Factors for direct cross-differentiation of motor neurons

The Gsta4 protein effectively addresses the inefficiencies of conventional direct cross-differentiation methods by enhancing the conversion of somatic cells into motor neurons, offering improved efficiency and therapeutic potential for neurological disorders.

JP2026086824APending Publication Date: 2026-05-26STANDUP THERAPEUTICS INC +2
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2026025777
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-12-29
Filing Date
2026-02-19
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

Conventional direct cross-differentiation methods for converting somatic cells into motor neurons suffer from low efficiency and ethical concerns associated with the use of stem cells, particularly induced pluripotent stem cells, which pose challenges such as teratoma formation and low differentiation efficiency.

Method used

A novel differentiation factor, Gsta4 protein or its nucleic acid, is used to directly convert somatic cells into motor neurons, optionally combined with proteins like Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1, utilizing viral or non-viral vectors for efficient conversion without generating induced pluripotent stem cells.

Benefits of technology

Gsta4 enhances the direct cross-differentiation efficiency into motor neurons, potentially increasing it by 2 to 10 times alone or in combination with conventional factors, and offers therapeutic benefits for neurological diseases by promoting neuronal function and reducing inflammatory activity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026086824000002
    Figure 2026086824000002
  • Figure 2026086824000003
    Figure 2026086824000003
  • Figure 2026086824000004
    Figure 2026086824000004
Patent Text Reader

Abstract

This application provides a novel differentiation factor for direct cross-differentiation from somatic cells to motor neurons, a composition containing the differentiation factor, a method for direct cross-differentiation using the composition, and uses for the novel differentiation factor. [Solution] A composition for direct cross-differentiation from somatic cells to induced motor neurons, the composition comprising (A) the Gsta4 protein or nucleic acid coding therefor; and (B) one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, ISL1, Lhx3, Ngn2 and NeuroD1 or nucleic acid coding therefor; and further comprising a viral capsid for transmitting (A) or (B).
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This application relates to a novel differentiation factor for direct cross-differentiation of motor neurons.

[0002] This application relates to a composition containing the novel differentiation factor described above.

[0003] This application relates to a direct cross-differentiation method using the above-mentioned composition.

[0004] This application relates to the diverse applications of the novel differentiation factor described above. [Background technology]

[0005] Stem cells are widely used in regenerative medicine. Stem cells are pluripotent cells that can differentiate into all the cells that make up the human body. Theoretically, they can differentiate into all types of functional cells and can proliferate indefinitely. Stem cells are classified according to their origin into germinal stem cells, adult stem cells, garden stem cells, and reverse-differentiated stem cells (or induced pluripotent stem cells).

[0006] However, stem cells present ethical challenges, stability issues, and low differentiation efficiency depending on the type. Furthermore, reverse-differentiated stem cells have the potential for teratoma formation and also suffer from low differentiation efficiency.

[0007] Because stem cells present these diverse challenges, the field of regenerative medicine demands new technologies.

[0008] One technique that has recently been gaining attention is direct cross-differentiation. Direct cross-differentiation differs in that it directly induces conversion to the target cell without going through the process of reprogramming induced pluripotent stem cells and then redifferentiating them into the target cell.

[0009] In other words, it is a method for inducing conversion between mature (differentiated) cells of completely different cell types. However, conventional direct cross-differentiation methods have limitations in terms of efficiency, and there is a need for new methods that can overcome these limitations. [Overview of the Initiative] [Problems that the invention aims to solve]

[0010] One of the objectives of this application is to provide a novel differentiation factor for direct crossover of motor neurons. In particular, the novel differentiation factor relates to the Gsta4 (Glutathione S-transferase A4) protein or the nucleic acid coding therefor.

[0011] Another object of this application is to provide a composition containing the novel differentiation factor described above.

[0012] Another object of this application is to provide a direct cross-differentiation method using the above composition.

[0013] Another objective of this application is to provide diverse applications for the aforementioned novel differentiation factors. [Means for solving the problem]

[0014] This application aims to solve the aforementioned problems, This application provides, as one specific example, a composition for direct cross-differentiation of somatic cells into motor neurons, comprising the Gsta4 (Glutathione S-Transferase Alpha 4) protein or a nucleic acid coding therefor.

[0015] The composition may further comprise ii) one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or nucleic acids coding thereto.

[0016] The aforementioned composition is characterized in that Hb9 and Lhx3 are selected from ii).

[0017] In this case, the Ascl1 protein may have sequence number 17, and the nucleic acid coding the Ascl1 protein may have sequence number 18; The Brn2 protein may have sequence number 19, and the nucleic acid coding the Brn2 protein may have sequence number 20; The Myt1L protein may have sequence number 21, and the nucleic acid coding the Myt1L protein may have sequence number 22; The Hb9 protein may have sequence number 13, and the nucleic acid coding the Hb9 protein may have sequence number 14; The Isl1 protein may have sequence number 23, and the nucleic acid coding the Isl1 protein may have sequence number 24; The Lhx3 protein may have sequence number 15, and the nucleic acid coding the Lhx3 protein may have sequence number 16; The Ngn2 protein may have sequence number 25, and the nucleic acid coding the Ngn2 protein may have sequence number 26; The NeuroD1 protein may have sequence number 27, and the nucleic acid coding the NeuroD1 protein may have sequence number 28.

[0018] As another specific example of this application, as a vector for the expression of differentiation factors for direct cross-differentiation, the direct cross-differentiation is converted from somatic cells into motor neurons, and the vector is i) nucleic acid coding the Gsta4 protein; and ii) promoter; In this case, a vector can be provided characterized in that i) and ii) are operably connected.

[0019] The vector can further include: iii) a nucleic acid encoding one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0020] As a vector for the expression of a differentiation factor for direct transdifferentiation, the direct transdifferentiation is converted into motor neurons induced from somatic cells, and the vector can include at least a first vector and a second vector. The first vector includes i) a nucleic acid encoding the Gsta4 protein; and ii) a promoter. At this time, i) and ii) are operably linked. The second vector includes iii) a nucleic acid encoding one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; and iv) a promoter. At this time, iii) and iv) are operably linked. ii) and iv) are the same promoter or different promoters. A vector can be provided, wherein iii) can be included in one vector or in two or more vectors.

[0021] The aforementioned vectors may be viral or nonviral vectors, and viral vectors may be one or more selected from retroviruses, lentiviruses, adenoviruses, adeno-associated viruses (AAVs), vexinia viruses, poxviruses, HIV (Human Immunodeficiency virus), MLV (Murineleukemia virus), ASLV (Aviansarcoma / leukosis), SNV (Spleennecirosis virus), RSV (Rous sarcoma virus), MMTV (Mouse mammary tumor virus), herpes simplex virus, epizomal, and herpes simplex virus.

[0022] Another specific example of this application is a method for direct cross-differentiation, in which somatic cells are converted into motor neurons, the method comprising introducing a composition comprising the Gsta4 protein or nucleic acid coding thereon into somatic cells, wherein the method does not generate induced pluripotent stem cells (iPSCs).

[0023] The somatic cells may be one or more selected from fibroblasts, epithelial cells, endothelial cells, muscle cells, nerve cells, hair cells, hair root cells, hair follicle cells, oral epithelial cells, somatic cells extracted from urine, gastric mucosal cells, goblet cells, gastrin cells (G cells), B cells, pericytes, astrocytes, blood cells, and rare dendritic progenitor cells.

[0024] With the aforementioned introduction, somatic cells can differentiate into induced motor neurons within one to seven weeks.

[0025] Another specific example of this application is a pharmaceutical composition for the prevention or treatment of neurological diseases, comprising the Gsta4 protein for direct cross-differentiation from somatic cells into motor neurons.

[0026] Furthermore, pharmaceutical compositions for the prevention or treatment of neurological diseases can be provided, comprising somatic cells into which the Gsta4 protein or a nucleic acid coding therefor is introduced, for direct cross-differentiation from somatic cells into motor neurons.

[0027] The aforementioned pharmaceutical composition may further comprise nucleic acids coding one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0028] A pharmaceutical composition for the prevention or treatment of neurological diseases can be provided, comprising motor neurons in which differentiation factors for direct cross-differentiation into motor neurons induced from somatic cells are overexpressed. In this case, the motor neurons may overexpress one or more differentiation factors selected from Gsta4, Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1).

[0029] Another specific example of this application is a method for preventing or treating neurological diseases, i) Gsta4 protein; or ii) Gsta4 protein; and one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; administered to the target; A method can be provided that includes the above, and is characterized in that the direct cross-differentiation does not generate induced pluripotent stem cells (iPSCs).

[0030] A method can be provided for preventing or treating a neurological disease, comprising administering a composition containing the Gsta4 protein or a nucleic acid coding therefor to somatic cells into which the protein has been introduced.

[0031] A method can be provided for preventing or treating a neurological disease, comprising introducing a composition containing the Gsta4 protein or a nucleic acid coding therein into somatic cells and administering the resulting mixture to motor neurons.

[0032] The aforementioned neurological disorders may be one or more selected from spinal cord injury, Parkinson's disease, stroke, amyotrophic spinal lateral sclerosis, motor nerve injury, traumatic peripheral nerve injury, ischemic brain injury, neonatal hypoxic-ischemic brain injury, cerebral palsy, epilepsy, intractable diseases, Alzheimer's disease, congenital metabolic neurological disorders, traumatic brain injury, motor neuron injury, or diseases induced thereby. [Effects of the Invention]

[0033] According to this application, the following effects occur.

[0034] Firstly, this application provides a novel differentiation factor for direct cross-differentiation of motor neurons. This novel differentiation factor enables effective differentiation of somatic cells into motor neurons and may be useful in the treatment of neurological diseases. [Brief explanation of the drawing]

[0035] [Figure 1]Figure 1 shows schematic diagrams of the AAV vectors used in this embodiment. (a) is a schematic diagram of the AAV vector including Gsta4; (b) is a schematic diagram of the AAV vector including Ascl1, Isl1, Lhx3 and Ngn2 (also called Neurog2); (c) is a schematic diagram of the AAV vector including Brn2, Hb9 (also called Mnx1) and NeuroD1; (d) is a schematic diagram of the AAV vector including Gsta4 and Myt1l; and (e) is a schematic diagram of the AAV vector including Gsta4, Hb9 and Lhx3. [Figure 2] Figure 2 shows the results of introducing the novel differentiation factor Gsta4 into mouse-derived fibroblasts and confirming the degree of direct cross-differentiation into motor neurons by examining the expression of neuronal markers (ChaT, Map2). (a) shows the results of immunofluorescence staining, and (b) shows the results of (a) quantified. [Figure 3] Figure 3 shows the results of introducing conventional differentiation factors (Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, NeuroD1) into human-derived fibroblasts and confirming the degree of direct cross-differentiation into motor neurons by changes in the expression of neuronal markers (Synapsin, Map2, Hb9). [Figure 4] Figure 4 shows the results of introducing a novel differentiation factor Gsta4 and conventional differentiation factors (Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, NeuroD1) into mouse-derived fibroblasts, and confirming the degree of direct cross-differentiation into motor neurons by changes in the expression of neuronal markers (Synapsin, Map2, Hb9). [Figure 5] Figure 5 shows the results of introducing differentiation factors into mouse-derived fibroblasts and confirming the degree of direct cross-differentiation into motor neurons by immunofluorescence staining, which indicates the expression of neuronal markers (ChaT, Map2). The differentiation factors used were Gsta4 alone and a combination of Gsta4 and conventional differentiation factors. [Figure 6] Figure 6 is a graph that quantifies the number of immunofluorescently stained cells in Figure 5. [Figure 7]Figure 7 shows the results of introducing differentiation factors into mouse-derived fibroblasts and confirming the degree of direct cross-differentiation into motor neurons by changes in the expression of neuronal markers (Synapsin, Map2). The differentiation factors used were conventional differentiation factors alone, and combinations of Gsta4 and conventional differentiation factors. [Figure 8] Figure 8 shows the results of introducing differentiation factors into mouse-derived fibroblasts and confirming the degree of direct cross-differentiation into motor neurons by immunofluorescence staining, which is used to confirm the expression of neuronal markers (ChaT, Map2). The differentiation factors used were a combination of Mnx1 and Lhx3, and a combination of Gsta4, Mnx1, and Lhx3. (a) shows the results of immunofluorescence staining, and (b) shows the results of (a) quantified. [Figure 9] Figure 9 shows the results of introducing differentiation factors into mouse-derived fibroblasts and confirming the degree of direct cross-differentiation into motor neurons by examining the expression of neuronal markers (Synapsin, Map2, Hb9). The differentiation factors used were Gsta4 alone; Mnx1 and Lhx3 combination; and Gsta4, Mnx1, and Lhx3 combination. [Figure 10] Figure 10 shows the results of introducing differentiation factors into mouse-derived fibroblasts and confirming the degree of direct differentiation of motor neurons by examining the expression of neuronal markers (Synapsin, Map2). The differentiation factors used were a combination of Ascl1, Brn2, and Myt1L; and a combination of Gsta4, Ascl1, Brn2, and Myt1L. [Figure 11] Figure 11 shows the results of introducing differentiation factors into human-derived fibroblasts and confirming the degree of direct cross-differentiation into motor neurons by changes in the expression of neuronal markers (Synapsin, Map2, Hb9). The differentiation factors used were combinations of Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; and combinations of Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, NeuroD1, and Gsta4. [Figure 12]Figure 12 shows the results of introducing differentiation factors into mouse character cells and confirming the degree of direct cross-differentiation into motor neurons by immunofluorescence staining, which identified neuronal markers (vChaT, Map2). The differentiation factors used were combinations of Hb9, Isl1, Lhx3, and Ascl1; combinations of Hb9, Isl1, Lhx3, Ascl1, Brn2, Myt1L, and Ngn2 (listed under known factors); and combinations of known factors and Gsta4. [Figure 13] Figure 13 shows the results of introducing differentiation factors into human fibroblasts and confirming the degree of direct cross-differentiation into motor neurons by immunofluorescence staining, which indicates the expression of neuronal markers (NEUN, Map2). [Figure 14] Figure 14 shows the overall experimental design for administering differentiation factors (indicated as "injection") to L5, the spinal cord injury site in a spinal cord injury (SCI) mouse model, which is a model of lower body paralysis due to spinal cord injury, in order to perform morphological changes, physiological analyses, and behavioral analyses. [Figure 15] Figure 15 shows the results of crystal violet staining to confirm morphological changes in the spinal cord injury site after administering differentiation factors to the SCI mouse model. In this case, "Mock" refers to the group administered AAV (Adeno-associated virus); "Control" refers to the group administered AAV into which conventional differentiation factors (a combination of Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1) were introduced; and "+Gsta4" refers to the group administered AAV into which the aforementioned conventional differentiation factors and Gsta4 were introduced. [Figure 16] Figure 16 shows the results of immunofluorescence staining of motor neuron markers (ChaT, Map2) after administering differentiation factors to an SCI mouse model. In this case, "Mock" refers to the group administered AAV (Adeno-associated virus); "Control" refers to the group administered AAV containing conventional differentiation factors (a combination of Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1); and "+Gsta4" refers to the group administered AAV containing the aforementioned conventional differentiation factors and Gsta4. [Figure 17] Figure 17 shows the results of examining the white dotted box area in Figure 16. [Figure 18] Figure 18 shows the results of the immunofluorescence staining in Figure 16, quantified numerically. [Figure 19] Figure 19 shows the results of analyzing the electrophysiological changes in motor neurons after administering differentiation factors to SCI mouse models. (a) shows nerve cells subjected to patch clamping; (b) shows the results of measuring action potentials; and (c) shows the results of measuring signals from presynaptic nerve cells. In this case, Sham refers to the normal group with no spinal cord damage; mock refers to the group administered AAV to the SCI mouse model; control refers to the group administered AAV containing conventional differentiation factors (a combination of Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1); and +Gsta4 refers to the group administered AAV containing the aforementioned conventional differentiation factors and Gsta4. [Figure 20] Figure 20 shows the results of analyzing the therapeutic effect of administering differentiation factors to SCI mouse models on lower body paralysis at the spinal cord injury site (L5) using the BBB score (Basso Beatie, and Bresnahan score). (a) is a graph quantifying the observation results in (b). In this case, Sham refers to the normal group with no spinal cord injury; mock refers to the group administered AAV to the SCI mouse model; -Gsta4 refers to the group administered with conventional differentiation factors (a combination of Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1); +Gsta4 refers to the group administered with the aforementioned conventional differentiation factors and Gsta4. [Figure 21] Figure 21 shows the results of behavioral analysis to confirm the therapeutic effect of administering differentiation factors to an SCI mouse model on lower body paralysis. (a) is the Forced swimming test; (b) is Self urination; (c) is a numerical representation of (a) and (b); and (d) is the Foot printing test; the results are shown. Modes for carrying out the invention

[0036] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as those commonly understood by those skilled in the art to which this application pertains. Similar or identical methods and substances to those described in this application may be used in the execution or testing of this application, but adapted methods and substances are described below. All publications, patent applications, articles and other references mentioned in this application are included in their entirety for reference. Furthermore, substances, methods and practices are merely illustrative and not intended to be limiting.

[0037] Term definition ● Direct reprogramming / direct cell-conversion / transdifferentiation

[0038] The term "direct reprogramming / direct conversion / transdifferentiation" as used in this application refers to the process of introducing differentiation factors into ultimately differentiated cells to convert them into target cells. In particular, direct cross-differentiation induces conversion between mature cells of completely different cell types. That is, it is the conversion of somatic cells into target cells without going through the pluripotent state. The terms direct cross-differentiation, direct differentiation, and direct cross-differentiation can be used interchangeably.

