisms and cell lines to induce the formation of double-strand breaks using wild-type Cas9 protein or to nick a single DNA strand using a mutant protein called Cas9n / Cas9 D10A (see, for example, Mali et al., (2013) and Sander and Joung, “CRISPR-Cas systems for editing, regulating and targeting genomes,” Nature Biotechnology 32(4):347-55 (2014), each of which is incorporated herein by reference in its entirety). The formation of double-strand breaks (DSBs) results in the generation of small insertions and deletions (indels) that can disrupt gene function, but Cas9 wild-type as well as Cas9n / Cas9 D10A nickases avoid the generation of indels (as a result of repair by non-homologous end joining) while stimulating the endogenous homologous recombination machinery. Thus, these systems can be used to insert regions of DNA into the genome with high fidelity.

[0032] In some embodiments, provided herein are methods of producing editable cells in which the gene editing protein utilized in the method is a CRISPR-related gene editing protein. In preferred embodiments, the CRISPR-associated (Cas) nuclease is Cas9 nuclease or may be other Cas nucleases such as Cas12, Cas12i2, Cas13, Cas14, MAD7 (Cas12a). In some embodiments, the Cas9 nuclease is a Cas9 nuclease having reduced immunogenicity as disclosed in U.S. Patent Application Publication No. 2018-0319850, the disclosure of which is incorporated herein by reference in its entirety. In some embodiments, the gene editing protein is a zinc finger nuclease. In some embodiments, the gene editing protein is a TALEN. In some embodiments, the gene editing protein is a FokI nuclease.

[0033] In addition to Cas9 nuclease, Cas12, Cas13, Cas14, and MAD7 (Cas12a) nuclease can also be utilized in the methods described herein. Cas12 generates staggered cuts in dsDNA (5 nucleotide 5’ overhang dsDNA cleavage). Cas12 processes its own guide RNA, resulting in increased multiplexing ability. Cas13 targets RNA and not DNA. When activated by an ssRNA sequence complementary to the crRNA spacer, nonspecific RNase activity is unleashed and nearly all nearby RNA is destroyed regardless of their sequences. See, for example, Yan et al., “CRISPR-Cas12 and Cas13: the lesser known siblings of CRISPR Cas9,” Cell Biology and Toxicology pages 1-4 (August 29, 2019) (the disclosure of which is incorporated herein by reference in its entirety). In some embodiments, the Cas12i2 nuclease can also be utilized in the methods described herein as disclosed in U.S. Patent No. 10,808,245, the disclosure of which is incorporated herein by reference in its entirety.

[0034] In some embodiments, provided herein are methods of producing an editable cell in which a sequence encoding a gene editing protein (genomically integrated) is operably linked to an inducible promoter. By placing the gene editing protein under the control of an inducible promoter, the nuclease can be maintained in a dormant or silent state prior to its desired use as a gene editing tool. In some embodiments, the inducible promoter is the TET-on system.

[0035] As used herein, "promoter", "promoter sequence", or "promoter region" refers to a DNA regulatory region / sequence that can bind to RNA polymerase and initiate transcription of downstream coding or non-coding gene sequences. In other words, the promoter and the gene are in an operable combination or are operably linked. As referred to herein, the terms "in an operable combination", "in an operable order", "operably connected", and "operably linked" refer to the linkage of nucleic acid sequences in such a manner that a promoter capable of directing the transcription of a given gene and / or the synthesis of a desired protein molecule is produced. This term also refers to the linkage of amino acid sequences in such a manner that a protein is produced.

[0036] In some examples of the present disclosure, the promoter sequence includes the transcription start site and extends upstream to include the minimum number of bases or elements necessary to initiate transcription at a detectable level above background. In some embodiments, the promoter sequence includes the transcription start site and a protein-binding domain involved in the binding of RNA polymerase. Eukaryotic promoters often, but not always, include a "TATA" box and a "CAT" box.

[0037] Various promoters can be used to drive gene expression. In some embodiments, the promoter is an "inducible promoter", i.e., the promoter does not constitutively express any of the gene products described herein and is activated in response to a specific stimulus that can be turned on or off in response to the desired regulation of the gene under the control of the promoter. In other embodiments described herein, the promoter is a constitutive promoter that initiates mRNA synthesis independent of the influence of external regulation.

