Therapeutic MUSK antibodies

Antibody-based molecules targeting MuSK enhance neuromuscular junction stability and improve muscle function in neuromuscular disorders by activating MuSK, addressing the limitations of current therapies.

JP2026056615APending Publication Date: 2026-04-01NEW YORK UNIV +1
View PDF 6 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-11-06
Publication Date
2026-04-01

Smart Images

  • Figure 2026056615000020
    Figure 2026056615000020
  • Figure 2026056615000021
    Figure 2026056615000021
  • Figure 2026056615000022
    Figure 2026056615000022
Patent Text Reader

Abstract

One objective is to overcome this and other shortcomings in the relevant technical field. [Solution] The present invention relates to antibody-based molecules, such as full-length antibodies, their antigen-binding domains, and antibody derivatives, that can bind to and activate human muscle-specific tyrosine protein kinase (MuSK). The present invention further discloses a method for treating neuromuscular symptoms using the MuSK antibody.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 011,986, filed April 17, 2020; U.S. Provisional Patent Application No. 63 / 038,633, filed June 12, 2020; and U.S. Provisional Patent Application No. 63 / 112,375, filed November 11, 2020, which are hereby incorporated by reference in their entirety.

[0002] Field The present invention relates to antibody-based molecules, such as full-length antibodies, antigen-binding domains thereof, and antibody derivatives, that can bind to and activate human muscle-specific tyrosine protein kinase (MuSK). The present invention further discloses methods of treating neuromuscular disorders using the MuSK antibodies.

Background Art

[0003] Background Muscle-specific kinase (MuSK) is a receptor-type tyrosine kinase essential for the establishment and maintenance of the neuromuscular junction (NMJ). Activation of MuSK by agrin, a heparan sulfate proteoglycan derived from nerves, and LRP4, an agrin receptor, leads to clustering of acetylcholine receptors (AChRs) on the postsynaptic side of the NMJ, enabling neuromuscular transmission and muscle contraction. The ectodomain of MuSK contains three immunoglobulin-like domains (Ig-like domains 1-3) and a cysteine-rich domain (Fz-CRD) related to domains in the Frizzled protein, a receptor for Wnt.

[0004] Many neuromuscular disorders are characterized by dysfunctional neuromuscular junctions (NMJs). The importance of MuSK signaling in establishing and maintaining synapses suggests that stimulating MuSK may have therapeutic potential for these disorders. In line with this hypothesis, MuSK overexpression was demonstrated to maintain innervation and motor function for over one month in a mouse model of amyotrophic lateral sclerosis (ALS). In addition, several monoclonal MuSK-binding scFvs were identified using phage display. One of these MuSK binders was produced in (mouse-like) IgG form and tested in ALS mice (see Cantor et al., "Preserving Neuromuscular Synapses in ALS by Stimulating MuSK with a Therapeutic Agonist Antibody," Elife 7:e34375 (2018), and Sengupta-Ghosh et al., "Muscle Specific Kinase (MuSK) Activation Preserves Neuromuscular Junctions in the Diaphragm but is not Sufficient to Provide a Functional Benefit in the SOD1G93A Mouse Model of ALS," Neurobiol. Dis. 124:340-352 (2019)). Both studies passively transferred antibody #13 to SOD1-G93A mice and demonstrated that treatment with antibody #13 improved NMJ innervation and delayed muscle denervation compared to mock-treated mice. Cantor et al., "Preserving Neuromuscular Synapses in ALS by Stimulating MuSK with a Therapeutic Agonist Antibody," Elife 7:e34375 (2018), further demonstrated that motor neuron survival and muscle function improved, resulting in a slight extension of lifespan.These studies have demonstrated that MuSK agonists have the ability to at least maintain the structural integrity of neuromuscular synapses in ALS mice, but further studies are needed to confirm improvements in muscle function. Evaluating the therapeutic potential of MuSK agonist antibodies in other neuromuscular disorders appears to be an important new research direction (Vergoossen et al., "MuSK Antibodies, Lessons Learned from Poly- and Monoclonality", J. Autoimmun. 112:102488 (2020)).

Prior Art Documents

Patent Documents

[0005]

Patent Document 1

Patent Document 2

Patent Document 3

Patent Document 4

Patent Document 5

Patent Document 6

Non-Patent Documents

[0006]

Non-Patent Document 1

Non-Patent Document 2

[0007] The present invention aims to overcome this and other shortcomings in the art. Brief explanation of the drawing [Brief explanation of the drawing]