[0039] ● Direct cross-differentiation factor (Direct cell-Conversion factor, converting factor)

[0040] In this application, the term "direct cell-conversion factor" refers to the factors involved in the aforementioned direct cell-conversion. These differentiation factors may include genes, compounds, proteins, nucleic acids, etc. The term "direct cell-conversion factor" can be used interchangeably with "converting factor."

[0041] ● Induced motor neurons (iMNs)

[0042] In this application, the term "induced motor neuron" refers to a motor neuron induced by direct cross-differentiation. The induced motor neuron refers to a motor neuron artificially produced by directly cross-differentiating somatic cells, etc., using the novel differentiation factor of this application. The term "induced motor neuron" can be used interchangeably with motor neuron and iMN.

[0043] ● Treatment As used in this application, the term "treatment" means alleviating or inhibiting the progression of diseases, illnesses, symptoms, etc. The aforementioned treatment refers to all actions by which symptoms are improved or favorably altered by the compositions of the present invention, direct cross-differentiation factors, etc. Substances exhibiting such therapeutic effects are commonly referred to as "treatment agents" or "pharmaceutical compositions." In particular, gene therapy agents refer to genetic materials that transmit genes into the human body in various forms and methods for the purpose of treating diseases, etc. Cell therapy agents refer to cases where therapeutic substances are transmitted into the human body in the form of cells for the purpose of treating diseases, etc.

[0044] ● About As used in this application, the term “drug” means a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight, or length that varies by approximately 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1% with respect to the reference quantity, level, value, number, frequency, percentage, size, amount, or length.

[0045] 1. Novel factor for direct cross-differentiation: Gsta4 (glutathione S-transferase alpha 4)

[0046] Characteristics of direct crossover

[0047] Direct cross-differentiation is the process of transforming fully differentiated cells into cells of another lineage without the need for reprogramming (re-differentiation) into stem cells. This process effectively converts fully differentiated cells into specific cells of another lineage without going through the stem cell stage.

[0048] To date, two methodologies have been proposed for direct cross-differentiation: SDR (Somatic cell-specific factor-mediated Direct Reprogramming) and PDR (Pluripotent cell-specific factor-mediated Direct Reprogramming). SDR induces direct cross-differentiation into the target cell type by overexpressing factors that are highly expressed in the target cell type in the target cells. PDR uses factors OCT4, SOX2, KLF4, and C-Myc, which are used in the reprogramming of induced pluripotent stem cells, to dedifferentiate them into an incomplete intermediate cell type (a cell similar to a stem cell), and then directly cross-differentiates them into the target cell type through the creation of a culture medium. In the case of PDR, even when directly cross-differentiating into various cell types, four reprogramming factors (OCT4, SOX2, KLF4, and C-Myc) are commonly used to overexpress them in the initial stages.

[0049] Publicly announced known direct cell-conversion factors

[0050] Known differentiation factors used for direct cross-differentiation include Ascl1 (Achaete-scute homolog 1), Nurr1 (Nuclear Receptor Subfamily 4 Group A Member 2), Lmx1a (LIM Homeobox Transcription Factor 1 Alpha), Foxa2 (Forkhead box protein A2), Brn2 (POU Class 3 Homeobox 2), Sox2 (sex determining region Y-box 2), Foxg1 (Forkhead Box G1), Lhx3 (LIM homeobox 3), HB9 (Homeobox HB9), IsL1 (ISL LIM homeobox 1), Ngn2 (neurogenin 2), NeuroD1 (Neuronal Differentiation 1), Myt1l (Myelin Transcription Factor 1 Like), and NeuroD2 (Neuronal Differentiation 2), miR-9 (microRNA-9), miR-124 (microRNA-124), Zic1 (Zic Family Member 1), Gata5 (GATA Binding Protein 5), Hnf4α (Hepatocyte nuclear factor 4 alpha), HNF1α (hepatocyte nuclear factor 1 alpha), Foxa1 (Forkhead Box A1), Foxa3 (Forkhead Box A3), Tbx5 (T-Box Transcription Factor 5), Mef2c (Myocyte Enhancer Factor 2C), Oct4 (Octamer-binding transcription factor 4), PRDM16 (PR / SET Domain 16), MyoD (myoblast determination protein 1), Klf4 (Kruppel-like factor 4), and c-Myc (cellular Myc) are known (Mol Cell. 2012 Sep 28;47(6):827-838.).

[0051] In particular, known differentiation factors used for direct cross-differentiation into motor neurons include Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0052] Problems with conventional direct cross-differentiation factors The aforementioned direct cross-differentiation has the advantage of enabling the conversion of differentiated cells with completely different cell types without going through the induced pluripotent stem cell stage. However, the differentiation factors known to date have had the problem of low or almost no efficiency in cell conversion when used alone or in combination.

[0053] Overview of Gsta4, a novel factor for direct cross-differentiation This application discloses Gsta4 (glutathione S-transferase alpha 4), a novel factor for direct cross-differentiation.

[0054] The aforementioned Gsta4 can effectively and directly cross-differentiate somatic cells into motor neurons even when used alone. Furthermore, when Gsta4 is used in conjunction with conventional direct cross-differentiation factors, the differentiation efficiency into motor neurons can be further enhanced compared to when conventional differentiation factors are used alone.

[0055] Below, we will explain Gsta4, a novel differentiation factor, in more detail.

[0056] Gsta4's previously known features Gsta4 is an enzyme belonging to the glutathione S-transferase (GST) group. It is known that eight types of GSTs—alpha, kappa, mu, omega, pi, sigma, theta, and zeta—are produced in the cytoplasm of mammals. Of these, alpha is located on chromosome 6 and includes GSTA1, GSTA2, GSTA3, GSTA4, GSTA5, etc.

[0057] Gsta4, also known as GTA4, is known to be involved in cellular defense mechanisms, toxin degradation, and anti-cancer effects. It is also known to play a significant role in reducing cellular stress by decreasing reactive oxygen species. Furthermore, the absence of Gsta4 is known to be negatively associated with diseases such as Parkinson's disease and Alzheimer's disease. However, its function as a direct cross-differentiation factor between cells has not been reported.

[0058] New features in Gsta4 This application discloses a novel function of Gsta4 that enables direct cross-differentiation. Specifically, it discloses Gsta4 as a novel differentiation factor for direct cross-differentiation.

[0059] In particular, the fact that Gsta4 in this application has the function of converting somatic cells into motor neurons (direct cross-differentiation) has never been reported before and was discovered through experimental confirmation by the inventors. The term Gsta4 used below should be understood as referring to its novel function as a direct cross-differentiation factor. Also, when Gsta4 is written below for convenience, it should be interpreted as referring to the Gsta4 protein or the nucleic acid that codes for it, depending on the context.

[0060] Morphology of Gsta4 (1) - Gsta4 protein In one manner, this application discloses a Gsta4 protein for direct cross-differentiation.

[0061] The Gsta4 protein can be wild-type or mutant. The mutant may have one or more deletions, substitutions, or insertions in the wild-type amino acid sequence. The Gsta4 mutant may also have a sequence identity with the wild-type amino acid sequence. In this case, the sequence identity may be 50% to 99%. Preferably, the Gsta4 protein can have 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% or more of sequence identity with the wild-type amino acid sequence.

[0062] As an optional embodiment, the Gsta4 protein for direct crossover in this application may be the amino acid sequence shown in SEQ ID NO: 1.

[0063] Sequence ID 1: maarpklhyp ngrgrmesvr wvlaaagvef deefletkeq lyklqdgnhl lfqqvpmvei dgmklvqtrs ilhyiadkhn lfgknlkert lidmyvegtl dllellimhp flkpddqqke vvnmaqkaii ryfpvfekil rghgqsflvg nqlsladvil lqtilaleek ipnilsafpf lqeytvklsn iptikrflep gskkkpppde iyvrtvynif rp

[0064] In another example, the Gsta4 protein may be a sequence that has 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 1.

[0065] Gsta4 morphology (2) - Nucleic acids coding the Gsta4 protein

[0066] As another example, this application discloses a nucleic acid coding for the Gsta4 protein for direct cross-differentiation. The nucleic acid may be DNA or RNA.

[0067] The nucleic acid coding the Gsta4 protein may be wild-type or a mutant. The mutant may have one or more wild-type nucleic acid sequences that have been compounded, substituted, or inserted. The Gsta4 mutant may also have a sequence identity with the nucleic acid sequence coding the wild-type protein. In this case, the sequence identity may be 50% to 99%. Preferably, the nucleic acid coding the Gsta4 protein may have a sequence that has 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more sequence identity with the wild-type nucleic acid sequence.

[0068] The nucleic acid sequence coding the Gsta4 protein could be a known sequence.

[0069] The nucleic acid sequence may include intron and exon sequences.

[0070] The nucleic acid sequence may contain only exon sequences.

[0071] For example, the nucleic acid sequence coding the Gsta4 protein may include a CDS (Coding Sequence) sequence from which introns have been removed.

[0072] The nucleic acid sequence may be a DNA sequence coding for the Gsta4 protein and a corresponding mRNA sequence (which is the result of the transcription).

[0073] The nucleic acid sequence may be an mRNA sequence that corresponds to the exon sequence of the Gsta4 gene (the result of transcription).

[0074] In one specific example, the nucleic acid coding the Gsta4 protein may contain SEQ ID NO: 2, which is the full DNA sequence of the Gsta4 gene.

[0075] Array number 2: gctttgtgcg gctccaggcc tccgagtgga ctccagaaag cctgaaaagc tatcatggca gcaaggccca agctccacta tcccaacgga agaggccgga tggagtccgt gagatgggtt ttagctgccg ccggagtcga gtttgatgaa gaatttctgg aaacaaaaga acagttgtac aagttgcagg atggtaacca cctgctgttc caacaagtgc ccatggttga aattgacggg atgaagttgg tacagacccg aagcattctc cactacatag cagacaagca caatctcttt ggcaagaacc tcaaggagag aaccctgatt gacatgtacg tggaggggac actggatctg ctggaactgc ttatcatgca tcctttctta aaaccagatg atcagcaaaa ggaagtggtt aacatggccc agaaggctat aattagatac tttcctgtgt ttgaaaagat tttaaggggt cacggacaaa gctttcttgt tggtaatcag ctgagccttg cagatgtgat tttactccaa accattttag ctctagaaga gaaaattcct aatatcctgt ctgcatttcc tttcctccag gaatacacag tgaaactaag taatatccct acaattaaga gattccttga acctggcagc aagaagaagc ctccccctga tgaaatttat gtgagaaccg tctacaacat ctttaggcca taaaacaaca catccatgtg tgagtgacag tgtgttccta gagatggtat tgtctacagt catgtcttaa tggatcccag ctctgtcatg gtgctatcta tgtattaagt tgggtcctaa gttgggtctt ttgtgtcaac gagatcatct cttctagaaa tatcaacctt ttttgtccagtaaataattg ttaggggatc tttattggaa aacttttttg gagaggctgg tatttaagtt agatctgatt gggctactca tgtcctgtag ccagttcatc ctcataataa gaatgggcag gatctcttgt tctctcctga gtgtctttct actctcctga gcgtctttct gctctcctta tcctgttctc ttatccttat cccctccagt ctctgcctaa tttttagtgt ttaataacaa ccgaatgtct agtaaatgac tctcctctga gctgtaataa ataaaatggt agtaatgaat gcaatcagta ttagccaaaa taaagaattt atgagtcatt

[0076] In another specific example, the nucleic acid coding the Gsta4 protein can have the CDS sequence, which is sequence number 12.

[0077] SEQ ID NO: 12: Atggcagcaaggcccaagctccactatcccaacggaagaggccggatggagtccgtgagatgggtttttagctgccgccggagtcgagtttgatgaagaatttctggaaacaaaagaacagttgtacaagttgcaggatggtaaccacctgctgttccaacaa gtgcccatggttgaaattgacgggatgaagttggtacagaccgaagcattctccactacatagcagacaagcacaatctctttggcaagaacctcaaggagagaaccctgattgacatgtacgtggaggggacactggatctgctggaactgcttatcatgcatcctt tcttaaaaccagatgatcagcaaaaggaagtggttaacatggcccagaaggctataattagatactttcctgtgtttgaaaagattttaaggggtcacggacaaagctttcttgttggtaatcagctgagccttgcagatgtgattttactccaaaccattttagctct agaagagaaaattcctaatatcctgtctgcatttcctttcctccaggaatacacagtgaaactaagtaatatccctacaattaagagattccttgaacctggcagcaagaagaagcctccccctgatgaaatttatgtgagaaccgtctacaacatctttaggccataa

[0078] In another example, the nucleic acid coding the Gsta4 protein may have a sequence with 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% or more sequence identity with the DNA sequence represented by Sequence ID No. 2.

[0079] In another example, the nucleic acid coding the Gsta4 protein may have a CDS sequence represented by SEQ ID NO: 12 and a sequence with 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% or more sequence identity.

[0080] Features of Gsta4 (1) The novel direct cross-differentiation factor Gsta4, described in this application, can directly convert somatic cells into motor neurons. For example, Gsta4 converts fibroblasts into motor neurons. As another example, Gsta4 converts astrocytes into motor neurons.

[0081] Features of Gsta4 (2) The problem with conventional differentiation factors is that they have low or almost no direct cross-differentiation efficiency. In contrast, Gsta4, the novel differentiation factor of this application, has a higher direct cross-differentiation efficiency compared to conventional differentiation factors. For example, when Gsta4 is used alone, the differentiation efficiency can be approximately 2 to 10 times higher than that of conventional differentiation factors.

[0082] Features of Gsta4 (3) Gsta4 possesses a boosting function that enhances the differentiation efficiency of conventional differentiation factors that have low or almost no differentiation efficiency. This boosting function refers to the ability to significantly increase differentiation efficiency when conventional differentiation factors are used together with Gsta4 compared to when they are used alone. For example, when Gsta4 is used in combination with conventional differentiation factors, it can directly increase cross-differentiation efficiency by approximately 2 to 10 times compared to when it is not used.

[0083] Features of Gsta4 (4) Because Gsta4 has the effect of directly inducing motor neurons from somatic cells, it can be used to treat neurological diseases induced by motor neuron damage. Furthermore, using Gsta4 in combination with conventional direct cross-differentiation factors can improve the therapeutic effect of neurological diseases.

[0084] For example, administering Gsta4 to patients with neurological disorders may result in a decrease in inflammatory cell activity, an increase in action potentials, and an increase in presynaptic signal transmission between neurons.

[0085] 2. Differentiation factors that can be combined with Gsta4 Overview of differentiation factors that can be combined with Gsta4 In one aspect of this application, the Gsta4 protein or the nucleic acid coding it, which is a novel differentiation factor for direct cross-differentiation as described above, can be used not only alone but also in combination with known differentiation factors (known Direct cell-Conversion factors, known DC factors).

[0086] When Gsta4 is used in combination with conventionally known differentiation factors, not only is the efficiency of direct cross-differentiation improved, but the time required for differentiation during direct cross-differentiation can also be reduced.

[0087] The aforementioned known differentiation factors are not limited to those known to be directly involved in cross-differentiation. Furthermore, variants of conventional differentiation factors may also be included. In this case, the variant may have one or more amino acid sequences or nucleic acid sequences of the wild type deleted, substituted, or inserted.

[0088] As an example, the conventional differentiation factor may be one or more selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0089] As one example, this application discloses a combination of Gsta4 and one or more known differentiation factors.

[0090] Below, we will explain in more detail some possible combinations of Gsta4 and conventional differentiation factors.

[0091] Example of a combination of Gsta4 and conventional differentiation factors (1) The aforementioned Gsta4 can be used in combination with one conventional differentiation factor selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0092] In this case, the aforementioned combination can be selected from, for example, Gsta4+Brn2 (referring to the combination of Gsta4 and Brn2); Gsta4+Ascl1; Gsta4+Hb9; Gsta4+Lhx3; Gsta4+Myt1L; Gsta4+Isl1; Gsta4+Ngn2; Gsta4+NeuroD1; etc.

[0093] Examples of combinations of Gsta4 and conventional differentiation factors (2) The aforementioned Gsta4 can be used in combination with two conventional differentiation factors selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0094] In this case, the aforementioned combination can be selected from, for example, Gsta4+Brn2+Hb9 (referring to the combination of Gsta4, Brn2, and HB9); Gsta4+Ascl1+Hb9; Gsta4+Lhx3+Hb9; Gsta4+Ngn2+Hb9; Gsta4+Ngn2+NeuroD1; Gsta4+Lhx3+Ngn2; Gsta4+Lhx3+NeuroD1, etc.

[0095] Examples of combinations of Gsta4 and conventional differentiation factors (3) The aforementioned Gsta4 can be used in combination with three conventional differentiation factors selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0096] In this case, the aforementioned combination can be selected from, for example, Gsta4+Brn2+Hb9+Ascl1 (referring to the combination of Gsta4, Brn2, Hb9, and Ascl1); Gsta4+Brn2+Hb9+NeuroD1; Gsta4+Ascl1+Hb9+NeuroD1; Gsta4+Lhx3+Hb9+NeuroD1; Gsta4+Lhx3+Hb9+Ngn2; Gsta4+Lhx3+Ngn2+NeuroD1; Gsta4+Hb9+Ngn2+NeuroD1; etc.

