gene therapy
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- FOND AZIONE TELETHON
- Filing Date
- 2023-08-08
- Publication Date
- 2026-06-25
AI Technical Summary
Current treatments for lysosomal storage diseases (LSDs) with skeletal involvement, such as mucopolysaccharidosis types IVA and IVB, GM1 gangliosidosis, and alpha-mannosidosis, are either ineffective or have significant limitations, including immunogenicity, short half-life, and inability to target bone and central nervous system tissues.
Ex vivo gene therapy using viral vectors to transduce hematopoietic stem and progenitor cells (HSPCs) with polynucleotides encoding lysosomal enzymes like α-D-mannosidase, β-galactosidase, and galactosamine-6-sulfatase, enabling these cells to express therapeutic enzymes and deliver them to skeletal tissues.
The approach effectively corrects enzyme deficiencies in skeletal tissues, providing sustained enzyme expression and improving clinical symptoms by targeting resident cells like mesenchymal stromal cells and osteoblasts, offering a promising treatment for LSDs with skeletal pathology.
Smart Images

Figure 00000092_0000 
Figure 00000092_0001 
Figure 00000092_0002
Abstract
Description
[Technical Field]
[0001] The present invention relates to means and methods for gene therapy of lysosomal storage diseases (LSDs), preferably LSDs associated with skeletal pathology, which are based on an ex vivo gene therapy approach in which autologous hematopoietic stem and progenitor cells (HSPCs) are transduced with a viral vector to express the enzyme deficient in the disorder.
[0002] The final formulation is a suspension of transduced cells in culture medium for administration to patients suffering from LSD, preferably following a conditioning regimen prior to administration. [Background technology]
[0003] Lysosomal storage diseases (LSDs) are a group of inherited metabolic disorders, most of which result from lysosomal enzyme deficiencies that lead to the accumulation of undegraded substrates. This storage process leads to a wide range of clinical symptoms, depending on the specific substrate and site of storage.
[0004] In general, LSDs have been shown to simultaneously affect multiple intracellular pathways and signaling cascades, each of which contributes to the pathophysiology and clinical symptoms. In particular, mitochondrial dysfunction, oxidative stress, accumulation of secondary substrates unrelated to the defective enzyme, abnormal membrane composition, abnormal vesicle fusion and intracellular trafficking, impaired autophagy, dysregulated signaling pathways and activated inflammation, and abnormalities in calcium homeostasis and signaling are now considered important factors in the pathogenesis of several LSDs.
[0005] Skeletal abnormalities, which cause significant morbidity in many LSDs, are particularly prevalent in most mucopolysaccharidoses (MPS). Most patients with MPS exhibit a constellation of radiographic abnormalities known as dysostosis multiplex, which are diagnostic of the disease.
[0006] MPS is characterized by a deficiency of enzymes required for the stepwise degradation of glycosaminoglycans (GAGs).
[0007] Alpha-mannosidosis (OMIM 248500) is a rare, autosomal recessive, inherited lysosomal storage disorder caused by mutations in the MAN2B1 gene, which encodes lysosomal alpha-D-mannosidase (MAN2B), resulting in restricted expression and subsequent reduced activity of the enzyme. Lysosomal alpha-mannosidase activity, with an acidic pH optimum, is ubiquitously present in human tissues and exists as two major forms, A and B, separable by ion-exchange chromatography on diethylaminoethylcellulose (DEAE-cellulose), which are the products of a single gene, MAN2B1. In alpha-mannosidosis, both forms A and B are absent. Lysosomal alpha-D-mannosidase in humans, rats, cats, and cows can catalyze the hydrolysis of alpha(1,2)-, alpha(1-3)-, and alpha(1-6)-mannosidic linkages present in N-linked oligosaccharides. Historically, α-mannosidosis was classified as a mucopolysaccharidoses due to the similar coarse facies, but it was later identified as a separate entity.
[0008] Deficiency or insufficiency of lysosomal α-mannosidase leads to the multi-organ accumulation of undigested oligosaccharides in lysosomes. α-Mannosidosis is characterized by immunodeficiency, facial and skeletal abnormalities, hearing impairment, and intellectual disability. It occurs in approximately 1 in 500,000 people.
[0009] Patients with α-mannosidosis typically present with coarse facial features, macrocephaly with protruding forehead, highly arched eyebrows, nasal recession, broad dental arches, macroglossia, and mandibular prognathism. Bone disease ranges from asymptomatic osteopenia to focal osteolytic or sclerotic lesions and osteonecrosis. Ninety percent of patients diagnosed with α-mannosidosis have clinical or radiological evidence of mild to moderate dysostosis multiplex. These changes are present at birth and may diminish with age. Genu valgum is common and may be treated with epiphyseal plate arthrodesis at a young age before closure of the knee epiphyses occurs. Over time, between the teens and 30s, patients may develop destructive polyarthropathy, particularly hip arthropathy. These symptoms are often severe and require orthopedic correction. Ataxia is the most characteristic and specific movement disorder. In addition to joint abnormalities and metabolic myopathy, the disease particularly affects brain regions responsible for fine motor function and muscle coordination. Hypotonia is common. Nearly all patients exhibit some degree of mental retardation, with symptom onset ranging from 6 months to 3 years of age. Patients have late speech onset (sometimes into their teens), limited vocabulary, and difficulty understanding speech, which may be the result of congenital and / or acquired hearing loss. Brain MRI, including sagittal T1 and axial T2 sections, reveals partial syrinx of the sella turcica, cerebellar atrophy, and white matter signal changes. Progressive cortical and subcortical atrophy, particularly in the cerebellar vermis, has been reported, and communicating hydrocephalus can occur at any age. In some patients, axial T2-weighted images identify hyperintense abnormalities involving the parietal and occipital white matter, possibly related to demyelination and associated gliosis.
[0010] During the first decade of life, there is a high incidence of recurrent infections, including colds, pneumonia, and gastroenteritis, with rare urinary tract infections. Serous otitis media is common and is usually not bacterial. Immunodeficiency is due to a reduced ability to produce specific antibodies in response to antigen presentation. Furthermore, the intracellular bactericidal capacity of leukocytes is reduced, which may contribute to the severe outcome of bacterial infections. Infections decrease in the teens and twenties, during which time ataxia and muscle weakness become more pronounced. The long-term prognosis is poor. Neuromuscular and skeletal deterioration progresses gradually over several decades, and most patients become wheelchair dependent. Early death may occur due to primary central nervous system disorders or myopathies.
[0011] Mucopolysaccharidosis type IVA (MPSIVA), also known as Morquio A syndrome, belongs to a group of LSDs. MPSIVA (OMIM 253000) is an autosomal recessive disorder caused by mutations in the GALNS gene, which encodes the N-acetylgalactosamine-6-sulfatase (GALNS) enzyme and is located on chromosome 16q24.3. To date, over 300 different mutations in the GALNS gene have been identified, primarily missense point mutations and small deletions. This diversity of GALNS gene mutations corresponds to the wide spectrum of clinical phenotypes in MPSIVA patients. MPSIVA is a severe multisystem disorder. Clinical manifestations are diverse and include skeletal and joint abnormalities, short stature, coarsening of the facial features, cardiorespiratory problems, hearing and vision loss, subtle corneal opacities, dental abnormalities, and hepatomegaly. Patients with severe forms of the disease have a shortened lifespan, often not surviving into their teens or twenties, whereas those with milder forms of MPSIVA may live into their sixth decade.
[0012] Although the prevalence and incidence of MPSIVA have not been precisely estimated, the global prevalence at birth has been reported to be between 1 in 76,000 and 1 in 1,179,000 (Leadley et al., 2014), with estimated disease incidence ranging from 1 in 200,000 to 1 in 300,000 (The National MPS Society, http: / / www.mpssociety.org / mps / mps-iv / ). The incidence of MPSIVA in Italy is estimated to be 1 in 300,000 live births (Caciotti et al., 2015). However, the implementation of newborn screening (NBS) programs for MPSIVA will likely clarify the true incidence and prevalence of Morquio A syndrome in the future.
[0013] GALNS catalyzes the degradation of glycosaminoglycans (GAGs), keratan sulfate (KS) and chondroitin-6-sulfate (C6S), by cleaving the GAGs keratan sulfate and chondroitin-6-sulfate at the N-linked sulfate moieties.
[0014] Thus, GALNS enzyme deficiency leads to abnormal intracellular accumulation of KS and C6S in lysosomes in a wide range of tissues, and subsequent progressive cellular damage and multiple organ failure.
[0015] These GAGs are mainly produced in cartilage, and as undegraded substrates accumulate mainly in cartilage and extracellular matrix (ECM), their primary accumulation occurs in lysosomes of chondrocytes, associated ligaments, and adjacent ECM, directly affecting cartilage and bone development and subsequently resulting in systemic skeletal dysplasia.
[0016] Furthermore, in MPSIVA patients, KS is synthesized and accumulated mainly in the cartilage and cornea. Because C6S is mainly localized in the growth plate, aorta, and cornea, the accumulation sites in MPSIVA patients are also the heart valves and aorta.
[0017] Patients with MPSIVA exhibit one or more of the following: skeletal dysplasias such as short neck and trunk, cervical spinal cord compression, odontoid hypoplasia and associated cervical instability, pigeon pectus, kyphoscoliosis, hip dysplasia, coxa valga and genu valgum; respiratory disorders, adenoid and tonsillar hypertrophy, tracheal distortion, tracheal and bronchomalacia and obstructive sleep apnea; joint laxity and joint hypermobility, short stature; cardiac complications including primarily ventricular hypertrophy and early-onset severe valvular disease, but occasionally coronary endometrial sclerosis; ophthalmological disorders including hearing loss, corneal opacities, astigmatism, cataracts, punctate lenticular opacities, open-angle glaucoma, optic disc swelling, optic atrophy and / or retinopathy; dental abnormalities, hepatomegaly and coarse facial features.
[0018] Excess C6S and KS are secreted into the blood and excreted in the urine of patients with MPSIVA. Blood and urinary KS levels have been shown to correlate with clinical severity in the early and advanced stages of the disease and are therefore good prognostic biomarkers.
[0019] In children with MPSIVA, the most common early signs of the severe form usually appear between the ages of 1 and 3 and include kyphoscoliosis, genu valgum, short stature, pigeon chest, and gait abnormalities. The slowly progressive form of MPSIVA often manifests as hip problems (pain, stiffness, and Legg-Perthes disease) and may become apparent in later childhood or adolescence. In both the severe and slowly progressive forms, the initial symptoms vary and may include a single finding or multiple findings.
[0020] Untreated patients with severe disease often become wheelchair dependent during adolescence and frequently die in their teens or twenties from cardiorespiratory problems or cervical spinal complications.
[0021] Patients with MPSIVA showed reduced antioxidant defense levels, as assessed by decreased glutathione content and increased superoxide dismutase activity in erythrocytes. Regarding lipid and protein damage, patients with MPSIVA showed elevated urinary isoprostanes and dityrosines and decreased plasma sulfhydryl groups compared with controls. Furthermore, patients with MPSIVA showed higher DNA damage than controls, and this damage was of oxidative origin in both pyrimidine and purine bases. Interleukin-6 was elevated in patients and inversely correlated with reduced glutathione (GSH) levels, indicating a possible link between inflammation and oxidative stress in MPSIVA disease. These data suggest that a pro-inflammatory and pro-oxidant state occurs in patients with MPSIVA.
[0022] Mucopolysaccharidosis type IVB (MPSIVB), also known as Morquio B disease (MBD), is another LSD caused by mutations in the GLB1 gene (3p21.33), resulting in deficiency of the β-galactosidase lysosomal enzyme (β-GAL, hereafter referred to as GLB1). The GLB1 gene produces two alternatively spliced mRNAs: a 2.5-kb transcript encoding a lysosomal enzyme and a 2.0-kb transcript encoding elastin-binding protein (EBP), which localizes to the endosomal compartment. Depletion of EBP in arterial smooth muscle, fibroblasts, and chondroblasts has been shown to disrupt elastic fiber formation.
[0023] GM1 gangliosidosis is also caused by mutations in the GLB1 gene. Depending on the location of mutations within the GLB1 gene and their combination in compound heterozygous individuals, the molecular pathophysiology of the resulting β-galactosidase protein can produce a range of phenotypic symptoms, from primarily neurological symptoms in GM1-gangliosidosis to primarily skeletal pathology in MBD. Mutations associated with GM1-gangliosidosis are mostly located in the core protein region and cause β-galactosidase instability, whereas mutations associated with types 2 and 3 GM1-gangliosidosis tend to be on the protein surface.
[0024] The W273L mutation has been consistently associated with MBD-related skeletal dysplasia, particularly MBD without neuropathic involvement (or pure MBD), and may also serve as a predictor of the Morquio B phenotype. W273L occurs in a highly conserved region of the GLB1 gene, where amino acid residue Trp-273 is located at the entrance to a ligand-binding pocket that serves as a substrate holder for catalytic reactions. W273L has a more significant effect on keratan sulfate degradation than on GM1-ganglioside metabolism. Indeed, in cells and tissues from Morquio B patients, the GLB1 enzyme can degrade the terminal β-linked galactose of GM1 ganglioside and oligosaccharides, but not KS.
[0025] Therefore, keratan sulfate is the major accumulation substance in MBD. Quantitative measurement of KS using LC-MS / MS-based techniques has recently become available.
[0026] In GM1 gangliosidosis, the major storage substrates (GM1 and GA1 gangliosides) affect the central nervous system, whereas in MBD, keratan sulfate accumulation in bone and cartilage predominates, explaining the predominance of skeletal manifestations. However, skeletal involvement has also been reported in patients with GM1 gangliosidosis, especially those affected by the most severe type 1 infantile form.
[0027] Furthermore, in vitro and animal studies have shown that intracellular glycosaminoglycan accumulation can potentially trigger and sustain inflammatory responses via apoptosis of connective tissue cells, cartilage destruction, and subsequent elevation of inflammatory cytokines (mainly TNF-α, IL-1β, and inflammatory proteases) or activation of the TLR4 pathway, leading to the release of TNF-α and IL-1β.
[0028] Clinically, MBD is characterized by short stature with a disproportionately short trunk, kyphoscoliosis, pigeon chest (pectus carinatum), short neck, a large-appearing head with midface hypoplasia and mandibular prognathism, large-appearing joints (elbows, wrists, knees, and ankles), coxa valga and varus, and flat feet. Joint laxity, corneal opacity, cardiac valve disease, and tracheal stenosis are additional findings. Characteristic radiological findings include vertebral flattening and fractures, odontoid hypoplasia, spinal stenosis, hip dysplasia, carpal and tarsal hypoplasia, and shortening of long bones and epiphyseal dysplasia (e.g., shortened ulna, tilted distal ends of radius and ulna). Thus, skeletal involvement is a major feature of MPSIVB; fewer than 80% of GLB1-related MBD cases exhibit a pure skeletal phenotype (pure MBD), while the remaining cases exhibit additional primary neurodegenerative symptoms.
[0029] The first signs and symptoms of the disease may be apparent at birth. Bone lesions are progressive, with over 84% of adults requiring walking aids. Based on current data, life expectancy is not limited by the disease, but it is important to note that all GLB1-related diseases may be associated with anesthetic risks.
[0030] Individuals with α-mannosidosis exhibit clinical symptoms, including skeletal changes, similar to those of patients with MPSIVB.
[0031] Thus, mucopolysaccharidosis type IVA (also abbreviated herein as MPSIVA), mucopolysaccharidosis type IVB (also abbreviated herein as MPSIVB or MBD), and alpha-mannosidosis (also abbreviated herein as a-MANN) represent rare lysosomal storage disorders with skeletal involvement characterized by severe and potentially life-threatening symptoms.
[0032] Currently, both enzyme replacement therapy (ERT) and allogeneic hematopoietic stem cell transplantation (HSCT) from healthy donors are available for patients with Morquio A syndrome and α-mannosidosis. ERT is particularly useful for treating non-neurological symptoms in patients with mild to moderate α-mannosidosis. However, ERT has important limitations, including immunogenicity, a short half-life requiring weekly intravenous administration, and an inability to target some organs and tissues, particularly bone and the central nervous system. Furthermore, to date, ERT has not been shown to improve bone lesions in patients with MPS IVA and α-mannosidosis.
[0033] In MPSIVB and GM1 gangliosidoses, only supportive and symptomatic care are currently available, with orthopedic surgery being the mainstay of treatment.
[0034] Therefore, non-surgical treatment approaches for MPS-related skeletal lesions are either unavailable or not significantly effective, and the challenge of preventing and reversing bone and cartilage lesions in patients with MPSIVA, MPSIVB, GM1 gangliosidosis, and α-mannosidosis remains unsolved.
[0035] Additionally, although growth has been observed in patients with α-mannosidosis who have undergone HSCT, normal development has not been achieved, and concerns remain about the effectiveness of HSCT on the neurological and skeletal manifestations of the disease.
[0036] On the other hand, HSCT for Morquio A syndrome has only been reported in small case series and has resulted in improvement of some clinical features, but it is still associated with significant morbidity and mortality, especially in the absence of a fully matched donor. In particular, the therapeutic effect of allogeneic HSCT on the skeleton of patients with MPS IVA remains limited. Therefore, effective therapies for the treatment of this disease are highly desirable.
[0037] Gene therapy in hematopoietic stem and progenitor cells (GT-HSPCs) is an emerging treatment for lysosomal storage diseases. Autologous cells can be genetically modified to constitutively express therapeutic enzymes, providing an effective source of functional enzymes in multiple tissues. However, there remains a need for ex vivo gene therapy-based treatments that can deliver missing enzymes to affected tissues, particularly skeletal resident cells, in patients with certain LSDs, particularly those with skeletal involvement, such as MPSIVA, MPSIVB, GM1 gangliosidosis, and α-mannosidosis.
[0038] In particular, there remains a need to deliver sufficient quantities and / or sufficient efficacy of enzymes to cross-correct affected tissues, such as resident cells of the skeletal system (mesenchymal stromal cells, osteoblasts, and chondroblasts), to treat certain LSDs with skeletal pathology, such as MPSIVA, MPSIVB, GM1 gangliosidosis, and α-mannosidosis. Summary of the Invention
[0039] The present invention overcomes the limitations of the prior art and provides effective means and methods for the treatment of LSDs, in particular LSDs with skeletal involvement, in particular mucopolysaccharidosis types IVA and IVB, GM1 gangliosidosis or α-mannosidosis, based on ex vivo gene therapy (GT).
[0040] The present invention provides novel viral vectors for expressing functional lysosomal enzymes that are deficient in the LSDs defined by the present claims.
[0041] In a first aspect of the present invention, the viral vector comprises a polynucleotide encoding a lysosomal enzyme selected from the group consisting of α-D-mannosidase (MAN2B) lysosomal enzyme, β-galactosidase (GLB1) lysosomal enzyme, and galactosamine (N-acetyl)-6-sulfatase (GALNS), and preferably comprises a polynucleotide encoding a human or mouse lysosomal enzyme selected from the above enzymes or a variant thereof.
[0042] Preferably, the viral vector is a lentiviral (LV) vector.
[0043] The present invention also relates to modified cells comprising the viral vector, preferably cells transfected ex vivo with the viral vector of the present invention, preferably HSPCs, more preferably CD34 + It can also be directed towards HSPC.
[0044] Optionally, the cells are T cells, preferably CD4 + T cells.
[0045] The present invention is also directed to pharmaceutical compositions comprising a therapeutically effective amount of the vectors or modified cells of the present invention.
[0046] The present invention is further directed to methods for producing the viral vectors, modified cells and pharmaceutical compositions of the present invention.
[0047] Viral vectors containing a polynucleotide encoding a lysosomal enzyme, as well as cells and pharmaceutical compositions of the present invention containing such viral vectors, are suitable for use in the treatment of LSD. In particular, viral vectors containing a polynucleotide encoding the β-galactosidase (GLB1) lysosomal enzyme, as well as cells and pharmaceutical compositions of the present invention containing such viral vectors, are suitable for use in the treatment of mucopolysaccharidosis type IVB or GM1 gangliosidosis. Viral vectors containing a polynucleotide encoding galactosamine (N-acetyl)-6-sulfatase (GALNS), as well as cells and pharmaceutical compositions of the present invention containing such viral vectors, are suitable for use in the treatment of mucopolysaccharidosis type IVA or Morquio A syndrome. Furthermore, viral vectors containing a polynucleotide encoding the α-D-mannosidase lysosomal enzyme, as well as cells and pharmaceutical compositions of the present invention containing such viral vectors, are suitable for use in the treatment of α-mannosidosis.
[0048] Therefore, the present invention is also directed to a method for treating an LSD, preferably an LSD associated with skeletal lesions, in particular mucopolysaccharidosis type IVA, mucopolysaccharidosis type IVB, GM1 gangliosidosis or α-mannosidosis, comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector, cell or pharmaceutical composition of the present invention that expresses the corresponding enzyme deficient in the LSD to be treated.
[0049] Ex vivo gene therapy in HSPCs (abbreviated HSPC-GT) according to a preferred embodiment of the present invention combines three unique features in a single therapy.
[0050] 1) Genetic modification of hematopoietic cells to produce the therapeutic enzyme in sufficient amounts and / or enzymatic activity to correct the genetic defect and restore the physiological function of the enzyme.
[0051] 2) The ability of HSPC progeny to circulate and reside in all tissues, including bone and brain.
[0052] 3) The ability of HSPC progeny to locally produce therapeutic enzymes that can be taken up by non-hematopoietic cells, including cells of bone tissue and the central nervous system.
