Novel compounds, their uses, and methods for producing them, as well as compound-containing compositions, methods for producing 4-trehalosamine, and microorganisms.

Novel compounds, particularly 4-trehalosamine, address the limitations of trehalose by offering starch retrogradation inhibition, surfactant activity, blood glucose control, and efficient acid-fast bacteria staining, produced through Streptomyces sp. MK186-mF5 and chemical modifications.

JP2026110588APending Publication Date: 2026-07-02MICROBIAL CHEM RES FOUND

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
MICROBIAL CHEM RES FOUND
Filing Date
2026-03-05
Publication Date
2026-07-02

AI Technical Summary

Technical Problem

Trehalose is rapidly broken down in the body, leading to increased blood glucose levels and product spoilage, and its analogs are not available on the market, making it difficult to synthesize derivatives with specific modifications.

Method used

Development of novel compounds represented by specific general and structural formulas, including 4-trehalosamine, produced using Streptomyces sp. MK186-mF5, and chemical modifications to enhance properties such as starch retrogradation inhibition, surfactant activity, and blood glucose control.

Benefits of technology

The novel compounds provide effective starch retrogradation inhibition, surfactant properties, blood glucose control, autophagy induction, and efficient acid-fast bacteria staining, while being produced inexpensively and efficiently.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026110588000001_ABST
    Figure 2026110588000001_ABST
Patent Text Reader

Abstract

To provide protective agents with excellent effects such as starch retrogradation inhibition, prevention or inhibition of the decrease in activity of proteins during storage in a frozen or freeze-dried state, prevention or inhibition of damage or death of microorganisms during storage in a frozen or freeze-dried state, and pH buffering; surfactants with excellent surfactant properties; blood glucose control compositions that do not raise blood glucose levels when administered to individuals; autophagy inducers with excellent autophagy induction properties; staining agents for acid-fast bacteria that can easily and efficiently stain acid-fast bacteria; and protein extractants with excellent protein extraction properties. [Solution] A protective agent, surfactant composition, blood glucose control composition, autophagy inducer, acid-fast bacilli staining agent, or protein extractant characterized by containing a compound represented by general formula (1).
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This invention relates to novel compounds, or pharmaceutically acceptable salts thereof, or solvates thereof, their uses, and methods for producing them, as well as compound-containing compositions, methods for producing 4-trehalosamine, and microorganisms. [Background technology]

[0002] Trehalose is inexpensive and possesses moisturizing and protective properties, making it useful in various fields, including food. Furthermore, it has been reported to have therapeutic effects on various diseases, and its development as a pharmaceutical is being considered.

[0003] However, since trehalose is rapidly broken down into glucose by trehalase in the body, a large dose is required to achieve the aforementioned effect. This large dose of trehalose has the problem of causing an increase in blood glucose levels due to the glucose. In addition, there are problems with its impact on the symbiotic bacterial flora in the body and the fact that it is assimilated by microorganisms, which can cause product spoilage.

[0004] Therefore, there is a strong demand for a trehalose substitute that has similar effects to trehalose but is not degraded in the body. However, trehalose analogs are not available on the market, and because trehalose contains multiple hydroxyl groups with the same chemical properties in a single molecule, it is difficult to synthesize derivatives with specific modifications.

[0005] On the other hand, 4-trehalosamine, a well-known analog of trehalose, is known to have antibacterial activity, but no other uses are known (see Non-Patent Document 1). [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] THE JOURNAL OF ANTIBIOTICS, Vol. XXVII No.2, 1974, p.145 [Overview of the Initiative] [Problems that the invention aims to solve]

[0007] The present invention aims to solve the aforementioned problems of the conventional approach and achieve the following objectives. In other words, the present invention aims to provide a protective agent that excels in various functions such as starch retrogradation inhibition, prevention or inhibition of the decrease in activity of proteins during storage in a frozen or freeze-dried state, prevention or inhibition of damage or death of microorganisms during storage in a frozen or freeze-dried state, and pH buffering; a surfactant with excellent surfactant properties; a blood glucose control composition that does not raise blood glucose levels even when administered to an individual; an autophagy inducer with excellent autophagy induction properties; a staining agent for acid-fast bacteria that can easily and efficiently stain acid-fast bacteria; and a protein extractant with excellent protein extraction properties.

[0008] Furthermore, the present invention aims to provide novel compounds that are excellent in various effects, such as starch retrogradation inhibition, prevention or inhibition of the decrease in activity of proteins during storage in a frozen or freeze-dried state, prevention or inhibition of damage or death of microorganisms during storage in a frozen or freeze-dried state, pH buffering effect, excellent surfactant effect, effect of not raising blood glucose levels when administered to individuals, autophagy induction effect, acid-fast bacilli staining effect that allows for easy and efficient staining of acid-fast bacilli, and protein extraction effect, or pharmaceutically acceptable salts thereof, or solvates thereof, and compositions containing such compounds.

[0009] Furthermore, the present invention aims to provide a method for producing the aforementioned novel compound in an inexpensive, simple, and efficient manner.

[0010] Furthermore, the present invention aims to provide a method for producing 4-trehalosamine that is inexpensive, simple, and efficient.

[0011] Furthermore, the present invention aims to provide a microorganism capable of producing 4-trehalosamine. [Means for solving the problem]

[0012] The means to solve the aforementioned problem are as follows: <1> A protective agent, surfactant composition, blood glucose control composition, autophagy inducer, acid-fast bacilli staining agent, or protein extractant characterized by containing a compound represented by the following general formula (1), or pharmaceutically acceptable salts thereof, or solvates thereof: [ka] However, in the above general formula (1), R 1 -NH2, substituents represented by the following structural formula (A), substituents represented by the following structural formula (B), or -NH(CH2) m CH3, where m represents an integer from 7 to 14. [ka] [ka] However, in the above structural formula (A) or the following structural formula (B), "*" represents a bond. <2> A compound characterized by being represented by the following general formula (2), or a pharmaceutically acceptable salt thereof, or a solvate thereof: [ka] However, in the general formula (2) above, R 2This refers to substituents represented by the following structural formula (A), substituents represented by the following structural formula (B), or -NH(CH2) m CH3, where m represents an integer from 7 to 14. [ka] [ka] However, in the above structural formula (A) or the following structural formula (B), "*" represents a bond. <3> The aforementioned <2> This compound-containing composition is characterized by containing the compounds described in [reference], or pharmaceutically acceptable salts thereof, or solvates thereof. <4> Streptomyces This is a method for producing 4-trehalosamine, characterized by including a culture step in which sp. MK186-mF5 (accession number: NITE BP-03495) is cultured. <5> In the culture process, the culture medium contains at least one of 3% to 9% by mass of soluble starch, 0.001% to 0.02% by mass of zinc chloride, and 0.1% to 1% by mass of potassium chloride. <4> This is a method for producing 4-trehalosamine as described above. <6> Using 4-trehalosamine as a starting material, the amino group at the 4th position of 4-trehalosamine and CH3(CH2) p The method for producing a compound represented by the following general formula (3) is characterized by comprising the step of reacting COH (wherein p represents an integer from 6 to 13), 2-azido-1,3-dimethylimidazolinium hexafluorophosphate, 5-carboxyfluorescein N-succinimidyl ester, or D-biotin N-succinimidyl: [ka] However, in the general formula (3) above, R 3 is -N(CH2) mCH3, -N3, a substituent represented by the following structural formula (A), or a substituent represented by the following structural formula (B), where m represents an integer from 7 to 14. [ka] [ka] However, in the above structural formula (A) or the following structural formula (B), "*" represents a bond. <7> Streptomyces This microorganism, identified as sp. MK186-mF5 (accession number: NITE BP-03495), is characterized by its ability to produce 4-trehalosamine. [Effects of the Invention]

[0013] According to the present invention, the aforementioned problems of the conventional era can be solved and the aforementioned objectives can be achieved, and a protective agent with excellent various effects such as starch retrogradation inhibition, prevention or inhibition of the decrease in activity when proteins are stored in a frozen or freeze-dried state, prevention or inhibition of damage or death of microorganisms when stored in a frozen or freeze-dried state, and pH buffering effect can be provided; a surfactant with excellent surfactant properties; a blood glucose control composition that does not raise blood glucose levels even when administered to an individual; an autophagy inducer with excellent autophagy induction properties; a staining agent for acid-fast bacteria that can easily and efficiently stain acid-fast bacteria; and a protein extractant with excellent protein extraction properties can be provided.

[0014] Furthermore, according to the present invention, the aforementioned problems of the conventional approach can be solved and the aforementioned objectives can be achieved. The present invention provides novel compounds that are excellent in various effects, such as starch retrogradation inhibition, prevention or inhibition of the decrease in activity of proteins during storage in a frozen or freeze-dried state, prevention or inhibition of damage or death of microorganisms during storage in a frozen or freeze-dried state, pH buffering, excellent surfactant activity, the ability to not raise blood glucose levels when administered to an individual, autophagy induction, acid-fast bacilli staining activity that allows for easy and efficient staining of acid-fast bacilli, and protein extraction activity, or pharmaceutically acceptable salts thereof, or solvates thereof, and compound-containing compositions containing such compounds.

[0015] Furthermore, according to the present invention, it is possible to solve the aforementioned problems in the conventional methods, achieve the aforementioned objectives, and provide a method for producing the novel compound in an inexpensive, simple, and efficient manner.

[0016] Furthermore, according to the present invention, it is possible to provide a method for producing 4-trehalosamine that can solve the aforementioned problems in the conventional method, achieve the aforementioned objectives, and produce 4-trehalosamine inexpensively, simply, and efficiently.