[0097] Examples of combinations of Gsta4 and conventional differentiation factors (4) The aforementioned Gsta4 can be used in combination with four conventional differentiation factors selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0098] In this case, the aforementioned combination can be selected from, for example, Gsta4+Brn2+Hb9+Ascl1+Isl1 (referring to the combination of Gsta4, Brn2, Hb9, Ascl1 and Isl1); Gsta4+Ascl1+Brn2+Myt1L+Hb9; Gsta4+Brn2+Hb9+NeuroD1+Isl1; Gsta4+Ascl1+Hb9+NeuroD1+Isl1; Gsta4+Lhx3+Hb9+NeuroD1+Isl1; Gsta4+Lhx3+Hb9+Ngn2+Isl1; Gsta4+Lhx3+Ngn2+NeuroD1+Isl1; Gsta4+Hb9+Ngn2+NeuroD1+Isl1; etc.

[0099] Examples of combinations of Gsta4 and conventional differentiation factors (5) The aforementioned Gsta4 can be combined with five conventional differentiation factors selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0100] In this case, the aforementioned combination can be selected from, for example, Gsta4+Brn2+Hb9+Ascl1+Isl1+NeuroD1 (referring to the combination of Gsta4, Brn2, Hb9, Ascl1, Isl1 and NeuroD1); Gsta4+Ascl1+Brn2+Ngn2+Isl1+Lhx3; Gsta4+Brn2+Hb9+NeuroD1+Isl1+Lhx3; Gsta4+Ascl1+Hb9+NeuroD1+Isl1+Lhx3; Gsta4+Lhx3+Hb9+NeuroD1+Isl1+Ascl1; Gsta4+Lhx3+Hb9+Ngn2+Isl1+NeuroD1; Gsta4+Lhx3+Ngn2+NeuroD1+Isl1+Ascl1; Gsta4+Hb9+Ngn2+NeuroD1+Isl1+Ascl1; etc.

[0101] Examples of combinations of Gsta4 and conventional differentiation factors (6) The aforementioned Gsta4 can be combined with six conventional differentiation factors selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0102] In this case, the aforementioned combination can be selected from, for example, Gsta4+Brn2+Hb9+Ascl1+Isl1+NeuroD1+Lhx3 (referring to the combination of Gsta4, Brn2, Hb9, Ascl1, Isl1, NeuroD1 and Lhx3); Gsta4+Ascl1+Brn2+Ngn2+Isl1+Lhx3+Myt1L; Gsta4+Brn2+Hb9+NeuroD1+Isl1+Lhx3+Ngn2; Gsta4+Ascl1+Hb9+NeuroD1+Isl1+Lhx3+Ngn2; etc.

[0103] Examples of combinations of Gsta4 and conventional differentiation factors (7) The aforementioned Gsta4 can be combined with seven conventional differentiation factors selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0104] In this case, the aforementioned combinations are, for example, Gsta4+Brn2+Myt1L+Hb9+Isl1+Lhx3+Ngn2+NeuroD1 (referring to the combination of Gsta4, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2 and NeuroD1); Gsta4+Ascl1+Myt1L+Hb9+Isl1+Lhx3+Ngn2+NeuroD1; Gsta4+Ascl1+Brn2+Hb9+Isl1+Lhx3+Ngn2+NeuroD1; Gsta4+Ascl1+B You can choose from options such as rn2+Myt1L+Isl1+Lhx3+Ngn2+NeuroD1;Gsta4+Ascl1+Brn2+Myt1L+Hb9+Lhx3+Ngn2+NeuroD1;Gsta4+Ascl1+Brn2+Myt1L+Hb9+Isl1+Ngn2+NeuroD1;Gsta4+Ascl1+Brn2+Myt1L+Hb9+Isl1+Lhx3+NeuroD1;Gsta4+Ascl1+Brn2+Myt1L+Hb9+Isl1+Lhx3+Ngn2; etc.

[0105] Examples of combinations of Gsta4 and conventional differentiation factors (8) The aforementioned Gsta4 can be combined with eight conventional differentiation factors: Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0106] Gsta4 and conventional differentiation factor combination ratios As mentioned above, Gsta4 and conventional differentiation factors can be used in a variety of combinations.

[0107] In this case, Gsta4 and conventional differentiation factors can be used in the same proportion for direct cross-differentiation.

[0108] For example, when using Gsta4 and one conventional differentiation factor, they can be used in a 1:1 ratio.

[0109] As another example, when using Gsta4 and two conventional differentiation factors, they can be used in ratios such as 1:1:1, 2:1:1, 2:1:2, and 1:2:1.

[0110] As another example, when using Gsta4 and three conventional differentiation factors, they can be used in a 1:1:1:1 ratio.

[0111] Furthermore, Gsta4 and conventional differentiation factors can be used in different proportions for direct cross-differentiation.

[0112] As a specific example, when using Gsta4, Hb9, and Lhx3, they can be used in ratios of 1:1:1, 2:1:1, 2:1:2, or 1:2:1.

[0113] 3. Compositions containing Gsta4 Overview of compositions containing Gsta4 This application discloses a composition that essentially contains Gsta4, a novel differentiation factor as described above.

[0114] As an example, the above composition may contain Gsta4 alone.

[0115] As another example, the composition may contain a combination of Gsta4 and conventional differentiation factors. Examples of these combinations include those described in combination examples (1) to (8) above.

[0116] In this case, each differentiation factor can be included in the composition in the form of the amino acid sequence that makes up each protein.

[0117] Alternatively, each differentiation factor may be included in the composition as a nucleic acid sequence coding for each protein.

[0118] As a specific example, the amino acid sequence of the Gsta4 protein can be sequence number 1, and the nucleic acid coding the Gsta4 protein can have sequence number 2 or 12.

[0119] As a specific example, the amino acid sequence of the Ascl1 protein can be sequence number 17, and the nucleic acid coding the Ascl1 protein can have the sequence of sequence number 18.

[0120] As a specific example, the amino acid sequence of the Brn2 protein can be sequence number 19, and the nucleic acid coding the Brn2 protein can have the sequence of sequence number 20.

[0121] As a specific example, the amino acid sequence of the Myt1L protein can be sequence number 21, and the nucleic acid coding the Myt1L protein can have the sequence of sequence number 22.

[0122] As a specific example, the amino acid sequence of the Hb9 protein can be sequence number 13, and the nucleic acid coding the Hb9 protein can have the sequence of sequence number 14.

[0123] As a specific example, the amino acid sequence of the Isl1 protein can be sequence number 23, and the nucleic acid coding the Isl1 protein can have the sequence of sequence number 24.

[0124] As a specific example, the amino acid sequence of the Lhx3 protein can be sequence number 15, and the nucleic acid coding the Lhx3 protein can have the sequence of sequence number 16.

[0125] For example, the Ngn2 protein can have sequence number 25, and the nucleic acid coding the Ngn2 protein can have sequence number 26.

[0126] As a specific example, the amino acid sequence of the NeuroD1 protein can be sequence number 27, and the nucleic acid coding the NeuroD1 protein can have the sequence of sequence number 28.

[0127] The composition will be described in more detail below.

[0128] Example composition Composition (1): Contains Gsta4 alone The composition of this application may include the Gsta4 protein or a nucleic acid coding therefor.

[0129] Furthermore, the compositions of this application may include the protein variant or the nucleic acid variant.

[0130] Composition (2): Contains Gsta4 + 1 conventional differentiation factor The arguments of this application are i) Gsta4 protein or nucleic acid coding it; and ii) One protein selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or a nucleic acid coding the selected protein; It can include...

[0131] For example, the composition, i) Gsta4 protein or nucleic acid coding it; and ii) The Ascl1 protein or nucleic acid coding therefor may be included.

[0132] For example, the composition, i) Gsta4 protein or nucleic acid coding it; and ii) Brn2 protein or nucleic acid coding therefor; may include.

[0133] For example, the composition, i) Gsta4 protein or nucleic acid coding it; and ii) Myt1L protein or nucleic acid coding therefor; may include.

[0134] For example, the composition, i) Gsta4 protein or nucleic acid coding it; and ii) Hb9 protein or nucleic acid coding therein; may include.

[0135] For example, the composition, i) Gsta4 protein or nucleic acid coding it; and ii) Isl1 protein or nucleic acid coding therein; may include.

[0136] At this time, For example, the composition, i) Gsta4 protein or nucleic acid coding it; and ii) Lhx3 protein or nucleic acid coding therefor; may include.

[0137] For example, the composition, i) Gsta4 protein or nucleic acid coding it; and ii) Ngn2 protein or nucleic acid coding therefor; may include

[0138] For example, the composition, i) Gsta4 protein or nucleic acid coding it; and ii) NeuroD1 protein or nucleic acid coding therefor; may include

[0139] Composition (3): Contains Gsta4 + 2 conventional differentiation factors

[0140] The arguments of this application are i) Gsta4 protein or nucleic acid coding it; and ii) Two proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or nucleic acids coding the two selected proteins; It can include...

[0141] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding therefor; and iii) Lhx3 protein or nucleic acid coding therefor; It can include...

[0142] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding therefor; and iii) Ngn2 protein or nucleic acid coding it; It can include...

[0143] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Lhx3 protein or nucleic acid coding therefor; and iii) Ngn2 protein or nucleic acid coding it; It can include...

[0144] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding therefor; and iii) Isl1 protein or nucleic acid coding for it; It can include...

[0145] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Lhx3 protein or nucleic acid coding therefor; and iii) Isl1 protein or nucleic acid coding for it; It can include...

[0146] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Ngn2 protein or nucleic acid coding it; and iii) Isl1 protein or nucleic acid coding for it; It can include...

[0147] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding therefor; and iii) Ascl1 protein or nucleic acid coding for it; It can include...

[0148] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Lhx3 protein or nucleic acid coding therefor; and iii) Ascl1 protein or nucleic acid coding for it; It can include...

[0149] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Ngn2 protein or nucleic acid coding it; and iii) Ascl1 protein or nucleic acid coding for it; It can include...

[0150] Composition (4): Contains Gsta4 + 3 conventional differentiation factors

[0151] The arguments of this application are i) Gsta4 protein or nucleic acid coding it; and ii) Three proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or nucleic acids coding the three selected proteins; It can include...

[0152] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Brn2 protein or nucleic acid coding it; iii) Hb9 protein or nucleic acid coding therefor; and iv) NeuroD1 protein or nucleic acid coding it; It can include...

[0153] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; and iv) Ngn2 protein or nucleic acid coding it; It can include...

[0154] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; and iv) Isl1 protein or nucleic acid coding it; It can include...

[0155] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; and iv) Ascl1 protein or nucleic acid coding it; It can include...

[0156] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; and iv) Brn2 protein or nucleic acid coding it; It can include...

[0157] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; and iv) Myt1L protein or nucleic acid coding it; It can include...

[0158] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; and iv) NeuroD1 protein or nucleic acid coding it; It can include...

[0159] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Ngn2 protein or nucleic acid coding therefor; and iv) Isl1 protein or nucleic acid coding it; It can include...

[0160] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Ngn2 protein or nucleic acid coding therefor; and iv) Ascl1 protein or nucleic acid coding it; It can include...

[0161] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Lhx3 protein or nucleic acid coding it; iii) Ngn2 protein or nucleic acid coding therefor; and iv) Isl1 protein or nucleic acid coding it; It can include...

[0162] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Lhx3 protein or nucleic acid coding it; iii) Ngn2 protein or nucleic acid coding therefor; and iv) Ascl1 protein or nucleic acid coding it; It can include...

[0163] Composition (5): Contains Gsta4 + 4 conventional differentiation factors

[0164] The arguments of this application are i) Gsta4 protein or nucleic acid coding it; and ii) Four proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or nucleic acids coding the four selected proteins; It can include...

[0165] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Ascl1 protein or nucleic acid coding it; iii) Brn2 protein or nucleic acid coding it; iv) Myt1L protein or nucleic acid coding it; and v) Hb9 protein or nucleic acid coding for it; It can include...

[0166] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or nucleic acid coding it; and v) Isl1 protein or nucleic acid coding for it; It can include...

[0167] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or nucleic acid coding it; and v) Ascl1 protein or nucleic acid coding for it; It can include...

[0168] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or nucleic acid coding it; and v) Brn2 protein or nucleic acid coding it; It can include...

[0169] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or nucleic acid coding it; and v) Myt1L protein or nucleic acid coding it; It can include...

[0170] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or nucleic acid coding it; and v) NeuroD1 protein or nucleic acid coding for it; It can include...

[0171] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Lhx3 protein or nucleic acid coding it; iii) Ngn2 protein or nucleic acid coding it; iv) Isl1 protein or nucleic acid coding it; and v) Ascl1 protein or nucleic acid coding for it; It can include...

[0172] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Lhx3 protein or nucleic acid coding it; iii) Ngn2 protein or nucleic acid coding it; iv) Ascl1 protein or nucleic acid coding it; and v) Brn2 protein or nucleic acid coding it; It can include...

[0173] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Isl1 protein or nucleic acid coding it; and v) Ascl1 protein or nucleic acid coding for it; It can include...

[0174] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iii) Lhx3 protein or nucleic acid coding therefor; v) Brn2 protein or nucleic acid coding it; It can include...

[0175] Composition (6): Contains Gsta4 + 5 conventional differentiation factors

[0176] The arguments of this application are i) Gsta4 protein or nucleic acid coding it; and ii) Five proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or nucleic acids coding the five selected proteins; It can include...

[0177] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Ascl1 protein or nucleic acid coding it; iii) Brn2 protein or nucleic acid coding it; iv) Ngn2 protein or nucleic acid coding it; v) Isl1 protein or nucleic acid coding it; and vi) Lhx3 protein or nucleic acid coding it; It can include...

[0178] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or nucleic acid coding it; v) Isl1 protein or nucleic acid coding it; and vi) Ascl1 protein or the nucleic acid coding it; It can include...

[0179] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or nucleic acid coding it; v) Isl1 protein or nucleic acid coding it; and vi) Brn2 protein or the nucleic acid coding it; It can include...

[0180] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or nucleic acid coding it; v) Isl1 protein or nucleic acid coding it; and vi) Myt1L protein or nucleic acid coding it; It can include...

[0181] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid encoding the same; iv) Ngn2 protein or nucleic acid encoding the same; v) Isl1 protein or nucleic acid encoding the same; and vi) NeuroD1 protein or nucleic acid encoding the same; can include.

[0182] For example, the composition may i) Gsta4 protein or nucleic acid encoding the same; ii) Hb9 protein or nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid encoding the same; iv) Ngn2 protein or nucleic acid encoding the same; v) Ascl1 protein or nucleic acid encoding the same; and vi) Brn2 protein or nucleic acid encoding the same; can include.

[0183] For example, the composition may i) Gsta4 protein or nucleic acid encoding the same; ii) Hb9 protein or nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid encoding the same; iv) Ngn2 protein or nucleic acid encoding the same; v) Ascl1 protein or nucleic acid encoding the same; and vi) Myt1L protein or nucleic acid encoding the same; can include.

[0184] For example, the composition may i) Gsta4 protein or nucleic acid encoding the same; ii) Hb9 protein or nucleic acid encoding the same; iii) Lhx3 protein or nucleic acid encoding the same; iv) Ngn2 protein or nucleic acid encoding the same; v) The Ascl1 protein or a nucleic acid encoding the same; and vi) The NeuroD1 protein or a nucleic acid encoding the same; can include.

[0185] For example, the composition may i) The Gsta4 protein or a nucleic acid encoding the same; ii) The Hb9 protein or a nucleic acid encoding the same; iii) The Lhx3 protein or a nucleic acid encoding the same; iv) The Isl1 protein or a nucleic acid encoding the same; v) The Ascl1 protein or a nucleic acid encoding the same; and vi) The Brn2 protein or a nucleic acid encoding the same; can include.

[0186] For example, the composition may i) The Gsta4 protein or a nucleic acid encoding the same; ii) The Hb9 protein or a nucleic acid encoding the same; iii) The Lhx3 protein or a nucleic acid encoding the same; iv) The Isl1 protein or a nucleic acid encoding the same; v) The Ascl1 protein or a nucleic acid encoding the same; and vi) The Myt1L protein or a nucleic acid encoding the same; can include.

[0187] For example, the composition may i) The Gsta4 protein or a nucleic acid encoding the same; ii) The Hb9 protein or a nucleic acid encoding the same; iii) The Lhx3 protein or a nucleic acid encoding the same; iv) The Isl1 protein or a nucleic acid encoding the same; v) The Ascl1 protein or a nucleic acid encoding the same; and vi) NeuroD1 protein or nucleic acid coding for it; It can include...

[0188] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Ngn2 protein or nucleic acid coding it; iv) Isl1 protein or nucleic acid coding it; v) Ascl1 protein or nucleic acid coding it; and vi) Brn2 protein or the nucleic acid coding it; It can include...

[0189] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iv) Isl1 protein or nucleic acid coding it; v) Ascl1 protein or nucleic acid coding it; and vi) Myt1L protein or nucleic acid coding it; It can include...

[0190] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Ngn2 protein or nucleic acid coding it; iv) Isl1 protein or nucleic acid coding it; v) Ascl1 protein or nucleic acid coding it; and vi) NeuroD1 protein or nucleic acid coding for it; It can include...