[0053] The invention is best understood from the following detailed description when read in conjunction with the accompanying drawing figures. [Brief explanation of the drawings]
[0054] [Figure 1A]Schematic diagram of a vector transgene carrying an expression cassette for expressing GLB1 (LV-GLB1 cassette). The expression cassette shown consists of GLB1 cDNA under the control of the human promoter of the phosphoglycerate kinase gene (PGK). The following cis-acting polynucleotide regulatory sequences are shown: the major splice donor site (SD), the 5' portion of the gag gene (GA), the encapsidation signal (Ψ), the splice acceptor site (SA), the central polypurine tract / chain termination sequence (cPPT / CTS), and the post-transcriptional regulatory element of the woodchuck hepatitis virus (WPRE). The arrow indicates the direction of transgene transcription. [Figure 1B] Figure 1A shows a schematic diagram of a transfer vector carrying a transgene. In addition to the expression cassette, the following viral cis-acting polynucleotide sequences required for virus production are shown: a truncated 5' LTR, an encapsidation signal (Ψ), a Rev-responsive element (HIV_RRE), a central polypurine tract / chain termination sequence (cPPT / CTS), a woodchuck hepatitis virus posttranscriptional regulatory element (Wpre), a 3' LTR (ΔU3), and a poly(A) signal. The expression cassette consists of the GLB1 cDNA under the control of the human PGK promoter. Neomycin and kanamycin resistance (NeoR / KanR) are also shown. [Figure 2A] Analysis of integrated vector copy number (VCN) in the genome of myeloid progeny of mobilized peripheral blood (mPB) CD34+ cells transduced with LV GLB1 WT and LV GLB1 OPT at different MOIs (100, 30, 10). Untransduced cells (UT) were used as a control. [Figure 2B] Proliferation curves of human mobilized peripheral blood (mPB) CD34+ cells transduced with LV GLB1 WT (left panel) and LV GLB1 OPT (right panel) at different MOIs (100, 30, 10) and expanded in liquid myeloid culture for 14 days. Untransduced cells (UT) served as a control. Values are reported as Log 10-fold increase compared to cell numbers on day 0. [Figure 2C]Colony formation assay of CD34+ cells (mPB) transduced with LV GLB1 WT and LV GLB1 OPT at different MOIs (100, 30, 10). Untransduced cells (UT) were used as a control. Each error bar represents the mean ± sem (n = 3). [Figure 3A] Representative images of Western blot analysis of GLB1 expression in cell pellets of myeloid progeny of human mPB CD34+ cells transduced with LV GLB1 WT and LV GLB1 OPT at different MOIs (100, 30, 10). Untransduced cells (UT) were used as a control. Actin-β (ACTB) was used for normalization. [Figure 3B] GLB1 enzyme activity measured as nmol / mg / h in cell pellets of myeloid progeny of human mPB CD34+ cells transduced with LV GLB1 WT and LV GLB1 OPT at different MOIs (100, 30, 10). Data are reported as fold increase over untransduced cells (UT). Each error bar represents the mean ± sem (n ≥ 3). [Figure 4A] Representative images of tartrate-resistant acid phosphatase (TRAP) assays performed on untransduced (UT) and LV GLB1 WT (MOI 30)-transduced myeloid liquid cultures (LCs) after 10 days of culture in osteoclast differentiation medium to detect the presence of bone-resorbing osteoclasts. [Figure 4B] Expression analysis of MMP9 and TRAP5b as markers of osteoclast differentiation. [Figure 4C] qPCR analysis of GLB1 expression in LV GLB1 (MOI 30)-transfected myeloid liquid cultures (LCs) and LC-derived osteoclasts. Untransfected cells were used as controls. In B) and C), results are expressed as 2(-DCT), where DCT is calculated as CT target gene - CT ACTB. Each error bar represents the mean ± sem (n ≥ 3). [Figure 4D] Representative images of Western blot analysis of GLB1 expression in the cell pellet (left panel) and medium (right panel) of osteoclasts obtained by differentiation of untransduced and LV GLB1-transduced HSPCs in myeloid liquid culture (LC). [Figure 4E] GLB1 enzyme activity measured in cell pellets (nmol / mg / h) and medium (nmol / ml / h) of osteoclasts derived from the myeloid progeny of human mPB CD34+ cells transduced with LV GLB1 WT at an MOI of 30. Each error bar represents the mean ± sem (n ≥ 2). [Figure 5A] Analysis of integrated vector copy number (VCN) in the genome of human CD4+ T cells transduced with LV human GLB1 (hGLB1), human eIF4A-GLB1 (eIF4A-hGLB1), or mouse GLB1 (mGLB1) at an MOI of 30 and then expanded in vitro for 10 days in the presence of human IL-2 and IL-7. Untransduced cells (UT) were used as a control. [Figure 5B] qPCR analysis of human GLB1 expression in human CD4+ T cells transduced with LV hGLB1 and LV eIF4A-hGLB1 at an MOI of 30 (left panel). qPCR analysis of murine GLB1 expression in human CD4+ T cells transduced with LV mGLB1 (right panel). GLB1 expression analysis was performed after 10 days of expansion of transduced cells. Untransduced cells were used as a control. Results are expressed as 2(-DCT), where DCT is calculated as CT gene of interest - CT ACTB. [Figure 5C] GLB1 enzyme activity was measured in the cell pellet (left panel) and medium (right panel) of human CD4+ T cells transduced with LV human GLB1 (hGLB1), human eIF4A GLB1 (eIF4A-hGLB1), and mouse GLB1 (mGLB1) (MOI 30). Results are expressed as fold increase over untransduced human CD4+ T cells. In all figures, each error bar represents the mean ± sem (n ≥ 2). [Figure 6A]Human mPB CD34+ cells from healthy donors transduced with LV GLB1 WT at an MOI of 30 were injected into sublethally irradiated NSG mice (GT) (4.3 x 105 cells / mouse). NSG mice (MOCK) transplanted with the same dose of cultured untransduced mPB CD34+ cells served as controls. After transduction, 1 x 105 mPB CD34+ cells were expanded in vitro as a myeloid liquid culture to test the toxicity and transduction efficiency of LV GLB1 for transplantation experiments. [Figure 6B] Cell proliferation in myeloid progeny of mPB CD34+ cells transduced with LV GLB1 WT at an MOI of 30 and untransduced (UT). [Figure 6C] Analysis of integrated vector copy number in myeloid progeny of mPB CD34+ cells transduced with LV GLB1 WT at an MOI of 30 and untransduced (UT). [Figure 6D] Western blot analysis of GLB1 in cell pellets and medium of myeloid progeny derived from untransduced and LV GLB1-transduced mPB CD34+ cells for use in in vivo experiments. [Figure 6E] GLB1 enzymatic activity in cell pellets and medium of myeloid progeny derived from untransduced and LV GLB1-transduced mPB CD34+ cells for use in in vivo experiments. [Figure 6F] Body weight monitoring at different time points after transplantation of NSG mice transplanted with untransduced (MOCK) or LV GLB1-transduced mPB CD34+ cells (GT). [Figure 6G] The percentage of human cell engraftment (% human CD45+ cells / total cells) in peripheral blood (PB) at 7 weeks after transplantation and in bone marrow (BM) at 12 weeks after transplantation. [Figure 6H] Integrated vector copy numbers in BM cells isolated from NSG mice transplanted with untransduced (mock) and LV GLB1-transduced mPB CD34+ cells (GT). [Figure 6I] Analysis of GLB1 enzyme activity in BM cells isolated from NSG mice transplanted with untransfected (mock) and LV GLB1-transfected mPB CD34+ cells (GT). [Figure 7A] Schematic diagram of a vector transgene carrying an expression cassette for expressing MAN2B (LV-MAN2B cassette). The expression cassette shown consists of the MAN2B cDNA under the control of the human promoter phosphoglycerate kinase gene (PGK). The cis-acting polynucleotide regulatory sequences are shown as in Figure 1A. [Figure 7B] Figure 1A shows a schematic diagram of a transfer vector carrying a transgene. In addition to the expression cassette, the following viral cis-acting polynucleotide sequences required for virus production are shown: a truncated 5' LTR, an encapsidation signal (Ψ), a Rev-responsive element (HIV_RRE), a central polypurine tract / chain termination sequence (cPPT / CTS), a woodchuck hepatitis virus posttranscriptional regulatory element (Wpre), a 3' LTR (ΔU3), and a poly(A) signal. The expression cassette consists of the GLB1 cDNA under the control of the human PGK promoter. Neomycin and kanamycin resistance (NeoR / KanR) are also shown. [Figure 8A] Proliferation curves of human mobilized peripheral blood (mPB) CD34+ cells transduced with LV-MAN2B WT (left panel) or LV-MAN2B OPT (right panel) at different MOIs (100, 30, 10) and expanded in liquid myeloid culture for 14 days. Untransduced cells (UT) were used as a control to assess potential toxic effects on cell proliferation of LV-MAN2B WT and OPT HSPC progeny. Values are reported as fold increase compared to cell counts on day 0. Error bars indicate mean ± s.e.m. (n = 3). [Figure 8B]Colony formation assay of human mPB CD34+ cells transfected with LV-MAN2B WT or LV-MAN2B OPT at different MOIs (100, 30, 10). (BFU-E: erythroid burst-forming unit; GM-CFU: granulocyte-monocyte colony-forming unit; GEMM-CFU: granulocyte, erythroid, monocyte, and megakaryocyte colony-forming unit). Untransfected cells (UT) were used as a control to assess potential toxic effects on the colony-forming ability of LV-MAN2B WT and OPT HSPCs. Error bars indicate the mean ± s.e.m. (n = 3). [Figure 9A] Analysis of integrated vector copy number (VCN) in the genome of myeloid progeny of mPB CD34+ cells transduced with LV-MAN2B WT and OPT at different MOIs (100, 30, 10). Untransduced cells (UT) were used as a control. [Figure 9B] Transduction efficiency was calculated as the percentage of vector-positive colonies (CFC: colony-forming cells). [Figure 9C] MAN2B enzyme activity measured in the cell pellet (intracellular) and medium (extracellular) of myeloid progeny of human mPB CD34+ cells transduced with LV-MAN2B WT and OPT at different MOIs (100, 30, 10). Data are reported as fold increase over untransduced cells (UT). Each error bar represents the mean ± sem (n ≥ 3). [Figure 10A] Growth curve analysis of mPB hCD34+ cells transduced with LV-MAN2B WT (left panel) and LV-CTRL (right panel) at an MOI of 30 and expanded in liquid myeloid culture for 14 days. Untransduced cells (UT) were used as a control. Values are reported as fold increase compared to cell numbers on day 0. Each error bar represents the mean ± sem (n = 3). Cells transduced with a control vector expressing GFP (LV-CTRL) were used for comparison. [Figure 10B]Colony formation assay of mPB hCD34+ cells transduced with LV-MAN2B WT (left panel) and LV-CTRL (right panel) at an MOI of 30. Untransduced cells (UT) were used as a control. (BFU-E: erythroid burst-forming unit; GM-CFU: granulocyte-monocyte colony-forming unit; GEMM-CFU: granulocyte, erythroid, monocyte, and megakaryocyte colony-forming unit) [Figure 10C] VCN measurement of myeloid progeny of human mPB hCD34+ cells transduced with LV-MAN2B WT. Each error bar represents the mean ± sem (n = 3). [Figure 10D] MAN2B enzyme activity in the cell pellet and medium of myeloid progeny of human mPB hCD34+ cells transduced with LV-MAN2B WT. Data are reported as fold increase over untransduced cells (UT). Each error bar represents the mean ± sem (n = 3). [Figure 11A] Schematic diagram of the cross-correction assay. Cell culture medium conditioned by myeloid progeny of human mPB CD34+ cells transduced with LV-MAN2B WT at an MOI of 30 was harvested after 12 hours of conditioning. Cell culture medium conditioned by untransduced cells was used as a control. Fibroblasts from an α-mannosidosis (a-MAN) patient were exposed to conditioned medium for 12–16 hours and harvested for Western blot analysis and enzyme activity titration. [Figure 11B] MAN2B enzyme activity in a-MAN fibroblasts from two patients (Pts 1 and 2) upon exposure to conditioned medium from the myeloid progeny of transduced (LV-MAN2B) and untransduced (UT) cells. MAN2B enzyme activity was also measured in untreated fibroblasts from the same two patients and one healthy donor (HD) as a control. [Figure 12A]Analysis of GLB1 expression and enzyme activity in HSPCs transduced with LV-human GLB1 WT and OPT. Representative images of Western blot analysis of GLB1 expression in the cell pellet (intracellular) and medium (extracellular) of myeloid progeny of human HSPCs transduced with LV-human GLB1 WT and OPT at different MOIs (100, 30, 10). Untransduced cells (UT) were used as a control. Actin-β (ACTB) was used for normalization. [Figure 12B] GLB1 enzyme activity measured as nmol / mg / h in cell pellets (intracellular) and medium (extracellular) of myeloid progeny of human mPB CD34+ cells transduced with LV-human GLB1 WT and OPT at different MOIs (100, 30, 10). Data are reported as fold increase over untransduced cells (UT). Each error bar represents the mean ± sem (n≥3). Each point represents a biological replicate. [Figure 12C] GLB1 enzyme activity measured in MPSIVB fibroblasts exposed for 24 hours to conditioned medium from myeloid progeny of HSPCs transduced with LV-human WT and OPT and untransduced (UT) HSPCs at an MOI of 30. Untreated MPSIVB fibroblasts and healthy donor (HD) fibroblasts were used as controls. [Figure 13A] Analysis of GLB1 expression. qPCR expression analysis of GLB1 RNA in different cell types transfected with LV-human GLB1 at an MOI of 30. Results are expressed as fold change relative to untransfected cells (UT). Each error bar represents the mean ± sem (n ≥ 3). Each point represents a biological replicate. [Figure 13B] Representative images of Western blot analysis of GLB1 expression in cell pellets (intracellular) and medium (extracellular) of myeloid progeny of human HSPCs transduced with LV-human GLB1 WT at an MOI of 30 upon treatment with 100 M chloroquine (+CL) to inhibit GLB1 lysosomal processing. Protein extracts from untransduced (NT) and untransduced (UT) cells were used as controls. [Figure 13C]GLB1 enzyme activity measured in the cell culture medium of myeloid progeny of HSPC cells transfected with LV-human GLB1 WT and LV-human GLB1 eIF4a at an MOI of 30. Each error bar represents the mean ± sem (n = 2). [Figure 14] Representative image showing protein alignment of mouse GLB1 WT protein and C2C12-specific protein isoforms, with three amino acid substitutions in the C2C12-specific protein indicated by black boxes. [Figure 15A] Analysis of integrated vector copy number (VCN) in the genome of myeloid progeny (LC) of human HSPCs transduced with LV-human GLB1 WT (hGLB1), LV-mouse GLB1 C2C12 (mGLB1), and LV-mouse GLB1 WT (mGLB1). LV GLB1 OPT at an MOI of 30. Untransduced cells (UT) were used as a control. [Figure 15B] Cell proliferation analysis of human HSPCs transduced with LV-human GLB1 (hGLB1), LV-mouse GLB1 (mGLB1) C2C12, and LV-mouse GLB1 (mGLB1) WT at an MOI of 30 and expanded for 14 days as myeloid liquid cultures (LCs). Untransduced cells (UT) were used as a control. Values are reported as Log 10-fold increase compared to cell numbers on day 0. [Figure 15C] Colony formation assay evaluating the number and composition of colonies formed by human HSPCs transduced with LV-human GLB1 (hGLB1), LV-mouse GLB1 (mGLB1) C2C12, and LV-mouse GLB1 (mGLB1) WT at an MOI of 30. Untransduced cells (UT) were used as a control. Error bars represent the mean ± sem (n = 3). [Figure 15D] GLB1 enzyme activity was measured in cell pellets and extracellular medium of myeloid progeny of HSPC cells transfected with LV-human GLB1 (hGLB1), LV-mouse GLB1 (mGLB1) C2C12, and LV-mouse GLB1 (mGLB1) WT at an MOI of 30. Each error bar represents the mean ± sem (n ≥ 3). Each point represents a biological replicate. p values were determined by the Mann-Whitney test (*p < 0.05, **p < 0.001). [Figure 16A] Representative images of TRAP assays performed on myeloid progeny of human HSPCs transduced with LV-human GLB1 and LV-mouse GLB1 C2C12 at an MOI of 30 after 10 days of osteoclast differentiation in the presence of human RANKL (50 ng / ml) and M-CSF (25 ng / ml). [Figure 16B] GLB1 enzyme activity measured in the cell pellet and extracellular medium of osteoclasts (OCs) obtained by differentiation of myeloid progeny of human HSPCs transfected with LV-human GLB1 and LV-mouse GLB1 C2C12 at an MOI of 30. [Figure 16C] Cross-compensation assay using MPSIVB fibroblasts exposed for 24 hours to conditioned medium from bone marrow progeny and osteoclasts of HSPCs transduced with LV-human GLB1 and LV-murine GLB1 C2C12 at an MOI of 30. [Figure 16D] Cross-compensation assay using MPSIVB fibroblasts exposed for 24 hours to conditioned medium from myeloid progeny of HSPCs transduced with LV-human GLB1, LV-mouse GLB1 C2C12, and LV-mouse GLB1 WT at an MOI of 30. [Figure 17A] GLB1 enzyme activity was measured in osteoblast (OB) cell pellets obtained by differentiation of HS5 stromal cells transfected with LVs co-expressing Cas9 cDNA and a GLB1-specific gRNA to knock out GLB1 enzyme expression (HS5 OBs GLB1 KO). HS5 OBs transfected with the same LVs carrying a control gRNA served as a control (HS5 OBs ctrl). HS5 OBs were exposed for 24 hours to conditioned medium from myeloid progeny of human HSPCs transfected with LV-human GLB1, LV-mouse GLB1 C2C12, or LV-mouse GLB1 WT at an MOI of 30. Each error bar represents the mean ± sem (n = 3). Each point represents a biological replicate. Absolute values of GLB1 enzyme activity are reported above each bar. [Figure 17B] ELISA assay for measuring keratan sulfate accumulation levels in the same experimental sample. Each error bar represents the mean ± sem (n = 3). Each point represents a biological repeat. [Figure 18A] Xenotransplantation experimental scheme. HSPCs from healthy donors were transduced with LV-human GLB1 (hGLB1), LV-mouse GLB1 C2C12 (mGLB1 C2C12), and LV-mouse GLB1 WT (mGLB1 WT) at an MOI of 30 and transplanted into NOD.Cg-KitW-41J Prkdcscid Il2rgtm1Wjl / WaskJ (NSGW41) mice (1.95 x 10 cells / mouse). NSGW41 mice transplanted with the same dose of cultured untransduced HSPCs (MOCK) and untreated mice served as controls. [Figure 18B] Body weight monitoring at different time points after transplantation of NSGW41 mice transplanted with untransduced (MOCK) or transduced HSPCs. [Figure 18C] Evaluation of human cell engraftment rate as the percentage of human CD45-positive cells among total cells in peripheral blood (PB) at 8 and 16 weeks after transplantation. [Figure 18D] Evaluation of human cell engraftment rate as the percentage of human CD45-positive cells among all cells in the bone marrow (BM) (D) 16 weeks after transplantation. [Figure 18E] Evaluation of human cell engraftment rate as the percentage of human CD45-positive cells among all cells in the spleen (E) 16 weeks after transplantation. [Figure 18F] Evaluation of hematopoietic differentiation into myeloid, T, B, and NK cells of HSPCs transduced with LV-human GLB1, LV-mouse GLB1 C2C12, and LV-mouse GLB1 WT at an MOI of 30. [Figure 18G] Percentage of human HSPC (CD34+ CD38-) engraftment in the BM of transplanted mice. [Figure 18H] Integrated vector copy number (VCN) in mononuclear cells isolated from the BM of transplanted NSGW41. [Figure 18I] GLB1 enzyme activity was measured in cell pellets of mononuclear cells isolated from the BM of transplanted NSGW41 mice (left panel). Enzyme activity was normalized to VCN (right panel). Each error bar represents the mean ± sem (n = 3). Each point represents a biological replicate. p values were determined by the Mann-Whitney test (*p < 0.05, **p < 0.001). [Figure 19] GLB1 enzyme activity measured in cell pellets of MPSIVB fibroblasts (MPSIVB fibro) exposed to conditioned medium (+LC medium) from myeloid progeny of HSPCs transduced with LV-human GLB1 and LV-mouse GLB1 at an MOI of 30 and untransduced HSPCs (UT) in the presence (+M6P) or absence of 5 mM mannose 6-phosphate (M6P). The presence of M6P inhibits the uptake of both human and mouse GLB1 enzymes. Each error bar represents the mean ± sem (n = 3). Each point represents a biological replicate. [Figure 20A] Short-term responses of peripheral blood mononuclear cells (PBMNC) from healthy donors to mouse (left panel) and human (right panel) GLB1 enzyme. The level of immunogenicity was assessed as T cell proliferation (upper panel) and INF-γ production (lower panel) after 5 days of PBMNC exposure to conditioned medium from LV-mouse WT, LV-mouse C2C12, and LV-human GLB1-transduced HEK293T cells. [Figure 20B] Long-term immunogenic responses following a second exposure to conditioned medium from HEK293T cells transfected with LV-mouse WT (left panel), LV-mouse C2C12 (left panel), and LV-human GLB1 (right panel). T cell proliferation (top panel) and IFN-γ production (bottom panel) were measured. Each error bar represents the mean ± sem (n = 3). Each point represents a biological replicate. [Figure 21A] Growth curve analysis of human mobilized peripheral blood (mPB) cells transfected with LV-MAN2B WT (left panel) and LV-CTRL (right panel) at an MOI of 30 using a 1-hit CsH (C, n = 6) or 1-hit CsH + PGE2 (C + P, n = 3) protocol and expanded in liquid myeloid culture for 14 days. Values are reported as fold increase compared to cell counts on day 0. [Figure 21B] Colony formation assay of mPB hCD34+ cells transduced with LV-MAN2B WT and LV-CTRL at an MOI of 30 using a 1-hit CsH or 1-hit CsH+PGE2 protocol. [Figure 21C]Analysis of integrated vector copy number (VCN) into the genome of myeloid progeny of mPB CD34+ cells transduced with LV-MAN2B WT and LV-CTRL at an MOI of 30 using a 1-hit CsH or 1-hit CsH+PGE2 protocol. [Figure 21D] Transduction efficiency calculated as the percentage of vector-positive colony-forming cells (CFCs). [Figure 21E] Dose of MAN2B enzyme activity in the cell pellet (intracellular) and medium (extracellular) of myeloid progeny of human mPB hCD34+ cells transduced with LV-MAN2B WT (MOI 30) using a 1-hit CsH or 1-hit CsH + PGE2 protocol. Untransduced cells (UT) and cells transduced with a control vector expressing GFP (LV-CTRL) were used as controls in all experiments. Error bars represent the mean ± s.e.m. [Figure 22A] Schematic diagram of the cross-correction assay. Cell culture medium conditioned by myeloid progeny of human mPB CD34+ cells transduced with LV-MAN2B WT at an MOI of 30 using a 1-hit CsH (C, n=3) or 1-hit CsH+PGE2 (C+P, n=3) protocol was harvested after 12 hours of conditioning. Cell culture medium conditioned by untransduced (UT) cells was used as a control. Fibroblasts from patients with α-mannosidosis (a-MAN) were exposed to conditioned medium for 12–16 hours and harvested for enzyme activity dose. [Figure 22B] MAN2B enzyme activity in a-MAN fibroblasts from two patients (Pt1 and Pt2) upon exposure to conditioned medium from the myeloid progeny of transduced (LV-MAN2B) and untransduced (UT) cells. MAN2B enzyme activity was also measured in untreated fibroblasts from the same two patients and one healthy donor (HD) as a control. [Figure 23A]Representative images of tartrate-resistant acid phosphatase (TRAP) assays performed on osteoclasts differentiated from untransduced (UT) and transduced CD34+ cells. Cells were transduced with LV-MAN2B WT (MOI 30) using a 1-hit CsH or 1-hit CsH + PGE2 protocol. After 10 days of culture in osteoclast differentiation medium, a TRAP assay was performed to detect the presence of bone-resorbing osteoclasts. [Figure 23B] qPCR expression analysis of MMP9 and TRAP5b genes involved in osteoclast (OC) differentiation in bone marrow liquid culture (LC) cells and differentiated osteoclasts (OCs). Values are reported as 2(-DCT), where DCT is calculated as the gene CT - CT ACTB. [Figure 23C] MAN2B enzyme activity was measured in the cell pellets (intracellular) and medium (extracellular) of osteoclasts and myeloid liquid cultures obtained from myeloid LCs of human mPB CD34+ cells transfected with LV-MAN2B WT in the presence of CsH or CsH + PGE2. Untransfected cells (UT) served as a control. Error