[0017] Furthermore, according to the present invention, it is possible to solve the aforementioned problems in the conventional method, achieve the aforementioned objectives, and provide a microorganism capable of producing 4-trehalosamine. [Brief explanation of the drawing]

[0018] [Figure 1A] Figure 1A is a chart of the absorption spectrum of the compound (4-trehalosamine) represented by structural formula (1), measured by infrared spectroscopy. Vertical axis: transmittance (%T), horizontal axis: wavenumber (cm-1). [Figure 1B] Figure 1B is a chart of the proton nuclear magnetic resonance spectrum of the compound (4-trehalosamine) represented by structural formula (1), measured at 600 MHz in heavy water at 25°C. Horizontal axis: ppm units. [Figure 1C] Figure 1C is a chart of the carbon-13 nuclear magnetic resonance spectrum of the compound (4-trehalosamine) represented by structural formula (1), measured at 150 MHz in heavy water at 25°C. Horizontal axis: ppm units. [Figure 2A] Figure 2A is a chart of the absorption spectrum of the compound (IMCTA-C8) represented by structural formula (2), measured by infrared spectroscopy. Vertical axis: transmittance (%T), horizontal axis: wavenumber (cm-1). [Figure 2B] Figure 2B is a chart of the proton nuclear magnetic resonance spectrum of the compound (IMCTA-C8) represented by structural formula (2), measured at 600 MHz in deuterium methanol at 25°C. Horizontal axis: ppm units. [Figure 2C] Figure 2C is a chart of the carbon-13 nuclear magnetic resonance spectrum of the compound (IMCTA-C8) represented by structural formula (2), measured at 150 MHz in deuterium methanol at 25°C. Horizontal axis: ppm units. [Figure 3A] Figure 3A is a chart of the absorption spectrum of the compound (IMCTA-C9) represented by structural formula (3), measured by infrared spectroscopy. Vertical axis: transmittance (%T), horizontal axis: wavenumber (cm-1). [Figure 3B] Figure 3B is a chart of the proton nuclear magnetic resonance spectrum of the compound (IMCTA-C9) represented by structural formula (3), measured at 600 MHz in deuterium methanol at 25°C. Horizontal axis: ppm units. [Figure 3C] Figure 3C is a chart of the carbon-13 nuclear magnetic resonance spectrum of the compound (IMCTA-C9) represented by structural formula (3), measured at 150 MHz in deuterium methanol at 25°C. Horizontal axis: ppm units. [Figure 4A] Figure 4A is a chart of the absorption spectrum of the compound (IMCTA-C10) represented by structural formula (4), measured by infrared spectroscopy. Vertical axis: transmittance (%T), horizontal axis: wavenumber (cm-1). [Figure 4B] Figure 4B is a chart of the proton nuclear magnetic resonance spectrum of the compound (IMCTA-C10) represented by structural formula (4), measured at 600 MHz in deuterium methanol at 25°C. Horizontal axis: ppm units. [Figure 4C] Figure 4C is a chart of the carbon-13 nuclear magnetic resonance spectrum of the compound (IMCTA-C10) represented by structural formula (4), measured at 150 MHz in deuterium methanol at 25°C. Horizontal axis: ppm units. [Figure 5A] Figure 5A is a chart of the absorption spectrum of the compound (IMCTA-C11) represented by structural formula (5), measured by infrared spectroscopy. Vertical axis: transmittance (%T), horizontal axis: wavenumber (cm-1). [Figure 5B] Figure 5B is a chart of the proton nuclear magnetic resonance spectrum of the compound (IMCTA-C11) represented by structural formula (5), measured at 600 MHz in deuterium methanol at 25°C. Horizontal axis: ppm units. [Figure 5C] Figure 5C is a chart of the carbon-13 nuclear magnetic resonance spectrum of the compound (IMCTA-C11) represented by structural formula (5), measured at 150 MHz in deuterium methanol at 25°C. Horizontal axis: ppm units. [Figure 6A] Figure 6A is a chart of the absorption spectrum of the compound (IMCTA-C12) represented by structural formula (6), measured by infrared spectroscopy. Vertical axis: transmittance (%T), horizontal axis: wavenumber (cm-1). [Figure 6B] Figure 6B is a chart of the proton nuclear magnetic resonance spectrum of the compound (IMCTA-C12) represented by structural formula (6), measured at 600 MHz in deuterium methanol at 25°C. Horizontal axis: ppm units. [Figure 6C] Figure 6C is a chart of the carbon-13 nuclear magnetic resonance spectrum of the compound (IMCTA-C12) represented by structural formula (6), measured at 150 MHz in deuterium methanol at 25°C. Horizontal axis: ppm units. [Figure 7A] Figure 7A is a chart of the absorption spectrum of the compound (IMCTA-C13) represented by structural formula (7), measured by infrared spectroscopy. Vertical axis: transmittance (%T), horizontal axis: wavenumber (cm-1). [Figure 7B]Figure 7B is a chart of the proton nuclear magnetic resonance spectrum of the compound (IMCTA-C13) represented by structural formula (7), measured at 600 MHz in deuterium methanol at 25°C. Horizontal axis: ppm units. [Figure 7C] Figure 7C is a chart of the carbon-13 nuclear magnetic resonance spectrum of the compound (IMCTA-C13) represented by structural formula (7), measured at 150 MHz in deuterium methanol at 25°C. Horizontal axis: ppm units. [Figure 8A] Figure 8A is a chart of the absorption spectrum of the compound (IMCTA-C14) represented by structural formula (8), measured by infrared spectroscopy. Vertical axis: transmittance (%T), horizontal axis: wavenumber (cm-1). [Figure 8B] Figure 8B is a chart of the proton nuclear magnetic resonance spectrum of the compound (IMCTA-C14) represented by structural formula (8), measured at 600 MHz in deuterium methanol at 25°C. Horizontal axis: ppm units. [Figure 8C] Figure 8C is a chart of the carbon-13 nuclear magnetic resonance spectrum of the compound (IMCTA-C14) represented by structural formula (8), measured at 150 MHz in deuterium methanol at 25°C. Horizontal axis: ppm units. [Figure 9A] Figure 9A is a chart of the absorption spectrum of the compound (IMCTA-C15) represented by structural formula (9), measured by infrared spectroscopy. Vertical axis: transmittance (%T), horizontal axis: wavenumber (cm-1). [Figure 9B] Figure 9B is a chart of the proton nuclear magnetic resonance spectrum of the compound (IMCTA-C15) represented by structural formula (9), measured at 600 MHz in heavy DMSO at 25°C. Horizontal axis: ppm units. [Figure 9C] Figure 9C is a chart of the carbon-13 nuclear magnetic resonance spectrum of the compound (IMCTA-C15) represented by structural formula (9), measured at 150 MHz in heavy DMSO at 25°C. Horizontal axis: ppm units. [Figure 10A] Figure 10A is a chart of the absorption spectrum of the compound (IMCTA-fluorescein) represented by structural formula (10) measured by infrared spectroscopy. Vertical axis: transmittance (%T), horizontal axis: wavenumber (cm-1). [Figure 10B] Figure 10B is a chart of the proton nuclear magnetic resonance spectrum of the compound (IMCTA-fluorescein) represented by structural formula (10), measured at 600 MHz in deuterium methanol at 25°C. Horizontal axis: ppm units. [Figure 10C] Figure 10C is a chart of the carbon-13 nuclear magnetic resonance spectrum of the compound (IMCTA-fluorescein) represented by structural formula (10), measured at 150 MHz in deuterium methanol at 25°C. Horizontal axis: ppm units. [Figure 11A] Figure 11A is a chart of the absorption spectrum of the compound (IMCTA-biotin) represented by structural formula (11), measured by infrared spectroscopy. Vertical axis: transmittance (%T), horizontal axis: wavenumber (cm-1). [Figure 11B] Figure 11B is a chart of the proton nuclear magnetic resonance spectrum of the compound (IMCTA-biotin) represented by structural formula (11), measured at 600 MHz in deuterium methanol at 25°C. Horizontal axis: ppm units. [Figure 11C] Figure 11C is a chart of the carbon-13 nuclear magnetic resonance spectrum of the compound (IMCTA-biotin) represented by structural formula (11), measured at 150 MHz in deuterium methanol at 25°C. Horizontal axis: ppm units. [Figure 12A] Figure 12A is a chart of the absorption spectrum of the compound (IMCTA-azide) represented by structural formula (12), measured by infrared spectroscopy. Vertical axis: transmittance (%T), horizontal axis: wavenumber (cm-1). [Figure 12B] Figure 12B is a chart of the proton nuclear magnetic resonance spectrum of the compound (IMCTA-azide) represented by structural formula (12), measured at 600 MHz in deuterium methanol at 25°C. Horizontal axis: ppm units. [Figure 12C] Figure 12C is a chart of the carbon-13 nuclear magnetic resonance spectrum of the compound (IMCTA-azide) represented by structural formula (12), measured at 150 MHz in deuterium methanol at 25°C. Horizontal axis: ppm units. [Figure 13A]Figure 13A shows the results (phosphomolybdate staining pattern) of the detection of 4-trehalosamine in the culture medium by TLC analysis in Test Example 1. Horizontal axis: Production example number. [Figure 13B] Figure 13B shows the results of LC-MS analysis of the 4-trehalosamine content in the culture medium in Test Example 1. Horizontal axis: Production example number, Vertical axis: 4-trehalosamine production amount (mg / mL). [Figure 14A] Figure 14A shows the results of protein extraction efficiency using IMCTA-Cn in Test Example 4. Vertical axis: Extracted protein (mg / mL). [Figure 14B] Figure 14B shows the SDS-PAGE results after protein extraction with IMCTA-Cn at a final concentration of 0.05% in Test Example 4. Vertical axis: Molecular weight (kDa). [Figure 14C] Figure 14C shows the SDS-PAGE results after protein extraction with a final concentration of 0.5% IMCTA-Cn in Test Example 4. Vertical axis: Molecular weight (kDa). [Figure 14D] Figure 14D shows the results of a Western blot of membrane proteins extracted using IMCTA-Cn in Test Example 4. "0.05%" or "0.5%" in the figure indicates the final concentration of the test sample. [Figure 14E] Figure 14E shows the results of CIP activity of proteins extracted using IMCTA-Cn in Test Example 4 (n=3, mean±SD). Vertical axis: CIP activity (A420). [Figure 15A] Figure 15A shows the evaluation results of the degree of retrogradation of starch (corn starch) in enzyme assay 1 of Test Example 5 when the final concentration of the test sample was 10% (n=5, mean±SD). White circles represent the control, gray circles represent trehalose (TRH), gray triangles represent 4-trehalosamine (4TA), black squares represent sucrose (SCR), and white triangles represent glycerol (GOL). Horizontal axis: time, vertical axis: degradation efficiency (%). [Figure 15B]Figure 15B shows the evaluation results of the degree of retrogradation of starch (corn starch) in enzyme assay 2 of Test Example 5 when the final concentration of the test sample was 2% (n=5, mean±SD). White circles represent the control, gray circles represent trehalose (TRH), gray triangles represent 4-trehalosamine (4TA), black squares represent sucrose (SCR), and white triangles represent glycerol (GOL). Horizontal axis: time, vertical axis: degradation efficiency (%). [Figure 15C] Figure 15C shows the results of the evaluation of the degree of retrogradation of starch (corn starch) in enzyme assay 2 of Test Example 5 when the final concentration of the test sample was 5% (n=5, mean±SD). White circles represent the control, gray circles represent trehalose (TRH), gray triangles represent 4-trehalosamine (4TA), black squares represent sucrose (SCR), and white triangles represent glycerol (GOL). Horizontal axis: time, vertical axis: degradation efficiency (%). [Figure 15D] Figure 15D shows the evaluation results of the degree of retrogradation of starch (corn starch) in enzyme assay 2 of Test Example 5 when the final concentration of the test sample was 15% (n=5, mean±SD). White circles represent the control, gray circles represent trehalose (TRH), gray triangles represent 4-trehalosamine (4TA), black squares represent sucrose (SCR), and white triangles represent glycerol (GOL). Horizontal axis: time, vertical axis: degradation efficiency (%). [Figure 15E] Figure 15E shows the evaluation results of the degree of retrogradation of starch (potato starch) in enzyme assay 3 of Test Example 5 when the final concentration of the test sample was 10% (n=5, mean±SD). White circles represent the control, black circles represent trehalose (TRH), gray triangles represent 4-trehalosamine (4TA), black squares represent sucrose (SCR), and white triangles represent glycerol (GOL). Horizontal axis: time, vertical axis: degradation efficiency (%). [Figure 15F]Figure 15F shows the results of the evaluation of the degree of retrogradation of starch (potato starch) in enzyme assay 3 of Test Example 5 when the final concentration of the test sample was 15% (n=5, mean±SD). White circles represent the control, black circles represent trehalose (TRH), gray triangles represent 4-trehalosamine (4TA), black squares represent sucrose (SCR), and white triangles represent glycerol (GOL). Horizontal axis: time, vertical axis: degradation efficiency (%). [Figure 15G] Figure 15G shows the evaluation results of the degree of retrogradation of starch (rice flour) when the final concentration of the test sample was 10% in enzyme assay 4 of Test Example 5 (n=5, mean±SD). White circles represent the control, black circles represent trehalose (TRH), gray triangles represent 4-trehalosamine (4TA), black squares represent sucrose (SCR), and white triangles represent glycerol (GOL). Horizontal axis: time, vertical axis: degradation efficiency (%). [Figure 15H] Figure 15H shows the evaluation results of the degree of retrogradation of starch (rice flour) in enzyme assay 4 of