[0008] [Figure 1A] Figures 1A–1D demonstrate that the C-terminal region of Dok7 is essential for synaptic differentiation. Figure 1A is a schematic diagram showing the plextrin homology (PH) domain and phosphotyrosine-binding (PTB) domain in Dok7, which mediate Dok7 dimerization and binding to tyrosine-phosphorylated MuSK. The C-terminal region contains two tyrosine residues, Y396 and Y406, which are phosphorylated after Dok7 recruitment to MuSK. The Dok7 1124_1127 dup mouse (also referred to herein as the Dok7 CM mouse and Dok7CM / CM mouse) exhibits the most common mutation seen in humans with congenital myasthenia gravis of Dok7, leading to frameshift, premature termination, and cleavage, including deletions of Y396 and Y406, of the Dok7 protein. Dok7 Y396F;Y406F (Dok7 2YF) mice have mutations in which Y396 and Y406 are replaced with phenylalanine. [Figure 1B] Figures 1A–1D demonstrate that the C-terminal region of Dok7 is essential for synaptic differentiation. Figure 1B shows the chi-squared analysis of offspring from hybridized Dok7CM / +C57BL / 6 mice, showing that Dok7CM / CM homozygous mice did not survive after birth. In contrast, Dok72YF / 2YF mice were present in the expected number when genotyped at P5–P10. [Figure 1C]Figures 1A to 1D demonstrate that the C-terminal region of Dok7 is essential for synaptic differentiation. Figure 1C shows fluorescence microscopy images of diaphragm muscle from wild-type, Dok7CM / CM, and Dok72YF / 2YF mice from E18.5, stained with Alexa488-α-BGT to label AChR (red) and stained with antibodies against neurofilaments / synapsin to label motor axons / nerve terminals (green). Scale bar = 10 μm. [Figure 1D] Figures 1A to 1D demonstrate that the C-terminal region of Dok7 is essential for synaptic differentiation. Figure 1D shows a graph indicating that the number of synapses, synaptic size, and synaptic AChR density were reduced to 1 / 4.5, 1 / 4, and 1 / 5, respectively, at E18.5. In Dok72YF / 2YF mice, synaptic size was normal, but synaptic AChR density was slightly reduced (15%). The shape of synapses in Dok72YF / 2YF mice often appeared elongated. The graphs show the values ​​for three mice of each genotype and the mean ± SEM values ​​of these mice (ns, not significant; p, ****<0.00005). [Figure 2A] Figures 2A–2D demonstrate that cleaved Dok7 is sufficiently expressed and MuSK tyrosine phosphorylation is significantly reduced in Dok7CM / CM mice. Figures 2A–2B are immunoblots of Dok7 immunoprecipitated from the muscle of E18.5 wild-type, Dok7CM / +, and Dok72YF / 2YF mice. The blots were probed with antibodies against Dok7 (Figures 9A–9B). Figure 9A shows that cleaved Dok7 (t-Dok7) encoded by Dok7CM migrates at the predicted size but is expressed at a level 1 / 3 times lower than wild-type Dok7. Quantification and comparison of wild-type and mutant proteins were simplified when the two proteins were co-immunoprecipitated from the same lysate; similar results were obtained by comparing expression in wild-type and Dok7CM / CM mice (Figures 10A–10C). The scatter plot shows the values ​​and mean ± SEM values ​​for 8 mice from each genotype (p, ****<0.00005). [Figure 2B]Figures 2A–2D demonstrate that truncated Dok7 is sufficiently expressed and MuSK tyrosine phosphorylation is significantly reduced in Dok7CM / CM mice. Figures 2A–2B are immunoblots of Dok7 immunoprecipitated from the muscle of E18.5 wild-type, Dok7CM / +, and Dok72YF / 2YF mice. Figure 2B shows that the mutant Dok7Y396F;Y406F protein migrates to the predicted size and its expression is similar to that of wild-type Dok7. The scatter plots show the values ​​and mean ± SEM values ​​(ns, not significant) for 11 mice of each genotype. [Figure 2C] Figures 2A to 2D demonstrate that truncated Dok7 is sufficiently expressed, and MuSK tyrosine phosphorylation is significantly reduced in Dok7CM / CM mice. Figures 2C to 2D show that MuSK was immunoprecipitated from the muscle of E18.5 wild-type, Dok7CM / CM, and Dok72YF / 2YF mice, and the blots were probed with antibodies against MuSK or phosphotyrosine. MuSK phosphorylation was quantified and normalized to MuSK expression. Figure 2C shows that MuSK phosphorylation is 1 / 7 times lower in Dok7CM / CM mice than in wild-type mice. The scatter plot shows the values ​​and mean ± SEM values ​​for 7 mice of each genotype (p, ****<0.00005). [Figure 2D] Figures 2A-2D demonstrate that truncated Dok7 is sufficiently expressed, and MuSK tyrosine phosphorylation is significantly reduced in Dok7CM / CM mice. Figures 2C-2D show that MuSK was immunoprecipitated from the muscle of E18.5 wild-type, Dok7CM / CM, and Dok72YF / 2YF mice, and the blots were probed with antibodies against MuSK or phosphotyrosine. MuSK phosphorylation was quantified and normalized to MuSK expression. Figure 2D shows that MuSK tyrosine phosphorylation is similar in Dok72YF / 2YF mice and wild-type mice. The scatter plot shows the values ​​and mean ± SEM values ​​(ns, not significant) for 5 mice of each genotype. [Figure 3A]Figures 3A–3D demonstrate reduced recruitment of CrK to synapses and the MuSK / Dok7 complex in Dok7CM / CM mice. Figure 3A shows Crk-L (green) colocalizing with AChR in synapses of a cross-section of the tibialis anterior muscle from E18.5 wild-type mice. Crk-L staining persists in synaptic sites of Dok7CM / CM and Dok72YF / 2YF mice, but recruitment appears to be reduced in the synapses of Dok7CM / CM mice. Scale bar = 5 μm. [Figure 3B] Figures 3A–3D demonstrate reduced recruitment of CrK to synapses and the MuSK / Dok7 complex in Dok7CM / CM mice. Figure 3B shows immunoprecipitation of MuSK from the muscle of E18.5 wild-type, Dok7CM / CM, and Dok72YF / 2YF mice, with blots probed with antibodies against MuSK or Crk. Levels of Crk co-isolated with the MuSK complex were normalized to MuSK expression. Association between Crk and the MuSK complex was reduced 1 / 2.8-fold in Dok7CM / CM mice; scatter plots show values ​​and mean ± SEM values ​​for 8 mice of each genotype (p, ****<0.00005). Association between Crk and the MuSK complex was reduced by 24% in Dok72YF / 2YF mice; mean ± SEM values ​​for 4 mice are shown (p, *<0.05, ****<0.00005). [Figure 3C] Figures 3A to 3D demonstrate that CrK recruitment to synapses and to the MuSK / Dok7 complex is reduced in Dok7CM / CM mice. Figure 3C shows that the MuSK perimembranous region (JM) contains a binding site for Dok7 (residues 547-554 of SEQ ID NO: 129) and a potential binding site for Crk (residues 554-557 of SEQ ID NO: 129). [Figure 3D]Figures 3A–3D demonstrate reduced recruitment of CrK to synapses and the MuSK / Dok7 complex in Dok7CM / CM mice. Figure 3D shows experimental results when HA-tagged Dok7 or Crk-I was expressed from transfected 293T cells. Biotin-tagged peptides from MuSK JM (SEQ ID NOs. 272–275) were incubated with lysates from transfected 293T cells. The biotin-tagged peptides were captured with streptavidin-agarose beads, and blots of isolated proteins were probed with antibodies against HA and Crk. Both Dok7 and Crk showed greater binding to phosphopeptides than to non-phosphorylated peptides. Mutations in the key asparagine at position -3 of the consensus (NPXY)PTB binding site of MuSK JM phosphopeptides prevented Dok7 binding but not Crk binding. In contrast, mutations in the consensus SH2 site of the MuSK JM phosphopeptide prevented Crk from binding to the MuSK JM phosphopeptide. [Figure 4A] Figures 4A to 4F demonstrate that antibodies against MuSK bind to human and mouse MuSK with high affinity, stimulate MuSK phosphorylation in cultured myotubes, and bind to MuSK in vivo. Figure 4A is a table showing the KD values ​​of antibody clones against different MuSK antigens, tested in monovalent Fab form using a bead-binding assay. KD values ​​are the mean and sd values ​​from n=3. Titrations are shown in Figures 12A to 12C. [Figure 4B] Figures 4A to 4F demonstrate that antibodies against MuSK bind to human and mouse MuSK with high affinity, stimulate MuSK phosphorylation in cultured myotubes, and bind to MuSK in vivo. Figure 4B shows the results of an experiment in which C2 myotubes were treated for 30 minutes with biotinylated Fab containing negative control Fab (isotype), each tetramerized by pre-incubation with streptavidin. MuSK was immunoprecipitated, and Western blots were probed with antibodies against MuSK or phosphotyrosine (pTyr). MuSK phosphorylation was normalized to total MuSK expression. The scatter plots show the values ​​and mean ± SEM for each Fab. [Figure 4C] Figures 4A to 4F demonstrate that antibodies against MuSK bind to human and mouse MuSK with high affinity, stimulate MuSK phosphorylation in cultured myotubes, and bind to MuSK in vivo. Figure 4C is a table showing the KD values ​​of IgG antibodies against immobilized hFz, hECD, mFz, and mECD, tested using a bead-based binding assay. KD values ​​are the mean and standard deviation from n=3. Titrations are shown in Figures 12A to 12C. [Figure 4D] Figures 4A to 4F demonstrate that antibodies against MuSK bind to human and mouse MuSK with high affinity, stimulate MuSK phosphorylation in cultured myotubes, and bind to MuSK in vivo. Figure 4D shows the results of an experiment in which C2 myotubes were treated with 10 nM antibodies X2, X3, or X17 containing either 0.5 nM agrin, the Fc region of mouse IgG2 or human IgG1, or an isotype control, and MuSK was analyzed as shown in Figure 4B. The scatter plot shows the MuSK phosphorylation values ​​normalized to MuSK expression and the mean ± SEM. [Figure 4E] Figures 4A to 4F demonstrate that antibodies against MuSK bind to human and mouse MuSK with high affinity, stimulate MuSK phosphorylation in cultured myotubes, and bind to MuSK in vivo. Figure 4E is a plot showing the blood half-life measurements of X17-mIgG2a-LALAPG. A nonlinear least-squares fitting of the median fluorescence intensity using a single exponential curve for three mice is shown. The half-life was determined to be 4.9 ± 0.2 days. [Figure 4F]Figures 4A to 4F demonstrate that antibodies against MuSK bind to human and mouse MuSK with high affinity, stimulate MuSK phosphorylation in cultured myotubes, and bind to MuSK in vivo. Figure 4F demonstrates that the MuSK antibody mIgG2a-X17 associates with MuSK at synapses and saturates MuSK at 10 mg / kg. P30 wild-type mice were intraperitoneally injected with the MuSK agonist antibody mIgG2a-X17 (0, 0.4, 2, 10 mg / kg). Two days later, the mice were sacrificed, and the diaphragm muscle was stained with Alexa488-α-BGT to label AChR, and stained with Alexa647 goat anti-human IgG, F(ab')2 fragment-specific to label X17. The saturation level of mIgG2a-X17 at synapses was measured by the ratio of X17 to AChR signal intensity. The average ± SEM values ​​from three mice at each concentration are shown. [Figure 5A] Figures 5A–5E demonstrate that the agonist antibody mIgG2a-X17 against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 5A shows that Dok7 1124_1127 dup mice survive for 1–2 weeks after birth in a C57BL / 6-CBA mixed background. Dok7 1124_1127 dup mice in the mixed background were treated to P4 with either the agonist antibody mIgG2a-X17 or an isotype-equivalent negative control. Dok7 1124_1127 dup mice (n=11) injected with isotype controls died at 1-2 weeks postnatology, similar to untreated mice. However, Dok7 1124_1127 dup mice (n=12) injected with mIgG2a-X17 at P4, P24, and P44 survived as adults. Of the 12 mutant mice injected with X17, 6 were sacrificed at P60. Three mutant mice injected with X17 died at 3 weeks postnatology, immediately before a second planned injection. Three mutant mice were aged for disease recurrence experiments. The scatter plots show survival time and mean ± SEM values ​​for each mouse (p, ****<0.00005). [Figure 5B]Figures 5A–5E demonstrate that the agonist antibody mIgG2a-X17 against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 5B shows that Dok7 1124_1127 dup mice injected with mIgG2a-X17 gained body weight, unlike Dok7 1124_1127 dup mice treated with isotype control antibodies. Dok7 1124_1127 dup mice were injected with mIgG2a-X17 (10 mg / kg) via P4, P24, and P44. [Figure 5C] Figures 5A–5E demonstrate that the agonist antibody mIgG2a-X17 against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 5C demonstrates that mIgG2a-X17 restores synaptic development in young Dok7 1124_1127 dup mice. Diaphragmatic muscle from P60 wild-type mice and Dok7 1124_1127 mice was stained with Alexa488-α-BGT to label AChRs, and motor axons / nerve terminals were stained with antibodies against βIII tubulin / synapsin to label them. In Dok7 1124_1127 dup mice treated with mIgG2a-X17, synapses matured from a simple plaque-like shape to a complex pretzel-like shape characteristic of mature mouse neuromuscular synapses. Scale bar = 10 mm. In Dok7 1124_1127 dup mice treated with mIgG2a-X17, synapse number, synapse size, and synaptic AChR density recovered to 60%, 60%, and 68% of normal levels, respectively. Mean ± SEM values ​​from 3 mice (>50 synapses per mouse) are shown (ns, **<0.005, ****<0.00005). [Figure 5D]Figures 5A–5E demonstrate that the agonist antibody mIgG2a-X17 against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 5D is an image showing that in a single muscle fiber isolated from the pretibialis muscle of Dok7 1124_1127 dup mice rescued with X17, Crk-L (center panel) is concentrated at synapses marked by AChR (left panel) and nerve terminals (right panel). Mean ± SEM values ​​from 3 mice (10 synapses per mouse; ns, not significant). Scale bar = 5 μm. [Figure 5E] Figures 5A–5E demonstrate that the agonist antibody mIgG2a-X17 against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 5E is a graph showing that mIgG2a-X17 rescues motor performance in Dok7 1124_1127 dup mice. Motor performance in Dok 1124 1127 dup mice was fully restored by treatment with mIgG2a-X17, as assessed by grip strength and latency to fall from a rotating rotor rod. The scatter plot shows the values ​​and mean ± SEM values ​​(ns, not significant) for 18 wild-type mice and 9 Dok7 1124_1127 dup mice rescued with X17. [Figure 6A]Figures 6A–6C demonstrate that mIgG2a-X17 improves disease relapse in adult Dok7 1124_1127 dup mice. Mice were injected with mIgG2a-X17 (10 mg / kg) via P4, P24, and P44, or P4, P18, and then antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained mobility for several months, but eventually began to lose weight (Figures 6A–6B) and began to show motor impairment, as assessed by grip strength and latency to fall from a rotating rotor rod (Figure 6C). At this point, mice were either not reinjected with mIgG2a-X17 (Figure 6A) or reinjected with mIgG2a-X17 (Figure 6B). Mice that were not reinjected died within a few days (Figure 6A), while Dok7 1124_1127 dup mice began to gain weight after resuming mIgG2a-X17 treatment (Figure 6B), and their motor impairments improved within one week of resuming treatment (Figure 6C). Dok7 1124_1127 dup mice showed a 5.5-fold improvement in motor performance on a rotord and a 1.25-fold improvement in grip strength (p, *<0.05, ***<0.0005 (Figure 6C)). [Figure 6B]Figures 6A–6C demonstrate that mIgG2a-X17 improves disease relapse in adult Dok7 1124_1127 dup mice. Mice were injected with mIgG2a-X17 (10 mg / kg) via P4, P24, and P44, or P4, P18, and then antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained mobility for several months, but eventually began to lose weight (Figures 6A–6B) and began to show motor impairment, as assessed by grip strength and latency to fall from a rotating rotor rod (Figure 6C). At this point, mice were either not reinjected with mIgG2a-X17 (Figure 6A) or reinjected with mIgG2a-X17 (Figure 6B). Mice that were not reinjected died within a few days (Figure 6A), while Dok7 1124_1127 dup mice began to gain weight after resuming mIgG2a-X17 treatment (Figure 6B), and their motor impairments improved within one week of resuming treatment (Figure 6C). Dok7 1124_1127 dup mice showed a 5.5-fold improvement in motor performance on a rotord and a 1.25-fold improvement in grip strength (p, *<0.05, ***<0.0005 (Figure 6C)). [Figure 6C]Figures 6A–6C demonstrate that mIgG2a-X17 improves disease relapse in adult Dok7 1124_1127 dup mice. Mice were injected with mIgG2a-X17 (10 mg / kg) via P4, P24, and P44, or P4, P18, and then antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained mobility for several months, but eventually began to lose weight (Figures 6A–6B) and began to show motor impairment, as assessed by grip strength and latency to fall from a rotating rotor rod (Figure 6C). At this point, mice were either not reinjected with mIgG2a-X17 (Figure 6A) or reinjected with mIgG2a-X17 (Figure 6B). Mice that were not reinjected died within a few days (Figure 6A), while Dok7 1124_1127 dup mice began to gain weight after resuming mIgG2a-X17 treatment (Figure 6B), and their motor impairments improved within one week of resuming treatment (Figure 6C). Dok7 1124_1127 dup mice showed a 5.5-fold improvement in motor performance on a rotord and a 1.25-fold improvement in grip strength (p, *<0.05, ***<0.0005 (Figure 6C)). [Figure 7] Figure 7 shows synaptic terminal plate width, denervation, and colocalization in Dok7 CM (i.e., Dok7 1124_1127 dup) mice. Terminal plate band width (dashed line) was increased by 45% in Dok7CM / CM mice, but was normal in Dok72YF / 2YF mice. In Dok7CM / CM mice, 17% of AChR clusters were not completely opposed by nerve terminals, suggesting denervation of muscle fibers. Many synapses in Dok7CM / CM mice were partially innervated, as nearly half of the AChR-enriched region at the synapse was not juxtaposed with the nerve terminal. Mean ± SEM values ​​(100 synapses per mouse) from 3 mice of each genotype are shown (p, *<0.05; p, **<0.005; p, ***<0.0005; p, ****<0.00005; ns not significant). Scale bar = 50 μm. [Figure 8]Figure 8 demonstrates that Y396 and Y406F in the carboxyl terminal region of Dok7 are not important for neuromuscular synapse maturation. Diaphragmatic muscle from wild-type P35 mice and Dok72YF / 2YF mice was stained with Alexa488-α-BGT to label AChRs, and motor axons / nerve terminals were labeled with antibodies against neurofilaments / synapsins. Scale bar = 10 μm. In Dok72YF / 2YF mice, synapses matured from a plaque-like shape to a complex pretzel-like shape characteristic of mature mouse neuromuscular synapses. The number of synapses was similar in wild-type and Dok72YF / 2YF mice. Synaptic AChR density and synaptic size were 15% and 20%, respectively, greater in Dok72YF / 2YF mice than in wild-type mice. The mean ± SEM values ​​(100 synapses per mouse) from three mice are shown (ns, not significant; p, ***<0.0005, ****<0.00005). [Figure 9A] Figures 9A and 9B demonstrate that wild-type and truncated Dok7 can be detected with similar efficiency using antibodies against the PH / PTB domain of Dok7. Figure 9A shows the results of an experiment in which HEK293 cells were transiently transfected with a plasmid expressing either HA-tagged Dok7 or HA-tagged truncated Dok7 encoded by Dok7 1124_1127 TGCC dup. Proteins (triple) in cell lysates were separated by SDS-PAGE, and Western blots were probed with either rabbit antibodies against the PTB domain of Dok7 or monoclonal antibodies against HA. The gray levels of the bands for wild-type and truncated Dok7 proteins were measured, and the levels detected by Western blotting were normalized with rabbit antibodies against Dok7, and in addition, the levels detected by Western blotting were normalized with antibodies against HA. The proportion of wild-type Dok7 was equivalent to that of truncated Dok7, indicating that rabbit antibodies against Dok7 detected both wild-type and truncated Dok7 proteins with similar efficiency using Western blotting. [Figure 9B]Figures 9A and 9B demonstrate that wild-type and cleaved Dok7 can be detected with similar efficiency using antibodies against the PH / PTB domain in Dok7. Figure 9B shows the results of an experiment in which wild-type and cleaved Dok7 were immunoprecipitated with similar efficiency using a goat antibody against the PTB domain of Dok7. HEK293 cells were transiently co-transfected with plasmids expressing HA-tagged Dok7 and HA-tagged cleaved Dok7 encoded by Dok7 1124_1127 TGCC dup. Dok7 protein was immunoprecipitated from cell lysates (triple) with either a monoclonal antibody against HA or a goat antibody against the PTB domain in Dok7, and Western blots were probed with a monoclonal antibody against HA. Gray levels were measured, and background band levels in control and untransfected samples were subtracted to normalize the values ​​of each protein immunoprecipitated with the goat antibody against Dok7 to the values ​​of the same protein immunoprecipitated with the antibody against HA. This ratio was similar for wild-type and cleaved Dok7 proteins, indicating that goat antibodies against Dok7 immunoprecipitated both wild-type and cleaved proteins with similar efficiency. The scatter plots in Figures 9A and 9B show the values ​​from the three experiments and the mean ± SEM (ns, not significant). [Figure 10A] Figures 10A–10C demonstrate that Dok7 RNA expression is normal in Dok7CM / CM mice. Figure 10A shows that RT-PCR amplification of Dok7 RNA showed similar Dok7 mRNA levels in muscle tissue from E18.5 wild-type mice and Dok7CM / CM mice. GAPDH was used as a loading control. [Figure 10B] Figures 10A to 10C demonstrate that Dok7 RNA expression is normal in Dok7CM / CM mice. Figure 10B shows the results of an experiment in which Dok7 mRNA levels were quantified by qPCR. The results showed that Dok7 mRNA levels were normal in Dok7CM / CM mice. The scatter plot shows the values ​​from three mice and the mean ± SEM values ​​(ns, not significant). [Figure 10C] Figures 10A–10C demonstrate that Dok7 RNA expression is normal in Dok7CM / CM mice. Figure 10C shows the results of an experiment in which Dok7 was immunoprecipitated from the muscle of E18.5 wild-type and Dok7CM / CM mice, and the blots were probed with an antibody against Dok7. The truncated Dok7 (t-Dok7) encoded by Dok7CM / CM migrates at the predicted size but is expressed at a lower level, about 1 / 3 times lower than wild-type Dok7. The scatter plot shows the values ​​and mean ± SEM values ​​for 10 mice from each genotype (p, ****<0.00005). [Figure 11] Figure 11 demonstrates that Y396 and Y406 are the major tyrosine residues in Dok7 that are phosphorylated by agrin stimulation when they are not the only tyrosine residues. Myotubes were cultured from wild-type and Dok72YF / 2YF mice and treated with agrin for 30 minutes. MuSK was immunoprecipitated, and Western blots were probed with antibodies against MuSK or phosphotyrosine (pTyr). Agrin stimulates Dok7 tyrosine phosphorylation in wild-type mice but not in Dok72YF / 2YF myotubes. [Figure 12A] Figures 12A–12C show the binding characteristics of MuSK antibody clones. Figures 12A–12C show the binding titration of antibodies against Fab-form MuSK to immobilized hFz, hECD, mFz, and mECD when tested using a bead-based binding assay. The curves show the optimal fit of the 1:1 binding model. KD values ​​are listed in Figure 5A. The datasets in Figures 12A and 12B were measured with different instruments and resulted in different signal ranges. [Figure 12B] Figures 12A–12C show the binding characteristics of MuSK antibody clones. Figures 12A–12C show the binding titration of antibodies against Fab-form MuSK to immobilized hFz, hECD, mFz, and mECD when tested using a bead-based binding assay. The curves show the optimal fit of the 1:1 binding model. KD values ​​are listed in Figure 5A. The datasets in Figures 12A and 12B were measured with different instruments and resulted in different signal ranges. [Figure 12C] Figures 12A–12C show the binding characteristics of MuSK antibody clones. Figures 12A–12C show the binding titration of antibodies against Fab-form MuSK to immobilized hFz, hECD, mFz, and mECD when tested using a bead-based binding assay. The curves show the optimal fit of the 1:1 binding model. KD values ​​are listed in Figure 5A. Figure 12C shows the binding titration of antibodies against IgG-form MuSK, performed in a similar manner to Figure 12A. [Figure 13A] Figures 13A–13D demonstrate that long-term injection of the MuSK agonist antibody mIgG2a-X17 does not affect survival, neuromuscular synaptic organization, weight gain, or motor behavior in wild-type mice. Figure 13A is a scatter plot showing the results of an experiment in which wild-type mice (n=4) injected with mIgG2a-X17 at P4, P24, and P44 in a C57BL / 6-CBA mixed background survived until sacrifice at P60. The scatter plot shows the survival time and mean ± SEM values ​​(ns, not significant) for 9 uninjected wild-type mice and 4 wild-type mice injected with mIgG2a-X17. [Figure 13B] Figures 13A to 13D demonstrate that long-term injection of the MuSK agonist antibody mIgG2a-X17 does not affect survival, neuromuscular synaptic organization, weight gain, or motor behavior in wild-type mice. Figure 13B is a plot showing experimental results in which wild-type mice (n=4) injected with mIgG2a-X17 gained weight similarly to wild-type mice (n=9). [Figure 13C]Figures 13A–13D demonstrate that long-term injection of the MuSK agonist antibody mIgG2a-X17 does not affect survival, neuromuscular synaptic organization, weight gain, or motor behavior in wild-type mice. Figure 13C shows that long-term injection of mIgG2a-X17 does not affect neuromuscular synaptic organization in wild-type mice. Diaphragmatic muscle from P60 wild-type mice and wild-type mice injected with mIgG2a-X17 was stained with Alexa488-α-BGT to label acetylcholine receptors (AChRs), and motor axons / nerve terminals were stained with antibodies against βIII tubulin / synapsin to label them. In wild-type mice treated with mIgG2a-X17, synapses matured from a simple plaque-like shape to a complex pretzel-like shape characteristic of mature mouse neuromuscular synapses. Scale bar = 10 mm. Injection of mIgG2a-X17 in wild-type mice did not affect synapse number, synapse size, or AChR density. 100 synapses from two mice in each category were analyzed. [Figure 13D] Figures 13A–13D demonstrate that long-term injection of the MuSK agonist antibody mIgG2a-X17 does not affect survival, neuromuscular synaptic organization, weight gain, or motor behavior in wild-type mice. Figure 13D is a scatter plot showing that long-term injection of mIgG2a-X17 does not affect motor behavior in wild-type mice. The motor performance of wild-type mice injected with mIgG2a-X17 was similar to that of uninjected wild-type mice, as assessed by grip strength and latency to fall from a rotating rotor rod. The scatter plots show values ​​and mean ± SEM values ​​(ns, not significant) for 18 wild-type mice and 4 wild-type mice injected with mIgG2a-X17. [Figure 14A]Figures 14A and 14B are tables showing that Dok7CM / CM mice with mixed genetic backgrounds survive for approximately two weeks after birth. The survival of Dok7CM / CM mice was analyzed using mixed genetic background mice. Dok7CM / + mice with a C57BL / 6 background were crossed with wild-type CBA, 129svl, FVB, or BALB / c mice. Then, heterozygous FI offspring were crossed to produce Dok7CM / CM mice with mixed backgrounds. Genotypes were determined in offspring or postmortem at P5-P10. Figure 14A is a table showing x2 square analysis of F2 mice, indicating that genotype development is unlikely to occur by chance and that homozygous Dok7CM / CM mice with each mixed genetic background survive after birth. [Figure 14B] Figures 14A and 14B are tables showing that Dok7CM / CM mice with a mixed genetic background survive for approximately two weeks after birth. The survival of Dok7CM / CM mice was analyzed using mixed genetic background mice. Dok7CM / + mice with a C57BL / 6 background were crossed with wild-type CBA, 129svl, FVB, or BALB / c mice. Then, heterozygous FI offspring were crossed to produce mixed-background Dok7CM / CM mice. Genotypes were determined for offspring or postmortem mice from P5 to P10. Figure 14B is a table showing the mean and maximum survival time (days) of homozygous Dok7CM / CM mice with a mixed genetic background. [Figure 15A]Figures 15A–15E demonstrate that the C-terminal region of Dok7 is essential for complete differentiation and maturation of neuromuscular synapses in Dok7CM / CM mice with a mixed genetic background. In Figures 15A–15C, diaphragmatic muscle tissue from wild-type mice and Dok7CM / CM mice with a C57BL / 6-CBA mixed genetic background in E18.5 and P10 was stained with Alexa488-α-BGT to label AChR (red) and stained with an antibody against neurofilaments / synapsin to label motor axons / nerve terminals (green). Figure 15A shows that in E18.5, the endplate band (white dashed line) is 30% wider in Dok7CM / CM mice than in wild-type mice. Furthermore, in Dok7CM / CM mice, nerve terminals were absent in 15% of AChR clusters, and the colocalization index (synapsin / AChR) was reduced by 1 / 3.5 times. Scale bar = 50 μm. Mean ± SEM values ​​from 3 mice are shown (p, *<0.05; p, ****<0.00005). [Figure 15B] Figures 15A–15E demonstrate that the C-terminal region of Dok7 is essential for complete differentiation and maturation of neuromuscular synapses in Dok7CM / CM mice with a mixed genetic background. In Figures 15A–15C, diaphragmatic muscle from wild-type mice and Dok7CM / CM mice with a C57BL / 6-CBA mixed genetic background in E18.5 and P10 was stained with Alexa488-α-BGT to label AChR (red) and stained with an antibody against neurofilaments / synapsins to label motor axons / nerve terminals (green). Figure 15B shows that in Dok7CM / CM mice in E18.5, the number of synapses, synapse size, and synaptic AChR density were reduced by 1 / 3.2, 1 / 4.5, and 1 / 8, respectively. Mean ± SEM values ​​from 3 mice (100 synapses per mouse) are shown (p, ****<0.00005). Scale bar = 10 μm. [Figure 15C]Figures 15A–15E demonstrate that the C-terminal region of Dok7 is essential for complete differentiation and maturation of neuromuscular synapses in Dok7CM / CM mice with a mixed genetic background. In Figures 15A–15C, diaphragmatic muscle from wild-type mice and Dok7CM / CM mice with a C57BL / 6-CBA mixed genetic background in E18.5 and P10 was stained with Alexa488-α-BGT to label AChRs (red) and stained with antibodies against neurofilaments / synapsins to label motor axons / nerve terminals (green). Figure 15C shows that in P10, the number of synapses, synapse size, and synaptic AChR density decreased by more than 1 / 10 in Dok7CM / CM mice. In addition, nerve terminals were absent from 20% of the AChR clusters in Dok7CM / CM mice. The mean ± SEM values ​​from 3 mice (100 synapses per mouse) are shown (p, ****<0.00005). [Figure 15D] Figures 15A–15E show that the C-terminal region of Dok7 is essential for complete differentiation and maturation of neuromuscular synapses in Dok7CM / CM mice in a mixed genetic background. Figure 15D shows Dok7 immunoprecipitated from the muscle of E18.5 wild-type and Dok7CM / CM mice, with blots probed with an antibody against Dok7. Truncate Dok7 (t-Dok7) encoded by Dok7CM / CM migrates at the predicted size but is expressed at a level 1 / 3 times lower than wild-type Dok7. Dok7 expression and MuSK phosphorylation were similarly reduced in C57BL / 6-CBA mixed breed and C57BL / 6 inbred mice, suggesting that other factors contributed to the increased survival rate in a mixed genetic background. Scatter plots show values ​​for 8 mice from each genotype and mean ± SEM values ​​(p, ****<0.00005). [Figure 15E]Figures 15A–15E demonstrate that the C-terminal region of Dok7 is essential for complete neuromuscular synaptic differentiation and maturation in Dok7CM / CM mice with a mixed genetic background. Figure 15E shows that MuSK was immunoprecipitated from the muscle of wild-type El8.5 and Dok7CM / CM mice, and the blots were probed with antibodies against MuSK, phosphotyrosine, and Crk. The levels of phosphotyrosine and Crk co-segregated with the MuSK complex were normalized to MuSK expression. Association of Crk with the MuSK complex was lower in Dok7CM / CM mice (1 / 2.8 times) than in wild-type mice. MuSK tyrosine phosphorylation was lower in Dok7CM / CM mice (1 / 5 times) than in wild-type mice. The scatter plot shows values ​​for 3 mice of each genotype and mean ± SEM values ​​(p, **<0.005, ****<0.00005). Scale bar = 10 μm. [Figure 16A] Figures 16A and 16B are tables showing that sequence analysis of potential off-target sites failed to identify mutations in these genes. Figure 16A shows the top potential off-target gene sequences 1-5 (sequence numbers 280-284) in Dok 7CM mice. [Figure 16B] Figures 16A and 16B are tables showing that sequence analysis of potential off-target sites failed to identify mutations in these genes. Figure 16B shows the top potential off-target gene sequences 1-5 (sequence numbers 285-289) in Dok72YF mice. [Figure 17A] Figures 17A to 17C are graphs showing that antibodies X2 and X3, like X17, rescued Dok7CM / CM mice from early lethality. Figure 17A shows the results of an experiment in which Dok7CM / CM mice in a C57BL / 6-CBA mixed background were injected with 10 mg / kg of mIgG2a-X3 at P4 (see also Figure 46B). At this dose, X3 did not rescue the mice from lethality. [Figure 17B]Figures 17A-17C are graphs showing that antibodies X2 and X3, like X17, rescued Dok7CM / CM mice from early lethality. Figure 17B, in contrast, shows that administration of 20 mg / kg of mIgG2a-X3 at P4 rescued mice from early lethality (see also Figure 47B). When these mice were subsequently injected with 10 mg / kg of mIgG2a-X3 at P18, they survived until P60, when the mice were sacrificed. [Figure 17C] Figures 17A to 17C are graphs showing that antibodies X2 and X3, like X17, rescued Dok7CM / CM mice from early lethality. Figure 17C shows that when Dok7CM / CM mice were administered 20 mg / kg of hIgG1-X2 at P4, they were similarly rescued from early lethality. Subsequently, when 10 mg / kg of hIgG1-X2 was injected at P18, the Dok7CM / CM mice survived until P60, when the mice were sacrificed. [Figure 18] Figure 18 is a schematic diagram illustrating the strategy for phage display selection in the Lama ImmunoFab library. [Figure 19] Figure 19 shows the results of ELISA experiments revealing poor antibody binding to human or mouse MuSK. [Figure 20] Figure 20 is a plot demonstrating that 3B2 rescues early postnatal lethality in Dok7 1124_1127 dup mice. [Figure 21] Figure 21 is a graph showing the phosphorylation percentage induced by the MuSK antibody of the present invention in a C2C12 phosphorylation assay. [Figure 22] Figure 22 is a graph showing the binding affinity of 3B2 antibodies and 3B2 antibody variants to MuSK in humans, cynomolgus monkeys, rats, or mice, as measured via ELISA. [Figure 23]Figure 23 is a graph showing the binding of MuSK agonists Fab (Fab X17, Fab X2, Fab X2m4, Fab X3, Fab 3B2, Fab 3B2g2m1, Fab X9) to mouse MuSK at pH 7.4 and pH 5.5 in Biacore. [Figure 24] Figure 24 is a scatter plot showing that MuSK phosphorylation can be co-stimulated by the natural ligand agrin and the agonist MuSK-mAb 3B2g2m1, which targets the Fz domain of MuSK. [Figure 25A] Figures 25A and 25B demonstrate that a combination of agonist antibodies mIgG2a-X17 and hIgG-X17 against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 25A is a scatter plot showing that Dok7 1124_1127 dup mice in a C57BL / 6-CBA mixed background survive for 1–2 weeks after birth. Dok7 1124_1127 dup mice in a mixed background were treated to P4 with either the agonist antibody X17 or the isotype-equivalent negative control motavizumab. Dok7 1124_1127 dup mice injected with isotype controls (n=11) died at 1-2 weeks postnatology, similar to untreated mice. However, Dok7 1124_1127 dup mice (n=3) injected with mIgG2a-X17 at P4 and hIgG-X17 at P24 and P44 survived as adults. Mutant mice injected with mIgG2a-X17, followed by hIgG-X17, were sacrificed at P60. The scatter plots show the survival time and mean ± SEM values ​​for each mouse (p, ****<0.00005). [Figure 25B]Figures 25A and 25B demonstrate that the combination of agonist antibodies mIgG2a-X17 and hIgG-X17 against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 25B is a plot showing that Dok7 1124_1127 dup mice injected with mIgG2a-X17, followed by hIgG-X17, gained body weight, unlike Dok7 1124_1127 dup mice treated with isotype control antibodies. Dok7 1124_1127 dup mice were injected with mIgG2a-X17 (10 mg / kg) at P4 and hIgG-X17 (10 mg / kg) at P24 and P44. [Figure 26] Figure 26 demonstrates that the combination of mIgG2a-X17 and hIgG-X17 rescues the motor performance of Dok7 1124_1127 dup mice. Motor performance in Dok7 1124_1127 dup mice was fully restored by treatment with the mIgG2a-X17 and hIgG-X17 combination, as assessed by grip strength (left panel) and latency to fall from a rotating rotor rod (right panel). The scatter plot shows the values ​​and mean ± SEM values ​​(ns, not significant) for 27 wild-type mice and 3 Dok7 1124_1127 dup mice rescued with the mIgG2a-X17 and hIgG-X17 combination. [Figure 27] Figure 27 demonstrates that the MuSK agonist antibody hIgG-X17 associates with MuSK at synapses and saturates MuSK at 20 mg / kg. P40 wild-type mice were intraperitoneally injected with MuSK agonist antibody hIgG-X17 (0, 2, 10, 20 mg / kg). Two days later, the mice were sacrificed, and the diaphragm muscle was stained with Alexa488-α-BGT to label AChR, and stained with Alexa647 goat anti-human IgG, F(ab')2 fragment-specific to label X17. The saturation level of X17 at synapses was measured by the ratio of X17 to AChR signal intensity. Mean ± SEM values ​​from three mice at each concentration are shown. [Figure 28A]Figures 28A and 28B demonstrate that the agonist antibody hIgG-X17 against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 28A is a scatter plot showing that Dok7 1124_1127 dup mice in a C57BL / 6-CBA mixed background survive for 1–2 weeks after birth. Dok7 1124_1127 dup mice in a mixed background were treated at P4 with the agonist antibody gG-X17 or the isotype-equivalent negative control motavizumab. Dok7 1124_1127 dup mice (n=11) injected with isotype controls died at 1-2 weeks postnatology, similar to untreated mice. However, Dok7 1124_1127 dup mice (n=4) injected with hIgG-X17 at P4, P18, and P38 or P4 and P18 survived as adults. Of the four mutant mice injected with hIgG-X17, two were sacrificed at P60, and two mutant mice were aged for disease recurrence experiments. The scatter plots show the survival time and mean ± SEM values ​​for each mouse (p, ****<0.00005). [Figure 28B] Figures 28A and 28B demonstrate that the agonist antibody hIgG-X17 against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 28B is a plot showing that Dok7 1124_1127 dup mice injected with hIgG-X17 gained body weight, unlike Dok7 1124_1127 dup mice treated with an isotype control antibody. Dok7 1124_1127 dup mice were injected with hIgG-X17 at P4 (20 mg / kg), P18, and P38 (10 mg / kg), or P4 (20 mg / kg) and P18 (10 mg / kg). [Figure 29]Figure 29 demonstrates that hIgG-X17 restores synaptic development in young Dok7 1124_1127 dup mice. Diaphragmatic muscle from wild-type P60 and Dok7 1124_1127 dup mice was stained with Alexa488-α-BGT to label AChRs, and motor axons / nerve terminals were labeled with antibodies against βIII tubulin / synapsin. In Dok7 1124_1127 dup mice treated with hIgG-X17, synapses matured from a simple plaque-like shape to a complex pretzel-like shape characteristic of mature mouse neuromuscular synapses. Scale bar = 10 mm. In Dok7 1124_1127 dup mice treated with hIgG-X17, synapse number, synapse size, and synaptic AChR density recovered to 70%, 50%, and 40% of normal levels, respectively. Mean ± SEM values ​​from two mice (>50 synapses per mouse) are shown. [Figure 30] Figure 30 demonstrates that hIgG-X17 rescues the motor performance of Dok7 1124_1127 dup mice. Motor performance in Dok7 1124_1127 dup mice was fully restored by treatment with hIgG-X17, as assessed by grip strength (left panel) and latency to fall from a rotating rotor rod (right panel). The scatter plot shows values ​​and mean ± SEM values ​​for 27 wild-type mice and 2 Dok7 1124_1127 dup mice rescued with hIgG-X17. [Figure 31A]Figures 31A–31C demonstrate that hIgG-X17 improves disease relapse in adult Dok7 1124_1127 dup mice. Dok7 1124_1127 dup mice were injected with MuSK agonist antibodies at P4, P24, and P44, or P4, P18, and then antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained mobility for several months, but eventually began to lose weight (Figures 31A, 31B) and began to show motor impairment, as assessed by grip strength and latency to fall from a rotating rotor rod (Figure 31C). At this point, the mice were either not reinjected with hIgG-X17 (Figure 31A) or reinjected with hIgG-X17 (Figure 31B). Mice that were not reinjected died within a few days (Figure 31A), while Dok7 1124_1127 dup mice began to gain weight after resuming X17 treatment (Figure 31B), and their motor impairments improved within one week of resuming treatment (Figure 31C, left panel). Dok7 1124_1127 dup mice showed a 3.25-fold improvement in rotorod performance, compared to a 1.30-fold improvement in wild-type mice (p, ***<0.0005). Dok7 1124_1127 dup mice also showed a 1.30-fold improvement in grip strength, compared to no improvement in wild-type mice (p, ***<0.0005) (Figure 31C). [Figure 31B]Figures 31A–31C demonstrate that hIgG-X17 improves disease relapse in adult Dok7 1124_1127 dup mice. Dok7 1124_1127 dup mice were injected with MuSK agonist antibodies at P4, P24, and P44, or P4, P18, and then antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained mobility for several months, but eventually began to lose weight (Figures 31A, 31B) and began to show motor impairment, as assessed by grip strength and latency to fall from a rotating rotor rod (Figure 31C). At this point, the mice were either not reinjected with hIgG-X17 (Figure 31A) or reinjected with hIgG-X17 (Figure 31B). Mice that were not reinjected died within a few days (Figure 31A), while Dok7 1124_1127 dup mice began to gain weight after resuming X17 treatment (Figure 31B), and their motor impairments improved within one week of resuming treatment (Figure 31C, left panel). Dok7 1124_1127 dup mice showed a 3.25-fold improvement in rotorod performance, compared to a 1.30-fold improvement in wild-type mice (p, ***<0.0005). Dok7 1124_1127 dup mice also showed a 1.30-fold improvement in grip strength, compared to no improvement in wild-type mice (p, ***<0.0005) (Figure 31C). [Figure 31C]Figures 31A–31C demonstrate that hIgG-X17 improves disease relapse in adult Dok7 1124_1127 dup mice. Dok7 1124_1127 dup mice were injected with MuSK agonist antibodies at P4, P24, and P44, or P4, P18, and then antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained mobility for several months, but eventually began to lose weight (Figures 31A, 31B) and began to show motor impairment, as assessed by grip strength and latency to fall from a rotating rotor rod (Figure 31C). At this point, the mice were either not reinjected with hIgG-X17 (Figure 31A) or reinjected with hIgG-X17 (Figure 31B). Mice that were not reinjected died within a few days (Figure 31A), while Dok7 1124_1127 dup mice began to gain weight after resuming X17 treatment (Figure 31B), and their motor impairments improved within one week of resuming treatment (Figure 31C, left panel). Dok7 1124_1127 dup mice showed a 3.25-fold improvement in rotorod performance, compared to a 1.30-fold improvement in wild-type mice (p, ***<0.0005). Dok7 1124_1127 dup mice also showed a 1.30-fold improvement in grip strength, compared to no improvement in wild-type mice (p, ***<0.0005) (Figure 31C). [Figure 32A] Figures 32A and 32B demonstrate that long-term injection of 3B2 does not affect survival or weight gain in wild-type mice. Figure 32A is a scatter plot showing that wild-type mice injected with 3B2 (n=3) at P4 and P18 in a C57BL / 6-CBA mixed background survived until sacrifice at P38. The scatter plot shows the survival times of four uninjected wild-type mice and three 3B2-injected wild-type mice, as well as the mean ± SEM values ​​(ns, not significant). [Figure 32B] Figures 32A and 32B demonstrate that long-term injection of 3B2 does not affect survival or weight gain in wild-type mice. Figure 32B is a scatter plot showing that wild-type mice injected with 3B2 (n=3) gained weight, similar to wild-type mice (n=4). [Figure 33A] Figures 33A and 33B demonstrate that the 3B2 agonist antibody against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 33A is a scatter plot showing that Dok7 1124_1127 dup mice in a C57BL / 6-CBA mixed background survive for 1–2 weeks after birth. Dok7 1124_1127 dup mice in a mixed background were treated at P4 with the agonist antibody 3B2 or the isotype-equivalent negative control motavizumab. Dok7 1124_1127 dup mice (n=11) injected with the isotype control died at 1-2 weeks postnatology, similar to untreated mice. However, Dok7 1124_1127 dup mice injected with 3B2 (n=3) at P4, P18, and P38, or at P4 and P18, survived as adults. Of the three mutant mice injected with 3B2, two were sacrificed at P60, and one mutant mouse was aged for disease recurrence experiments. The scatter plots show the survival time and mean ± SEM values ​​for each mouse (p, ****<0.00005). [Figure 33B] Figures 33A and 33B demonstrate that the 3B2 agonist antibody against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 33B is a scatter plot showing that Dok7 1124_1127 dup mice injected with 3B2 gained body weight, unlike Dok7 1124_1127 dup mice treated with isotype control antibodies. Dok7 1124_1127 dup mice were injected with 3B2 at P4 (20 mg / kg), P18, and P38 (10 mg / kg). [Figure 34]Figure 34 demonstrates that 3B2 restores synaptic development in young Dok7 1124_1127 dup mice. Diaphragmatic muscle from P60 wild-type mice and Dok7 1124_1127 dup mice was stained with Alexa488-α-BGT to label AChRs, and motor axons / nerve terminals were labeled with an antibody against βIII tubulin / synapsin. In Dok7 1124_1127 dup mice treated with 3B2, synapses matured from a simple plaque-like shape to a complex pretzel-like shape characteristic of mature mouse neuromuscular synapses. Scale bar = 10 mm. In Dok7 1124_1127 dup mice treated with 3B2, synaptic number, synaptic size, and synaptic AChR density were restored to 80%, 75%, and 40% of normal levels, respectively. The average ± SEM values ​​from two mice (>50 synapses per mouse) are shown. [Figure 35] Figure 35 demonstrates that 3B2 rescues the motor performance of Dok7 1124_1127 dup mice. Motor performance in Dok7 1124_1127 dup mice was fully restored by treatment with 3B2, as assessed by grip strength (left panel) and latency to fall from a rotating rotor rod (right panel). The scatter plot shows the values ​​and mean ± SEM values ​​for 27 wild-type mice and 2 Dok7 1124_1127 dup mice rescued with 3B2. [Figure 36] Figure 36 demonstrates that 3B2 keeps Dok7 1124_1127 dup mice healthy for at least two months. Dok7 1124_1127 dup mice were injected with 3B2 via P4, P18, and P38, and antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained mobility for several months, but eventually began to lose weight and died within a few days. [Figure 37]Figure 37 demonstrates that 3B2 improves disease relapse in adult Dok7 1124_1127 dup mice. Dok7 1124_1127 dup mice were injected with mIgG2a-X17 at P4, P24, and P44, and then antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained mobility for several months, but eventually began to lose weight. At this point, the mice were reinjected with 3B2. After resuming treatment with 3B2, these Dok7 1124_1127 dup mice began to gain weight. [Figure 38A] Figures 38A and 38B demonstrate that long-term injection of hIgG-X2 does not affect survival or weight gain in wild-type mice. Figure 38A is a scatter plot showing that wild-type mice (n=3) injected with hIgG-X2 at P4 and P18 in a C57BL / 6-CBA mixed background survived until sacrifice at P38. The scatter plot shows the survival time and mean ± SEM values ​​(ns, not significant) for four uninjected wild-type mice and three wild-type mice injected with hIgG-X2. [Figure 38B] Figures 38A and 38B demonstrate that long-term injection of hIgG-X2 in wild-type mice does not affect survival or weight gain. Figure 38B is a scatter plot showing that wild-type mice injected with hIgG-X2 (n=3) gained weight similarly to wild-type mice (n=4). [Figure 39A]Figures 39A and 39B demonstrate that the agonist antibody hIgG-X2 against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 39A is a scatter plot showing that Dok7 1124_1127 dup mice in a C57BL / 6-CBA mixed background survive for 1–2 weeks after birth. Dok7 1124_1127 dup mice in a mixed background were treated at P4 with the agonist antibody gG-X2 or the isotype-equivalent negative control motavizumab. Dok7 1124_1127 dup mice (n=11) injected with isotype controls died at 1-2 weeks postnatology, similar to untreated mice. However, Dok7 1124_1127 dup mice (n=2) injected with hIgG-X2 at P4 and P18 survived as adults. Mutant mice injected with hIgG-X2 were aged for disease recurrence experiments. The scatter plots show the survival time and mean ± SEM values ​​for each mouse (p, ****<0.00005). [Figure 39B] Figures 39A and 39B demonstrate that the agonist antibody hIgG-X2 against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 39B is a scatter plot showing that Dok7 1124_1127 dup mice injected with hIgG-X2 gained body weight, unlike Dok7 1124_1127 dup mice treated with an isotype control antibody. Dok7 1124_1127 dup mice were injected with hIgG-X2 at P4 (20 mg / kg) and P18 (10 mg / kg). [Figure 40A]Figures 40A and 40B demonstrate that hIgG-X2 improves disease relapse in adult Dok7 1124_1127 dup mice. Dok7 1124_1127 dup mice were injected with hIgG-X2 at P4 and P18, and then antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained mobility for several weeks, but eventually began to lose weight (Figure 40A) and began to show motor impairment, as assessed by grip strength and latency to fall from a rotating rotor rod (Figure 40B). At this point, the mice were reinjected with hIgG-X2. After resuming X2 treatment, Dok7 1124_1127 dup mice began to gain weight (Figure 40A), and within 3 weeks after resuming treatment, their motor impairment had completely improved (Figure 40B). [Figure 40B] Figures 40A and 40B demonstrate that hIgG-X2 improves disease relapse in adult Dok7 1124_1127 dup mice. Dok7 1124_1127 dup mice were injected with hIgG-X2 at P4 and P18, and then antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained mobility for several weeks, but eventually began to lose weight (Figure 40A) and began to show motor impairment, as assessed by grip strength and latency to fall from a rotating rotor rod (Figure 40B). At this point, the mice were reinjected with hIgG-X2. After resuming X2 treatment, Dok7 1124_1127 dup mice began to gain weight (Figure 40A), and within 3 weeks after resuming treatment, their motor impairment had completely improved (Figure 40B). [Figure 41A]Figures 41A and 41B demonstrate that the agonist antibody hIgG-X2m4 against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 41A is a scatter plot showing that Dok7 1124_1127 dup mice in a C57BL / 6-CBA mixed background survive for 1–2 weeks after birth. Dok7 1124_1127 dup mice in a mixed background were treated at P4 with either the agonist antibody hIgG-X2m4 or the isotype-equivalent negative control motavizumab. Dok7 1124_1127 dup mice (n=11) injected with isotype controls died at 1-2 weeks postnatology, similar to untreated mice. However, Dok7 1124_1127 dup mice (n=3) injected with hIgG-X2m4 at P4 and P18 survived as adults. Mutant mice injected with hIgG-X2m4 were monitored for survival or aged for disease recurrence experiments using hIgG-X17. The scatter plots show survival time and mean ± SEM values ​​for each mouse (p, ****<0.00005). [Figure 41B] Figures 41A and 41B demonstrate that the agonist antibody hIgG-X2m4 against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 41B is a scatter plot showing that Dok7 1124_1127 dup mice injected with hIgG-X2m4 gained body weight, unlike Dok7 1124_1127 dup mice treated with an isotype control antibody. Dok7 1124_1127 dup mice were injected with hIgG-X2m4 at P4 (20 mg / kg) and P18 (10 mg / kg). One mouse was used for a disease recurrence experiment using hIgG-X17, while the other mice were monitored for survival. [Figure 42]Figure 42 is a scatter plot showing that hIgG-X2m4 keeps Dok7 1124_1127 dup mice healthy for at least two months. Dok7 1124_1127 dup mice were injected with X2m4 at P4 and P18, and then antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained mobility for several months, but eventually began to lose weight and died within a few days. [Figure 43A] Figures 43A and 43B demonstrate that long-term injection of mIgG2a-X3 does not affect survival or weight gain in wild-type mice. Figure 43A is a scatter plot showing that two wild-type mice (n=2) injected with mIgG2a-X3 at P4, P24, and P44 in a C57BL / 6-CBA mixed background survived until sacrifice at P60. The scatter plot shows the survival time and mean ± SEM values ​​for nine uninjected wild-type mice and two wild-type mice injected with mIgG2a-X3. [Figure 43B] Figures 43A and 43B demonstrate that long-term injection of mIgG2a-X3 does not affect survival or weight gain in wild-type mice. Figure 43B is a scatter plot showing that wild-type mice injected with mIgG2a-X3 (n=2) gained weight similarly to wild-type mice that were not injected (n=9). [Figure 44] Figure 44 demonstrates that long-term injection of mIgG2a-X3 in wild-type mice does not affect the tissue of neuromuscular synapses. Diaphragmatic muscle from P60 wild-type mice and wild-type mice injected with mIgG2a-X3 was stained with Alexa488-α-BGT to label acetylcholine receptors and stained with an antibody against βIII-tubulin / synapsin to label motor axons / nerve terminals. In wild-type mice treated with mIgG2a-X3, synapses matured from a simple plaque-like shape to a complex pretzel-like shape characteristic of mature mouse neuromuscular synapses. Scale bar = 10 mm. Injection of mIgG2a-X3 in wild-type mice did not affect synapse number, synapse size, or AChR density. 100 synapses from two mice in each category were analyzed. [Figure 45]Figure 45 demonstrates that long-term injection of mIgG2a-X3 does not affect motor behavior in wild-type mice. Motor performance in wild-type mice injected with mIgG2a-X3 was similar to that of uninjected wild-type mice, as assessed by grip strength (left panel) and latency to fall from a rotating rotor rod (right panel). The scatter plot shows values ​​and mean ± SEM values ​​for 27 wild-type mice and 2 wild-type mice injected with mIgG2a-X3. [Figure 46A] Figures 46A and 46B demonstrate that 10 mg / kg of mIgG2a-X3, an agonist antibody against MuSK, rescues young Dok7 1124_1127 dup mice from lethality for several days at P4. Figure 46A is a scatter plot showing that Dok7 1124_1127 dup mice survive for 1–2 weeks after birth in a C57BL / 6-CBAno mixed background. Dok7 1124_1127 dup mice in a mixed background were treated at P4 with either the agonist antibody mIgG2a-X3 or the isotype-equivalent negative control motavizumab. Dok7 1124_1127 mice injected with isotype control (n=11) and Dok7 1124_1127 mice injected with mIgG2a-X33 (n=4) died at 1-2 weeks postnatology, similar to untreated mice. The scatter plot shows the survival time and mean ± SEM values ​​for each mouse (p, **<0.05). [Figure 46B] Figures 46A and 46B demonstrate that 10 mg / kg of mIgG2a-X3, an agonist antibody against MuSK, rescues young Dok7 1124_1127 dup mice from lethality for several days at P4. Figure 46B is a scatter plot showing that Dok7 1124_1127 dup mice injected with mIgG2a-X3 did not gain body weight, similar to Dok7 1124_1127 dup mice treated with an isotype control antibody. Dok7 1124_1127 dup mice were injected with mIgG2a-X3 (10 mg / kg) at P4. [Figure 47A]Figures 47A and 47B demonstrate that 20 mg / kg of the agonist antibody mIgG2a-X3 against MuSK rescues lethality in young Dok7 1124_1127 dup mice at P4. Figure 47A is a scatter plot showing that Dok7 1124_1127 dup mice in a C57BL / 6-CBA mixed background survive for 1–2 weeks after birth. Dok7 1124_1127 dup mice in a mixed background were treated at P4 with either the agonist antibody mIgG2a-X3 (20 mg / kg) or the isotype-equivalent negative control motavizumab. Dok7 1124_1127 dup mice injected with the isotype control (n=11) died at 1–2 weeks after birth, similar to untreated mice. Dok7 1124_1127 dup mice (n=2) injected with mIgG2a-X3 at P4 (20 mg / kg) and P18 (10 mg / kg) survived as adults. Mutant mice injected with mIgG2a-X3 were aged for disease recurrence experiments. The scatter plot shows the survival time and mean ± SEM values ​​for each mouse. [Figure 47B] Figures 47A and 47B demonstrate that the agonist antibody mIgG2a-X3 against MuSK, administered at 20 mg / kg in P4, rescues lethality in young Dok7 1124_1127 dup mice. Figure 47B is a scatter plot showing that Dok7 1124_1127 dup mice injected with mIgG2a-X3 gained body weight, unlike Dok7 1124_1127 dup mice treated with isotype control antibodies. Dok7 1124_1127 dup mice were injected with mIgG2a-X3 at P4 (20 mg / kg) and P18 (10 mg / kg). [Figure 48] Figure 48 demonstrates that mIgG2a-X3 keeps Dok7 1124_1127 dup mice healthy for at least two months. Dok7 1124_1127 dup mice were injected with mIgG2a-X3 at P4 and P18, and then antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained mobility for two months, but eventually began to lose weight and died within a few days. [Figure 49A] Figures 49A and 49B demonstrate that the agonist antibody mIgG2a-X9 against MuSK can rescue lethality in young Dok7 1124_1127 dup mice. Figure 49A is a scatter plot showing that Dok7 1124_1127 dup mice in a C57BL / 6-CBA mixed background survive for 1–2 weeks after birth. Dok7 1124_1127 dup mice in a mixed background were treated to P4 with either the agonist antibody mIgG2a-X9 or the isotype-equivalent negative control motavizumab. Dok7 1124_1127 dup mice injected with the isotype control (n=11) and Dok7 1124_1127 dup mice injected with mIgG2a-X9 (n=6) died at 1–2 weeks after birth, similar to untreated mice. Only one Dok7 1124_1127 dup mouse, injected with mIgG2a-X9 (10 mg / kg) at P4, P24, and P44, survived to P60. The scatter plot shows the survival time and mean ± SEM value for each mouse (ns, not statistically significant). [Figure 49B] Figures 49A and 49B demonstrate that the agonist antibody mIgG2a-X9 against MuSK can rescue lethality in young Dok7 1124_1127 dup mice. Figure 49B is a scatter plot showing that Dok7 1124_1127 dup mice injected with mIgG2a-X9 did not gain body weight, similar to Dok7 1124_1127 dup mice treated with isotype control antibodies. Only one Dok7 1124_1127 dup mouse injected with mIgG2a-X9 gained body weight over time. Dok7 1124_1127 dup mice were injected with mIgG2a-X9 (10 mg / kg) via P4, P24, and P44. [Figure 50]Figure 50 demonstrates that the MuSK agonist antibody 3B2g2m1 associates with MuSK at synapses and saturates MuSK at 20 mg / kg. P30 wild-type mice were intraperitoneally injected with MuSK agonist antibody 3B2g2m1 (0, 2, 10, 20 mg / kg). Two days later, the mice were sacrificed, and the diaphragm muscle was stained with Alexa488-α-BGT to label AChR, and stained with Alexa647 goat anti-human IgG, F(ab')2 fragment-specific to label 3B2g2m1. The saturation level of 3B2g2m1 at synapses was measured by the ratio of the signal intensity of 3B2g2m1 to AChR. Mean ± SEM values ​​from three mice at each concentration are shown. [Figure 51A] Figures 51A and 51B demonstrate that long-term injection of 3B2g2m1 does not affect survival or weight gain in wild-type mice. Figure 51A is a scatter plot showing that wild-type mice (n=6) injected with 10 mg / kg of 3B2g2m1 in P4, P24, and P44 in a C57BL / 6-CBA mixed background survived and gained weight similarly to wild-type mice (n=6) injected with 10 mg / kg of the isotype-equivalent negative control motabizumab in P4, P24, and P44. [Figure 51B] Figures 51A and 51B demonstrate that long-term injection of 3B2g2m1 does not affect survival or weight gain in wild-type mice. Figure 51B is a scatter plot showing that wild-type mice in a C57BL / 6-CBA mixed background, initiated with 3B2g2m1 at 20 mg / kg in phase 4 and injected twice weekly, survived and gained weight, similar to wild-type mice that were administered motavizumab, an isotype-equivalent negative control, initiated with 20 mg / kg in phase 4 and injected twice weekly. [Figure 52A]Figures 52A and 52B demonstrate that the agonist antibody 3B2g2m1 against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 52A is a scatter plot showing that Dok7 1124_1127 dup mice in a C57BL / 6-CBA mixed background survive for 1–2 weeks after birth. Dok7 1124_1127 dup mice in a mixed background were treated to P4 with either the agonist antibody 3B2g2m1 or the isotype-equivalent negative control motavizumab. Dok7 1124_1127 dup mice (n=11) injected with isotype controls died at 1-2 weeks postnatology, similar to untreated mice. However, Dok7 1124_1127 dup mice (n=10) injected with 3B2g2m1 at P4 (20 mg / kg), P18 (10 mg / kg), and P38 (10 mg / kg) survived as adults. Of the 10 mutant mice injected with 3B2g2m1, 3 were sacrificed at P60 and 7 were aged for disease recurrence experiments. The scatter plots show the survival time and mean ± SEM values ​​for each mouse (p, ****<0.00005). [Figure 52B] Figures 52A and 52B demonstrate that the agonist antibody 3B2g2m1 against MuSK rescues lethality in young Dok7 1124_1127 dup mice. Figure 52B is a scatter plot showing that Dok7 1124_1127 dup mice injected with 3B2g2m1 gained body weight, unlike Dok7 1124_1127 dup mice treated with an isotype control antibody. Dok7 1124_1127 dup mice were injected with 3B2g2m1 at P4 (20 mg / kg), P18 (10 mg / kg), and P44 (10 mg / kg). [Figure 53]Figure 53 demonstrates that 3B2g2m1 restores synaptic development in young Dok7 1124_1127 dup mice. Diaphragmatic muscle from P60 wild-type mice and Dok7 1124_1127 dup mice was stained with Alexa488-α-BGT to label AChRs, and motor axons / nerve terminals were labeled with antibodies against βIII tubulin / synapsin. In Dok7 1124_1127 dup mice treated with 3B2g2m1, synapses matured from a simple plaque-like shape to a complex pretzel-like shape characteristic of mature mouse neuromuscular synapses. Scale bar = 10 mm. In Dok7 1124_1127 dup mice treated with 3B2g2m1, synapse number, synapse size, and synaptic AChR density recovered to 80%, 50%, and 60% of normal levels, respectively. Mean ± SEM values ​​from 3 mice (>50 synapses per mouse) are shown (p, *<0.05, ****<0.00005). [Figure 54] Figure 54 demonstrates that 3B2g2m1 rescues the motor performance of Dok7 1124_1127 dup mice. Motor performance in Dok7 1124_1127 dup mice was fully restored by treatment with 3B2g2m1, as assessed by grip strength (left panel) and latency to fall from a rotating rotor rod (right panel). The scatter plot shows values ​​and mean ± SEM values ​​(ns, not significant) for 27 wild-type mice and 10 Dok7 1124_1127 dup mice rescued with 3B2g2m1. [Figure 55]Figure 55 demonstrates that 3B2g2m1 keeps Dok7 1124_1127 dup mice healthy for at least two months. Dok7 1124_1127 dup mice were injected with 3B2g2m1 into p4, p18, and p38, after which antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained their motility for several months, but eventually began to lose weight. At this point, the mice were re-injected with either 5 mg / kg or 10 mg / kg of 3B2g2m1. After resuming 3B2g2m1 treatment, the Dok7 1124_1127 dup mice began to gain weight again. [Figure 56A] Figures 56A–56C demonstrate that 3B2g2m1 improves disease recurrence in adult Dok7 1124_1127 dup mice. Dok7 1124_1127 dup mice were injected with 3B2g2m1 at P4, P18, and P38, and antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained their motility for several months, but eventually began to lose weight (Figure 56A) and began to show motor impairment, as assessed by grip strength and latency to fall from a rotating rotor rod (Figure 56B). At this point, the mice were re-injected with 3B2g2m1 (Figure 56A). After resuming treatment with 3B2g2m1, the Dok7 1124_1127 dup mice began to gain weight (Figure 56A), and their motor impairments improved within one week of resuming treatment (Figures 56B-56C). The Dok7 1124_1127 dup mice showed a 5.5-fold improvement in rotorod performance (Figure 56b) and a 1.1-fold improvement in grip strength (Figure 56c). [Figure 56B]Figures 56A–56C demonstrate that 3B2g2m1 improves disease recurrence in adult Dok7 1124_1127 dup mice. Dok7 1124_1127 dup mice were injected with 3B2g2m1 at P4, P18, and P38, and antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained their motility for several months, but eventually began to lose weight (Figure 56A) and began to show motor impairment, as assessed by grip strength and latency to fall from a rotating rotor rod (Figure 56B). At this point, the mice were re-injected with 3B2g2m1 (Figure 56A). After resuming treatment with 3B2g2m1, the Dok7 1124_1127 dup mice began to gain weight (Figure 56A), and their motor impairments improved within one week of resuming treatment (Figures 56B-56C). The Dok7 1124_1127 dup mice showed a 5.5-fold improvement in rotorod performance (Figure 56b) and a 1.1-fold improvement in grip strength (Figure 56c). [Figure 56C] Figures 56A–56C demonstrate that 3B2g2m1 improves disease recurrence in adult Dok7 1124_1127 dup mice. Dok7 1124_1127 dup mice were injected with 3B2g2m1 at P4, P18, and P38, and antibody treatment was discontinued. These Dok7 1124_1127 dup mice gained weight and maintained their motility for several months, but eventually began to lose weight (Figure 56A) and began to show motor impairment, as assessed by grip strength and latency to fall from a rotating rotor rod (Figure 56B). At this point, the mice were re-injected with 3B2g2m1 (Figure 56A). After resuming treatment with 3B2g2m1, the Dok7 1124_1127 dup mice began to gain weight (Figure 56A), and their motor impairments improved within one week of resuming treatment (Figures 56B-56C). The Dok7 1124_1127 dup mice showed a 5.5-fold improvement in rotorod performance (Figure 56b) and a 1.1-fold improvement in grip strength (Figure 56c). [Figure 57]Figure 57 demonstrates that the agonist antibody 3B2g2m1 against MuSK rescues lethality in young Dok7 1124_1127 dup mice (long-term administration twice weekly). Figure 57 demonstrates that Dok7 1124_1127 dup mice in a C57BL / 6-CBA mixed background survive for 1-2 weeks after birth. Dok7 1124_1127 dup mice in a mixed background were treated with the agonist antibody 3B2g2m1 (20 mg / kg) twice weekly, starting from phase 4. Dok7 1124_1127 dup mice injected with 3B2g2m1 (n=4) survived as adults and gained body weight. [Figure 58A] Figures 58A to 58C show that MuSK antibody treatment extends the survival of Dok7 1124_1127 dup mice. Figure 58A shows survival plots of Dok7 1124_1127 dup mice injected with the indicated MuSK agonist antibody or isotype control (motavizumab) at P4 (20 mg / kg), P18 (10 mg / kg), and P38 (10 mg / kg). [Figure 58B] Figures 58A to 58C show that MuSK antibody treatment extends the survival of Dok7 1124_1127 dup mice. Figure 58B shows the survival plot of Dok7 1124_1127 dup mice injected with MuSK agonist antibody or isotype control (motavizumab) at P4 (20 mg / kg) and P18 (10 mg / kg). [Figure 58C] Figures 58A–58C show that MuSK antibody treatment extends the survival of Dok7 1124_1127 dup mice. Figure 58C shows the survival plot of Dok7 1124_1127 dup mice that were reinjected with the indicated MuSK agonist antibody (10 mg / kg) (treatment resumed) several days after weight loss (Figure 58C) occurred. These results demonstrate that injection of MuSK agonist antibody extends the survival of Dok7 1124_1127 dup mice. [Modes for carrying out the invention]

[0009] Detailed explanation general definition The following terms and definitions are provided solely to aid in the understanding of the present invention. Unless otherwise defined herein, all terms used herein have the same meaning as commonly understood by those skilled in the art. For practitioners, the definitions and terms of the art are shown in particular to Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Press, Plainsview, New York (1989), and Ausubel et al., Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999). The definitions provided herein should not be construed as having a narrower scope than that understood by those skilled in the art.