bars represent the mean ± sem (n = 3). [Figure 24A] Schematic diagram of the cross-correction assay. Cell medium conditioned by osteoclasts derived from the myeloid progeny of human mPB CD34+ cells transduced with LV-MAN2B WT at an MOI of 30 using a 1-hit CsH or 1-hit CsH + PGE2 protocol was harvested after 12 hours of conditioning. Cell medium conditioned by untransduced (UT) cells was used as a control. Fibroblasts derived from an α-mannosidosis (a-MAN) patient were exposed to conditioned medium for 12–16 hours and harvested for enzyme activity. [Figure 24B] MAN2B enzyme activity in a-MAN fibroblasts from two patients (Pt1 and Pt2) upon exposure to conditioned medium from transduced (LV-MAN2B) and untransduced (UT) osteoclasts. MAN2B enzyme activity was also measured in untreated fibroblasts from the same two patients and one healthy donor (HD) as a control. [Figure 25A]Experimental scheme for in vivo transplantation using LV-MAN2B WT-transfected human mPB CD34+ cells and untransfected cells. Human mPB CD34+ cells from a healthy donor were transfected with LV-MAN2B WT at an MOI of 30 using one-hit CsH and injected into NBSGW mice (3 x 105 CD34+ cells / mouse). As a control, NBSGW mice were transplanted with cultured untransfected mPB CD34+ cells (MOCK). [Figure 25B] Vector copy number (VCN) analysis in total bone marrow (BM) cells from mice transplanted with untransduced (MOCK) and transduced (LV-MAN2B) mPB CD34+ cells. [Figure 25C] Relative frequencies of human CD45+ cells detected in the peripheral blood of mice 7 and 12 weeks after cell infusion (left panel), and in the bone marrow of mice 12 weeks after transplantation (right panel). [Figure 25D] MAN2B enzyme activity (EA) in total BM cells 12 weeks after transplantation in mice transplanted with untransfected (MOCK) and transfected (LV-MAN2B) mPB CD34+ cells. Each error bar represents the mean ± sem. [Figure 26A] Results of toxicity evaluation of wild-type (WT) and codon-optimized (OPT) LV GALNS in Example 26. Growth curves of human mobilized peripheral blood (mPB) CD34+ cells transfected with LV GALNS WT (left panel) and LV GALNS OPT (right panel) at different MOIs (100, 30, 10). Untransfected cells (UT) were used as a control. Values are reported as fold increase compared to the cell count on day 0. Each error bar represents the mean ± sem (n = 3). [Figure 26B] Colony formation assay of human mPBCD34+ cells transfected with LV-GALNS WT and LV-GALNS OPT at different MOIs (100, 30, 10). Untransfected cells (UT) were used as a control. Each error bar represents the mean ± sem (n = 3). [Figure 27A]Analysis of GALNS expression and enzyme activity in human mPB CD34+ cells transduced with LV GALNS WT and OPT in Example 27. Analysis of integrated vector copy number (VCN) into the genome of myeloid progeny of mPB CD34+ cells transduced with LV GALNS WT and OPT at different MOIs (100, 30, 10). [Figure 27B] Transduction efficiency calculated as the percentage of vector-positive colonies. [Figure 27C] Western blot analysis of GALNS expression in the cell pellet (intracellular) and medium (extracellular) of myeloid progeny of human mPB CD34+ cells transfected with LV GALNS WT and OPT at different MOIs (100, 30, 10). Actin-β (ACTB) was used for normalization. [Figure 27D] GALNS enzyme activity measured in the cell pellet (intracellular) and medium (extracellular) of myeloid progeny of human mPB CD34+ cells transduced with LV GALNS WT and OPT at different MOIs (100, 30, 10). Untransduced cells (UT) were used as a control in all experiments. Each error bar represents the mean ± sem (n = 3). [Figure 28A] Evaluation of the toxicity and transduction efficiency of LV-GALNS WT in human mPB CD34+ cells in Example 28. Growth curve analysis of mPB hCD34+ cells transduced with LV-GALNS WT (left panel) or LV-CTRL (right panel) at an MOI of 30 and expanded as myeloid liquid culture for 14 days. Values are reported as fold increase compared to the cell number on day 0. Each error bar represents the mean ± sem (n = 3). For comparison, cells transduced with a control vector (LV-CTRL) expressing GFP were used. [Figure 28B] Colony formation assay of mPB hCD34+ cells transduced with LV-GALNS WT (left panel) and LV-CTRL (right panel) at an MOI of 30. [Figure 28C] Measurement of VCN of myeloid progeny of human mPB hCD34+ cells transfected with LV GALNS WT. Each error bar represents the mean ± sem (n = 3). [Figure 28D]GALNS enzyme activity levels in cell pellets and medium of myeloid progeny of human mPB hCD34+ cells transduced with LV GALNS WT. Each error bar represents the mean ± sem (n = 3). Untransduced cells (UT) were used as a control in all experiments. [Figure 29A] Restoration of GALNS enzyme activity in fibroblasts derived from MPSIVA patients (Example 29). Schematic diagram of cross-correction assay. Cell culture medium conditioned by myeloid progeny of human mPB CD34+ cells transduced with LV GALNS WT at an MOI of 30 was collected after 12 hours of conditioning. Cell culture medium conditioned by untransduced cells was used as a control. [Figure 29B] On the left, Western blot analysis of GALNS expression in fibroblasts from three different MPSIVA patients (n = 3) exposed to conditioned medium from the myeloid progeny of transduced (LV GALNS) and untransduced (UT) mPB CD34+ cells (n = 3: mPB1, mPB2, mPB3). Calnexin (CNX) was used for normalization (left panel). On the right, the level of GALNS enzyme activity in MPSIVA fibroblasts upon exposure to conditioned medium from the myeloid progeny of transduced (LV GALNS) and untransduced (UT) cells is reported. GALNS enzyme activity was also measured in fibroblasts from one healthy donor (HD) as a control. [Figure 30A] Example 30: Restoration of GALNS activity in MPSIVA-derived mesenchymal stromal cells (MSCs) and MSC-derived osteoblasts (OBs). Western blot analysis of GALNS expression in MSCs and MSC-derived OBs isolated from one MPSIVA patient. GALNS expression was also assessed in MSCs from a healthy donor (HD) as a control. Actin-β (ACTB) was used for sample normalization. [Figure 30B] Schematic of the cross-compensation assay. [Figure 30C]Western blot analysis of GALNS expression in MSCs (left) and OBs (right) from MPSIVA patients after exposure to conditioned medium (CM) from the progeny of LV-GALNS-transduced human mPB CD34+. Conditioned medium from the myeloid progeny of untransduced (UT) human mPB CD34+ was used as a control. [Figure 30D] GALNS enzyme activity measured in MPSIVA MSCs after exposure to conditioned medium (CM) from untransduced (UT) and LV GALNS-transduced mPB CD34+ cells. GALNS activity in healthy donor (HD) MSCs was measured as a control. [Figure 31A] Analysis of the molecular mechanisms mediating GALNS uptake in MPSIVA MSCs and MSC-derived OBs in Example 31. Western blot analysis of GALNS expression in MPSIVA MSCs and MSC-derived OBs exposed to conditioned medium from HEK293T cells (WT) transduced with LV GALNS WT at an MOI of 30 for 12 hours in the presence (+) or absence (-) of a saturating dose of mannose-6-phosphate (M6P). Conditioned medium from untransduced HEK293T cells (UT) was used as a control. [Figure 31B] Western blot analysis of GALNS expression in MPSIVA MSCs and OBs exposed to conditioned medium from HEK293T cells transduced with LV GALNS WT at an MOI of 30 for a shorter period (3 h) in the presence (+) or absence (−) of a saturating dose of M6P. [Figure 31C] GALNS expression in MSC-derived OBs from a patient with MPSIVA exposed to increasing volumes (1 or 2 ml) of conditioned medium from HEK293T cells transduced with LV-GALNS WT at an MOI of 30, in the presence (+) or absence (-) of M6P. In all experiments, cells exposed to conditioned medium from untransduced HEK293T cells (UT) served as a control. Calnexin (CNX) was used for sample normalization. [Figure 32A]Analysis of osteoclasts (OCs) derived from myeloid progeny of human mPB CD34+ cells transduced with LV GALNS WT in Example 32. TRAP assay for the presence of OCs 10 days after in vitro differentiation of myeloid progeny of mPB CD34+ cells transduced with LV GALNS at an MOI of 30. OCs derived from untransduced (UT) cells were used as a control. [Figure 32B] qPCR expression analysis of MMP9 and TRAP5b genes involved in OC differentiation. Values are reported as 2(-DCT), where DCT is calculated as gene CT - CT ACTB. [Figure 32C] Western blot analysis of GALNS expression in pellets and cell culture media of OCs derived from bone marrow cultures of untransduced and LV GALNS WT-transduced mPB CD34+ cells. [Figure 33A] Results of in vivo transplantation experiment in Example 33. Experimental scheme for in vivo transplantation experiment using human mPB CD34+ cells transduced with LV-GALNS WT and untransduced cells. Using a one-hit CsH protocol, human mPB CD34+ cells derived from a healthy donor transduced with LV-GALNS WT at an MOI of 30 were injected into sublethally irradiated NSG mice (GT). As a control, NSG mice were transplanted with cultured untransduced mPB CD34+ cells (MOCK). To test the toxicity and transduction efficiency of LV-GALNS for in vivo experiments, 1 x 105 mPB CD34+ cells were expanded in vitro as a myeloid liquid culture. [Figure 33B] Cell proliferation in myeloid progeny of untransduced and LV-GALNS WT-transduced mPB CD34+ cells at an MOI of 30 (B). [Figure 33C] Colony-forming ability of myeloid progeny of untransduced mPB CD34+ cells and those transduced with LV-GALNS WT at an MOI of 30 (C). [Figure 33D] Transduction efficiency (D) in myeloid progeny of untransduced and LV-GALNS WT-transduced mPB CD34+ cells at an MOI of 30. [Figure 33E]Vector copy number analysis in myeloid progeny of untransduced and LV GALNS WT-transduced mPB CD34+ cells at an MOI of 30 (E). [Figure 33F] Western blot analysis of GALNS in cell pellets and medium of myeloid progeny of untransduced and LV GALNS WT-transduced mPB CD34+ cells at an MOI of 30 (F). [Figure 33G] Enzymatically active dose (G) of GALNS in cell pellets and medium of myeloid progeny of mPB CD34+ cells untransduced and transduced with LV GALNS WT at an MOI of 30. [Figure 34A] Analysis of in vivo human reconstitution of human mPB CD34+ cells transduced with LV GALNS WT and untransduced cells after xenotransplantation in Example 34. Body weights of untransduced (MOCK) and mice transplanted with mPB CD34+ cells transduced with LV GALNS WT at an MOI of 30 (GT) at different time points after transplantation. [Figure 34B] Absolute number (cells / ul) and percentage (%) of human CD45+ cells in the peripheral blood (PB) of transplanted mice 7 and 12 weeks after cell injection. [Figure 34C] Absolute number (cells / ul) and percentage (%) of human CD45+ cells in bone marrow (BM) (C) 12 weeks after transplantation. [Figure 34D] Absolute number (cells / ul) and percentage (%) of human CD45+ cells in the spleen (D) 12 weeks after transplantation. [Figure 34E] GALNS enzyme activity in total BM cells of mice in the GT and mock groups 12 weeks after transplantation. [Figure 35A] Schematic diagram of a vector transgene carrying an expression cassette (LV-GALNS cassette) for expressing GALNS. The expression cassette consists of GALNS cDNA (wild-type, WT, or optimized, OPT) under the control of the human promoter phosphoglycerate kinase gene (hPGK). The cis-acting polynucleotide regulatory sequences are shown as in Figure 1A. [Figure 35B]Schematic diagram of transfer vector transgene. In addition to the expression cassette, the following viral cis-acting polynucleotide sequences required for virus production are shown: a truncated 5' LTR, encapsidation signal (Ψ), Rev-responsive element (RRE), central polypurine tract / chain termination sequence (cPPT / CTS), woodchuck hepatitis virus posttranscriptional regulatory element (Wpre), 3' LTR (ΔU3), and polyA sequence. The expression cassette consists of GALNS cDNA (wild-type or optimized) under the control of the human PGK promoter. Neomycin and kanamycin resistance (NeoR / KanR) are also shown. [Figure 36A] Experimental scheme for mPB HSPC transduction. Human mPB HSPCs (CD34+) derived from healthy donors were pre-stimulated in appropriate cell culture medium for 22 hours and then transduced with clinical-grade LV-GALNS at different MOIs (25, 50, 100) over 14 hours in the absence of transduction enhancers (TEs) or in the presence of TEs alone (PGE2, CsH, LB) or in combination (PGE2 + LB, PGE2 + CsH, CsH + LB). Untransduced (UT) cells served as controls. At the end of transduction, cells were harvested for colony formation assays in MethoCult and expansion as myeloid liquid cultures. During cell expansion, cells were counted at different passages to assess cell proliferation potential (toxicity assessment). After 14 days of expansion, myeloid cells were harvested for VCN analysis and enzyme activity measurements (efficiency assessment). [Figure 36B] Colony formation assay to evaluate the colony-forming ability of transfected cells as the number and composition of colonies. [Figure 36C] Proliferation assay to determine the proliferation potential of transduced cells. Values represent the fold change in the total number of cells counted at different passages relative to the number of cells seeded for LV transduction (d0). [Figure 37A] Vector copy number assessed by ddPCR in cells transfected at different MOIs. [Figure 37B] Enzyme activity, measured as nmol after 17 h incubation of protein extracts of transfected and untransfected (UT) cells with the appropriate substrate, was normalized to protein content (nmol / 17 h / mg). Detailed Description of the Invention
[0055] All technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs, unless otherwise defined.
[0056] It must be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a "cell" includes a plurality of such cells.
[0057] As used herein, the term "lysosomal storage disease with skeletal involvement" refers to LSDs whose clinical symptoms involve abnormalities and / or involvement of skeletal tissues, including bone and cartilage, in particular MPSIVA, MPSIVB, GM1 gangliosidosis, and a-MANN.
[0058] As used herein, the terms "therapy," "treatment," "treating," and the like refer to administering a compound, composition, or formulation of the present invention to achieve a desired pharmacological and / or physiological effect. The effect may be preventative, in that a disease or its symptoms are completely or partially prevented, and / or therapeutic, in that a disease and / or its deleterious effects are partially or completely stabilized or cured, or disease progression is controlled. As used herein, terms such as "prevent," "preventing," and "prevention" refer to inhibiting the onset of a disease or reducing its occurrence in a subject. Prevention may be complete (e.g., the complete absence of pathological cells in a subject) or partial. Prevention also refers to a reduction in susceptibility to a clinical condition. Controlling disease progression is understood as achieving a beneficial or desired clinical result, including, but not limited to, alleviation of symptoms, shortening the duration of the disease, stabilization of the condition (particularly avoiding further deterioration), delay in disease progression, improvement in the condition, and remission (both partial and complete). Controlling disease progression also entails an increase in survival compared to the expected survival if the treatment were not applied.
[0059] In particular, in accordance with the present invention, the terms "therapy," "treatment," "treating," and the like as used herein refer to the administration of a compound, composition, or formulation of the present invention to preferably cure, prevent, delay, and / or control the clinical symptoms of a condition that includes skeletal symptoms in addition to CNS and metabolic symptoms.
[0060] The term "effective amount" refers to a sufficient amount of a substance to achieve its intended purpose.
[0061] For example, an effective amount of a lysosomal enzyme produced and released by a modified cell to increase enzymatic activity is an amount sufficient to reduce the accumulation of the enzyme's substrate.
[0062] A "therapeutically effective amount" of a lysosomal enzyme produced and released by modified cells or a "therapeutically effective amount" for treating a disease or disorder is an amount of lysosomal enzyme produced and released by modified cells sufficient to reduce or eliminate the signs and symptoms of the disease or disorder. The effective amount of a particular substance will vary depending on factors such as the nature of the substance, the route of administration, the size and species of the animal receiving the substance, and the purpose for which the substance is administered. The effective amount in a particular case can be determined empirically by one of ordinary skill in the art according to methods established in the art. For example, what is intended by a "therapeutically effective dose or amount" of a compound, composition, or formulation according to the present invention is an amount that, when administered as described herein, results in a positive therapeutic response, such as improved recovery from a disease or from the accompanying symptoms of a disease.
[0063] The term "individual" or "subject" as used herein refers to a mammal, preferably a human or non-human mammal, more preferably a mouse, rat, other rodent, rabbit, dog, cat, pig, cow, horse or primate, and even more preferably a human.
[0064] Those in need of treatment include those already with the disease as well as those in whom prevention is desired (for example, asymptomatic individuals diagnosed with a genetic disease).
[0065] The term "pharmaceutically acceptable excipient" refers to a conventional non-toxic solid, semi-solid, or liquid filler, diluent, encapsulating material, or formulation auxiliary that may optionally be included in the compositions of the present invention and that does not cause significant adverse toxicological effects in patients. Pharmaceutically acceptable excipients are essentially non-toxic to recipients at the dosages and concentrations employed and are compatible with other ingredients of the formulation. The number and nature of pharmaceutically acceptable excipients depend on the desired form of administration. Pharmaceutically acceptable excipients are known and can be prepared by methods well known in the art.
[0066] The pharmaceutical composition according to the present invention can be formulated according to routine procedures as a pharmaceutical composition adapted for intravenous, subcutaneous, intramuscular, intracerebrospinal fluid (CSF), e.g., intracisternal or intraventricular administration to humans. In a preferred embodiment, the pharmaceutical composition is for intravenous or intracerebrospinal fluid (CSF) administration. More preferably, the pharmaceutical composition is for intravenous administration.
[0067] The term "unit dosage form" as used herein refers to physically discrete units suitable as unitary dosages for human and animal subjects, each unit containing a predetermined amount of the compound, composition, or formulation to be administered, calculated in an amount sufficient to produce the desired effect in association with a pharmaceutically acceptable diluent, carrier, or vehicle. The specifications for the unit dosage forms for use in the present invention depend on the particular compound employed, the effect to be achieved, the pharmacodynamics associated with each compound in the host, and the like.
[0068] The terms "nucleotide sequence" or "isolated nucleotide sequence" or "polynucleotide sequence" or "polynucleotide" or "isolated polynucleotide sequence" are used interchangeably herein and refer to a nucleic acid molecule, DNA or RNA, containing deoxyribonucleotides or ribonucleotides, respectively. A nucleic acid can be double-stranded, single-stranded, or contain portions of both double-stranded and single-stranded sequence.
[0069] The term "variant" refers to a biologically active derivative of a reference molecule that retains a desired activity. Generally, the term "variant" refers to a molecule that has a native sequence and structure, has one or more additions, substitutions (generally conservative in nature), and / or deletions compared to the native molecule, and is "substantially homologous" to the reference molecule, so long as the modification does not destroy the biological activity. Generally, the sequence of such a variant has a high degree of sequence identity to the reference sequence, e.g., greater than 50%, generally greater than 60%-70%, and even more particularly, 80%-85% or more, e.g., at least 90%-95% or more, when the two sequences are aligned. According to the present invention, a variant of any biomolecule is a biomolecule that has a nucleic acid or amino acid sequence that is 50%, 60%, 70%, 80%, 90%, 95%, or 99% identical to the wild-type nucleic acid or amino acid sequence and retains the biological activity of the wild-type biomolecule. In a preferred embodiment, the term "variant" of a polynucleotide sequence is used herein to refer to a sequence having at least 90%, 95%, or 99% percent identity to the polynucleotide sequence. In a preferred embodiment, the term "variant" of a polynucleotide sequence is used herein to refer to a codon-optimized sequence for expressing a biomolecule encoded by the sequence. The terms "% sequence identity," "% identity," or "% sequence homology" refer to the percentage of nucleotides or amino acids in a candidate sequence that are identical to nucleotides or amino acids in a reference sequence after aligning the sequences to achieve the maximum % sequence identity. In a preferred embodiment, sequence identity is calculated based on the entire length of two given sequences or on a portion thereof. % sequence identity can be determined by any method or algorithm established in the art, such as the ALIGN, BLAST, and BLAST 2.0 algorithms. As used herein, "% sequence identity," "% identity," or "% sequence homology" is calculated by dividing the number of identical nucleotides or amino acids after aligning a reference sequence and a candidate sequence by the total number of nucleotides or amino acids in the reference sequence and multiplying the result by 100.Due to the degeneracy of the genetic code, variants include sequences in which at least one base in the base sequence of a gene is replaced with a different type of base without changing the amino acid sequence of the polypeptide expressed from the gene. Variants also include codon-optimized sequences and sequences containing mutated or added nucleotides for cloning purposes, etc. In accordance with the present invention, variants also include fragments of any biomolecule, i.e., sequences encoding shorter forms, e.g., truncated forms, of a biomolecule that retain the biological activity of the wild-type biomolecule.
[0070] The terms "encode" or "encoding" refer to the genetic code, which determines how a nucleotide sequence is translated into a polypeptide or protein. The order of nucleotides in a sequence determines the order of amino acids along the polypeptide or protein.
[0071] The terms "transcriptional control region" or "regulatory element or region," as used herein, refer to a nucleotide fragment capable of controlling the expression of one or more genes. The regulatory region of a polynucleotide of the present invention may include a promoter and response elements, activator and enhancer sequences to which transcription factors bind and facilitate the binding of RNA polymerase, thereby promoting expression, and operator or silencer sequences to which repressor proteins bind, inhibiting the attachment of RNA polymerase and preventing expression.