Test Example 5 when the final concentration of the test sample was 15% (n=5, mean±SD). White circles represent the control, black circles represent trehalose (TRH), gray triangles represent 4-trehalosamine (4TA), black squares represent sucrose (SCR), and white triangles represent glycerol (GOL). Horizontal axis: time, vertical axis: degradation efficiency (%). [Figure 15I] Figure 15I shows the results of evaluating the degree of retrogradation of starch (wheat flour) in enzyme assay 5 of Test Example 5 when the final concentration of the test sample was 10% (n=5, mean±SD). White circles represent the control, black circles represent trehalose (TRH), gray triangles represent 4-trehalosamine (4TA), black squares represent sucrose (SCR), and white triangles represent glycerol (GOL). Horizontal axis: time, vertical axis: degradation efficiency (%). [Figure 15J]Figure 15J shows the evaluation results of the degree of retrogradation of starch (wheat flour) when the final concentration of the test sample was 15% in enzyme assay 5 of test example 5 (n=5, mean±SD). White circles represent the control, black circles represent trehalose (TRH), gray triangles represent 4-trehalosamine (4TA), black squares represent sucrose (SCR), and white triangles represent glycerol (GOL). Horizontal axis: time, vertical axis: degradation efficiency (%). [Figure 15K] Figure 15K shows the results of dynamic viscoelasticity measurements in Test Example 5 (n=5, mean±SD). White circles represent the control, gray circles represent trehalose (TRH), gray triangles represent 4-trehalosamine (4TA), black squares represent sucrose (SCR), and white triangles represent glycerol (GOL). Horizontal axis: time, vertical axis: Tanδ. [Figure 16A] Figure 16A shows the evaluation results of CIP protective activity in Test Example 6-1 (n=3, mean±SD). Horizontal axis: Test sample number, Vertical axis: CIP activity (A420). [Figure 16B] Figure 16B shows the evaluation results of ADH protective activity in Test Example 6-2 (n=3, mean±SD). Horizontal axis: Test sample number, Vertical axis: ADH activity (A340 test sample / A340 control). [Figure 17A] Figure 17A shows the evaluation results of the baker's yeast protective activity in Test Example 7-1. [Figure 17B] Figure 17B shows the evaluation results of the E. coli protective activity in Test Example 7-2. [Figure 17C] Figure 17C shows the evaluation results of the Bacillus subtilis protective activity in Test Example 7-3. [Figure 17D] Figure 17D shows the evaluation results of mycobacterial protective activity in Test Example 7-4. [Figure 18]Figure 18 shows the evaluation results of pH buffering action in Test Example 8. The gray circles represent the results for 4-trehalosamine (4TA), the black circles for trehalose (TRH), the white triangles (△) for Tris, the white squares for MES, and the white inverted triangles (▽) for HEPES. The horizontal axis is the amount of sodium hydride or hydrogen chloride added (μL), and the vertical axis is pH. [Figure 19A] Figure 19A shows the evaluation results of degradation by trehalase in Test Example 9-1. The black circles represent the results for trehalose (TRH), and the black squares represent the results for 4-trehalosamine (4TA). The horizontal axis is the substrate concentration (mM), and the vertical axis is the free glucose concentration (mM). [Figure 19B] Figure 19B is a magnified view of the graph for 4-trehalosamine (4TA) in Figure 19A. The black squares indicate the results for 4-trehalosamine (4TA). Horizontal axis: substrate concentration (mM), Vertical axis: free glucose concentration (mM). [Figure 19C] Figure 19C shows the results of a Western blot confirming trehalase expression in cultured cells in Test Example 9-2. [Figure 19D] Figure 19D shows the results of confirming the degradation rate by trehalose in Test Example 9-2. White circles represent the reaction solution of trehalose with human pancreatic ductal carcinoma cell extract KP4 (TRH C), black circles represent the reaction solution of trehalose with cell extract of KP4-TREH10 strain (TRH T), white triangles represent the reaction solution of 4-trehalosamine with human pancreatic ductal carcinoma cell extract KP4 (4TA C), and black triangles represent the reaction solution of 4-trehalosamine with cell extract of KP4-TREH10 strain (4TA T). Horizontal axis: time, vertical axis: survival rate (%). [Figure 19E] Figure 19E shows the cumulative urinary excretion of 4-trehalosamine over time in Test Example 9-3. White circles represent the results for trehalose (TRH), and black circles represent the results for 4-trehalosamine (4TA). Horizontal axis: time, Vertical axis: cumulative urinary excretion (mg / mouse). [Figure 19F]Figure 19F shows the cumulative fecal excretion of 4-trehalosamine over time in Test Example 9-3. White circles represent the results for trehalose (TRH), and black circles represent the results for 4-trehalosamine (4TA). Horizontal axis: time, Vertical axis: cumulative fecal excretion (mg / mouse). [Figure 19G] Figure 19G shows the blood concentration of 4-trehalosamine in individuals administered 4-trehalosamine in Test Example 9-3. Horizontal axis: time, Vertical axis: 4-trehalosamine (μg / mL) (n=5). [Figure 19H] Figure 19H shows the blood concentration of trehalose in individuals administered trehalose in Test Example 9-3. Horizontal axis: time, Vertical axis: trehalose (μg / mL) (n=5). [Figure 19I] Figure 19I shows the blood glucose levels of mice (n=5) administered 4-trehalosamine in Test Example 9-3. Horizontal axis: time, Vertical axis: blood glucose (mg / dL). [Figure 19J] Figure 19J shows the blood glucose levels of mice (n=5) administered trehalose in Test Example 9-3. Horizontal axis: time, Vertical axis: blood glucose (mg / dL). [Figure 20A] Figure 20A shows the results of Western blotting to confirm the expression and phosphorylation patterns of autophagy-related proteins when human ovarian cancer cells OVK18 were treated with 4-trehalosamine in Test Example 10-1. [Figure 20B] Figure 20B shows the results of Western blotting to confirm the expression and phosphorylation patterns of autophagy-related proteins when human ovarian cancer cells OVK18 were treated with a trehalose analog (IMCTA-Cn) in Test Example 10-1. [Figure 20C] Figure 20C shows the results of Western blotting to confirm the expression and phosphorylation patterns of autophagy-related proteins when human ovarian cancer cells OVK18 were treated with a trehalose analog (IMCTA-Cn) in Test Example 10-1. [Figure 20D]Figure 20D shows the results of Western blotting to confirm the expression and phosphorylation patterns of autophagy-related proteins when human malignant melanoma cells (Mewo) were treated with 4-trehalosamine in Test Example 10-1. [Figure 20E] Figure 20E shows the results of Western blotting to confirm the expression and phosphorylation patterns of autophagy-related proteins when human malignant melanoma cells (Mewo) were treated with a trehalose analog (IMCTA-Cn) in Test Example 10-1. [Figure 20F] Figure 20F shows the results of Western blotting to confirm the expression and phosphorylation patterns of autophagy-related proteins when human malignant melanoma cells (Mewo) were treated with a trehalose analog (IMCTA-Cn) in Test Example 10-1. [Figure 21A] Figure 21A shows the results of Western blotting to confirm the expression of autophagy-related proteins LC3-I and LC3-II when human ovarian cancer cells OVK18 were treated with 4-trehalosamine or a trehalose analog (IMCTA-C14) in the presence of an autophagy inhibitor (BM or CQ) in Test Example 10-2, and the results of calculating the expression levels (expression ratios) of LC3-II in each compound-treated group relative to the expression level of the control group (n=10, mean±SD) based on image analysis (n=10, mean±SD). [Figure 21B] Figure 21B shows the results of Western blotting to confirm the expression of autophagy-related proteins LC3-I and LC3-II when human malignant melanoma cells Mewo were treated with 4-trehalosamine or a trehalose analog (IMCTA-C14) in the presence of an autophagy inhibitor (BM or CQ) in Test Example 10-2, and the results of calculating the expression levels (expression ratios) of LC3-II in each compound-treated group relative to the expression level of the control group (n=10, mean±SD) based on image analysis (n=10, mean±SD). [Figure 22A]Figure 22A shows the results of Western blotting to confirm the expression of aggregated protein Q74 when neuroblastoma cells SH-SY5Y were treated with 4-trehalosamine or a trehalose analog (IMCTA-C14) in Test Example 10-3, and the results of calculating the Q74 expression levels (expression ratios) of each compound-treated group relative to the control group's Q74 expression level (n=5, mean±SD) based on image analysis (n=5, mean±SD). [Figure 22B] Figure 22B shows the results of Western blotting to confirm the expression of the aggregated protein SynA53T when neuroblastoma cells SH-SY5Y were treated with 4-trehalosamine or a trehalose analog (IMCTA-C14) in Test Example 10-3, and the results of calculating the expression levels (expression ratios) of SynA53T in each compound-treated group relative to the expression level of the control group (n=5, mean±SD) based on image analysis (n=5, mean±SD). [Figure 22C] Figure 22C shows the results of Western blotting to confirm the expression of aggregated protein Q74 when human neuroblastoma cells NH-12 were treated with 4-trehalosamine or a trehalose analog (IMCTA-C14) in Test Example 10-3, and the results of calculating the Q74 expression levels (expression ratios) of each compound-treated group relative to the control group's Q74 expression level (n=5, mean±SD) based on image analysis (n=5, mean±SD). [Figure 22D] Figure 22D shows the results of Western blotting to confirm the expression of the aggregated protein SynA53T when human neuroblastoma cells NH-12 were treated with 4-trehalosamine or a trehalose analog (IMCTA-C14) in Test Example 10-3, and the results of calculating the expression levels (expression ratios) of SynA53T in each compound-treated group relative to the expression level of the control group (n=5, mean±SD) based on image analysis (n=5, mean±SD). [Figure 23A]Figure 23A shows the results of Western blotting to confirm the expression and nuclear translocation of the autophagy-related transcription factor TFEB when human ovarian cancer cells OVK18 were treated with 4-trehalosamine or a trehalose analog (IMCTA-C14) in Test Example 10-4. [Figure 23B] Figure 23B shows the results of Western blotting in Test Example 10-4, where human malignant melanoma cells (Mewo) were treated with 4-trehalosamine or a trehalose analog (IMCTA-C14) to confirm the expression and nuclear translocation of the autophagy-related transcription factor TFEB. [Figure 23C] Figure 23C shows the results of immunohistochemical staining to confirm the expression and nuclear translocation of the autophagy-related transcription factor TFEB when human ovarian cancer cells OVK18 were treated with 4-trehalosamine or a trehalose analog (IMCTA-C14) in Test Example 10-4. [Figure 23D] Figure 23D shows the results of immunohistochemical staining to confirm the expression and nuclear translocation of the autophagy-related transcription factor TFEB when human malignant melanoma cells (Mewo) were treated with 4-trehalosamine or a trehalose analog (IMCTA-C14) in Test Example 10-4. [Figure 24A] Figure 24A shows the results of staining Mycobacterium smegmatis with a trehalose analog (IMCTA-fluorescein) in Test Example 11-1. [Figure 24B] Figure 24B shows the results of staining Mycobacterium smegmatis with a trehalose analog (IMCTA-biotin) in Test Example 11-1. [Figure 24C] Figure 24C shows the results of staining Mycobacterium smegmatis with a trehalose analog (IMCTA-azide) in Test Example 11-1. [Figure 25A]Figure 25A shows the fluorescence intensity per unit amount of bacterial cells when Mycobacterium smegmatis was stained with a trehalose analog (IMCTA-fluorescein) in Test Example 11-1 (n=3, mean±SD). [Figure 25B] Figure 25B shows the fluorescence intensity per unit amount of bacterial cells when Mycobacterium smegmatis was stained with a trehalose analog (IMCTA-biotin) in Test Example 11-1 (n=3, mean±SD). [Figure 25C] Figure 25C shows the fluorescence intensity per unit amount of bacterial cells when Mycobacterium smegmatis was stained with a trehalose analog (IMCTA-azide) in Test Example 11-1 (n=3, mean±SD). [Figure 26A] Figure 26A shows the results of TLC analysis (phosphomolybdate staining pattern) of lipid components of Mycobacterium smegmatis cells stained with a trehalose analog (IMCTA-fluorescein) in Test Example 11-2. [Figure 26B] Figure 26B shows the results of TLC analysis (fluorescence detection pattern) of lipid components of Mycobacterium smegmatis cells stained with a trehalose analog (IMCTA-fluorescein) in Test Example 11-2. [Figure 27A] Figure 27A shows the results of testing the remaining percentage of 4-trehalosamine in the culture medium of 12 types of microorganisms cultured in the presence of 4-trehalosamine in Test Example 12-1. Vertical axis: Remaining percentage (%). [Figure 27B] Figure 27B shows the results of culturing 12 types of microorganisms in the presence of 4-trehalosamine in Test Example 12-1, confirming their growth. Vertical axis: A620. [Figure 28A] Figure 28A shows the binding model of trehalose to human trehalase in Test Example 13. [Figure 28B]Figure 28B is a diagram showing the binding model of 4-trehalosamine to human trehalase in Test Example 13.