[0191] For example, the composition may contain i) Gsta4 protein or nucleic acid encoding the same; ii) Lhx3 protein or nucleic acid encoding the same; iii) Ngn2 protein or nucleic acid encoding the same; iv) Isl1 protein or nucleic acid encoding the same; v) Ascl1 protein or nucleic acid encoding the same; and vi) Brn2 protein or nucleic acid encoding the same. It can include the above.

[0192] For example, the composition may contain i) Gsta4 protein or nucleic acid encoding the same; ii) Lhx3 protein or nucleic acid encoding the same; iii) Ngn2 protein or nucleic acid encoding the same; iv) Isl1 protein or nucleic acid encoding the same; v) Ascl1 protein or nucleic acid encoding the same; and vi) Myt1L protein or nucleic acid encoding the same. It can include the above.

[0193] For example, the composition may contain i) Gsta4 protein or nucleic acid encoding the same; ii) Lhx3 protein or nucleic acid encoding the same; iii) Ngn2 protein or nucleic acid encoding the same; iv) Isl1 protein or nucleic acid encoding the same; v) Ascl1 protein or nucleic acid encoding the same; and vi) NeuroD1 protein or nucleic acid encoding the same. It can include the above.

[0194] Composition (7): Containing Gsta4 + six conventional differentiation factors

[0195] The arguments of this application are i) Gsta4 protein or nucleic acid coding it; and ii) Six proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or nucleic acids coding the six selected proteins; It can include...

[0196] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Ascl1 protein or nucleic acid coding it; iii) Brn2 protein or nucleic acid coding it; iv) Ngn2 protein or nucleic acid coding it; v) Isl1 protein or nucleic acid coding for it; vi) Lhx3 protein or nucleic acid coding it; and vii) Myt1L protein or the nucleic acid coding it; It can include...

[0197] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or nucleic acid coding it; v) Isl1 protein or nucleic acid coding for it; vi) Ascl1 protein or nucleic acid coding it; and vii) Brn2 protein or the nucleic acid coding it; It can include...

[0198] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or nucleic acid coding it; v) Isl1 protein or nucleic acid coding for it; vi) Ascl1 protein or nucleic acid coding it; and vii) Myt1L protein or the nucleic acid coding it; It can include...

[0199] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or nucleic acid coding it; iv) Ngn2 protein or nucleic acid coding it; vi) Ascl1 protein or nucleic acid coding it; and vii) NeuroD1 protein or nucleic acid coding for it; It can include...

[0200] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or nucleic acid coding it; v) Ascl1 protein or nucleic acid coding for it; vi) Brn2 protein or nucleic acid coding it; and vii) Myt1L protein or the nucleic acid coding it; It can include...

[0201] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or nucleic acid coding it; v) Ascl1 protein or nucleic acid coding for it; vi) Brn2 protein or nucleic acid coding it; and vii) NeuroD1 protein or nucleic acid coding for it; It can include...

[0202] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or nucleic acid coding it; v) Isl1 protein or nucleic acid coding for it; vi) Brn2 protein or nucleic acid coding it; and vii) NeuroD1 protein or nucleic acid coding for it; It can include...

[0203] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Isl1 protein or nucleic acid coding it; v) Ascl1 protein or nucleic acid coding for it; vi) Brn2 protein or nucleic acid coding it; and vii) Myt1L protein or the nucleic acid coding it; It can include...

[0204] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Isl1 protein or nucleic acid coding it; v) Ascl1 protein or nucleic acid coding for it; vi) Brn2 protein or nucleic acid coding it; and vii) NeuroD1 protein or nucleic acid coding for it; It can include...

[0205] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Ngn2 protein or nucleic acid coding it; iv) Isl1 protein or nucleic acid coding it; v) Ascl1 protein or nucleic acid coding for it; vi) Brn2 protein or nucleic acid coding it; and vii) Myt1L protein or the nucleic acid coding it; It can include...

[0206] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Ngn2 protein or nucleic acid coding it; iv) Isl1 protein or nucleic acid coding it; v) Ascl1 protein or nucleic acid coding for it; vi) Brn2 protein or nucleic acid coding it; and vii) NeuroD1 protein or nucleic acid coding for it; It can include...

[0207] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Lhx3 protein or nucleic acid coding it; iii) Ngn2 protein or nucleic acid coding it; iv) Isl1 protein or nucleic acid coding it; v) Ascl1 protein or nucleic acid coding for it; vi) Brn2 protein or nucleic acid coding it; and vii) Myt1L protein or the nucleic acid coding it; It can include...

[0208] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Lhx3 protein or nucleic acid coding it; iii) Ngn2 protein or nucleic acid coding it; iv) Isl1 protein or nucleic acid coding it; v) Ascl1 protein or nucleic acid coding for it; vi) Brn2 protein or nucleic acid coding it; and vii) NeuroD1 protein or nucleic acid coding for it; It can include...

[0209] Composition (8): Contains Gsta4 + 7 conventional differentiation factors

[0210] The arguments of this application are i) Gsta4 protein or nucleic acid coding it; and ii) Seven proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or nucleic acids coding the seven selected proteins; It can include...

[0211] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Brn2 protein or nucleic acid coding it; iii) Myt1L protein or nucleic acid coding for it; iv) Hb9 protein or nucleic acid coding it; v) Isl1 protein or nucleic acid coding for it; vi) Lhx3 protein or nucleic acid coding it; vii) Ngn2 protein or nucleic acid coding it; and viii) Ascl1 protein or the nucleic acid coding it; It can include...

[0212] For example, the composition, i) Gsta4 protein or nucleic acid coding for it ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or nucleic acid coding it; v) Isl1 protein or nucleic acid coding for it; vi) Ascl1 protein or the nucleic acid coding it; vii) Brn2 protein or nucleic acid coding it; and viii) Myt1L protein or the nucleic acid that codes for it; It can include...

[0213] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or nucleic acid coding it; v) Isl1 protein or nucleic acid coding for it; vi) Ascl1 protein or the nucleic acid coding it; vii) Brn2 protein or nucleic acid coding it; and viii) NeuroD1 protein or nucleic acid coding for it; It can include...

[0214] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or nucleic acid coding it; v) Ascl1 protein or nucleic acid coding for it; vi) Brn2 protein or the nucleic acid coding it; vii) Myt1L protein or nucleic acid coding it; and viii) NeuroD1 protein or nucleic acid coding for it; It can include...

[0215] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or nucleic acid coding it; v) Isl1 protein or nucleic acid coding for it; vi) Brn2 protein or the nucleic acid coding it; vii) Myt1L protein or nucleic acid coding it; and viii) NeuroD1 protein or nucleic acid coding for it; It can include...

[0216] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or nucleic acid coding it; v) Isl1 protein or nucleic acid coding for it; vi) Ascl1 protein or the nucleic acid coding it; vii) Myt1L protein or nucleic acid coding it; and viii) NeuroD1 protein or nucleic acid coding for it; It can include...

[0217] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Ngn2 protein or nucleic acid coding it; v) Isl1 protein or nucleic acid coding for it; vi) Ascl1 protein or the nucleic acid coding it; vii) Brn2 protein or nucleic acid coding it; and viii) NeuroD1 protein or nucleic acid coding for it; It can include...

[0218] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Lhx3 protein or nucleic acid coding therefor; iv) Isl1 protein or nucleic acid coding it; v) Ascl1 protein or nucleic acid coding for it; vi) Brn2 protein or the nucleic acid coding it; vii) Myt1L protein or nucleic acid coding it; and viii) NeuroD1 protein or nucleic acid coding for it; It can include...

[0219] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Hb9 protein or nucleic acid coding for it; iii) Ngn2 protein or nucleic acid coding it; iv) Isl1 protein or nucleic acid coding it; v) Ascl1 protein or nucleic acid coding for it; vi) Brn2 protein or the nucleic acid coding it; vii) Myt1L protein or nucleic acid coding it; and viii) NeuroD1 protein or nucleic acid coding for it; It can include...

[0220] For example, the composition, i) Gsta4 protein or nucleic acid coding for it; ii) Lhx3 protein or nucleic acid coding it; iii) Ngn2 protein or nucleic acid coding it; iv) Isl1 protein or nucleic acid coding it; v) Ascl1 protein or nucleic acid coding for it; vi) Brn2 protein or the nucleic acid coding it; vii) Myt1L protein or nucleic acid coding it; and viii) NeuroD1 protein or nucleic acid coding for it; It can include...

[0221] Composition (9): Contains Gsta4 + 8 conventional differentiation factors

[0222] The arguments of this application are i) Gsta4 protein or nucleic acid coding it; and ii) Proteins of Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or nucleic acids coding for them; It can include...

[0223] Herein, the aforementioned compositions may, but are not limited to, include protein form, nucleic acid form, or a mixture of protein and nucleic acid. In this case, the nucleic acid may be DNA, RNA, or a mixture of DNA and RNA.

[0224] For example, the composition may contain all of its components in the form of proteins.

[0225] In other examples, the aforementioned composition may contain all factors in the form of nucleic acids.

[0226] In another example, the composition may contain some of its factors in protein form and others in nucleic acid form.

[0227] In this case, the nucleic acid form may be a vector form. In this case, the vector may consist of one or more vectors.

[0228] Furthermore, the above composition may contain a viral capsid.

[0229] At this time, the aforementioned differentiation factor can be transmitted contained within the viral capsid.

[0230] As an example, the pharmaceutical composition of this application may include a viral capsid containing the Gsta4 monogene.

[0231] Other examples include the viral capsid containing Gsta4 of the composition; and The viral capsid may contain one or more selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0232] Vector for expression of converting factor As an example, the composition may include a vector for expressing a differentiation factor. In this case, the vector may include a nucleic acid coding for the Gsta4 protein. Alternatively, it may further include a nucleic acid that codes for a conventional differentiation factor in addition to the nucleic acid coding for the Gsta4 protein.

[0233] The vector has the function of effectively expressing the target differentiation factor in the target cell, and for that purpose, it may further include other necessary additional components such as promoters and enhancers.

[0234] Essential components of the vector - nucleic acids coding the Gsta4 protein The vector essentially contains nucleic acid coding for the Gsta4 protein.

[0235] The nucleic acid to be encrypted may be the full-length sequence or a partial sequence of the Gsta4 gene.

[0236] For example, some of the aforementioned sequences can be exon sequences of Gsta4. In this case, the exon sequence may be a CDS (Coding Sequence) sequence from which introns have been removed from the Gsta4 gene sequence.

[0237] For example, the vector may contain the DNA sequence of SEQ ID NO: 2 or SEQ ID NO: 12.

[0238] Selective vector construction - Nucleic acids that encode conventional differentiation factors The vector may selectively further contain nucleic acids that encode conventional differentiation factors in addition to the nucleic acid encoding the Gsta4 protein. The nucleic acids encoding Gsta4 and conventional differentiation factors may be contained in one vector or in two or more vectors.

[0239] In one embodiment, the vector may contain nucleic acids that encode a differentiation factor selected from the combination examples (1) to (8) of Gsta4 and conventional differentiation factors.

[0240] For example, a vector is i) A sequence selected from sequence number 2 and sequence number 12; and ii) One array selected from sequence numbers 14, 16, 18, 20, 22, 24, 26, and 28; may include this.

[0241] For example, an expression vector is i) A sequence selected from sequence number 2 and sequence number 12; and ii) Two arrays selected from sequence numbers 14, 16, 18, 20, 22, 24, 26, and 28; may contain these.

[0242] For example, an expression vector is i) A sequence selected from sequence number 2 and sequence number 12; and ii) It may contain three arrays selected from sequence numbers 14, 16, 18, 20, 22, 24, 26, and 28.

[0243] For example, an expression vector is i) A sequence selected from sequence number 2 and sequence number 12; and ii) Four arrays selected from sequence numbers 14, 16, 18, 20, 22, 24, 26, and 28; may contain these.

[0244] For example, an expression vector is i) A sequence selected from sequence number 2 and sequence number 12; and ii) Five arrays selected from sequence numbers 14, 16, 18, 20, 22, 24, 26, and 28; may contain these.

[0245] For example, an expression vector is i) A sequence selected from sequence number 2 and sequence number 12; and ii) Six arrays selected from sequence numbers 14, 16, 18, 20, 22, 24, 26, and 28; may contain these.

[0246] For example, an expression vector is i) A sequence selected from sequence number 2 and sequence number 12; and ii) It may contain seven arrays selected from sequence numbers 14, 16, 18, 20, 22, 24, 26, and 28.

[0247] For example, an expression vector is i) A sequence selected from sequence number 2 and sequence number 12; and ii) The arrays of sequence numbers 14, 16, 18, 20, 22, 24, 26 and 28 may be included.

[0248] Additional component of the vector (1)

[0249] In addition to the essential and selective components of the target protein, the vector may include additional components necessary for differentiation factor expression within the cell.

[0250] For example, the aforementioned additional configuration may include expression regulatory elements, selection elements, and so on.

[0251] The expression regulatory elements may include promoters, enhancers, polyadenylation signals, Kozak consensus sequences, inverted terminal repeats (ITRs), long terminal repeats (LTRs), terminators, internal ribosome entry sites (IRESs), and 2A self-cleaving peptides.

[0252] For example, the promoter could be the SV40 initial promoter, the LTR (mouse mammary tumor virus long terminal repeat) promoter, the Ad MLP (adenovirus major late) promoter, the HSV (herpes simplex virus) promoter, the CMV (cytomegalovirus) promoter, the RSV (roussarcoma virus) promoter, the U6 promoter, and so on.

[0253] For example, the 2A self-cleaving peptide can be T2A, P2A, E2A, F2A, etc. The vector for differentiation factor expression may contain one or more 2A self-cleaving peptides. In this case, the 2A self-cleaving peptide generates multiple proteins from the same transcript. Therefore, the 2A self-cleaving peptide can be positioned between two or more different proteins intended for expression within the vector.

[0254] The aforementioned selection factors can include fluorescent protein genes, tags, reporter genes, antibiotic resistance genes, and the like.

[0255] For example, the fluorescent protein gene may be the GFP gene, YFP gene, RFP gene, or mCherry gene.

[0256] For example, the tags may include histidine (His) tags, V5 tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags.

[0257] For example, the reporter gene can be glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta-galactosidase, beta-glucuronidase, or the like.

[0258] For example, the aforementioned antibiotic resistance genes may include hygromycin-resistant genes, neomycin-resistant genes, kanamycin-resistant genes, blasticidin-resistant genes, and zeocin-resistant genes.

[0259] The vectors of this application can be used to effectively express target differentiation factors, including written, selective, and additive configurations.

[0260] As a specific example, if a vector in this application contains a nucleic acid coding for the Gsta4 protein, the vector may consist of the sequence of SEQ ID NO: 36.

[0261] As a specific example, if the expression vector contains a dinucleic acid that encodes the Gsta4 protein and a nucleic acid that encodes the Myt1l protein, the vector can be made using the sequence of SEQ ID NO: 5.

[0262] As another example, if the expression vector contains nucleic acids that encode the Gsta4 protein; nucleic acids that encode the MNX1 protein; and nucleic acids that encode the LHX3 protein, the vector can be made using the sequence of SEQ ID NO: 29.

[0263] Vector addition configuration (2) (configuration for knock-in)

[0264] In another embodiment, the expression vector may additionally include an additional configuration (2) for knocking in a differentiation factor into the target genome.

[0265] The aforementioned knock-in refers to the insertion of a differentiation factor into the genome of a target cell. In such cases, the expression of the inserted differentiation factor is sustained within the cell, which can further enhance the differentiation efficiency of the target cell (e.g., somatic cell) into motor neurons.

[0266] As a specific example, the differentiation factor can be knocked into a safe harbor region within the target cell genome.

[0267] The safe harbor refers to a gene locus in the target genome where, even if an exogenous differentiation factor is inserted into a specific region, it does not induce side effects, and the expression of the differentiation factor can be sustained.

[0268] For example, the safe harbor can be a locus region in the target cell's genome sequence that codes for AAVS1, ROSA26, or the like.

[0269] The knock-in of the aforementioned differentiation factor can be performed by methods known in the art.

[0270] As a specific example, the above method can utilize a transposable element (TE) system, a CRISPR / Cas system, and the like.

[0271] The aforementioned transposition factor system utilizes DNA fragments that can be moved within a dielectric material.

[0272] For example, the transposable element system may include piggyback transposable elements, sleeping beauty transposable elements, and the like.

[0273] The CRISPR / Cas system can consist of a Cas protein, guide RNA, and a donor. In this case, the donor may include (i) a differentiation factor to be expressed, and (ii) a sequence homologous to a portion of the safe harbor gene in the target cell genome. In this case, the sequence homologous to the portion of the safe harbor gene in (ii) can function as homology arms at both ends of the donor.

[0274] For example, the Cas protein and guide RNA form a complex, causing a double-strand break (DSB) cleavage within the safe harbor gene sequence in the target cell genome. At this time, a differentiation factor (donor) sequence having homologous cancers at both ends can be inserted into the cleavage site by homologous recombination (HDR). In this case, the two homologous cancers are sequences homologous to a portion of the upstream sequence and a portion of the downstream sequence, centered around the cleavage site.

[0275] Types of vectors In one example, the vector can be a viral vector.