[0072] The term "promoter" should be understood as a nucleic acid fragment that functions to control the transcription of one or more polynucleotides, e.g., coding sequences. A "promoter" is located 5' upstream of a polynucleotide sequence and is structurally identified by the presence of a DNA-dependent RNA polymerase binding site, a transcription initiation site, and binding sites for, but not limited to, transcription factors, repressors, and any other nucleotide sequences known in the art to directly or indirectly regulate the amount of transcription from the promoter. A promoter is said to be operably linked to or drive the expression of a nucleotide sequence. In this case, a genetic construct containing the promoter operably linked to a nucleotide sequence of interest can be used to initiate transcription of the nucleotide sequence in an expression system using an appropriate assay, such as RT-qPCR or Northern blotting (detection of transcripts). The activity of the promoter can also be assessed at the protein level using an appropriate assay for the encoded protein, such as Western blotting or ELISA. A promoter is said to be capable of initiating transcription if transcript can be detected or if there is at least a 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 500%, 1000%, 1500% or 2000% increase in transcript or protein levels compared to transcription using a construct that differs only in that it does not contain the promoter.
[0073] The term "constitutive" promoter refers to a promoter that is active under most physiological and developmental conditions. An "inducible" promoter is preferably a promoter that is regulated depending on physiological or developmental conditions. A "tissue-specific" promoter is preferably active in specific types of cells / tissues. A ubiquitous promoter can be defined as a promoter that is active in many or any different tissues.
[0074] The term "post-transcriptional regulatory region" refers to any polynucleotide that facilitates the expression, stabilization, or localization of a sequence contained within a cassette or resultant gene product.
[0075] The term "vector" refers to a particle capable of delivering and optionally expressing one or more polynucleotides of interest in a host cell. Examples of vectors include, but are not limited to, naked DNA or RNA expression vectors, plasmids, cosmids, or phage vectors, DNA or RNA expression vectors associated with cationic condensing agents, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic cells, such as producer cells. A vector may be a cloning vector suitable for propagation and for obtaining polynucleotides, gene constructs, or expression vectors integrated into multiple heterologous organisms. The term "expression vector" refers to a vector designed for intracellular gene expression, i.e., a vector used to introduce a specific gene into a target cell to produce the protein encoded by the gene.
[0076] A "vector" is a vector capable of introducing a nucleic acid sequence into a target cell. Therefore, the term "vector" encompasses viral vectors, non-viral vectors, microparticle carriers, and liposomes. Typically, "vector construct," "expression vector," and "gene transfer vector" refer to any nucleic acid construct capable of directing the expression of a nucleic acid of interest and introducing a nucleic acid sequence into a target cell. Thus, the terms encompass cloning and expression vehicles as well as viral vectors. A vector contains at least one expression cassette consisting of one or more genes to be expressed by the transfected cell and regulatory sequences that control their expression. The expression cassette directs the cellular machinery to produce RNA and protein. An expression cassette typically contains at least three components: a promoter sequence, an open reading frame, and a 3' untranslated region, which in eukaryotes usually contains a polyadenylation site. A vector further contains regulatory sequences that function as enhancers and / or promoter regions, leading to efficient transcription of the genes carried by the expression vector. Examples of vectors include prokaryotic expression vectors, phage and shuttle vectors, eukaryotic expression vectors based on viral vectors, and non-viral vectors.
[0077] The term "recombinant plasmid" or "plasmid" refers to a small, circular, double-stranded, self-replicating DNA molecule obtained by genetic engineering techniques that can introduce genetic material of interest into cells, resulting in the production of a product (e.g., a protein polypeptide, peptide, or functional RNA) encoded by the genetic material in the target cell. Furthermore, the term "recombinant plasmid" or "plasmid" also refers to a small, circular, double-stranded, self-replicating DNA molecule obtained by genetic engineering techniques that is used as a carrier of a recombinant vector genome during the production of a viral vector.
[0078] The terms "modified" or "genetically modified" are used interchangeably herein to refer to transfected cells.
[0079] The term "recombinant viral vector" or "viral vector" refers to an agent derived from a naturally occurring virus through genetic engineering techniques that is capable of transferring genetic material of interest (e.g., DNA or RNA) into a cell, resulting in the production of a product encoded by the genetic material (e.g., a protein polypeptide, peptide, or functional RNA) in the target cell.
[0080] As used herein, the term "vector transgene" or "recombinant vector transgene" refers to a transgene that is transferred to a recipient cell upon introduction. The term "viral vector" or "recombinant viral vector" as used herein also refers to a recombinant viral particle, which is a packaged viral vector, that can bind to and enter a recipient cell and deliver the vector transgene. "Recombinant host cells," "host cells," "cells," "cell lines," "cell cultures," "modified cells," and other such terms that refer to microorganisms or higher eukaryotic cell lines cultured as unicellular organisms, refer to cells that can be or have been used as recipients for recombinant vectors or other introduced DNA, including the original progeny of the original cell that was introduced.
[0081] The term "transformation" refers to the insertion of an exogenous polynucleotide into a host cell, regardless of the method of insertion used, including, for example, direct uptake, transduction, or F-mating. The exogenous polynucleotide can be maintained as a non-integrated vector, for example, a plasmid, or alternatively, can be integrated into the host genome.
[0082] "Gene transfer" or "gene delivery" refers to a method or system for reliably inserting a DNA or RNA of interest into a host cell. Such methods may result in transient expression of non-integrated introduced DNA, extrachromosomal replication and expression of an introduced replicon (e.g., an episome), or integration of the introduced genetic material into the genomic DNA of the host cell.
[0083] The term "derived from" is used herein to identify the original source of a molecule, but is not intended to limit the manner in which the molecule is produced, e.g., by chemical synthesis or recombinant means.
[0084] The term "gene therapy" refers to the introduction of genetic material of interest (e.g., DNA or RNA) into cells to treat or prevent inherited or acquired diseases or conditions. The genetic material of interest encodes a product (e.g., a protein polypeptide, peptide, or functional RNA) whose production in vivo is desired. For example, the genetic material of interest may encode an enzyme, hormone, receptor, or polypeptide of therapeutic value. As used herein, the terms "transduction" or "transduction" refer to the process of introducing an exogenous nucleotide sequence into a cell via a viral vector. Transduction in which the exogenous polynucleotide is integrated into the host genome, i.e., the host cell genome, is preferred for the methods of gene transfer described herein.
[0085] The present invention relates to a recombinant viral vector, preferably a lentiviral vector (LV), comprising an expression cassette for expressing in a cell a polynucleotide encoding a lysosomal enzyme (herein also referred to as "enzyme of interest") that is deficient in a lysosomal disorder (LSD), preferably a skeletal disorder (LSD), particularly mucopolysaccharidosis type IVA or type IVB, GM1 gangliosidosis, or α-mannosidosis. The expression cassette comprises a promoter and a polynucleotide encoding the enzyme of interest operably linked to the promoter.
[0086] The enzyme of interest is preferably selected from the following: β-galactosidase (β-GAL, hereinafter also referred to as GLB1), which is deficient in mucopolysaccharidosis type IVB, and GM1 gangliosidosis α-D-mannosidase (MAN2B), which is deficient in α-mannosidosis, and galactosamine (N-acetyl)-6-sulfatase (GALNS), which is deficient in mucopolysaccharidosis type IVA.
[0087] The term "deficient" as used with respect to an enzyme of interest in connection with the disease states disclosed herein is meant to indicate that the enzyme is in an insufficient amount or is functionally insufficient to provide a physiological function.
[0088] Thus, the recombinant viral vector comprises a) a polynucleotide encoding an enzyme of interest, and b) a promoter that drives expression of the operably linked polynucleotide encoding the enzyme of interest.
[0089] The viral vector of the present invention is preferably a lentiviral vector (LV), more preferably a replication-deficient third-generation pseudotyped vector, which comprises a core of HIV-1 structural proteins and enzymes, i.e., an HIV-1-derived vector, an envelope of vesicular stomatitis virus (VSV), and HIV-1 cis-acting sequences, a genome without viral genes, and one expression cassette for a gene of interest.
[0090] Lentiviral vector (LV) particles can be produced by transiently transfecting vector-producing cells, such as HEK293T cells, with four constructs that express the vector components (core, envelope, and transgene of interest). Preferably, the constructs are two core packaging constructs, an envelope construct, and a transfer vector construct that contains a vector transgene containing an expression cassette (promoter + gene of interest). Only the transgene is integrated into the genome of the target cell, resulting in stable expression of the gene of interest.
[0091] In the recombinant viral vectors of the present invention, the transfer vector construct is optimized for maximum transduction efficiency and stable constitutive transgene expression in target cells.
[0092] LV is preferably replication-deficient by design. No viral genes are transferred to target cells. Because the vector is pseudotyped with an unrelated viral envelope, recombination between the constructs used to generate the vector cannot generate wild-type HIV. Furthermore, the lack of homology between the envelope and core packaging sequences makes recombination between these constructs highly unlikely (Vigna and Naldini 2000).
[0093] The recombinant lentiviral vector according to the invention further comprises a viral cis-regulatory element, preferably an element derived from the human immunodeficiency virus (HIV). More preferably, the recombinant lentiviral vector of the invention further comprises: c) a 5' long terminal repeat (5'LTR), preferably having the sequence of SEQ ID NO: 9, or a variant thereof; d) an encapsidation signal (Ψ), preferably having the sequence SEQ ID NO: 10 or a variant thereof; e) a Rev response element (RRE), preferably having the sequence of SEQ ID NO: 11, or a variant thereof; f) central polypurine sequence
[0094] g) a central termination sequence (cPPT / CTS), preferably having the sequence SEQ ID NO: 12 or a variant thereof; h) a post-transcriptional regulatory element of the woodchuck hepatitis virus (Wpre), preferably having the sequence of SEQ ID NO: 13, or a variant thereof; i) a 3' long terminal repeat region (3'LTR), preferably a self-inactivating (SIN) 3'LTR, preferably having the sequence of SEQ ID NO: 14, or a variant thereof; j) a polyadenylation (polyA) signal, preferably having the sequence SEQ ID NO: 15 or a variant thereof; k) the SV40 origin of replication, preferably having the sequence SEQ ID NO: 16, or a variant thereof, and l) A bacterial high copy origin of replication (f1 ori), preferably having the sequence of SEQ ID NO: 17, or a variant thereof.
[0095] Preferably, the viral vector further comprises a resistance gene, such as a kanamycin and / or neomycin resistance gene.
[0096] Preferably, the backbone of the recombinant lentiviral vector is the sequence of SEQ ID NO: 19, or a variant thereof.
[0097] A "backbone" of a recombinant lentiviral vector refers to the empty transfer vector construct of the lentiviral vector (i.e., minus the gene of interest).
[0098] The expression cassette is cloned between the LTRs of the recombinant lentiviral vector backbone, such that the expression cassette in the viral vector is flanked by the 5'LTR and 3'LTR, with optional additional regulatory elements cloned between the LTRs and the expression cassette.
[0099] Preferably, the viral vector is a self-inactivating (SIN) LV vector.
[0100] Preferably, the viral vector comprises f) a central polypurine tract / central termination sequence (cPPT / CTS), g) post-transcriptional regulatory elements of woodchuck hepatitis virus (Wpre), and i) a polyA signal, more preferably having the sequences set forth above.
[0101] The expression cassette of the viral vector of the present invention preferably comprises a Kozak sequence polynucleotide, preferably a Kozak sequence polynucleotide having the sequence of SEQ ID NO: 18, or a variant thereof, before the transcription start site ATG of the polynucleotide encoding the enzyme of interest.
[0102] Preferably, lentiviral vectors and expression cassettes (vector transgenes) according to preferred embodiments of the present invention comprise components arranged as depicted in the maps shown in Figures 1A, 7A, 35A and 1B, 7B, 35B, respectively.
[0103] The viral vectors of the present invention can be produced in cells according to techniques known in the art.
[0104] For example, lentiviral vectors can be produced by transiently transfecting HEK293T cells with a packaging plasmid (e.g., pMDLg / pRRE), a Rev expression plasmid (e.g., pCMV-Rev), and a VSV-G envelope-encoding plasmid (e.g., pMD2.VSV-G plasmid), combined with an appropriate transfer vector plasmid carrying the expression cassette of interest, as described in Dull et al., 1998 or Follenzi et al., 2000.
[0105] Preferably, the expression cassette of the lentiviral vector comprises a ubiquitous promoter.
[0106] Preferably, the promoter of the expression cassette of the lentiviral vector is selected from the group consisting of: a) an isolated human PGK promoter, preferably the sequence of SEQ ID NO: 3, or a variant thereof; b) an isolated eukaryotic translation elongation factor 1A (EIF1A) promoter, preferably the sequence of SEQ ID NO: 6, or a variant thereof; c) an isolated CMV enhancer-containing promoter, preferably the sequence of SEQ ID NO: 7, or a variant thereof; d) a CAG promoter, preferably the sequence of SEQ ID NO: 8, or a variant thereof; e) The native promoter of the gene of interest.
[0107] More preferably, the promoter is an isolated human PGK promoter, preferably the sequence of SEQ ID NO: 3, or a variant thereof.
[0108] The viral vectors of the present invention can be safely introduced into cells to express the enzyme of interest in an amount and / or enzymatic activity suitable to correct the enzymatic deficiency underlying the disease.
[0109] In a first aspect of the present invention, the enzyme of interest is α-D-mannosidase (MAN2B) and the viral vector comprises a polynucleotide encoding the MAN2B enzyme.
[0110] As used herein, the term "polynucleotide encoding the MAN2B (or α-D-mannosidase) enzyme" refers to a polynucleotide that encodes an enzyme with α-mannosidase activity that is capable of degrading a natural substrate of the α-D-mannosidase enzyme that is deficient in α-mannosidosis.
[0111] Preferably, the polynucleotide encoding the MAN2B enzyme comprises a cDNA comprising the sequence of nucleotides 42 to 3077 of the human MAN2B1 gene (GenBank Reference #NM_000528.4), which corresponds to the coding sequence (CDS) encoding the Homo sapiens MAN2B enzyme. The MAN2B enzyme encoded by this sequence comprises 1011 amino acids.
[0112] Preferably, the polynucleotide encoding the MAN2B enzyme has a codon-optimized (OPT) sequence to improve expression in cells, preferably HSPCs.
[0113] Preferably, the expression cassette of the lentiviral vector comprises a polynucleotide encoding the MAN2B enzyme having the sequence of SEQ ID NO: 21, 22, or a variant thereof.
[0114] More preferably, the expression cassette has the sequence of SEQ ID NO: 24, 25, or a variant thereof.
[0115] The expression cassette is preferably cloned into a lentiviral transfer vector having the sequence of SEQ ID NO: 19, and the resulting transfer vector has the sequence of SEQ ID NO: 31, 32, or a variant thereof.
[0116] Therefore, the transfer vector according to the invention preferably has the sequence of SEQ ID NO: 31, 32 or a variant thereof.
[0117] In a second embodiment of the invention, the enzyme of interest is β-galactosidase (GLB1) and the viral vector comprises a polynucleotide encoding the GLB1 enzyme.
[0118] As used herein, the term "polynucleotide encoding the GLB1 (or β-galactosidase) enzyme" refers to a polynucleotide that encodes an enzyme having β-galactosidase activity that is capable of degrading the natural substrate of the β-galactosidase enzyme that is deficient in mucopolysaccharidosis type IVB and GM1 gangliosidosis.
[0119] Preferably, the polynucleotide encoding the GLB1 enzyme comprises a cDNA comprising the sequence of nucleotides 62 to 2095 of the human GLB1 gene (GenBank Reference #NM_000404.4), which corresponds to the coding sequence (CDS) encoding the Homo sapiens GLB1 enzyme. The GLB1 enzyme encoded by this sequence comprises 677 amino acids.
[0120] Alternatively, the polynucleotide encoding the GLB1 enzyme preferably comprises a cDNA comprising the sequence of nucleotides 115 to 2058 of the mouse Glb1 gene (GenBank reference #NM_009752.2), which corresponds to the coding sequence (CDS) encoding the GLB1 enzyme from the house mouse (mus musculus). The GLB1 enzyme encoded by said sequence comprises 647 amino acids.
[0121] Preferably, the polynucleotide encoding the human GLB1 enzyme has a codon-optimized (OPT) sequence that improves its expression in cells, preferably HSPCs. Preferably, the polynucleotide in the viral vector of the present invention encodes the mouse GLB1 enzyme, more preferably the wild-type mouse GLB1 enzyme or its C2C12 isoform (see Figure 14).
[0122] Preferably, the expression cassette of the lentiviral vector comprises a polynucleotide encoding the GLB1 enzyme having the sequence of SEQ ID NO: 1, 2, 41, 20, or a variant thereof.
[0123] Optionally, the polynucleotide encoding the GLB1 enzyme further comprises a sequence immediately upstream of the eukaryotic translation initiation factor 4A (eIF4A) sequence number 26, more preferably a Kozak sequence (sequence number 18), which favors translation initiation and improves protein expression of the GLB1 enzyme.
[0124] More preferably, the expression cassette has a sequence comprising or consisting of SEQ ID NO: 4, 5, 23, 27, or a variant thereof. Said expression cassette is preferably cloned into a lentiviral transfer vector having the sequence of SEQ ID NO: 19, and the resulting transfer vector has the sequence of SEQ ID NO: 28, 29, 30, 33, or a variant thereof. Thus, the transfer vector according to the invention preferably has the sequence of SEQ ID NO: 28, 29, 30, 33, or a variant thereof.
[0125] In a third aspect of the present invention, the enzyme of interest is preferably a GALNS enzyme, and the polynucleotide is a polynucleotide encoding the GALNS enzyme, more preferably comprising the cDNA sequence of nucleotides 71 to 1639 of the GALNS gene (GenBank reference #NM_000512.5), which corresponds to the coding sequence (CDS) encoding the GALNS enzyme. The GALNS enzyme encoded by said sequence comprises 522 amino acids.
[0126] As used herein, the term "polynucleotide encoding a GALNS enzyme" refers to a polynucleotide that encodes an enzyme having GALNS enzyme activity that can degrade the natural substrate of the GALNS enzyme that is deficient in the MPSIVA type.
[0127] Preferably, the polynucleotide encoding the GALNS enzyme has a codon-optimized sequence for expression in cells, preferably HSPCs.
[0128] Preferably, the expression cassette of the lentiviral vector comprises a polynucleotide encoding the human GALNS enzyme having the sequence of SEQ ID NO: 35 or 36, or a variant thereof.
[0129] More preferably, the expression cassette has the sequence of SEQ ID NO: 37 or 38, or a variant thereof.
[0130] The expression cassette is preferably cloned into a lentiviral transfer vector having the sequence of SEQ ID NO: 19. More preferably, the resulting transfer vector has the sequence of SEQ ID NO: 39 or 40, or a variant thereof. Thus, the transfer vector according to the invention preferably has the sequence of SEQ ID NO: 39 or 40, or a variant thereof.
[0131] The present invention is further directed to genetically modified cells comprising the LV vectors of the present invention, preferably cells transfected with the LV vectors of the present invention, whereby an expression cassette for expressing a gene of interest has been integrated into its genome.
[0132] The cells are preferably stem cells, more preferably HSPCs, and most preferably CD34 + It is HSPC.
[0133] CD34 is a transmembrane phosphoglycoprotein membrane protein encoded by the CD34 gene in humans, mice, rats, and other species. + is used clinically to refer to hematopoietic stem cells that express the CD34 protein.
[0134] In a further preferred embodiment, the cells are T cells, preferably CD4 + T cells.
[0135] In a preferred embodiment of the invention, the cells are autologous cells isolated from a subject suffering from a lysosomal storage disease and therefore in need of receiving the ex vivo gene therapy of the invention.
[0136] The present invention further relates to the use of the viral vector or the genetically modified cell in a method for treating LSD, preferably LSD associated with skeletal pathology, more preferably α-MANN, MPSIVA, MPSIVB, or GM1 gangliosidosis, wherein the viral vector is a viral vector for expressing the MAN2B, GALNS, or GLB1 enzyme, respectively.
[0137] The present invention is further directed to the formulation of a medical product comprising hematopoietic stem and progenitor cells (HSPCs) genetically modified with the viral vectors of the present invention to express an enzyme of interest, preferably resuspended in a freezing medium for further administration.
[0138] The present invention is also directed to the use of the formulation in a method for treating LSDs associated with skeletal lesions, more preferably in a method for treating α-MANN, MPSIVA, MPSIVB, or GM1 gangliosidosis, the treatment method preferably including a chemotherapy-based conditioning regimen prior to administration of the formulation to a subject in need thereof.
[0139] The preparation of the present invention is preferably obtained by a production method comprising the following steps: 1) CD34 + 1) providing hematopoietic stem and progenitor cells (HSPCs) isolated based on their expression, and 2) transducing the isolated cells with a viral vector of the present invention to obtain genetically modified cells of the present invention. The transduction method involves transducing autologous CD34 in the presence of a human cytokine mixture (preferably IL-3, TPO, SCF, and FLT3-1). + The method further comprises stimulating the cells, more preferably for about 22 hours, followed by the addition of viral particles, preferably for about 14 hours. + The cells are preferably resuspended in freezing medium and frozen.
[0140] The term "autologous cells" refers to the recipient of the modified cells, meaning that the cells are obtained from a patient, genetically modified in vitro, and then reinfused into the patient, the recipient of those same cells. Cells can be obtained and isolated from the patient themselves (autologous) by leukapheresis (after mobilization with mobilizing agents, e.g., G-CSF and Plerixafor) or bone marrow harvest (for patients unsuitable for mobilization / leukapheresis). Purification steps usually involve the identification of specific markers, e.g., CD34 + This includes the use of techniques to separate cell populations expressing cells, including magnetic bead-based separation techniques (e.g., closed-circuit magnetic bead-based separation, immunomagnetic beads), flow cytometry, fluorescence-activated cell sorting (FACS), affinity tag purification (e.g., the use of affinity columns or beads, such as biotin columns to separate avidin-labeled agents), and microscopy-based techniques.
[0141] Clinical-grade separation can be performed, for example, using the CliniMACS™ system (Miltenyi), which is a closed-circuit magnetic bead-based separation technology.
[0142] Separation can also be performed using a combination of different techniques, such as a magnetic bead-based separation step followed by flow cytometry to sort the resulting cell population for one or more additional (positive or negative) markers.