Mode for Carrying Out the Invention

[0019] (Novel compound, or pharmaceutically acceptable salt thereof, or solvate thereof) The compound of the present invention, or pharmaceutically acceptable salt thereof, or solvate thereof is a compound represented by the following general formula (2), or pharmaceutically acceptable salt thereof, or solvate thereof, and is a novel compound found by the present inventors, or pharmaceutically acceptable salt thereof, or solvate thereof.

Chemical formula

Chemical formula

Chemical formula

[0020] <IMCTA-Fluorescein> In the general formula (2), when R 2 is the substituent represented by the structural formula (A), it is a compound represented by the following structural formula (10), or pharmaceutically acceptable salt thereof, or solvate thereof. The compound represented by the following structural formula (10) may hereinafter be referred to as "IMCTA-Fluorescein". The physicochemical properties of the IMCTA-Fluorescein are as shown in the following Synthesis Example 9.

Chemical formula

[0021] <IMCTA-ビオチン> In the above general formula (2), R 2 When the substituent is represented by the above structural formula (B), the compound is represented by the following structural formula (11), or a pharmaceutically acceptable salt thereof, or a solvate thereof. The compound represented by the following structural formula (11) may hereinafter be referred to as "IMCTA-biotin". The physicochemical properties of IMCTA-biotin are as shown in Synthesis Example 10 below. [ka]

[0022] -Applications- The compounds represented by structural formula (10) or (11), or pharmaceutically acceptable salts thereof, or solvates thereof, have an acid-fast staining effect that can easily and efficiently stain acid-fast bacteria, as shown in the test examples described later. For this reason, they can be suitably used as active ingredients in the acid-fast staining agents of the present invention, as described later.

[0023] <imcta-cn> In the above general formula (2), R 2 -NH(CH2) m If the substituent is represented by CH3, it is a compound represented by any of the following structural formulas (2) to (9), or a pharmaceutically acceptable salt thereof, or a solvate thereof. Hereinafter, compounds in which m is an integer from 7 to 14, or pharmaceutically acceptable salts thereof, or solvates thereof may be collectively referred to as "IMCTA-Cn". In "IMCTA-Cn", "n" is an integer, and in the general formula (2) above, substituent R 2 -NH(CH2) m This matches the integer "m+1" when CH3 is selected.

[0024] The aforementioned m is 7 (i.e., R 2 When is a substituent represented by -NH(CH2)7CH3, the compound is represented by the following structural formula (2), or a pharmaceutically acceptable salt thereof, or a solvate thereof. Hereinafter, it may be referred to as "IMCTA-C8". The physicochemical properties of IMCTA-C8 are as shown in Synthesis Example 1 below. [ka]

[0025] The aforementioned m is 8 (i.e., R 2 When is a substituent represented by -NH(CH2)8CH3, the compound is represented by the following structural formula (3), or a pharmaceutically acceptable salt thereof, or a solvate thereof. Hereinafter, it may be referred to as "IMCTA-C9". The physicochemical properties of IMCTA-C9 are as shown in Synthesis Example 2 below. [ka]

[0026] The aforementioned m is 9 (i.e., R 2 When the substituent is represented by -NH(CH2)9CH3, the compound is represented by the following structural formula (4), or a pharmaceutically acceptable salt thereof, or a solvate thereof. Hereinafter, it may be referred to as "IMCTA-C10". The physicochemical properties of IMCTA-C10 are as shown in Synthesis Example 3 below. [ka]

[0027] The aforementioned m is 10 (i.e., R 2 -NH(CH2) 10 The substituent represented by CH3 is the compound shown in structural formula (5) below, or a pharmaceutically acceptable salt thereof, or a solvate thereof. Hereinafter, it may be referred to as "IMCTA-C11". The physicochemical properties of IMCTA-C11 are as shown in synthesis example 4 below. [ka]

[0028] The aforementioned m is 11 (i.e., R 2 -NH(CH2) 11 The substituent represented by CH3 is the compound shown in structural formula (6) below, or a pharmaceutically acceptable salt thereof, or a solvate thereof. Hereinafter, it may be referred to as "IMCTA-C12". The physicochemical properties of IMCTA-C12 are as shown in synthesis example 5 below. [ka]

[0029] The aforementioned m is 12 (i.e., R 2 -NH(CH2) 12 The substituent represented by CH3 is the compound shown in structural formula (7) below, or a pharmaceutically acceptable salt thereof, or a solvate thereof. Hereinafter, it may be referred to as "IMCTA-C13". The physicochemical properties of IMCTA-C13 are as shown in synthesis example 6 below. [ka]

[0030] The aforementioned m is 13 (i.e., R 2 -NH(CH2) 13 The substituent represented by CH3 is the compound shown in structural formula (8) below, or a pharmaceutically acceptable salt thereof, or a solvate thereof. Hereinafter, it may be referred to as "IMCTA-C14". The physicochemical properties of IMCTA-C14 are as shown in synthesis example 7 below. [ka]

[0031] The aforementioned m is 14 (i.e., R 2 -NH(CH2) 14 The substituent represented by CH3 is the compound shown in structural formula (9) below, or a pharmaceutically acceptable salt thereof, or a solvate thereof. Hereinafter, it may be referred to as "IMCTA-C15". The physicochemical properties of IMCTA-C15 are as shown in synthesis example 8 below. [ka]

[0032] -Applications- Compounds represented by any of the structural formulas (2) to (9) above, or pharmaceutically acceptable salts thereof, or solvates thereof, have excellent surfactant activity and excellent autophagy-inducing activity, as shown in the test examples described later. For this reason, they can be suitably used as active ingredients in the surfactant compositions and protein extractants and autophagy-inducing agents of the present invention, as described later.