[0276] As an example, the viral vector may be a retrovirus, lentivirus, adenovirus, adeno-associated virus (AAV), velcinia virus, fox virus, HIV (Human Immunodeficiency virus), MLV (Murineleukemia virus), ASLV (Avian sarcoma / leukosis), SNV (Spleen necrosis virus), RSV (Rous sarcoma virus), MMTV (Mouse mammary tumor virus), herpes simplex virus, epizomal, or herpes simplex virus. Preferably, it may be an adenovirus or adeno-associated virus (AAV).

[0277] In other cases, the vector may be a non-viral vector.

[0278] As an example, the aforementioned non-viral vectors may be plasmids, phages, naked DNA, DNA-lipid complexes, DNA-molecular complexes, or mRNA.

[0279] 4. Direct cross-differentiation method Overview of direct cross-differentiation methods In another aspect of the present invention, a method is provided for directly cross-differentiating somatic cells into motor neurons using the composition for the expression of the differentiation factor described above.

[0280] Therefore, this application discloses a direct cross-differentiation method using a composition containing Gsta4.

[0281] Using the above-mentioned composition, target cells can be directly cross-differentiated without a reverse differentiation step, and in particular, converted into motor neurons. The above-mentioned direct cross-differentiation method can be performed by an ordinary technician by appropriately selecting a publicly disclosed method, and is not particularly limited as long as it can achieve the predetermined objective.

[0282] As an example, the direct cross-differentiation method includes introducing one composition selected from compositions (1) to (9) into the target cells.

[0283] In this case, the composition is characterized by essentially containing Gsta4,

[0284] The aforementioned direct cross-differentiation method does not show the effect of dedifferentiating the target cells into induced pluripotent stem cells (iPSCs).

[0285] As an optional embodiment, the direct cross-differentiation method of this application may include introducing a vector containing nucleic acid encoding the Gsta4 protein into a target cell.

[0286] In any embodiment, the direct cross-differentiation method of this application may be Gsta4 protein; or nucleic acid coding for it; and This may include introducing a vector into a target cell containing one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or a nucleic acid coding the selected proteins.

[0287] As one example, the direct cross-differentiation method of this application may include introducing a vector containing nucleic acids coding for the Gsta4 protein, nucleic acids coding for the Lhx3 protein, and nucleic acids coding for the Hb9 protein into a target cell.

[0288] Cells targeted for direct cross-differentiation (starting cells) The direct cross-differentiation that this application aims to achieve involves introducing the factors of this application into "differentiated cells" and directly converting them into the target cells.

[0289] The differentiated cells used as the target cells in the direct cross-differentiation method of this application may be somatic cells. Somatic cells refer to all cells except germ cells.

[0290] For example, the somatic cells may include fibroblasts, epithelial cells, endothelial cells, muscle cells, nerve cells, hair cells, hair root cells, hair follicle cells, oral epithelial cells, somatic cells extracted from urine, gastric mucosal cells, goblet cells, gastrin cells (G cells), B cells, pericytes, astrocytes, blood cells, rare dendritic progenitor cells, and the like.

[0291] The somatic cells may be derived from or isolated from mammals such as humans, dogs, cats, horses, sheep, rabbits, pigs, mice, and camels.

[0292] As an example, the direct cross-differentiation method of this application is: The composition for the expression of differentiation factors for direct cross-differentiation described above is introduced into somatic cells;

[0293] In this case, the somatic cells may be somatic cells that have been cultured for a certain period of time prior to the introduction of the composition.

[0294] The differentiation method described above may further include a step of further culturing somatic cells into which the composition has been introduced in a culture medium for neuronal differentiation.

[0295] The following describes the culture medium for somatic cell culture, the culture medium for neuronal cell differentiation, the differentiation period (i.e., the period during which somatic cells to which the composition has been introduced are cultured), and the introduction method used in the differentiation method described above.

[0296] Culture medium The culture medium may be a culture medium for somatic cell culture or a culture medium for neuronal cell differentiation, depending on the purpose.

[0297] Culture media for somatic cell culture and culture media for neuronal cell differentiation can utilize culture media known in the art. Furthermore, culture media can be appropriately modified for a predetermined purpose. For example, in order to improve the efficiency of direct cross-differentiation, which is the objective of this application, appropriately modified carbon sources, nitrogen sources, trace elements, growth factors, etc., known in the art can be used.

[0298] For example, the culture medium can be DMEM, MEM, RPMI-1640, Ham's F-10, or Ham's F-12.

[0299] Cell confluence, culture period, and large chicken culture In somatic cell culture, the cell confluence can be adjusted to facilitate experiments.

[0300] At this time, somatic cells can appropriately regulate confluence depending on whether they are in the state before the introduction of the composition or in the state after the introduction of the composition.

[0301] Somatic cells can be cultured until their confluence reaches approximately 60% to 100%. Preferably, they can be cultured until their confluence reaches approximately 80% to 100%.

[0302] Furthermore, the somatic cell culture can be cultured for approximately 12 to 60 hours to reach an appropriate confluence for easy experimentation, but is not limited to this.

[0303] The somatic cell culture described above can be subcultured one to three times to achieve the appropriate confluence, but is not limited to this.

[0304] The order of introduction of each component of the composition for the expression of differentiation factors In the direct cross-differentiation method described above, there are no particular restrictions on the order in which the selected compositions from composition (1) to composition (9) are introduced into the target cells. For example, if the composition contains two or more differentiation factors, these may be introduced into the target cells simultaneously or sequentially.

[0305] For example, the direct cross-differentiation method of this application may include simultaneously or sequentially introducing an expression vector containing a nucleic acid encoding the Gsta4 protein, an expression vector containing a nucleic acid encoding the Lhx3 protein, and an expression vector containing a nucleic acid encoding the Hb9 protein.

[0306] A method for introducing a composition for the expression of differentiation factors into target cells.

[0307] In the direct cross-differentiation method described above, the introduction of a composition for the expression of differentiation factors for direct cross-differentiation into target cells can be carried out by a typical technician appropriately selecting known techniques.

[0308] For example, methods such as electroporation, gene guns, ultrasonic perforation, magnetofection using magnetic nanoparticles, microinjection, transient cell compression or squeezing, cationic liposome methods, lithium acetate-DMSO, lipid-mediated transfection, calcium phosphate precipitation, lipofection, PEI (polyethyleneimine)-mediated transfection, and DEAE-dextran-mediated transfection can be used to introduce the composition into cells, but are not limited to these.

[0309] Characteristics of somatic cells into which a composition for differentiation factor expression has been introduced.

[0310] Somatic cells into which the composition for the expression of differentiation factors provided in this application has been introduced show increased expression of differentiation factors and neuronal cell markers as the culture period progresses.

[0311] The aforementioned neuronal cell markers can include NEUN, ChAT, Map2, Hb9, Synapsin, Tuj1, IsL1, PAX6, Olig2, Nkx2.2, SMI-32, and others.

[0312] For example, somatic cells into which the differentiation factor expression composition of this application has been introduced may show increased expression of one or more neuronal markers selected from NEUN, ChAT, Map2, Hb9, and Synapsin on day 3 of the culture period compared to day 1.

[0313] differentiation period

[0314] If differentiation factors are introduced into somatic cells using the direct cross-differentiation method described above, the somatic cells will be converted into motor neurons after an appropriate period of time. The differentiation environment can be maintained through changes in the culture medium until the somatic cells are converted into motor neurons. The appropriate period can be determined by the target cells.

[0315] For example, fibroblasts into which a composition for the expression of differentiation factors has been introduced can be converted into motor neurons within approximately 7 to 30 days.

[0316] To give another example, astrocytes into which a composition for the expression of differentiation factors has been introduced can be converted into motor neurons within approximately 7 to 30 days.

[0317] Results of the direct cross-differentiation method

[0318] By utilizing the direct cross-differentiation method described in this application, it is possible to obtain motor neurons induced by direct cross-differentiation of somatic cells. Motor neurons are nerve cells that transmit motor stimuli occurring in the brain and spinal cord to muscles and glands.

[0319] In particular, motor neurons induced by introducing the direct cross-differentiation factor of this application into somatic cells exhibit an expression characteristic of over-expression of the differentiation factor within the cell. Therefore, due to this over-expression environment of the differentiation factor, the induced motor neurons can also exhibit the characteristic of over-expression of neuronal markers.

[0320] The aforementioned direct cross-differentiation factors may include, but are not limited to, Gsta4, Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), NeuroD1 (Neuronal Differentiation 1), etc.

[0321] For example, in motor neurons obtained through the direct cross-differentiation method described above, Gsta4 is overexpressed.

[0322] For example, in motor neurons obtained by the aforementioned direct cross-differentiation, one or more direct cross-differentiation factors selected from Gsta4, Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Neuren(2), and NeuroD1 (Neuronal Differentiation 1) are overexpressed.

[0323] Furthermore, overexpression of such differentiation factors leads to increased expression of neuronal marker proteins in motor neurons. These neuronal markers may include, but are not limited to, NEUN, ChAT, Map2, Synapsin, HB9, Tuj1, IsL1, Notch1, HES1, HES3, E-cadherin, occludin, PAX6, N-cadherin, SOX2, etc.

[0324] For example, motor neurons obtained through the direct cross-differentiation described above can overexpress one or more neuronal markers from among ChAT, Map2, Hb9, and Synapsin.

[0325] To give another example, motor neurons obtained through the aforementioned direct cross-differentiation may overexpress one or more of the induced Tuj1, IsL1, and NEUN.

[0326] Direct cross-differentiation result confirmation The direct cross-differentiation method of this application may additionally include a step to confirm selective conversion to motor neurons.

[0327] At this time, the confirmation process can be confirmed using neuronal cell markers known in the field, and can be confirmed through a variety of molecular biology techniques known in the field. For example, the molecular biology techniques can be, but are not limited to, immunofluorescence staining, Western blot, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), enzyme-linked immunosorbent assay (ELISA), etc.

[0328] Features of the direct cross-differentiation method of this application (1) The direct cross-differentiation method disclosed in this application is characterized by the absence of induced pluripotent stem cells (iPSCs). In other words, it is characterized by directly inducing the conversion from somatic cells to target motor neurons without going through the induced pluripotent stem cell stage via the somatic cell reverse differentiation process.

[0329] For example, if somatic cells such as fibroblasts or astrocytes are treated with Gsta4 alone, or with Gsta4 together with conventional differentiation factors, the fibroblasts or astrocytes can directly differentiate into motor neurons.

[0330] Features of the direct cross-differentiation method of this application (2) Furthermore, as mentioned above, the method of this application does not involve the induced pluripotent stem cell stage, and therefore has the advantage of a low probability of teratoma formation in the target cells. In other words, it is a method that significantly reduces the probability of teratoma generation, which is a problem with conventional stem cell use. This advantage suggests that the method of this application may be even more useful for the treatment of neurological diseases.

[0331] Features of the direct cross-differentiation method of this application (3) The direct cross-differentiation method disclosed in this application significantly contributes to improving the differentiation efficiency, which is a problem with conventional differentiation factors. In particular, treating fibroblasts or astrocytes with both Gsta4 and conventional differentiation factors, rather than treating them with conventional differentiation factors alone, can significantly improve the differentiation efficiency of motor neurons that differentiate directly.

[0332] 5. Pharmaceutical compositions for direct cross-differentiation containing Gsta4 Overview of Pharmaceutical Compositions for Direct Cross-Differentiation Containing Gsta4 This application discloses, in other words, one composition selected from the above compositions (1) to (9) as a pharmaceutical composition for the treatment of neurological disorders. The components that the pharmaceutical composition may contain and specific indications for therapeutic use are disclosed below.

[0333] Active ingredients of pharmaceutical compositions The active ingredient of the pharmaceutical composition of this application may be one or more of the following:

[0334] (1) Differentiation factors of this application (2) Somatic cells containing the differentiation factor of this application (3) Motor neurons induced using the differentiation factor of this application

[0335] In this case, the differentiation factor may be Gsta4 alone or in combination with a conventional differentiation factor. In this case, the conventional differentiation factor is one or more selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

[0336] The differentiation factor (1) may be in the form of a protein or nucleic acid.

[0337] As an example, the pharmaceutical composition for the prevention or treatment of neurological diseases of this application may include the Gsta4 protein or a nucleic acid coding therefor.

[0338] As another example, the pharmaceutical compositions for the prevention or treatment of neurological diseases of this application may include the Gsta4 protein or nucleic acid coding therefor; the Hb9 protein or nucleic acid coding therefor; and the Lhx3 protein or nucleic acid coding therefor.

[0339] As another example, the pharmaceutical compositions for the prevention or treatment of neurological diseases of this application may include Gsta4 protein or nucleic acid coding therefor; Hb9 protein or nucleic acid coding therefor; Lhx3 protein or nucleic acid coding therefor; and Ngn2 protein or nucleic acid coding therefor.

[0340] In this case, the differentiation factor (1) can be transmitted contained in a viral capsid. For example, the pharmaceutical composition of this application may contain a viral capsid containing the Gsta4 monogene. As another example, the composition may contain a viral capsid containing Gsta4, a viral capsid containing Hb9, and a viral capsid containing Lhx3 together. When a viral capsid containing the differentiation factor of this application is included, it can be used as a type of gene therapy agent.

[0341] Furthermore, the somatic cells containing the differentiation factor described in (2) above may be i) somatic cells into which a vector containing nucleic acid coding the differentiation factor has been introduced; or ii) somatic cells into which a differentiation factor protein has been introduced. When the somatic cells containing the differentiation factor of this application are included as an active ingredient, they can be used as a type of cell therapy agent. A cell therapy agent means a therapeutic agent that utilizes autologous, allogenic, or xenogenic "cells" as an active ingredient to restore tissue function.

[0342] As an example, the pharmaceutical composition for the prevention or treatment of neurological diseases of this application may include somatic cells into which a vector containing nucleic acid encoding the Gsta4 protein has been introduced.

[0343] As another example, the pharmaceutical composition for the prevention or treatment of neurological diseases of this application may include somatic cells into which a vector comprising nucleic acid coding for the Gsta4 protein; nucleic acid coding for the Hb9 protein; and nucleic acid coding for the Lhx3 protein has been introduced.

[0344] Furthermore, the motor neurons induced using the differentiation factor described in (3) above are motor neurons generated by the direct cross-differentiation of somatic cells using the direct cross-differentiation method described in [4. Direct Cross-Differentiation Method] above. When the induced motor neurons of this application are included as an active ingredient, they can also be used as another type of cell therapy agent.

[0345] Pharmaceutically acceptable extra components

[0346] The pharmaceutical composition may further contain pharmaceutically acceptable additional components in addition to the active ingredient. These pharmaceutically acceptable additional components may be, but are not limited to, carriers, excipients, diluents, preservatives, etc.

[0347] For example, the aforementioned carriers, excipients, and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, distilled water, physiological saline, glycerol, ethanol, and HSA (Humanserumalbumin).

[0348] For example, the preservatives mentioned above include benzoic acid, sodium benzoate, sorbic acid, parahydroxybenzoic acid, chlorobutanol, and the like.

[0349] When the aforementioned pharmaceutical composition is formulated, it may further contain fillers, bulking agents, binders, wetting agents, and the like.

[0350] Formulation of pharmaceutical compositions The aforementioned pharmaceutical composition can be formulated for oral or parenteral use.

[0351] For example, when formulated for oral use, it can be manufactured in solid form, liquid form, capsule form, or semi-solid form.

[0352] As another example, when formulated for parenteral use, it may be manufactured as an injectable, aerosol, etc. Preferably, it can be formulated as an injectable.

[0353] Target diseases of pharmaceutical compositions

[0354] The aforementioned pharmaceutical composition can be applied to neurological disorders. In particular, the aforementioned pharmaceutical composition can be used for the treatment or prevention of neurological disorders. The neurological disorders of this application may be nerve cell damage or diseases induced by such damage.

[0355] For example, the aforementioned neurological disorders may include, but are not limited to, spinal cord injury, Parkinson's disease, stroke, Huntington's disease, Lou Gehrig's disease, ataxia telangiectasia, amyotrophic lateral sclerosis, motor nerve injury, traumatic peripheral nerve injury, ischemic brain injury, neonatal hypoxic-ischemic brain injury, cerebral palsy, peripheral paralysis, central paralysis, quadriplegia, diplegia, epilepsy, neuronal developmental disorders, neuralgia, intractable epilepsy, Alzheimer's disease, congenital metabolic neurological disorders and traumatic brain injury, motor nerve cell damage or diseases induced thereby. Preferably, the aforementioned neurological disorders can be selected from spinal cord injury, Parkinson's disease, Alzheimer's disease, amyotrophic lateral sclerosis, peripheral paralysis, central paralysis, quadriplegia, and diplegia.

[0356] 6. Treatment methods for neurological disorders Overview of treatment methods for neurological disorders A method for treating neurological disorders using the aforementioned [5. Pharmaceutical composition for direct cross-differentiation containing Gsta4] is disclosed.

[0357] As mentioned above, the pharmaceutical composition is Gsta4 or Gsta4 and one or more selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; Includes.

[0358] The method for treating neurological diseases described in this application can be carried out by (i) directly treating the subject (patient) with the composition, (ii) treating somatic cells into which the composition has been introduced, or (iii) generating motor neurons induced from ex vivo and treating the subject with these. In this case, method (i) can have the effect of generating motor neurons induced in the subject's body, i.e., in vivo.

[0359] Treatment method (1) A method for treating neurological disorders can utilize a system in which the "pharmaceutical composition" of this application is administered to a subject requiring treatment or prevention of a neurological disorder, thereby generating motor neurons induced in vivo.