[0010] Unless otherwise indicated, all methods, processes, techniques, and operations not specifically described can and have been carried out in ways that are known to those skilled in the art. For example, refer again to standard handbooks, the general background art mentioned above, and the further references cited therein.

[0011] As used herein, the singular forms "a," "an," and "the" include both singular and plural references, unless the context clearly indicates otherwise.

[0012] As used herein, the terms “comprising,” “comprises,” and “comprised of” are synonymous with “including,” “uncludes,” or “containing,” and are inclusive or open, and do not exclude additional, unlisted members, compounds, products, elements, or process steps. The expression “essentially consists of” as used in the context of a product or composition (e.g., “a product essentially consisting of” or “a composition essentially consisting of”) means that additional molecules may be present, but such molecules do not alter the characteristics / activity / functionality of the product or composition. For example, if a composition itself exhibits similar characteristics / activity / functionality as one of an antibody or one of an antibody fragment, then the composition may essentially consist of an antibody or an antibody fragment.

[0013] The enumeration of numerical ranges by endpoints includes all numbers and fractions contained within each range, as well as the enumerated endpoints.

[0014] As used herein, the term “about” means, when referring to a measurable value such as a parameter, quantity, or duration, to include variations of + / -10%, preferably + / -5%, more preferably + / -1%, and even more preferably + / -0.1% or less of the specified value, insofar as such variations are appropriate for the disclosed invention. It should be understood that the values ​​referred to by the modifier “about” are also specifically and preferably disclosed.

[0015] As used herein, amino acid residues are indicated by their full names or according to standard three-letter or one-letter amino acid codes.

[0016] As used herein, the terms “polypeptide” and “protein” are used interchangeably and refer to macromolecular forms of amino acids of any length, which may include coded and uncoded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having a modified peptide backbone. “Peptide” is also a polymer of amino acids, typically having a length of up to 50 amino acids. Polypeptides or peptides are represented by an amino acid sequence.

[0017] As used herein, the terms “nucleic acid molecule,” “polynucleotide,” “polynucleic acid,” and “nucleic acid” are interchangeable and refer to macromolecular forms of nucleotides of any length, whether deoxyribonucleotides, ribonucleotides, or their analogues. A nucleic acid molecule is represented by a nucleic acid sequence, characterized primarily by its base sequence. A polynucleotide may have any three-dimensional structure and may perform any known or unknown function. Non-limiting examples of polynucleotides include genes, gene fragments, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, regulatory regions, isolated RNA of any sequence, nucleic acid probes, and primers. A nucleic acid molecule may be linear or cyclic.

[0018] As used herein, the term “homology” refers to the identity or similarity, at least of secondary structure, between two macromolecules from the same or different taxa, particularly between two polypeptides or polynucleotides, where such similarity is attributable to a common ancestor. Thus, the term “homolog” refers to a macromolecule so related that possesses such secondary and, optionally, tertiary structure similarity. To compare two or more nucleotide sequences, the “percentage of sequence identity” between a first nucleotide sequence and a second nucleotide sequence may be calculated using methods known to those skilled in the art, for example, by dividing the number of nucleotides in the first nucleotide sequence that are identical to the nucleotides at the corresponding positions in the second nucleotide sequence by the total number of nucleotides in the first nucleotide sequence and multiplying by 100%, or by using known computer algorithms for sequence alignment such as NCBI Blast. In determining the degree of sequence similarity between two amino acid sequences, those skilled in the art may consider so-called “conservative” amino acid substitutions. A “conservative” amino acid substitution is generally described as an amino acid substitution in which an amino acid residue is replaced by another amino acid residue with a similar chemical structure, and which has little or no effect on the function, activity, or other biological properties of a polypeptide. Possible conservative amino acid substitutions have already been illustrated herein. Amino acid sequences and nucleic acid sequences are said to be “completely identical” if they have 100% sequence identity over their entire length.

[0019] Throughout this application, in each instance where a specific amino acid sequence number (e.g., sequence number Y) is referenced, that sequence may be replaced with a polypeptide containing an amino acid sequence having at least 80% sequence identity or similarity to the amino acid sequence number Y. Throughout this application, the phrase "the sequence is at least X% identical to another sequence" may be replaced with "the sequence has at least X% sequence identity to another sequence."

[0020] Each amino acid sequence described herein by its identity percentage (at least 80%) with a given amino acid sequence is, in a further preferred embodiment, identical to the given amino acid sequence by at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more. In a preferred embodiment, sequence identity is determined by comparing the full lengths of the sequences identified herein. Each amino acid sequence described herein, by a percentage of similarity (at least 80%) to a given amino acid sequence, in a further preferred embodiment, has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more similarity to the given amino acid sequence. In a preferred embodiment, sequence similarity is determined by comparing the full lengths of the sequences identified herein. Unless otherwise indicated herein, identity or similarity to a given sequence number means identity or similarity based on the full length of the sequence (i.e., across its entire length or as a whole).

[0021] "Sequence identity" is defined herein as the relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences determined by comparing their sequences. Identity between two amino acid sequences is preferably defined by evaluating identity within the entire sequence number or a portion thereof as specified herein. A portion thereof may mean at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90% of the length of the sequence number.

[0022] In this technical field, "identity" also means the degree of sequence relevance between amino acid sequences, which may be determined by the matching of amino acid sequence strings. The "similarity" between two amino acid sequences is determined by comparing the amino acid sequence and its conserved amino acid substitutions of one polypeptide with the sequence of the second polypeptide. "Identity" and "similarity" can be readily calculated by known methods, including, but are not limited to, Computational Molecular Biology, edited by Lesk, AM, Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, edited by Smith, DW, Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, edited by Griffin, AM and Griffin, HG, Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heine, G., Academic Press, 1987; Sequence Analysis Primer, edited by Gribskov, M. and Devereux, J., M Stockton Press, New York, 1991; and the method described in Carillo, H. and Lipman, D., SIAM, J. Applied Math., 48:1073 (1988).

[0023] A preferred method for determining identity is designed to give the greatest match between the sequences being tested. Methods for determining identity and similarity are systematized in publicly available computer programs. Preferred computer programs for determining identity and similarity between two sequences include, for example, the GCG program package (Devereux, J. et al., Nucleic Acids Research 12(1): p. 387 (1984)), BestFit, FASTA, BLASTN, and BLASTP (Altschul, SF et al., J. Mol. Biol. 215: pp. 403-410 (1990)), and EMBOSS Needle (Madeira, F. et al., Nucleic Acids Research 47(W1): pp. W636-W641 (2019)). The BLAST program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al., NCBI NLM NIH Bethesda, MD20894; Altschul, S. et al., J. Mol. Biol. 215: pp. 403-410 (1990)). The EMBOSS program is publicly available from EMBL-EBI. Identity may be determined using the well-known Smith-Waterman algorithm. The EMBOSS Needle program is a preferred program to use.

[0024] Preferred parameters for polypeptide sequence comparison include the following algorithm: Needleman and Wunsch, J. Mol. Biol. 48(3): pp. 443-453 (1970); comparison matrix: BLOSUM62 from Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA. 89: pp. 10915-10919 (1992); gap open penalty: 10; and gap extended penalty: 0.5. A useful program with these parameters is publicly available from EMBL-EBI as the EMBOSS Needle program. The aforementioned parameters are the default parameters for global pairwise sequence alignment of proteins (without penalty for end gaps).

[0025] Preferred parameters for nucleic acid comparison include the following algorithm: Needleman and Wunsch, J. Mol. Biol. 48: pp. 443-453 (1970); comparison matrix: DNAfull; gap open penalty: 10; gap extended penalty: 0.5. A useful program with these parameters is publicly available from EMBL-EBI as the EMBOSS Needle program. The aforementioned parameters are the default parameters for global pairwise sequencing alignment of nucleotide sequences (without penalty for end gaps).

[0026] Any embodiment described herein may also be provided in combination with any one or more other embodiments, provided that such combinations are not mutually exclusive.

[0027] MuSK antibody-based molecule The present invention relates to antibody-based molecules capable of binding to muscle-specific tyrosine protein kinase (MuSK) and activating its signaling and / or phosphorylation, such as the antibodies described herein, their epitope-binding domains, and antibody derivatives. Such antibody-based molecules are useful for treating conditions in which the subject requires increased MuSK signaling or MuSK phosphorylation, such as neuromuscular conditions.

[0028] A first aspect of the present invention relates to an antibody-based molecule that binds to the epitope of MuSK. MuSK is a receptor tyrosine kinase expressed in skeletal muscle and plays a crucial and dominant role in the formation and maintenance of neuromuscular synapses (Burden et al., "The Role of MuSK in Synapse Formation and Neuromuscular Disease," Cold Spring Harb. Perspect. Biol. 5:a009167 (2013)), which is incorporated herein by reference in its entirety. MuSK is a single-pass, 120 kDa transmembrane protein comprising an extracellular domain containing three Ig-like domains and a Frizzled (Fz)-like domain, and an intracellular domain containing a proximal-membrane domain, a kinase domain, and a short cytoplasmic tail (the entire protein is incorporated herein by reference: Jennings et al., "Muscle-Specific trk-Related Receptor with a Kringle Domain Defines a Distinct Class of Receptor Tyrosine Kinases," Proc. Natl. Acad. Sci. USA 90:2895-2899 (1993) and Valenzuela et al., "Receptor Tyrosine Kinase Specific for the Skeletal Muscle Lineage: Expression in Embryonic Muscle, at the Neuromuscular Junction, and After Injury," Neuron 15: 573-584 (1995)). MuSK phosphorylation is stimulated by agrin, a signal provided by motor neurons. When activated, MuSK stimulates pathways that (1) assemble and anchor AChR and additional muscle proteins essential for synaptic transmission, (2) enhance transcription of genes encoding synaptic proteins within the muscle "synaptic nucleus," and (3) promote the production of retrograde signals that facilitate presynaptic differentiation and the attachment of motor nerve endings to muscle.In the absence of MuSK, neuromuscular synapses are not formed (Burden et al., "The Role of MuSK in Synapse Formation and Neuromuscular Disease," Cold Spring Harb. Perspect. Biol. 5: a009167 (2013)), the entire article of which is incorporated herein by reference). In addition to its role in synapse formation, MuSK is also necessary for maintaining adult synapses, because inhibition of MuSK expression in adult muscle leads to serious defects in presynaptic and postsynaptic differentiation (Kong et al., "Inhibition of Synapse Assembly in Mammalian Muscle in vivo by RNA Interference," EMBO Rep 5: pp. 183-188 (2004), and Hesser et al., "Synapse Disassembly and Formation of New Synapses in Postnatal Muscle Upon Conditional Inactivation of MuSK," Mol. Cell. Neurosci. 31: pp. 470-480 (2006), which are incorporated herein by reference in their entirety).Consistent with these findings in mice, mutations that impair MuSK kinase activity or inhibit downstream signaling steps from MuSK cause myasthenia gravis (CM) characterized by structurally and functionally defective synapses, resulting in muscle weakness and fatigue (Beeson et al., "Dok-7 Mutations Underlie a Neuromuscular Junction Synaptopathy," Science 313: pp. 1975-1978 (2006), incorporated herein by reference in their entirety; Muller et al., "Phenotypical Spectrum of DOK7 Mutations in Congenital Myasthenic Syndromes," Brain 130: pp. 1497-1506 (2007); and Selcen et al., "A Compensatory Subpopulation of Motor Neurons in a Mouse Model of Amyotrophic Lateral Sclerosis," J. Comp. Neurol. 490: pp. 209-219 (2008)).

[0029] The amino acid sequence of human MuSK is the same as the amino acid sequence of sequence number 129 below. [ka]

[0030] According to the present invention, the MuSK antibody molecule described herein binds to an epitope within the Frizzled (Fz)-like domain of the MuSK protein. The Fz-like domain of MuSK has the amino acid sequence of SEQ ID NO: 130, as shown below. [ka]

[0031] As used herein, the term “epitope” refers to an antigenic determinant that can bind to an antibody. Epitopes typically consist of molecular surface groups such as amino acids or sugar side chains and usually possess distinctive three-dimensional structural and charge properties. Constructive epitopes and non-constructive epitopes are distinguished in that binding to conformative epitopes is lost in the presence of a denaturing solvent, while binding to non-constructive epitopes is not. Epitopes may contain amino acid residues directly involved in binding (also called the immunodominant component of the epitope), or they may contain amino acid residues that are not directly involved in binding, such as those that are effectively blocked by specific antigen-binding peptides (in other words, amino acid residues that are within the footprint of specific antigen-binding peptides). An epitope typically contains at least three, and more commonly, at least five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more amino acids in its specific spatial conformation.

[0032] The MuSK antibody-based molecules of the present invention immunospecifically bind to epitopes in the MuSK-Fz-like domain sequence of SEQ ID NO: 130 with a higher frequency, faster speed, longer duration, and / or higher affinity or avidity than alternative epitopes. In one embodiment, the MuSK antibody-based molecules described herein immunospecifically bind to any 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid residues of SEQ ID NO: 130. As used herein, the terms “affinity,” “specific binding,” “binding,” “immunospecific binding,” “binding activity,” or “specific binding activity” refer to the degree to which an antibody or antibody fragment, as defined herein, binds to epitopes in the MuSK-Fz-like domain sequence of SEQ ID NO: 130.

[0033] In one embodiment, the MuSK antibody-based molecule disclosed herein is approximately 10 -7 M or less than K DIt binds to the MuSK Fz-like domain with an affinity corresponding to, for example, when determined by surface plasmon resonance (SPR) technology in a Biacore 3000 instrument (preferably using the antibody as the ligand and MuSK as the analyte), about 10 -8 M, about 10 -9 M, about 10 -10 M, about 10 -11 M, about 10 -12 M or less of K D It binds to the MuSK Fz-like domain with an affinity corresponding to. The MuSK antibody-based molecules disclosed herein have a K that is at least 1 / 10-fold, for example at least 1 / 100-fold, for example at least 1 / 1,000-fold, for example at least 1 / 10,000-fold, for example at least 1 / 100,000-fold lower than their affinity for binding to non-specific antigens (such as bovine serum albumin, casein, etc.). D It binds to the MuSK Fz-like domain with an affinity corresponding to. The amount in the case of low affinity depends on the K D of the antibody, and when the K D of the antibody is very low (i.e., the antibody is very specific), the amount when the affinity for the antigen is lower than the affinity for the non-specific antigen can be at least 10,000-fold. As used herein, the term "k d " (seconds -1 or 1 / s) refers to the dissociation rate constant of a particular antibody-antigen interaction. This value is also referred to as the k 0ff value. The term "k a " (M -1 × seconds -1 or 1 / M) refers to the association rate constant of a particular antibody-antigen interaction as used herein. The term "K D " (M) refers to the dissociation equilibrium constant of a particular antibody-antigen interaction as used herein and is obtained by dividing k d by k a . As used herein, the term "K A " (M -1 or 1 / M) refers to the association equilibrium constant of a particular antibody-antigen interaction and is k a divided by kd It is obtained by dividing by [a certain factor].

[0034] In one embodiment, the MuSK antibody-based molecule described herein has a pH-dependent binding affinity to MuSK, enabling antibody recycling that enhances antigen binding. For example, in one embodiment, the association rate constant or dissociation rate constant may differ under acidic pH conditions versus neutral pH conditions versus basic pH conditions. In one embodiment, the MuSK antibody-based molecule described herein has a higher dissociation rate constant at acidic pH conditions, e.g., pH <7.0, compared to neutral pH conditions, e.g., pH about 7.0–7.9. In some embodiments, the MuSK antibody-based molecule described herein has a dissociation rate constant (i.e., lower binding affinity) at acidic pH (e.g., pH about 5.5) compared to neutral pH (pH about 7.4). In one embodiment, the MuSK antibody-based molecule binds to the MuSK Fz-like domain with higher affinity under neutral pH conditions than under acidic pH conditions. In other words, in one embodiment, the MuSK antibody-based molecule binds to the MuSK Fz-like domain at a higher dissociation rate under acidic pH conditions than under neutral pH conditions. Neutral pH conditions may be defined as pH values ​​ranging from 7.0 to 7.9. Acidic pH conditions may be defined as pH values ​​below 7.0. Higher can mean at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, or 300% higher. Antibodies with this pH-dependent dissociation property dissociate from the antigen after binding and activation, before lysosomal degradation. Upon dissociation, the antibody re-enters the circulation via the neonatal Fc receptor, is released, and binds to more antigens.

[0035] MuSK signaling is activated by the binding of the MuSK antibody of the present invention to each epitope within the Fz-like domain. In particular, when the MuSK antibody of the present invention binds to each epitope of the MuSK Fz-like domain, this binding induces MuSK phosphorylation and activation as described above. The MuSK antibody of the present invention induces MuSK phosphorylation at about 50% to about 100% compared to MuSK phosphorylation induced by agrin activation (for example, when measured in the C2C12 phosphorylation assay described herein). In one embodiment, the MuSK antibody of the present invention induces about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% MuSK phosphorylation (compared to MuSK phosphorylation induced by agrin activation). In one embodiment, the MuSK antibody-based molecule of the present invention induces approximately 90% to 100% MuSK phosphorylation upon MuSK binding (compared to MuSK phosphorylation induced by agrin activation). MuSK phosphorylation can be evaluated using techniques known to those skilled in the art, such as Western blotting. Phosphorylation assays described in the examples herein (i.e., C2C12 myotubular phosphorylation assays) can also be used to evaluate phosphorylation.

[0036] In some embodiments, the MuSK antibody of the present invention, i.e., the MuSK antibody that binds to the Fz domain of MuSK, does not interfere with (i.e., does not block, suppress, inhibit, or reduce) the intrinsic ligand binding and stimulation of MuSK. In some embodiments, the MuSK antibody co-stimulates MuSK activation with its intrinsic ligand, i.e., agrin, to produce additional effects such as activation, e.g., MuSK phosphorylation. Therefore, in some embodiments, the MuSK antibody of the present invention enhances intrinsic MuSK activation, i.e., phosphorylation, induced by intrinsic ligand binding. In some embodiments, the antibody of the present invention, in combination with the intrinsic ligand, activates MuSK to >100% of the endogenous activation level, e.g., at least 110%, 130%, 150%, or 200% of the endogenous activation level (i.e., phosphorylates MuSK). MuSK phosphorylation can be evaluated as previously described.

[0037] Accordingly, in one embodiment, the activity of the MuSK antibody-based molecule of the present invention includes: (i) binding to an epitope of human muscle-specific tyrosine protein kinase (MuSK) present in the MuSK Frizzled (Fz)-like domain sequence of SEQ ID NO: 130, and upon binding to the epitope, the antibody-based molecule induces MuSK phosphorylation; and / or (ii) binding to the MuSK Fz-like domain does not block, suppress, or inhibit innate or endogenous MuSK ligand-induced phosphorylation, but may enhance it; and (iii) binding to the MuSK Fz-like domain occurs with higher affinity under neutral pH conditions than under acidic pH conditions. All of these features are further defined herein.

[0038] Antibody-based molecules include, but are not limited to, complete antibodies, epitope-bound fragments of whole antibodies, and antibody derivatives. Epitope-bound fragments of antibodies can be obtained by actual fragmentation of a parent antibody (e.g., Fab or (Fab)2 fragment). Alternatively, an epitope-bound fragment is an amino acid sequence containing a portion of the amino acid sequence of such a parent antibody. As used herein, a molecule is said to be a “derivative” of an antibody (or a portion thereof) if it is obtained through actual chemical modification of a parent antibody or a portion thereof, or if it contains an amino acid sequence substantially similar to the amino acid sequence of such a parent antibody or a portion thereof (e.g., differing by less than 30%, less than 20%, less than 10%, or less than 5% from such a parent molecule or a portion thereof, or differing by only 10 amino acid residues, or less than 10, less than 9, less than 8, less than 7, less than 6, less than 5, less than 4, less than 3%, or less than 2 amino acid residues from such a parent molecule or a portion thereof).

[0039] In one embodiment, the antibody-based molecule of the present invention is a molecule having intact immunoglobulin or an epitope-binding fragment thereof. As used herein, the terms “fragment,” “region,” “part,” and “domain” are intended to be generally synonymous unless otherwise indicated. Naturally occurring antibodies typically consist of a tetramer composed of at least two heavy (H) chains and at least two light (L) chains. Each heavy chain is heavy chain variable (V H ) region and heavy chain constant (C H These consist of regions, and these typically consist of three domains (C H 1 domain, C H 2 domains, and C H It contains 3 domains. The heavy chain can be any isotype heavy chain including IgG (subtypes IgG1, IgG2, IgG3, and IgG4), IgA (subtypes IgA1 and IgA2), IgM, and IgE. Each light chain is light chain variable (V L ) region and light chain constant (C L It consists of the following regions. Examples of light chains include the kappa chain and the lambda chain. The variable regions of the heavy and light chains are typically involved in antigen recognition, while the constant regions of the heavy and light chains can mediate the binding of immunoglobulins to various cells of the immune system (e.g., effector cells) and host tissues or factors including the first component (C1q) of the classical complement system. H Region and V L The region can be further subdivided into a highly variable region called the "complementarity determination region" or "CDR," and a more conserved sequence region called the "framework region" (FR) that encloses it. H Region and V L The region consists of three CDR domains and four FR domains arranged from the amino terminus to the carboxyl terminus in the following order: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. The variable regions of the heavy and light chains contain binding domains that interact with the antigen. Of particular interest are antibodies and their epitope-binding fragments that are "isolated" to exist in a physical environment different from that which may exist in nature, or that have been modified in a way that differs in their amino acid sequence from naturally occurring antibodies.

[0040] Antibody fragments exhibiting epitope binding ability (including Fab and (Fab)2 fragments) can be obtained, for example, by protease cleavage of an intact antibody. Single-domain antibody fragments have one variable domain (e.g., V L or V H (i)V L , V H , C L and C H (ii) a monovalent fragment containing one domain, namely Fab' or Fab fragment; (ii) a bivalent fragment containing two Fab fragments linked by disulfide bridges in a hinge region, namely F(ab')2 fragment; (iii) essentially a VH domain and C H Fd fragment consisting of one domain; (iv) Essentially V L and V H Fv fragment consisting of domains; (v) essentially V H or V L(vi) A domain (the entire text is incorporated herein by reference by Ward et al., "Binding Activities Of A Repertoier of Single Immunoglobulin Variable Domains Secreted From Escherichia coli," Nature 341: pp. 544-546 (1989)), also called a domain antibody (the entire text is incorporated herein by reference by Holt et al., "Domain Antibodies: Proteins for Therapy," Trends Biotechnol. 21(11): pp. 484-490 (2003)), a dAb fragment; (vi) a nanobody (the entire text is incorporated herein by reference by Revets et al., "Nanobodies As Novel Agents For Cancer Therapy," Expert Opin. Biol. Ther. 5(1):pp. 111-124 (2005), and (vii) isolated complementarity-determining regions (CDRs). An epitope-binding fragment may contain one, two, three, four, five, or all six CDR domains of such an antibody. In one embodiment, the antibody fragment (or region, part, or domain) contains, is essentially, or consists of 30-100 amino acids, 50-150 amino acids, or 70-200 amino acids. In one embodiment, the length of the antibody fragment (or region, part, or domain) is less than the length of the antibody (full-length antibody). The percentage is at least 40%, 50%, 60%, 70%, 80%, 90%, or 95%. In one embodiment, the fragment means an epitope-binding fragment or functional fragment of the antibody that is expected to induce antibody activity to at least some extent. "At least some extent" may mean at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100%, 150%, 200%, or more. In one embodiment, the antibody or fragment of the antibody should induce detectable activity of the antibody. Antibody activity is defined previously herein.

[0041] Such antibody fragments can be obtained using conventional techniques known to those skilled in the art. For example, the F(ab')2 fragment can be produced by treating a full-length antibody with pepsin. The obtained F(ab')2 fragment may be processed to reduce the disulfide crosslinks and produce the Fab' fragment. The Fab fragment may be obtained by treating an IgG antibody with papain. The Fab' fragment may be obtained by pepsin digestion of an IgG antibody. The Fab' fragment can be obtained by treating the F(ab')2 fragment with a reducing agent, such as dithiothreitol. Antibody fragments may also be produced by expressing nucleic acids encoding such fragments in recombinant cells (see, for example, Evans et al., "Rapid Expression Of An Anti-Human C5 Chimeric Fab Utilizing A Vector That Replicates In COS And 293 Cells," J. Immunol. Meth. 184: pp. 123-38 (1995), which is incorporated in its entirety herein by reference). For example, a chimeric gene encoding a portion of the F(ab')2 fragment may contain DNA sequences encoding the heavy chain's CH1 domain and hinge region, followed by a translation termination codon, to produce such a cleavage-type antibody fragment molecule. Suitable fragments capable of binding to a desired epitope can be readily screened for utility in the same manner as intact antibodies.

[0042] Antibody derivatives include molecules containing at least one epitope-binding domain of an antibody, and are typically formed using recombinant technology. One exemplary antibody derivative is single-chain Fv (scFv). scFv consists of two domains of the Fv fragment, V L Region and V H These are formed from regions, which may be encoded by separate genes. Such gene sequences or gene sequences encoding cDNA are linked by flexible linkers (typically about 10, 12, 15 or more amino acid residues) using a recombination method, thereby the gene sequences are V L and V HThe regions associate to form a monovalent epitope-binding molecule, and are constructed as a single protein chain (see Bird et al., "Single-Chain Antigen-Binding Proteins," Science 242: pp. 423-426 (1988), the entire text of which is incorporated herein by reference; and Huston et al., "Protein Engineering Of Antibody Binding Sites: Recovery Of Specific Activity In An Anti-Digoxin Single-Chain Fv Analogue Produced In Escherichia coli," Proc. Natl. Acad. Sci. (USA) 85: pp. 5879-5883 (1988)). Alternatively, the V of different single polypeptide chains can be constructed. L and V H By using a flexible linker that is not too short (e.g., approximately 9 residues or more) to allow the regions to associate together, it is possible to form a bispecific antibody that has binding specificity to two different epitopes.

[0043] In another embodiment, the antibody derivative is a divalent (or bivalent) single-chain variable fragment manipulated by linking two scFvs in tandem (i.e., tandem scFv) or by linking them so that they dimerize to form a diabody (Holliger et al., "'Diabodies': Small Bivalent And Bispecific Antibody Fragments," Proc. Natl. Acad. Sci. (USA) 90(14), pp. 6444-648 (1993), the whole of which is incorporated herein by reference). In yet another embodiment, the antibody is a triabody, i.e., a trivalent single-chain variable fragment manipulated by linking three scFvs in tandem or by linking them so that they trimerize to form a triabody. In yet another embodiment, the antibody is a tetramer of four single-chain variable fragments. In yet another embodiment, the antibody is a pair of tandem Fd segments (V) that form a pair of antigen-binding regions. H-C H 1-V H -C H 1) is a linear antibody containing (see Zapata et al., Protein Eng. 8(10): pp. 1057-1062 (1995), the whole of which is incorporated herein by reference). In another embodiment, the antibody derivative is C H A single-stranded Fv region bound to 3 regions (i.e., scFv-C) H It is a mini body consisting of 3).

[0044] These and other useful antibody fragments and antibody derivatives in the context of the present invention will be discussed further herein. It should also be understood that, unless otherwise specified, the term "antibody-based molecule" includes antibody-like polypeptides, such as chimeric antibodies and humanized antibodies, as well as antibody fragments (epitope-binding fragments or functional fragments) that retain the ability to specifically bind to an antigen, provided by any known technique such as enzymatic cleavage, peptide synthesis, and recombination. In one embodiment, the term "antibody-based molecule" may be replaced by the term "antibody" or the expression "antibody or its functional fragment."

[0045] The antibodies produced herein may be of any isotype. As used herein, “isotype” refers to an immunoglobulin class encoded by a heavy chain constant region gene (e.g., IgG1, IgG2, IgG3, IgG4, IgD, IgA, IgE, or IgM). The selection of an isotype is typically guided by the desired effector function, such as the induction of antibody-dependent cytotoxicity (ADCC). Exemplary isotypes are IgG1, IgG2, IgG3, and IgG4. Particularly useful isotypes of the MuSK antibodies disclosed herein include IgG1 and IgG2.

[0046] Either the kappa or lambda region of the human light chain constant region may be used. If desired, the class of the MuSK antibody of the present invention may be switched by known methods. For example, the antibody of the present invention, which was originally IgM, may be switched to the IgG antibody of the present invention. Furthermore, one IgG subclass may be converted to another subclass, for example, from IgG1 to IgG2, using class switching technology. Thus, the effector function of the antibody of the present invention may be changed for various therapeutic applications by switching the isotype to, for example, IgG1, IgG2, IgG3, IgG4, IgD, IgA, IgE, or IgM antibodies.

[0047] In one embodiment, the antibody-based molecule of the present invention is “humanized,” particularly when used for therapeutic purposes. The term “humanized” generally refers to a chimeric molecule prepared using recombinant technology, having an antigen-binding site derived from an immunoglobulin of a non-human species and the remaining immunoglobulin structure based on the structure and / or sequence of a human immunoglobulin. The antigen-binding site may consist of either a complete non-human antibody variable domain fused to a human constant domain, or only the complementarity-determining region (CDR) of such a variable domain transplanted into a suitable human framework region of the human variable domain. The framework residues of such a humanized molecule may be wild-type (e.g., fully human) or modified to include one or more amino acid substitutions not found in the sequence of the human antibody serving as the basis for humanization. Humanization reduces or eliminates the possibility that the constant region of a molecule can function as an immunogen in a human organism, but the possibility of an immune response to an exogenous variable region remains (see LoBuglio, AF et al., "Mouse / Human Chimeric Monoclonal Antibody In Man: Kinetics And Immune Response," Proc. Natl. Acad. Sci. USA 86: pp. 4220-4224 (1989), which is incorporated herein by reference in its entirety). Another approach focuses not only on providing a human-derived constant region but also on modifying the variable region to reshape it as closely as possible to a human form. Both the heavy and light chain variable regions contain three complementarity-determining regions (CDRs) that change in response to the antigen in question and determine binding ability. The CDRs are adjacent to four framework regions (FRs). The FRs are relatively conserved in a given species and presumptively provide the skeleton for the CDRs. When non-human antibodies are prepared for a specific antigen, the variable region can be “remodeled” or “humanized” by transplanting a CDR derived from the non-human antibody onto the FR present in the modified human antibody. Preferred methods for humanizing non-human antibodies described herein are known in the art. For example, Sato, K., whose entire work is incorporated herein by reference.et al., Cancer Res 53:851 - 856 (1993); Riechmann, L. et al., "Reshaping Human Antibodies for Therapy", Nature 332:323 - 327 (1988); Verhoeyen, M. et al., "Reshaping Human Antibodies: Grafting An Antilysozyme Activity", Science 239:1534 - 1536 (1988); Kettleborough, C. A. et al., "Humanization Of A Mouse Monoclonal Antibody By CDR - Grafting: The Importance Of Framework Residues On Loop Conformation", Protein Engineering 4:773 - 3783 (1991); Maeda, H. et al., "Construction Of Reshaped Human Antibodies With HIV - Neutralizing Activity", Human Antibodies Hybridoma 2:124 - 134 (1991); Gorman, S. D. et al., "Reshaping A Therapeutic CD4 Antibody", Proc. Natl. Acad. Sci. USA 88:4181 - 4185 (1991); Tempest, P.R. et al., "Reshaping A Human Monoclonal Antibody To Inhibit Human Respiratory Syncytial Virus Infection In Vivo", Bio / Technology 9:266 - 271 (1991); Co, M. S. et al., "Humanized Antibodies For Antiviral Therapy", Proc. Natl. Acad. Sci. USA 88:2869 - 2873 (1991); Carter, P. et al., "Humanization Of An Anti - pl85her2 Antibody For Human Cancer Therapy", Proc. Natl. Acad. Sci.See USA 89: pp. 4285-4289 (1992); and Co, MS et al., "Chimeric And Humanized Antibodies With Specificity For The CD33 Antigen," J. Immunol. 148: pp. 1149-1154 (1992). In some embodiments, the humanized MuSK antibody of the present invention retains all CDR sequences (e.g., a humanized antibody containing all six CDRs derived from a llama or mouse antibody). In other embodiments, the humanized MuSK antibody of the present invention has one or more CDRs (one, two, three, four, five, or six) that are modified with respect to the original antibody. Methods for humanizing antibodies are well known in the art and are suitable for humanizing the antibodies disclosed herein (see, for example, U.S. Patent No. 5,225,539 by Winter; U.S. Patents No. 5,530,101 and 5,585,089 by Queen and Selick; U.S. Patent No. 5,859,205 by Robert et al.; U.S. Patent No. 6,407,213 by Carter; and U.S. Patent No. 6,881,557 by Foote, which are incorporated herein by reference in their entirety).

[0048] In some antibodies, only a subset of CDRs, specifically the "specificity-determining residues" (SDRs), are necessary for binding to the antibody. CDR residues that do not come into contact with the antigen and are not present within the SDR can be identified by molecular modeling and / or empirically, based on previous studies from the region of Kabat CDR located outside the Chothia hypervariable loop (see Kabat et al., SEQUENCES OF PROTEINS OF IMMUNOLOGICAL INTEREST, National Institutes of Health Publication No. 91-3242 (1992), which is incorporated herein by reference in its entirety; see Chothia, C. et al., "Canonical Structures For The Hypervariable Regions Of Immunoglobulins," J. Mol. Biol. 196:901-917 (1987)), or as described in Gonzales, NR et al., "SDR Grafting Of A Murine Antibody Using Multiple Human Germline Templates To Minimize Its Immunogenicity," Mol. Immunol. 41:863-872 (2004), which is incorporated herein by reference in its entirety. In such humanized antibodies, at positions where one or more donor CDR residues are absent or where the entire donor CDR is excluded, the amino acid residues occupying these positions may be amino acid residues occupying the corresponding positions (according to Kabat numbering) in the acceptor antibody sequence. The number of such acceptor substitutions for donor amino acids that would be included in the CDR reflects a balance of competing considerations. Such substitutions are potentially advantageous in reducing the number of non-human amino acids in the humanized antibody and consequently reducing potential immunogenicity. However, substitutions can also cause changes in affinity, and it is preferable to avoid significant decreases in affinity. Substitutions can also cause changes in activity.Such substitutions that would cause a significant decrease in activity are also preferably avoided. In this situation, the antibody or antibody fragment should still exhibit detectable antibody activity or at least some degree of antibody activity as defined herein. The position for substitution within the CDR and the amino acid to be substituted may be selected empirically.

[0049] Alternatively, phage display technology can be used to increase (or decrease) the CDR affinity of the antibody-based molecule of the present invention. This technique, referred to as affinity maturation, uses mutagenesis or "CDR walking" to reselect an antibody with a CDR that binds to the antigen with a higher (or lower) affinity compared to the initial or parental antibody, using a target antigen or a fragment thereof (see, for example, Glaser et al., "Antibody Engineering By Codon-Based Mutagenesis In A Filamentous Phage Vector System," J. Immunology 149:3903-3913 (1992), which is incorporated herein by reference in its entirety). Mutagenesis of entire codons rather than single nucleotides results in a semi-randomized repertoire of amino acid mutations. A library consisting of a pool of variant clones may be constructed, each of which, by a single amino acid modification in a single CDR, differs from other members of such a library, and the library contains variants that potentially represent each possible amino acid substitution for each CDR residue. Mutants with increased (or decreased) binding affinity to an antigen can be screened by contacting immobilized mutants with a labeled antigen. Variant antibody-based binding molecules with increased or decreased affinity to an antigen can be identified using any screening method known in the art (e.g., ELISA) (see Wu, H. et al., "Stepwise In Vitro Affinity Maturation of Vitaxin, An Alphav Beta 3-Specific Humanized mAb," Proc. Natl. Acad. Sci. USA 95:6037-6042 (1998), which is incorporated in its entirety herein by reference; Yelton et al., "Affinity Maturation Of The BR96 Anti-Carcinoma Antibody By Codon-Based Mutagenesis," J. Immunology 155:1994 (1995)).CDR walking may be used to randomize the light chain (see Schier, R. et al., "Isolation Of Picomolar Affinity Anti-c-erbB-2 Single-Chain Fv By Molecular Evolution Of The Complementarity Determining Regions In The Center Of The Antibody Binding Site," J. Mol. Biol. 263: pp. 551-567 (1996), which is incorporated herein by reference in its entirety).