[0038] Suitably, the promoter used to control the engineered nuclease is a derepressible promoter. As used herein, a "derepressible promoter" refers to a structure that includes a functional promoter and additional elements or sequences that can bind to a repressor element and cause repression of the functional promoter. "Repression" refers to a decrease or inhibition in the initiation of transcription of a downstream coding or non-coding gene sequence by a promoter. A "repressor element" refers to a protein or polypeptide that can bind to a promoter (or near the promoter) to decrease or inhibit the activity of the promoter. The repressor element can interact with a substrate or binding partner of the repressor element such that the repressor element undergoes a conformational change. This conformational change in the repressor element results in "derepression" of the promoter by eliminating the ability of the repressor element to decrease or inhibit the promoter, thereby allowing the promoter to proceed with transcription initiation. A "functional promoter" refers to a promoter that is capable of initiating transcription in the absence of the action of a repressor element. Various functional promoters that can be used in the practice of the present invention are known in the art and include, for example, PCMV, PH1, P19, P5, P40, and the promoters of adenovirus helper genes (e.g., E1A, E1B, E2A, E4Orf6, and VA).

[0039] Examples of various controllable promoters, including inducible promoters and derepressible promoters, are described herein, as well as methods for inducing the expression of Cas9 nuclease via the introduction of a molecule that induces expression or a molecule that derepresses a derepressible promoter.

[0040] Exemplary repression elements that can be used as derepressible promoters and their corresponding binding partners are known in the art and include the cumate gene switch system (CuO operator, CymR repressor, and cumate binding partner) (see, e.g., Mullick et al., “The cumate gene-switch: a system for regulated expression in mammalian cells,” BMC Biotechnology 6:43 (1-18) (2006). The disclosure thereof is hereby incorporated by reference in its entirety and includes the disclosure of the derepressible promoter system described therein) and the TetO / TetR system described herein (see, e.g., Yao et al., “Tetracycline Repressor, tetR, rather than the tetR-Mammalian Cell Transcription Factor Fusion Derivatives, Regulates Inducible Gene Expression in Mammalian Cells,” Human Gene Therapy 9:1939-1950 (1998). The disclosure thereof is hereby incorporated by reference in its entirety). Systems such as these are included. In an exemplary embodiment, the derepressible promoter includes a functional promoter and any one of two tetracycline operator sequences (TetO or TetO2). In such an embodiment, the nucleic acid introduced into the T cell further includes a tetracycline repressor protein for controlling the TetO derepressible system (TET-on system).

[0041] As described herein, the method can further include inducing the expression of a CRISPR-related nuclease by activating an inducible promoter. In the case of an inducible promoter (e.g., a 4HT-inducible promoter, a rapamycin-inducible promoter, a hormone response element, or a glutamate-inducible promoter), the promoter is induced, for example, by adding 4-hydroxytamoxifen, rapamycin, a hormone, or glutamate, respectively. In the case of a derepressible promoter (e.g., the TetO sequence described herein linked to the CMV promoter), the addition of doxycycline releases the repression and the gene (engineered nuclease) is expressed via the CMV promoter. Preferably, the nucleic acid molecule encoding Cas9 preferably also encodes a TetR repression element under the control of another promoter system such as a constitutive promoter like the hPGK promoter.

[0042] Figure 2 shows a representation of a method for producing an editable cell by introducing a first sequence encoding the constant regions 1, 2, and 3 of an antibody heavy chain, represented by CH1, CH2, and CH3, respectively, and introducing a second sequence encoding the constant region 1 of an antibody light chain into the genomic nucleic acid sequence represented by C L In Figure 2, the first and second sequences are located on opposite strands of the genomic nucleic acid with respect to each other, but are within the same locus and are separated by 10 or fewer nucleotide base pairs. As described herein, other orientations include situations where the antibody heavy chain constant region is on a first nucleic acid sequence of a chromosome that is completely different from the second sequence encoding the antibody light chain constant region.

[0043] In some embodiments, the method further includes introducing a sequence encoding a selectable marker.