[0360] As an example, the method for treating neurological disorders described in this application is: A composition containing the Gsta4 protein or the nucleic acid coding therein may be administered to the target; this may include:

[0361] As another example, the method for treating neurological disorders of this application is, i) Gsta4 protein; and ii) One or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; A composition containing the following may be administered to the target; it may include

[0362] Treatment method (2) A method for treating neurological disorders is characterized by administering the pharmaceutical composition of this application to "somatic cells" into which it has been introduced.

[0363] As an example, the method for treating neurological disorders described in this application is: A composition containing the Gsta4 protein or the nucleic acid coding it is administered to somatic cells into which it has been introduced; It can include...

[0364] As another example, the method for treating neurological disorders of this application is, i) Gsta4 protein or nucleic acid coding it; and ii) One or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or nucleic acids coding the said proteins; A composition containing the above was administered to somatic cells into which it had been introduced; It can include...

[0365] As described above, when somatic cells into which the composition of this application has been introduced are administered to a subject, the somatic cells directly cross-differentiate and are converted into motor neurons within the subject's body by the differentiation factors introduced into the somatic cells. As a result, the motor neurons proliferate within the administered subject, and nervous system diseases can be treated or prevented.

[0366] Treatment method (3) A method for treating neurological diseases can be used in which the composition of this application is introduced into isolated somatic cells to directly obtain cross-differentiated motor neurons ex vivo, and then these "motor neurons" are administered to subjects requiring treatment or prevention of neurological diseases. In other words, this method involves applying the induced motor neurons of this application as the direct active ingredient of a therapeutic agent to the subject.

[0367] As an example, the method for treating neurological disorders described in this application is: A composition containing the Gsta4 protein or a nucleic acid coding for it was introduced into somatic cells and administered to motor neurons induced by this composition; It can include...

[0368] As another example, the method for treating neurological disorders of this application is, somatic cells i) Gsta4 protein or nucleic acid coding it; and ii) One or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1; or nucleic acids coding the said proteins; A composition containing [the specified substance] is introduced and administered to the induced motor neurons; It can include...

[0369] Target for administration The treatment methods for the aforementioned neurological disorders may be applied to, but are not limited to, individuals in whom motor neuron function is reduced compared to healthy individuals, or individuals in whom disease has developed due to a decrease in motor neurons.

[0370] The subjects requiring treatment or prevention of neurological disorders may be mammals. For example, such mammals may include humans, dogs, horses, cats, mice, rabbits, sheep, and monkeys.

[0371] The administration method, dosage, concentration of the pharmaceutical composition, and administration cycle described below may be determined considering the age, weight, general health status, diet, severity of neurological disorders, whether other medications are being taken, and the duration of treatment.

[0372] Method of administration The aforementioned treatment methods for neurological disorders can be administered via various routes depending on the patient's condition.

[0373] Administration can be by oral or parenteral administration. In this case, parenteral administration may be by injection.

[0374] The injection site may be, but is not limited to, muscle, intradermal, subcutaneous, vein, abdominal cavity, artery, mucous membrane, spinal cord, bone marrow, intraspinal cavity, or percutaneous.

[0375] For example, if the administration site is the spinal cord, it may be L1 (lumbar 1), L2 (lumbar 2), L3 (lumbar 3), L4 (lumbar 4), L5 (lumbar 5), T1 (thoracic 1), T2 (thoracic 2), T3 (thoracic 3), T4 (thoracic 4), T5 (thoracic 5), T6 (thoracic 6), T7 (thoracic 7), C1 (cervical 1), C2 (cervical 2), C3 (cervical 3), C4 (cervical 4), C5 (cervical 5), etc.

[0376] Another example is that it can be administered directly to the site where the neurological disorder has occurred. An arbitrary specific example would be direct administration to the brain affected by Parkinson's disease.

[0377] Concentration of pharmaceutical composition

[0378] The concentrations of the pharmaceutical composition may be as follows based on the overall composition. In this case, the pharmaceutical composition may be, but is not limited to, a form containing a vector, a form containing a virus purified from a vector, a form of a cell containing a vector, a form of a protein, a form of a cell containing a protein, etc.

[0379] As an example, when purifying a viral vector containing the pharmaceutical composition of this application with a virus, the following concentrations may be included based on the entire composition.

[0380] For example, 1 x 10 based on the entire pharmaceutical composition. 5 vg(viral genome) / mL or 1x10 20 It may contain viruses at a concentration of vg(viral genome) / mL.

[0381] For example, 1 x 10 based on the entire pharmaceutical composition. 5 GC (genome copies) / mL or 1x10 20It may contain viruses at a concentration of vg(genome copies) / mL.

[0382] As another example, 1 x 10 based on the entire pharmaceutical composition 5 VP (viral particle) / mL or 1x10 20 It may contain viruses at a concentration of VP (viral particle) / mL.

[0383] Dosage

[0384] The dosage of the pharmaceutical composition can be determined by considering the method of administration, the target population, etc., to determine an appropriate dose.

[0385] For example, the dosage can be 1 μL to 20 mL per administration, but it is not limited to this.

[0386] For example, when administered via spinal injection, it can be given in doses of 1 uL / kg to 20 uL / kg. When administered intravenously, it can be given in doses of 0.5 mL / kg to 10 mL / kg.

[0387] Administration cycle

[0388] The administration cycle of the aforementioned pharmaceutical composition may vary depending on the target disease, its severity, and other factors.

[0389] The drug can be administered once or several times a day, and can also be administered several times over a long period. In this case, it is also possible to administer the drug at regular intervals.

[0390] The aforementioned administration interval may be 1 day to 60 days, etc. In this case, continuous or non-continuous administration is possible.

[0391] Confirmation of treatment effectiveness

[0392] After applying the aforementioned treatment methods for neurological disorders to the target population, the effects of alleviation, improvement, or treatment of the neurological disorder can be confirmed in various ways.

[0393] For example, this can be confirmed through measures such as a decrease in scar cells, changes in neuronal marker expression, BBB score, action potentials, and spontaneous responses.

[0394] For example, by using the aforementioned treatment methods for neurological disorders, the incidence of scalculia can be reduced by approximately 2 to 50 times.

[0395] As another example, using the aforementioned treatment methods for neurological diseases may increase the expression of neuronal cell markers by approximately 2 to 50 times.

[0396] As another example, using the aforementioned treatment methods for neurological disorders may increase the BBB score by approximately 2 to 50 times.

[0397] As another example, using the aforementioned treatment methods for neurological disorders may result in action potentials or spontaneous responses appearing in a manner similar to that of a healthy person.

[0398] 7. Applications of induced motor neurons Overview of the uses of induced motor neurons

[0399] This application discloses diverse applications of motor neurons obtained by the direct cross-differentiation method described above. The following describes drug screening, biomaterial applications, and other uses of these motor neurons.

[0400] Applications of motor neurons (1) - Drug screening As an example, the present application discloses a drug screening application utilizing induced motor neurons. In particular, it can be used for the prevention of neurological diseases and the screening of therapeutic drugs.

[0401] Methods such as confirming the responsiveness of the motor neurons before and after administration of the candidate drug to the induced motor neurons can be usefully used for screening drugs for the prevention and / or treatment of neurological diseases.

[0402] Applications of motor neurons (2) - Artificial organs

[0403] Another example disclosed in this application is an artificial organ containing induced motor neurons. Organoids, which are artificial organs created by inducing stem cells into specific organs and then replicating them in vitro, are also a type of artificial organ. Because this application does not involve the induced pluripotent stem cell stage, it can be used for artificial organs with fewer side effects compared to organoids that utilize stem cells.

[0404] The motor neurons of this application can be applied to 3D bioprinting. 3D bioprinting is a method of creating artificial organs such as nerves, corneas, livers, skin, and blood vessels by stacking layers of bio-ink made from living cells, similar to 3D printing. Therefore, the induced motor neurons of this application can be 3D bioprinted to produce artificial organs for treating neurological diseases and injuries.

[0405] [Possible embodiments of the invention]

[0406] Example 1: Gsta4 standalone A composition for direct cross-differentiation from somatic cells to motor neurons, wherein the composition is Gsta4 (Glutathione S-transferase A4) protein or the nucleic acid coding for it; A composition comprising, wherein the motor neurons are motor neurons induced (differentiated) from the somatic cells.

[0407] (A composition characterized by the direct cross-differentiation of somatic cells into induced motor neurons.)

[0408] Example 2: Gsta4 + 1 conventional factor In Example 1, The aforementioned composition is One protein selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1); or a nucleic acid coding for said protein; A composition characterized by further containing

[0409] Example 3: Gsta4 + 2 conventional factors In Example 1, The aforementioned composition is Two proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1); or nucleic acids coding the said proteins; A composition characterized by further containing

[0410] Example 4: Gsta4 + 3 conventional factors In Example 1, The aforementioned composition is Three proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1); or nucleic acids coding the said proteins; A composition characterized by further containing

[0411] Example 5: Gsta4 + 4 conventional factors In Example 1, The aforementioned composition is Four proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1); or nucleic acids coding the said proteins; A composition characterized by further containing

[0412] Example 6: Gsta4 + 5 conventional factors In Example 1, The aforementioned composition is Five proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1); or nucleic acids coding the said proteins; A composition characterized by further containing

[0413] Example 7: Gsta4 + 6 conventional factors In Example 1, The aforementioned composition is Six proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1); or nucleic acids coding the said proteins; A composition characterized by further containing

[0414] Example 8: Gsta4 + 7 conventional factors In Example 1, The aforementioned composition is Seven proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1); or nucleic acids coding the said proteins; A composition characterized by further containing

[0415] Example 9: Gsta4 + 8 conventional factors In Example 1, The aforementioned composition is Seven proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1); or nucleic acids coding the said proteins; A composition characterized by further containing

[0416] Example 10: Combination of compositions In Example 2, The aforementioned composition is Gsta4 protein or nucleic acid coding it; and Brn2 protein or nucleic acid coding it; or Ascl1 protein or nucleic acid coding it; A composition characterized by containing the following:

[0417] Example 11: Combination of compositions In Example 3, The aforementioned composition is Gsta4 protein or nucleic acid coding for it; Hb9 protein or nucleic acid coding it; and Lhx3 protein or nucleic acid coding for it; A composition characterized by containing the following:

[0418] Example 12: Combination of compositions In Example 4, The aforementioned composition is Gsta4 protein or nucleic acid coding for it; Brn2 protein or the nucleic acid coding it; Hb9 protein or nucleic acid coding it; and The neuroD1 protein or the nucleic acid that codes for it. A composition characterized by containing the following:

[0419] Example 13: Combination of compositions In Example 5, The aforementioned composition is Gsta4 protein or nucleic acid coding for it; Brn2 protein or the nucleic acid coding it; Hb9 protein or nucleic acid coding for it; Ascl1 protein or nucleic acid coding it; and Myt1L protein or the nucleic acid that codes for it; A composition characterized by containing the following:

[0420] Example 14: Combination of compositions In Example 6, The aforementioned composition is Gsta4 protein or nucleic acid coding for it; Brn2 protein or the nucleic acid coding it; Ascl1 protein or the nucleic acid coding for it; Ngn2 protein or nucleic acid coding for it; Isl1 protein or nucleic acid coding it; and Lhx3 protein or nucleic acid coding for it; A composition characterized by containing the following:

[0421] Example 15: Combination of compositions There is a concrete example 7, The aforementioned composition is Gsta4 protein or nucleic acid coding for it; Brn2 protein or the nucleic acid coding it; Ascl1 protein or the nucleic acid coding for it; Ngn2 protein or nucleic acid coding for it; Isl1 protein or nucleic acid coding it; and Lhx3 protein or nucleic acid coding for it; Myt1L protein or the nucleic acid that codes for it; A composition characterized by containing the following:

[0422] Example 16: Gsta4 array In Example 1, The Gsta4 protein is characterized by having the amino acid sequence shown in Sequence ID No. 1 or a sequence that is 70% or more identical thereto.

[0423] Example 17: Hb9 array In Example 2, The Hb9 protein is characterized by having an amino acid sequence represented by Sequence ID No. 14 or a sequence that is 70% or more identical thereto.

[0424] Example 18: Lhx3 array In Example 2, The Lhx3 protein is characterized by having an amino acid sequence represented by Sequence ID No. 15 or a sequence that is 70% or more identical thereto.

[0425] Example 19: Limited arrangement In Example 11, The Gsta4 protein is the amino acid sequence represented by Sequence ID No. 1 or a sequence that is 70% or more identical thereto. The Hb9 protein is the amino acid sequence represented by Sequence ID No. 14 or a sequence that is 70% or more identical thereto. The Lhx3 protein is characterized by having an amino acid sequence represented by Sequence ID No. 15 or a sequence that is 70% or more identical thereto.

[0426] Example 20: Vector 1 As a vector for direct cross-differentiation from somatic cells to motor neurons, the vector is: i) Specific example 1 or 16; and ii) Promoter; Includes, i) is operably connected to ii), The vector is characterized in that the motor neurons are motor neurons induced (differentiated) from the somatic cells.

[0427] Example 21: Additional configuration of Vector 1 In Example 20, The aforementioned vector is selected from examples 2 through 9; A vector characterized by being able to further include

[0428] Example 22: Vector 2 As a vector for direct cross-differentiation from somatic cells to motor neurons, the vector is: i) Implemented Example 3 or Implemented Example 11; and ii) Promoter; Includes, i) is operably connected to ii), The vector is characterized in that the motor neurons are motor neurons induced (differentiated) from the somatic cells.

[0429] Example 23: Vector 3 As a vector for direct cross-differentiation from somatic cells to motor neurons, the vector may contain two or more vectors. At this time, two or more vectors include at least the first vector and the second vector, The previous vector 1 is, i) Specific example 1 or 16; and ii) Promoter; Includes, The i) is operably connected to the ii), The aforementioned second vector is iii) The vector is one or more selected from Implement Examples 2 to 9; and iv) Promoter; Includes, The above iii) is operably connected to iv), At this time, iii) the vector can be selected from embodiment examples 2 to 9 and one or more of them can be included in individual vectors. The vector is characterized in that the motor neurons are motor neurons induced (differentiated) from the somatic cells.

[0430] Example 24: Vector Addition Configuration In any one of the embodiment examples 21 to 23, The vector is characterized in that it may further selectively contain one or more of the following: promoters other than the promoter described in ii) above, enhancers, polyadenylation signals, Kozak consensus sequences, ITRs (inverted terminal repeats), LTRs (long terminal repeats), terminators, internal ribosome entry sites (IRESs), fluorescent protein genes, glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta-galactosidase, beta-glucuronidase, luciferase, histidine (His) tag, V5 tag, FLAG tag, influenza hemagglutinin (HA) tag, Myc tag, 2A self-cleaving peptides, and antibiotic resistance genes.

[0431] Example 25: Limited to additional vector configurations In Example 24, The vector is characterized in that the 2A self-cleaving peptide is one or more selected from T2A, P2A, E2A, and F2A.

[0432] Example 26: Limited to additional vector configurations In any one of the embodiment examples 21 to 23, The vector is characterized in that it may further contain one or more selected from donor, piggyback transposable elements, and sleeping beauty transposable elements.

[0433] Example 27: Limited Vector Types In any one of the embodiment examples 21 to 23, The vector is a viral vector characterized by being one or more of the following: retrovirus, lentivirus, adenovirus, adeno-associated virus (AAV), velcinia virus, fox virus, HIV (Human immunodeficiency virus), MLV (Murineleukemia virus), ASLV (Avian sarcoma / leukosis), SNV (Spleen necrosis virus), RSV (Rous sarcoma virus), MMTV (Mouse mammary tumor virus), herpes simplex virus, epizomal, and herpes simplex virus.

[0434] Example 28: Differentiation Method (1) A method for direct cross-differentiation from somatic cells to motor neurons, The aforementioned direct cross-differentiation is a process in which somatic cells directly cross-differentiate and become induced (differentiated) motor neurons. The above method is a) Introduce Example 1, Example 16, or Example 20 into somatic cells; A method that includes this.

[0435] Example 29: Differentiation Method (1) In Example 28, In the aforementioned somatic cells b) Implement one of the examples 2 through 9 or 21; A method characterized by further including

[0436] Example 30: Differentiation Method (1) In Implemented Example 28 or Implemented Example 29, The above introduction; after Somatic cells are cultured using a culture medium for neural differentiation; A method characterized by further including

[0437] Example 31: Differentiation Method (2) A method for direct cross-differentiation from somatic cells to motor neurons, The aforementioned direct cross-differentiation is a process in which somatic cells directly cross-differentiate and become induced (differentiated) motor neurons. The above method is a) Mix Example 1, Example 16, or Example 20 into the culture medium; b) Culture somatic cells using the mixture; A method that includes this.

[0438] Example 32: Differentiation Method (3) A method for direct cross-differentiation from somatic cells to motor neurons, The aforementioned direct cross-differentiation is a process in which somatic cells directly cross-differentiate and become induced (differentiated) motor neurons. The above method is Implement Example 11, Implement Example 19, or Implement Example 22; into somatic cells; or Examples 16, 17, and 18 were introduced into somatic cells; A method that includes this.