[0033] Whether the compound has the structure of the compound represented by general formula (2), or a pharmaceutically acceptable salt thereof, or a solvate thereof, can be confirmed by various analytical methods selected as appropriate. Examples include mass spectrometry, ultraviolet spectroscopy, infrared spectroscopy, proton nuclear magnetic resonance spectroscopy, carbon-13 nuclear magnetic resonance spectroscopy, and elemental analysis. These analytical methods may be used individually or in combination of two or more. Although some errors may occur in the measured values ​​obtained by each of these analytical methods, a person skilled in the art can easily identify whether the compound has the structure of the compound represented by general formula (2), or a pharmaceutically acceptable salt thereof, or a solvate thereof.

[0034] The aforementioned salts are not particularly limited as long as they are pharmaceutically acceptable and can be appropriately selected according to the purpose. Examples include hydrohalides such as hydrofluoric acid, hydrochloride, hydrobromide, and hydroiodide; inorganic salts such as sulfates, nitrates, phosphates, perchlorates, and carbonates; carboxylates such as acetates, trichloroacetates, trifluoroacetates, hydroxyacetates, lactates, citrates, tartrates, oxalates, benzoates, mandelates, butyrates, maleates, propionates, formates, and malates; amino acid salts such as arginates, aspartates, and glutamates; and sulfonates such as methanesulfonates and p-toluenesulfonates.

[0035] The solvate is not particularly limited and can be appropriately selected depending on the purpose, for example, hydrates and ethanolates.

[0036] The compounds represented by the general formula (2), or pharmaceutically acceptable salts thereof, or solvates thereof, can be obtained by appropriate chemical synthesis. There are no particular limitations on the method for chemically synthesizing the compounds represented by the general formula (2), or pharmaceutically acceptable salts thereof, or solvates thereof, and a method can be appropriately selected from known synthesis methods depending on the purpose, but they can be preferably obtained by the compound production method of the present invention described later.

[0037] (Method of producing compounds) The present invention provides a method for producing the compound using 4-trehalosamine as a starting material, and the amino group at the 4th position of 4-trehalosamine and CH3(CH2) p The process includes a step of reacting COH (where p represents an integer from 6 to 13), 2-azido-1,3-dimethylimidazolinium hexafluorophosphate, 5-carboxyfluorescein N-succinimidyl ester, or D-biotin N-succinimidyl (hereinafter sometimes referred to as the "reaction step"), and further includes other steps as necessary. [ka] However, in the general formula (3) above, R 3 is -N(CH2) m CH3, -N3, a substituent represented by the following structural formula (A), or a substituent represented by the following structural formula (B), where m represents an integer from 7 to 14. [ka] [ka] However, in the above structural formula (A) or the following structural formula (B), "*" represents a bond.

[0038] As the starting material, 4-trehalosamine may be a commercially available product, obtained from microorganisms that produce 4-trehalosamine, or synthesized as appropriate by chemical synthesis. However, the 4-trehalosamine obtained by the method for producing 4-trehalosamine of the present invention, described later, is preferred because it is simple, inexpensive, and efficient in obtaining large quantities of 4-trehalosamine.

[0039] <4-The amino group at the 4th position of trehalosamine and CH3(CH2) p Reaction with COH (where p represents an integer between 6 and 13) The amino group at the 4th position of 4-trehalosamine and CH3(CH2) p There are no particular restrictions on the method of reacting with CO, and any known method can be appropriately selected. For example, an aqueous solution of 4-trehalosamine and CH3(CH2) dissolved in a solvent. p One method involves mixing with COH, allowing it to stand, then adding an aqueous solution of sodium borohydride, and allowing it to stand further.

[0040] The amino group at the 4th position of the aforementioned 4-trehalosamine and CH3(CH2) p There are no particular restrictions on the reaction conditions such as reaction temperature and reaction time in the reaction with COH, nor on the compounds used, their amounts, or the solvent; these can be appropriately selected according to the purpose. 4-Trehalosamine aqueous solution and CH3(CH2) p Examples of reaction temperatures and reaction times when the mixture with COH is allowed to stand include 20°C to 45°C and 1 to 72 hours. Furthermore, when the solution of sodium borohydride is added and allowed to stand, the reaction temperature and reaction time can be, for example, 20°C to 45°C for 1 to 72 hours. The aforementioned solvent consists of the amino group at the 4th position of 4-trehalosamine and CH3(CH2) p As long as it can react with COH, there are no particular restrictions, and it can be appropriately selected depending on the purpose. Examples include lower alcohols such as 1-propanol, 2-propanol, methanol, and ethanol, and dimethyl sulfoxide (DMSO). These may be used individually or in combination of two or more.

[0041] As a result of the above reaction, in the general formula (3), R 3 However, -N(CH2) m A compound (IMCTA-Cn) can be obtained in which CH3 and m represents an integer from 7 to 14. In the above general formula (3), R 3 However, -N(CH2) m A compound that is CH3 and in which m is an integer from 7 to 14 is, in the section "(novel compounds, or pharmaceutically acceptable salts thereof, or solvates thereof)", in the general formula (2), R 2 However, -NH(CH2) m It is CH3, and the case is the same as when m represents an integer from 7 to 14, and its physicochemical properties are also the same.

[0042] <Reaction of the amino group at position 4 of 4-trehalosamine with 2-azido-1,3-dimethylimidazolinium hexafluorophosphate> There are no particular restrictions on the method for reacting the amino group at the 4th position of 4-trehalosamine with 2-azido-1,3-dimethylimidazolinium hexafluorophosphate, and any known method can be appropriately selected. For example, one method involves mixing an aqueous solution of 4-trehalosamine with a DMSO solution of 2-azido-1,3-dimethylimidazolinium hexafluorophosphate and a DMSO solution of N,N-dimethyl-4-aminopyridine (DMAP), and allowing it to stand.

[0043] There are no particular restrictions on the reaction conditions, such as reaction temperature and reaction time, as well as the compounds used, their amounts, and solvents in the reaction between the amino group at the 4th position of 4-trehalosamine and 2-azido-1,3-dimethylimidazolinium hexafluorophosphate, and these can be appropriately selected according to the purpose. There are no particular restrictions on the reaction temperature and reaction time when mixing an aqueous solution of 4-trehalosamine, a DMSO solution of 2-azido-1,3-dimethylimidazolinium hexafluorophosphate, and a DMSO solution of DMAP and then allowing them to stand. These can be appropriately selected depending on the purpose, for example, at 20°C to 25°C for 2 to 72 hours.

[0044] <<IMCTA-アジド> > As a result of the above reaction, in the general formula (3), R 3 However, compounds with substituents represented by -N3 can be obtained. In the above general formula (3), R 3 However, the substituent represented by -N3 is the compound shown in structural formula (12) below. Hereinafter, it may be referred to as "IMCTA-azide". The physicochemical properties of the IMCTA-azide are as shown in synthesis example 11 below. [ka]

[0045] <Reaction between the amino group at position 4 of 4-trehalosamine and 5-carboxyfluorescein N-succinimidyl ester> There are no particular restrictions on the method for reacting the amino group at the 4th position of 4-trehalosamine with 5-carboxyfluorescein N-succinimidyl ester, and any known method can be appropriately selected. For example, one method involves mixing an aqueous solution of 4-trehalosamine with 5-carboxyfluorescein N-succinimidyl ester dissolved in a solvent and allowing it to stand.

[0046] There are no particular restrictions on the reaction conditions, such as reaction temperature and reaction time, as well as the compounds used, their amounts, and solvents in the reaction between the amino group at the 4th position of 4-trehalosamine and 5-carboxyfluorescein N-succinimidyl ester. These can be appropriately selected according to the purpose. There are no particular restrictions on the reaction temperature and reaction time when mixing an aqueous solution of 4-trehalosamine with a DMSO solution of 5-carboxyfluorescein N-succinimidyl ester and allowing it to stand. These can be appropriately selected depending on the purpose, for example, at 20°C to 45°C for 24 to 72 hours. The solvent is not particularly limited as long as it can react with the amino group at the 4th position of 4-trehalosamine and 5-carboxyfluorescein N-succinimidyl ester, and can be appropriately selected depending on the purpose. Examples include methanol, DMSO, and dimethylformamide. These may be used individually or in combination of two or more.

[0047] As a result of the above reaction, in the general formula (3), R 3 However, a compound with a substituent represented by the above structural formula (A) can be obtained. In the above general formula (3), R 3 However, the compound which is a substituent represented by the structural formula (A) is, in the section "(novel compounds, or pharmaceutically acceptable salts thereof, or solvates thereof)", R in the general formula (2) 2 However, this is the same as when it is a substituent represented by the structural formula (A) above, and its physicochemical properties are also the same.

[0048] <Reaction between the amino group at position 4 of 4-trehalosamine and D-biotin N-succinimidyl> There are no particular restrictions on the method for reacting the amino group at the 4th position of 4-trehalosamine with D-biotin N-succinimidyl, and any known method can be appropriately selected. For example, one method involves mixing an aqueous solution of 4-trehalosamine with D-biotin N-succinimidyl dissolved in a solvent and allowing it to stand.

[0049] There are no particular restrictions on the reaction conditions, such as reaction temperature and reaction time, as well as the compounds used, their amounts, and solvents in the reaction between the amino group at the 4th position of 4-trehalosamine and D-biotin N-succinimidyl. These can be appropriately selected according to the purpose. When mixing an aqueous solution of 4-trehalosamine with a DMSO solution of D-biotin N-succinimidyl and allowing it to stand, the reaction temperature and reaction time can be, for example, 20°C to 45°C for 24 hours to 72 hours. The solvent is not particularly limited as long as it can react with the amino group at position 4 of 4-trehalosamine and D-biotin N-succinimidyl, and can be appropriately selected depending on the purpose. Examples include DMSO and dimethylformamide. These may be used individually or in combination of two or more.