[0044] As used herein, the terms "selectable marker" or "selectable marker gene" refer to a gene introduced into a cell that confers a trait suitable for artificial selection. Selectable markers for general use are well known to those skilled in the art. Drug selectable markers such as ampicillin / carbenicillin, kanamycin, chloramphenicol, nourseothricin N-acetyltransferase, erythromycin, tetracycline, gentamicin, bleomycin, streptomycin, puromycin, hygromycin, blast, and G418 may be used. In other embodiments, selectable markers include, but are not limited to, human nerve growth factor receptor (detected by MAb as described in U.S. Patent No. 6,365,373), truncated human growth factor receptor (detected by MAb), mutant human dihydrofolate reductase (DHFR; available fluorescent MTX substrate), secreted alkaline phosphatase (SEAP; available fluorescent substrate), human thymidylate synthase (TS; confers resistance to the anticancer drug fluorodeoxyuridine), human glutathione S-transferase alpha (GSTA1; conjugates glutathione to the stem cell-selective alkylator busulfan; a chemoprotective selectable marker in CD34+ cells), CD24 cell surface antigen in hematopoietic stem cells; human CAD gene that confers resistance to N-phosphonoacetyl-L-aspartic acid (PALA); human multidrug resistance-1 (MDR-1; P-glycoprotein surface protein selectable by increased drug resistance or enriched by FACS), human CD25 (IL-2.alpha.; detectable by Mab-FITC), methylguanine-DNA methyltransferase (MGMT; selectable by carmustine), L-rhamnose, and cytidine deaminase (CD; selectable by Ara-C).

[0045] In a further embodiment, there is provided a method for generating antibody-producing cells, comprising providing the cells described herein, introducing a sequence encoding an antibody heavy chain variable region upstream of a first sequence encoding antibody heavy chain constant regions 1, 2, and 3 on one strand of the genomic nucleic acid sequence of the cells, and introducing a sequence encoding an antibody light chain variable region upstream of a second sequence encoding antibody light chain constant region 1 on the strand opposite to the genomic nucleic acid sequence of the cells. A method is provided herein.

[0046] In some embodiments, provided herein is a method for generating antibody-producing cells, further comprising introducing both a sequence encoding an antibody heavy chain variable region on one strand of the genomic nucleic acid sequence of the cells and a sequence encoding an antibody light chain variable region on the strand opposite to the genomic nucleic acid sequence of the cells using a single guide RNA. In some embodiments, the method further comprises introducing a promoter sequence having a sequence encoding an antibody heavy chain variable region. In some embodiments, the method further comprises introducing a promoter sequence having a sequence encoding an antibody light chain variable region. In some embodiments, the promoter sequence is operably linked to the sequence encoding the antibody heavy chain variable region. In some embodiments, the promoter sequence is operably linked to the sequence encoding the antibody light chain variable region.

[0047] In some embodiments, the sequence encoding the antibody heavy chain variable region is operably linked to a first sequence encoding antibody heavy chain constant regions 1, 2, and 3. In some embodiments, the sequence encoding the antibody light chain variable region is operably linked to a second sequence encoding antibody light chain constant region 1.

[0048] In some embodiments, the method further comprises introducing the guide RNA through a plasmid that transiently expresses the guide RNA.

[0049] As described herein, in embodiments, the editable cell is a eukaryotic cell. In some embodiments, the cell is a mammalian cell, a yeast cell, an insect cell, an algal cell, or a plant cell. In a preferred embodiment, the cell is a Chinese hamster ovary (CHO) cell. Examples of CHO cells include, but are not limited to, CHO-K1, CHOK1SV, Potelligent CHOK1SV (FUT8-KO), CHO GS-KO, Xceed (CHOK1SV GS-KO), CHO-S, CHO DG44, CHO DXB11, CHOZN, or cells derived from CHO. In some embodiments, the cell is a Chinese hamster ovary (CHO) cell.

[0050] In a preferred embodiment, the cell is a human embryonic kidney (HEK) cell. In some embodiments, the cell is selected from the group consisting of HeLa, HEK293, H9, HepG2, MCF7, Jurkat, NIH3T3, PC12, PER.C6, BHK, VERO, SP2 / 0, NS0, YB2 / 0, EB66, C127, L cells, COS, such as COS1 and COS7, QC1-3, CHO-K1, CHOK1SV, Potelligent CHOK1SV (FUT8-KO), CHO GS-KO, Exceed (CHOK1SV GS-KO), CHO-S, CHO DG44, CHO DXB11, and CHOZN.