[0439] Example 33: Introduction Method In any of the embodiment examples selected from embodiment examples 28 to 32, The aforementioned introduction is characterized by being performed by one or more of the following methods selected from electroporation, gene gun, ultrasonic perforation, magnetofection using magnetic nanoparticles, microinjection, transient cell compression or squeezing, cationic liposome method, lithium acetate-DMSO, lipid-mediated transfection, calcium phosphate precipitation, lipofection, PEI (polyethyleneimine)-mediated transfection, and DEAE-dextran-mediated transfection.

[0440] Example 34: Somatic cell types In any of the embodiment examples selected from embodiment examples 28 to 32, The somatic cells described above are characterized by being selected from among fibroblasts, epithelial cells, endothelial cells, muscle cells, nerve cells, hair cells, hair root cells, hair follicle cells, oral epithelial cells, somatic cells extracted from urine, gastric mucosal cells, goblet cells, gastrin cells (G cells), B cells, pericytes, astrocytes, blood cells, and rare dendritic pontine progenitor cells.

[0441] Example 35: Differentiation Period In any of the embodiment examples selected from embodiment examples 28 to 32, A method characterized in that somatic cells differentiate into motor neurons within 1 to 10 weeks as a result of the aforementioned introduction.

[0442] Example 36: Characteristics of Differentiation Methods In any of the embodiment examples selected from embodiment examples 28 to 32, The aforementioned introduction is characterized in that the somatic cells do not generate induced pluripotent stem cells (iPSCs) but instead become induced motor neurons.

[0443] Example 37: Acquired results of differentiation method - Motor neuron (overexpression of differentiation factors) In motor neurons where direct cross-differentiation factors are overexpressed, At this time, the direct cross-differentiation factor is one or more selected from Gsta4, Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Transcription Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Differentiation 1). The motor neuron is characterized by having cross-differentiated directly from somatic cells.

[0444] Example 38: Acquired Differentiation Method - Motor Neuron (Overexpression of Neuronal Markers)

[0445] In motor neurons where neuronal cell markers are overexpressed, At this time, the neuronal cell marker is one or more selected from NEUN, ChAT, Map2, Hb9, Synapsin, Tuj1, IsL1, PAX6, Olig2, Nkx2.2, and SMI-32. The motor neuron is characterized by having cross-differentiated directly from somatic cells.

[0446] Example 39: Pharmaceutical composition (1) Includes 1, 16, or 20 of the Implemented Examples. Pharmaceutical compositions for the prevention or treatment of neurological disorders.

[0447] Example 40: Pharmaceutical composition (2) Implementing Examples 1, 16, or 20; and One example selected from examples 2 through 9 and 21; A pharmaceutical composition for the prevention or treatment of neurological disorders, including [the specified substance].

[0448] Example 41: Pharmaceutical composition (3) Including Implementing Example 37 or 38 Pharmaceutical compositions for the prevention or treatment of neurological disorders.

[0449] Example 42: Indications In any of the embodiment examples selected from embodiment examples 39 to 41, The aforementioned neurological disorder is one or more selected from spinal cord injury, Parkinson's disease, stroke, Huntington's disease, Lou Gehrig's disease, ataxia telangiectasia, amyotrophic lateral sclerosis, motor nerve injury, traumatic peripheral nerve injury, ischemic brain injury, neonatal hypoxic-ischemic brain injury, cerebral palsy, peripheral paralysis, central paralysis, quadriplegia, diplegia, epilepsy, neuronal developmental disorder, neuralgia, intractable epilepsy, Alzheimer's disease, congenital metabolic neurological disorders, and traumatic brain injury, motor nerve injury, or diseases induced thereby.

[0450] Example 42: Additional Configuration In any of the embodiment examples selected from embodiment examples 39 to 41, The pharmaceutical composition is characterized in that it may further contain one or more selected from acceptable carriers, excipients, diluents, and preservatives.

[0451] Example 43: Treatment Method (1) In the treatment of neurological disorders, the aforementioned method is Administer to somatic cells as shown in Example 39 or 40; Includes, The method is characterized in that, at this time, the somatic cells do not generate induced pluripotent stem cells (iPSCs) but become induced motor neurons.

[0452] Example 44: Treatment Method (2) In the treatment of neurological disorders, the aforementioned method is The somatic cells into which embodiment example 39 or 40 has been introduced are administered; The method is characterized in that, at this time, the somatic cells do not generate induced pluripotent stem cells (iPSCs) but become induced motor neurons.

[0453] Example 45: Treatment Method (3) In the treatment of neurological disorders, the aforementioned method is Administered to the subject of Example 41; Includes,

[0454] The method is characterized in that, at this time, the somatic cells within the target do not generate induced pluripotent stem cells (iPSCs), but instead become induced motor neurons.

[0455] Example 46: Target Restriction (1) In one of the implementation examples selected from implementation example 43, implementation example 44, and implementation example 45, The method is characterized in that the subject is a mammal.

[0456] Example 47: Target Restriction (2) In Example 46, The method is characterized in that the aforementioned mammal is selected from among humans, mice, dogs, and cats.

[0457] Example 48: Limited administration In one of the implementation examples selected from implementation example 43, implementation example 44, and implementation example 45, The method is characterized in that the administration site is one or more selected from the following: muscle, intradermal, subcutaneous, vein, abdominal cavity, artery, mucosa, spinal cord, bone marrow, intraspinal cavity, and percutaneous.

[0458] Example 49: Dosage

[0459] In one of the implementation examples selected from implementation example 43, implementation example 44, and implementation example 45, The method is characterized by administering the dose at a rate of 1 uL / kg to 20 uL / kg at a time.

[0460] Example 50: Indications

[0461] In one of the implementation examples selected from implementation example 43, implementation example 44, and implementation example 45,

[0462] The method is characterized in that the neurological disorder is one or more selected from among spinal cord injury, Parkinson's disease, stroke, amyotrophic spinal lateral sclerosis, motor nerve injury, peripheral nerve injury due to trauma, ischemic brain injury, neonatal hypoxic-ischemic brain injury, cerebral palsy, epilepsy, intractable epilepsy, Alzheimer's disease, congenital metabolic neurological disorder, traumatic brain injury, motor neuron injury, or diseases induced thereby.

[0463] I will now explain this application in more detail through the following examples.

[0464] These embodiments are provided solely to illustrate the present application in more detail, and it will be obvious to those ordinary skill in the art to which this application pertains that the scope of this application is not limited by these embodiments.

[0465] Experimental materials ● Vector design

[0466] The vector used in the following procedure is the AAV vector (Cell Biolabs, INC., VPK-402), and a schematic diagram of the AAV vector for differentiation factor introduction is shown in Figure 1.

[0467] Figure 1(a) corresponds to sequence number 36; Figure 1(b) corresponds to sequence number 3; Figure 1(c) corresponds to sequence number 4; Figure 1(d) corresponds to sequence number 5; Figure 1(e) corresponds to sequence number 29.

[0468] ● AAV production

[0469] 293T celline was used to produce AAV. The 293T cells were cultured in Dulbecco's Modified Eagle Medium (DMEM, Thermal Fisher, #12430112) with 10% fetal bovine serum (Thermal Fisher, #26140079) and 1% antibiotic-antimyotic (Thermal Fisher, #15240096) at 37°C and 5% CO2. The 293T cells were transfected with AAV vector 1, pHelper, and pRapCap and cultured for 48 hours. Subsequently, the virus containing differentiation factors was extracted through a viral extraction process.

[0470] ● Cell culture and intracellular AAV introduction

[0471] Human dermal fibroblasts (Sigma, 106-05A) were cultured in batches of fibroblast growth medium (Sigma, 116-500) containing 10% fetal bovineserum (Thermal Fisher, #26140079) and 1% antibiotic-antimyotic (Thermal Fisher, #15240096) at 37°C under 5% CO2 conditions.

[0472] Humandermal fibroblasts are placed in 24 wells in a 0.025 x 10⁻¹⁵ 6 Individual cells were seeded and prepared. 24 hours after seeding, the cells were treated with differentiation factors. 24 hours after differentiation factor treatment, the medium was changed to fibroblast growth medium. After another 24 hours, it was changed to neural induction medium. The medium was changed every two days. On days 14-17, the cells were stained using immunofluorescence via fixation.

[0473] Mouse astrocyte (Abm, T0289) was cultured in Prigrow III medium (Abm, TM003) supplemented with 10% fetal bovine serum (Thermal Fisher, #26140079) and 1% Penicillin / Streptomycin (Gibco) at 37°C in a 5% CO2 atmosphere.

[0474] Mouse astrocyte was seeded at 0.025x10 6 cells per well in a 24-well plate. Twenty-four hours after cell seeding, differentiation factors were added. Twenty-four hours after treatment with differentiation factors, the medium was replaced with Prigrow III medium. After 24 hours, it was alternated with Neural induction medium. The medium was alternated once every two days. On days 14 - 17, cells were subjected to immunofluorescence staining through fixation.

[0475] Mouse embryonic fibroblasts were cultured in DMEM (Gibco) supplemented with 10% fetal bovine serum (Thermal Fisher, #26140079) and 1% Penicillin / Streptomycin (Gibco) at 37°C in a 5% CO2 atmosphere.

[0476] Mouse embryonic fibroblasts were seeded at 0.025x10 6O cells per well in a 24-well plate. Twenty-four hours after cell seeding, differentiation factors were added. Twenty-four hours after treatment with differentiation factors, the medium was replaced with DMEM medium. After 24 hours, it was alternated with Neural induction medium. The medium was alternated once every two days. On days 14 - 17, cells were subjected to immunofluorescence staining through fixation.

[0477] When introducing AAV into the SCI model, the injured area (Lumbar 5) of the mouse spinal cord injury model was microscanned using a directional fixation device (Stereotaxic, Harvard Apparatus), and then analyzed for 60 days.

[0478] ● Immunofluorescence staining

[0479] For cell fixation, the cells were washed twice with PBS (Gibco) for 5 minutes each. Then, 4% paraformaldehyde (ThermoFisher) was added and incubated at room temperature for 10 minutes.

[0480] For permeabilization, the cells were incubated in PBS with 0.1% Triton-X at room temperature for 10 minutes. The cells were then washed three times with PBS for 5 minutes each.

[0481] For blocking and immunostaining, 1% BSA + PBST (PBS + 0.1% Tween20) was added and incubated at room temperature for 30 minutes. Primary antibodies used were ChAT (Invitrogen, 1:1000), Map2 (Millipore, 1:200), and NeuN (Merck Millipore, 1:100). The primary antibodies were placed in 1% BSA + PBST and incubated overnight at 4°C. After washing three times with PBS for 5 minutes each, the secondary antibodies Alexa Fluor™ 488 / 594 (Thermo Fisher, 1:1000) were placed in 1% BSA + PBST and incubated in a dark place at room temperature for 1 hour. After washing three times with PBS for 5 minutes each, DAPI staining was performed.

[0482] ● RNA extraction and cDNA synthesis

[0483] cells 2x10 6After removing the supernatant with trypsin (ThemoFisher), centrifugation was performed at 13,000 rpm for 10 seconds. After removing the supernatant, 1 ml of easy-Blue™ (iNtRON) was added, the port was extinguished for 10 seconds, then 200 μl of Choloroform was added, and the port was extinguished again. After centrifugation at 13,000 rpm for 10 minutes, 400 μl of upper fluid was transferred to a new 1.5 ml tube. 400 μl of 2-propanol (Sigma) was added, inverted 2-3 times, and then left in RT for 10 minutes. After centrifugation at 13,000 rpm for 5 minutes, the upper layer was removed. 1 ml of 75% EtOH (Sigma) was added, and inverted 2-3 times. After centrifugation at 10,000 rpm at 4°C for 5 minutes, the upper layer was removed. After drying for 5 minutes in RT mode, the RNA was dissolved in 20 μl of distilled water. The final obtained RNA was stored at -70°C.

[0484] cDNA was synthesized using AccuPower® CycleScrip® RT PreMix & Master Mix (Bioneer).

[0485] ● Real-time quantitative reverse transcription PCR (qRT-PCR)

[0486] The analysis was performed using qPCR (SYBRGreen Realtime PCR Master Mix, TOYOBO). Cells differentiated from human fibroblasts into motor neurons by qRT-PCR expressed Synapsin, Map2, and Hb9. Cells differentiated from mouse-derived fibroblasts into motor neurons expressed Synapsin, Map2, and Hb9.

[0487] The primers used at this time are as shown in the table below.

[0488] [Table 1] JPEG2026086824000001.jpg143160

[0489] Example 1: Confirmation of direct cross-differentiation of Gsta4 into motor neurons within cells. GSTA4 was introduced into mouse-derived fibroblasts using AAV. Differentiation of somatic cells into neurons by Gsta4 was confirmed by immunofluorescence staining and qPCR (Figure 2). Immunofluorescence staining confirmed the expression of ChAT, a marker for motility neurons, and Map2, a marker for mature neurons. By qPCR, the degree of neuronal differentiation was confirmed by changes in the expression of Synapsin, a marker for synapse formation, Map2, a marker for mature neurons, and Hb9, a marker for mature neurons.

[0490] When Gsta4 was treated alone, synapsin expression increased by approximately four times compared to the control group (shown as "control"), Map2 expression increased by approximately five times compared to the control group (shown as "control"), and Hb9 expression increased by approximately two times compared to the control group (shown as "control"). These experimental results confirmed that Gsta4 alone can effectively convert somatic cells into neurons.

[0491] Example 2: Confirmation of direct cross-differentiation of intracellularly mediated differentiation factors into motor neurons.

[0492] To confirm the direct cross-differentiation effect of known factors, conventional differentiation factors were introduced into human-derived fibroblasts, and the degree of cross-differentiation was directly observed in motor neurons (Figure 3).

[0493] At this time, the conventional differentiation factors were introduced as follows:

[0494] Ascl1 monotherapy; Ascl1, Brn2, Myt1l combination therapy (indicated as ABM); Hb9, Isl1, Lhx3 combination therapy (indicated as HIL); ABM ​​and HIL combination therapy; ABM, HIL, Ngn2, and NeuroD1 combination therapy (indicated as HND).

[0495] In Example 1, when Gsta4 was administered alone, the expression levels of Synapsin, Map2, and Hb9 increased by approximately 4, 5, and 2 times, respectively, compared to the control group. In contrast, when Ascl1 was administered alone, the expression levels of Synapsin, Map2, and Hb9 increased by only about 1 to 1.5 times. This suggests that, compared to the previously published factor Ascl1 administration alone, Gsta4, the novel differentiation factor of this application, exhibits higher efficiency in direct cross-differentiation of motor neurons.

[0496] Furthermore, when ABM was administered in combination with the three known factors, the expression increases of Synapsin, Map2, and Hb9 were only about 2, 4, and 1 times, respectively. Similarly, when HIL was administered in combination with the three publicly disclosed factors, the expression increases of Synapsin, Map2, and Hb9 were only about 2, 1.5, and 1.5 times, respectively. This confirmed that even when the three publicly disclosed factors were administered in combination, the direct cross-differentiation efficiency in motor neurons was lower or similar to that of Gsta4 alone, the novel differentiation factor of this application.

[0497] On the other hand, administration of ABM+HIL (a combination of six known factors) and ABM+HND (a combination of eight known factors) sometimes resulted in increased expression of neuronal cell markers compared to administration of one known factor or a combination of three known factors. In other words, combining six or more factors showed a significant effect.

[0498] Example 3: Confirmation of direct cross-differentiation using a combination of Gsta4

[0499] After confirming the neuronal cell conversion effect using only the factors disclosed in Example 2, we attempted to confirm the effect of combining Gsta4 of the present invention with these factors.

[0500] Therefore, AAV was introduced into mouse-derived fibroblasts in various combinations with Gsta4 and conventional differentiation factors, and the degree of differentiation was confirmed by qPCR to check the expression of neuronal cell markers (Synapsin, Map2, Hb9) (Figure 4).

[0501] As a result, we confirmed that the expression of neuronal cell markers in the group combining Gsta4 with conventional differentiation factors increased by approximately 5-10 times compared to the control group (labeled Control). Compared to the case where only the conventional factors confirmed in Example 2 were used, it was found that the expression results (fold change) of each identical marker were even higher when Gsta4 of the present invention was combined with these factors.

[0502] Furthermore, immunofluorescence staining confirmed the expression of ChAT, a marker for motility neurons, and Map2, a marker for mature neurons (Figures 5 and 6). Immunofluorescence staining confirmed that ChAT and Map2 expression appeared in the group treated with Gsta4 combined with conventional differentiation factors.

[0503] In other words, as shown in Figures 4 to 6, it was found that somatic cells effectively and directly cross-differentiate into motor neurons even when Gsta4 is used together with conventional differentiation factors.

[0504] Example 4: Confirmation of direct cross-differentiation of conventional differentiation factors into motor neurons based on the presence or absence of Gsta4 in cells.

[0505] After reviewing the results of Examples 2 and 3, we attempted to more specifically investigate the effects of combining Gsta4 of the present invention with known differentiation factors.

[0506] Comparison of a single conventional differentiation factor versus a combination of a single conventional differentiation factor and Gsta4. Mouse-derived fibroblasts were introduced with conventional differentiation factors based on the presence or absence of Gsta4 using AAV, and the degree of differentiation was confirmed by the expression of neuronal cell markers (Synapsin, Map2) using qPCR (Figure 7).

[0507] We confirmed that the expression of neuronal cell markers (Synapsin, Map2) increased by approximately 2 to 5 times when Gsta4 and Ascl1 were administered in combination (indicated as Gsta4+Ascl1) or when Gsta4 and Brn2 were administered in combination (indicated as Gsta4+Brn2) compared to when the conventional differentiation factors Ascl1 and Brn2 were administered individually.