[0050] Methods for affinity maturation of MuSK antibody molecules are described herein and incorporated herein in their entirety by reference, for example: Krause, JC et al., "An Insertion Mutation That Distorts Antibody Binding Site Architecture Enhances Function of a Human Antibody," MBio. 2(1): e00345-10 (2011); Kuan, CT et al., "Affinity-Matured Anti-Glycoprotein NMB Recombinant Immunotoxins Targeting Malignant Gliomas And Melanomas," Int. J. Cancer 10.1002 / ijc.25645 (2010); Hackel, BJ et al., "Stability And CDR Composition Biases Enrich Binder Functionality Landscapes," J. Mol. Biol. 401(l):84-96 (2010); Montgomery, DL et al., "Affinity Maturation And Characterization Of A Human Monoclonal Antibody Against HIV-1" gp41”, MAbs 1(5):462–474 (2009); Gustchina, E. et al., “Affinity Maturation By Targeted Diversification Of The CDR-H2 Loop Of A Monoclonal Fab Derived From A Synthetic Naive Human Antibody Library And Directed Against The Internal Trimeric Coiled-Coil Of Gp41 Yields A Set Of Fabs With Improved HIV-1 Neutralization "Potency And Breadth", Virology 393(1): pp. 112-119 (2009); Finlay, WJet al., "Affinity Maturation Of A Humanized Rat Antibody For Anti-RAGE Therapy: Comprehensive Mutagenesis Reveals A High Level Of Mutational Plasticity Both Inside And Outside The Complementarity-Determining Regions", J. Mol. Biol. 388(3):541-558 (2009); Bostrom, J. et al., "Improving Antibody Binding Affinity And Specificity For Therapeutic Development”, Methods Mol. Biol. 525:353-376 (2009); Steidl, S. et al., “In Vitro Affinity Maturation Of Human GM-CSF Antibodies By Targeted CDR-Diversification”, Mol. Immunol.46(1): pp.135-144 (2008); and Barderas, R. et al., “Affinity Maturation Of Antibodies Assisted By In Silico This is disclosed in "Modeling," Proc. Natl. Acad. Sci. USA 105(26):9029-9034 (2008).

[0051] In one embodiment of the present invention, the MuSK antibody-based molecule described herein comprises any one, any two, any three, any four, any five, or any six CDR amino acid sequences shown in Table 1 and Table 2 herein.

[0052] In one embodiment, an antibody-based molecule that binds to human muscle-specific tyrosine protein kinase (MuSK) includes a heavy chain variable region, the heavy chain variable region comprising: (i) a complementarity-determining region 1 (CDR-H1) which includes one amino acid sequence of any one of SEQ ID NOs: 1-16, 135, 136, or 147-149, or one modified amino acid sequence of any one of SEQ ID NOs: 1-16, 135, 136, or 147-149, and which has at least 80% sequence identity with any one of SEQ ID NOs: 1-16, 135, 136, or 147-149; and (ii) one amino acid sequence of any one of SEQ ID NOs: 17-32, 137, 138, or 150-155, or SEQ ID NOs: 17-32, 137, 138, or 150-1 Complementarity determination region 2 (CDR-H2) includes a modified amino acid sequence which is any one of the 55 modified amino acid sequences and has at least 80% sequence identity with any one of sequence numbers 17-32, 137, 138, or 150-155; and a complementarity determination region 3 (CDR-H3) includes an amino acid sequence which is any one of sequence numbers 33-48, 139, 140, 156-158, or 240-251, or a modified amino acid sequence which is any one of sequence numbers 33-48, 139, 140, 156-158, or 240-251 and has at least 80% sequence identity with any one of sequence numbers 33-48, 139, 140, 156-158, or 240-251.

[0053] In one embodiment, the antibody-based molecule that binds to human muscle-specific tyrosine protein kinase (MuSK) comprises: (i) a heavy chain variable region including CDR-H1 of SEQ ID NO: 1, CDR-H2 of SEQ ID NO: 17, and CDR-H3 of SEQ ID NO: 33; (ii) a heavy chain variable region including CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 34; (iii) a heavy chain variable region including CDR-H1 of SEQ ID NO: 3, CDR-H2 of SEQ ID NO: 19, and CDR-H3 of SEQ ID NO: 35; (iv) CDR-H1 of SEQ ID NO: 4, CDR-H2 of SEQ ID NO: 20; (v) Heavy chain variable region including CDR-H3 of SEQ ID NO: 36, (vi) Heavy chain variable region including CDR-H1 of SEQ ID NO: 5, CDR-H2 of SEQ ID NO: 21, and CDR-H3 of SEQ ID NO: 37, (vi) Heavy chain variable region including CDR-H1 of SEQ ID NO: 6, CDR-H2 of SEQ ID NO: 22, and CDR-H3 of SEQ ID NO: 38, (vii) Heavy chain variable region including CDR-H1 of SEQ ID NO: 7, CDR-H2 of SEQ ID NO: 23, and CDR-H3 of SEQ ID NO: 39, (viii) Heavy chain variable region including CDR-H1 of SEQ ID NO: 8, CDR-H2 of SEQ ID NO: 24, and CDR-H3 of SEQ ID NO: 40 (ix) Heavy chain variable region including CDR-H1 of SEQ ID NO: 9, CDR-H2 of SEQ ID NO: 25, and CDR-H3 of SEQ ID NO: 41, (x) Heavy chain variable region including CDR-H1 of SEQ ID NO: 10, CDR-H2 of SEQ ID NO: 26, and CDR-H3 of SEQ ID NO: 42, (xi) Heavy chain variable region including CDR-H1 of SEQ ID NO: 11, CDR-H2 of SEQ ID NO: 27, and CDR-H3 of SEQ ID NO: 43, (xii) Heavy chain variable region including CDR-H1 of SEQ ID NO: 12, CDR-H2 of SEQ ID NO: 28, and CDR-H3 of SEQ ID NO: 44, (xiii) CDR-H1 of SEQ ID NO: 13 , a heavy chain variable region including CDR-H2 of SEQ ID NO: 29 and CDR-H3 of SEQ ID NO: 45, (xiv) a heavy chain variable region including CDR-H1 of SEQ ID NO: 14, CDR-H2 of SEQ ID NO: 30 and CDR-H3 of SEQ ID NO: 46, (xv) a heavy chain variable region including CDR-H1 of SEQ ID NO: 15, CDR-H2 of SEQ ID NO: 31 and CDR-H3 of SEQ ID NO: 47, (xvi) a heavy chain variable region including CDR-H1 of SEQ ID NO: 16, CDR-H2 of SEQ ID NO: 32 and CDR-H3 of SEQ ID NO: 48, (xvii) CDR-H1 of SEQ ID NO: 135 and CDR-H2 of SEQ ID NO: 137,It also includes a heavy chain variable region containing CDR-H3 of SEQ ID NO: 139, and (xviii) a heavy chain variable region containing CDR-H1 of SEQ ID NO: 136, CDR-H2 of SEQ ID NO: 138, and CDR-H3 of SEQ ID NO: 140. The sequences of the heavy chain CDR sequences are shown in Table 1 below.

[0054] In one embodiment, the antibody-based molecule that binds to human muscle-specific tyrosine protein kinase (MuSK) comprises: (ii.a) a heavy chain variable region (X2m1) including CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 240; (ii.b) a heavy chain variable region (X2m2) including CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 241; (ii.c) a heavy chain variable region (X2m3) including CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 242; and (ii.d) CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 24 (ii.e) A heavy chain variable region (X2m5) containing CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 244; (ii.f) A heavy chain variable region (X2m6) containing CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 245; (ii.g) A heavy chain variable region (X2m7) containing CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 246; (ii.h) A heavy chain variable region (X2m8) containing CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 247.

[0055] In one embodiment, an antibody-based molecule that binds to human muscle-specific tyrosine protein kinase (MuSK) comprises (xvii.a) a heavy chain variable region (X17m1) including CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 248; (xvii.b) a heavy chain variable region (X17m2) including CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 249; (xvii.c) a heavy chain variable region (X17m3) including CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 250; and (xvii.d) a heavy chain variable region (X17m6) including CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 251.

[0056] In one embodiment, an antibody-based molecule that binds to human muscle-specific tyrosine protein kinase (MuSK) includes a heavy chain variable region, the heavy chain variable region including (xix) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, (xx) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 148, CDR-H2 of SEQ ID NO: 151, and CDR-H3 of SEQ ID NO: 157, and (xxi) a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 149, CDR-H2 of SEQ ID NO: 152, and CDR-H3 of SEQ ID NO: 158.

[0057] In one embodiment, an antibody-based molecule that binds to human muscle-specific tyrosine protein kinase (MuSK) includes a heavy chain variable region, which comprises: (xxii) a heavy chain variable region (3B2g1m1 / 3B2g2m1) containing CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 153, and CDR-H3 of SEQ ID NO: 156; (xxiii) a heavy chain variable region (3B2g1m2 / 3B2g2m2) containing CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 154, and CDR-H3 of SEQ ID NO: 156; and (xxiv) a heavy chain variable region (3B2g1m4 / 3B2g2m4) containing CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 155, and CDR-H3 of SEQ ID NO: 156. The sequences of the heavy chain CDR sequences are shown in Table 1 below.

[0058] In one embodiment, an antibody-based molecule that binds to human muscle-specific tyrosine protein kinase (MuSK) includes a heavy chain variable region, the heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 153, or a CDR-H2 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 153, and CDR-H3 of SEQ ID NO: 156 (3B2g2m1). According to this embodiment, the CDR-H2 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 153 includes one or more amino acid substitutions to the amino acid sequence of SEQ ID NO: 153, the substitutions being located at residues 1, 2, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or any combination thereof. In another embodiment, the CDR-H2 amino acid sequence has at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with respect to SEQ ID NO: 153. In one embodiment, the antibody CDR-H2 contains proline (P) at position 3, tryptophan (W) at position 4, and serine (S) or asparagine (N) at position 5.

[0059] In one embodiment, an antibody-based molecule that binds to human muscle-specific tyrosine protein kinase (MuSK) includes a heavy chain variable region, the heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 153, and CDR-H3 of SEQ ID NO: 156.

[0060] The heavy chain CDR sequence is shown in Table 1 below.

[0061] [Table 1A] [Table 1B]

[0062] In some embodiments, the MuSK antibody-based molecules disclosed herein further comprise a light chain variable region. The light chain variable region comprises (i) a complementarity-determining region 1 (CDR-L1) having a modified amino acid sequence which is one of the amino acid sequences of SEQ ID NOs. 49-64, 141, 142, or 159-169, or one of the modified amino acid sequences of SEQ ID NOs. 49-64, 141, 142, or 159-169, and which has at least 80% sequence identity with one of SEQ ID NOs. 49-64, 141, 142, or 159-169; and (ii) an amino acid sequence which is one of the amino acid sequences of SEQ ID NOs. 65-80, 143, 144, or 170-179, or one of the modified amino acid sequences which is one of the modified amino acid sequences of SEQ ID NOs. 65-80, 143, 144, or 170-179. (iii) Complementarity-determining region 2 (CDR-L2) having a modified amino acid sequence that has at least 80% sequence identity with any one of sequence numbers 65-80, 143, 144, or 170-179, and (iii) Complementarity-determining region 3 (CDR-L3) having a modified amino acid sequence that has at least 80% sequence identity with any one of sequence numbers 81-96, 145, 146, or 180-195, or a modified amino acid sequence that has at least 80% sequence identity with any one of sequence numbers 81-96, 145, 146, or 180-195.

[0063] In one embodiment, the light chain variable region of the MuSK antibody-based molecule disclosed herein is: (i) a light chain variable region comprising CDR-L1 of SEQ ID NO: 49, CDR-L2 of SEQ ID NO: 65, and CDR-L3 of SEQ ID NO: 81; (ii) a light chain variable region comprising CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO: 82; (iii) a light chain variable region comprising CDR-L1 of SEQ ID NO: 51, CDR-L2 of SEQ ID NO: 67, and CDR-L3 of SEQ ID NO: 83; (iv) CDR-L1 of SEQ ID NO: 52, CDR-L2 of SEQ ID NO: 68, and SEQ ID NO: (v) Light chain variable region including CDR-L3 of 84, (v) Light chain variable region including CDR-L1 of SEQ ID NO: 53, CDR-L2 of SEQ ID NO: 69, and CDR-L3 of SEQ ID NO: 85, (vi) Light chain variable region including CDR-L1 of SEQ ID NO: 54, CDR-L2 of SEQ ID NO: 70, and CDR-L3 of SEQ ID NO: 86, (vii) Light chain variable region including CDR-L1 of SEQ ID NO: 55, CDR-L2 of SEQ ID NO: 71, and CDR-L3 of SEQ ID NO: 87, (viii) Light chain variable region including CDR-L1 of SEQ ID NO: 56, CDR-L2 of SEQ ID NO: 72, and CDR-L3 of SEQ ID NO: 88 , (ix) light chain variable region including CDR-L1 of SEQ ID NO: 57, CDR-L2 of SEQ ID NO: 73, and CDR-L3 of SEQ ID NO: 89, (x) light chain variable region including CDR-L1 of SEQ ID NO: 58, CDR-L2 of SEQ ID NO: 74, and CDR-L3 of SEQ ID NO: 90, (xi) light chain variable region including CDR-L1 of SEQ ID NO: 59, CDR-L2 of SEQ ID NO: 75, and CDR-L3 of SEQ ID NO: 91, (xii) light chain variable region including CDR-L1 of SEQ ID NO: 60, CDR-L2 of SEQ ID NO: 76, and CDR-L3 of SEQ ID NO: 92, (xiii) CDR-L1 of SEQ ID NO: 61 , a light chain variable region including CDR-L2 of SEQ ID NO: 77 and CDR-L3 of SEQ ID NO: 93, (xiv) a light chain variable region including CDR-L1 of SEQ ID NO: 62, CDR-L2 of SEQ ID NO: 78 and CDR-L3 of SEQ ID NO: 94, (xv) a light chain variable region including CDR-L1 of SEQ ID NO: 63, CDR-L2 of SEQ ID NO: 79 and CDR-L3 of SEQ ID NO: 95, (xvi) a light chain variable region including CDR-L1 of SEQ ID NO: 64, CDR-L2 of SEQ ID NO: 80 and CDR-L3 of SEQ ID NO: 96, (xvii) CDR-L1 of SEQ ID NO: 141 and CDR-L2 of SEQ ID NO: 143,It also includes the light chain variable region containing CDR-L3 of SEQ ID NO: 145, (xviii) CDR-L1 of SEQ ID NO: 142, CDR-L2 of SEQ ID NO: 144, and CDR-L3 of SEQ ID NO: 146. The sequences of the light chain CDR sequences are shown in Table 2 below.

[0064] In one embodiment, the light chain variable region of the MuSK antibody-based molecule disclosed herein is: (xix) a light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 170, and CDR-L3 of SEQ ID NO: 180; (xx) a light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 171, and CDR-L3 of SEQ ID NO: 181; (xxi) a light chain variable region including CDR-L1 of SEQ ID NO: 160, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 182; (xxii) CDR-L1 of SEQ ID NO: 159, SEQ ID NO: 1 (xxiii) Light chain variable region including CDR-L2 of 72 and CDR-L3 of SEQ ID NO: 183, (xxiv) Light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 171, and CDR-L3 of SEQ ID NO: 184, (xxv) Light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 173, and CDR-L3 of SEQ ID NO: 185, (xxv) Light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 173, and CDR-L3 of SEQ ID NO: 186, (xxvi) CDR-L1 of SEQ ID NO: 161, SEQ ID NO: 1 Light chain variable region including CDR-L2 of 74 and CDR-L3 of sequence number 187, (xxvii) Light chain variable region including CDR-L1 of sequence number 162, CDR-L2 of sequence number 174, and CDR-L3 of sequence number 188, (xxviii) Light chain variable region including CDR-L1 of sequence number 163, CDR-L2 of sequence number 174, and CDR-L3 of sequence number 188, (xxix) Light chain variable region including CDR-L1 of sequence number 164, CDR-L2 of sequence number 174, and CDR-L3 of sequence number 189, (xxx) CDR-L1 of sequence number 165, sequence number Light chain variable region including CDR-L2 of sequence number 175 and CDR-L3 of sequence number 190, (xxxi) Light chain variable region including CDR-L1 of sequence number 166, CDR-L2 of sequence number 176 and CDR-L3 of sequence number 191, (xxxi) Light chain variable region including CDR-L1 of sequence number 167, CDR-L2 of sequence number 177 and CDR-L3 of sequence number 192, (xxxii) Light chain variable region including CDR-L1 of sequence number 168, CDR-L2 of sequence number 178 and CDR-L3 of sequence number 193, (xxxiii) CDR-L1 of sequence number 169,It includes light chain variable regions, including CDR-L2 of SEQ ID NO: 179 and CDR-L3 of SEQ ID NO: 194.

[0065] In one embodiment, the light chain variable region of a MuSK antibody-based molecule disclosed herein includes a light chain variable region comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 195 or a CDR-L3 having at least 80% sequence identity to SEQ ID NO: 195. According to this embodiment, the CDR-L3 amino acid sequence having at least 80% sequence identity to SEQ ID NO: 195 comprises one or more amino acid substitutions to the amino acid sequence of SEQ ID NO: 195, wherein the substitutions are located at residues 1, 2, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or any combination thereof. In another embodiment, the CDR-L3 amino acid sequence has at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with respect to the amino acid sequence of SEQ ID NO: 195.

[0066] The light chain CDR sequence is shown in Table 2 below.

[0067] [Table 2A] [Table 2B]

[0068] Suitable amino acid modifications to the heavy-chain CDR sequences and / or light-chain CDR sequences of the MuSK antibody-based molecules disclosed herein include, for example, conservative substitutions or functionally equivalent amino acid residue substitutions resulting in variant CDR sequences having binding properties similar to or enhanced to those of the CDR sequences disclosed herein, as described above. The CDRs in Table 1 and Table 2 containing one, two, three, four, five or more amino acid substitutions (depending on the length of the CDR) that maintain or enhance the MuSK binding of the antibody are included in the present invention. The resulting modified CDRs are at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, and at least 95% similar in sequence to the CDRs in Table 1 and Table 2. Suitable amino acid modifications for the heavy chain CDR sequences in Table 1 and / or the light chain CDR sequences in Tables 1 and 2 include, for example, conservative substitutions or functionally equivalent amino acid residue substitutions that result in variant CDR sequences having binding properties similar to or enhanced to those of the CDR sequences in Tables 1 and 2. Conservative substitutions are substitutions made within the family of amino acids to which their side chains relate. Genetically, coding amino acids can be divided into four families: (1) acidic (aspartate, glutamate), (2) basic (lysine, arginine, histidine), (3) nonpolar (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), and (4) non-charged (glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine). Phenylalanine, tryptophan, and tyrosine are sometimes collectively classified as aromatic amino acids.Alternatively, the amino acid repertoire may be grouped as follows: (1) acidic (aspartates, glutamates), (2) basic (lysine, arginine histidine), (3) aliphatic (glycine, alanine, valine, leucine, isoleucine, serine, threonine), where serine and threonine may be separately grouped as aliphatic-hydroxyl; (4) aromatic (phenylalanine, tyrosine, tryptophan), (5) amide (asparagine, glutamine); and (6) sulfur-containing (cysteine ​​and methionine) (the whole of which is incorporated herein by reference: Stryer (ed.), Biochemistry, 2nd edition, WH Freeman and Co., 1981). Non-conservative substitutions may be made to the heavy chain CDR sequences in Table 1 and the light chain CDR sequences in Table 2. Non-conservative substitutions include replacing one or more amino acid residues of a CDR with one or more amino acid residues derived from a different class of amino acids to improve or enhance the binding properties of the CDR. The amino acid sequences of the heavy chain variable region CDRs in Table 1 and / or the light chain variable region CDRs in Table 2 may further include one or more internal neutral amino acid insertions or deletions that maintain or enhance MuSK binding.

[0069] In one embodiment, the MuSK antibody-based molecule is (i) Heavy chain variable region including CDR-H1 of SEQ ID NO: 1, CDR-H2 of SEQ ID NO: 17, and CDR-H3 of SEQ ID NO: 33, and light chain variable region including CDR-L1 of SEQ ID NO: 49, CDR-L2 of SEQ ID NO: 65, and CDR-L3 of SEQ ID NO: 81, (ii) Heavy chain variable region including CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 34, and light chain variable region including CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO: 82, (iii) Heavy chain variable region including CDR-H1 of SEQ ID NO: 3, CDR-H2 of SEQ ID NO: 19, and CDR-H3 of SEQ ID NO: 35, and light chain variable region including CDR-L1 of SEQ ID NO: 51, CDR-L2 of SEQ ID NO: 67, and CDR-L3 of SEQ ID NO: 83, (iv) Heavy chain variable region including CDR-H1 of SEQ ID NO: 4, CDR-H2 of SEQ ID NO: 20, and CDR-H3 of SEQ ID NO: 36, and light chain variable region including CDR-L1 of SEQ ID NO: 52, CDR-L2 of SEQ ID NO: 68, and CDR-L3 of SEQ ID NO: 84, (v) Heavy chain variable region including CDR-H1 of SEQ ID NO: 5, CDR-H2 of SEQ ID NO: 21, and CDR-H3 of SEQ ID NO: 37, and light chain variable region including CDR-L1 of SEQ ID NO: 53, CDR-L2 of SEQ ID NO: 69, and CDR-L3 of SEQ ID NO: 85 (vi) Heavy chain variable regions including CDR-H1 of SEQ ID NO: 6, CDR-H2 of SEQ ID NO: 22, and CDR-H3 of SEQ ID NO: 38, and light chain variable regions including CDR-L1 of SEQ ID NO: 54, CDR-L2 of SEQ ID NO: 70, and CDR-L3 of SEQ ID NO: 86, (vii) Heavy chain variable regions including CDR-H1 of SEQ ID NO: 7, CDR-H2 of SEQ ID NO: 23, and CDR-H3 of SEQ ID NO: 39, and light chain variable regions including CDR-L1 of SEQ ID NO: 55, CDR-L2 of SEQ ID NO: 71, and CDR-L3 of SEQ ID NO: 87, (viii) Heavy chain variable region including CDR-H1 of SEQ ID NO: 8, CDR-H2 of SEQ ID NO: 24, and CDR-H3 of SEQ ID NO: 40, and light chain variable region including CDR-L1 of SEQ ID NO: 56, CDR-L2 of SEQ ID NO: 72, and CDR-L3 of SEQ ID NO: 88, (ix) Heavy chain variable region including CDR-H1 of SEQ ID NO: 9, CDR-H2 of SEQ ID NO: 25, and CDR-H3 of SEQ ID NO: 41, and light chain variable region including CDR-L1 of SEQ ID NO: 57, CDR-L2 of SEQ ID NO: 73, and CDR-L3 of SEQ ID NO: 89, (x) Heavy chain variable region including CDR-H1 of SEQ ID NO: 10, CDR-H2 of SEQ ID NO: 26, and CDR-H3 of SEQ ID NO: 42, and light chain variable region including CDR-L1 of SEQ ID NO: 58, CDR-L2 of SEQ ID NO: 74, and CDR-L3 of SEQ ID NO: 90. (xi) Heavy chain variable region including CDR-H1 of SEQ ID NO: 11, CDR-H2 of SEQ ID NO: 27, and CDR-H3 of SEQ ID NO: 43, and light chain variable region including CDR-L1 of SEQ ID NO: 59, CDR-L2 of SEQ ID NO: 75, and CDR-L3 of SEQ ID NO: 91, (xii) Heavy chain variable region including CDR-H1 of SEQ ID NO: 12, CDR-H2 of SEQ ID NO: 28, and CDR-H3 of SEQ ID NO: 44, and light chain variable region including CDR-L1 of SEQ ID NO: 60, CDR-L2 of SEQ ID NO: 76, and CDR-L3 of SEQ ID NO: 92, (xiii) Heavy chain variable region including CDR-H1 of SEQ ID NO: 13, CDR-H2 of SEQ ID NO: 29, and CDR-H3 of SEQ ID NO: 45, and light chain variable region including CDR-L1 of SEQ ID NO: 61, CDR-L2 of SEQ ID NO: 77, and CDR-L3 of SEQ ID NO: 93, (xiv) Heavy chain variable region including CDR-H1 of SEQ ID NO: 14, CDR-H2 of SEQ ID NO: 30, and CDR-H3 of SEQ ID NO: 46, and light chain variable region including CDR-L1 of SEQ ID NO: 62, CDR-L2 of SEQ ID NO: 78, and CDR-L3 of SEQ ID NO: 94, (xv) Heavy chain variable region including CDR-H1 of SEQ ID NO: 15, CDR-H2 of SEQ ID NO: 31, and CDR-H3 of SEQ ID NO: 47, and light chain variable region including CDR-L1 of SEQ ID NO: 63, CDR-L2 of SEQ ID NO: 79, and CDR-L3 of SEQ ID NO: 95, (xvi) Heavy chain variable region including CDR-H1 of SEQ ID NO: 16, CDR-H2 of SEQ ID NO: 32, and CDR-H3 of SEQ ID NO: 48, and light chain variable region including CDR-L1 of SEQ ID NO: 64, CDR-L2 of SEQ ID NO: 80, and CDR-L3 of SEQ ID NO: 96, (xvii) Heavy chain variable region including CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 139, and light chain variable region including CDR-L1 of SEQ ID NO: 141, CDR-L2 of SEQ ID NO: 143, and CDR-L3 of SEQ ID NO: 145, and (xviii) Heavy chain variable region including CDR-H1 of SEQ ID NO: 136, CDR-H2 of SEQ ID NO: 138, and CDR-H3 of SEQ ID NO: 140, and light chain variable region including CDR-L1 of SEQ ID NO: 142, CDR-L2 of SEQ ID NO: 144, and CDR-L3 of SEQ ID NO: 146 Includes.

[0070] In one embodiment, the MuSK antibody-based molecule is (ii.a) A heavy chain variable region including CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 240, and a light chain variable region (X2m1) including CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO: 82; (ii.b) A heavy chain variable region including CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 241, and a light chain variable region (X2m2) including CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO: 82; (ii.c) A heavy chain variable region including CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 242, and a light chain variable region (X2m3) including CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO: 82; (ii.d) A heavy chain variable region including CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 243, and a light chain variable region (X2m4) including CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO: 82; (ii.e) A heavy chain variable region including CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 244, and a light chain variable region (X2m5) including CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO: 82; (ii.f) A heavy chain variable region including CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 245, and a light chain variable region (X2m6) including CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO: 82; (ii.g) A heavy chain variable region including CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 246, and a light chain variable region (X2m7) including CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO: 82; (ii.f) Heavy chain variable region including CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 247, and light chain variable region (X2m8) including CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO: 82. Includes.

[0071] In one embodiment, the MuSK antibody-based molecule is (xvii.a) Heavy chain variable region including CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 248, and light chain variable region (X17m1) including CDR-L1 of SEQ ID NO: 141, CDR-L2 of SEQ ID NO: 143, and CDR-L3 of SEQ ID NO: 145; (xvii.b) Heavy chain variable region including CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 249, and light chain variable region (X17m2) including CDR-L1 of SEQ ID NO: 141, CDR-L2 of SEQ ID NO: 143, and CDR-L3 of SEQ ID NO: 145; (xvii.c) Heavy chain variable region including CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 250, and light chain variable region (X17m3) including CDR-L1 of SEQ ID NO: 141, CDR-L2 of SEQ ID NO: 143, and CDR-L3 of SEQ ID NO: 145; (xvii.d) Heavy chain variable region including CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 251, and light chain variable region including CDR-L1 of SEQ ID NO: 141, CDR-L2 of SEQ ID NO: 143, and CDR-L3 of SEQ ID NO: 145 (X17m6) Includes.

[0072] In one embodiment, the MuSK antibody-based molecule is (i) A heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region (14D10) including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 170, and CDR-L3 of SEQ ID NO: 180; (ii) Heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and light chain variable region (7G4) including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 171, and CDR-L3 of SEQ ID NO: 181; (iii) A heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region (3C4) including CDR-L1 of SEQ ID NO: 160, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 182; (iv) A heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region (3B2) including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 183; (v) A heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region (3G3) including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 171, and CDR-L3 of SEQ ID NO: 184; (vi) Heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and light chain variable region (31G2) including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 173, and CDR-L3 of SEQ ID NO: 185; (vii) Heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 173, and CDR-L3 of SEQ ID NO: 186 (31B7); (viii) A heavy chain variable region including CDR-H1 of SEQ ID NO: 148, CDR-H2 of SEQ ID NO: 151, and CDR-H3 of SEQ ID NO: 157, and a light chain variable region (17H10) including CDR-L1 of SEQ ID NO: 161, CDR-L2 of SEQ ID NO: 174, and CDR-L3 of SEQ ID NO: 187; (ix) Heavy chain variable region including CDR-H1 of SEQ ID NO: 148, CDR-H2 of SEQ ID NO: 151, and CDR-H3 of SEQ ID NO: 157, and light chain variable region including CDR-L1 of SEQ ID NO: 162, CDR-L2 of SEQ ID NO: 174, and CDR-L3 of SEQ ID NO: 188 (23B6); (x) Heavy chain variable region including CDR-H1 of SEQ ID NO: 148, CDR-H2 of SEQ ID NO: 151, and CDR-H3 of SEQ ID NO: 157, and light chain variable region (30E1) including CDR-L1 of SEQ ID NO: 163, CDR-L2 of SEQ ID NO: 174, and CDR-L3 of SEQ ID NO: 188; (xi) Heavy chain variable region including CDR-H1 of SEQ ID NO: 148, CDR-H2 of SEQ ID NO: 151, and CDR-H3 of SEQ ID NO: 157, and light chain variable region (30A11) including CDR-L1 of SEQ ID NO: 164, CDR-L2 of SEQ ID NO: 174, and CDR-L3 of SEQ ID NO: 189; (xii) Heavy chain variable region including CDR-H1 of SEQ ID NO: 149, CDR-H2 of SEQ ID NO: 152, and CDR-H3 of SEQ ID NO: 158, and light chain variable region (16F11) including CDR-L1 of SEQ ID NO: 165, CDR-L2 of SEQ ID NO: 175, and CDR-L3 of SEQ ID NO: 190; (xiii) A heavy chain variable region including CDR-H1 of SEQ ID NO: 149, CDR-H2 of SEQ ID NO: 152, and CDR-H3 of SEQ ID NO: 158, and a light chain variable region (4C11) including CDR-L1 of SEQ ID NO: 166, CDR-L2 of SEQ ID NO: 176, and CDR-L3 of SEQ ID NO: 191; (xiv) Heavy chain variable region including CDR-H1 of SEQ ID NO: 149, CDR-H2 of SEQ ID NO: 152, and CDR-H3 of SEQ ID NO: 158, and light chain variable region (7A12) including CDR-L1 of SEQ ID NO: 167, CDR-L2 of SEQ ID NO: 177, and CDR-L3 of SEQ ID NO: 192; (xv) Heavy chain variable region including CDR-H1 of SEQ ID NO: 149, CDR-H2 of SEQ ID NO: 152, and CDR-H3 of SEQ ID NO: 158, and light chain variable region (7G12) including CDR-L1 of SEQ ID NO: 168, CDR-L2 of SEQ ID NO: 178, and CDR-L3 of SEQ ID NO: 193; (xvi) Heavy chain variable region including CDR-H1 of SEQ ID NO: 149, CDR-H2 of SEQ ID NO: 152, and CDR-H3 of SEQ ID NO: 158, and light chain variable region including CDR-L1 of SEQ ID NO: 169, CDR-L2 of SEQ ID NO: 179, and CDR-L3 of SEQ ID NO: 194 (7B8); (xvii) Heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 153, and CDR-H3 of SEQ ID NO: 156, and light chain variable region (3B2g1m1) including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 183; (xviii) Heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 154, and CDR-H3 of SEQ ID NO: 156, and light chain variable region (3B2g1m2) including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 183; (xvix) Heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 155, and CDR-H3 of SEQ ID NO: 156, and light chain variable region (3B2g1m4) including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 183; (xx) Heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 153, and CDR-H3 of SEQ ID NO: 156, and light chain variable region (3B2g2m1) including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 195; (xxi) Heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 154, and CDR-H3 of SEQ ID NO: 156, and light chain variable region (3B2g2m2) including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 195; and (xxii) Heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 155, and CDR-H3 of SEQ ID NO: 156, and light chain variable region (3B2g2m4) including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 195 Includes.

[0073] In a preferred embodiment, the MuSK antibody-based molecule includes a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 153, and CDR-H3 of SEQ ID NO: 156, as well as a light chain variable region (3B2g2m1) comprising CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 195.

[0074] The MuSK antibody-based molecules described herein may include a variable light (VL) chain, a variable heavy (VH) chain, or a combination of a VL chain and a VH chain. In some embodiments, the VH chain of the MuSK antibody-based molecule includes an amino acid sequence that is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to any one of the VH amino acid sequences shown in Table 3 below, or any one of the VH amino acid sequences listed in Table 3. In some embodiments, the VL chain of the MuSK antibody-based molecule includes an amino acid sequence that is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to any one of the VL amino acid sequences shown in Table 3 below, or any one of the VL amino acid sequences listed in Table 3.

[0075] [Table 3A] [Table 3B] [Table 3C] [Table 3D] [Table 3E]

Table 3F

[0076] In one embodiment, the MuSK antibody-based molecule disclosed herein comprises: (i) a heavy chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 97 and a light chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 98; (ii) a heavy chain variable region containing an amino acid sequence at least 80% identical to any one of SEQ ID NOs. 99 and 252-259 and a light chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 100; and (iii) a heavy chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 101. (iv) A light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 102, (v) A light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 103, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 104, (v) A light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 105, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 106, (vi) A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 107 (vii) a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 108, or (vii) a heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 109, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 110, (viii) a heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 111, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 112, (ix) a heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 113 (x) A variable region and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 114, (x) a heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 115, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 116, (xi) a heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 117, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 118, (xii) a heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 119,a light chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 120, (xiii) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 121, and a light chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 122, (xiv) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 123, and a light chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 124, (xv) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 125, and a light chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 126, (xvi) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 127, and a light chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 128, (xvii) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to any one of SEQ ID NOs: 131 and 260 to 263, and a light chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 132, and (xviii) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 133, and a light chain variable region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 134.

[0077] In some embodiments, the MuSK antibody-based molecules disclosed herein include: (i) a heavy chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 196 and a light chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 197; (ii) a heavy chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 198 and a light chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 199; (iii) a heavy chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 200 and at least identical to SEQ ID NO: 201. (iv) A light chain variable region containing an amino acid sequence that is 80% identical to (v) SEQ ID NO: 202 and a heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 203 and a light chain variable region containing an amino acid sequence that is at least 80% identical to (v) SEQ ID NO: 204 and a light chain variable region containing an amino acid sequence that is at least 80% identical to (v) SEQ ID NO: 205 and a heavy chain variable region containing an amino acid sequence that is at least 80% identical to (v) SEQ ID NO: 206 and a light chain variable region containing an amino acid sequence that is at least 80% identical to (v) SEQ ID NO: 207 and a light chain variable region containing an amino acid sequence that is at least 80% identical to (v) SEQ ID NO: 204 and a light7 and a light chain variable region containing an amino acid sequence that is at least 80% identical to (v) SEQ ID NO: 204 and a light chain variable region containing an amino acid sequence that is at least 80% identical to (v) SEQ ID NO: 207 and a light chain variable region containing an amino acid sequence that is at least 80% identical to (v) SEQ ID NO: 204 and a light chain variable region containing an amino acid sequence that is at least 80% identical to (v) SEQ ID NO: 207 and a light chain variable region containing an amino acid sequence that is at least 80% (vii) a light chain variable region containing an amino acid sequence, a heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 208, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 209, (viii) a heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 210, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 211, (vix) a heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 212, and an amino acid sequence that is at least 80% identical to SEQ ID NO: 213 (x) a light chain variable region including (x) an amino acid sequence that is at least 80% identical to SEQ ID NO: 214, and a light chain variable region including an amino acid sequence that is at least 80% identical to SEQ ID NO: 215, (xi) a heavy chain variable region including an amino acid sequence that is at least 80% identical to SEQ ID NO: 216, and a light chain variable region including an amino acid sequence that is at least 80% identical to SEQ ID NO: 217, (xii) a heavy chain variable region including an amino acid sequence that is at least 80% identical to SEQ ID NO: 218, and a light chain variable region including an amino acid sequence that is at least 80% identical to SEQ ID NO: 219,(xiii) Heavy chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 220, and a light chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 221, (xiv) Heavy chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 222, and a light chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 223, (xv) Heavy chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 224, and a light chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 225, (xvi) Heavy chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 226, and a light chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 227, (xvii) Heavy chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 228, and a light chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 229, (x viii) A heavy chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 230, and a light chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 231; (xix) A heavy chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 232, and a light chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 233; (xx) A heavy chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 234, and a light chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 235; (xxi) A heavy chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 236, and a light chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 237; (xxii) A heavy chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 238, and a light chain variable region containing an amino acid sequence at least 80% identical to SEQ ID NO: 229.