[0051] In a further embodiment, a cell comprising a genomic nucleic acid sequence is provided herein, wherein the genomic nucleic acid sequence is a first sequence encoding constant regions 1, 2, and 3 of an antibody heavy chain on one strand of the genomic nucleic acid sequence, the first sequence not being adjacent to the sequence encoding the antibody heavy chain variable region, a first sequence, and a second sequence encoding constant region 1 of an antibody light chain on the strand opposite to the genomic nucleic acid sequence, the second sequence not being adjacent to the sequence encoding the antibody light chain variable region, a second sequence. As described herein, preferably, the first and second sequences are on strands opposite to each other of the genomic nucleic acid within the same locus. See, for example, FIG. 3 showing an embodiment where the heavy chain region and the light chain region are on strands opposite to each other of the genomic nucleic acid. In some embodiments, the first and second sequences on strands opposite to each other within the same locus are separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide base pairs. In still further embodiments, the nucleic acids may be separated by a greater number of base pairs and may also be on different chromosomes.

[0052] In some embodiments, the cell further comprises a first promoter operably connected to the first sequence and a second promoter operably connected to the second sequence. In some embodiments, the cell further comprises a bidirectional promoter operably connected to the first and second sequences on strands opposite to each other of the genomic nucleic acid within the same locus. In some embodiments, the first and second sequences do not have a promoter connected to the sequence.

[0053] In some embodiments, the cell further comprises a sequence encoding a gene editing protein. In some embodiments, the gene editing protein is a CRISPR-associated gene editing protein. In preferred embodiments, the CRISPR-associated (Cas) nuclease is Cas9 nuclease or other Cas nucleases such as Cas12, Cas12i2, Cas13, Cas14, MAD7 (Cas12a). In some embodiments, the Cas9 nuclease is a Cas9 nuclease with reduced immunogenicity. In some embodiments, the gene editing protein is a zinc finger nuclease. In some embodiments, the gene editing protein is TALENS. In some embodiments, the gene editing protein is FokI nuclease. As described herein, the gene editing protein can be included as part of the genomic sequence, or can be a separately provided sequence (e.g., via a vector), or can be an RNP.

[0054] In some embodiments, the sequence encoding the gene editing protein is operably linked to an inducible promoter. By placing the gene editing protein under the control of an inducible promoter, the nuclease can be maintained in a dormant or silent state prior to its desired use as a gene editing tool. In some embodiments, the inducible promoter is the TET-on system described herein.

[0055] As described herein, the cell is preferably a eukaryotic cell. In some embodiments, the cell is a mammalian cell, a yeast cell, an insect cell, an algal cell, or a plant cell. In a preferred embodiment, the cell is a Chinese hamster ovary (CHO) cell. Examples of CHO cells include, but are not limited to, CHO-K1, CHOK1SV, Potelligent CHOK1SV (FUT8-KO), CHO GS-KO, Xceed (CHOK1SV GS-KO), CHO-S, CHO DG44, CHO DXB11, CHOZN, or cells derived from CHO. In some embodiments, the cell is a Chinese hamster ovary (CHO) cell. In a preferred embodiment, the cell is a human embryonic kidney (HEK) cell. In some embodiments, the cell is selected from the group consisting of HeLa, HEK293, H9, HepG2, MCF7, Jurkat, NIH3T3, PC12, PER.C6, BHK, VERO, SP2 / 0, NS0, YB2 / 0, EB66, C127, L cells, COS, e.g., COS1 and COS7, QC1-3, CHO-K1, CHOK1SV, Potelligent CHOK1SV (FUT8-KO), CHO GS-KO, Exceed (CHOK1SV GS-KO), CHO-S, CHO DG44, CHO DXB11, and CHOZN.

[0056] In some embodiments, the cell further comprises a sequence encoding a selectable marker.

[0057] Figure 3 shows an exemplary representation of the genomic sequence of an editable cell, including first and second sequences on opposite strands of genomic nucleic acids located within the same locus. The genomic sequence also includes a sequence encoding a gene editing protein (Cas9), a sequence encoding a selection marker, and a sequence encoding a TET-on inducible promoter, which is provided as an exemplary embodiment.

[0058] Figure 4A shows the genomic sequence of a headless antibody (and thus no headless antibody is expressed) containing heavy and light chain constant regions on opposite strands of genomic nucleic acids located within the same locus without a promoter. However, the genomic sequence also encodes a selectable marker (e.g., RFP) inserted using a proximal cassette with a CMV promoter that can be used to indicate antibody expression. Figure 4B shows the recovery of cells after transfection of the genomic sequence of the headless antibody described herein, indicating good generation and cloning of cells with the genomic sequence of the headless antibody. Figure 4C shows FACS analysis verifying good integration of the cassette, as indicated by RFP expression compared to GFP expression in control cells.