[0050] As a result of the above reaction, in the general formula (3), R 3 However, a compound with a substituent represented by the above structural formula (B) can be obtained. In the above general formula (3), R 3 However, the compound which is a substituent represented by the structural formula (B) is, in the section "(novel compounds, or pharmaceutically acceptable salts thereof, or solvates thereof)", R in the general formula (2) 2 However, this is the same as when it is a substituent represented by the structural formula (B) above, and its physicochemical properties are also the same.

[0051] <Other processes> The aforementioned other processes are not particularly limited and can be appropriately selected depending on the purpose, for example, a purification process.

[0052] -Purification process- The purification step is a step of purifying and isolating the compound obtained in the reaction step. There are no particular restrictions on the purification and isolation methods, and they can be appropriately selected depending on the purpose. Examples include liquid-liquid separation, distillation, sublimation, precipitation, crystallization, silica gel column chromatography using normal-phase or reverse-phase silica gel as a packing material, column chromatography using ion exchange resin, column chromatography using cellulose, etc., preparative thin-layer chromatography, and high-performance liquid chromatography. These may be used individually or in combination of two or more. The compounds obtained in the above manufacturing process can be used in subsequent processes as appropriate without further isolation and purification.

[0053] Whether or not the obtained compound has the structure represented by the general formula (3) can be confirmed by various analytical methods selected as appropriate. There are no particular restrictions on the analytical methods, and they can be selected as appropriate depending on the purpose. Examples include mass spectrometry, ultraviolet spectroscopy, infrared spectroscopy, proton nuclear magnetic resonance spectroscopy, carbon-13 nuclear magnetic resonance spectroscopy, elemental analysis, and other analytical methods. One analytical method may be used alone, or two or more may be used in combination. Although there may be some errors in the measured values ​​obtained by each of the analytical methods, a person skilled in the art can easily identify that the compound has the structure represented by the general formula (3).

[0054] (Compound-containing composition) The compound-containing composition of the present invention comprises at least the compound represented by the general formula (2) of the present invention, or a pharmaceutically acceptable salt thereof, or a solvate thereof, and optionally further comprises other components. The compounds represented by the general formula (2) above, or pharmaceutically acceptable salts thereof, or solvates thereof may be used individually or in combination of two or more.

[0055] <Compounds represented by general formula (2), or pharmaceutically acceptable salts thereof, or solvates thereof> The compounds represented by the general formula (2) above, or pharmaceutically acceptable salts thereof, or solvates thereof, are the compounds represented by the general formula (2) of the present invention described above, or pharmaceutically acceptable salts thereof, or solvates thereof. There are no particular restrictions on the total content of the compound represented by general formula (2), or pharmaceutically acceptable salts thereof, or solvates thereof in the compound-containing composition, and can be appropriately selected depending on the purpose. The compound-containing composition may consist only of the compound represented by general formula (2), or pharmaceutically acceptable salts thereof, or solvates thereof.

[0056] <Other ingredients> The aforementioned other components are not particularly limited as long as they do not impair the effects of the present invention, and can be appropriately selected according to the purpose. Examples include the components listed under "-Other Components-" for each agent described in the section "(Protective agents, surfactant compositions, blood glucose control compositions, autophagy inducers, staining agents for mycobacteria, or protein extractants)" described later.

[0057] There are no particular restrictions on the content of the other components in the compound-containing composition, and they can be appropriately selected according to the purpose, within a range that does not impair the effects of the compound represented by general formula (2), or pharmaceutically acceptable salts thereof, or solvates thereof.

[0058] -Applications- A compound-containing composition comprising a compound represented by any of the structural formulas (2) to (9), or a pharmaceutically acceptable salt thereof, or a solvate thereof, has excellent surfactant activity and excellent protein extraction activity, and is therefore suitably used as an active ingredient in, for example, surfactant compositions and protein extractants. A compound-containing composition comprising a compound represented by structural formula (10) or (11), or a pharmaceutically acceptable salt thereof, or a solvate thereof, has the effect of easily and efficiently staining or labeling mycobacteria, and is therefore suitably used, for example, as an active ingredient in a staining agent for mycobacteria.

[0059] The compound-containing composition may be used alone or in combination with a pharmaceutical product containing other active ingredients. Furthermore, the compound-containing composition may be used in a compounded state within a composition containing other active ingredients. There are no particular limitations on the composition containing the aforementioned other components as active ingredients, and they can be appropriately selected depending on the purpose. Examples include food and beverages, pharmaceuticals, cosmetics, and reagents.

[0060] (4-Method for producing trehalosamine) The present invention relates to a method for producing 4-trehalosamine, which includes a culture step and, if necessary, other steps. The method for producing 4-trehalosamine is advantageous in that it allows for the simple, easy, and efficient production of 4-trehalosamine. The 4-trehalosamine is a compound represented by the following structural formula (1). [ka]

[0061] <Culture process> The aforementioned culture step is, Streptomyces This is the process of culturing sp. MK186-mF5 (accession number: NITE BP-03495).

[0062] In the aforementioned culture step, Streptomyces sp. MK186-mF5 can have its 4-trehalosamine production capacity further enhanced by exposure to ultraviolet light, X-rays, radiation, chemicals, or other mutagenetic treatments. Furthermore, its 4-trehalosamine production capacity can also be increased through genetic engineering techniques.

[0063] Methods for analyzing whether the microorganism has the ability to produce 4-trehalosamine include, for example, detecting 4-trehalosamine from a culture of the microorganism, preferably the culture supernatant after liquid culture or the solid culture medium after solid culture, using various analytical methods.

[0064] <<Culture medium>> The culture medium used in the culture step is: Streptomyces If sp. MK186-mF5 can be cultured, there are no particular restrictions, conventionally Streptomyces A culture medium containing known components used for culturing bacteria belonging to the genus can be used, and may be a liquid medium or a solid (agar) medium. There are no particular restrictions on the nutrients added to the culture medium, and they can be appropriately selected according to the purpose. Examples include commercially available nitrogen sources such as soy flour, wheat germ, rolled barley, peptone, cottonseed meal, yeast extract (e.g., brewer's yeast extract, baker's yeast extract, etc.), meat extract, corn steep liquor, ammonium sulfate, sodium nitrate, and urea; and carbon sources such as carbohydrates such as soluble starch, tomato paste, glycerin, glucose, galactose, dextrin, and bactosyton, and fats. Furthermore, inorganic salts such as sodium chloride, calcium carbonate, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, potassium chloride, and sodium chloride can be added to the culture medium, and trace amounts of metal salts such as zinc chloride and magnesium sulfate can also be added to the culture medium as needed. These materials are Streptomyces Any known culture material can be used, as long as it is utilized by sp. MK186-mF5 and is useful for the production of 4-trehalosamine.

[0065] Among these, the culture medium used in the culture step preferably contains a carbon source such as soluble starch and glucose; a nitrogen source such as brewer's yeast and baker's yeast; inorganic salts such as calcium carbonate, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, potassium chloride, and sodium chloride; and metal salts such as zinc chloride and magnesium sulfate. It is more preferable to contain at least one of soluble starch, potassium chloride, sodium chloride, calcium carbonate, and zinc chloride in order to produce 4-trehalosamine at high levels, and it is particularly preferable to contain soluble starch, potassium chloride, sodium chloride, and zinc chloride, but not magnesium sulfate.

[0066] There are no particular restrictions on the concentration of soluble starch in the culture medium, and it can be appropriately selected depending on the purpose. However, in order to produce a high amount of 4-trehalosamine, 1% to 10% by mass is preferred, 3% to 9% by mass is more preferred, and 5% to 6% by mass is particularly preferred.

[0067] The concentration of zinc chloride in the medium is not particularly limited and can be appropriately selected according to the purpose. However, it is preferably 10% by mass or less, more preferably 0.001% to 0.02% by mass, and particularly preferably 0.001% to 0.015% by mass.

[0068] The concentration of potassium chloride in the medium is not particularly limited and can be appropriately selected according to the purpose. However, it is preferably 0.1% to 1% by mass, more preferably 0.1% to 0.8% by mass, and particularly preferably 0.4% to 0.7% by mass.

[0069] The concentration of brewer's yeast in the medium is not particularly limited and can be appropriately selected according to the purpose. However, the lower limit is preferably 2% by mass or more, more preferably 3% by mass or more. The upper limit of the concentration of brewer's yeast in the medium is not particularly limited in terms of the production amount of 4-trehalosamine and can be appropriately selected according to the purpose. However, from a cost perspective, it is preferably 4% by mass or less. The lower limit and the upper limit of the concentration of brewer's yeast in the medium can be appropriately combined, preferably 2% to 4% by mass, more preferably 2% to 3% by mass, and particularly preferably 3% by mass.

[0070] The preculture medium for the production of 4-trehalosamine is not particularly limited and can be appropriately selected according to the purpose. For example, growth products obtained by culturing sp. MK186-mF5 on media such as liquid media, plate media, slant media, and semi-slant media can be used. Streptomyces Growth products obtained by culturing sp. MK186-mF5 can be used.

[0071] The method of culturing is not particularly limited and can be appropriately selected according to the purpose. Examples include shaking culture, static culture, and tank culture. Regarding the temperature of the culture, Streptomyces As long as the growth of sp. MK186-mF5 is not substantially inhibited and 4-trehalosamine can be produced, there is no particular limitation and it can be appropriately selected according to the purpose. However, 25°C to 35°C is preferred. Regarding the pH of the culture, Streptomyces There is no particular limitation as long as the growth of sp. MK186-mF5 is not substantially inhibited and 4-trehalosamine can be produced, and it can be appropriately selected according to the purpose. There is no particular limitation on the period of the culture, and it can be appropriately selected according to the accumulation of 4-trehalosamine.

[0072] There is no particular limitation on the method of performing the culture step, and it can be appropriately selected according to the purpose. It may be performed at the laboratory level such as in a flask, or it may be cultured using a large-scale culture device or the like. Examples of the large-scale culture device include MPF-U3 (manufactured by Marubishi Bio Engineering Co., Ltd.).

[0073] <Other steps> There is no particular limitation on the other steps, and they can be appropriately selected according to the purpose. Examples include a collection step.

[0074] -Collection step- The collection step is a step of collecting 4-trehalosamine from the culture containing 4-trehalosamine obtained in the culture step. Since 4-trehalosamine has the above-described physicochemical properties, it can be purified and isolated from the culture according to its properties.