[0078] Another aspect of the invention relates to an isolated polynucleotide encoding a MuSK antibody-based molecule described herein. In one embodiment, the polynucleotide encoding the MuSK antibody of the invention comprises a sequence encoding any one, any two, any three, any four, any five, or any six of the above CDRs, for example, the heavy chain CDRs of SEQ ID NOs: 1-48, 135-140, 147-158, and 240-251 and the light chain CDRs of SEQ ID NOs: 49-96, 141-146, and 159-195.

[0079] In one embodiment, the polynucleotide comprises a nucleotide sequence encoding a V H domain and a V HThe domains are: (i) a heavy chain variable region including CDR-H1 of SEQ ID NO: 1, CDR-H2 of SEQ ID NO: 17, and CDR-H3 of SEQ ID NO: 33; (ii) a heavy chain variable region including CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 34; (iii) a heavy chain variable region including CDR-H1 of SEQ ID NO: 3, CDR-H2 of SEQ ID NO: 19, and CDR-H3 of SEQ ID NO: 35; (iv) a heavy chain variable region including CDR-H1 of SEQ ID NO: 4, CDR-H2 of SEQ ID NO: 20, and CDR-H3 of SEQ ID NO: 36; (v) CDR-H of SEQ ID NO: 5 1. Heavy chain variable region including CDR-H2 of SEQ ID NO: 21 and CDR-H3 of SEQ ID NO: 37, (vi) Heavy chain variable region including CDR-H1 of SEQ ID NO: 6, CDR-H2 of SEQ ID NO: 22 and CDR-H3 of SEQ ID NO: 38, (vii) Heavy chain variable region including CDR-H1 of SEQ ID NO: 7, CDR-H2 of SEQ ID NO: 23 and CDR-H3 of SEQ ID NO: 39, (viii) Heavy chain variable region including CDR-H1 of SEQ ID NO: 8, CDR-H2 of SEQ ID NO: 24 and CDR-H3 of SEQ ID NO: 40, (ix) CDR-H1 of SEQ ID NO: 9, CDR-H2 of SEQ ID NO: 25, and (x) Heavy chain variable region including CDR-H3 of SEQ ID NO: 41, (x) Heavy chain variable region including CDR-H1 of SEQ ID NO: 10, CDR-H2 of SEQ ID NO: 26, and CDR-H3 of SEQ ID NO: 42, (xi) Heavy chain variable region including CDR-H1 of SEQ ID NO: 11, CDR-H2 of SEQ ID NO: 27, and CDR-H3 of SEQ ID NO: 43, (xii) Heavy chain variable region including CDR-H1 of SEQ ID NO: 12, CDR-H2 of SEQ ID NO: 28, and CDR-H3 of SEQ ID NO: 44, (xiii) CDR-H1 of SEQ ID NO: 13, CDR-H2 of SEQ ID NO: 29, and CDR-H3 of SEQ ID NO: 45 (xiv) Heavy chain variable region including CDR-H1 of SEQ ID NO: 14, CDR-H2 of SEQ ID NO: 30, and CDR-H3 of SEQ ID NO: 46, (xv) Heavy chain variable region including CDR-H1 of SEQ ID NO: 15, CDR-H2 of SEQ ID NO: 31, and CDR-H3 of SEQ ID NO: 47, (xvi) Heavy chain variable region including CDR-H1 of SEQ ID NO: 16, CDR-H2 of SEQ ID NO: 32, and CDR-H3 of SEQ ID NO: 48, (xvii) Heavy chain variable region including CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 139,(xviii) also includes a heavy chain variable region comprising CDR-H1 of SEQ ID NO: 136, CDR-H2 of SEQ ID NO: 138, and CDR-H3 of SEQ ID NO: 140.

[0080] In some embodiments, polynucleotides are V H Contains a nucleotide sequence that codes for the domain, V H The domains are: (ii.a) a heavy chain variable region (X2m1) containing CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 240; (ii.b) a heavy chain variable region (X2m2) containing CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 241; (ii.c) a heavy chain variable region (X2m3) containing CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 242; (ii.d) a heavy chain variable region (X2m 4) (ii.e) a heavy chain variable region (X2m5) including CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 244; (ii.f) a heavy chain variable region (X2m6) including CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 245; (ii.g) a heavy chain variable region (X2m7) including CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 246; (ii.h) a heavy chain variable region (X2m8) including CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 247.

[0081] In some embodiments, polynucleotides are V H Contains a nucleotide sequence that codes for the domain, V HThe domain includes (xvii.a) a heavy chain variable region (X17m1) containing CDR-H1 of sequence number 135, CDR-H2 of sequence number 137, and CDR-H3 of sequence number 248; (xvii.b) a heavy chain variable region (X17m2) containing CDR-H1 of sequence number 135, CDR-H2 of sequence number 137, and CDR-H3 of sequence number 249; (xvii.c) a heavy chain variable region (X17m3) containing CDR-H1 of sequence number 135, CDR-H2 of sequence number 137, and CDR-H3 of sequence number 250; and (xvii.d) a heavy chain variable region (X17m6) containing CDR-H1 of sequence number 135, CDR-H2 of sequence number 137, and CDR-H3 of sequence number 251.

[0082] In one embodiment, the polynucleotide is V H Contains a nucleotide sequence that codes for the domain, V H The domain includes a heavy chain variable region containing (xix) CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156; a heavy chain variable region containing (xx) CDR-H1 of SEQ ID NO: 148, CDR-H2 of SEQ ID NO: 151, and CDR-H3 of SEQ ID NO: 157; and a heavy chain variable region containing (xxi) CDR-H1 of SEQ ID NO: 149, CDR-H2 of SEQ ID NO: 152, and CDR-H3 of SEQ ID NO: 158.

[0083] In one embodiment, the polynucleotide is V H Contains a nucleotide sequence that codes for the domain, V H The domain includes a heavy chain variable region containing (xxii) CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 153, and CDR-H3 of SEQ ID NO: 156; (xxiii) a heavy chain variable region containing CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 154, and CDR-H3 of SEQ ID NO: 156; and (xxiv) a heavy chain variable region containing CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 155, and CDR-H3 of SEQ ID NO: 156.

[0084] In one embodiment, the polynucleotide is V L Contains a nucleotide sequence that codes for the domain, V LThe domains are: (i) a light chain variable region including CDR-L1 of SEQ ID NO: 49, CDR-L2 of SEQ ID NO: 65, and CDR-L3 of SEQ ID NO: 81; (ii) a light chain variable region including CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO: 82; (iii) a light chain variable region including CDR-L1 of SEQ ID NO: 51, CDR-L2 of SEQ ID NO: 67, and CDR-L3 of SEQ ID NO: 83; (iv) a light chain variable region including CDR-L1 of SEQ ID NO: 52, CDR-L2 of SEQ ID NO: 68, and CDR-L3 of SEQ ID NO: 84; and (v) a CD of SEQ ID NO: 53. (vi) Light chain variable region including R-L1, CDR-L2 of SEQ ID NO: 69, and CDR-L3 of SEQ ID NO: 85, (vi) Light chain variable region including CDR-L1 of SEQ ID NO: 54, CDR-L2 of SEQ ID NO: 70, and CDR-L3 of SEQ ID NO: 86, (vii) Light chain variable region including CDR-L1 of SEQ ID NO: 55, CDR-L2 of SEQ ID NO: 71, and CDR-L3 of SEQ ID NO: 87, (viii) Light chain variable region including CDR-L1 of SEQ ID NO: 56, CDR-L2 of SEQ ID NO: 72, and CDR-L3 of SEQ ID NO: 88, (ix) CDR-L1 of SEQ ID NO: 57, CDR-L3 of SEQ ID NO: 73 (x) Light chain variable region including L2 and CDR-L3 of SEQ ID NO: 89, (x) Light chain variable region including CDR-L1 of SEQ ID NO: 58, CDR-L2 of SEQ ID NO: 74, and CDR-L3 of SEQ ID NO: 90, (xi) Light chain variable region including CDR-L1 of SEQ ID NO: 59, CDR-L2 of SEQ ID NO: 75, and CDR-L3 of SEQ ID NO: 91, (xii) Light chain variable region including CDR-L1 of SEQ ID NO: 60, CDR-L2 of SEQ ID NO: 76, and CDR-L3 of SEQ ID NO: 92, (xiii) CDR-L1 of SEQ ID NO: 61, CDR-L2 of SEQ ID NO: 77, and CDR-L3 of SEQ ID NO: 93 Light chain variable region including L3, (xiv) Light chain variable region including CDR-L1 of SEQ ID NO: 62, CDR-L2 of SEQ ID NO: 78, and CDR-L3 of SEQ ID NO: 94, (xv) Light chain variable region including CDR-L1 of SEQ ID NO: 63, CDR-L2 of SEQ ID NO: 79, and CDR-L3 of SEQ ID NO: 95, (xvi) Light chain variable region including CDR-L1 of SEQ ID NO: 64, CDR-L2 of SEQ ID NO: 80, and CDR-L3 of SEQ ID NO: 96, (xvii) Light chain variable region including CDR-L1 of SEQ ID NO: 141, CDR-L2 of SEQ ID NO: 143, and CDR-L3 of SEQ ID NO: 145(xviii) Includes a light chain variable region comprising CDR-L1 of sequence number 142, CDR-L2 of sequence number 144, and CDR-L3 of sequence number 146.

[0085] In one embodiment, the polynucleotide is V L Contains a nucleotide sequence that codes for the domain, V LThe domains are: (xix) light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 170, and CDR-L3 of SEQ ID NO: 180; (xx) light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 171, and CDR-L3 of SEQ ID NO: 181; (xxi) light chain variable region including CDR-L1 of SEQ ID NO: 160, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 182; (xxii) light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 183 , (xxiii) light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 171, and CDR-L3 of SEQ ID NO: 184, (xxiv) light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 173, and CDR-L3 of SEQ ID NO: 185, (xxv) light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 173, and CDR-L3 of SEQ ID NO: 186, (xxvi) light chain variable region including CDR-L1 of SEQ ID NO: 161, CDR-L2 of SEQ ID NO: 174, and CDR-L3 of SEQ ID NO: 187, ( xxvii) Light chain variable region including CDR-L1 of sequence number 162, CDR-L2 of sequence number 174, and CDR-L3 of sequence number 188, (xxviii) Light chain variable region including CDR-L1 of sequence number 163, CDR-L2 of sequence number 174, and CDR-L3 of sequence number 188, (xxix) Light chain variable region including CDR-L1 of sequence number 164, CDR-L2 of sequence number 174, and CDR-L3 of sequence number 189, (xxx) Light chain variable region including CDR-L1 of sequence number 165, CDR-L2 of sequence number 175, and CDR-L3 of sequence number 190, ( xxxi) Light chain variable region including CDR-L1 of sequence number 166, CDR-L2 of sequence number 176, and CDR-L3 of sequence number 191, (xxxi) Light chain variable region including CDR-L1 of sequence number 167, CDR-L2 of sequence number 177, and CDR-L3 of sequence number 192, (xxxii) Light chain variable region including CDR-L1 of sequence number 168, CDR-L2 of sequence number 178, and CDR-L3 of sequence number 193, (xxxiii) Light chain variable region including CDR-L1 of sequence number 169, CDR-L2 of sequence number 179, and CDR-L3 of sequence number 194,Includes.

[0086] In one embodiment, the polynucleotide is V L Contains a nucleotide sequence that codes for the domain, V L The domain includes a light chain variable region containing (xxxiv) CDR-L1 of sequence number 159, CDR-L2 of sequence number 172, and CDR-L3 of sequence number 183, and a light chain variable region containing (xxxv) CDR-L1 of sequence number 159, CDR-L2 of sequence number 172, and CDR-L3 of sequence number 195.

[0087] In one embodiment, the isolated polynucleotide encoding the MuSK antibody-based molecule is V shown in Table 3 below. H and / or V L It encodes one of the domain sequences. The nucleic acid molecules described herein include isolated polynucleotides, portions of expression vectors, or portions of linear DNA sequences, such as linear DNA sequences used for in vitro transcription / translation, and vectors suitable for the expression, secretion, and / or presentation of antibodies or their conjugated fragments described herein in prokaryotes, eukaryotes, or filamentous phages.

[0088] The polynucleotides of the present invention may be prepared by chemical synthesis, for example, by solid-phase polynucleotide synthesis in an automated polynucleotide synthesizer, and assembled into complete single-stranded or double-stranded molecules. Alternatively, the polynucleotides of the present invention may be prepared by other techniques, such as PCR followed by routine cloning. Techniques for producing or obtaining polynucleotides of a given sequence are well known in the art.

[0089] The polynucleotide of the present invention may include at least one non-coding sequence, such as a promoter or enhancer sequence, an intron, a polyadenylation signal, or a cis sequence that promotes RepA binding. The polynucleotide sequence may also include additional sequences that encode, for example, a linker sequence, a marker or tag sequence, such as a histidine tag or HA tag to facilitate protein purification or detection, a signal sequence, a fusion protein partner such as RepA, an Fc moiety, or a bacteriophage coat protein, such as pIX or pill.

[0090] Another embodiment of the present invention relates to a vector comprising at least one polynucleotide encoding a MuSK antibody-based molecule as described herein. Such vectors include, but are not limited to, plasmid vectors, viral vectors, e.g., vaccinia vectors, lentiviral vectors, adenovirus vectors, adeno-associated virus vectors, vectors for baculovirus expression, transposon-based vectors, or any other vector suitable for introducing the polynucleotide described herein into a given organism or genetic background by any means to promote the expression of the encoded antibody polypeptide. In one embodiment, the polynucleotide sequence encoding the heavy chain variable domain described herein, alone or together with the polynucleotide sequence encoding the light chain variable domain described herein, is combined with a sequence of promoter, translation initiation segment (e.g., ribosome-binding sequence and start codon), 3' untranslated region, polyadenylation signal, termination codon, and transcription termination to form one or more expression vector constructs.

[0091] In one embodiment, the vector is an adenovirus-associated virus (AAV) vector. Several therapeutic AAV vectors suitable for delivering the polynucleotide encoding the antibody described herein to the central nervous system are known in the art. For example, see Deverman et al., "Gene Therapy for Neurological Disorders: Progress and Prospects," Nature Rev. 17: pp. 641-659 (2018), which is incorporated in its entirety herein by reference. Suitable AAV vectors include serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, or AAV11, either in their native form or engineered to enhance tropism. AAV vectors known to have CNS tropism particularly suitable for the therapeutic expression of the MuSK antibody described herein include AAV1, AAV2, AAV4, AAV5, AAV8, and AAV9, either in their native form or engineered to enhance tropism. In one embodiment, the AAV vector is an AAV2 vector. In another embodiment, the AAV vector is an AAV5 vector (Vitale et al., "Anti-tau Conformational scFv MCI Antibody Efficiently Reduces Pathological Tau Species in Adult JNPL3 Mice," Acta Neuropalhol. Commun. 6:82 (2018), which is incorporated herein by reference in its entirety). In yet another embodiment, the AAV vector is an AAV9 vector (Haiyan et al., "Targeting Root Cause by Systemic scAAV9-hIDS Gene Delivery: Functional Correction and Reversal of Severe MPSII in Mice," Mol. Ther. Methods Clin. Dev. 10:327-340 (2018), which is incorporated herein by reference in its entirety).In another embodiment, the AAV vector is an AAVrhlO vector (Liu et al., "Vectored Intracerebral Immunizations with the Anti-Tau Monoclonal Antibody PHF1 Markedly Reduces Tau Pathology in Mutant Transgenic Mice," J. Neurosci. 36(49): 124 pp. 25-35 (2016) is incorporated herein by reference in its entirety).

[0092] In another embodiment, the AAV vector is a hybrid vector containing the genome of one serotype, e.g., AAV2, and the capsid protein of another serotype, e.g., AAV1 or AAV3-9, to control tropism. See, for example, Broekman et al., "Adeno-associated Virus Vectors Serotyped with AAV8 Capsid are More Efficient than AAV-1 or-2 Serotypes for Widespread Gene Delivery to the Neonatal Mouse Brain," Neuroscience 138: pp. 501-510 (2006), which is incorporated herein by reference in its entirety. In one embodiment, the AAV vector is an AAV2 / 8 hybrid vector (see, Ising et al., "AAV-mediated Expression of Anti-Tau ScFv Decreases Tau Accumulation in a Mouse Model of Tauopathy," J. Exp. Med. 214(5): pp. 1227 (2017), which is incorporated herein by reference in its entirety). In another embodiment, the AAV vector is an AAV2 / 9 hybrid vector (Simon et al., "A Rapid Gene Delivery-Based Mouse Model for Early-Stage Alzheimer Disease-Type Tauopathy," J. Neuropath. Exp. Neurol. 72(11): pp. 1062-1061 (2013) is incorporated herein by reference in its entirety).

[0093] In another embodiment, the AAV vector is modified or selected for enhanced CNS transduction after intracerebral administration, e.g., AAV-DJ (Grimm et al., J. Viol. 82: pp. 5887-5911 (2008), the whole of which is incorporated herein by reference); modified or selected for enhanced transduction of neural stem cells and progenitor cells, e.g., SCH9 and AAV4.18 (Murlidharan et al., J. Virol. 89: pp. 3976-3987 (2015), the whole of which is incorporated herein by reference, and Ojala et al., Mol. Ther. 26: pp. 304-319 (2018)); modified or selected for enhanced retrograde transduction, e.g., rAAV2-retro (Muller et al., Nat. Biotechnol., the whole of which is incorporated herein by reference). 21: pp. 1040-1046 (2003)); modified or selected for selective transduction into brain endothelial cells, e.g., AAV-BRI (Korbelin et al., EMBO Mol. Med. 8: pp. 609-625 (2016), the whole of which is incorporated herein by reference); or modified or selected for enhanced transduction of adult CNS after IV administration, e.g., AAV-PHP.B and AAVPHP.eB (Deverman et al., Nat. Biotechnol. 34: pp. 204-209 (2016) and Chan et al., Nat. Neurosci. 20: pp. 1172-1179 (2017)).

[0094] According to this embodiment, the expression vector construct encoding a MuSK antibody-based molecule comprises a polynucleotide sequence encoding a heavy chain polypeptide, a functional fragment thereof, a variant thereof, or a combination thereof. Alternatively, the expression construct may comprise a nucleic acid sequence encoding a light chain polypeptide, a functional fragment thereof, a variant thereof, or a combination thereof. In one embodiment, the expression vector construct comprises a heavy chain polypeptide, a functional fragment thereof, or a variant thereof, and a nucleic acid sequence encoding a light chain polypeptide, a functional fragment thereof, or a variant thereof.

[0095] In one embodiment, the expression construct further comprises a promoter sequence suitable for driving the expression of a MuSK antibody-based molecule. Suitable promoter sequences include, but are not limited to, the elongation factor-1α promoter (EF1a) promoter, the phosphoglycerate kinase-1 promoter (PGK) promoter, the cytomegalovirus pre-early gene promoter (CMV), the chimeric liver-specific promoter (LSP), the cytomegalovirus enhancer / chicken β-actin promoter (CAG), the tetracycline-responsive promoter (TRE), the transthyretin promoter (TTR), the Simian virus 40 promoter (SV40), and the CK6 promoter. Other promoters known in the art that are suitable for driving gene expression in mammalian cells are also suitable for incorporation into the expression constructs disclosed herein.

[0096] In one embodiment, the expression construct further encodes a linker sequence. The linker sequence may encode an amino acid sequence that spatially separates and / or links one or more components of the expression construct (the heavy and light chain components of the encoded antibody).

[0097] Another aspect of the present invention is a host cell that produces the MuSK antibody described herein, comprising one or more vectors encoding the MuSK antibody. The MuSK antibody-based molecules described herein may, as is well known in the art, be prepared by cell lines, mixed cell lines, immortalized cells, or clonal populations of immortalized cells (see, for example, Ausubel et al., *Current Protocols in Molecular Biology*, John Wiley & Sons, Inc., NY, NY (1987-2001), which is incorporated herein by reference in its entirety; Sambrook et al., *Molecular Cloning: A Laboratory Manual*, 2nd edition, Cold Spring Harbor, NY (1989); Harlow and Lane, *Antibodies, a Laboratory Manual*, Cold Spring Harbor, NY (1989); Colligan et al., *Current Protocols in Immunology*, John Wiley & Sons, Inc., NY (1994-2001); Colligan et al., *Current Protocols in Protein Science*, John Wiley & Sons, NY, NY (1997-2001)).

[0098] In some embodiments, the host cells selected for expression may be of mammalian origin. Suitable mammalian host cells include, but are not limited to, COS-1 cells, COS-7 cells, HEK293 cells, BHK21 cells, CHO cells, BSC-1 cells, HeG2 cells, SP2 / 0 cells, HeLa cells, mammalian myeloma cells, mammalian lymphoma cells, or any derivatives, immortalized, or transformed cells thereof. Other suitable host cells include, but are not limited to, yeast cells, insect cells, and plant cells. Alternatively, the host cell may be selected from species or organisms incapable of glycosylation of polypeptides, such as prokaryotic cells or prokaryotes, e.g., BL21, BL21(DE3), BL21-GOLD(DE3), XLi-Blue, JM109, HMS174, HMS174(DE3), and any natural or engineered strains of Escherichia coli (E. coli spp.), Klebsiella spp., or Pseudomonas spp.

[0099] The MuSK antibody-based molecules described herein can be prepared by any of a variety of techniques using the isolated polynucleotides, vectors, and host cells described above. Generally, antibodies can be produced by cell culture techniques that enable the production of antibodies, such as via conventional techniques or by generating monoclonal antibodies via transfection of antibody genes, heavy and / or light chains into suitable bacterial or mammalian cell hosts, and the antibodies can be recombinant. In one embodiment, the MuSK antibody-based molecules described herein are monoclonal antibodies or functional binding fragments thereof. Recombinant expression vectors are prepared using standard molecular biology techniques, transfected into host cells, transformants are selected, the host cells are cultured, and the antibodies are recovered from the medium. Transfection of host cells can be carried out using various techniques commonly used for the introduction of foreign DNA into prokaryotic or eukaryotic host cells, such as electroporation, calcium phosphate precipitation, DEAE-dextran transfection, etc. The antibodies described herein can be expressed in either prokaryotic or eukaryotic host cells, but it may be preferred to express the antibodies in such eukaryotic cells, particularly mammalian cells, because properly folded and immunologically active antibodies are more likely to be constructed and secreted in eukaryotic cells (especially mammalian cells) than in prokaryotic cells.

[0100] As described above, exemplary mammalian host cells for expressing the recombinant antibody of the present invention include Chinese hamster ovary (CHO cells) (for example, dhfr-CHO cells described in Urlaub and Chasin, Proc. Natl. Acad. Sci. USA, 77: pp. 4216-4220 (1980), which are incorporated herein by reference in their entirety). Other suitable mammalian host cells include, but are not limited to, NS0 myeloma cells, COS cells, and SP2 cells. When a recombinant expression vector encoding the antibody gene is introduced into mammalian host cells, the antibody is produced by culturing the host cells for a period of time sufficient to allow antibody expression in the host cells, or more preferably, the host cells to secrete the antibody into a growing medium.

[0101] Functional antibody fragments, such as Fab fragments or scFv molecules, can also be produced using host cells. It should be understood that variations of the above procedure are within the scope of the present invention. For example, it may be desirable to transfect host cells with DNA encoding a functional fragment of either the light chain or / or heavy chain of the antibody described herein. Recombinant DNA technology may be used to remove some or all of the DNA encoding either or both of the light and heavy chains that are not necessary for binding to the target antigen. Molecules expressed from such cleaved DNA molecules are also included in the antibodies described herein.

[0102] Antibodies and antibody-conjugated fragments are recovered and purified from recombinant cell cultures by known methods, including, but not limited to, protein A purification, ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyl apatite chromatography, and lectin chromatography. High-performance liquid chromatography ("HPLC") may also be used for purification.

[0103] Pharmaceutical composition containing a MuSK antibody-based molecule The MuSK antibody-based molecule or the polynucleotide encoding the MuSK antibody-based molecule of the present invention is advantageously administered as a composition. In one embodiment, such a composition is a pharmaceutical composition comprising an active therapeutic agent (i.e., a MuSK antibody) and one or more various other pharmaceutically acceptable components. See REMINGTON: THE SCIENCE AND PRACTICE OF PHARMACY (21st edition) (2005) (Troy, DB et al. (eds.), Lippincott Williams & Wilkins (Pubis.), Baltimore MD), which is incorporated herein by reference in its entirety. The preferred form depends on the intended mode of administration and therapeutic application. The composition may also contain, depending on the desired formulation, pharmaceutically acceptable non-toxic carriers, excipients, diluents, fillers, salts, buffers, detergents (e.g., nonionic detergents such as Tween-20 or Tween-80), stabilizers (e.g., amino acids that do not contain sugars or proteins), preservatives, tissue fixatives, solubilizers, and / or other materials suitable for inclusion in the pharmaceutical composition, which are commonly used media for formulating pharmaceutical compositions for animal or human administration. Diluents are selected so as not to affect the biological activity of the combination. Examples of such diluents include distilled water, physiological phosphate-buffered saline, Ringer's solution, dextrose solution, and Hanks' solution. In addition, the pharmaceutical composition or formulation may contain other carriers or non-toxic, non-therapeutic, non-immunogenic stabilizers, etc. Suitable aqueous and non-aqueous carriers that can be used in the pharmaceutical compositions of the present invention include water, physiological saline, phosphate-buffered physiological saline, ethanol, dextrose, polyols (e.g., glycerol, propylene glycol, polyethylene glycol, etc.), and suitable mixtures thereof, vegetable oils (e.g., olive oil, corn oil, peanut oil, cottonseed oil, and sesame oil), carboxymethylcellulose colloidal solutions, tragacanth gum, and organic esters for injection (e.g., ethyl oleate) and / or various buffers. Other carriers are well known in the pharmaceutical field.

[0104] Examples of pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions, and sterile powders for the immediate preparation of sterile injectable solutions or dispersions. The use of such media and agents for pharmaceutically active substances is well known in the art. Unless any conventional media or agent is incompatible with the active compound, their use in the pharmaceutical compositions of the present invention is intended.

[0105] The composition may also contain large macromolecules that are metabolized slowly, such as proteins, polysaccharides such as chitosan, polylactic acid, polyglycolic acid and copolymers (e.g., latex-functionalized Sepharose, agarose, cellulose, etc.), polymeric amino acids, amino acid copolymers, and lipid aggregates (e.g., oil droplets or liposomes). The compatibility of the carrier with other components of the pharmaceutical composition is determined on the basis that there is no significantly adverse effect on the desired biological properties of the active antibody-based molecule of the present invention (e.g., no substantial effect on antigen binding (e.g., relative inhibition of 10% or less, relative inhibition of 5% or less, etc.)).

[0106] The pharmaceutical compositions of the present invention may also contain pharmaceutically acceptable antioxidants, such as (1) water-soluble antioxidants such as ascorbic acid, cysteine ​​hydrochloride, sodium bicarbonate, sodium disulfite, and sodium sulfite; (2) oil-soluble antioxidants such as ascorbyl palmitic acid, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, and α-tocopherol; and (3) metal chelating agents such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, and phosphoric acid.

[0107] The pharmaceutical composition of the present invention may contain an isotonic agent, such as sugar, polyalcohol, such as mannitol, sorbitol, or glycerol, or sodium chloride.

[0108] The pharmaceutical compositions of the present invention may also contain one or more adjuvants suitable for the selected route of administration, such as preservatives, wetting agents, emulsifiers, dispersants, antiseptics, or buffers that can improve the shelf life or efficacy of the pharmaceutical composition. The antibodies of the present invention may also be prepared with a carrier that protects the antibodies against rapid release, such as controlled-release formulations, such as implants, transdermal patches, and microencapsulated delivery systems. Such carriers may include gelatin, glyceryl monostearate, glyceryl distearate, or biodegradable or biocompatible polymers, either alone or in combination with wax, such as ethylene vinyl acetate, polyanhydride, polyglycolic acid, collagen, polyorthoesters, and polylactic acid, or other materials well known in the art. Methods for preparing such formulations are generally known to those skilled in the art. See, for example, SUSTAINED AND CONTROLLED RELEASE DRUG DELIVERY SYSTEMS, edited by JR Robinson, Marcel Dekker, Inc., New York, 1978.

[0109] In one embodiment, the antibody of the present invention may be formulated to ensure proper distribution in vivo. Examples of pharmaceutically acceptable carriers for parenteral administration include sterile aqueous solutions or dispersions, and sterile powders for the immediate preparation of sterile injectable solutions or dispersions. The use of such media and agents for pharmaceutically active substances is well known in the art.

[0110] Pharmaceutical compositions for injection must typically be sterile and stable under manufacturing and storage conditions. The composition may be formulated as a solution, microemulsion, liposome, or other ordered structure suitable for achieving high drug concentrations. The carrier may be an aqueous or non-aqueous solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, polyethylene glycol, etc.) and suitable mixtures thereof, vegetable oils such as olive oil, and organic esters for injection such as ethyl oleate. Appropriate fluidity can be maintained, for example, by using a coating such as lecithin, by maintaining the required particle size in the case of dispersants, and by using surfactants. In many cases, it is preferable to include isotonic agents, such as sugars, polyalcohols (e.g., glycerol, mannitol, or sorbitol), or sodium chloride in the composition. Extending the absorption time of the injection composition can be achieved by including absorption-delaying agents, such as monostearate salts and gelatin, in the composition. Sterile injectable solutions can be prepared by incorporating the active compound in appropriate amounts, as needed, together with one or a combination of the components listed above, into a suitable solvent, followed by sterile microfiltration. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and other necessary components. For sterile powders for the preparation of sterile injectable solutions, preparation methods include vacuum drying and freeze-drying, from which a powder of the active component and any additional desired components is obtained from the previously sterile-filtered solution.

[0111] For parenteral administration, the agents of the present invention are typically formulated as an injectable dose solution or suspension of the substance in a physiologically acceptable diluent with a pharmaceutical carrier that may be a sterile liquid, such as water, oil, saline, glycerol, or ethanol. Furthermore, auxiliary substances such as wetting agents or emulsifiers, surfactants, and pH buffers may be present in the composition. Other components of the pharmaceutical composition may be of petroleum, animal, plant, or synthetic origin. Peanut oil, soybean oil, and mineral oil are all examples of useful materials. Generally, glycols, such as propylene glycol or polyethylene glycol, are preferred for liquid carriers, particularly for injectable solutions. The agents of the present invention may be administered in the form of depot injections or implant preparations that can be formulated in a manner that allows for sustained release of the active ingredient. An exemplary composition contains approximately 5 mg / mL of scFv formulated in an aqueous buffer containing 50 mM L-histidine and 150 mM NaCl, adjusted to pH 6.0 with HCl.

[0112] Typically, the composition is prepared as an injectable preparation, either as a liquid solution or a suspension. A solid form suitable for solution or suspension in a liquid vehicle may also be prepared before injection. The preparation may also be emulsified or encapsulated with liposomes or microparticles, such as polylactides, polyglycolides, or copolymers, for enhanced adjuvant effects (Langer et al., Science 249:1527 (1990); Hanes et al., Advanced Drug Delivery Reviews 28:97-119 (1997) is incorporated herein by reference in its entirety). Further formulations suitable for other modes of administration include oral formulations, intranasal formulations, pulmonary formulations, suppositories, and transdermal formulations.

[0113] Administration of a pharmaceutical composition containing a MuSK antibody-based molecule The MuSK antibody-based molecules of the present invention can be administered by parenteral, topical, oral, or intranasal means for therapeutic treatment. Intramuscular injection (e.g., injection into the muscle of the arm or leg) and intravenous injection are preferred methods of administering the molecules of the present invention. In some methods, such molecules are administered as sustained-release compositions or devices, e.g., Medipad® devices (Elan Pharm. Technologies, Dublin, Ireland). In some methods, the antibodies disclosed herein are injected directly into specific tissues, e.g., intracranial injection.

[0114] In one embodiment, the pharmaceutical composition of the present invention is administered parenterally. As used herein, the terms “parenteral administration” and “parenteral administration” refer to a mode of administration other than enteral and topical administration, usually by injection, and include injections, subcutaneous injections, and infusions, including injections,

[0115] In therapeutic applications (i.e., applications related to patients diagnosed with neuromuscular disorders, such as amyotrophic lateral sclerosis (ALS), myasthenia gravis, or congenital myasthenia gravis), the MuSK antibody-based molecules of the present invention are administered to such patients in amounts sufficient to cure, treat, or at least partially cessate the symptoms of the disease (as presented by biochemical, histological, and / or behavioral assessments), including its complications and intermediate pathological phenotypes in the onset of the disease. In some embodiments, administration of the therapeutic molecules of the present invention reduces or eliminates the neuromuscular disorder.

[0116] The effective dose of the therapeutic molecule provided in this invention for the treatment of the symptoms described above may vary depending on many different factors, such as the means of administration, the target site, the patient's physiological condition, and other drugs administered. Treatment doses are typically titrated to optimize their safety and efficacy. On any given day for which a dose is given, the dose of the MuSK antibody-based molecule described herein may range from about 0.0001 to about 100 mg / kg of the patient's body weight, more typically from about 0.01 to about 20 mg / kg. For example, the dose may be 1 mg / kg body weight or 10 mg / kg body weight, or within the range of 1 to 10 mg / kg body weight. Therefore, example dosages include approximately 0.1 to 10 mg / kg body weight, approximately 0.1 to 5 mg / kg body weight, approximately 0.1 to 2 mg / kg body weight, approximately 0.1 to 1 mg / kg body weight, for example, approximately 0.15 mg / kg body weight, approximately 0.2 mg / kg body weight, approximately 0.5 mg / kg body weight, approximately 1 mg / kg body weight, approximately 1.5 mg / kg body weight, approximately 2 mg / kg body weight, approximately 5 mg / kg body weight, or approximately 10 mg / kg body weight.

[0117] A physician or veterinarian skilled in the art can easily determine and prescribe the effective dose of the required pharmaceutical composition. For example, a physician or veterinarian can start with a dose of the antibody-based molecule in the pharmaceutical composition at a lower level than necessary to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. Generally, a preferred daily dose of the composition of the present invention is the amount of the compound that is the minimum effective dose to produce a therapeutic effect. Such an effective dose generally depends on the factors described above. Administration may be, for example, intravenous, intramuscular, intraperitoneal, or subcutaneous, and may be administered, for example, proximal to the target site. If desired, the effective daily dose of the pharmaceutical composition may optionally be administered in unit dosage form as partial doses of two, three, four, five, six or more doses administered separately at appropriate intervals throughout the day. While the antibody-based molecule of the present invention can be administered alone, it is preferable to administer the antibody-based molecule as part of a pharmaceutical composition, as described above.

[0118] For therapeutic purposes, the MuSK antibody-based molecules of the present invention are typically administered multiple times. The interval between single doses (e.g., bolus or injection) may be weekly, monthly, or yearly. In some cases, the dosage is adjusted to achieve plasma concentrations of 1–1000 μg / mL, and in some cases, to achieve 25–300 μg / mL. Alternatively, the therapeutic molecules of the present invention can be administered as a sustained-release formulation, in which case the required frequency of administration is reduced. The dosage and frequency vary depending on the half-life of the antibody in the patient. Generally, human antibodies exhibit the longest half-lives, followed by humanized antibodies, chimeric antibodies, and non-human antibodies. scFv molecules generally have short serum half-lives.

[0119] In another embodiment, a pharmaceutical composition comprising a recombinant nucleic acid sequence encoding a MuSK antibody-based molecule described herein is administered to a subject to promote the in vivo expression and formation of an antibody-based molecule for the treatment of symptoms mediated by reduced MuSK signaling and / or phosphorylation. Expression vector constructs suitable for use in this embodiment of the present invention are described above.

[0120] The polynucleotide composition can induce the generation of MuSK antibody-based molecules in a subject at least approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, or 60 hours after administration of the composition to the subject. The composition can induce the generation of antibody-based molecules in a subject at least approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days after administration of the composition to the subject. The composition can induce the generation of antibody-based molecules in the subject approximately 1 hour to 6 days, 1 hour to 5 days, 1 hour to 4 days, 1 hour to 3 days, 1 hour to 2 days, 1 hour to 1 day, 1 hour to 72 hours, 1 hour to 60 hours, 1 hour to 48 hours, 1 hour to 36 hours, 1 hour to 24 hours, 1 hour to 12 hours, or 1 hour to 6 hours after administration of the composition to the subject.