[0059] Figure 5A shows the PCR results of a well-generated and expressed headless antibody, indicated by a band at 400 bp. Thus, as shown in Figure 5B, good transfection of the non-expressing headless antibody shows no bands by PCR, while PCR expression of the light chain region of the full antibody shows a band at 493 bp. Similarly, Figure 5C shows a band at 370 bp for PCR expression of the heavy chain region of the full antibody, but no band for the non-expressing headless antibody.

[0060] In Figure 6A, the Western blot results show good generation of the non-expressing headless antibody. The expected size of the full antibody is 144.64 kDa, clearly shown by the bands in the left two columns, while no bands are shown in the right two columns for the headless antibody without a promoter. Figure 6B also shows good generation of the full antibody and the headless antibody through FACS analysis of the functionality and expression of the full antibody and the headless antibody. The results, similar to the control, show no binding or expression of the headless antibody.

[0061] In some embodiments, provided herein is a method of producing an antibody-producing cell, further comprising introducing a promoter operably connected to a sequence encoding an antibody heavy chain region and a promoter operably connected to a sequence encoding an antibody light chain region. In some embodiments, the method further comprises introducing a promoter operably connected to a sequence encoding an antibody.

[0062] In some embodiments, provided herein is a method of producing an antibody-producing cell, further comprising introducing a first sequence encoding a first selectable marker and a second sequence encoding a second selectable marker. In some embodiments, the method further comprises using the first selectable marker to select cells that express the antibody. In some embodiments, the method further comprises using the second selectable marker to select cells that express the antibody. In some embodiments, the method further comprises using the first and second selectable markers to select cells that express the antibody. In some embodiments, the method further comprises expressing the antibody intracellularly.

[0063] Methods for expanding the cells produced using the methods described herein, as well as methods for recovering the antibodies produced thereby, are known in the art. Such methods include, for example, various column filtration methods, washing steps, and bead-based magnetic separation methods.

[0064] It will be readily apparent to those skilled in the relevant art that other suitable modifications and adaptations to the methods and uses described herein can be made without departing from the scope of any of the embodiments.

[0065] Although certain embodiments are illustrated and described herein, it should be understood that the claims are not limited to the specific forms or configurations of the elements described and shown. Exemplary embodiments are disclosed herein and specific terms are used, but these terms are used only in a general and descriptive sense and are not intended to be limiting. Modifications and variations of the embodiments are possible in light of the above teachings. Accordingly, it should be understood that the embodiments may be practiced in ways other than those specifically described.

[0066] All publications, patents, and patent applications mentioned herein are incorporated herein by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

Example

[0067] Example 1: Seamless Incorporation of Heavy Chain Variable Region and Light Chain Variable Region into Non-Expressing Headless IgG Antibody Method Cells having a non-expressing headless IgG antibody, where one chain encodes the heavy chain constant region and the opposite chain encodes the light chain constant region, are subcultured in an Erlenmeyer shake flask of appropriate size (CD-CHO medium) at a viable concentration of 0.3×10 6 cells / mL. Guide RNAs are selected and prepared for nucleofection. 100 μg of a DNA template consisting of a VL domain encoded by one chain and a VH domain encoded by the other chain is centrifuged briefly to collect the contents and resuspended in 25 μl of TE buffer to obtain a concentration of 4 μg / μl.

[0068] The Cas9 RNP complex is prepared according to Table 1.

Table 1

[0069] The complex is incubated at room temperature for 30 - 60 minutes.

[0070] 17×10 6 Transfer 17×10 cells into a new tube and centrifuge at 200 g for 5 minutes to remove as much medium as possible, thereby preparing cells with non-expressing headless IgG antibody for nucleofection. Add the DNA template described in Table 1 to the appropriate Cas9 RNP complex prepared. Then, resuspend the cells in 1196.8 μl of nucleofection solution (1250 μl of SF solution prepared by mixing 1025 μl of SF solution and 225 μl of Supplement 1). Add 70.4 μl of the cells to each of the Cas9 RNP complex mixtures.

[0071] Transfer 20 μl of the cell-nucleofection solution-RNP complex mixture into the cuvettes in a nucleofection 16-well strip, where the cells are pulsed using a Lonza 4D nucleofector unit with program DU-158. After nucleofection, leave the cells in the nucleofection cuvette for 10 minutes, then add and mix 80 μl of pre-warmed 10 mL of CD-CHO medium warmed to 36.5°C. Transfer 100 μl of the final mixture to a 12-well plate with 1.5 mL of CD-CHO medium and keep it in an incubator at 36.5°C. Then, incubate the cells in a static incubator at 36.5°C and 5% CO2 for 48 hours.