[0143] Preferably, in the treatment method of the present invention, the preparation of the present invention is administered in an amount of 4 to 35 × 10 per kg of body weight. 6 cells, preferably 14-30 x 10 6 and administering to a patient in need thereof a dose providing 100,000 cells, said cells preferably containing CD34 + The cells are HSPCs, and the median number of vector copies per genome is 1 to 6, preferably 1.5 to 5, and more preferably 2 to 4.
[0144] The present invention is also directed to a process for producing the genetically modified cells of the present invention described above.
[0145] According to a preferred embodiment, the cells are autologous CD34 + The cytokine stimulation step for the isolated cells was performed on day 0 by culturing CD34 cells in a cell culture bag (e.g., a RetroNectin™-coated bag) using a serum-free medium (e.g., CellGro (Cell Genix) medium). + This involves seeding the cells and stimulating the cells with cytokines for an appropriate period of time, preferably 22±2 hours.
[0146] According to this preferred embodiment, on day 1, CD34 + The cells are transduced by exposure to LV supernatant, preferably overnight, more preferably for 14±1 hours, in the same culture medium (single transduction protocol). Optionally, the cells are transduced using a double transduction protocol. According to a preferred embodiment of the manufacturing process of the present invention, CD34 + Cells, such as cells, are transfected at a multiplicity of infection (MOI) of 1 to 100, more preferably 10 to 100, and most preferably 10 to 40. An MOI of about 30 is particularly preferred.
[0147] Immediately after the transfection process, without any holding time, genetically modified CD34 + The cells are collected and washed, preferably at a concentration of 2.5 to 10 × 10 6 The cells are resuspended in a minimum amount of freezing medium (for example, 20 ml) at a concentration of 1000 cells / ml and stored frozen in a cryobag under liquid nitrogen vapor.
[0148] Preferably, a viral transduction enhancer is added to the cell culture prior to transduction according to optimized protocols, for example as described in WO2013049615, WO2018193118, WO2013127964 and Delville et al.
[0149] Suitable delivery enhancers include prostaglandin E2 (PGE2), protamine sulfate (PS), Vectofusin-1, ViraDuctin, RetroNectin, staurosporine (Stauro), 7-hydroxy-stauro, human serum albumin, polyvinyl alcohol, cyclosporine H (CsH), cyclosporine A (CsA), poloxamine, and poloxamer.
[0150] Preferably, the viral transduction promoter added to the cell culture before transduction is PGE2, CsH, poloxamer, or a mixture thereof.
[0151] Transduction-enhancing agents increase the proportion of transduced cells and / or increase the vector copy number (VCN) per cell.
[0152] Genetically modified frozen CD34 cells before infusion into subjects in need of it. + The suspension of HSPCs is thawed under controlled conditions in a clinical setting.
[0153] In some embodiments, the preparations comprising the modified cells of the present invention are substantially purified and free of other cells, hi some embodiments, the preparations further comprise one or more pharmaceutically acceptable excipients.
[0154] Surprisingly, HSPCs transduced with the lentiviral vectors of the present invention are able to restore the physiological function of enzymes deficient in disease in a variety of tissues, most surprisingly in bone and the central nervous system, without significant toxicity, even when the enzymes are not expressed or released at supraphysiological levels.
[0155] Nevertheless, the ability of viral vectors to produce high levels of expression of an enzyme of interest allows for reduced viral load, thereby offering safety and cost advantages.
[0156] Furthermore, conditioned supernatant from transduced cells containing the enzyme can cross-correct non-hematopoietic patient-derived cells obtained from subjects with lysosomal storage diseases, particularly resident skeletal cells such as mesenchymal stromal cells, osteoblasts, and chondroblasts.
[0157] Next, the present invention is also directed to a method of ex vivo gene therapy for treating lysosomal storage diseases, particularly LSDs associated with skeletal lesions, comprising the step of administering a therapeutically effective amount of a viral vector or modified cell or formulation of the present invention to a subject in need thereof.
[0158] The inventors have also developed an in vitro cross-correction model using both relevant patient-derived fibroblasts and skeletal-derived cells (MSCs and osteoblasts), which were derived from mobilized peripheral blood (mPB) CD34 cells transduced with the lentiviral vector of the present invention. + was exposed to the supernatant from
[0159] The model includes fibroblasts, mesenchymal stromal cells (MSCs), and / or osteoblasts derived from differentiated MSCs isolated from patients with LSDs associated with skeletal pathology. Conditioned medium collected from genetically modified HSPCs was used to condition the patient's cells. Conditioned medium from untransfected cells served as a control. The patient's cells were exposed to the medium for an appropriate period of time. Protein extracts were obtained from the conditioned cells and analyzed for the expression and activity of enzymes of interest.
[0160] This model is particularly useful for predicting the efficacy of ex vivo gene therapy using genetically modified cells that express and release an enzyme of interest into the culture medium, such as the genetically modified cells of the present invention.
[0161] The present invention is then also directed to kits and methods for predicting the efficacy of ex vivo gene therapy for treating disease based on the in vitro cross-correction model described herein.
[0162] It is to be understood that all possible combinations of preferred aspects of the invention are also described and, therefore, are likewise preferred.
[0163] Examples of preferred embodiments of the present invention and an analysis of their effectiveness are provided below, by way of example and not by way of limitation. [Example]
[0164] Materials and Methods
[0165] LV preparation and titration
[0166] Third-generation lentiviral vector (LV) stocks were prepared, concentrated, and titered as previously described (Dull et al., 1998; Follenzi et al., 2000). Briefly, self-inactivating (SIN) LV vectors were generated by transiently transfecting HEK293T cells with a packaging plasmid (pMDLg / pRRE), Rev expression (pCMV-Rev), and a VSV-G envelope-encoding (pMD2.VSV-G) plasmid in combination with the appropriate transfer vector. Vector titers were determined by droplet digital PCR on genomic DNA from HEK293T cells transfected with serial dilutions of the viral preparation. Viral p24 concentrations were measured by ELISA.
[0167] Mobilized peripheral blood (mPB) CD34 + In vitro transfection of cells
[0168] Granulocyte Colony Stimulating Factor (G-CSF)-mobilizes peripheral blood CD34 +Cells were cultured in retronectin-coated, non-tissue culture-treated wells (T100A Takara) in CellGro medium (Cell Genix) supplemented with the following cytokines: 60 ng / ml interleukin-3 (IL-3), 100 ng / ml thrombopoietin (TPO), 300 ng / ml stem cell factor (SCF), and 300 ng / ml FLT3-L (all from Cell Peprotech). After 22 h of pre-stimulation, cells were transduced with a single addition of the appropriate lentiviral vector at a specific multiplicity of infection (MOI) in the presence of 8 μM cyclosporine H (CsH) (Merck) as a transduction enhancer for 16 h in the same cytokine-containing medium. After transduction, cells were harvested, washed, and plated for colony-forming cell (CFC) assays and myeloid liquid culture.
[0169] Myeloid liquid-cultured human transduced and non-transduced HSPCs were cultured in Iscove's modified Dulbecco's medium (IMDM) containing 10% fetal bovine serum (Cambrex, East Rutherford, NJ, USA), 300 ng / ml SCF, 60 ng / ml interleukin-6 (IL-6), and 60 ng / ml IL-3 (all from Preprotech). After 15 days of culture, cells were harvested, and the supernatants and cell pellets were subjected to VCN analysis, Western blot (WB), qPCR, and enzyme activity assays.
[0170] Colony-forming cell assays were performed by seeding 1,000 human transduced and non-transduced HSPCs in methylcellulose-based medium (Methocult GF4434; Stem Cell Technologies). After 15 days, colonies were assessed by light microscopy for colony number and morphology as erythroid, myeloid, and erythroid / myeloid lineages. Furthermore, they were harvested as pools and single colonies, lysed, and subjected to molecular analysis. Transduction efficiency was assessed by VCN analysis performed by droplet digital PCR on individual colonies.
[0171] Determination of vector copy number (VCN) by droplet digital PCR. Genomic DNA was extracted using the QIAamp DNA Blood Mini or Micro Kit (QIAGEN) according to the manufacturer's instructions. Droplet digital PCR (ddPCR) technology was used to assess the number of lentiviral vector copies integrated per genome. Briefly, the ddPCR assay is based on a primer / probe set designed to detect a DNA sequence in the common packaging signal region of lentiviruses (human immunodeficiency virus, HIV-like). To standardize the exact amount of template used in each reaction, an endogenous control assay was established using a DNA sequence specific to a region of the human GAPDH gene (GAPDH-like). The concentrations of the target and reference molecules were calculated by endpoint measurement. This allows nucleic acid quantification without the need for a standard curve or relying on reaction efficiency. VCN is determined by calculating the ratio between the target and reference molecule concentrations and multiplying it by the copy number of the reference species in the genome. All reactions were performed according to the manufacturer's instructions and analyzed using a QX200 ddPCR system (Bio-Rad).
[0172] RNA extraction, qPCR and gene expression analysis
[0173] RNA extraction from cells was performed using the RNeasy micro Kit (Qiagen) or PureLink RNA mini Kit (Thermofisher) according to the manufacturer's instructions. 1 μg of RNA was reverse transcribed (RT) using the High-Capacity cDNA Reverse Transcription kit (ThermoFisher Scientific). SYBR Green-based quantitative PCR was performed using the QuantiFast SYBR Green PCR Kit (Qiagen, 1039712) with 10 ng of cDNA as starting material on a Viia7 real-time PCR system (Thermofisher) using the ACTB gene as the housekeeping gene.
[0174] The following primers were used: GALNS WT:FOR:GCTCATGGACGACATGGGAT; REV:AGTTTGGGAAAAGCAGCCCT; GALNS OPT:FOR:ATTACCAGCGTGGTTCAGCAS; REV:CCAGTTCATAACCGCCCAGT; MAN2B WT:FOR:GTAAATGCGCAGCAGGCAAA, REV:CTCCCAGAGGTAACAAGCGG; MAN2B OPT:FOR:GCTGGAGATGGAGCAAGTGT, REV:TATAGCGTTAGGCAGCACG; human GLB1 WT:FOR:GGCCAGGACAGTACCAGTTT, REV:TTCTCTAGCAGCCAAGCAGG; human GLB1 OPT:FOR:TTTCGCGCTGCGTAACATC, REV:ACCTGAATGAAGGTCAGCGG; murine GLB1 FOR:GGTAAACCCCATTCCACGGT, REV:GTGGGGCGTCGTAGTCATAG.
[0175] The following primers were used to amplify the ACTB housekeeping gene: ACTB:FOR:ACAGAGCCTCGCCTTTGCC; REV:GATATCATCATCCATGGTGAGCTGG.
[0176] To determine gene expression, the difference (ΔCt) between the threshold cycle (Ct) of each gene and the Ct of the reference gene was calculated by applying an equal threshold. Relative quantification values were calculated as the fold change in expression of the gene of interest relative to its expression in the reference sample (UT) by the formula 2^-ΔΔCt.
[0177] Humanized mouse model for in vivo studies. Mouse studies were performed according to protocols approved by the San Raffaele Scientific Institute and its Animal Care Committee, in accordance with the Italian Ministry of Health guidelines for the use and care of laboratory animals. Every effort was made to minimize the number of mice and their pain or distress during and after the experimental procedures. scid Il2rg tm1Wjl / SzJ(NSG, Stock #005557), NOD.Cg-Kit W-41J Tyr + Prkdc scid Il2rg tm1Wjl / ThomJ (NBSGW, stock #026622) and NOD.Cg-Kit W-41J Prkdc scid Il2rg tm1Wjl / WaskJ (NSGW41) mice were purchased from The Jackson Laboratory. Mice were maintained under specific pathogen-free conditions.
[0178] Human mobilized peripheral blood CD34 in NBSGW mice + Cell transplantation
[0179] Human mPB-CD34 was expressed in the presence of CsH as described herein. + The cells were pre-stimulated and transfected with LV-MAN2B WT at an MOI of 30. Untransfected cells (MOCK) were used as a control. After transfection, 3x10 5 MAN2B gene therapy cells were injected into the tail vein of 8-10 week-old NBSGW mice. Human cell engraftment and hematopoietic reconstitution were monitored by flow cytometry analysis of peripheral blood (PB) at 7 and 12 weeks post-transplant. At 12 weeks, mice were euthanized, and hematopoietic organs (bone marrow and spleen) were also analyzed for human cell engraftment, MAN2B enzyme activity, and viral integration (VCN).
[0180] Human mobilized peripheral blood CD34 in NSG mice + Cell transplantation
[0181] Human mPB-CD34 was expressed in the presence of CsH as described herein.+ The cells were pre-stimulated and transduced with LV for gene therapy at an MOI of 30. Untransduced cells were used as a control. After transduction, 4.3x10 cells were used for GLB1 gene therapy. 5 cells, or 5x10 for GALNS gene therapy 5 Cells were injected into the tail vein of 8-10 week-old NSG mice that had been sublethally irradiated (2 Gy). Human cell engraftment and hematopoietic reconstitution were monitored by flow cytometry analysis of peripheral blood (PB) at 7 and 12 weeks after transplantation. At the end of the experiment (12 weeks), mice were euthanized, and hematopoietic organs (bone marrow, spleen) were also analyzed for human cell engraftment, viral integration (VCN), and enzyme activity.
[0182] Transplantation of human HSPCs into NSGW41 mice
[0183] Human HSPC cells were cultured and transfected with LV-human GLB1 WT, LV-mouse GLB1 WT, and LV-mouse GLB1 C2C12 at an MOI of 30 in the presence of CsH (8 mM). After transfection, 1.95 x 10 5 Cells were injected into the tail vein of 6- to 8-week-old NSGW41 mice. Mice transplanted with untransfected cells and untreated mice served as controls. Human cell engraftment was monitored by flow cytometry analysis of peripheral blood (PB) samples at 8 and 16 weeks posttransplant, as well as bone marrow (BM) and spleen samples at the end of the experiment (week 16). BM cells were also analyzed for vector integration (VCN) and GLB1 enzyme activity.
[0184] Assessment of human engraftment and immune reconstitution in xenotransplanted mice
[0185] For GLB1 studies in NSGW41 mice, PB, BM, and spleen samples were collected from transplanted mice and analyzed using a multiplex flow cytometry assay. Briefly, after RBC lysis with ACK (STEMCELL Technologies #07850), BM cells were stained with fluorescently labeled antibodies against human CD45 APC, CD19 PE-Cy7, CD56 BV510, CD90 PE-Cy5, CD38 APC-Cy7 (Biolegend), CD3 PE, CD34 FITC (BD Biosciences), and CD33 VioBlue (Miltenyi Biotec). PB cells were subjected to the same preparation process and stained with fluorescently labeled antibodies against human CD45 APC, CD19 PE-Cy7, CD56 BV510, CD13 PerCP-Cy5.5 (Biolegend), CD3 PE, CD34 FITC (BD Biosciences), and CD33 VioBlue (Miltenyi Biotec). Absolute cell quantification was performed by adding precision counting beads (Biolegend #424902) to the samples. All stained samples were acquired using a BD FACSCanto II (BD Bioscience) cytofluorimeter after calibration with Rainbow beads (Spherotech #RCP-30-5A). Raw data were collected using DIVA software (BD Biosciences). Data were then analyzed using FlowJo software version 10.9 (BD Biosciences) and graphical output was generated automatically using Prism 10.0.0 (GraphPad software).
[0186] For the MAN2B1 study in NBSGW mice and the GALNS study in irradiated NSG mice, peripheral blood and bone marrow samples from transplanted mice were analyzed using a newly developed multiparameter flow cytometry assay (Whole Blood Dissection) (Basso-Ricci et al., 2017). Briefly, after red blood cell (RBC) lysis with ACK (STEMCELL Technologies #07850), cells were incubated with mouse FcR blocking reagent (BD #6148596, dilution 1:100) before staining with fluorescently labeled antibodies against human CD3, CD56, CD14, CD41 / 61, CD135, CD34, and CD45RA (Biolegend) and CD33, CD66b, CD38, CD45, CD90, CD10, CD11c, CD19, CD7, and CD71 (BD Biosciences).
[0187] A titration assay was performed to assess the optimal antibody concentration. After surface marking, cells were incubated with PI (Biolegend #421301) to stain for dead cells. Absolute cell quantification was performed by adding precision counting beads (Biolegend #424902) to bone marrow (BM) or peripheral blood (PB) samples before the WBD procedure. All stained samples were acquired using a BD Symphony A5 (BD Bioscience) cytofluorimeter after calibration with Rainbow beads (Spherotech #RCP-30-5A). Raw data were collected using DIVA software (BD Biosciences). Data were then analyzed using FlowJo software version 10.5.3 (BD Biosciences), and graphical output was automatically generated using Prism 9.0.0 (GraphPad software). Technically validated results were always included in the analysis, and no outlier exclusion criteria were applied.
[0188] GLB1 enzyme activity
[0189] The cell pellet was resuspended in 50–150 μl of HO and sonicated for 25 seconds using a Sonoreaktor UTR200 (Hielscher) to obtain protein extracts for GLB1 enzyme activity. Protein concentrations were measured using a BCA Protein Assay kit (Biorad) with BSA standards (Biorad). 0.1–5 μg of protein extract diluted in 10 μl of 0.2% BSA was incubated with 20 μl of (0.1 M) 4-methylumbelliferyl-β-D-galactopyranoside (4MU-β-gal) for 1 hour at 37°C. Enzyme activity in cell culture media was measured using 2 x 10 cells from the myeloid progeny of human HSPCs for 24 hours. 6 / ml, and 0.5x10 6 / ml, and human CD4 + 1x10 T cells 6 Although the cells were seeded at a concentration of 1 / ml, 10 μl of conditioned medium was used. At the end of the reaction, 200 μl of stop buffer 2 (0.5 M carbonate, pH 10.7, Triton X-100) was added to each sample, and enzyme activity was measured as fluorescence (450 / 10). The level of enzyme activity was calculated using fluorescence based on known amounts of 4-methylumbelliferone (4-MU) standards (nmol) and the amount of protein (mg).
[0190] GLB1 enzyme activity in bone marrow cells from xenografted mice
[0191] BM cell pellet (2x10 6) were resuspended in 50 μl of HO and sonicated for 25 seconds using a Sonoreaktor UTR200 (Hielscher) to obtain protein extracts for GLB1 enzyme activity. Protein concentrations of BM samples were measured using a Bradford protein assay kit (Biorad) with BSA standards (Thermo Scientific). 0.3 μg of protein extract diluted in 10 μl of 0.2% BSA was incubated with 20 μl of 0.1 M 4-methylumbelliferyl-β-D-galactopyranoside (4MU-β-gal) for 1 h at 37°C. Plasma samples (10 μl) were directly incubated with 20 μl of 0.1 M 4-methylumbelliferyl-β-D-galactopyranoside (4MU-β-gal) for 1 h at 37°C. At the end of the reaction, 200 μl of stop buffer (0.5 M carbonate, pH 10.7, Triton X-100) was added to each sample, and enzyme activity was measured as fluorescence (450 / 10) (FLUOstar Omega). The level of enzyme activity was calculated using fluorescence based on known amounts of 4-methylumbelliferone (4-MU) standards (nmol) and the amount of protein (mg).
[0192] α-mannosidase or GALNS enzyme activity
[0193] The cell pellet was resuspended in 50–150 μl of HO and sonicated for 25 s using a Sonoreaktor UTR200 (Hielscher) to obtain protein extracts for α-mannosidase or GALNS enzyme activity. Protein concentrations were measured using a BCA Protein Assay kit (Biorad) with BSA standards (Biorad). 0.1–1 μg of protein extract diluted in 10 μl of 0.2% BSA was incubated with 20 μl of 4 mM 4-methylumbelliferyl-α-D-mannopyranoside (4MU-α-mann) for 1 h at 37°C, or 0.1–5 μg of protein extract diluted in 10 μl of 0.2% BSA was incubated with 20 μl of (10 mM) 4-methylumbelliferyl-β-D-galactoside-6-sulfate (4MU-Gal-6S) for 17 h at 37°C. α-Mannosidase enzyme activity in cell culture medium was measured using 2 x 10 6 Ten microliters of conditioned medium from myeloid progeny of human HSPCs seeded at a concentration of 10 μL / ml was used. For GALNS enzyme activity, 5 μL of stop buffer 1 (0.9 M sodium phosphate, pH 4.3) was added, followed by 10 μL of β-galactosidase (10 U / ml) to each sample and incubation at 37°C for 2 hours. At the end of the reaction, 200 μL of stop buffer (0.5 M carbonate, pH 10.7, Triton X-100) was added to each sample, and enzyme activity was measured as fluorescence emission (450 / 10). The level of enzyme activity was calculated using fluorescence emission based on known amounts of 4-methylumbelliferone (4-MU) standards (nmol) and the amount of protein (mg). To measure GALNS enzyme activity in the cell culture medium, 2 x 10 μL of β-galactosidase was added to each sample and incubated at 37°C for 24 hours. 6 Myeloid progeny of human HSPCs were seeded at a concentration of 0.5x10 / ml for 17 hours at 37°C. 6Ten μl of conditioned medium from human osteoclasts seeded at a concentration of 1 / ml was incubated with 20 μl of 4-methylumbelliferyl-β-D-galactopyranoside-6-sulfate (4MU-Gal-6S) for 17 hours at 37°C. After 17 hours of incubation, the reaction was stopped by adding Stop Buffer 1 (0.9 M sodium phosphate, pH 4.3). 10 μL of β-Gal working solution (10 U / mL) was added, and the samples were incubated for 2 hours at 37°C. At the end of the second reaction, 200 μl of Stop Buffer 2 (0.5 M carbonate, pH 10.7, Triton X-100) was added to each sample, and enzyme activity was measured as fluorescence emission (450 / 10). The level of enzyme activity was calculated using fluorescence emission based on known amounts of 4-methylumbelliferone (4-MU) standards (nmol) and the amount of protein (mg).
[0194] ELISA for measuring keratan sulfate
[0195] Keratan sulfate accumulation in HS5 cells was measured using a mouse keratan sulfate (KS) ELISA kit provided by Assay Genie (MOEB2495). Cells were harvested after exposure to conditioned medium from untransfected and transfected cells (LV-human GLB1, LV-mouse GLB1 WT, and LV-mouse GLB1 C2C12) and sonicated for 25 seconds using an ADV-00654PTEP Sonoreaktor UTR200 (Hielscher). Protein extracts were quantified using Bradford reagent and a BSA standard curve. 10 ml of protein extract was diluted in 40 ml of sample diluent. 50 μL of diluted sample, blank (sample diluent only), and standard were added in duplicate to a flat-bottom, precoated 96-well micro ELISA plate. 50 μL of detection reagent A working solution was immediately added to each well and incubated at 37°C for 1 hour. After incubation, the wells were washed three times with 200 μL of 1X wash buffer, and 100 μL of detection buffer B working solution was added to each well. After 45 minutes of incubation at 37°C, the plate was washed five times with 200 μL of 1X wash buffer. 90 μL of substrate solution was added directly to each well and incubated at 37°C for 10–15 minutes. The reaction was stopped by adding 50 μL of stop solution to each well. The plate was then loaded into a Multiskan and light emission was measured at 450 nm. Optical density (OD) values were obtained for each well. OD results were then averaged and adjusted for the OD value of the blank sample, and the KS concentration was obtained from the standard curve equation. Results were normalized by the concentration of the protein extract.