[0121] The composition can result in the sustained production of antibody-based molecules in a subject when administered to a subject that requires it. The composition can result in the sustained production of antibody-based molecules in the subject for at least about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 32 days, 3 The generation of antibody-based molecules in the subject can be induced for 3, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 days.

[0122] Therapeutic utility of MuSK-conjugated antibody-based molecules One aspect of the present invention relates to a method for increasing muscle-specific tyrosine-protein kinase (MuSK) signaling in a subject requiring increased muscle-specific tyrosine-protein kinase (MuSK) signaling. The method comprises administering to a subject a pharmaceutical composition comprising a MuSK antibody-based molecule as described herein, or a polynucleotide encoding the MuSK antibody-based molecule as described herein or the MuSK antibody-based molecule as described herein. According to this method, the composition is administered in an amount effective to increase MuSK signaling in the subject compared to MuSK signaling in the subject before administration. Such administrations may be provided to subjects having neuromuscular disorders, such as amyotrophic lateral sclerosis (ALS), myasthenia gravis (MG), congenital myasthenia gravis, MuSK-MG, spinal muscular atrophy (SMA), bulbar spinal muscular atrophy (SBMA), Charcot-Marie-Tooth disease (CMT), distal motor neuropathy (dHMN), Duchenne muscular dystrophy (DMD), limb-girdle muscular dystrophy (LGMD), congenital muscular dystrophy (CMD), sarcopenia (SP), and Emery-Dreyfus muscular dystrophy. In one embodiment, the subject to be treated is a subject having congenital myasthenia gravis. In one embodiment, the subject to be treated is a subject having Dok7-mediated congenital myasthenia gravis. According to this aspect of the present invention, such administrations treat neuromuscular symptoms.

[0123] In one embodiment, the MuSK antibody-based molecule administered to a target requiring it is a MuSK antibody-based molecule (3B2g2m1) comprising a heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 153, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region including CDR-H1 of SEQ ID NO: 159, CDR-H2 of SEQ ID NO: 172, and CDR-H3 of SEQ ID NO: 195.

[0124] In one embodiment, the MuSK antibody-based molecule administered to a target requiring it is a MuSK antibody-based molecule (3B2g1m1) comprising a heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 153, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region including CDR-H1 of SEQ ID NO: 159, CDR-H2 of SEQ ID NO: 172, and CDR-H3 of SEQ ID NO: 183.

[0125] In one embodiment, the MuSK antibody-based molecule administered to a target requiring it is a MuSK antibody-based molecule (3B2g1m2) comprising a heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 154, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region including CDR-H1 of SEQ ID NO: 159, CDR-H2 of SEQ ID NO: 172, and CDR-H3 of SEQ ID NO: 183.

[0126] In one embodiment, the MuSK antibody-based molecule administered to a target requiring it is a MuSK antibody-based molecule (3B2g2m2) comprising a heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 154, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region including CDR-H1 of SEQ ID NO: 159, CDR-H2 of SEQ ID NO: 172, and CDR-H3 of SEQ ID NO: 195.

[0127] In one embodiment, the MuSK antibody-based molecule administered to a target requiring it is a MuSK antibody-based molecule (3B2) comprising a heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region including CDR-H1 of SEQ ID NO: 159, CDR-H2 of SEQ ID NO: 172, and CDR-H3 of SEQ ID NO: 183.

[0128] As used herein, the terms “treatment” or “treating” mean improving, delaying or reversing the progression or severity of a disease or disorder, or improving, delaying or reversing one or more symptoms or side effects of such disease or disorder. For the purposes of the present invention, “treatment” or “treating” further means an approach to obtain a beneficial or desired clinical outcome. A “beneficial or desired clinical outcome” includes, but is not limited to, relief of symptoms, whether partial or general, detectable or undetectable; reduction of the degree of disorder or disease; stabilization (i.e., no worsening) of a disease or disorder; delay or slowing of the progression of a disease or disorder; improvement or relief of a disease or disorder; and remission of a disease or disorder.

[0129] The “effective dose” of an antibody-based molecule refers to a sufficient amount in the required dose and duration to achieve the intended biological effect or desired therapeutic outcome, including clinical results. When applied to the antibody-based molecule of the present invention, the term “therapeutic effective dose” is intended to indicate a sufficient amount of antibody to improve, alleviate, stabilize, improve, slow down, or delay the progression of a disorder or disease state, or the symptoms of a disorder or disease. In one embodiment, the method of the present invention provides a combined administration of an antibody-based molecule with another compound. In such a case, the “effective dose” is a sufficient amount of the combination to produce the intended biological effect.

[0130] Another aspect of the present invention relates to a method for treating congenital myasthenia gravis in a subject. The method comprises administering a muscle-specific tyrosine-protein kinase (MuSK) agonist to a subject having congenital myasthenia gravis in an amount effective to enhance MuSK phosphorylation, thereby treating the congenital myasthenia gravis in the subject.

[0131] In some embodiments, the MuSK agonist is a MuSK agonist antibody described herein. The MuSK agonist antibody binds to MuSK and enhances MuSK signaling or phosphorylation. In one embodiment, the MuSK agonist antibody binds to the Frizzled-like domain of human MuSK. In one embodiment, the MuSK agonist antibody binds to an epitope having the amino acid sequence (Fz-like domain) of SEQ ID NO: 130. Suitable MuSK agonist antibodies are those disclosed herein. In some embodiments, the congenital myasthenia gravis is DOK7-mediated congenital myasthenia gravis. [Examples]

[0132] The detailed description of the present invention is further illustrated by the following examples, which should not be construed as limiting in any way.

[0133] Materials and methods of Examples 1 and 5-12 mouse To generate Dok7 CM mice (also referred to herein as Dok7 1124 1127 dup mice), in vitro transcription sgRNA (5'-CTGCTCAGTCTGCCCCC-3' (SEQ ID NO: 264)) (5 ​​ng / μl) and in vitro transcription Cas9 RNA (10 ng / μl) were microinjected into the pronucleus of C57BL / 6 zygotes together with a DNA repair template containing TGCC duplication (5'-ATGCCGGCAATCTG GACGTCTGGCGGGCCGGTGAGGAATTCGGTTCTCTGCTCAGTCTGCCTGCCCCCTGG AGCCAGCGCACCTGAGCCCAGACTGTGTGCCTGCCCACCTGGGGCGGCCGAGTA-3' (SEQ ID NO: 265) (10 ng / μl) (the entire text of which is incorporated herein by reference is Price et al., "Specific Disruption of Abca1 Targeting Largely Mimics the Effects of miR-33 Knockout on Macrophage Cholesterol "Efflux and Atherosclerotic Plaque Development," Circ. Res. 124: pp. 874-880 (2019). Fourteen mice born from injected zygotes were analyzed by sequencing their tail DNA (primer: 5'-GCAGTTACAG GAGGTTGG-3' (SEQ ID NO: 266)). One mouse possessed the Dok7 allele with the desired TGCC duplication. The founder mouse was crossed with wild-type C57BL / 6 mice to generate the Dok7 CM strain. DNA sequencing confirmed the Dok7 mutation. Subsequently, the mice were genotyped using primers (forward: 5'-GCGGCCTCGGCAGTTACAG-3' (SEQ ID NO: 267); reverse: 5'-GCTTTACCTTG AGTCCGCCACAGA-3' (SEQ ID NO: 268). We analyzed the five genomic loci with the highest probability of off-target recognition. No evidence of mutations in these genes was found (Figures 16A-16B).

[0134] To generate Dok7 2YF mice, sgRNA (5'-TTCGAGGTGTGTCATAG-3' (SEQ ID NO: 269)) (15 ng / μl) was injected into the cytoplasm of C57BL / 6 zygotes, and Cas9 RNA (30 ng / μl) was transcribed in vitro with a DNA repair template (5'-ATGCCGGCAGCAACCTGGACGTGTGGCGGGCCGG TGAGGAATTCGGTTCTCTGCTCAGTCTGCCTGCCCCCTGGAGCCAGCGCACCTGAGC CCAGACTGTGTGCCTGCCCACCTGGGGCGGCCGAGTA-3' ((SEQ ID NO: 270)) (30 ng / μl) for converting tyrosine 396 and tyrosine 406 to phenylalanine. 33 mice born from the injected zygotes were transcribed with tail DNA (primer: 5'-TGGCATTGCC The mutation was analyzed by sequencing ACAGGCAG-3' (SEQ ID NO: 271). One mouse possessed a Dok7 allele with the desired tyrosine-to-phenylalanine substitution. Founder mice were crossed with wild-type C57BL / 6 mice to generate Dok7 2YF strains. DNA sequencing of these strains confirmed the Dok7 mutation. Mice were housed and maintained according to the guidelines of the Institutional Animal Use Control Committee (IACUC).

[0135] Growth of cultured skeletal muscle cells C2C12 mouse muscle cells (ATCC catalog number CRL-1772) were grown at 37°C in growth medium (GM), i.e., Dulbecco's modified Eagle medium (DMEM) containing 4.5 g / L glucose, L-glutamine, and sodium pyruvate (Coming cellgro), supplemented with 10% fetal bovine serum (FBS; GemCell®). When the myoblasts reached 70% confluence, myoblast fusion and myotube differentiation were induced by replacing the medium with differentiation medium (DM), i.e., DMEM containing 4.5 g / L glucose and 1 mM L-glutamine, supplemented with 2% heat-inactivated horse serum. Immortalized myoblasts were isolated from wild-type embryos and Dok7 2YF embryos and augmented as described above (Smith et al., "Src, Fyn, and Yes are not required for Neuromuscular Synapse Formation but are Necessary for Stabilization of Agrin-Induced Clusters of Acetylcholine Receptors," J. Neurosci. 21:3151-3160 (2001), which is incorporated herein by reference in its entirety).

[0136] Agrin and antibody treatment of C2 myotubules Three days after C2C12 myotubes were formed, the cultures were treated with 10 nM biotinylated Fab for 30 minutes in combination with 2.5 nM streptavidin, 10 nM IgG, or 0.5 nM recombinant neuronal agrin-B8 (R&D Systems). The myotubes were homogenized at 4°C in lysis buffer (50 mM sodium chloride, 30 mM triethanolamine, pH 7.5, 50 mM sodium fluoride, 5 mM EDTA, 5 mM EGTA, 2 mM sodium orthovanadate, 1 mM N-ethylmaleimide, 1 mM sodium tetrathionate, 10 μM pepstatin, and a complete protease inhibitor mix) (Roche). NP-40 was added to a final concentration of 1%, and the extracts were incubated at 4°C for 30 minutes with shaking. Insoluble proteins were removed by centrifugation at 12,000 rpm at 4°C for 20 minutes. The supernatant was pre-clarified with Protein G-agarose beads (Sigma-Aldrich) for 1 hour at 4°C, and then incubated with antibody against MuSK (MuSK 1A) overnight at 4°C (see Takata, K. et al., "Characterization of Pathogenic Monoclonal Autoantibodies Derived from Muscle-Specific Kinase Myasthenia Gravis Patients," JCI Insight 4(12):el27167 (2019), and Fichtner et al., "Affinity Maturation is Required for Pathogenic Monovalent IgG4 Autoantibody Development in Myasthenia Gravis," J. Exp. Med.217(12):e20200513 (2020), which are incorporated herein by reference in their entirety). The complex was incubated with Protein G-agarose beads for 4 hours. Subsequently, the beads were washed in lysis buffer containing 1% NP-40 (three times for 9 minutes each). The protein was eluted from the beads with 1% SDS in lysis buffer.

[0137] Isolation of MuSK and Dok7 from muscle tissue The entire leg muscle or cultured muscle cells were homogenized at 4°C in a lysis buffer (50 mM sodium chloride, 30 mM triethanolamine pH 7.5, 50 mM sodium fluoride, 5 mM EDTA, 5 mM EGTA, 2 mM sodium orthovanadate, 1 mM N-ethylmaleimide, 1 mM sodium tetrathionate, 10 μM pepstatin, and a complete protease inhibitor mix (Roche)). NP-40 was added to a final concentration of 1%, and the extract was incubated at 4°C for 30 minutes with shaking. Insoluble proteins were removed by centrifugation at 12,000 rpm at 4°C for 20 minutes. The supernatant was pre-clarified at 4°C for 1 hour using protein G-agarose beads (Sigma-Aldrich), and then an antibody against MuSK (MuSK 1A) was added (the entire antibody is incorporated herein by reference in Takata, K. et al., "Characterization of Pathogenic Monoclonal Autoantibodies Derived from..."). The proteins were incubated overnight at 4°C with either "Muscle-Specific Kinase Myasthenia Gravis Patients," JCI Insight 4(12):el27167 (2019) or Fichtner et al., "Affinity Maturation is Required for Pathogenic Monovalent IgG4 Autoantibody Development in Myasthenia Gravis," J. Exp. Med. 217(12):e20200513 (2020) or goat anti-Dok7 (R&D Systems, AF 6398), followed by incubation with protein G-agarose beads for 4 hours. The beads were then washed in lysis buffer containing 1% NP-40 (three times for 9 minutes). The protein was eluted from the beads with 1% SDS in lysis buffer.

[0138] Western blotting The proteins were fractionated by SDS-PAGE and transferred to a PVDF membrane. The blots were probed with antibodies against MuSK (R&D Systems, AF 562), phosphotyrosine (Millipore, 05-321), or Dok7 (#1916) as previously described (the entire text of which is incorporated herein by reference: Herbst & Burden, "The Juxtamembrane Region of MuSK has a Critical Role in Agrin-Mediated Signaling," EMBO J. 19: pp. 67-77 (2000); Bergamin et al., "The Cytoplasmic Adaptor Protein Dok7 Activates the Receptor Tyrosine Kinase MuSK via Dimerization," Mol. Cell 39: pp. 100-109 (2010); Hallock et al., "Dok-7 Regulates Neuromuscular Synapse Formation by Recruiting Crk and Crk-L," Genes Dev. 24: pp. 2451-2461 (2010)); Remedio et al., “Diverging Roles for Lrp4 and Wnt Signaling in Neuromuscular Synapse Development During Evolution”, Genes Dev. 30: 1058-1069 (2016); and Jaworski & Burden, “Neuromuscular Synapse Formation in Mice Lacking Motor Neuron- and Skeletal Muscle-Derived Neuregulin-1”, J. Neurosci. 26:655-661 (2006)).Antibodies against Crk (BD Bioscience, 610035) and Crk-L (Santa Cruz Biotechnology, sc-365092) have been previously described (Hallock et al., "Dok-7 Regulates Neuromuscular Synapse Formation by Recruiting Crk and Crk-L," Genes Dev. 24:2451-2461 (2010)), which is incorporated herein by reference in its entirety. Band intensities were quantified using a ChemiDoc imaging system (BioRad) as previously described (Remedio et al., "Diverging Roles for Lrp4 and Wnt Signaling in Neuromuscular Synapse Development During Evolution," Genes Dev. 30:1058-1069 (2016)), which is incorporated herein by reference in its entirety. The graph shows the mean values ​​from at least three separate experiments. The Wilcoxon-Mann-Whitney test was used to determine statistical significance and was performed using GraphPad Prism 6.0 software.

[0139] Whole-mount muscle immunohistochemistry Diaphragmatic muscles were dissociated from E18.5 embryos and postnatal mice in oxygenated L-15 medium. The muscles were pinned to Sylgard-coated dissociation dishes, fixed in 1% PFA for 1.5 hours, and blocked for 1 hour in PBS (Sigma, IgG-free) containing 3% BSA and 0.5% Triton X-100 (PBT). Diaphragmatic muscle tissue was stained with Alexa488 conjugate α-BGT (Invitrogen) to label AChRs, and motor axons and nerve endings were labeled with antibodies against neurofilament-L (Synaptic Systems, 171002), β-TUBIII (Synaptic Systems, 302302), or synapsin 1 / 2 (Synaptic Systems, 106002) (Kim & Burden, "MuSK Controls where Motor Axons Grow and Form Synapses," Nat. Neurosci. 11: pp. 19-27 (2008), the entire text of which is incorporated herein by reference). The antibodies were forcibly transferred to the muscle tissue by pipette, and the muscle tissue was incubated overnight at 4°C using an orbital shaker in a humidified room. The diaphragmatic muscle tissue was washed 10 times with PT over 5 hours at room temperature, rinsed with PBS, and then whole-mounted in 50% glycerol. Muscle tissue from at least three mice of each genotype was analyzed for each experiment. Images were acquired using a Zeiss LSM 800 confocal microscope. Detector gain and laser intensity were adjusted to avoid saturation. Synaptic number and size, synaptic AChR density, terminal zone width, degree of denervation, and colocalization index (synapsin / AChR) were quantified using FIJI / ImageJ software as previously described (Jaworski & Burden, "Neuromuscular Synapse Formation in Mice Lacking Motor Neuron- and Skeletal Muscle-Derived Neuregulin-1," J. Neurosci. 26:655-661 (2006) is incorporated herein by reference in its entirety).The Wilcoxon-Mann-Whitney test was used to determine statistical significance and was performed using GraphPad Prism 9.0 software.

[0140] Isolation and staining of single muscle fibers The pretibialis muscle was dissected in oxygenated L-15 medium, pinned to a Sylgard-coated dish, and fixed in 2% PFA (in PBS) for 2 hours. After rinsing several times in PBS, 1 to 3 muscle fibers were manually separated using sharp forceps (Ralston et al., "The Organization of the Golgi Complex and Microtubules in Skeletal Muscle is Fiber Type-Dependent," J. Neurosci. 19:10694-10705 (1999) is incorporated herein by reference in its entirety). The fixed muscle fibers were blocked at room temperature for 2 hours in PBS containing 5% BSA, 1% normal goat serum, and 0.04% saponin. The fibers were then incubated overnight with primary antibody at 4°C, washed three times for 5 minutes each in PBS containing 0.04% saponin, incubated with secondary antibody at room temperature for 2 hours, washed again, and mounted on a VectaShield (Vector Laboratories). The postsynaptic membrane was visualized by using an antibody against Crk-L (Santa Cruz Biotechnology, sc-365092) and staining it with AlexaFluor488-α-BGT (Invitrogen).

[0141] cryoablation immunohistochemistry Limb muscles were embedded in OCT medium and frozen on a dry ice platform. 10 μm sections collected on poly-L-lysine coated glass slides were fixed in 1-4% PFA for 10 minutes, washed three times for 5 minutes each with PBS (PB) containing 3% BSA, permeabilized with PB + 0.5% X-Triton (PBT) for 10 minutes, washed in PB, and incubated overnight at 4°C in a humidified chamber with primary antibody against Crk-L in PBT (Santa Cruz Biotechnology, sc-365092). After washing the sections three times for 5 minutes each in PB, they were incubated overnight at 4°C in a humidified chamber with secondary antibody diluted in PBS and AlexaFluor488-α-BGT (Invitrogen). After washing the sections three times for 5 minutes each in PB and then in PBS, they were mounted on VECTASHIELD fade-resistant mounting medium.

[0142] behavior Grip strength was measured using a grip strength dynamometer (Bioseb) that measures grip strength in both the forelimbs and whole limbs. To measure forelimb grip strength, the mouse was positioned in the center of a metal grid, lightly held at the base of the tail, so that only the forelimbs could grasp the grid. The mouse was gradually pulled backward until the forelimbs released the grid. The grip strength dynamometer digitally displayed the maximum force applied (in grams) once the grip was released. For whole limb measurements, the mouse was made to grasp the grid with both the forelimbs and hindlimbs, and the mouse was gradually pulled backward until it no longer grasped the grid. For both forelimb and whole limb measurements, the average of six consecutive trials was used as an indicator of forelimb or whole limb grip strength. Mice were given a 10-15 second interval between each trial and a 1-3 hour interval between forelimb and whole limb tests. Body weight was determined after all grip strength measurements, and potential covariances were analyzed. To enhance the robustness and reliability of the grip strength assessment, all measurements were performed by the same experimenter (Mandillo et al., "Reliability, Robustness, and Reproducibility in Mouse Behavioral Phenotyping: A Cross-Laboratory Study," Physiol. Genomics 34:243-255 (2008), which are incorporated herein by reference in their entirety; and Oury et al., "MACF1 Links Rapsyn to Microtubule- and Actin-Binding Proteins to Maintain Neuromuscular Synapses," J. Cell Biol. 218:1686-1705 (2019)).

[0143] The motor function of male and female P60 mice was evaluated using a rotor rod (AccuRotor four-channel, Omnitech Electronics, Inc.). Mice were placed on a rotor rod (3.0 cm rotating cylinder) rotating at 2.5 rpm, and the rotation speed was linearly increased to 40 rpm over 5 minutes. The time until the mouse fell from the rod was measured. Each mouse underwent three tests at 5-minute intervals, and the longest latency until falling was recorded from the three tests. The Wilcoxon-Mann-Whitney U test was used to determine statistical significance and was performed using GraphPad Prism 9.0 software.

[0144] Development of human synthetic antibodies The full-length extracellular region (E22-T494 of mouse MuSK and E22-T495 of human MuSK), including the Fz domain and C-terminal flanking sequences (D307-T494 of mouse MuSK and K314-T495 of human MuSK), was expressed as a C-terminal fusion with Avi and His6 tags using the mouse IgkVIII secretion signal sequence in EXPI293 cells. Expression was performed using the ExpiFectamine 293 Transfection kit (Thermo Fisher Scientific) and the standard procedure provided by the vendor. The protein was purified from the filtered culture supernatant using a HiTrap nickel column (GE Healthcare) and biotinylated in vitro using BirA enzyme in the presence of 0.5 mM biotin and 10 mM ATP. The biotinylated protein was further purified using a Superdex S75 10 / 300 column (GE Healthcare).

[0145] The antibody phage display library was sorted as previously described (Miller et al., "T Cell Receptor-Like Recognition of Tumor in vivo by Synthetic Antibody Fragment," PLoS One 7:e43746 (2012)), which is incorporated herein by reference in its entirety. Briefly, the phage display library was first sorted with all four antigens at 100 nM in the first round, and then sorted again in the second, third, and fourth rounds using single antigens at 100, 50, and 20 nM, respectively. Multiple sorting strategies were used, and surrogate antigens were used sequentially (e.g., human Fz-mouse ECD-human ECD) to enrich clones that bind to both human and mouse Fz domains. Individual clones were screened using phage ELISA with the four antigens, and the DNA sequences of clones showing binding to all antigens were determined.

[0146] Fab proteins with an Avi tag at the C-terminus of the heavy chain of the selected clone were produced from E. coli and biotinylated, as previously described (Miller et al., "T Cell Receptor-Like Recognition of Tumor in vivo by Synthetic Antibody Fragment," PLoS One 7:e43746 (2012)), the entire text of which is incorporated herein by reference). Mouse IgG2a-LALAPG samples of clone X17 were prepared using modified pFUSE-mIgG2a-Fc vectors (InvivoGen) containing an LALAPG mutation in the Fc region (Lo et al., "Effector-Attenuating Substitutions That Maintain Antibody Stability and Reduce Toxicity in Mice," J. Biol. Chem. 292:3900~3908 (2017)), the entire text of which is incorporated herein by reference, and a human CH1 domain, as well as pFUSE-CLIg vectors (InvivoGen). This chimeric antibody was composed of a human Fab sequence and a mouse Fc sequence. In addition, the mouse Fc sequence was replaced with one derived from human IgG1 containing the LALA mutation to produce hIgG1-X17 antibody, hIgG1-X2 antibody, and hIgG1-X3 antibody.

[0147] Affinity measurement The affinity of antibody clones in Fab and IgG forms was measured using a bead binding assay (Nishikori et al., "Broad Ranges of Affinity and Specificity of Anti-Histone Antibodies Revealed by a Quantitative Peptide Immunoprecipitation Assay," J. Mol. Biol. 424:391-399 (2012), which is incorporated herein by reference in its entirety; Nady et al., "ETO Family Protein Mtgrl Mediates Prdml4 Functions in Stem Cell Maintenance and Primordial Germ Cell Formation," Elife 4:el0150 (2015); and Hattori et al., "Multiplex Bead Binding Assays Using Off-the-Shelf Components and Common Flow Cytometers," J. Immunol. Methods 490:112952 (2020)). Biotinylated human antigen proteins were immobilized on Dynabeads M280 streptavidin beads (Thermo Fisher Scientific) by rapidly mixing 10-fold diluted beads in 100 μl of PBSB (PBS containing 0.5% bovine serum albumin (BSA, GeminiBio)) with 100 μl of 50 nM Fz protein. The beads were then blocked with 2 μM biotin, washed twice with PBSB, and resuspended in 1 ml of PBSB. This reaction was scaled appropriately for the number of measurements as needed. 5 microliters of diluted beads and 20 μl of antibody sample were mixed in the wells of a 96-well polypropylene plate (Greiner Bio-One, catalog no. 650261) and incubated at room temperature for 30 minutes with gentle shaking. The sample was transferred to the wells of a 96-well filter plate (Millipore MultiScreen HTS HV, 0.45 mm, Thermo Fisher).The liquid was removed using a vacuum manifold, and the wells were washed three times with 200 μl of ice-cold PBSB using a vacuum manifold. The beads were stained with an anti-human Fab antibody labeled with AlexaFluor 647 (Jackson Immuno Research, AlexaFluor® 647 AffmiPure Goat Anti-Human IgG, F(ab')2 fragment specific, 109-605-097). After washing, the beads were suspended in 70 μl of PBSB and analyzed using an iQue screener (Sartorius) or an Intellicyt HTFC system. The resulting titration curves were analyzed using GraphPad Prizm software by nonlinear least-squares fitting of a 1:1 binding model.

[0148] Blood half-life measurement Mouse blood samples were centrifuged, and the supernatant was diluted 2000-fold in PBSB. Antibody levels were quantified using the bead assay described above, except that the binding reaction was performed at 4°C. Half-lives were determined by fitting a single exponential curve with a non-linear least squares formula for the median fluorescence intensity.

[0149] Phosphopeptide pulldown assay 293T cells were transfected with plasmids encoding HA-tagged Dok-7 and HA-tagged Crkl at 37°C for 48 hours (Lipofectamine 3000, Thermofisher Scientific). After 48 hours, the transfected cells were homogenized in lysis buffer at 4°C, NP-40 was added to a final concentration of 1%, and the extract was incubated at 4°C for 30 minutes with shaking. Insoluble proteins were removed by centrifugation at 12,000 rpm at 4°C for 20 minutes. The supernatant was pre-clarified using streptavidin-agarose beads (Sigma-Aldrich) at 4°C for 1 hour.

[0150] Four biotinylated phosphopeptides, (1) ELLLDRLHPNPMYQRMPLLLN (SEQ ID NO: 272), (2) ELLLDRLHPNPMp(Y)QRMPLLLN (SEQ ID NO: 273), (3) ELLLDRLHPAPMp(Y)QRMPLLLN (SEQ ID NO: 274), and (4) ELLLDRLHPNPMp(Y)AAAPLLLN (SEQ ID NO: 275) (Thermofisher Scientific), were immobilized on streptavidin agarose beads and incubated overnight at 4°C in a lysis buffer containing 1% NP-40 (50 mM sodium chloride, 30 mM triethanolamine, pH 7.5, 50 mM sodium fluoride, 5 mM EDTA, 5 mM EGTA, 2 mM sodium orthobanate, 1 mM N-methylimide, 1 mM sodium tetrathionate, and 10 μM pepstatin, and a complete protease inhibitor mix) (Roche). Cell extracts pre-clarified with streptavidin-agarose beads were incubated overnight at 4°C with biotinylated phosphopeptides immobilized on streptavidin-agarose beads. Subsequently, the beads were washed in lysis buffer containing 1% NP-40 (three times for 9 minutes each). Proteins were eluted from the beads with 1% SDS in lysis buffer. Western blotting was performed using an antibody against HA tags (Abcam, ab49969).

[0151] RT-qPCR Total RNA was isolated from the muscle tissue of E18.5 wild-type and Dok-7CM embryos using TRIZOL reagent (Invitrogen) and reverse transcribed using the Superscript-Ill First Strand Kit (Invitrogen). Real-time quantitative PCR was performed on a LightCycler 480 (Roche) using the SYBR Green Master Kit (Roche). For HPrt, the primer pairs used were 5'-CTGGTGAA AAGGACCTCTCGAAG-3' (SEQ ID NO: 276) and 5'-CCAGTTTCACTAATGACACAAACG-3' (SEQ ID NO: 277). For Dok7, the primer pairs used were 5'-TCAGCCTCAGAAGAGCGTGTTG-3' (SEQ ID NO: 278) and 5'-GCCTCAGAAGAGGAACTGGATAG-3' (SEQ ID NO: 279). The samples were run in three separate passes, and the Dok7 expression level was normalized relative to the HPrt expression level.

[0152] (Example 1) Dok7: Disease Mechanisms and Therapeutic Rescue for Congenital Myasthenia Gravis Congenital myasthenic syndrome (CM) is a group of disorders caused by mutations in genes that play a crucial role in the formation, function, and maintenance of neuromuscular synapses (for example, Muller et al., "Congenital Myasthenic Syndromes: Spotlight on Genetic Defects of Neuromuscular Transmission," Expert Rev. Mol. Med. 9: pp. 1-20 (2007), which is incorporated herein by reference in its entirety; Engel, AG, "Current Status of the Congenital Myasthenic Syndromes," Neuromuscul. Disord. 22: pp. 99-111 (2012); and Engel et al., "Congenital Myasthenic Syndromes: Pathogenesis, Diagnosis, and Treatment," Lancet Neurol. 14: pp. 420-434 (2015)). In most cases, mutations in these genes are recessive, reducing gene activity and causing synaptic defects that lead to the early onset of structural and functional deficits in neuromuscular synapses, resulting in fluctuating, fatigued, or persistent muscle weakness throughout life.

[0153] Mutations in Dok7, a gene encoding an adapter protein crucial for the formation and maintenance of neuromuscular synapses (Okada et al., "The Muscle Protein Dok-7 is Essential for Neuromuscular Synaptogenesis," Science 312: pp. 1802-1805 (2006)), which are incorporated herein by reference in their entirety, account for a significant proportion (10-20%) of all CM cases (Beeson et al., "Dok-7 Mutations Underlie a Neuromuscular Junction Synaptopathy," Science 313: pp. 1975-1978 (2006)); Muller et al., "Phenotypical Spectrum of DOK7 Mutations in Congenital Myasthenic Syndromes," Brain 130: pp. 1497-1506 (2007); and Hamuro et al., "Mutations Causing DOK7 Congenital Myasthenia Ablate Functional Motifs in Dok-7," J. Biol. Chem. 283: pp. 5518-5524 (2008). The disease causes weakness and paralysis of the muscles of the limbs, neck, and face, and a quarter of Dok7 CM patients require non-invasive mechanical ventilation at some point in their lives.Albuterol / salbutamol, which activates adrenaline receptors, may benefit some Dok7 CM patients through mechanisms that are not fully understood, but there are few treatments that alleviate clinical symptoms (Liewluck et al., "Beneficial Effects of Albuterol in Congenital Endplate Acetylcholinesterase Deficiency and Dok-7 Myasthenia," Muscle Nerve 44:789-794 (2011), and Burke et al., "Salbutamol Benefits Children with Congenital Myasthenic Syndrome due to DOK7 mutations," Neuromuscul. Disord. 23:170-175 (2013), the entire text of which is incorporated herein by reference).

[0154] The formation and maintenance of neuromuscular synapses require the assembly of highly specialized presynaptic and postsynaptic membranes and the coordinated action of several key molecules (the entirety of which is incorporated herein by reference: Burden, S. J, "The Formation of Neuromuscular Synapses," Genes Dev. 12: pp. 133-148 (1998); Sanes & Lichtman, "Induction, Assembly, Maturation and Maintenance of a Postsynaptic Apparatus," Nat. Rev. Neurosci. 2: pp. 791-805 (2001); Burden, SJ, "SnapShot: Neuromuscular Junction," Cell 144: pp. 826-826 (2011); Burden et al., "The Role of MuSK in Synapse Formation and Neuromuscular Disease," Cold Spring Harb. Perspect. Biol. 5: a009167 (2013), and Tintignac et al., "Mechanisms Regulating Neuromuscular Junction Development and Function and Causes of Muscle Wasting," Physiol. Rev. 95: 809-852 (2015). Agrin released from motor nerve terminals binds to lipoprotein receptor-associated protein 4 (Lrp4) in muscles, stimulating the formation of a complex between Lrp4 and muscle-specific kinase (MuSK), a receptor tyrosine kinase that acts as a major regulator of synaptic differentiation (Burden et al., "The Role of MuSK in Synapse Formation and Neuromuscular Disease," Cold Spring Harb. Perspect. Biol., which is incorporated herein by reference in its entirety).5: pages 9167 (2013); Tintignac et al., "Mechanisms Regulating Neuromuscular Junction Development and Function and Causes of Muscle Wasting", Physiol. Rev. 95: 809-852 (2015); McMahan, U. J., "The Agrin Hypothesis", Cold Spring Harb. Symp. Quant. Biol. 55: 407-418 (1990); Jennings et al., "Muscle-Specific trk-Related Receptor with a Kringle Domain Defines a Distinct Class of Receptor Tyrosine Kinases", Proc. Natl. Acad. Sci. USA 90: 2895-2899 (1993); DeChiara et al., "The Receptor Tyrosine Kinase MuSK is Required for Neuromuscular Junction Formation in vivo", Cell 85: 501-512 (1996); Glass et al., "Agrin Acts via a MuSK Receptor Complex", Cell 85: 513-523 (1996); Kim et al., "Lrp4 is a Receptor for Agrin and Forms a Complex with MuSK", Cell 135: 334-342 (2008); and Zhang et al., "LRP4 Serves as a Coreceptor of Agrin", Neuron.See 60:285-297 (2008). As a result of MuSK activation, Lrp4 clustered on the postsynaptic membrane transmits retrograde signals to motor axons, stimulating presynaptic differentiation (see Yumoto et al., "Lrp4 is a Retrograde Signal for Presynaptic Differentiation at Neuromuscular Synapses," Nature 489:438-442 (2012), which is incorporated herein by reference in its entirety). Mutations in agrin, Lrp4, and MuSK, as well as mutations in the acetylcholine receptor (AChR) subunit gene, also cause CM (see, in their entirety, Engel et al., "Congenital Myasthenic Syndromes: Pathogenesis, Diagnosis, and Treatment," Lancet Neurol. 14:420-434 (2015) and McMacken et al., "The Increasing Genetic and Phenotypical Diversity of Congenital Myasthenic Syndromes," Neurodiatrics 48:294-308 (2017)), which are incorporated herein by reference).

[0155] MuSK activation is also dependent on Dok7. The amino-terminal region of Dok7 contains plextrin homology (PH) and phosphotyrosine-binding (PTB) domains (Figure 1A), which function to dimerize Dok7 and bind to phosphorylated tyrosine motifs within the near-membrane (JM) region of MuSK (Yamanashi et al., "Activation of Receptor Protein-Tyrosine Kinases from the Cytoplasmic Compartment," J. Biochem. 151:353-359 (2012) is incorporated herein by reference in its entirety). Failure of Dok7 to bind to MuSK due to Dok7 absence or mutations in the MuSK JM region that prevent Dok7 binding leads to failure of MuSK phosphorylation stimulation of agrin (Okada et al., "The Muscle Protein Dok-7 is Essential for Neuromuscular Synaptogenesis," Science 312: pp. 1802-1805 (2006), which is incorporated herein by reference in its entirety; Herbst & Burden, "The Juxtamembrane Region of MuSK has a Critical Role in Agrin-Mediated Signaling," EMBO J. 19: pp. 67-77 (2000); and Zhou et al., "Distinct Domains of MuSK Mediate its Abilities to Induce and to Associate with Postsynaptic Specializations," J. Cell Biol. 146: pp. 1133-1146 (1999)). This indicates that the binding of Dok7 to MuSK is necessary to stabilize MuSK phosphorylation, possibly by promoting MuSK dimerization (Bergamin et al., "The Cytoplasmic Adaptor Protein Dok7 Activates the Receptor Tyrosine Kinase MuSK via Dimerization," Mol. Cell 39: pp. 100-109 (2010), which is incorporated herein by reference in its entirety).Furthermore, agrin-stimulated MuSK phosphorylation leads to phosphorylation of two tyrosine residues in the carboxy-terminal region of Dok7, triggering the recruitment of Crk and Crk-L proteins involved in acetylcholine receptor (AChR) clustering (Hallock et al., "Dok-7 Regulates Neuromuscular Synapse Formation by Recruiting Crk and Crk-L," Genes Dev. 24:2451-2461 (2010), and Hamuro et al., "Mutations Causing DOK7 Congenital Myasthenia Ablate Functional Motifs in Dok-7," J. Biol. Chem. 283:5518-5524 (2008)), which are incorporated herein by reference in their entirety.