[0508] Comparison of two conventional differentiation factors vs. two conventional differentiation factors + Gsta4 combination

[0509] Mouse-derived fibroblasts were introduced with conventional differentiation factors based on the presence or absence of Gsta4 using AAV, and the degree of differentiation was confirmed by the expression of neuronal cell markers (ChaT, Map2) using immunofluorescence staining (Figure 8).

[0510] We confirmed that the number of cells immunostained with neuronal cell markers increased by more than 40 times when Gsta4 was administered in combination with Mnx1 and Lhx3 (indicated as Gsta4+Mnx1+Lhx3) compared to when the conventional differentiation factors Mnx1 and Lhx3 were administered in combination (indicated as Mnx1+Lhx3).

[0511] Furthermore, the expression of neuronal cell markers (Synapsin, Map2) was confirmed by qPCR (Figure 9).

[0512] We confirmed that the expression of neuronal cell markers increased by approximately 2 to 4 times when Gsta4 was administered in combination with Mnx1 and Lhx3 (indicated as Gsta4+Mnx1+Lhx3) compared to when the conventional differentiation factors Mnx1 and Lhx3 were administered together (indicated as Mnx1+Lhx3). Furthermore, when Gsta4 was administered alone (indicated as Gsta4), the expression of neuronal cell markers increased by approximately 2 to 4 times compared to the control group (indicated as Control).

[0513] Comparison of conventional differentiation factors (3) vs. conventional differentiation factors (3) + Gsta4 combination Mouse-derived fibroblasts were introduced with conventional differentiation factors based on the presence or absence of Gsta4 using AAV, and the degree of differentiation was confirmed by the expression of neuronal cell markers (Synapsin, Map2) using qPCR (Figure 10).

[0514] It was confirmed that the expression of neuronal cell markers (Synapsin, Map2) increased by approximately 2 to 4 times when Gsta4 was administered in combination with Ascl1, Brn2, and Myt1L (represented as Gsta4+Ascl1+Brn2+Myt1l) compared to when the conventional differentiation factors Ascl1, Brn2, and Myt1L were administered in combination (represented as Ascl1+Brn2+Myt1l).

[0515] Comparison of the conventional 8 eruption factors vs. the conventional 8 eruption factors + Gsta4 combination Human-derived fibroblasts were introduced with conventional differentiation factors based on the presence or absence of Gsta4 using AAV, and the degree of differentiation was confirmed by the expression of neuronal cell markers (Synapsin, Map2, Hb9) using qPCR (Figure 11).

[0516] We confirmed that the expression of neuronal markers increased by approximately 2 to 5 times when Gsta4 was administered in combination with Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1 (indicated as ABM+HND+Gsta4) compared to when the conventional differentiation factors Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1 were administered in combination (indicated as ABM+HIL+Ngn2+NeuroD1(HND)). Furthermore, it was found that the expression of neuronal markers increased by approximately 10 to 12 times when Gsta4 was administered in combination with Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1 compared to the control group (indicated as Control).

[0517] Furthermore, conventional differentiation factors were introduced into human-derived fibroblasts using AAV, depending on the presence or absence of Gsta4, and the degree of differentiation was confirmed by the expression of neuronal cell markers (vChaT, Map2) using immunofluorescence staining (Figure 13).

[0518] When conventional differentiation factors Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1 were introduced in combination (indicated as known factors), approximately 15.51% of the cells differentiated into mature nerve cells. In contrast, when the aforementioned known factors and Gsta4 were introduced in combination (indicated as known factors + Gsta4), it was confirmed that approximately 48.72% of the cells differentiated into mature nerve cells.

[0519] Comparison of conventional eruption factors (4) vs. conventional eruption factors (7) vs. conventional eruption factors (7) + Gsta4 combination Mouse astrocytes were introduced with conventional differentiation factors based on the presence or absence of Gsta4 using AAV, and the degree of differentiation was confirmed by the expression of neuronal cell markers (vChaT, Map2) using immunofluorescence staining (Figure 12).

[0520] When conventional differentiation factors Hb9, Isl1, Lhx3, and Ascl1 were administered in combination, approximately 20% of neuronal cell markers were expressed. When conventional differentiation factors Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, and Ngn2 were administered in combination (indicated as "existing known factors"), approximately 50% of neuronal cell markers were expressed. However, when the aforementioned existing known factors were administered in combination with Gsta4 (indicated as "existing known factors + Gsta4"), approximately 70% of neuronal cell markers were expressed. In other words, it was found that the expression of ChaT and Map2 increased when Gsta4 was administered in combination with the seven conventional differentiation factors compared to when only the seven conventional differentiation factors were administered.

[0521] Through these results, it was found that Gsta4 of this application is a differentiation factor that has the function of directly cross-differentiating somatic cells such as fibroblasts and sympathetic cells and converting them into induced motor neurons. Furthermore, it was found that Gsta4 has a higher differentiation efficiency than conventional direct cross-differentiation factors, and that when Gsta4 is used together with conventional differentiation factors, it enhances the differentiation efficiency of the conventional differentiation factors which had low differentiation efficiency.

[0522] Example 5: Confirmation of direct cross-differentiation into motor neurons and therapeutic effect in vivo Based on the results of Examples 1 to 4, which confirmed the neuronal differentiation efficacy of Gsta4 in cells, experiments were conducted based on the schematic diagram in Figure 14 to confirm direct cross-differentiation into motor neurons and therapeutic effects in vivo.

[0523] We confirmed the effect of improving or treating spinal nerve damage in the SCI mouse model, an animal model of lower body paralysis, through morphological, physiological, and behavioral analyses.

[0524] 1) Creation of a mouse model for SCI (Spinal Cord Injury) To create a SCI mouse model, which is a model of lower body paralysis due to spinal cord injury, ICR mice were anesthetized and the Lumbar 5 region of the spinal cord (hereinafter referred to as L5; corresponding to vertebral T13-L1) was injured. After the injury, the mice were used in experiments five weeks later.

[0525] 2) Administration of AAV to SCI mouse model

[0526] AAV2ul was microinjected into the L5 region of an SCI mouse model using a microsyringe (Hamilton, 705).

[0527] Example 5-1: Confirmation of morphological changes at the spinal cord injury site.

[0528] In the SCI mouse model, we introduced eight conventional differentiation factors (Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, NeuroD1) into a group (referred to as Control); eight conventional differentiation factors plus Gsta4 into a group (referred to as +Gsta4); and AAV without any differentiation factors into a group (referred to as Mock). To observe the morphological changes at the spinal cord injury site (L5) in each group, we performed crystal violet (Sigma) staining (Figure 15).

[0529] Looking at Figure 15, the mock group, which lacked differentiation factors that directly induce cross-differentiation, showed a large accumulation of inflammatory cells, forming dense scars (red dotted line). The control group, which received eight conventional differentiation factors, showed a reduction in the accumulation of cells compared to the mock group. On the other hand, in the group that received eight conventional differentiation factors and GSTA4 together, it was confirmed that the scars caused by inflammatory cells were mitigated compared to the control group.

[0530] Example 5-2: Confirmation of changes in the expression of motor neuron markers.

[0531] In the SCI mouse model, we introduced eight conventional differentiation factors (Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, NeuroD1) into a group (referred to as Control); eight conventional differentiation factors and Gsta4 into a group (referred to as +Gsta4); and AAV without differentiation factors into a group (referred to as Mock). Immunofluorescence staining was performed to observe changes in the expression of motor neuron markers at the spinal cord injury site (L5) in each group (Figures 16, 17, and 18).

[0532] Figures 16, 17, and 18 show that ChaT and Map2 expression increased approximately twice in the Control group compared to the Mock group. On the other hand, in the group to which eight conventional differentiation factors and GSTA4 were introduced together, ChaT and Map2 expression increased by more than five times compared to the Control group. This means that GSTA4 leads to higher differentiation efficiency in direct cross-differentiation from astrocytes to motor neurons compared to the Control group.

[0533] Example 5-3: Confirmation of therapeutic effect of lower body paralysis by electrophysiological analysis

[0534] Electrophysiological changes were observed in the spinal cord injury site (L5) of each of the following groups: a normal group with no spinal cord damage (referred to as Sham); a group administered AAV containing eight conventional differentiation factors (Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, NeuroD1) to an SCI mouse model (referred to as Control); a group administered AAV containing the eight conventional differentiation factors plus Gsta4 (referred to as +Gsta4); and a group of SCI mice with AAV introduced (referred to as Mock) (Figure 19).

[0535] Figure 19(a) is a photograph of a nerve cell that has undergone patch clamping.

[0536] As seen in the action potential measurement results in Figure 19(b), the action potential was 25 Hz in the sham group, but decreased to 2 Hz in the mock group, a reduction of more than 1 / 10. On the other hand, the control group, which was introduced with eight conventional differentiation factors, showed an increased action potential of 6 Hz, and the group that was introduced with both eight conventional differentiation factors and Gsta4 showed an increase of more than twice that of the control group, reaching 13 Hz.

[0537] An increase in action potentials indicates that a nerve cell has the ability to transmit signals when it receives them. Without action potentials, signal transmission is impossible. Furthermore, action potentials are the most representative characteristic of nerve cells. The generation and increase of action potentials means that differentiation into nerve cells has been successful. Therefore, the group in which eight differentiation factors and Gsta4 were introduced together showed the best differentiation into nerve cells, demonstrating that this combination is efficient for nerve cell differentiation.

[0538] As shown in Figure 19(c), the signal from presynaptic neurons was measured at 1 Hz in the mock group, 6 Hz in the control group, and 47 Hz in the +Gsta4 group.

[0539] An increase in signals from presynaptic neurons indicates increased signal transmission between neurons. This suggests that the connections between neurons severed by SCI led to the regeneration of new motor neurons. Example 5-4: Direct confirmation of cross-differentiation by behavioral analysis

[0540] The study included a group with no spinal cord injury (referred to as "Sham"), a group in which eight conventional differentiation factors (Ascl1, Brn2, Myt1l, Hb9, Isl1, Lhx3, Ngn2, NeuroD1) were introduced into the SCI mouse model (referred to as "-Gsta4"), a group in which the eight conventional differentiation factors and Gsta4 were introduced together (referred to as "+Gsta4"), and a group in which AAV was administered to the SCI mouse model (referred to as "Mock"). Changes in the BBB score were examined at each spinal cord injury site (L5) (Figure 20).

[0541] The BBB score (Basso Beattie, and Bresnahan score) in Figure 20 is a measurement method traditionally used in spinal cord injury models. It is calculated by comprehensively evaluating the shape and angle of the lower limbs, the angle of the knee, and the shape, angle, and position of the soles of the feet. The score ranges from a minimum of 0 to a maximum of 21, with a normal animal scoring 21.

[0542] The group that received only the eight conventional differentiation factors (indicated as -Gsta4) showed no difference from the mock group (BBB score of approximately 4 points). However, the group that received both the eight conventional differentiation factors and Gsta4 (indicated as +Gsta4) showed more than twice the increase compared to the -Gsta4 group at 3 weeks after AAV administration (BBB score of approximately 8 points).

[0543] In addition, changes in the Forced Swimming Test, Selfurination, Foot Printing Test, etc., were observed in each of the following groups: a normal group with no spinal cord damage (referred to as Sham); a group in which AAV was introduced into the SCI mouse model (referred to as Mock); a group administered AAV containing eight conventional differentiation factors and Gsta4 (referred to as Gsta4+); and a group administered AAV containing only eight conventional differentiation factors (referred to as Control) (Figure 21).

[0544] The forced swimming test in Figure 21(a) involved placing animal models in a water tank for 3 minutes and measuring the number of times their lower limbs moved. In the mock group, the lower limbs did not move due to spinal cord injury. However, it was confirmed that introducing the eight conventional differentiation factors along with Gsta4 increased lower limb movement by approximately 6 to 12 times.

[0545] Figures 21(b) and (c) show the results of measuring spontaneous urination ability. Spinal cord injury mice are unable to urinate on their own. In the group to which eight conventional differentiation factors and Gsta4 were introduced together, spontaneous urination was confirmed 14 or 16 days after administration of AAV.

[0546] Figure 21(d) shows the results of the foot printing test. Foot printing is an experiment in which red ink is applied to the soles of the feet of mice and their shapes are observed. In Sham's case, the soles of his feet were clearly visible (number 11 / 20cm), but in Mock's case, the shape of his feet could not be observed (number 11 / 20cm). In contrast, in the group in which the eight conventional differentiation factors and Gsta4 were introduced together, the soles of the mice's feet were clearly visible (number 5 / 20cm).

[0547] Through the results described above, it was found that Gsta4, a novel differentiation factor discovered by the inventors of this application, is an important factor for the direct cross-differentiation of somatic cells into motor neurons. Furthermore, Gsta4 has a higher differentiation efficiency than conventional differentiation factors, and when Gsta4 is used together with conventional differentiation factors, the differentiation efficiency is even higher than when conventional differentiation factors are used alone. In addition, the inventors confirmed the therapeutic effect of Gsta4 on a lower body paralysis model with spinal cord injury, suggesting that Gsta4 will play an important role in various neurological diseases in the future. [Industrial applicability]

[0548] This application can provide a novel differentiation factor for direct cross-differentiation from somatic cells to motor neurons and its applications. (Sequence List FreeText)

[0549] This relates to the Gsta4 (Glutathione S-Transferase Alpha 4) protein or the nucleic acid sequence that codes for it.

Claims

1. A composition for direct cross-differentiation from somatic cells into induced motor neurons (iMNs), The aforementioned composition, (A) Gsta4 protein or nucleic acid coding therefor; and (B) One or more proteins selected from Ascl1 (Achaete-scute homolog 1), Brn2 (POU Class 3 Homeobox 2), Myt1L (Myelin Translation Factor 1 Like), Hb9 (Homeobox HB9), ISL1 (ISL LIM homeobox 1), Lhx3 (LIM homeobox 3), Ngn2 (neurogenin 2), and NeuroD1 (Neuronal Difference 1), or nucleic acids coding therefor; A composition comprising (A) or (B), further comprising a viral capsid for transmitting (A) or (B).

2. The composition according to claim 1, wherein the somatic cells are one or more selected from fibroblasts, epithelial cells, endothelial cells, muscle cells, nerve cells, hair cells, hair root cells, hair follicle cells, oral epithelial cells, somatic cells extracted from urine, gastric mucosal cells, goblet cells, gastrin cells (G cells), B cells, pericytes, astrocytes, blood cells, and rare dendritic glial progenitor cells.

3. The composition according to claim 1, wherein the somatic cells are derived from one mammal selected from humans, dogs, cats, horses, sheep, rabbits, pigs, mice, and camels.

4. The composition according to claim 1, characterized in that (B) is selected as Hb9, Lhx3, or Ngn2.

5. The composition according to claim 1, wherein (B) is selected to be Hb9 and Lhx3; Hb9 and Ngn2; or Lhx3 and Ngn2.

6. The composition according to claim 1, wherein Hb9, Lhx3, and Ngn2 are selected in (B).

7. In the composition according to claim 1, The composition is one in which Hb9, Lhx3, Ngn2 and Isl1 are selected in (B).

8. The composition according to claim 1, wherein (B) is selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1.

9. The Gsta4 protein consists of the amino acid sequence of SEQ ID NO: 1, and the nucleic acid coding the Gsta4 protein consists of SEQ ID NO: 2 or 12; The Ascl1 protein consists of the amino acid sequence of SEQ ID NO: 17, and the nucleic acid coding the Ascl1 protein consists of SEQ ID NO: 18; The Brn2 protein consists of the amino acid sequence of SEQ ID NO: 19, and the nucleic acid coding the Brn2 protein consists of SEQ ID NO: 20; The Myt1L protein consists of the amino acid sequence of SEQ ID NO: 21, and the nucleic acid coding the Myt1L protein consists of SEQ ID NO: 22; The Hb9 protein consists of the amino acid sequence of SEQ ID NO: 13, and the nucleic acid coding the Hb9 protein consists of SEQ ID NO: 14; The Isl1 protein consists of the amino acid sequence of SEQ ID NO: 23, and the nucleic acid coding the Isl1 protein consists of SEQ ID NO: 24; The Lhx3 protein consists of the amino acid sequence of SEQ ID NO: 15, and the nucleic acid coding the Lhx3 protein consists of SEQ ID NO: 16; The Ngn2 protein consists of the amino acid sequence of SEQ ID NO: 25, and the nucleic acid coding the Ngn2 protein consists of SEQ ID NO: 26; The composition according to claim 1, wherein the NeuroD1 protein consists of the amino acid sequence of SEQ ID NO: 27, and the nucleic acid coding the NeuroD1 protein consists of SEQ ID NO:

28.

10. A composition for direct cross-differentiation from somatic cells to induced motor neurons, The aforementioned composition, Gsta4 protein or nucleic acid coding it; or It comprises Gsta4 and one or more proteins selected from Ascl1, Brn2, Myt1L, Hb9, Isl1, Lhx3, Ngn2, and NeuroD1, or nucleic acids coding therefor. A composition having the function of increasing the expression of motor neuron markers under conditions that do not induce iPSC formation.

11. The composition according to claim 10, wherein the motor neuron marker is one or more selected from NEUN, ChAT, Map2, Hb9, Synapsin, Tuj1, IsL1, PAX6, Olig2, Nkx2.2, and SMI-32.