[0072] Results The integration efficiency assessment is performed using PCR, NGS, FACS analysis, and Western blot analysis.

[0073] Example 2: Seamless integration of heavy and light chain variable regions into non-expressing headless IgG antibodies Method Cells with non-expressing headless IgG antibody, where one strand encodes the heavy chain constant region and the opposite strand encodes the light chain constant region, are 0.3×10 6Subculture in an Erlenmeyer shaking flask of appropriate size (CD-CHO medium) at a viable concentration of cells / mL. Select a guide RNA (sgRNA#30) having the following sequence (from 5' to 3'): ccacggtccgcttCCATGCA (SEQ ID NO: 1) and prepare it for nucleofection. Centrifuge 100 μg of a DNA template consisting of a VL domain encoded on one strand and a VH domain encoded on the other strand briefly to collect the contents, and resuspend it in 19.3 μl of TE buffer to obtain a concentration of 5.2 μg / μl.

[0074] Figure 7 is a schematic diagram of various DNA templates for integrating both the heavy chain variable region and the light chain variable region into the genomic sequence of a headless antibody, where the heavy chain constant region and the light chain constant region are on opposite strands of the genomic nucleic acid with respect to each other. The DNA template contains a puromycin sequence for antibiotic selection and a promoter sequence connected to the heavy chain variable region sequence and the light chain variable region sequence. dsDNA#6 is selected as the DNA template for preparing a Cas9 RNP complex for transfection.

[0075] Prepare the Cas9 RNP complex according to Table 2.

Table 2

[0076] Incubate the complex at room temperature for 30 - 60 minutes.

[0077] 8×10 6 Transfer 8×10⁶ cells to a new tube and centrifuge at 200 g for 5 minutes to remove as much medium as possible to prepare cells having a non-expressing headless IgG antibody for nucleofection. Add the DNA template described in Table 2 to the appropriately prepared Cas9 RNP complex. Then, resuspend the cells in 563.2 μl of nucleofection solution (492 μl of SF solution with 108 μl of Supplement 1). Add 70.4 μl of the cells to each of the Cas9 RNP complex mixtures.

[0078] Transfer 20 μl of the cell-nucleofection solution-RNP complex mixture into the cuvette within the nucleofection 16-well strip, where the cells are pulsed using the Lonza 4D nucleofector unit with program DU-158. After nucleofection, leave the cells in the nucleofection cuvette for 10 minutes, then add and mix 80 μl of pre-warmed 10 mL of CD-CHO medium warmed to 36.5°C. Transfer 100 μl of the final mixture into a 12-well plate with 1.5 mL of CD-CHO medium and keep it in the incubator at 36.5°C. Then incubate the cells in a static incubator at 36.5°C and 5% CO2 for 24 hours.

[0079] After 24 hours, replace the medium with CD-CHO + 6 μg / mL of puromycin. Grow the cells in a static incubator until the negative control dies. Perform cell viability assessment using the Vi-Cell device.

[0080] Figure 8 shows the recovery of cells after puromycin antibiotic selection of cells transfected with the heavy chain variable region and the light chain variable region. As indicated by the *, the negative control of cells with the DNA template and gRNA recovered, and the two rightmost lines show the recovery of cells transfected with the heavy chain variable region and the light chain variable region using the DNA template described herein.

[0081] Results As shown in Figure 9A, FACS analysis shows good production of the full antibody through seamless integration of the heavy chain variable region and the light chain variable region into the headless cell line. Figure 9B shows antibody expression verified by WB and also verifies good production of the full antibody through seamless integration of the heavy chain variable region and the light chain variable region into the headless cell line. As expected, the non-expressing headless antibody showed no binding or expression, but good integration of the heavy chain variable region and the light chain variable region by the promoter produced the full antibody. dsDNA #6 sequence (5' to 3'): ccgagcccgtgacagtgtcctggaactctggcgccctgaccagcggcgtgcacaccttccctgccgtgctgcagtcctccggcctgtactccctgtccagcgtggtcacagtgccctcctccagcctgggcacccagacctaca (SEQ ID NO: 2)

Claims

1. A cell containing a genome nucleic acid sequence, wherein the genome nucleic acid sequence is A first sequence encoding antibody heavy chain constant regions 1, 2, and 3 on one strand of the genome nucleic acid sequence, wherein the first sequence is not adjacent to the sequence encoding the antibody heavy chain variable region, A cell comprising: a second sequence encoding the constant region 1 of the antibody light chain on the opposite strand of the genomic nucleic acid sequence, wherein the second sequence is not adjacent to the sequence encoding the variable region of the antibody light chain.