[0075] There is no particular limitation on the culture as long as it is obtained in the culture step and contains 4-trehalosamine, and it can be appropriately selected according to the purpose. Examples include bacterial cells, the culture supernatant after liquid culture, the solid medium after solid culture, and mixtures thereof. When using the bacterial cells as the culture, 4-trehalosamine may be extracted from the bacterial cells by an extraction method using an appropriate organic solvent or an elution method by disrupting the bacterial cells, and this may be subjected to separation and / or purification.

[0076] There are no particular restrictions on the collection method, and any method used to collect metabolites produced by microorganisms can be appropriately selected. Examples include solvent extraction, methods utilizing differences in adsorption affinity to various adsorbents, and chromatography. These methods can be used individually or in appropriate combinations, and may be used repeatedly, to collect separated and / or purified 4-trehalosamine.

[0077] There are no particular restrictions on the solvent used in the solvent extraction method described above, and it can be appropriately selected depending on the purpose. Examples include ethanol, methanol, acetone, butanol, and acetonitrile.

[0078] There are no particular restrictions on the adsorbent, and it can be appropriately selected from known adsorbents depending on the purpose, for example, polystyrene-based adsorbent resins.

[0079] There are no particular restrictions on the chromatographic method, and it can be appropriately selected depending on the purpose. Examples include thin-layer chromatography (TLC) and preparative high-performance liquid chromatography (preparative HPLC) using normal-phase or reverse-phase columns. There are no particular restrictions on the support used in the above-mentioned chromatographic method, and it can be appropriately selected depending on the purpose. Examples include ion exchange resin, gel filtration, silica gel, alumina, and activated carbon. Specific examples of commercially available carriers used in the aforementioned chromatography method include AmberLite® CG50 (manufactured by Sigma-Aldrich Co., Ltd.), DOWEX 50W×4 column 50-100 (manufactured by Muromachi Chemical Co., Ltd.), AmberLite FPC3500 (manufactured by Organo Co., Ltd.), and DIAION. TM Examples include WA30 (manufactured by Mitsubishi Chemical Corporation), Sephadex® LH-20 (manufactured by GE Healthcare Japan Corporation), activated carbon (manufactured by Fujifilm Wako Pure Chemical Industries Ltd.), Hydrosphere C18 (manufactured by YMC Corporation), Hydrodrophilic Interaction Chromatography column (manufactured by Waters), YMC-GEL ODS-A 6nm S-150μm (manufactured by YMC Corporation), YMC-Pack Polyamine II (manufactured by YMC Corporation), and ACQUITY UPLC Ethylene Bridged Hybrid (BEH) Amide 1.7μm, 2.1×100mm (manufactured by Waters).

[0080] There are no particular limitations on the method for eluting 4-trehalosamine from the adsorbent or the carrier in the chromatographic method, and the method can be appropriately selected depending on the type and properties of the adsorbent or carrier. For example, in the case of polystyrene-based adsorbent resins, methods such as eluting using aqueous alcohol or aqueous acetone as the elution solvent can be used.

[0081] 4-trehalosamine can be manufactured in the manner described above.

[0082] 4-Trehalosamine does not serve as a carbon or nutrient source for microorganisms and therefore does not promote their growth. Consequently, 4-Trehalosamine has the advantage of not causing spoilage. The aforementioned microorganisms are not particularly limited and can be appropriately selected depending on the purpose, for example, Escherichia Microorganisms belonging to the genus (for example, Escherichia coli etc. ), Serratia Microorganisms belonging to the genus (for example, Serratia marcescens et al. ), Enterococcus Microorganisms belonging to the genus (for example, Enterococcus faecalis et al. ), Aspergillus Microorganisms belonging to the genus (for example, Aspergillus niger et al. ), Salmonella Microorganisms belonging to the genus (for example, Salmonella Enteritidis etc. ) Mycobacter Microorganisms belonging to the genus (for example, Mycobacter smegmatis et al. ) Bacillus Microorganisms belonging to the genus (for example, Bacillus subtitles etc. ) Pseudomonas Microorganisms belonging to the genus (for example, Pseudomonas aeruginosa etc. ) Micrococcus Microorganisms belonging to the genus (for example, Micrococcus luteus, etc. ) Bacteroides Microorganisms belonging to the genus (for example, Bacteroides fragilis et al. ) Saccharomyces Microorganisms belonging to the genus (for example, Saccharomyces beer etc ) White Microorganisms belonging to the genus (for example, White albicans etc ) and the like can be mentioned.

[0083] The microorganism may be any of a commercially available product, a microorganism held by the applicant, and a strain of the microorganism of the above genus and species newly isolated. For example, Escherichia to be cultivated is Escherichia to be cultivated K-12 (held by the Institute of Microbial Chemistry, Incorporated Administrative Agency)​​​​​​​​​​​​​​​​​​​​​​​​​​​​​F16 (owned by the Japan Society for Microbial Chemistry), Aspergillus black Examples include NBRC 13245T (NITE NBRC). for example, Salmonella enteritis teeth, Salmonella enteritis 1891 (owned by the Japan Society for Microbial Chemistry), Salmonella enteritis Examples include JCM 1652 (RIKEN BRC). for example, Mycobacterium smegma teeth, Mycobacterium smegma Examples include ATCC-607 (ATCC). for example, Bacillus subtle teeth, Bacillus subtle Examples include 168. for example, Pseudomonas aeruginosa teeth, Pseudomonas aeruginosa A3 (owned by the Japan Society for Microbial Chemistry), Pseudomonas aeruginosa Examples include JCM 5962 T (RIKEN BRC). for example, Micrococci yellow teeth, Micrococci yellow Examples include IFO3333 (Fermentation Research Institute (IFO)). for example, Bacteroides fragile teeth, Bacteroides fragile Examples include JCM11019 (RIKEN BRC). for example, Saccharomyces yeast teeth, Saccharomyces yeast F-7 (owned by the Japan Society for Microbial Chemistry), Saccharomyces yeast Examples include JCM 7255 T (RIKEN BRC). for example, White albicans teeth, White albicans Examples include 3147 (IFO).

[0084] (Protective agents, surfactant compositions, blood glucose control compositions, autophagy inducers, staining agents for mycobacteria, or protein extractants) The protective agent, surfactant composition, blood glucose control composition, autophagy inducer, acid-fast bacilli staining agent, or protein extractant of the present invention contains a compound represented by the following general formula (1), or a pharmaceutically acceptable salt thereof, or a solvate thereof, and further contains other components as necessary. [ka] However, in the above general formula (1), R 1 -NH2, substituents represented by the following structural formula (A), substituents represented by the following structural formula (B), or -NH(CH2) m CH3, where m represents an integer from 7 to 14. [ka] [ka] However, in the above structural formula (A) or the following structural formula (B), "*" represents a bond.

[0085] <Protective agent> The inventors have conducted diligent research and have newly discovered that the compound represented by the general formula (1) has excellent protective effects against starch, proteins, microorganisms, etc., due to its moisturizing effect and pH buffering effect near neutrality, and can be used as a protective agent for these substances. Specifically, the protective agent is excellent in various effects based on the moisturizing effect and pH buffering effect near neutrality of the compound represented by the general formula (1), such as inhibiting starch retrogradation, preventing or suppressing the decrease in activity of proteins when stored in a frozen or freeze-dried state, and preventing or suppressing damage or death of microorganisms when stored in a frozen or freeze-dried state, and can be used as a starch retrogradation inhibitor, protein protectant, microbial protectant, pH buffer, etc.

[0086] <<Starch Retrogradation Inhibitor>> In starch-containing foods, the elastic modulus of starch changes over time during the manufacturing process, and it takes time for it to stabilize, resulting in variability in the quality of starch-containing foods and making it difficult to maintain consistent quality. In addition, deterioration of texture (loss of softness, moistness, etc.) due to starch retrogradation was also a problem. To solve the aforementioned problem, a method has been proposed to suppress the swelling of starch and prevent gelatinization and the resulting sticking and deterioration of texture of food by incorporating a natural polysaccharide or its decomposition product, which consists of at least one of glucose, mannose, and galactose as constituent sugars (see Japanese Patent Publication No. 5-276882). However, the anti-aging effect of this method was not entirely satisfactory. In response to this, the present inventors conducted diligent research and newly discovered that the compound represented by the general formula (1) has excellent starch retrogradation inhibitory activity.

[0087] - Compounds represented by general formula (1) - The compound represented by the general formula (1) contained in the starch retrogradation inhibitor is R 1 However, the compound is -NH2, or a pharmaceutically acceptable salt thereof, or a solvate thereof.

[0088] In the above general formula (1), R 1 The compound in which is -NH2 is the compound represented by structural formula (1) in the section "(Method for producing 4-trehalosamine)" above, and its physicochemical properties are as described in the section "(Method for producing 4-trehalosamine)" above.

[0089] The total content of the compound represented by general formula (1) (4-trehalosamine), or pharmaceutically acceptable salts thereof, or solvates thereof in the starch retrogradation inhibitor is not particularly limited and can be appropriately selected depending on the purpose. The starch retrogradation inhibitor may be the compound represented by general formula (1) itself.

[0090] -Other ingredients- Other components in the starch retrogradation inhibitor are not particularly limited as long as they do not impair the effects of the present invention, and can be appropriately selected according to the purpose. Examples include amino acids such as sodium L-aspartate; nucleic acids such as disodium 5'-inosinate; seasonings represented by organic acids such as monopotassium citrate and inorganic salts such as potassium chloride; shelf-life extenders such as mustard extract, wasabi extract, and kojic acid; preservatives such as sillago protein extract, polylysine, and sorbic acid; enzymes such as α,β amylase, α,β glucosidase, and papain; pH adjusters such as citric acid, fumaric acid, and succinic acid; and emulsifiers such as sucrose fatty acid esters, glycerin fatty acid esters, organic acid monoglycerides, and lecithin. Examples of additives include: flavorings, colorings, water-soluble soybean polysaccharides, carrageenan, xanthan gum, gellan gum, native sheran gum, sodium alginate, agar, konjac, pectin, tara gum, karaya gum, tragacanth gum, gutt gum, ramsang gum, welan gum, curdlan, pullulan, psyllium seed gum, and other thickening polysaccharides; leavening agents; proteins such as whey protein and soybean protein; sugars such as sucrose, fructose, reduced starch hydrolysates, erythritol, and xylitol; sweeteners such as sucralose, thaumatin, acesulfame potassium, and aspartame; vitamins such as vitamin A, vitamin C, vitamin E, and vitamin K; and minerals such as iron and calcium. Additives described in "-Formulation-" of "<Composition for Blood Glucose Control>" below are also included. These may be used individually or in combination of two or more.