[0156] The most common cause of Dok7 CM is a four-base pair duplication (1124 1127 dup TGCC), which is almost always present in Dok7 CM as one or two mutant alleles, resulting in Dok7 frameshift and premature termination (Beeson et al., "Dok-7 Mutations Underlie a Neuromuscular Junction Synaptopathy," Science 313:1975-1978 (2006), and Cossins et al., "The Spectrum of Mutations that Underlie the Neuromuscular Junction Synaptopathy in DOK7 Congenital Myasthenic Syndrome," Hum. Mol. Genet. 21:3765-3775 (2012)), the entire works of which are incorporated herein by reference). The cleavage form of Dok7 retains the PH and PTB domains and binds to the tyrosine-phosphorylated JM region of MuSK (the entire text is incorporated herein by reference to Beeson et al., "Dok-7 Mutations Underlie a Neuromuscular Junction Synaptopathy," Science 313: pp. 1975-1978 (2006)), but it is phosphorylated and lacks the two tyrosine residues that recruit the Crk protein.These and other findings suggest that the absence of these two tyrosine residues in cleaved Dok7 is the cause of the common morphology of synaptic defects in this Dok7 CM (Engel et al., "Congenital Myasthenic Syndromes: Pathogenesis, Diagnosis, and Treatment," Lancet Neurol. 14:420-434 (2015), which is incorporated herein by reference in its entirety; Hallock et al., "Dok-7 Regulates Neuromuscular Synapse Formation by Recruiting Crk and Crk-L," Genes Dev. 24:2451-2461 (2010); and Hamuro et al., "Mutations Causing DOK7 Congenital Myasthenia Ablate Functional Motifs in Dok-7," J. Biol. Chem. 283:5518-5524 (2008)). However, the mechanism of Dok7 1124_1127 dup TGCC CM remains unclear.

[0157] The C-terminal region of Dok7 is essential for synapse formation. To study how the loss of the carboxyl-terminal region of Dok7 leads to structural and functional defects in neuromuscular synapses, we generated a mouse model of the most common form of Dok7 CM (Dok7 1124_1127 dup) (Figure 1A). We also created a second mouse mutant (Dok7 Y396F; Y406F) in which two tyrosine residues in the carboxyl-terminal region were mutated to phenylalanine (Figure 1A).

[0158] Homozygous Dok7 1124_1127 dup mice, referred to as Dok7 CM mice, were present in the expected number at El8.5, but very few were alive at day 1, when neuromuscular synapses are essential for respiration and survival (Figure 1B). Diaphragmatic muscle from E18.5 embryos was stained with probes that allow visualization of presynaptic and postsynaptic differentiation. Dok7 CM mice had 1 / 5 times more synapses than wild-type mice (Figure 1C). Furthermore, synapse size and synaptic AChR density were both reduced to 1 / 5, indicating that the formed synapses were immature (Figure 1C; Figure 7). In contrast, homozygous Dok7 Y396F; Y406F mice, referred to as Dok7 2YF mice, were born at the expected frequency (Figure IB), and their neuromuscular synapses appeared nearly normal (Figure 1C; Figure 8). Furthermore, the Dok7 2YF mice developed into breeding adults. These findings, taken together, suggest that, surprisingly, the loss of two tyrosine residues in the carboxyl-terminal region of Dok7 is neither the cause of lethality in Dok7 CM mice nor a severe defect in synapse formation.

[0159] Dok7 protein levels and MuSK tyrosine phosphorylation are reduced in Dok7 CM mice. To determine how the loss of the carboxyl terminal region causes synaptic defects, the expression of Dok7 mRNA and truncated Dok7 protein in Dok7 CM mice was measured using antibodies against the Dok7 PTB domain that equally detected both truncated and wild-type proteins (Figures 9A-9B). While Dok7 mRNA levels were found to be normal in the muscle tissue from Dok7 CM mice (Figures 10A-10C), truncated Dok7 protein was expressed at a level 1 / 3 times lower than that of wild-type Dok7 protein (Figure 2A; Figures 10A-10C).

[0160] Dok7 functions as a dimer for dimerizing MuSK and stabilizing MuSK tyrosine phosphorylation (Bergamin et al., "The Cytoplasmic Adaptor Protein Dok7 Activates the Receptor Tyrosine Kinase MuSK via Dimerization," Mol. Cell 39: pp. 100-109 (2010), which is incorporated herein by reference in its entirety). Therefore, we investigated whether a decrease in Dok7 protein levels in Dok7 CM mice could lead to a reduction in MuSK tyrosine phosphorylation. When MuSK was immunoprecipitated and MuSK phosphorylation was measured, MuSK phosphorylation was reduced to 1 / 7 in Dok7 CM mice, but normal in Dok7 2YF mice (Figures 2C-2D).

[0161] The Crk protein, like Dok7, is directly recruited to MuSK. It was expected that Crk recruitment to synapses would be absent or significantly reduced in both Dok7 CM and Dok7 2YF mutant mice. Indeed, Crk recruitment to synapses and the MuSK complex was substantially reduced (1 / 2.8 times) in Dok7 CM mice (Figures 3A-3B), but surprisingly, it was only slightly reduced (28%) in Dok7 2YF mice (Figures 3A-3B). These findings suggest that Crk is recruited to tyrosine-phosphorylated synaptic proteins in addition to Dok7.

[0162] The tyrosine and Y553 of the three activation loops are phosphorylated in MuSK after agrin stimulation (the entire structure is incorporated herein by reference: Okada et al., "The Muscle Protein Dok-7 is Essential for Neuromuscular Synaptogenesis," Science 312: pp. 1802-1805 (2006); Herbst & Burden, "The Juxtamembrane Region of MuSK has a Critical Role in Agrin-Mediated Signaling," EMBO J 19: pp. 67-77 (2000); Watty et al., "The in vitro and in vivo Phosphotyrosine Map of Activated MuSK," Proc. Natl. Acad. Sci. USA 97: pp. 4585-4590 (2000); and Till et al., "Crystal Structure of the MuSK Tyrosine Kinase: Insights into Receptor Autoregulation," Structure 10: (pp. 1187-1196 (2002)). It was found that Y553 in the MuSK JM region is present not only in the PTB binding site that recruits Dok7, but also in the potential SH2 binding motif of the Crk protein (Figure 3C). Figure 3D shows that CrkI and Dok7 bound to the MuSK JM site in a phosphorylation-dependent manner. Mutations in amino acids that constitute the SH2 binding motif but not the PTB binding site impaired CrkI binding (Figure 3D). Therefore, Crk can directly bind not only to the phosphorylated carboxy-terminal region of Dok7, but also to the tyrosine-phosphorylated JM region of MuSK. This redundancy in recruiting Crk to synapses and the MuSK complex explains the nearly normal association of Crk and the MuSK complex in Dok7 2YF mice and may underlie the phenotypic differences between Dok7 CM mice and Dok7 2YF mice.

[0163] Therefore, the MuSK JM region has overlapping binding sites for PTB domain and SH2 domain-containing proteins. This arrangement provides flexibility and regulation in the downstream signaling mode of receptor tyrosine kinases and may be more common than currently understood.

[0164] Development of agonist antibodies against human and mouse MuSK If reduced MuSK phosphorylation is decisive to the disease in Dok7 CM, then stimulating MuSK could rescue synaptic defects and overcome lethality. The concept that reduced MuSK phosphorylation is central to the disease was explored by generating Dok7 CM mice and treating them with MuSK-targeting agonist antibodies.

[0165] Phage display libraries expressing synthetic human antibodies in Fab form were screened for antibodies that bind to the Fz-like domain in the extracellular domain of both mouse and human MuSK. The reason for targeting the Fz-like domain is that this domain is not essential for MuSK function, and previous studies have shown that antibodies against the Fz-like domain do not cause any apparent harm in mice (Remedio et al., "Diverging Roles for Lrp4 and Wnt Signaling in Neuromuscular Synapse Development During Evolution," Genes Dev.30:1058-1069 (2016), and Cantor et al., "Preserving Neuromuscular Synapses in ALS by Stimulating MuSK with a Therapeutic Agonist Antibody," Elife 7:e34375 (2018), which are incorporated herein by reference in their entirety).

[0166] High-affinity antibodies that bind to the Fz-like domain in human and mouse MuSK were identified (Figure 4A; Figures 12A-12C). Tetramerized versions of each Fab, except X1, stimulated MuSK phosphorylation in mouse C2 myotubes (Figure 4B). Antibodies X3 and X17 in both mouse IgG2a and human IgG1 forms, as well as antibody X2 in human IgG1 form, bound to human and mouse MuSK with sub-nanomolecular affinity and similarly stimulated MuSK tyrosine phosphorylation regardless of agrin (Figures 4C-4D). Since these antibodies exhibited similar activity, X17 was selected for further in vivo analysis.

[0167] Antibody X17 was administered intraperitoneally to wild-type mice in the form of mouse IgG2a with the so-called LALAPG mutation that reduces Fc domain effector function (Lo et al., "Effector-Attenuating Substitutions That Maintain Antibody Stability and Reduce Toxicity in Mice," J. Biol. Chem. 292:3900-3908 (2017)), which is incorporated herein by reference in its entirety. X17 was found to have a half-life of 5 days in the blood (Figure 4E). By staining X17 and quantifying target association at neuromuscular synapses, it was found that 10 mg / kg of X17 was sufficient to saturate synaptic MuSK (Figure 4F). Long-term injection of mIgG2a-X17 (10 mg / kg at P4, P24, and P44) over a two-month period in wild-type mice did not affect neuromuscular synaptic organization, weight gain, or motor behavior (Figures 13A-13D).

[0168] The agonist antibody X17 rescues synapse formation and lethality in Dok7 CM mice. Dok7 CM mice with a C57BL / 6 background died at birth, while Dok7 CM mice with a mixed gene background survived for 1-2 weeks after birth (Figures 14A-14B), facilitating experiments to study therapeutic efficacy. Dok7 CM mice with a C57BL / 6-CBA mixed background showed signs of disease immediately after birth, including stunted growth and defects in synapse formation (Figures 15A-15E). Despite surviving for several weeks after birth, Dok7 expression, MuSK phosphorylation, nerve terminal organization, and AChR were similar in inbred C57BL / 6 mice and mixed-species C57BL / 6-CBA mice with the same Dok7 mutation in El8.5.

[0169] Dok7 CM mice were injected with 10 mg / kg of antibody X17 or an isotype-matched negative control antibody at P4. Untreated Dok7 CM mice, or Dok7 CM mice injected with the isotype control antibody, continued to lose weight and died within one week at P10-12 (Figures 5A-5B). Injection with antibody X17 improved weight loss and rescued Dok7 CM mice from this early lethality (Figures 5A-5B). Over the following three weeks, 9 out of 12 Dok7 CM mice injected with antibody X17 continued to gain weight; 3 of the X17-injected mice experienced slowed weight gain and died at P23-24. Another antibody, X3, rescued Dok7 CM mice from early postnatal lethality when administered at 20 mg / kg, but did not rescue them when administered at 10 mg / kg (Figures 17A-17C). This suggests that higher initial doses of MuSK agonist antibodies may be more effective in early postnatal development when synapses are undergoing a crucial process of maturation.

[0170] We repeatedly administered antibody X17 to nine surviving Dok7 CM mice on P24 and P44 to determine if long-term administration could lead to long-term survival. When we evaluated the motor performance of the Dok7 CM mice and examined their synapses after sacrifice, long-term administration of antibody X17 to the nine surviving Dok7 CM mice rescued them for at least two months (Figures 5A-5B).

[0171] Antibody X17 rescued synapse formation and maturation, causing neuromuscular synapses to develop the complex pretzel-like shape characteristic of fully mature mouse neuromuscular synapses (Figure 5C). Furthermore, XI7 rescued the recruitment of Crk proteins to neuromuscular synapses (Figure 5D).

[0172] Antibody X17 rescued motor function in Dok7 CM mice as assessed by forelimb grip strength and rotorod assay (Figure 5E). Furthermore, Dok7 CM mice injected with antibody XI7 were fertile and produced offspring at the expected frequency. These findings together support the idea that reduced MuSK tyrosine phosphorylation is central to the disease in Dok7 CM mice. Even if the carboxyl terminal region of Dok7 has a further role in synapse formation, such function may be abolished by stimulating MuSK.

[0173] Therapeutic improvement in adult Dok7 CM mice Next, we investigated whether X17 could improve neuromuscular defects that develop in adulthood. This question is particularly relevant to the development of treatments in humans, as Dok7 CM in humans is likely to be treated in adulthood. Dok7 CM mice were treated with X17 in either P4, P24, and P44, or P4 and P18, and then antibody treatment was discontinued. These Dok7 CM mice maintained their body weight and motility for 2-3 months (Figure 6A), indicating that the rescue effect was more persistent than the lifespan of antibodies in the blood. However, these Dok7 CM mice eventually began to lose weight and exhibit motility impairment (Figures 6A-6B). When the mice were losing weight at a rate of approximately 0.4 g / day, X17 was injected again, and the body weight and motility of the Dok7 CM mice were monitored. Two days after resuming XI7 treatment, Dok7 CM mice began to regain weight, increasing at approximately 0.4 g / day over the following week (Figure 6A). Within one week of resuming antibody treatment, the exercise performance of Dok7 CM mice recovered (Figure 6B). Rescued mice continued to gain weight and improve exercise performance for at least another week after antibody treatment until the time of sacrifice (Figures 6A-6B).

[0174] Discussion of Example 1 Stimulating MuSK with an agonist antibody rescued synapse formation and motor function, prevented lethality, and enabled Dok7 CM mice to reproduce postnatally as fertile adults. Furthermore, although adult Dok7 CM mice eventually exhibited motor impairment after discontinuation of antibody treatment, this impairment rapidly improved after resuming antibody therapy. This suggests that this therapeutic strategy may be beneficial for Dok7 CM and other neuromuscular diseases in humans.

[0175] Most previous studies on Dok7 have relied on the analysis of transfected muscle and non-muscle cells overexpressing Dok7 (Okada et al., "The Muscle Protein Dok-7 is Essential for Neuromuscular Synaptogenesis," Science 312: pp. 1802-1805 (2006), which is incorporated herein by reference in its entirety; Hamuro et al., "Mutations Causing DOK7 Congenital Myasthenia Ablate Functional Motifs in Dok-7," J. Biol. Chem. 283: pp. 5518-5524 (2008); and Hallock et al., "Dok-7 Regulates Neuromuscular Synapse Formation by Recruiting Crk and Crk-L," Genes Dev. 24: pp. 2451-2461 (2010)). In this context, where the usual requirements for agrin and Lrp4 to stimulate MuSK are bypassed, the in vivo results of the Dok7 mutation may be masked due to Dok7 overexpression.

[0176] Previous studies have described similar mouse models of this common form of Dok7 CM generated using classical ES cell gene targeting (Arimura et al., "Neuromuscular Disease. DOK7 Gene Therapy Benefits Mouse Models of Diseases Characterized by Defects in the Neuromuscular Junction," Science 345: pp. 1505-1508 (2014), which is incorporated in its entirety herein by reference). The lethality of these mutant mice was rescued by an adenovirus-associated vector expressing wild-type Dok7, establishing a therapeutic approach to treat Dok7 CM (Arimura et al., "Neuromuscular Disease. DOK7 Gene Therapy Benefits Mouse Models of Diseases Characterized by Defects in the Neuromuscular Junction," Science 345: pp. 1505-1508 (2014), which is incorporated herein by reference in its entirety), but this study did not examine the cause of the disease in the Dok7 1124_1127 dup mouse model.

[0177] Inbred C57BL / 6 mice carrying the Dok7 1124_1127 dup mutation exhibited more severe functional defects than humans with the same mutation. Inbred mutant mice died at birth, while uninbred mice survived for several weeks, indicating that mice with a mixed genetic background exhibited less severe mutant phenotype. Modifiers in the hybrid line may reduce disease severity, or C57BL / 6 mice may carry genes that exacerbate the phenotype. In either case, the moderately extended lifespan of Dok7 CM mice with a mixed background provides a mouse model that offers a longer temporal window for better evaluating treatments.

[0178] These experiments demonstrate complete rescue from congenital lethality through targeted therapy. These findings represent an unexpected therapeutic approach to treating the disease because the strategy does not directly target the mutated protein, but rather targets the upstream gene, in this case Dok7 mutation, which causes a reduced activity of the wild-type protein. Such epistasis rescue could provide treatment for CM caused by mutations in Agrin, Lrp4, or MuSK, in addition to Dok7, as well as for further neuromuscular diseases. Furthermore, this strategy has the potential for broad applications in treating recessive genetic disorders in humans where the disease mechanisms are understood and appropriate targets have been identified.

[0179] (Example 2) MuSK antibody Selection of simple antibodies targeting the Frizzle domain of MuSK Two llamas were immunized with recombinant human MuSK (R&D Systems, catalog no. 9810-MK). PBLs isolated from the immunized llamas were used for RNA extraction, RT-PCR, and PCR cloning of Fab in phagemids using the strategy described by de Haard et al. (see de Haard et al., "A Large Non-Immunized Human Fab Fragment Phage Library that Permits Rapid Isolation and Kinetic Analysis of High Affinity Antibodies," J. Biol. Chem. 274: pp. 18218-18230 (1999), which is incorporated herein by reference in its entirety). Panning phage display selection was performed up to three rounds using either full-length human MuSK, full-length mouse MuSK, or human MuSK lacking Ig1-like and / or Ig2-like and / or Ig3-like domains (Figure 18).

[0180] For each selection involving concentration, individual clones were augmented in 96-deep-well plates, and periplasmic fractions were prepared. These periplasmic extracts (containing Fab) were tested for binding to full-length human MuSK, full-length mouse MuSK, or human MuSK lacking Ig1-like and / or Ig2-like and / or Ig3-like domains in ELISA. Subsequently, Fab showing clear binding in ELISA was tested for off-rate using Biacore on CM5 chips coated with full-length human MuSK, full-length mouse MuSK, or human MuSK lacking Ig1-like and / or Ig2-like and / or Ig3-like domains. Binders with good affinity to human and mouse MuSK, and binders specific to the Frizzle domain of MuSK, were sequenced. Six different binder families were obtained: 1E11, 6F8, 10F1, 17H10, 14D10, and 16F11. These were cloned into vectors containing human IgG1 sequences with LALA mutations (L234A, L235A) to knock out effector function. Antibodies were generated in HEK293 cells and purified using a protein A column.

[0181] Binding of human and mouse antibodies to MuSK in ELISA ELISA plates were coated with 0.2 μg / ml of human MuSK (R&D Systems, catalog number 10189-MK) or mouse MuSK (in-house prepared using HEK 293 cells). After washing and blocking the plates, a dilution series of anti-MuSK antibodies was applied and allowed to bind at room temperature for 2 hours. Binding was detected using goat anti-human Fc-HRP (Jackson Immunoresearch, catalog number 109-035-008) and TMB (Merck Millipore, #CL07). OD at 620 nm was measured using a 96-well ELISA plate reader.

[0182] All six antibodies (1E11, 6F8, 10F1, 17H10, 14D10, and 16F11) showed binding to human MuSK. However, binding to mouse MuSK was poor except for 16F11. In the case of 16F11, binding to mouse MuSK was increased, and the concentration of 16F11 was higher than that for human MuSK (Figure 19). In conclusion, this assay revealed poor human-mouse cross-binding for five of the six antibodies tested.

[0183] Light chain shuffling to improve cross-reactivity in mice During repeated exposure to the same antigen, for example during the immunization period of llamas, the immune response is optimized by increasing the affinity of the antibody to the target. The secondary response can induce antibodies with several log-fold higher affinity than the primary response. As a result, B cells produce a variety of antibodies and therefore variants with varying affinities to the antigen. Five of the six antibodies selected above showed low mouse cross-reactivity. Therefore, chain shuffling was applied to the mAbs. In this method, the VH of the Fab molecule is cloned into the entire individual llama VL repertoire. The resulting library contains Fab phages with Fab-specific VH chains and random VL chains. Using phage display and different variants of MuSK (similar to those described above), higher affinity variants naturally present in immunized animals were selected. For each selection with enrichment, individual clones were augmented in 96 deep-well plates, and periplasmic fractions were prepared. These periplasm extracts (containing Fab) were tested for binding with Biacore on CM5 chips coated with full-length human MuSK and full-length mouse MuSK. Binders with good affinity to human and mouse MuSK were sequenced. This campaign was successful with 14D10, 16F11, 6F8, and 17H10. No improvement in mouse cross-reactivity was obtained for 10F1 and 1E11.

[0184] For 14D10, we obtained cross-reactive binders for six different sequences: 31G2, 31B7, 3C4, 7G4, 3G3, and 3B2. For 17H10, we obtained cross-reactive binders for three different sequences: 23B6, 30E1, and 30A11. For 16F11, we obtained cross-reactive binders for four different sequences: 4C11, 7G12, 7B8, and 7A12.

[0185] All of these were cloned into vectors containing human IgG1 sequences with LALA mutations (L234A, L235A) to knock out effector function. Antibodies were generated in HEK293 cells and purified using a protein A column.

[0186] Binding of human and mouse antibodies to MuSK in ELISA ELISA plates were coated with 0.2 μg / ml human MuSK (R&D Systems, catalog number 10189-MK), rhesus monkey MuSK (in-house prepared using HEK293 cells), or mouse MuSK (in-house prepared using HEK293 cells). After washing and blocking the plates, a dilution series of anti-MuSK antibodies was applied and allowed to bind at room temperature for 2 hours. Binding was detected using goat anti-human Fc-HRP (Jackson Immunore Search, catalog number 109-035-008) and TMB (Merck Millipore, #CL07). After stopping the reaction with 0.5N H2SO4 (ChemLab, #CL052615), the OD at 450 nm was measured using a 96-well ELISA plate reader. EC 50 The values ​​are summarized in Table 4. Improved affinity for mouse MuSK was confirmed for all clones tested.

[0187] [Table 4]

[0188] The best clones were selected using the following criteria: (i) highest affinity for human, rhesus monkey, and mouse MuSK; (ii) minimum affinity difference between human, rhesus monkey, and mouse MuSK; (iii) maximum 10-fold affinity difference between human, rhesus monkey, and mouse MuSK; (iv) low risk of manufacturability issues based on CDR sequence analysis; and (v) highest identity / homologousity with human.

[0189] Clones 3B2, 30A11, and 30E1 were selected for large-scale antibody production and detailed characterization in HEK293 cells.

[0190] Biacore's binding affinity for human vs. mouse MuSK Monovalent binding to MuSK can inhibit agrin-inducible MuSK phosphorylation and AChR clustering, as described in Huijbers et al., "MuSK Myasthenia Gravis Monoclonal Antibodies: Valency Dictates Pathogenicity," Neurol. Neuroimmunol. Neuroinflamm. 6(3):e547 (2019), which is incorporated in its entirety herein by reference. Therefore, it is important to evaluate the affinity of 3B2, 30E1, and 30A11 Fabs to MuSK. In fact, Fabs with low affinity can reduce monovalent binding of mAbs and thus have a potential safety advantage. Therefore, the Fab affinity to human and mouse MuSK was compared with the mAb affinity in Biacore.

[0191] To determine affinity, CM5 chips were coated with either human or mouse MuSK (200RU), and a dilution series of antibodies (mAb and Fab) was applied to enable affinity calculation.

[0192] Using this assay, the affinity of the 3B2 mAb was 0.1 nM for both human and mouse MuSK. Fab 3B2 showed affinity of 3 nM for human MuSK and 1.5 nM for mouse MuSK, which is lower than the affinity of the mAb, ranging from 1 / 15 to 1 / 30 times.

[0193] 30E1 showed a 10-fold difference in binding affinity to human MuSK (0.01 nM) compared to mouse MuSK (0.1 nM). 30A11 showed a 100-fold difference in binding affinity between human MuSK (0.001 nM) and mouse MuSK (0.1 nM). Therefore, both antibodies are not sufficiently mouse cross-reactive. Furthermore, 30E1Fab and 30A11Fab showed high affinities to human MuSK of 0.07 nM and 0.8 nM, respectively. The lack of mouse cross-reactivity for both antibodies was also observed in the Fabs. These results suggest that when comparing affinity to human MuSK versus mouse MuSK, there is a 10- to 100-fold difference between 30E1 and 30A11 mAbs, and at least a 1000-fold difference between 30E1 and 30A11 Fabs (Table 5). This difference in antibody affinity to the target is not recommended for further antibody development, as it makes it difficult to evaluate in vivo mouse experiments and translate the data to humans. In conclusion, the mAb and Fab of 3B2 exhibit the desired affinity properties and interspecies reactivity for further development.

[0194] [Table 5]

[0195] Antibody efficacy in C2C12 phosphorylation assays To evaluate the expansion of MuSK phosphorylation induced by 3B2, 30E1, and 30A11, an in vitro MuSK phosphorylation assay was used with mouse C2C12 myotubes (91031101, Sigma Cell line service, ECACC). Differentiated myotubes were stimulated with 10 nM antibody. A positive control for MuSK phosphorylation was stimulated by applying 0.1 nM rat neural agrin (550-AG-100, R&D systems). Immunoprecipitation of MuSK began immediately after exposure during an overnight incubation at 4°C. The bound antigen-antibody complexes were pressed onto streptavidin-coated magnetic beads (V7820, The samples were precipitated at 4°C for at least 1 hour using Promega, and then thoroughly washed. Simultaneously, streptavidin-coated MSD plates (L15SA-1, MSD) were blocked and coated with biotinylated hIgG4 anti-MuSK (clone 13-3B5 - Evitria 801457.1 PID 9860 - biotinylation performed by argenx). The MuSK protein was eluted from beads under acidic conditions, followed by a neutralization step, and incubated on the hIgG4 anti-MuSK coated MSD plates at room temperature for at least 2.5 hours. Sample incubation was performed in the presence of cleaved MuSK in solution (MuSK Δ1-2-3Ig, argenx in HEK) to limit drug interference from co-eluting anti-MuSK hIgGl antibody. The sample was quadrupled on a plate to enable dual detection of both total MuSK (PA1-1741, Thermoscientific and MBS9205728, MyBioSource mix) and phosphorylated MuSK (05-321 Millipore Corp (clone 4G10) and ab10321, Abcam (clone PY20) mix). SULFO-TAG conjugated antibodies were applied to anti-rabbit IgG (32AB-1, MSD) for total MuSK detection and anti-mouse IgG (R32AC-1, MSD) for phosphorylated MuSK detection, respectively, for final detection. The conjugated antibodies were detected using Quickplex SQ 120 (MSD).

[0196] Addition of agrin (1 nM) to C2C12 myotubes induced MuSK phosphorylation, which was set to 100%. Three independent experiments were performed. Using this experimental setting, 3B2, 30E1, and 30A11 were able to induce MuSK phosphorylation between 50% and 94% in this assay (Table 6).

[0197] [Table 6]

[0198] 3B2 rescues early postnatal lethality in Dok7 1124_1127 dup mice. In the first experiment, intraperitoneal (IP) administration of 10 mg / kg of 3B2 in both P4 and P18 wild-type mice (C57BL / 6 / / CBA) showed no significant differences in body weight and overall health compared to wild-type mice injected with isotypes for at least 5 weeks, suggesting no safety concerns or toxicity issues and demonstrating that the 3B2 antibody is safe for further in vivo experimental work.

[0199] Next, 3B2 was administered to Dok7 1124_1127 dup mice, a CMS mouse model. In Dok7 1124_1127 dup mice (hereinafter referred to as Dok7 mice), cleaved Dok7 is not sufficiently expressed, and MuSK tyrosine phosphorylation is significantly reduced. The reduced level of MuSK phosphorylation in Dok7 mice plays a crucial role in the disease. Stimulating MuSK phosphorylation with an agonist antibody against MuSK can rescue the lethality of Dok7 mice and allow mutant mice to survive as adults. In fact, administration of 3B2 (20 mg / kg IP at P4 and 10 mg / kg IP at P18) was able to rescue Dok7 mutant mice from early postnatal lethality (Figure 20).

[0200] Removal of the 3B2 problem (LiTLS) and CDR porting The 3B2 antibody was diluted to 1 mg / mL in PBS-Tween and incubated at 37°C for up to 6 weeks. Next, the samples were analyzed by mass spectrometry to screen for deamidation, glycosylation, isomerization, and oxidation sites in VH and VL. As expected, two problem areas were identified: one deamidation site in VH-CDR2 and one oxidation site in VL-CDR3. Mutants were created to eliminate both problems. Furthermore, while 3B2 already possessed high human identity / homology (94.2% and 97.7%, respectively), this was further improved to 100% by transplanting the CDR into the nearest human germline sequence.

[0201] By combining these two strategies, a total of eight variants were generated, as summarized in Table 7. The antibodies were prepared in HEK293 cells using the human IgG1-LALA backbone and purified using a protein A column.

[0202] [Table 7]

[0203] Affinity of 3B2 sequence optimization variants in Biacore To determine affinity, CM5 chips were coated with MuSK (200RU) from cynomolgus monkeys, rats, and mice, and 66.7 nM antibodies were applied to calculate kinetic parameters (Table 8). The following conclusions were reached: (1) 3B2g1m3 and 3B2g2m3 (m3 variants) showed a significant decrease in affinity for MuSK in all species tested; (2) 3B2g1m2 and 3B2g2m2 (m2 variants) showed some decrease in affinity for MuSK; (3) 3B2g1m1, 3B2g2m1, 3B2g1m4, and 3B2g2m4 (m1 and m4 variants) showed no decrease in affinity for MuSK in all species tested; and (4) there was no difference between g1 and g2 variants for all clones (VL methionine vs. serine in CDR3).

[0204] [Table 8]

[0205] Conventional antibodies are taken up into cells via nonspecific endocytosis or pinocytosis, or via receptor-mediated internalization. In contrast to conventional antibodies that can only bind to an antigen once, recycled antibodies are engineered so that a single antibody molecule can bind to an antigen multiple times. In fact, when conventional antibodies bind to membrane-anchored antigens such as receptors, the antibody-antigen complex is internalized and degraded within lysosomes. This shortens the half-life of therapeutic antibodies, requiring more frequent or higher-dose administration of antibody drugs to maintain effective plasma antibody concentrations. Antibodies can be engineered to dissociate from antigens at the acidic pH of endosomes. Once dissociated, recycled antibodies freely bind to FcRn (fetal Fc receptor) in endosomes, thereby returning the antibody to the circulation and binding to more antigens.

[0206] MuSK is expressed in the membrane of muscle cells. The internalization of MuSK is described by Zhu et al., "Muscle-Specific Receptor Tyrosine Kinase Endocytosis in This is described in "Acetylcholine Receptor Clustering in Response to Agrin," J. Neurosci. 28(7): pp. 1688-1696 (2008). Therefore, recycled antibodies against this target may be of interest.

[0207] Most pH-dependent antibodies reported to date have been obtained after extensive manipulation of CDRs, but this property may have been present from the beginning. We investigated whether 3B2 and optimized sequence variants possess an inherent, pre-existing pH dependence for binding to MuSK using Biacore.

[0208] To study the pH-dependent binding of our antibody to MuSK, we used the same Biacore as described above, but this time, dissociation was performed at pH 5.5 instead of pH 7.4. The results demonstrate that 3B2 binds to MuSK (cynomolgus monkey, rat, or mouse) in a pH-dependent manner, and its affinity decreases at pH 5.5 (Table 9). Regarding the various variants, the following conclusions can be drawn: (1) 3B2g1m3 and 3B2g2m3 (m3 variants) show a significant decrease in affinity for MuSK in all species tested; (2) 3B2g1m2 and 3B2g2m2 (m2 variants) show some decrease in affinity for MuSK; (3) 3B2g1m1, 3B2g2m1, 3B2g1m4, and 3B2g2m4 (ml and m4 variants) show no decrease in affinity for MuSK in all species tested; and (4) there is no difference between the g1 and g2 variants for all clones (VL methionine vs. serine in CDR3).

[0209] [Table 9]

[0210] In vitro MuSK phosphorylation assay to evaluate the 3B2 variant To evaluate the expansion of MuSK phosphorylation induced by our agonist 3B2 variant antibody, we used an in vitro MuSK phosphorylation assay with mouse C2C12 myotubes. Controls included agrin, parental 3B2, and motavizumab (non-MuSK binding ab). Addition of agrin to C2C12 myotubes induced MuSK phosphorylation, which was set to 100%. This included subtracting the background of MuSK phosphorylation analyzed by inducing MuSK phosphorylation with motavizumab, a non-MuSK binder. Parental 3B2 ab induced MuSK phosphorylation to a similar degree as 1 nM agrin. Furthermore, the 3B2 variants 3B2g1m1 and 3B2g2m1 acted as well as parental 3B2 ab. 3B2g1m2 and 3B2g2m2 also strongly induced MuSK phosphorylation (+ / -80%). 3B2g1m3 and 3B2g2m3 lost their ability to induce MuSK, resulting in approximately 13% MuSK phosphorylation. Interestingly, 3B2g1m4 and 3B2g2m4 lost almost half of their ability to induce MuSK, resulting in approximately 58% MuSK phosphorylation (Figure 21).

[0211] Binding affinity of 3B2 variants to coated MuSK from different species in ELISA ELISA was performed to evaluate the binding affinity of 3B2 variants to MuSK proteins from different species. Plates were coated with human, cynomolgus monkey, rat, or mouse MuSK morphology, and the binding of different 3B2 variants compared to 3B2 was evaluated as described above. In this assay, 3B2g1m1, 3B2g2m1, 3B2g1m4, and 3B2g2m4 did not lose affinity compared to 3B2. On the other hand, 3B2g1m2, 3B2g2m2, 3B2g1m3, and 3B2g2m3 lost binding affinity to MuSK from different species (Figure 22).

[0212] (Example 3) Differences in pH dependence of agonist MuSK antibodies Conventional antibodies are taken up into cells via nonspecific endocytosis or pinocytosis, or via receptor-mediated internalization. As mentioned above, in contrast to conventional antibodies that can only bind to an antigen once, recycled antibodies are engineered so that a single antibody molecule can bind to an antigen multiple times. In fact, when conventional antibodies bind to membrane-anchored antigens such as receptors, the antibody-antigen complex is internalized and degraded within lysosomes. This shortens the half-life of therapeutic antibodies, necessitating frequent or higher doses of antibody drugs to maintain effective plasma antibody concentrations. Antibodies can be engineered to dissociate from antigens at the acidic pH of endosomes. Once dissociated, recycled antibodies freely bind to FcRn (fetal Fc receptor) in endosomes, thereby returning the antibody to the circulation and binding to more antigens.

[0213] MuSK is expressed in the membrane of muscle cells. The internalization of MuSK is described in Zhu et al., "Muscle-Specific Receptor Tyrosine Kinase Endocytosis in Acetylcholine Receptor Clustering in Response to Agrin," J. Neurosci. 28(7): pp. 1688-1696 (2008), which is incorporated entirely herein by reference. Therefore, recycled antibodies against this target may be of interest.

[0214] Most pH-dependent antibodies reported to date have been obtained after extensive manipulation of CDRs, but this property may have been present from the beginning. We investigated whether X2, X2m4, X3, X9, X17, 3B2, and 3B2g2m1 possess an inherent, pre-existing pH dependence for binding to MuSK using Biacore.

[0215] To study the pH-dependent binding of the antibodies described herein to MuSK, a Biacore T200 was used. Briefly, CM5 chips were coated with human and mouse MuSK (200RU), 22.2 nM Fab was applied, and kinetic parameters were calculated. Association occurred at pH 7.4, and dissociation occurred at pH 7.4 and pH 5.5. The following Fabs were tested: X2, X2m4, X3, X9, X17, 3B2, and 3B2g2m1 (Table 10 and Figure 23). Interestingly, these results suggest that 3B2g2m1 exhibits pH-dependent binding to both human and mouse MuSK. The binding affinity at pH 5.5 is very low, leading to rapid dissociation at endosomal pH and enabling the recycling of 3B2g2m1.