2. The cell according to claim 1, further comprising a sequence encoding a selectable marker.

3. The cell according to claim 1, further comprising a sequence encoding a gene editing protein.

4. The cell according to claim 3, wherein the gene editing protein is a Cas gene editing protein.

5. The cell according to claim 3, wherein the gene editing protein is selected from Cas9, Cas12, Cas12i2, TALENS, MAD7 nuclease, and zinc finger nuclease.

6. The cell according to claim 5, wherein the gene editing protein is Cas9.

7. The cell according to claim 3, wherein the sequence encoding the gene editing protein is operably connected to an inducible promoter.

8. The cell according to claim 7, wherein the inducible promoter is a TET-on system.

9. The cell according to claim 1, further comprising a first promoter operably connected to the first sequence and a second promoter operably connected to the second sequence.

10. The cell according to claim 1, wherein the cell is a stable clone with high expression.

11. The cell according to claim 10, wherein the cell is a Chinese hamster ovary (CHO) cell.

12. A method for producing editable cells, Introducing a first sequence that encodes antibody heavy chain constant regions 1, 2, and 3 on one strand of the cellular genome nucleic acid sequence, A method comprising introducing a second sequence encoding an antibody light chain constant region 1 on the opposite strand of the genomic nucleic acid sequence of the cell.

13. The method according to claim 12, further comprising introducing an array that codes for selectable markers.

14. The method according to claim 12, further comprising introducing a sequence encoding a gene editing protein into the genomic nucleic acid sequence.

15. The method according to claim 14, wherein the gene editing protein is a Cas gene editing protein.

16. The method according to claim 14, wherein the gene editing protein is selected from Cas9, Cas12, Cas12i2, TALENS, MAD7 nuclease, and zinc finger nuclease.

17. The method according to claim 16, wherein the gene editing protein is Cas9.

18. The method according to claim 14, wherein the sequence encoding the gene editing protein is operably connected to an inducible promoter.

19. The method according to claim 18, wherein the inductive promoter is a TET-on system.

20. The method according to claim 12, further comprising introducing a first promoter operably connected to the first sequence and a second promoter operably connected to the second sequence.

21. The method according to any one of claims 12 to 20, wherein the cells are stable clones with high expression.

22. The method according to claim 21, wherein the cells are Chinese hamster ovary (CHO) cells.

23. A method for producing antibody-producing cells, To provide the cells described in any one of claims 1 to 11, The sequence encoding the antibody heavy chain variable region is introduced upstream of the first sequence in the antibody heavy chain constant region, A method comprising introducing a sequence encoding an antibody light chain variable region upstream of the second sequence in the antibody light chain constant region 1.

24. The method according to claim 23, further comprising introducing a first promoter operably connected to the sequence encoding the antibody heavy chain variable region, and a second promoter operably connected to the sequence encoding the antibody light chain variable region.

25. The method according to claim 23, further comprising expressing the antibody in the cells.

26. The method according to claim 23, further comprising introducing an array that codes for selectable markers.

27. The method according to claim 26, further comprising selecting cells that express the antibody using the selectable marker.

28. A method for producing antibody-producing cells, A method comprising both introducing a sequence encoding an antibody heavy chain variable region upstream of a first sequence of the antibody heavy chain constant region on one strand of the cell's genomic nucleic acid sequence, and introducing a sequence encoding an antibody light chain variable region upstream of a second sequence of the antibody light chain constant region 1 on the opposite strand of the cell's genomic nucleic acid sequence.

29. The method according to claim 28, further comprising introducing a first promoter together with the sequence encoding the antibody heavy chain variable region.

30. The method according to claim 29, wherein the first promoter is operably connected to the sequence encoding the antibody heavy chain variable region.

31. The method according to any one of claims 28 to 30, further comprising introducing a second promoter together with the sequence encoding the antibody light chain variable region.

32. The method according to claim 31, wherein the second promoter is operably connected to the sequence encoding the antibody light chain variable region.

Images