[0196] Generation of HS5 GLB1 KO and control osteoblasts
[0197] HS5 stromal cells were purchased from ATCC (ATCC CRL11882) and culture-expanded in IMDM 10% FBS. The lentiCRISPR v2 plasmid was purchased from Addgene (52961). A GLB1-specific guide RNA was cloned into this plasmid to knock out GLB1 expression. A scrambled guide RNA sequence (Ctrl) was also cloned to generate LV (LV GLB1 CRISPR and LV-CTRL CRISPR). HS5 cells were transfected with LV GLB1 CRISPR and LV-CTRL CRISPR at an MOI of 30 and selected in vitro with puromycin (2 mg / ml). Selected cells were induced to differentiate into osteoblasts for 10 days using StemMACS OsteoDiff medium (130-091-678). Osteogenic differentiation was assessed by Alizarin Red (Sigma-Aldrich) staining of calcium deposits according to the manufacturer's instructions.
[0198] Western blot analysis. Western blots were performed on protein extracts from cells lysed in commercial RIPA buffer (ThermoFisher Scientific) supplemented with a protease inhibitor cocktail (ThermoFisher Scientific) for 20 min at 4°C. Samples were centrifuged at 10,000 rpm for 15 min at 4°C. Protein lysates were collected, and protein concentrations were measured using a BCA Protein Assay kit (Biorad) using BSA standards (Biorad). 20 μg of protein lysate was dissolved in 4x Loading Buffer (CAT) supplemented with β-mercaptoethanol (Sigma) diluted 1:10. For Western blot analysis of conditioned media, cells were incubated at 1x10 for 24 h in the absence of FBS. 6Cells were seeded at a density of 1000 / ml. The conditioned medium was collected and centrifuged at 2000 rpm for 5 minutes at room temperature to remove cell debris. Four volumes of ice-cold acetone were added to the conditioned medium for protein precipitation. Proteins were precipitated by centrifugation at 4000 rpm for 10 minutes at 4°C. The protein pellet was dissolved in an appropriate volume (1 μl / 25,000 conditioned cells) of 1x Loading Buffer (Biorad) supplemented with 1:10 diluted β-mercaptoethanol.
[0199] Proteins were separated on precast SDS-PAGE gels (Mini-PROTEAN™ TGX™ Gels, Bio-Rad) in commercially available Tris / glycine / SDS electrophoresis buffer (Biorad). Proteins were transferred to 0.2 μM PVDF membranes using the Trans-Blot Turbo Transfer system (Biorad). After blocking for 1 hour in 5% skim milk in TBS-0.1% Tween (Biorad), the membranes were incubated overnight with the appropriate primary antibodies. The following antibodies were used for GALNS Western blots: mouse monoclonal anti-human GALNS (1:1000; Santa Cruz Biotechnology, sc-390713), polyclonal rabbit anti-human calnexin (1:1000; Sigma, C4731), and mouse monoclonal anti-human β-actin (1:50000; Sigma, A3864). After washing five times for 5 minutes with TBS-0.1% Tween, the membranes were incubated with the appropriate HRP-conjugated secondary antibodies (anti-mouse 1:1500, anti-rabbit 1:1500, Dako). For GLB1 Western blots, the following antibodies were used: mouse monoclonal anti-human GLB1 (1:500, R&D Systems, MAB6464) and mouse monoclonal anti-human β-actin (1:50000, Sigma, A3864). After washing five times for 5 minutes with TBS-0.1% Tween, the membranes were incubated with the appropriate HRP-conjugated secondary antibodies (anti-mouse 1:1500, anti-rabbit 1:1500, Dako).
[0200] The following antibodies were used for MAN2B Western blotting: rabbit polyclonal anti-human MAN2B (1:500, AbCam, ab104521) and mouse monoclonal anti-human beta-actin (1:50,000, Sigma, A3864). After washing with TBS-0.1% Tween, the membranes were incubated with the appropriate HRP-conjugated secondary antibody (anti-rabbit 1:2,000, Dako).
[0201] Blots were developed using Immobilon Western (Millipore) and images were acquired using UVITEC (Eppendorf).
[0202] Cross-correction assay
[0203] For cross-validation of cells of non-hematopoietic origin, fibroblasts, mesenchymal stromal cells (MSCs) and / or MSC-derived osteoblasts (OBs) from human healthy donors and LSD patients were used. Fibroblasts were cultured at a density of 25,000 / cm in IMDM supplemented with 15% FBS and 1% PS. 2 MSCs were seeded at a density of 25,000 / cm in DMEM supplemented with 10% FBS and 1% PS. 2 MSCs were seeded at a concentration of 2x10 cells per well of a 6-well plate in osteogenic medium (Miltenyi Biotec) for 10 days and differentiated into OBs. The differentiation medium was replenished every 2-3 days. Fibroblasts were exposed to conditioned medium from untransfected and LV-transfected cells for 24 hours. 6 Conditioned medium from myeloid progeny of human HSPCs seeded at a concentration of 100 / ml was collected after 24 hours of conditioning.
[0204] After exposure to conditioned medium, cell pellets of fibroblasts, MSCs, and MSC-derived OBs were harvested for protein extraction and enzyme activity determination.
[0205] Osteoclast differentiation
[0206] Osteoclasts were derived from untransduced and LV-transduced human mobilized peripheral blood CD34 +Differentiated from myeloid progeny of cells. 5x10 5 Cells were seeded in 200 μl of α-Minimum Essential Medium (αMEM) supplemented with 10% FBS, 1% PS, 1% Glutamine, and the following cytokines: 25 ng / ml human recombinant macrophage colony-stimulating factor (M-CSF) and 50–100 ng / ml human recombinant receptor activator of nuclear factor kappa B ligand (RankL). Half of the medium was replaced twice over 10 days. Osteoclast differentiation was assessed by a tartrate-resistant acid phosphatase (TRAP) assay using a TRAP kit (Sigma-Aldrich) according to the manufacturer's instructions, and by RT-qPCR expression of the MMP9 and TRAP5b genes using the following primers:
[0207] MMP9:FOR:CTTTGAGTCCGGTGGACGAT;REV:TCGCCAGTACTTCCCATCCT;
[0208] TRAP5b:FOR:CCCATAGTGGAAGCGCAGAT;REV:CTGAGTGGGGCTGGGAATTT.
[0209] Human CD4 + T cell isolation and transduction
[0210] Peripheral blood mononuclear cells (PBMCs) were isolated from the buffy coats of healthy donors by density gradient centrifugation using Ficoll-Paque. + T cells, CD4 + Human CD4 was isolated from PBMCs by negative selection using an isolation kit, LS column, and MidiMACS separator (Miltenyi Biotec). +T cells were activated using Dynabeads™ Human T-Activator CD3 / CD28 (Gibco) and cultured at 1 x 10 in X-VIVO™ 15 Serum-free Hematopoietic Cell Medium (Lonza) supplemented with 1% penicillin / streptomycin, 5% human serum, human IL-2 (40 U / ml), and human IL-7 (10 ng / ml). 6 After 24 hours, human CD4 + T cells were transduced with the appropriate lentiviral vector (LV hGLB1 WT, LV mGLB1 WT, and LV eIF4A-hGLB1) at an MOI of 30. Transduced cells were passaged twice weekly for 10 days before collecting samples for further analysis.
[0211] Example 1 – Construction of a lentiviral vector to express the GLB1 gene Human mobilized peripheral blood (mPB) CD34 + Four different GLB1 lentiviral transfer vectors were constructed to overexpress four different GLB1 cDNAs in cells: 1) a lentiviral transfer vector for expressing human GLB1 with the wild-type sequence (expression cassette LV-hGLB1 WT, SEQ ID NO: 4), 2) a lentiviral transfer vector for expressing human GLB1 with the optimized sequence (expression cassette LV-hGLB1 OPT, SEQ ID NO: 5), 3) a lentiviral transfer vector for expressing human GLB1 with the wild-type sequence containing eIF4alpha (expression cassette LV-eIF4A-hGLB1 WT, SEQ ID NO: 27), and 4) a lentiviral transfer vector for expressing mouse GLB1 with the mouse sequence (expression cassette LV-mGLB1, SEQ ID NO: 23).
[0212] FIG. 1A shows a schematic diagram of the vector transgene, and FIG. 1B shows a schematic diagram of the transfer vector construct carrying an expression cassette for expressing the GLB1 enzyme in the transfected cells.
[0213] Example 2 – Generation of a lentiviral vector to express the MAN2B gene To overexpress MAN2B cDNA, two different types of LVs were generated. One contained a transfer vector construct (pCCLsin.cPPT.hPGK.MAN2Bwt.Wpre) carrying an expression cassette containing a polynucleotide encoding wild-type MAN2B (expression cassette LV-MAN2BWT, SEQ ID NO: 24). The other contained a transfer vector construct (pCCLsin.cPPT.hPGK.MAN2Bopt.Wpre) carrying an expression cassette containing a polynucleotide encoding codon-optimized MAN2B (expression cassette LV-MAN2BOPT, SEQ ID NO: 25). Another LV was generated containing a transfer vector construct (pCCLsin.cPPT.hPGK.eGFP.Wpre) carrying an expression cassette for expressing the eGFP reporter gene under the hPGK promoter. Figure 7A shows a schematic diagram of the vector transgene, and Figure 7B shows a schematic diagram of the transfer vector construct carrying the expression cassette for expressing MAN2B in transfected cells.
[0214] Example 3 - Evaluation of toxicity of LV GLB1 wild type (WT) and codon optimized (OPT). mPB CD34 from healthy donors (n=3) + Cells were cultured in retronectin-coated, non-tissue culture-treated wells (T100A Takara) in CellGro medium (Cell Genix) supplemented with the following human cytokines: 60 ng / ml interleukin-3 (IL-3), 100 ng / ml thrombopoietin (TPO), 300 ng / ml stem cell factor (SCF), and 300 ng / ml FLT3-L (all from Cell Peprotech). After 22 hours of pre-stimulation, cells were infected with IFN-γ at a specific multiplicity of infection (MOI) of 100, 30, or 10. Human wild-type and codon-optimized GLB1 were transduced by a single addition of lentiviral vector (LV) for 14 hours in the same cytokine-containing medium in the presence of 8 μM cyclosporine H (CsH) (Merck) as a transduction promoter. After transduction, cells were harvested, washed, and seeded for colony-forming cell (CFC) assays and in vitro expansion as myeloid liquid cultures. Cells from the myeloid liquid cultures were counted twice weekly to determine the proliferative potential of transduced cells compared to untransduced control cells, and a total of 0.5 × 10 cells were cultured. 5 The cells were passaged at a concentration of 1 / ml for 14 days. The cells were efficiently transduced (Figure 2A) without any signs of toxicity in terms of proliferation (Figure 2B) and clonogenicity (Figure 2C).
[0215] Example 4 - LV GLB1 WT and OPT transduced human mPB CD34 + Analysis of GLB1 expression and enzyme activity in GLB1 expression was significantly increased in mPB CD34 cells transfected with LV GLB1 WT and LV GLB1 OPT at different MOIs (Figure 3A). + Protein extracts from myeloid liquid cultures of the cells were assessed by Western blot analysis. GLB1 protein expression was increased in transfected cells compared with untransfected control cells. In transfected cells, the GLB1 lysosomal protein (low molecular weight) was significantly increased compared with the precursor protein (high molecular weight) (Figure 3A). Similarly, GLB1 enzyme activity was higher in transfected cells compared with controls (Figure 3B).
[0216] Example 5 - Human mPB CD34 transduced with LV GLB1 WT + Osteoclasts (OCs) derived from the myeloid progeny of the cells. Bone marrow cells were induced to differentiate into osteoclasts for 10 days in the appropriate differentiation medium supplemented with human RANKL (50 ng / ml) and M-CSF (25 ng / ml). The ability of osteoclasts (OCs) to express and release GLB1 was investigated as an in vitro system that recapitulates a resident source of GLB1 for cross-complementation of skeletal and chondrocytes. The presence of osteoclasts was assessed during differentiation by TRAP assay and qPCR analysis of the expression of osteoclast markers (MMP9, TRAP5b). Both untransduced (UT) and transduced bone marrow liquid culture (LC) cells efficiently differentiated into osteoclasts (Figure 4A) and overexpressed osteoclast genes (Figure 4B) compared with their undifferentiated counterparts. Importantly, GLB1 expression was found to increase during the differentiation process (Figure 4C). LV GLB1-transduced mPB CD34 + Cell-derived osteoclasts express higher levels of human GLB1 than their bone marrow liquid culture (LC) counterparts (Figure 4C). The higher levels of GLB1 gene correlated with increased expression of both lysosomal and precursor proteins in protein extracts from osteoclasts compared to controls (Figure 4D). GLB1 protein was also significantly detected in the cell culture medium of derived osteoclasts, indicating that osteoclasts release GLB1 into the extracellular space. GLB1 enzyme activity levels supported the protein expression data. mPB CD34 + Significantly higher enzyme activity was measured in the cell pellets and medium of derived osteoclasts compared to the control (Fig. 4E).
[0217] Example 6 - Human CD4 transduced with LV GLB1 viral vector + Analysis of GLB1 expression and enzyme activity in T cells. CD4 + T cells were introduced as an additional cell line to recapitulate a systemic source of GLB1 enzyme that could mediate the release of supraphysiological levels of the enzyme into the circulation. + After isolation of T cells, the cells were transduced with different versions of LV GLB1 (human GLB1 WT, human eIF4A-GLB1 WT, and mouse GLB1). Untransduced cells were used as a control. CD4 +T cells were efficiently transduced (Figure 5A). VCN was similar across all conditions. Human and mouse GLB1 expression was assessed by qPCR. The GLB1 gene was specifically induced in transduced T cells compared to control untransduced cells (Figure 5B). GLB1 enzyme activity was significantly increased by CD4 + In all conditions, transduced CD4 + We observed higher enzyme activity in CD4 T cells transduced with the mouse version of LV GLB1 than in untransduced cells. We analyzed the difference in GLB1 enzyme activity after transduction and surprisingly found that GLB1 enzyme activity was significantly higher in both the cell pellet (755-fold higher than untransduced) and the medium (1520-fold higher than untransduced). + It was significantly higher in T cells (Fig. 5C).
[0218] Example 7 - Human mPB CD34 cells transduced with untransduced and LV hGLB1 WT + In vivo transplantation experiments using cells. Healthy donor mPB CD34 transduced with LV hGLB1 at an MOI of 30 + The cells were transplanted into the tail vein of 7-week-old NSG mice that had been sublethally irradiated (200 rad) as a xenograft model to evaluate the hematopoietic reconstitution of the transduced cells and the level of GLB1 enzyme activity by gene therapy (GT group). Similar to hematopoietic stem cell transplantation, which is considered the standard treatment for other forms of LSD, cultured untransduced cells were similarly transplanted into NSG mice, referred to as the mock group. Specifically, 4.3 x 10 5 Cells / mouse were injected, and hematopoietic reconstitution was followed by analyzing the human cell engraftment rate in the peripheral blood (PB) at 7 weeks and in the bone marrow (BM) at 12 weeks after transplantation (Figure 6A). The body weight of treated mice was also monitored over time. Furthermore, 1x10 cells / mouse in both conditions were injected. 5The cells were expanded in vitro as myeloid liquid cultures to determine potential toxic effects on cell growth, transduction efficiency (VCN), and levels of GLB1 expression and enzyme activity. No signs of toxicity were observed in vitro, given that transduced cells proliferated as efficiently as untransduced cells (Figure 6B). LV GLB1-transduced mPB CD34 + A VCN of 1.95 was measured in myeloid cells derived from the cells (Figure 6C). GLB1 expression was assessed in cell pellets and medium by Western blot, and LV GLB1 mPB CD34 + Increased expression of GLB1 was observed in the cell pellets of myeloid cells derived from LV GLB1-transduced mPB CD34. In the cell culture medium, the presence of GLB1 protein was observed only in the conditioned medium from LV GLB1-transduced myeloid cells (Fig. 6D). The GLB1 enzyme activity dose was significantly higher in LV GLB1-transduced mPB CD34 cells. + The enrichment of GLB1 enzyme in the cell pellet and culture medium of myeloid cells derived from the cells was confirmed (Figure 6E). In vivo, although weight loss was observed over time in the GT group compared to mock mice (Figure 6F), all transplanted animals survived until the end of the experiment (12 weeks). The human engraftment rate in the PB of treated mice increased in the BM from 7 weeks to 12 weeks after transplantation (Figure 6G). Human CD45 in the BM of GT mice + Although the percentage of cells was reduced compared to the mock group, significantly higher enzyme activity was measured in all BM cells of GT mice (Figure 6I). This indicates that transduced cells expressed supraphysiological levels of enzymes, consistent with the VCN measured in the genome of BM cells 12 weeks after treatment (Figure 6H). Taken together, these data suggest that transduced mPB CD34 + We show that the cells efficiently engraft in the BM of recipient mice and overexpress GLB1 upon in vivo transplantation, a level of GLB1 expression that appears sufficient to cross-compensate for cells of non-hematopoietic origin. Example 8 - Evaluation of toxicity of LV-MAN2B wild type (WT) and codon optimized (OPT).
[0219] Human mobilized peripheral blood (mPB) CD34+ Cells were transfected with LV-MAN2B WT and LV-MAN2B OPT at different MOIs (100, 30, and 10) (left and right panels of Figure 8A, respectively), expanded as myeloid liquid cultures for 14 days, and their growth curves were evaluated. Untransfected cells (UT) were used as a control to assess potential toxic effects on the cell proliferation of the progeny of transfected cells. Colony formation assays were also performed on human mPBCD34 cells transfected with LV-MAN2B WT and OPT at different MOIs (100, 30, and 10). + This was performed on LV-MAN2B WT and OPT HSPCs (Figure 8B). To assess potential toxic effects on the colony-forming ability of LV-MAN2B WT and OPT HSPCs, untransfected cells (UT) were used as a control. LV-MAN2B WT or OPT did not show significant toxicity in transfected cells.
[0220] Example 9 – LV-MAN2B WT and OPT transduced human mPB CD34 + Analysis of MAN2B expression and enzyme activity in . MAN2B enzyme activity was measured in mPBCD34 cells transfected with LV-MAN2B WT and OPT at different MOIs. + The progeny of LV-MAN2B OPT and WT were tested. At similar integrated vector copy numbers per cell (VCN) (see Figure 9A), LV-MAN2B OPT and WT showed comparable MAN2B enzyme activity. It is also noteworthy that transfection at an MOI of 30 (see Figure 9B) was sufficient to obtain significant expression levels and enzyme activity, allowing the use of low amounts of vector (Figure 9C).
[0221] Example 10 – Human mPB CD34 + Evaluation of toxicity and transduction efficiency of LV-MAN2B WT in cells. Growth curve analysis (FIG. 10A) and colony formation assay (FIG. 10B) were performed on mPB hCD34 cells transfected with LV-MAN2B WT (FIG. 10A, left panel) and LV-CTRL (FIG. 10A, right panel) at an MOI of 30 and expanded as myeloid liquid culture for 14 days. + We performed the following experiments. +VCN measurement of myeloid progeny of cells and human mPB hCD34 transfected with LV-MAN2B WT + The MAN2B enzyme activity in the cell pellet and medium of the myeloid progeny of the cells was also measured (Figures 10C and 10D, respectively). + Cells (UT) were used as a control. The cells were efficiently transduced without any signs of toxicity and expressed and released the MAN2B enzyme at supraphysiological levels.
[0222] Example 11 - Restoration of MAN2B enzyme activity in fibroblasts from patients with α-mannosidosis. In an in vitro cross-correction model, fibroblasts from α-MANN patients (Pt1 and Pt2) were transfected with mobilized peripheral blood (mPB) CD34 cells transfected with LV-MAN2B at an MOI of 30. + The cross-compensation assay was performed on human mPB CD34 cells transfected with LV-MAN2B WT at an MOI of 30. + Cell culture medium conditioned by the myeloid progeny of the cells was collected after 12 hours of conditioning. Cell culture medium conditioned by untransduced cells was used as a control. Fibroblasts from the MAN2B patient were exposed to the conditioned medium for 12-16 hours and collected for Western blot analysis and enzyme activity titration. Untransduced (UT) cells were used as a control. MAN2B enzyme activity was also measured in untreated fibroblasts from both patients and in fibroblasts from one healthy donor (HD) as a control. Enzyme activity was efficiently restored, indicating that LV-MAN2B-transduced mPB CD34 + These results suggest that the IL-16A-mediated IL-16B ...
[0223] Example 12 - Analysis of GLB1 expression and enzyme activity in LV GLB1 WT and OPT-transduced HSPCs. The level of GLB1 expression was also analyzed in the conditioned medium from transduced cells after 14 days of expansion in myeloid liquid culture. Significantly higher intracellular overexpression of GLB1 enzyme was observed compared to untransduced (UT) cells, while the myeloid progeny of transduced HSPCs released lower amounts of the enzyme into the cell culture medium. A two-fold increase in GLB1 enzyme activity was measured in the conditioned medium from the myeloid progeny of transduced cells (Figure 12A, B).
[0224] GLB1 RNA expression levels were cell type-dependent (Figure 13A). The GLB1 enzyme was processed along the ER-Golgi pathway to a lysosomal form (64 kDa) (Figure 12A) and retained in the lysosomal compartment of LV-human GLB1-transduced HSPC-derived myeloid cells. Indeed, the addition of chloroquine (+CL) (100 mM) induced the accumulation of GLB1 precursor and improved GLB1 release (Figure 13B). Similar levels of protein release were observed with LV-human GLB1 eIF4a compared to LV-human GLB1 (Figure 13C).