[0216] [Table 10]

[0217] (Example 4) MuSK antibodies, which target the Fz domain, do not inhibit MuSK activation by its natural ligand, agrin. MuSK activation requires motor neuron-secreted agrin, fascial-located LRP4, and cytoplasmic DOK-7. LRP4 and MuSK are pre-assembled in the absence of agrin, but MuSK activation is induced only in the presence of agrin. In fact, agrin-bound LRP4 containing MuSK initiates MuSK transphosphorylation and activation (see, in whole, Stiegler et al., "Crystal Structure of the Agrin-Responsive Immunoglobulin-Like Domains 1 and 2 of the Receptor Tyrosine Kinase MuSK," J. Mol. Biol. 364:424-433 (2006), which is incorporated herein by reference); Kim et al., "Lrp4 is a Receptor for Agrin and Forms a Complex with MuSK," Cell 135:334-342 (2008); Zhang et al., "Agrin Binds to the N-Terminal Region of Lrp4 Protein and Stimulates Association between Lrp4 and the First Immunoglobulin-Like Domain in Muscle-Specific Kinase (MuSK)," J. Biol. Chem. 286:pp. 40624-40630 (2011); and Zong et al., "Structural Basis of Agrin-LRP4-MuSK Signaling," Genes Dev. 26:pp. 247-258 (2012).

[0218] MuSK agonist antibodies that target the Fz domain of MuSK may inhibit agrin-mediated activation of MuSK. In vitro co-stimulation experiments were performed to test whether Fz-conjugated MuSK agonist antibodies can activate MuSK together with agrin.

[0219] An in vitro MuSK phosphorylation assay using mouse C2C12 myotubes was used to evaluate the expansion of MuSK phosphorylation induced by the agonist MuSK antibody 3B2g2m1, in the presence or absence of unsaturated agrin (0.1 nM agrin). Controls included agrin (1 nM and 0.1 nM) and motabizumab (isotype control, non-MuSK-binding mAb, 333 nM). All stimulations were performed for 30 minutes. Addition of 1 nM agrin to C2C12 myotubes induced MuSK phosphorylation, which was set to 100%. This included subtracting the background of MuSK phosphorylation analyzed by inducing MuSK phosphorylation with motabizumab, a non-MuSK binder. Stimulation of MuSK with 0.1 nM agrin resulted in 53% induction of MuSK phosphorylation, suggesting that this is a suboptimal concentration of agrin in this assay. Titration of 0.01–333 nM 3B2g2m1 (without agrin) increased MuSK phosphorylation in a dose-dependent manner. Importantly, co-stimulation of 3B2g2m1 with a suboptimal concentration of 0.1 nM agrin resulted in increased MuSK phosphorylation compared to stimulation with 3B2g2m1 or 0.1 nM agrin alone. Notably, combining 0.3 nM 3B2g2m1 with 0.1 nM agrin resulted in 100% MuSK phosphorylation, similar to stimulation with 1 nM agrin alone (Figure 24). This data suggests that 3B2g2m1, which binds to the Fz domain of MuSK, can stimulate MuSK in parallel with agrin. Furthermore, it may be suggested that 3B2g2m1 can activate MuSK at a higher level than its natural ligand, agrin, leading to increased MuSK phosphorylation. Indeed, agrin binds to LRP4, which then binds to the Ig-1-like domain of MuSK. Therefore, activating MuSK by targeting the Fz domain with an agonist MuSK antibody does not interfere with MuSK activation by its natural ligand, agrin.

[0220] (Example 5) MuSK agonist antibodies mIgG2a-X17 and hIgG-X17 The therapeutic efficacy of a combination of mIgG2a-X...

Claims

1. An antibody-based molecule that binds to an epitope of human muscle-specific tyrosine protein kinase (MuSK), wherein the epitope is located in the MuSK Frizzled(Fz)-like domain sequence of SEQ ID NO: 130, and the antibody-based molecule induces MuSK phosphorylation when it binds to the epitope.

2. The MuSK antibody-based molecule according to claim 1, wherein the antibody-based molecule binds to the MuSK Fz-like domain with higher affinity under neutral pH conditions than under acidic pH conditions.

3. The MuSK antibody-based molecule according to claim 1 or 2, wherein the antibody-based molecule does not inhibit agrin-inducible MuSK phosphorylation when it binds to the MuSK Fz-like domain.

4. The MuSK antibody-based molecule according to claim 1 or 2, wherein when the antibody-based molecule binds to the MuSK Fz-like domain, it enhances agrin-inducible MuSK phosphorylation.

5. The antibody-based molecule Complementarity determination region 1 (CDR-H1) includes a modified amino acid sequence which is one of the amino acid sequences of SEQ ID NOs. 147, 1-16, 135, 136, 148, or 149, and which has at least 80% sequence identity with any one of SEQ ID NOs. 147, 1-16, 135, 136, 148, or 149, Complementarity determination region 2 (CDR-H2) includes a modified amino acid sequence which is one of the amino acid sequences of SEQ ID NOs: 153, 17-32, 137, 138, 150, 151, 154, or 155, and which is one of the modified amino acid sequences which is one of the amino acid sequences of SEQ ID NOs: 153, 17-32, 137, 138, 150, 151, 154, or 155, and the modified sequence has at least 80% sequence identity with one of the SEQ ID NOs: 153, 17-32, 137, 138, 150, 151, 154, or 155, and Complementarity determination region 3 (CDR-H3) includes a modified amino acid sequence which is one of the amino acid sequences of SEQ ID NOs: 156, 33-48, 139, 140, 157-158, or 240-251, or one of the modified amino acid sequences of SEQ ID NOs: 156, 33-48, 139, 140, 157-158, or 240-251, wherein the modified sequence has at least 80% sequence identity with any one of SEQ ID NOs: 156, 33-48, 139, 140, 157-158, or 240-251. A MuSK antibody-based molecule according to any one of claims 1 to 4, comprising a heavy chain variable region.

6. The aforementioned heavy chain variable region is Heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 153, and CDR-H3 of SEQ ID NO:

156. Heavy chain variable region including CDR-H1 of SEQ ID NO: 1, CDR-H2 of SEQ ID NO: 17, and CDR-H3 of SEQ ID NO: 33 Heavy chain variable region including CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and CDR-H3 of SEQ ID NO: 34 Heavy chain variable region including CDR-H1 of SEQ ID NO: 3, CDR-H2 of SEQ ID NO: 19, and CDR-H3 of SEQ ID NO: 35 Heavy chain variable region including CDR-H1 of SEQ ID NO: 4, CDR-H2 of SEQ ID NO: 20, and CDR-H3 of SEQ ID NO: 36 Heavy chain variable region including CDR-H1 of SEQ ID NO: 5, CDR-H2 of SEQ ID NO: 21, and CDR-H3 of SEQ ID NO: 37 Heavy chain variable region including CDR-H1 of SEQ ID NO: 6, CDR-H2 of SEQ ID NO: 22, and CDR-H3 of SEQ ID NO: 38 Heavy chain variable region including CDR-H1 of SEQ ID NO: 7, CDR-H2 of SEQ ID NO: 23, and CDR-H3 of SEQ ID NO: 39 Heavy chain variable region including CDR-H1 of SEQ ID NO: 8, CDR-H2 of SEQ ID NO: 24, and CDR-H3 of SEQ ID NO: 40, Heavy chain variable region including CDR-H1 of SEQ ID NO: 9, CDR-H2 of SEQ ID NO: 25, and CDR-H3 of SEQ ID NO: 41 Heavy chain variable region including CDR-H1 of SEQ ID NO: 10, CDR-H2 of SEQ ID NO: 26, and CDR-H3 of SEQ ID NO: 42 Heavy chain variable region including CDR-H1 of SEQ ID NO: 11, CDR-H2 of SEQ ID NO: 27, and CDR-H3 of SEQ ID NO: 43 Heavy chain variable region including CDR-H1 of SEQ ID NO: 12, CDR-H2 of SEQ ID NO: 28, and CDR-H3 of SEQ ID NO: 44 Heavy chain variable region including CDR-H1 of SEQ ID NO: 13, CDR-H2 of SEQ ID NO: 29, and CDR-H3 of SEQ ID NO: 45 Heavy chain variable region including CDR-H1 of SEQ ID NO: 14, CDR-H2 of SEQ ID NO: 30, and CDR-H3 of SEQ ID NO: 46 Heavy chain variable region including CDR-H1 of SEQ ID NO: 15, CDR-H2 of SEQ ID NO: 31, and CDR-H3 of SEQ ID NO: 47 Heavy chain variable region including CDR-H1 of SEQ ID NO: 16, CDR-H2 of SEQ ID NO: 32, and CDR-H3 of SEQ ID NO: 48 Heavy chain variable regions including CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and CDR-H3 of SEQ ID NO: 139, and Heavy chain variable region including CDR-H1 of SEQ ID NO: 136, CDR-H2 of SEQ ID NO: 138, and CDR-H3 of SEQ ID NO: 140 A MuSK antibody-based molecule according to claim 5, selected from the group consisting of the following.

7. The aforementioned heavy chain variable region is Heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156 Heavy chain variable region including CDR-H1 of SEQ ID NO: 148, CDR-H2 of SEQ ID NO: 151, and CDR-H3 of SEQ ID NO: 157 Heavy chain variable region including CDR-H1 of SEQ ID NO: 149, CDR-H2 of SEQ ID NO: 152, and CDR-H3 of SEQ ID NO:

158. Heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 154, and CDR-H3 of SEQ ID NO:

156. Heavy chain variable regions including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 155, and CDR-H3 of SEQ ID NO: 156, and Heavy chain variable region including CDR-H1 (SEQ ID NO: 147), CDR-H2 (SEQ ID NO: 150), and CDR-H3 (SEQ ID NO: 156). A MuSK antibody-based molecule according to claim 5, selected from the group consisting of the following.

8. The MuSK antibody-based molecule according to any one of claims 5 to 7, wherein the heavy chain variable region of the antibody-based molecule further comprises a heavy chain framework region of human or humanized immunoglobulin.

9. The aforementioned molecule, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of sequence number 97, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of sequence number 99, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of sequence number 101, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of sequence number 103, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of SEQ ID NO: 105, A heavy chain variable region containing at least 80% identical amino acid sequence to SEQ ID NO: 107, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of sequence number 109, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of sequence number 111, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of sequence number 113, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of SEQ ID NO: 115, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of SEQ ID NO: 117, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of sequence number 119, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of SEQ ID NO: 121, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of sequence number 123, A heavy chain variable region containing at least 80% identical amino acid sequence to SEQ ID NO: 125, A heavy chain variable region containing at least 80% identical amino acid sequence to SEQ ID NO: 127, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of sequence number 131, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of sequence number 133, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of SEQ ID NO: 252, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of sequence number 253, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of SEQ ID NO: 254, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of SEQ ID NO: 255, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of sequence number 256, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of SEQ ID NO: 257, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of SEQ ID NO: 258, A heavy chain variable region containing at least 80% identical amino acid sequence to sequence number 259, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of sequence number 260, A heavy chain variable region containing at least 80% identical amino acid sequence to sequence number 261, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of SEQ ID NO: 262, and Heavy chain variable region containing at least 80% identical amino acid sequence to SEQ ID NO: 263 A MuSK antibody-based molecule according to any one of claims 1 to 8, comprising:

10. The aforementioned molecule, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of sequence number 196, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of sequence number 198, A heavy chain variable region containing at least 80% identical amino acid sequence to SEQ ID NO: 200, A heavy chain variable region containing at least 80% identical amino acid sequence to SEQ ID NO: 202, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of SEQ ID NO: 204, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of SEQ ID NO: 206, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of SEQ ID NO: 208, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of SEQ ID NO: 210, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of sequence number 212, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of SEQ ID NO: 214, A heavy chain variable region containing at least 80% identical amino acid sequence to SEQ ID NO: 216, A heavy chain variable region containing at least 80% identical amino acid sequence to SEQ ID NO: 218, A heavy chain variable region containing at least 80% identical amino acid sequence to SEQ ID NO: 220, A heavy chain variable region containing at least 80% identical amino acid sequence to SEQ ID NO: 222, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of SEQ ID NO: 224, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of SEQ ID NO: 226, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of SEQ ID NO: 228, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of SEQ ID NO: 230, A heavy chain variable region containing at least 80% identical amino acid sequence to SEQ ID NO: 232, A heavy chain variable region containing at least 80% identical amino acid sequence to SEQ ID NO: 234, A heavy chain variable region containing an amino acid sequence at least 80% identical to that of SEQ ID NO: 236, and Heavy chain variable region containing at least 80% identical amino acid sequence to SEQ ID NO: 238 A MuSK antibody-based molecule according to any one of claims 1 to 8, comprising:

11. The MuSK antibody-based molecule according to any one of claims 1 to 10, wherein the antibody is a bivalent or polyvalent single-domain antibody.

12. The antibody-based molecule includes a light chain variable region, and the light chain variable region is Complementarity determination region 1 (CDR-L1) having a modified amino acid sequence which is one of the amino acid sequences of SEQ ID NOs: 159, 49-64, 141, 142, 160-169, or one of the modified amino acid sequences of SEQ ID NOs: 159, 49-64, 141, 142, or 160-169, wherein the modified sequence has at least 80% sequence identity with one of SEQ ID NOs: 159, 49-64, 141, 142, or 160-169. Complementarity determination region 2 (CDR-L2) having a modified amino acid sequence which is one of the amino acid sequences of SEQ ID NOs: 172, 65-80, 143, 144, 170, 171, or 173-179, and the modified sequence has at least 80% sequence identity with one of SEQ ID NOs: 172, 65-80, 143, 144, 170, 171, or 173-179, and Complementarity determination region 3 (CDR-L3) having a modified amino acid sequence which is one of the amino acid sequences of SEQ ID NOs: 195, 81-96, 145, 146, or 180-194, and the modified sequence has at least 80% sequence identity with one of the SEQ ID NOs: 195, 81-96, 145, 146, or 180-194. A MuSK antibody-based molecule according to any one of claims 1 to 10, comprising:

13. The aforementioned light chain variable region is Light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 195 Light chain variable region including CDR-L1 of SEQ ID NO: 49, CDR-L2 of SEQ ID NO: 65, and CDR-L3 of SEQ ID NO: 81, Light chain variable region including CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO:

82. Light chain variable region including CDR-L1 of SEQ ID NO: 51, CDR-L2 of SEQ ID NO: 67, and CDR-L3 of SEQ ID NO: 83 Light chain variable region including CDR-L1 of SEQ ID NO: 52, CDR-L2 of SEQ ID NO: 68, and CDR-L3 of SEQ ID NO: 84 Light chain variable region including CDR-L1 of SEQ ID NO: 53, CDR-L2 of SEQ ID NO: 69, and CDR-L3 of SEQ ID NO: 85 Light chain variable region including CDR-L1 of SEQ ID NO: 54, CDR-L2 of SEQ ID NO: 70, and CDR-L3 of SEQ ID NO: 86 Light chain variable region including CDR-L1 of SEQ ID NO: 55, CDR-L2 of SEQ ID NO: 71, and CDR-L3 of SEQ ID NO: 87 Light chain variable region including CDR-L1 of SEQ ID NO: 56, CDR-L2 of SEQ ID NO: 72, and CDR-L3 of SEQ ID NO: 88, Light chain variable region including CDR-L1 of SEQ ID NO: 57, CDR-L2 of SEQ ID NO: 73, and CDR-L3 of SEQ ID NO: 89 Light chain variable region including CDR-L1 of SEQ ID NO: 58, CDR-L2 of SEQ ID NO: 74, and CDR-L3 of SEQ ID NO: 90, Light chain variable region including CDR-L1 of SEQ ID NO: 59, CDR-L2 of SEQ ID NO: 75, and CDR-L3 of SEQ ID NO: 91, Light chain variable region including CDR-L1 of SEQ ID NO: 60, CDR-L2 of SEQ ID NO: 76, and CDR-L3 of SEQ ID NO: 92 Light chain variable region including CDR-L1 of SEQ ID NO: 61, CDR-L2 of SEQ ID NO: 77, and CDR-L3 of SEQ ID NO: 93, Light chain variable region including CDR-L1 of SEQ ID NO: 62, CDR-L2 of SEQ ID NO: 78, and CDR-L3 of SEQ ID NO: 94 Light chain variable region including CDR-L1 of SEQ ID NO: 63, CDR-L2 of SEQ ID NO: 79, and CDR-L3 of SEQ ID NO: 95 Light chain variable region including CDR-L1 of SEQ ID NO: 64, CDR-L2 of SEQ ID NO: 80, and CDR-L3 of SEQ ID NO: 96 Light chain variable region including CDR-L1 of SEQ ID NO: 141, CDR-L2 of SEQ ID NO: 143, and CDR-L3 of SEQ ID NO: 145, Light chain variable region including CDR-L1 of SEQ ID NO: 142, CDR-L2 of SEQ ID NO: 144, and CDR-L3 of SEQ ID NO: 146 A MuSK antibody-based molecule according to claim 12, selected from the group consisting of the following.

14. The aforementioned light chain variable region is Light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 170, and CDR-L3 of SEQ ID NO:

180. Light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 171, and CDR-L3 of SEQ ID NO: 181, Light chain variable region including CDR-L1 of SEQ ID NO: 160, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO:

182. Light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 183, Light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 171, and CDR-L3 of SEQ ID NO: 184 Light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 173, and CDR-L3 of SEQ ID NO: 185 Light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 173, and CDR-L3 of SEQ ID NO: 186, Light chain variable region including CDR-L1 of SEQ ID NO: 161, CDR-L2 of SEQ ID NO: 174, and CDR-L3 of SEQ ID NO: 187 Light chain variable region including CDR-L1 of SEQ ID NO: 162, CDR-L2 of SEQ ID NO: 174, and CDR-L3 of SEQ ID NO: 188, Light chain variable region including CDR-L1 of SEQ ID NO: 163, CDR-L2 of SEQ ID NO: 174, and CDR-L3 of SEQ ID NO: 188, Light chain variable region including CDR-L1 of SEQ ID NO: 164, CDR-L2 of SEQ ID NO: 174, and CDR-L3 of SEQ ID NO: 189 Light chain variable region including CDR-L1 of SEQ ID NO: 165, CDR-L2 of SEQ ID NO: 175, and CDR-L3 of SEQ ID NO: 190, Light chain variable region including CDR-L1 of SEQ ID NO: 166, CDR-L2 of SEQ ID NO: 176, and CDR-L3 of SEQ ID NO: 191, Light chain variable region including CDR-L1 of SEQ ID NO: 167, CDR-L2 of SEQ ID NO: 177, and CDR-L3 of SEQ ID NO: 192, Light chain variable region including CDR-L1 of SEQ ID NO: 168, CDR-L2 of SEQ ID NO: 178, and CDR-L3 of SEQ ID NO: 193, Light chain variable region including CDR-L1 of SEQ ID NO: 169, CDR-L2 of SEQ ID NO: 179, and CDR-L3 of SEQ ID NO: 194, Light chain variable regions including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 183, and Light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 183 A MuSK antibody-based molecule according to claim 12, selected from the group consisting of the following.

15. The MuSK antibody-based molecule according to claim 13 or 14, wherein the light chain variable region of the antibody-based molecule further comprises a heavy chain framework region of human or humanized immunoglobulin.

16. The antibody or its conjugated fragment A heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 153, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 195, A heavy chain variable region including CDR-H1 of SEQ ID NO: 1, CDR-H2 of SEQ ID NO: 17, and CDR-H3 of SEQ ID NO: 33, and a light chain variable region including CDR-L1 of SEQ ID NO: 49, CDR-L2 of SEQ ID NO: 65, and CDR-L3 of SEQ ID NO:

81. A heavy chain variable region including CDR-H1 of SEQ ID NO: 2, CDR-H2 of SEQ ID NO: 18, and one of CDR-H3 from SEQ ID NOs: 34 and 240-247, and a light chain variable region including CDR-L1 of SEQ ID NO: 50, CDR-L2 of SEQ ID NO: 66, and CDR-L3 of SEQ ID NO:

82. A heavy chain variable region including CDR-H1 of SEQ ID NO: 3, CDR-H2 of SEQ ID NO: 19, and CDR-H3 of SEQ ID NO: 35, and a light chain variable region including CDR-L1 of SEQ ID NO: 51, CDR-L2 of SEQ ID NO: 67, and CDR-L3 of SEQ ID NO: 83, A heavy chain variable region including CDR-H1 of SEQ ID NO: 4, CDR-H2 of SEQ ID NO: 20, and CDR-H3 of SEQ ID NO: 36, and a light chain variable region including CDR-L1 of SEQ ID NO: 52, CDR-L2 of SEQ ID NO: 68, and CDR-L3 of SEQ ID NO: 84, A heavy chain variable region including CDR-H1 of SEQ ID NO: 5, CDR-H2 of SEQ ID NO: 21, and CDR-H3 of SEQ ID NO: 37, and a light chain variable region including CDR-L1 of SEQ ID NO: 53, CDR-L2 of SEQ ID NO: 69, and CDR-L3 of SEQ ID NO:

85. A heavy chain variable region including CDR-H1 of SEQ ID NO: 6, CDR-H2 of SEQ ID NO: 22, and CDR-H3 of SEQ ID NO: 38, and a light chain variable region including CDR-L1 of SEQ ID NO: 54, CDR-L2 of SEQ ID NO: 70, and CDR-L3 of SEQ ID NO:

86. A heavy chain variable region including CDR-H1 of SEQ ID NO: 7, CDR-H2 of SEQ ID NO: 23, and CDR-H3 of SEQ ID NO: 39, and a light chain variable region including CDR-L1 of SEQ ID NO: 55, CDR-L2 of SEQ ID NO: 71, and CDR-L3 of SEQ ID NO:

87. A heavy chain variable region including CDR-H1 of SEQ ID NO: 8, CDR-H2 of SEQ ID NO: 24, and CDR-H3 of SEQ ID NO: 40, and a light chain variable region including CDR-L1 of SEQ ID NO: 56, CDR-L2 of SEQ ID NO: 72, and CDR-L3 of SEQ ID NO:

88. A heavy chain variable region including CDR-H1 of SEQ ID NO: 9, CDR-H2 of SEQ ID NO: 25, and CDR-H3 of SEQ ID NO: 41, and a light chain variable region including CDR-L1 of SEQ ID NO: 57, CDR-L2 of SEQ ID NO: 73, and CDR-L3 of SEQ ID NO:

89. A heavy chain variable region including CDR-H1 of SEQ ID NO: 10, CDR-H2 of SEQ ID NO: 26, and CDR-H3 of SEQ ID NO: 42, and a light chain variable region including CDR-L1 of SEQ ID NO: 58, CDR-L2 of SEQ ID NO: 74, and CDR-L3 of SEQ ID NO: 90, A heavy chain variable region including CDR-H1 of SEQ ID NO: 11, CDR-H2 of SEQ ID NO: 27, and CDR-H3 of SEQ ID NO: 43, and a light chain variable region including CDR-L1 of SEQ ID NO: 59, CDR-L2 of SEQ ID NO: 75, and CDR-L3 of SEQ ID NO: 91, A heavy chain variable region including CDR-H1 of SEQ ID NO: 12, CDR-H2 of SEQ ID NO: 28, and CDR-H3 of SEQ ID NO: 44, and a light chain variable region including CDR-L1 of SEQ ID NO: 60, CDR-L2 of SEQ ID NO: 76, and CDR-L3 of SEQ ID NO:

92. A heavy chain variable region including CDR-H1 of SEQ ID NO: 13, CDR-H2 of SEQ ID NO: 29, and CDR-H3 of SEQ ID NO: 45, and a light chain variable region including CDR-L1 of SEQ ID NO: 61, CDR-L2 of SEQ ID NO: 77, and CDR-L3 of SEQ ID NO: 93, A heavy chain variable region including CDR-H1 of SEQ ID NO: 14, CDR-H2 of SEQ ID NO: 30, and CDR-H3 of SEQ ID NO: 46, and a light chain variable region including CDR-L1 of SEQ ID NO: 62, CDR-L2 of SEQ ID NO: 78, and CDR-L3 of SEQ ID NO:

94. A heavy chain variable region including CDR-H1 of SEQ ID NO: 15, CDR-H2 of SEQ ID NO: 31, and CDR-H3 of SEQ ID NO: 47, and a light chain variable region including CDR-L1 of SEQ ID NO: 63, CDR-L2 of SEQ ID NO: 79, and CDR-L3 of SEQ ID NO: 95, A heavy chain variable region including CDR-H1 of SEQ ID NO: 16, CDR-H2 of SEQ ID NO: 32, and CDR-H3 of SEQ ID NO: 48, and a light chain variable region including CDR-L1 of SEQ ID NO: 64, CDR-L2 of SEQ ID NO: 80, and CDR-L3 of SEQ ID NO:

96. A heavy chain variable region including CDR-H1 of SEQ ID NO: 135, CDR-H2 of SEQ ID NO: 137, and any one of CDR-H3 from SEQ ID NOs: 139 and 248-251, and a light chain variable region including CDR-L1 of SEQ ID NO: 141, CDR-L2 of SEQ ID NO: 143, and CDR-L3 of SEQ ID NO: 145, and Heavy chain variable region including CDR-H1 of SEQ ID NO: 136, CDR-H2 of SEQ ID NO: 138, and CDR-H3 of SEQ ID NO: 140, and light chain variable region including CDR-L1 of SEQ ID NO: 142, CDR-L2 of SEQ ID NO: 144, and CDR-L3 of SEQ ID NO: 146 A MuSK antibody-based molecule according to any one of claims 1 to 4, comprising:

17. The antibody or its conjugated fragment A heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 170, and CDR-L3 of SEQ ID NO: 180, A heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 171, and CDR-L3 of SEQ ID NO: 181, A heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region including CDR-L1 of SEQ ID NO: 160, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO:

182. A heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 183, A heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 171, and CDR-L3 of SEQ ID NO: 184, A heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 173, and CDR-L3 of SEQ ID NO: 185, A heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 173, and CDR-L3 of SEQ ID NO: 186, A heavy chain variable region including CDR-H1 of SEQ ID NO: 148, CDR-H2 of SEQ ID NO: 151, and CDR-H3 of SEQ ID NO: 157, and a light chain variable region including CDR-L1 of SEQ ID NO: 161, CDR-L2 of SEQ ID NO: 174, and CDR-L3 of SEQ ID NO: 187, A heavy chain variable region including CDR-H1 of SEQ ID NO: 148, CDR-H2 of SEQ ID NO: 151, and CDR-H3 of SEQ ID NO: 157, and a light chain variable region including CDR-L1 of SEQ ID NO: 162, CDR-L2 of SEQ ID NO: 174, and CDR-L3 of SEQ ID NO: 188, A heavy chain variable region including CDR-H1 of SEQ ID NO: 148, CDR-H2 of SEQ ID NO: 151, and CDR-H3 of SEQ ID NO: 157, and a light chain variable region including CDR-L1 of SEQ ID NO: 163, CDR-L2 of SEQ ID NO: 174, and CDR-L3 of SEQ ID NO:

188. A heavy chain variable region including CDR-H1 of SEQ ID NO: 148, CDR-H2 of SEQ ID NO: 151, and CDR-H3 of SEQ ID NO: 157, and a light chain variable region including CDR-L1 of SEQ ID NO: 164, CDR-L2 of SEQ ID NO: 174, and CDR-L3 of SEQ ID NO: 189, A heavy chain variable region including CDR-H1 of SEQ ID NO: 149, CDR-H2 of SEQ ID NO: 152, and CDR-H3 of SEQ ID NO: 158, and a light chain variable region including CDR-L1 of SEQ ID NO: 165, CDR-L2 of SEQ ID NO: 175, and CDR-L3 of SEQ ID NO: 190, A heavy chain variable region including CDR-H1 of SEQ ID NO: 149, CDR-H2 of SEQ ID NO: 152, and CDR-H3 of SEQ ID NO: 158, and a light chain variable region including CDR-L1 of SEQ ID NO: 166, CDR-L2 of SEQ ID NO: 176, and CDR-L3 of SEQ ID NO: 191, A heavy chain variable region including CDR-H1 of SEQ ID NO: 149, CDR-H2 of SEQ ID NO: 152, and CDR-H3 of SEQ ID NO: 158, and a light chain variable region including CDR-L1 of SEQ ID NO: 167, CDR-L2 of SEQ ID NO: 177, and CDR-L3 of SEQ ID NO: 192, A heavy chain variable region including CDR-H1 of SEQ ID NO: 149, CDR-H2 of SEQ ID NO: 152, and CDR-H3 of SEQ ID NO: 158, and a light chain variable region including CDR-L1 of SEQ ID NO: 168, CDR-L2 of SEQ ID NO: 178, and CDR-L3 of SEQ ID NO: 193, A heavy chain variable region including CDR-H1 of SEQ ID NO: 149, CDR-H2 of SEQ ID NO: 152, and CDR-H3 of SEQ ID NO: 158, and a light chain variable region including CDR-L1 of SEQ ID NO: 169, CDR-L2 of SEQ ID NO: 179, and CDR-L3 of SEQ ID NO: 194, A heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 153, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 183, A heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 154, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 183, A heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 155, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 183, Heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 154, and CDR-H3 of SEQ ID NO: 156, and light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 195, and Heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 155, and CDR-H3 of SEQ ID NO: 156, and light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 195 A MuSK antibody-based molecule according to any one of claims 1 to 4, comprising:

18. The antibody-based molecule A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 234, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO:

235. A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 228, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 229, A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 230, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 231, A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 232, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO:

233. A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 236, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 237, and A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 238, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO:

239. A MuSK antibody-based molecule according to any one of claims 1 to 4, comprising:

19. The antibody-based molecule A heavy chain variable region containing an amino acid sequence that is at least 80% identical to sequence number 97, and a light chain variable region containing an amino acid sequence that is at least 80% identical to sequence number 98. A heavy chain variable region containing an amino acid sequence that is at least 80% identical to one of sequence numbers 99 and 252-259, and a light chain variable region containing an amino acid sequence that is at least 80% identical to sequence number 100. A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 101, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO:

102. A heavy chain variable region containing an amino acid sequence that is at least 80% identical to sequence number 103, and a light chain variable region containing an amino acid sequence that is at least 80% identical to sequence number 104, A heavy chain variable region containing an amino acid sequence that is at least 80% identical to sequence number 105, and a light chain variable region containing an amino acid sequence that is at least 80% identical to sequence number 106. A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 107, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO:

108. A heavy chain variable region containing an amino acid sequence that is at least 80% identical to sequence number 109, and a light chain variable region containing an amino acid sequence that is at least 80% identical to sequence number 110, A heavy chain variable region containing an amino acid sequence that is at least 80% identical to sequence number 111, and a light chain variable region containing an amino acid sequence that is at least 80% identical to sequence number 112. A heavy chain variable region containing an amino acid sequence that is at least 80% identical to sequence number 113, and a light chain variable region containing an amino acid sequence that is at least 80% identical to sequence number 114. A heavy chain variable region containing an amino acid sequence that is at least 80% identical to sequence number 115, and a light chain variable region containing an amino acid sequence that is at least 80% identical to sequence number 116. A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 117, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO:

118. A heavy chain variable region containing an amino acid sequence that is at least 80% identical to sequence number 119, and a light chain variable region containing an amino acid sequence that is at least 80% identical to sequence number 120. A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 121, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO:

122. A heavy chain variable region containing an amino acid sequence that is at least 80% identical to sequence number 123, and a light chain variable region containing an amino acid sequence that is at least 80% identical to sequence number 124. A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 125, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO:

126. A heavy chain variable region containing an amino acid sequence that is at least 80% identical to sequence number 127, and a light chain variable region containing an amino acid sequence that is at least 80% identical to sequence number 128. A heavy chain variable region containing an amino acid sequence that is at least 80% identical to any one of SEQ ID NOs. 131 and 260-263, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NOs. 132, and A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 133, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO:

134. A MuSK antibody-based molecule according to any one of claims 1 to 4, comprising:

20. The antibody-based molecule A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 196, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 197, A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 198, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO:

199. A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 200, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 201, A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 202, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 203, A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 204, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO:

205. A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 206, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 207, A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 208, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 209, A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 210, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 211, A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 212, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO:

213. A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 214, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO:

215. A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 216, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 217, A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 218, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO:

219. A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 220, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 221, A heavy chain variable region containing an amino acid sequence that is at least 80% identical to sequence number 222, and a light chain variable region containing an amino acid sequence that is at least 80% identical to sequence number 223, A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 224, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 225, and A heavy chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 226, and a light chain variable region containing an amino acid sequence that is at least 80% identical to SEQ ID NO:

227. A MuSK antibody-based molecule according to any one of claims 1 to 4, comprising:

21. The MuSK antibody-based molecule according to any one of claims 1 to 20, wherein the antibody-based molecule is a chimeric antibody or an epitope-binding fragment thereof.

22. The MuSK antibody-based molecule according to any one of claims 1 to 21, wherein the antibody-based molecule is a humanized antibody or an epitope-binding fragment thereof.

23. The MuSK antibody-based molecule according to any one of claims 1 to 22, wherein the antibody-based molecule is a monoclonal antibody or an epitope-conjugated fragment thereof.

24. The MuSK antibody-based molecule according to any one of claims 1 to 23, wherein the antibody-based molecule is a full-length antibody, an epitope-binding fragment of an antibody, or an antibody derivative.

25. The MuSK antibody-based molecule according to claim 24, wherein the antibody-based molecule is an epitope-binding fragment selected from the F(ab) fragment, the F(ab') fragment, and the F(ab')2 fragment.

26. The MuSK antibody-based molecule according to claim 24, wherein the antibody-based molecule is an antibody derivative selected from the group consisting of scFv, minibody, diabody, triabody, and tetrabody.

27. An isolated polynucleotide encoding a MuSK antibody-based molecule according to any one of claims 1 to 26.

28. A vector comprising an isolated polynucleotide as described in claim 27.

29. A host cell comprising the vector according to claim 28.

30. A MuSK antibody-based molecule according to any one of claims 1 to 26, a polynucleotide according to claim 27, or a vector according to claim 28, Pharmacologically acceptable carriers and A pharmaceutical composition containing the following:

31. A method for increasing muscle-specific tyrosine-protein kinase (MuSK) signaling in a subject requiring it, wherein the method is A method comprising the step of administering the pharmaceutical composition according to claim 30 to a subject, wherein the composition is administered in an amount effective to increase MuSK signaling in the subject compared to MuSK signaling in the subject before administration.

32. The method according to claim 31, wherein the subject has neuromuscular disorders.

33. The method according to claim 32, wherein the neuromuscular disorder is selected from amyotrophic lateral sclerosis (ALS), myasthenia gravis (MG), congenital myasthenia gravis, MuSK-MG, spinal muscular atrophy (SMA), spinal and bulbar muscular atrophy (SBMA), Charcot-Marie-Tooth disease (CMT), distal motor neuropathy (dHMN), Duchenne muscular dystrophy (DMD), limb-girdle muscular dystrophy (LGMD), congenital muscular dystrophy (CMD), sarcopenia (SP), and Emery-Dreyfus muscular dystrophy.

34. The method according to claim 33, wherein the neuromuscular disorder is congenital myasthenia gravis.

35. The method according to claim 34, wherein the congenital myasthenia gravis is DOK7-mediated congenital myasthenia gravis.

36. The pharmaceutical composition comprises a MuSK antibody-based molecule, and the antibody-based molecule is A heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 153, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 195, A heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 153, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 183, A heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 154, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 183, A heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 154, and CDR-H3 of SEQ ID NO: 156, and a light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 195, or Heavy chain variable region including CDR-H1 of SEQ ID NO: 147, CDR-H2 of SEQ ID NO: 150, and CDR-H3 of SEQ ID NO: 156, and light chain variable region including CDR-L1 of SEQ ID NO: 159, CDR-L2 of SEQ ID NO: 172, and CDR-L3 of SEQ ID NO: 183 The method according to any one of claims 31 to 35, including the method described in any one of claims 31 to 35.

37. A method for treating congenital myasthenia gravis in a subject, wherein the method is A method comprising the step of administering a muscle-specific tyrosine protein kinase (MuSK) agonist in an amount effective to enhance MuSK phosphorylation to a subject having congenital myasthenia gravis, thereby treating the congenital myasthenia gravis in the subject.

38. The method according to claim 37, wherein the MuSK agonist is a MuSK agonist antibody.

39. The method according to claim 38, wherein the MuSK agonist antibody binds to the MuSK Frizzled-like domain sequence of SEQ ID NO:

130.

40. The method according to claim 37, wherein the congenital myasthenia gravis is DOK7-mediated congenital myasthenia gravis.

41. A method for treating congenital myasthenia gravis in a subject, wherein the method is A method comprising the step of administering the pharmaceutical composition according to claim 30 to a subject having congenital myasthenia gravis, thereby treating the congenital myasthenia gravis in the subject.

Citation Information

Patent Citations

  • Recombinant altered antibodies and methods of making altered antibodies

    US5225539A

  • Humanized immunoglobulins

    US5530101A

  • Humanized immunoglobulins

    US5585089A

  • Humanised antibodies

    US5859205A

  • Method for making humanized antibodies

    US6407213B1