[0225] Example 13 – Generation of additional lentiviral vectors to express the GLB1 gene Third-generation lentiviral vectors were generated carrying polynucleotides encoding human GLB1 wild-type (LV-human GLB1 WT), mouse GLB1 wild-type (LV-mouse GLB1 WT), or the C2C12 isoform (LV-mouse GLB1 C2C12), which features three amino acid substitutions (R468Q, N517D, and E534G) compared to the WT protein (Figure 14A). The safety, efficacy, and effectiveness of the LV vectors were determined in vitro and in vivo in comparison to LV-human GLB1 WT in Examples 14-18 below.
[0226] Example 14 - Analysis of GLB1 expression and enzyme activity in HSPCs transduced with a lentiviral vector to express the GLB1 gene. In vitro, human HSPCs derived from healthy donors were transduced with LV-murine GLB1 WT, LV-murine GLB1 C2C12, and LV-human GLB1 WT at an MOI of 30 in the presence of cyclosporine H (CsH) (8 mM) as a transduction enhancer, following a single transduction protocol. After transduction, cells were harvested, washed, and seeded for colony-forming cell (CFC) assays and in vitro expansion as myeloid liquid cultures. Human HSPCs were efficiently transduced, as indicated by VCN in liquid culture (Figure 15A), and no signs of toxicity were observed in terms of colony formation (Figure 15B) and proliferation (Figure 15C). GLB1 expression was assessed by enzyme activity in protein extracts and conditioned medium from myeloid liquid culture cells. In protein extracts of human HSPC-derived myeloid cells transduced with LV-mouse GLB1 (5062 nmol / mg / h for LV-mouse GLB1 C2C12 and 5089 nmol / mg / h for LV-mouse GLB1 WT), significantly higher GLB1 enzyme activity was observed compared to cells transduced with LV-human GLB1 (2912 nmol / mg / h for LV-human GLB1). LV-mouse GLB1 (both WT and C2C12) and LV-human GLB1 resulted in a 7.4-fold and 4.3-fold increase in enzyme activity compared to untransduced (UT) cells, respectively (Figure 15D, left panel). Significant overexpression of the GLB1 enzyme was also measured in conditioned medium from myeloid cells derived from differentiation of LV-murine GLB1-transduced human HSPCs, corresponding to a 20-fold increase in enzyme activity compared to untransduced (UT) cells (123.1 nmol / mg / h for LV-murine GLB1 C2C12 and 123.9 nmol / mg / h for LV-murine GLB1 C2C12). A 2.5-fold increase in enzyme activity was achieved in myeloid cell-conditioned medium with LV-human GLB1 (Figure 15D, right panel). To exclude changes related to expression of the murine enzyme, additional myeloid cells derived from human HSPCs + LV-murine GLB1 C2C12 were differentiated into osteoclasts.LV-murine GLB1 C2C12-transfected myeloid cells differentiated into TRAP-positive osteoclasts (OCs) similar to untransfected (UT) and LV-human GLB1 myeloid cells (Figure 16A). They overexpressed GLB1 enzyme in the cell culture medium and achieved 60-fold higher GLB1 enzyme activity compared to untransfected OCs. OCs derived from LV-human GLB1-transfected myeloid cells exhibited only 4-fold higher GLB1 activity (Figure 16B). Conditioned medium from osteoclasts derived from myeloid cells + LV-murine GLB1 C2C12 and myeloid cells + LV-murine GLB1 C2C12 was used to demonstrate cross-correction of MPSIVB fibroblasts (Figure 16C). GLB1 enzyme activity was restored after 24 hours of exposure to conditioned medium from LV-mouse GLB1 myeloid cells (fold change relative to untreated MPSIVB fibroblasts: 31.37) and osteoclasts (fold change relative to untreated MPSIVB fibroblasts: 23.11) (Figure 16C). The level of enzyme activity in fibroblasts exposed to conditioned medium from LV-human GLB1 and untransduced myeloid cells was similar to the GLB1 enzyme activity measured in untreated MPSIVB fibroblasts (fold change relative to untreated: 3.7 and 1.93, respectively). Conditioned medium from LV-human GLB1 and untransduced osteoclasts also showed reduced cross-correction efficiency compared with conditioned medium from LV-mouse GLB1-transduced osteoclasts and failed to restore GLB1 enzyme activity in MPSIVB fibroblasts (Figure 16C). The efficacy of cross-correction was similar in LV-mouse WT and LV-mouse C2C12. Indeed, no significant difference in enzyme activity was observed in MPSIVB fibroblasts exposed to conditioned medium from LV-mouse GLB1 WT and LV-mouse GLB1 C2C12 myeloid cells (114.8 nmol / mg / h for LV-mouse GLB1 WT and 151.8 nmol / mg / h for LV-mouse GLB1 C2C12) (Figure 16D).
[0227] Example 15 - Analysis of GLB1 expression and enzyme activity in skeletal cells transfected with a lentiviral vector to express the GLB1 gene. The functionality of the mouse GLB1 enzyme compared to the human GLB1 enzyme was further tested in skeletal cells.
[0228] To this end, we generated GLB1 KO HS5 stromal cells by using LVs expressing Cas9 cDNA and a GLB1-specific gRNA (5' CAGATACTATATGAACGGGCACAAA 3'). Control LV CRISPR with a scrambled gRNA was also generated to generate CRISPR-control HS5 cells. First, we demonstrated a significant reduction in GLB1 enzymatic activity in GLB1 KO HS5 cells (99% reduction compared to control cells). In addition to inducing GLB1 KO and control HS5 cells to differentiate into osteoblasts, we also performed a cross-compensation assay on the differentiated cells, in which GLB1 KO and control osteoblasts were incubated with conditioned medium from bone marrow cells for 24 hours. Enzymatic activity was efficiently restored by incubation with conditioned medium from LV-mouse GLB1 WT and LV-mouse C2C12 transfected cells (Figure 17A). Keratan sulfate levels were also measured by ELISA and showed a trend toward decreased keratan sulfate in GLB1 KO HS5 cells exposed to conditioned medium from LV-murine GLB1 WT and C2C12 myeloid cells (Figure 17B). In vitro results demonstrated that human HSPCs transduced with LV-murine GLB1 (WT and C2C12) generated myeloid cells and osteoclasts capable of releasing high levels of stable GLB1 enzyme, which was incorporated into targeted GLB1-deficient cells (MPSIVB fibroblasts and GLB1 KO HS5-derived osteoblasts) and restored their enzymatic activity. These results support the use of LV-murine GLB1 for HSPC-GT.
[0229] Example 16 - In vivo transplantation experiments using LV-GLB1 vector-transduced HSPCs. To further support the in vitro data, human HSPCs transduced in vitro with LV-human GLB1, LV-mouse GLB1 WT, or LV-mouse GLB1 C2C12 vectors at an MOI of 30 were transplanted to rule out alterations in engraftment and reconstitution potential of human cells overexpressing the mouse enzyme and to assess the level of enzyme activity in bone marrow achieved with different LV transduced cells (1.95 x 10 in all conditions). 5 7-week-old immunodeficient NOD.Cg-Kit mice (100 individuals / mouse) were W-41J Prkdc scid Il2rg tm1Wjl / The mice were xenotransplanted into WaskJ (NSGW41). Untreated mice and mice transplanted with cultured untransfected cells were used as controls (Fig. 18A). The weight of the transplanted mice was monitored over time (Fig. 18B). Human CD45 in the peripheral blood was also monitored at 8 and 16 weeks after transplantation. + The level of human engraftment was assessed as the percentage of cells (% hCD45). Mice transplanted with HSPC-LV-human GLB1 had significantly higher levels of human engraftment than sham-transplanted mice (mean hCD45 + A slight but significant decrease in human engraftment rate was observed (mean hCD45 % = 8.9) compared with the control group. + In contrast, mice transplanted with human HSPC+LV-mouse GLB1 WT and C2C12 showed similar percentages of human CD45 compared to mock controls. + The percentage of human HSPCs engrafted with different LVs was measured (Fig. 18C). At 16 weeks, similar levels of human engraftment were detected in the bone marrow and spleen of transplanted mice (Fig. 18D, E), demonstrating that the expression of mouse GLB1 enzyme did not affect the biodistribution capacity of the transduced cells (Fig. 18C-E). It was also demonstrated that engrafted human HSPCs transduced with different LVs differentiated appropriately into myeloid, T, B, and NK cells, similar to mock control cells (Fig. 18F). Similar percentages of human HSCs (CD34 + , CD38 -) was measured, demonstrating that the in vitro gene correction procedure did not alter the undifferentiated HSC compartment (Figure 18G). Furthermore, VCN in the bone marrow of transplanted mice was measured to assess the efficiency of human HSPC transduction, demonstrating a higher VCN in mice transplanted with human HSPCs + LV-human GLB1 (Figure 18H). However, significantly higher levels of GLB1 enzyme activity were detected in the BM of mice transplanted with HSPCs transduced with LV-murine GLB1 C2C12 and WT (4.9- and 3.8-fold, respectively, compared with untreated mice) compared with mice injected with HSPCs + LV-human GLB1 (2.6-fold compared with untreated mice) (Figure 18I, upper panel). These differences were more pronounced when enzyme activity was normalized to VCN (Figure 18I, lower panel). Overall, the in vivo data confirmed the ability of transduced cells to engraft and reconstitute the hematopoietic system similarly to untransduced cells. We also confirmed that the use of LV-human GLB1 resulted in a mild induction of GLB1 enzyme activity in the bone marrow of transplanted mice.Furthermore, transplantation of human HSPCs transfected with LV-mouse GLB1 resulted in significantly higher GLB1 enzyme expression in vivo compared with untreated HSPCs and HSPCs transfected with LV-human GLB1.
[0230] Example 17 – Evaluation of cross-compensation by LV-GLB1 vector-transduced HSPCs Additional studies were performed to compare the mechanisms of cross-compensation. The mouse enzyme was internalized into MPSIVB fibroblasts via the mannose 6P receptor (M6PR). The presence of M6P in conditioned medium from bone marrow cells + LV-mouse GLB1, as well as LV-human GLB1, inhibited enzyme internalization by preventing recovery of GLB1 enzyme activity (Figure 19A). Furthermore, mouse and human GLB1 enzymes were detected by immunofluorescence in combination with vimentin (a cytoplasmic marker) and LAMP-1 (a lysosomal marker) in fibroblasts exposed to conditioned medium from bone marrow cells + LV-mouse GLB1 or + LV-human GLB1 (Figures 20A-C). Both the mouse and human enzymes colocalized with LAMP-1, demonstrating that the internalized enzymes were correctly targeted to the lysosomal compartment.
[0231] Example 18 – Immunogenicity assay using LV-GLB1 vector The protein structures of mouse and human GLB1 enzymes show 70% amino acid sequence homology, with a low proportion of highly biochemically distinct amino acids at corresponding positions. Taking these differences into account, we performed short-term and long-term immunogenicity assays using peripheral blood mononuclear cells (PBMNCs) from healthy donors. In the short-term response, PBMCs were exposed to conditioned medium from HEK-293T cells transduced with LV-human GLB1, LV-mouse GLB1 WT, and LV-mouse GLB1 C2C12 for 5 days. T cell proliferation and INFγ production were assessed to compare the immunogenicity of human and mouse GLB1 enzymes (Figure 20A). In the secondary challenge experiment, PBMCs were exposed to conditioned medium for 13 days. On day 0, autologous CD14 +Cells were isolated and differentiated into autologous dendritic cells (DCs) for 7 days in the presence of rh-IL-4 and rh-GM-CSF. PBMCs previously exposed to conditioned medium for 13 days were pulsed with conditioned medium from HEK-293T cells transduced with human or mouse GLB1 (tetanus toxoid was used as a positive control) and cocultured with autologous DCs for 3 days prior to T cell response assessment (proliferation and INFγ production) (Figure 20B). Results from both short-term and long-term immunogenicity assays demonstrated undetectable T cell responses to vector-derived human or mouse GLB1. These analyses further supported the use of LV-mouse GLB1 in the development of HSPC-GTs for MPSIVB patients.
[0232] Example 19 – LV-MAN2B transduced human mPB CD34 + Evaluation of toxicity and MAN2B activity in In the presence of cyclosporine H (8 μM, CsH condition) alone or in combination with prostaglandin E2 (10 μM, CsH + PGE2 condition) as a transduction promoter, human mobilized peripheral blood (mPB) CD34 + Cells were transduced with LV-MAN2B WT and a control vector (LV-CTRL) at an MOI of 30. A one-hit CsH + PGE2 protocol was tested to increase vector copy number (VCN) per cell and target enzyme activity compared to the one-hit CsH protocol. To assess potential toxic effects on cell proliferation and colony formation, cells were expanded in myeloid liquid culture for 14 days and seeded for colony-forming cell (CFC) assays after transduction. Untransduced cells (UT) were used as a control. Transduced and untransduced cells proliferated at similar rates in liquid culture, and retained colony-forming ability with a slight decrease in cell proliferation and colony number in the CsH + PGE2 condition (Figures 21A-B). Cells were efficiently transduced, and the combination of CsH and PGE2 increased VCN per cell by 2-fold compared to CsH alone, increasing the transduction rate (Figures 21C-D). Furthermore, LV-MAN2B-transduced mPB-CD34 +Myeloid progeny derived from the cells expressed and released MAN2B enzyme at supraphysiological levels in accordance with their VCN (intracellularly, 2.8-fold with CsH and 4.9-fold with CsH + PGE2; extracellularly, 1.7-fold with CsH and 2.5-fold with CsH + PGE2) (Figure 21E).
[0233] Example 20 - Restoration of MAN2B enzyme activity in fibroblasts from α-mannosidosis patients using conditioned medium from LV-MAN2B liquid cultures. In an in vitro cross-correction model, fibroblasts from α-mannosidosis patients were transduced with LV-MAN2B at an MOI of 30 using either CsH or CsH+PGE2 transduction protocols to mobilize mPB CD34 cells. + The cells were exposed to the supernatant of transfected human mPB CD34. A schematic diagram of the cross-compensation assay is shown in Figure 22A. + Cell culture medium conditioned by the myeloid progeny of the cells was collected after 12 hours of conditioning. Cell culture medium conditioned by untransduced cells was used as a control. MAN2B patient-derived fibroblasts were exposed to conditioned medium for 12–16 hours and collected for enzyme activity. Untransduced (UT) cells were used as a control. MAN2B enzyme activity was also measured in untreated fibroblasts from both patients and in fibroblasts from one healthy donor as a control (HD). Results showed complete recovery of MAN2B enzyme activity in the patient fibroblasts, reaching levels comparable to or exceeding those of HD controls. A greater than 1.4-fold cross-correction was observed after exposure to CsH+PGE2-derived medium compared to CsH-derived medium (Figure 22B). These results are consistent with the results of LV-MAN2B-transduced mPB CD34 cells. + These results suggest that the IL-16 / ...
[0234] Example 21 – LV-MAN2B transduced human mPB CD34 + Release of the MAN2B enzyme by osteoclasts (OCs), derived from the myeloid progeny of the cells. mPB CD34 transduced with LV-MAN2B at an MOI of 30 using either the CsH or CsH+PGE2 protocol. +A TRAP assay was performed to assess the presence of OCs 10 days after in vitro differentiation of the myeloid progeny of the cells (Figure 23A). OCs derived from untransduced (UT) cells were used as a control. qPCR expression analysis of MMP9 and TRAP5b genes involved in OC differentiation was performed (Figure 23B), and MAN2B enzyme activity was measured in the cell pellet and medium of OCs (Figure 23C). Transduced human mPB CD34 + Cell-derived osteoclasts exhibited elevated MAN2B enzyme activity compared to UT controls. The highest VCN achieved using the CsH+PGE2 delivery protocol resulted in a >1.9-fold increase in enzyme activity both intracellularly and extracellularly compared to CsH alone.
[0235] Example 22 - Restoration of MAN2B enzyme activity in fibroblasts from α-mannosidosis patients using conditioned medium from LV-MAN2B-transfected osteoclasts.
[0236] According to the in vitro cross-correction model, fibroblasts derived from α-mannosidosis patients were transfected with human mPB CD34 cells transfected with LV-MAN2B WT at an MOI of 30 using a one-hit CsH or one-hit CsH+PGE2 protocol. + The MAN2B-transduced human mPB CD34 cells were exposed to cell medium conditioned by osteoclasts derived from the myeloid progeny of the cells. A schematic diagram of the cross-compensation assay is shown in Figure 24A. The osteoclast-conditioned cell medium was collected after 12 hours of conditioning. Cell medium conditioned by untransduced cells was used as a control. MAN2B patient-derived fibroblasts were exposed to conditioned medium for 12–16 hours and collected for enzyme activity. Untransduced (UT) cells were used as a control. MAN2B enzyme activity was also measured in untreated fibroblasts from both patients and in fibroblasts from one healthy donor as a control (HD). The results show restoration of MAN2B enzyme activity in the patient fibroblasts to levels comparable to or exceeding those of the HD control. Furthermore, a greater than 1.8-fold cross-compensation was observed after exposure to CsH+PGE2-derived medium compared to CsH-derived medium (Figure 24B). These results support the results of LV-MAN2B-transduced human mPB CD34 cells. +This suggests that osteoclast-derived cells may act as a local source of enzymes within bone upon treatment.
[0237] Example 23 LV-MAN2B-transduced human mPB CD34 + In vivo transplantation experiments using LV-MAN2B WT and untransduced cells. Figure 25A shows modified CD34 cells from a healthy donor transduced with LV-MAN2B WT at an MOI of 30 by a one-hit CsH protocol to assess the ability of transduced cells to overexpress MAN2B in vivo. + The experimental scheme for in vivo transplantation of cells into NBSGW mice is shown. 6 After cell / mouse injection, human cell engraftment rates were analyzed in the PB at 7 and 12 weeks after transplantation. Mice were euthanized at 12 weeks, and bone marrow (BM) samples were analyzed for human cell content and MAN2B enzyme activity. Untransduced cultured mPB CD34 + Mice transplanted with cells (mock group) served as a control. The MAN2B and mock groups showed no statistically significant differences in the human hematopoietic cell content in the PB over time and in the BM at the end of the study, providing the first evidence that MAN2B overexpression does not alter human HSPC engraftment and differentiation (Figure 25B). At the end of the study, transduced cells were detected in the BM of mice transplanted with LV-MAN2B-modified human HSPCs, and the average VCN 1 was measured (Figure 25C). Furthermore, significantly higher MAN2B enzyme activity (3-fold) was measured in all BM cells from the MAN2B group compared with the mock group. Overall, these data support the conclusion that transduced mPB CD34 + We show that the cells efficiently engraft in the BM of immunodeficient mice and overexpress MAN2B when transplanted in vivo.
[0238] Example 24 – Construction of a lentiviral vector to express the GALNS gene Three different LVs were generated: one with the transfer vector construct pCCLsin.cPPT.hPGK.GALNSwt.Wpre, which contains an expression cassette containing a polynucleotide encoding wild-type GALNS (SEQ ID NO: 35) (referred to herein as the "LV GALNS WT cassette"); one with the transfer vector construct pCCLsin.cPPT.hPGK.GALNSopt.Wpre, which contains an expression cassette containing a polynucleotide encoding codon-optimized GALNS (SEQ ID NO: 36) (referred to herein as the "LV GALNS OPT cassette"); and one with the transfer vector construct pCCLsin.cPPT.hPGK.eGFP.Wpre, which contains an expression cassette for expressing the eGFP reporter gene. Figure 35B shows a schematic diagram of the transfer vector construct. Figure 35A shows a schematic diagram of the expression cassette in the transfer vector construct.
[0239] Example 25 – Mobilized Peripheral Blood (mPB) CD34 + In vitro transfection of LV to express the GALNS gene into cells. Granulocyte Colony Stimulating Factor (G-CSF)-mobilizes peripheral blood CD34 + Cells were cultured in retronectin-coated, non-tissue culture-treated wells (T100A Takara) in CellGro medium (Cell Genix) supplemented with the following cytokines: 60 ng / ml interleukin-3 (IL-3), 100 ng / ml thrombopoietin (TPO), 300 ng / ml stem cell factor (SCF), and 300 ng / ml FLT3-L (all from Cell Peprotech). After 22 hours of pre-stimulation, cells were transduced with a single addition of the lentiviral vector (LV) from Example 24 at a specific multiplicity of infection (MOI) in the presence of 8 μM cyclosporine H (CsH) (Merck) as a transduction enhancer for 16 hours in the same cytokine-containing medium. After transduction, cells were harvested, washed, and seeded for colony-forming cell (CFC) assays and myeloid liquid culture.
[0240] Example 26 - Evaluation of toxicity of LV GALNS wild type (WT) and codon optimized (OPT). Human mobilized peripheral blood (mPB) CD34 + Cells were transfected with LV GALNS WT (top left panel in Figure 26A) and LV GALNS OPT (bottom right panel in Figure 26A) at different MOIs (100, 30, 10), expanded as myeloid liquid cultures for 14 days, and their growth curves were evaluated. Untransfected cells (UT) were used as a control to evaluate potential toxic effects on the cell proliferation of the progeny of transfected cells. Colony formation assays were also performed on human mPBCD34 cells transfected with LV GALNS WT and LV GALNS OPT at different MOIs (100, 30, 10). + The cells were then transfected with LV-GALNS WT and OPT HSPCs. Untransfected cells (UT) were used as a control to assess potential toxic effects on the colony-forming ability of LV-GALNS WT and OPT HSPCs. As shown in Figure 26, LV-GALNS WT or OPT did not show significant toxicity in transfected cells.
[0241] Example 27 - LV GALNS WT and OPT transduced human mPB CD34 + Analysis of GALNS expression and enzyme activity in GALNS expression and enzyme activity were measured in mPBCD34 cells transfected with LV GALNS WT or OPT at different MOIs. + The progeny of LV GALNS OPT and WT were tested. At similar integrated vector copy numbers per cell (VCN) (see Figure 27A), LV GALNS OPT and WT showed comparable GALNS expression and enzyme activity. It is also noteworthy that transfection at an MOI of 30 (see Figure 27B) was sufficient to obtain significant expression levels and enzyme activity, allowing the use of low amounts of vector (Figures 27C and D).
[0242] Example 28 – Human mPB CD34 + Evaluation of the toxicity and transfection efficiency of LV GALNS WT in cells. Growth curve analysis (FIG. 28A) and colony formation assay (FIG. 28B) were performed on mPB hCD34 cells transduced with LV-GALNS WT (left panel of FIG. 28A) and LV-CTRL at an MOI of 30 and expanded in liquid myeloid culture for 14 days. + We performed the following experiments. + VCN measurement of myeloid progeny of cells and human mPB hCD34 transduced with LV-GALNS WT + The measurement of GALNS enzyme activity in the cell pellet and medium of the myeloid progeny of the cells was also performed (FIGS. 28C and D, respectively).
[0243] Untransfected (UT) and control vector (LV GFP)-transfected mPB CD34 + Cells were used as a control.
[0244] The cells were efficiently transduced without signs of toxicity and expressed and released the GALNS enzyme at supraphysiological levels.
[0245] Example 29 - Restoration of GALNS enzyme activity in fibroblasts from MPSIVA patients. In an in vitro cross-correction model, relevant patient-derived fibroblasts, MSCs, and osteoblasts were transfected with LV-GALNS at an MOI of 30 into mobilized peripheral blood (mPB) CD34 cells. + The cross-compensation assay was performed using human mPB CD34 cells transduced with LV-GALNS WT at an MOI of 30. + Cell culture medium conditioned by the myeloid progeny of the cells was collected after 12 hours of conditioning. Cell culture medium conditioned by untransfected cells was used as a control. Fibroblasts from a patient with MPSIVA were exposed to the conditioned medium for 12-16 hours and collected for Western blot analysis and enzyme activity titration. Untransfected (UT) cells were used as a control. GALNS enzyme activity was also measured in fibroblasts from a single healthy donor (HD) as a control. Enzyme activity was efficiently restored, indicating that LV-GALNS-transfected mPB CD34 +These results suggest that the IL-16A-mediated IL-16B ...
[0246] Example 30 - Restoration of GALNS activity in MPSIVA-derived mesenchymal stromal cells (MSCs) and MSC-derived osteoblasts (OBs). After obtaining informed consent, we also evaluated the restoration of GALNS activity by LV GALNS WT in mesenchymal stromal cells (MSCs) and MSC-derived osteoblasts (OBs) isolated from patients with MPSIVA. GALNS expression was also assessed in MSCs from healthy donors as a control. Actin-β (ACTB) was used for sample normalization. Figure 30B shows a schematic diagram of the cross-correction assay.
[0247] mPB CD34 + The cells were transfected with LV-GALNS WT at an MOI of 30 and expanded in liquid myeloid culture for 14 days. 6 The cells were seeded at a concentration of 1 / ml with conditioned medium. + Cell culture medium conditioned with untransfected and uninfected cells was collected after 24 hours of conditioning. MSCs and MSC-derived OBs from MPSIVA patients were exposed to conditioned medium for 12–16 hours and collected for Western blot analysis (Figure 30C) and enzyme activity (Figure 30D). Cell culture medium conditioned with untransfected cells was used as a control.
[0248] Patient cells take up the GALNS exoenzyme. Indeed, the enzyme activity is efficiently restored, which indicates that LV-GALNS-transfected mPB CD34 + These results suggest that the IL-16 / ...
[0249] Example 31 - Analysis of the molecular mechanisms mediating GALNS uptake in MPSIVA MSCs and MSC-derived OBs. MSCs and osteoblasts derived from MPSIVA patients were cultured using mPB CD34 +We exposed HEK293T cells transfected with LV-GALNS at an MOI of 30, reproducing the transfection conditions. Different exposure protocols were tested: 1) the presence or absence of mannose 6-phosphate (M6P), a ligand for the mannose 6-phosphate receptor (M6PR), which regulates the transport of lysosomal enzymes; 2) exposure to different amounts of conditioned medium; and 3) different exposure times. The results showed that GALNS uptake from conditioned medium increased with prolonged exposure and with higher amounts of conditioned medium. The presence of M6P inhibited GALNS uptake, indicating that GALNS uptake is M6P-dependent (Figure 31).
[0250] Example 32 - Human mPB CD34 transduced with LV GALNS WT + Expression and release of GALNS enzyme by osteoclasts (OCs), derived from the myeloid progeny of the cells. mPB CD34 cells transduced with LV-GALNS at an MOI of 30 + A TRAP assay was performed to assess the presence of OCs after 10 days of in vitro differentiation of the myeloid progeny of cells. OCs derived from untransduced (UT) cells were used as a control. qPCR expression analysis of MMP9 and TRAP5b genes involved in OC differentiation was performed in untransduced and LV-GALNS WT-transduced mPB CD34 cells. + This was followed by Western blot analysis of GALNS expression in pellets of OCs and cell culture media derived from bone marrow culture of cells (Fig. 32B, C). + Upon treatment, the cell-derived osteoclasts expressed and released the GALNS enzyme, potentially acting as a local source of enzyme within the bone.
[0251] Example 33 - Human mPB CD34 transduced with LV GALNS WT + In vivo transplantation experiments using cells and non-transfected cells Figure 33A shows the experimental scheme for evaluating the ability of transduced cells to overexpress GALNS in vivo: modified CD34 cells derived from healthy donors and transduced with LV GALNS WT at an MOI of 30 using a one-hit CsH protocol.+ The experimental scheme for in vivo transplantation of cells into sublethally irradiated NSG mice (GT) is shown. In detail, 0.5*10 cells were transplanted into sublethally irradiated NSG mice (200 rad). 6 After cell / mouse injection, hematopoietic reconstitution was performed by analyzing the human cell engraftment rate in the PB at 7 and 12 weeks after transplantation. Mice were euthanized at 12 weeks, and hematopoietic organs (BM and spleen) were analyzed for human cell content and GALNS enzyme activity. Cultured untransduced mPB CD34 + Cell-transplanted mice (mock group) were used as controls.
[0252] In vivo data obtained in NSG mice transplanted with LV-GALNS-modified human HSPCs show increased expression of the GALNS enzyme in their BM compared to mice transplanted with untransduced control HSCs (HSCT mouse group), despite similar levels of human engraftment (Figure 33B-G).
[0253] Example 34 - Human mPB CD34 transduced with LV GALNS WT and untransduced cells after xenotransplantation + In vivo human reconstitution of cells Human CD45 in peripheral blood (PB) of transplanted mice in Example 33 at 7 and 12 weeks after cell injection + The number (Fig. 34B, upper panel) and percentage (Fig. 34B, lower panel) of cells, as well as human CD45 in the bone marrow BM and spleen 12 weeks after transplantation. + The number and percentage of cells were measured. GALNS enzyme activity was also measured in total BM cells from mice in the GT and mock groups 12 weeks after transplantation. These data show that both the GALNS and mock groups exhibited comparable human hematopoietic cell content in the PB over time and in the hematopoietic organs at the end, providing the first evidence that GALNS overexpression does not alter human HSC engraftment and differentiation (Figure 34B-D). Furthermore, significantly higher GALNS enzyme activity (6.8-fold) was measured in total BM cells from mice in the GALNS group compared to mice in the mock group (Figure 34E). Overall, these data support the role of transduced mPB CD34 +We show that the cells efficiently engraft in the BM of recipient mice and overexpress GALNS upon transplantation in vivo. Based on these data, we can also conclude that the level of GALNS expression cross-compensates for cells of non-hematopoietic origin.
[0254] Example 35 – In vivo assay in knockout mouse model HSPCs were isolated from GALNS KO mice and transfected with human CD34 cells according to the transduction protocol for mouse cells by Biffi et al. (2013) and Visigalli et al. (2010). + The cells were transduced ex vivo using LV-GALNS engineered to overexpress the human enzyme. The transduced cells were then transplanted into the tail vein of KO recipient mice at the time of transplantation. The recovery of enzyme activity in PBMNCs and the reduction of urinary GAG levels at different time points after transplantation (4, 6, 8, 12, 16, 20, and 24 weeks) were measured. The level of transplanted cell engraftment and hematopoietic reconstitution in peripheral blood samples were also measured by flow cytometry. Furthermore, macroscopic correction of bone defects caused by XR was assessed. Histopathological and immunofluorescence analyses of skeletal tissues were performed upon euthanasia at 8, 16, and 24 weeks after treatment to evaluate cellular organization and interactions. The level of GAG accumulation was measured by immunohistochemistry and the presence of vacuolated lysosomes in the skeletal tissue. Finally, the recovery of bone properties was assessed by microCT. All analyses were also performed in GALNS KO mice transplanted with wild-type HSCs (HSCT), GALNS KO mice transplanted with GALNS KO HSCs transduced with a control vector (LV-GFP), and untreated mice.
[0255] Example 36 – Optimization of HSPC-GT protocol for clinical application For the clinical application of HSPC-GT to treat patients with LSD according to the present invention, clinical-grade LV-GALNS was used in the study. Various single-transduction protocols using transduction enhancers (TEs) were tested alone and in combination to identify the most effective ones in terms of VCN, percentage of positive colonies, and enzyme activity levels. A VCN of >2 and 80% positive colonies in peripheral blood mononuclear cells were shown to provide a better outcome of disease improvement. Peripheral blood mobilized (mPB) human HSPCs from healthy donors were cultured in retronectin-coated, non-tissue culture-treated wells (T100A Takara) in CellGro medium (Cell Genix) supplemented with the following human cytokines: 60 ng / ml interleukin-3 (IL-3), 100 ng / ml thrombopoietin (TPO), 300 ng / ml stem cell factor (SCF), and 300 ng / ml FLT3-L (all from Cell Genix). After 22 h of pre-stimulation, cells were transfected with a single round of LV-GALNS at a specified multiplicity of infection (MOI) of 25, 50, or 100 for 14 h using the following TEs, alone or in combination: 10 mM prostaglandin 2 (PGE2) (Cayman Chemical), 8 mM cyclosporine H (CsH) (Sigma-Aldrich), and 1x LentiBoost (LB) (Sirion-Biotech) (Figure 36A). At the end of transfection, cells were harvested and seeded for MethoCult (Stemcell Tech) colony formation assays and myeloid differentiation in liquid culture using IMDM + 10% FBS supplemented with 300 ng / ml stem cell factor (SCF), 60 ng / ml interleukin-3 (IL-3), and 60 ng / ml interleukin-6 (IL-6) (all from Cell Genix). Cells transfected without TE and untransfected (UT) cells were used as controls.
[0256] The toxicity of different transfection protocols was evaluated by measuring the colony-forming ability and myeloid cell proliferation of transfected cells. A tendency toward a decrease in colony number was observed in human HSPCs transfected at an MOI of 100 compared to controls (UT cells and cells transfected in the absence of TE), but no significant differences in colony number were observed in all other conditions. Importantly, all transfection protocols did not affect the colony composition (GEMM, GM, BFU) (Figure 36B). Only a slight decrease in the proliferation efficiency of transfected cells was observed compared to UT cells, especially at later passages. The proliferation levels of cells transfected with a single TE and cells transfected with a combination of TEs were similar (Figure 36C).
[0257] The VCN in transduced cells was measured by digital droplet PCR. A VCN of <2 was observed in all conditions transduced with mPB HSPCs at an MOI of 25. At an MOI of 50, the use of the TE combination allowed us to achieve a VCN of >2 (PGE2+LB: 2.56, PGE2+CsH: 2.79, CsH+LB: 2.415), which further increased when cells were transduced at an MOI of 100 (PGE2+LB: 3.56, PGE2+CsH: 3.83, CsH+LB: 3.105). Under these conditions (MOI 100), the use of CsH and LB alone also allowed us to achieve a VCN of >2 in transduced cells (CsH: 2.32, LB: 3.04) (Figure 37A). Finally, GALNS enzyme activity in transduced cells was measured, and the highest level of enzyme activity was observed in cells transduced with the TE combination at an MOI of 100 (Figure 37B). It was concluded that the TE combination improved cell transduction efficiency without causing toxicity.
[0258] array The sequences disclosed in connection with the present invention are enclosed and also presented below according to the following legend: [Table 1]
[0259] SEQ ID NO: 1 (hGLB1 WT) [Table 2]
[0260] SEQ ID NO: 2 (hGLB1 OPT) [Table 3]
[0261] SEQ ID NO: 3 (hPGK promoter) [Table 4]
[0262] SEQ ID NO: 4 (LV-hGLB1 WT cassette) [Table 5]
[0263] SEQ ID NO: 5 (LV-hGLB1 OPT cassette) [Table 6]
[0264] SEQ ID NO: 6 (Eukaryotic Translation Elongation Factor 1 alpha 1, EIF1a, promoter) [Table 7]
[0265] SEQ ID NO: 7 (Cytomegalovirus, CMV, enhancer + promoter) [Table 8]
[0266] SEQ ID NO: 8 (CAG synthetic promoter, CMV enhancer and chicken β-actin promoter combined) [Table 9]
[0267] SEQ ID NO: 9 (5'LTR) [Table 10]
[0268] SEQ ID NO: 10 (encapsidation signal Ψ) [Table 11]
[0269] SEQ ID NO: 11 (RRE) [Table 12]
[0270] SEQ ID NO: 12 (cPPT / CTS) [Table 13]
[0271] SEQ ID NO: 13 (WPRE) [Table 14]
[0272] SEQ ID NO: 14 (3'LTR) [Table 15]
[0273] SEQ ID NO: 15 (SV40 polyA) [Table 16]
[0274] SEQ ID NO: 16 (SV40 replication origin) [Table 17]
[0275] SEQ ID NO: 17 (F1 ori) [Table 18]
[0276] SEQ ID NO: 18 (KOZAK sequence) [Table 19]
[0277] Sequence number 19 (LV empty) [Table 20] [Table 21]
[0278] SEQ ID NO: 20 (mGLB1 C2C12) [Table 22]
[0279] SEQ ID NO: 21 (MAN2B WT) [Table 23]
[0280] SEQ ID NO: 22 (MAN2B OPT) [Table 24]
[0281] SEQ ID NO: 23 (LV-mGLB1 C2C12 cassette) [Table 25]
[0282] SEQ ID NO: 24 (LV-MAN2B WT cassette) [Table 26]
[0283] SEQ ID NO: 25 (LV-MAN2B OPT cassette) [Table 27]
[0284] SEQ ID NO: 26 (EIF4A) [Table 28]
[0285] SEQ ID NO: 27 (eIF4A-GLB1 cassette) [Table 29]
[0286] SEQ ID NO: 28 (LV hGLB1 WT transfer vector) [Table 30] [Table 31]
[0287] SEQ ID NO: 29 (LV hGLB1 OPT transfer vector) [Table 32] [Table 33]
[0288] SEQ ID NO: 30 (LV mGLB1 C2C12 transfer vector) [Table 34] [Table 35]
[0289] SEQ ID NO: 31 (LV human MAN2B WT transfer vector) [Table 36] [Table 37] [Table 38]
[0290] SEQ ID NO: 32 (LV human MAN2B OPT transfer vector) [Table 39] [Table 40] [Table 41]
[0291] SEQ ID NO: 33 (LV-EIF4A hGLB1 WT transfer vector) [Table 42] [Table 43]
[0292] SEQ ID NO: 34 (LV mGLB1 WT transfer vector) [Table 44] [Table 45]
[0293] SEQ ID NO: 35 (GALNS WT) [Table 46]
[0294] SEQ ID NO: 36 (GALNS OPT) [Table 47]
[0295] SEQ ID NO: 37 (LV-GALNS WT cassette) [Table 48]
[0296] SEQ ID NO: 38 (LV-GALNS OPT cassette) [Table 49]
[0297] SEQ ID NO: 39 (LV human GALNS WT) [Table 50] [Table 51]
[0298] SEQ ID NO: 40 (LV human GALNS OPT) [Table 52] [Table 53]
[0299] SEQ ID NO: 41 (mGLB1 WT) [Table 54]
[0300] SEQ ID NO: 42 (LV-GLB1 WT cassette) [Table 55]
Claims
1. A viral vector comprising an expression cassette for expressing an enzyme deficient in lysosomal storage disorders, preferably lysosomal storage disorders with skeletal lesions, The expression cassette, a) Promoter, and b) comprising at least one polynucleotide operably linked to the promoter, which encodes an enzyme that is deficient in lysosomal storage disorders, A viral vector wherein the enzyme is selected from the group consisting of α-D-mannosidase enzyme, β-galactosidase enzyme, and N-acetylgalactosamine-6-sulfatase enzyme.
2. The viral vector according to claim 1, wherein the promoter is selected from the following: a. 1) Isolated human PGK promoter, preferably the sequence of SEQ ID NO: 3, or a variant thereof. a. 2) Isolated eukaryotic translation elongation factor 1 alpha-1 promoter, preferably the sequence of SEQ ID NO: 6, or a variant thereof. a. 3) Isolated CMV enhancer-containing promoter, preferably the sequence of SEQ ID NO: 7, or a variant thereof. a. 4) CAG promoter, preferably the sequence of SEQ ID NO: 8, or a variant thereof, a. 5) The natural promoter of the gene encoding the enzyme that is deficient in lysosomal storage disorders with skeletal lesions.
3. The viral vector according to claim 1 or 2, which is a lentiviral vector, preferably a replication-deficient human immunodeficiency virus (HIV).
4. The viral vector according to claim 1 or 2, further comprising one or more of the following: c) 5' long terminal repeat sequence (5'LTR), d) Capsidation signal (Ψ) (preferably including the 5' portion of the gag gene (GA)), e) Rev response element (RRE), f) Central polypurine sequence (cPPT), g) Central Terminal Sequence (CTS), h) Post-transcriptional regulatory elements (Wpre) of woodchuck hepatitis virus, i) 3'-terminal repeat regions (3'LTRs), preferably self-inactivated (SIN) 3'LTRs, j) Polyadenylation signal, k) an SV40 origin of replication, and l) Bacterial high-copy replication start point (f1 ori).
5. The viral vector according to claim 1 or 2, wherein the polynucleotide encoding the enzyme that is deficient in lysosomal storage disorders is a polynucleotide encoding the α-D-mannosidase enzyme.
6. The viral vector according to claim 5, wherein the polynucleotide encoding the α-D-mannosidase enzyme includes or comprises the sequence of SEQ ID NOs. 21, 22, or a variant thereof.
7. The viral vector according to claim 1 or 2, wherein the polynucleotide encoding the enzyme that is deficient in lysosomal storage disease is a polynucleotide encoding the β-galactosidase enzyme.
8. The viral vector according to claim 7, wherein the polynucleotide encoding the β-galactosidase enzyme includes or comprises the sequence of SEQ ID NOs: 1, 2, 20, 41, or a variant thereof.
9. The viral vector according to claim 7, wherein the polynucleotide encoding the β-galactosidase enzyme includes or comprises the sequence of SEQ ID NOs. 20, 41, or a variant thereof.
10. The viral vector according to claim 1 or 2, wherein the polynucleotide encoding the enzyme that is deficient in lysosomal storage disorders is a polynucleotide encoding the N-acetylgalactosamine-6-sulfatase enzyme.
11. The viral vector according to claim 10, wherein the polynucleotide encoding the N-acetylgalactosamine-6-sulfatase enzyme includes or comprises the sequence of SEQ ID NOs. 35, 36, or a variant thereof.
12. The viral vector according to claim 1 or 2, wherein the expression cassette includes or comprises the sequence of sequence number 24, 25, or a variant thereof.
13. The viral vector according to claim 1 or 2, wherein the expression cassette includes or comprises the sequence of sequence numbers 4, 5, 23, 27, or variants thereof.
14. The viral vector according to claim 13, wherein the expression cassette includes the sequence of sequence number 23 or a variant thereof, or has a sequence consisting thereof.
15. The viral vector according to claim 1 or 2, wherein the expression cassette includes or comprises the sequence of sequence number 37, 38, or a variant thereof.
16. The viral vector according to claim 1, comprising the sequence of sequence number 31, 32, or a variant thereof, or having a sequence consisting thereof.
17. The viral vector according to claim 1, comprising or having a sequence of sequence numbers 28, 29, 30, 33, 34, or a variant thereof.
18. The viral vector according to claim 1, comprising the sequence of sequence number 39, 40, or a variant thereof, or having a sequence consisting thereof.
19. Modified cells comprising the viral vector according to claim 1 or 2.
20. The modified cell according to claim 19, which incorporates a viral vector expression cassette.
21. Stem cells, preferably hematopoietic stem cells and progenitor cells (HSPCs), more preferably CD34 + The modified cell according to claim 19, which is an HSPC.
22. T cells, preferably CD4 + A modified cell according to claim 19, which is a T cell.
23. A formulation comprising a suspension of modified cells according to claim 19 in a culture medium suitable for administration to a subject, wherein the suspension is preferably frozen, and optionally comprises appropriate pharmaceutically acceptable excipients.
24. A method for producing the modified cells described in claim 19, comprising the following steps: i. A step of providing isolated cells, and ii. A step of introducing the viral vector according to claim 1 or 2 into isolated cells to obtain modified cells, Furthermore, optionally, a method including the following steps: iii. The process of suspending modified cells in a frozen culture medium and freezing the modified cell suspension.
25. The isolated cells are HSPC, preferably CD34. + The method according to claim 24, wherein the method is HSPC.
26. The isolated cells are T cells, preferably CD4 cells. + The method according to claim 24, wherein the cell is a T cell.
27. The method according to claim 24, further comprising the following steps: i. A step in which the isolated cells are stimulated with a cytokine mixture before step ii. of introducing the viral vector into the isolated cells.
28. The method according to claim 24, further comprising the following steps: i. A step in which the isolated cells are brought into contact with one or more introduction promoters, prior to step ii. of introducing the viral vector into the isolated cells.
29. The method according to claim 24, wherein, after introduction, the viral vector is incorporated into the genome of isolated cells.
30. The viral vector according to claim 1 or 2 for use in the treatment of lysosomal storage disorders, preferably lysosomal storage disorders with skeletal lesions.
31. A viral vector according to claim 1 or 2 for use in the treatment of α-mannosidosis, wherein a polynucleotide encoding an enzyme deficient in lysosomal storage disease encodes the α-D-mannosidase enzyme, and preferably the polynucleotide comprises or has a sequence of SEQ ID NOs. 21, 22, or a variant thereof.
32. A viral vector according to claim 1 or 2 for use in the treatment of mucopolysaccharidosis type IVB, wherein a polynucleotide encoding an enzyme deficient in lysosomal storage disease encodes a β-galactosidase enzyme, and preferably the polynucleotide comprises or has a sequence of SEQ ID NOs: 1, 2, 20, 41, or a variant thereof.
33. The viral vector according to claim 32, wherein the polynucleotide encoding the β-galactosidase enzyme includes or comprises the sequence of SEQ ID NOs. 20, 41, or a variant thereof.
34. A viral vector according to claim 1 or 2 for use in the treatment of mucopolysaccharidosis type IVA, wherein a polynucleotide encoding an enzyme deficient in lysosomal storage disease with skeletal lesions encodes the enzyme N-acetylgalactosamine-6-sulfatase, and preferably the polynucleotide comprises or has a sequence of SEQ ID NO: 35 or 36, or a variant thereof.
35. The viral vector according to claim 30, wherein the treatment comprises the steps of administering a chemotherapy-based pretreatment regimen to a subject requiring the treatment, and then administering a viral vector to the subject.