[0091] The content of the other components in the starch retrogradation inhibitor is not particularly limited as long as it does not impair the effects of the present invention, and can be appropriately selected depending on the purpose.

[0092] -Applications- The starch retrogradation inhibitor contains a compound represented by the general formula (1) (4-trehalosamine), or a pharmaceutically acceptable salt thereof, or a solvate thereof. Therefore, when included in starch-containing foods, it can exhibit excellent starch retrogradation inhibitory effects and can be suitably used as a starch quality improver for starch-containing foods. Accordingly, the present invention also relates to a starch quality improver characterized by containing the starch retrogradation inhibitor and a method for producing the same, and to food and beverages characterized by containing the starch retrogradation inhibitor and a method for producing the same.

[0093] The aforementioned starch-containing foods are not particularly limited as long as they contain starch, and include, for example, bread such as sliced ​​bread and sweet bread; noodles such as soba, udon, vermicelli, gyoza wrappers, shumai wrappers, Chinese noodles, and instant noodles; cooking sauces such as white sauce and gratin; cakes such as sponge cake, butter cake, and fruit cake; donuts; wrappers for dumplings, shumai, spring rolls, and wontons; steamed buns, Chinese steamed buns, and steamed buns; and a wide variety of foods such as croquettes, okonomiyaki, takoyaki, taiyaki, imagawayaki, daifuku, dango, uiro, vermicelli, mitarashi dango sauce, custard cream, and flower paste.

[0094] <<Protein Protectants>> Enzymes, antibodies, and other proteins are useful as pharmaceuticals, diagnostic agents, and various reagents, but they have the property of losing their activity due to physicochemical denaturation, and special measures are required for their long-term storage. Generally, aqueous solutions of enzymes and antibodies are frozen and stored at low temperatures, or freeze-dried and stored in a dry state (solid). However, some enzymes and antibodies lose their activity when frozen or freeze-dried. Therefore, in order to prevent the decrease in activity during storage, (1) Erwinia genus or Xanthomonas Protective agents such as cryoprotective substances produced by microorganisms of the genus (see Japanese Patent Publication No. 2001-139599), sericin derived from silkworms (see Japanese Patent Publication No. 2002-101869), (3) plant-derived protein dehydrin and its partial peptides (see Protein Science, 2011, January; 20(1): 42-50), (4) freezing tolerance proteins from grasses Wcs19 and Wcor410 (see U.S. Patent No. 5,731,419), (5) bovine serum albumin (BSA), and (6) human serum albumin (HSA) have been developed and are in use.

[0095] When using enzymes, antibody proteins, etc., as biopharmaceuticals, it is necessary to consider the risk that cryoprotective agents may trigger an immune response in the human body, causing side effects such as inflammation and anaphylaxis. The aforementioned (1) to (5) are proteins derived from organisms other than humans, and therefore have the problem of not being suitable as additives to human pharmaceuticals. The aforementioned HSA (6) already has other medicinal effects as a blood product, so its use as a pharmaceutical additive is limited, and plasma-derived HSA has the problem of the risk of medical accidents such as viral contamination. Furthermore, recombinant HSA has the disadvantage of being expensive. Therefore, there has been a need for a protein protective agent that is highly versatile and suitable for use in human pharmaceuticals. In response, the present inventors conducted diligent research and newly discovered that the compound represented by the general formula (1) has high safety and excellent protein protection properties.

[0096] - Compounds represented by general formula (1) - The compound represented by the general formula (1) contained in the protein protective agent is R 1 However, the compound is -NH2, or a pharmaceutically acceptable salt thereof, or a solvate thereof.

[0097] In the above general formula (1), R 1 The compound in which is -NH2 is the compound represented by structural formula (1) in the section "(Method for producing 4-trehalosamine)" above, and its physicochemical properties are as described in the section "(Method for producing 4-trehalosamine)" above.

[0098] The total content of the compound represented by general formula (1) (4-trehalosamine), or pharmaceutically acceptable salts thereof, or solvates thereof in the protein protective agent is not particularly limited and can be appropriately selected depending on the purpose. The protein protective agent may be the compound represented by general formula (1) itself.

[0099] The protein protectant can prevent or suppress the decrease in protein activity (including loss of activity) that occurs when proteins are frozen or freeze-dried. Therefore, when the protein protectant is applied when proteins are frozen or freeze-dried, the effects of freezing or freeze-drying are reduced, resulting in higher protein activity after storage in a frozen or freeze-dried state compared to when the protein protectant is not applied.

[0100] The conditions for the freezing described above are not particularly limited as long as they do not impair the effects of the present invention. The freezing can be carried out by a conventional method after mixing the protein to be treated (protected) with the protein protective agent. For freezing, for example, -20°C to -160°C or lower (using liquid nitrogen, etc.), and for freeze-drying, the shelf temperature should be 35°C or lower, 1.0 × 10 -1 This can be done under a vacuum of approximately Torr.

[0101] -Other ingredients- Other components in the protein protective agent are not particularly limited as long as they do not impair the effects of the present invention, and can be appropriately selected depending on the purpose. Examples include the additives described in "-Formulation Form-" of "<Composition for Blood Glucose Control>" described later.

[0102] The content of the other components in the protein protective agent is not particularly limited, as long as it does not impair the effects of the present invention, and can be appropriately selected depending on the purpose.

[0103] -Applications- The amount of the protein-protecting agent added to the protein is not particularly limited as long as it achieves the effects of the present invention, and can be appropriately selected depending on the purpose.

[0104] Since the protein protective agent comprises a compound represented by the general formula (1) (4-trehalosamine), or a pharmaceutically acceptable salt thereof, or a solvate thereof, it can easily protect the protein (prevent or suppress the decrease in protein activity (including loss of activity)) by freezing or freeze-drying it together with various proteins, and can be suitably used as a reagent for protecting proteins in clinical and research settings, as well as in methods for protecting and preserving proteins. Accordingly, the present invention also relates to a method for protecting proteins characterized by containing the protein protective agent, a method for preserving proteins characterized by containing the protein protective agent, and a protein-containing composition characterized by containing any protein and the protein protective agent.

[0105] There are no particular restrictions on the proteins to which the aforementioned protein protective agent is applied (protected), and they can be appropriately selected according to the purpose. Examples include digestive enzymes (e.g., amylase, lipase, cellulase, etc.), proteases (e.g., pepsin, trypsin, chymotrypsin, papain, bromelain, blood coagulation factor Xa, etc.), glycosphagases (e.g., galactosidase, lactase, saccharase, etc.), oxidoreductases (e.g., lactate dehydrogenase, alcohol dehydrogenase (ADH), etc.), dephosphorylation enzymes (e.g., alkaline phosphatase (CIP), etc.), nucleases (e.g., DNase I, RNase H, etc.), restriction enzymes (EcoRI, Not I, etc.), etc.); antibodies such as polyclonal antibodies and monoclonal antibodies or fragments thereof.

[0106] The aforementioned protein protectant can be suitably used not only for protecting individual proteins but also for protecting various protein-based structures (complex proteins such as glycoproteins, lipoproteins, nucleoproteins, and phosphoproteins, as well as cells and tissues) during freezing or freeze-drying.

[0107] <<Microbial protective agent>> Microorganisms used in research and those added to food and beverages are susceptible to damage or death due to physicochemical denaturation, requiring special measures for long-term storage. Similar to proteins, it is common practice to freeze culture solutions containing microorganisms and store them at low temperatures, or to freeze-dry them and store them in a dry (solid) state. However, some microorganisms are damaged or killed during freezing or freeze-drying. Therefore, protective agents such as skim milk, monosodium glutamate, gelatin and sucrose (see, for example, Japanese Patent Publication No. 53-8792), phenylalanine, histidine, citric acid, succinic acid, tartaric acid and alkali carbonate (see, for example, Japanese Patent Publication No. 61-265085), lactose, trehalose, skim milk powder, sorbitol, and sodium ascorbate (see, for example, Ana S. Carvalho et al. Relevant factors for the preparation of freeze-dried lactic acid bacteria. International Dairy Journal. 14(10): 835-847, 2004.) have been developed and are being used to prevent a decrease in activity during storage.

[0108] However, even with these protective agents, the suppression of microbial damage or death during freezing and freeze-drying was not entirely satisfactory, making it difficult to prepare high-concentration, stable freeze- or freeze-dried microorganisms. In particular, when the microbial dispersion and the protective substance that the microorganisms utilize were mixed during microbial preparation, if the freezing process was not carried out as quickly as possible at the lowest possible temperature, the pH of the microbial dispersion to be frozen would decrease due to the acid produced by the active metabolism of the microorganisms, resulting in a significant decrease in survival rate. Furthermore, since the pH of the microbial dispersion during freezing significantly affects the damage or death of microorganisms during thawing or freeze-drying, careful attention had to be paid to the pH of the microbial dispersion before freezing, and in some cases, neutralization with alkali was necessary. Therefore, there was a need for a microbial protective agent that was highly versatile and could prevent microbial damage or death during freezing or freeze-drying. In response, the present inventors conducted diligent research and newly discovered that the compound represented by the general formula (1) is highly versatile, not assimilated by microorganisms, and possesses excellent microbial protection.

[0109] - Compounds represented by general formula (1) - The compound represented by the general formula (1) contained in the microbial protective agent is R 1 However, the compound is -NH2, or a pharmaceutically acceptable salt thereof, or a solvate thereof.

[0110] In the above general formula (1), R 1 The compound in which is -NH2 is the compound represented by structural formula (1) in the section "(Method for producing 4-trehalosamine)" above, and its physicochemical properties are as described in the section "(Method for producing 4-trehalosamine)" above.

[0111] The total content of the compound represented by general formula (1) (4-trehalosamine), or pharmaceutically acceptable salts thereof, or solvates thereof in the microbial protective agent is not particularly limited and can be appropriately selected depending on the purpose. The microbial protective agent may be the compound represented by general formula (1) itself.

[0112] The microbial protective agent can prevent or suppress damage or death of microorganisms that occur during freezing or freeze-drying. Therefore, when the microbial protective agent is applied during freezing or freeze-drying of microorganisms, the effects of freezing or freeze-drying are reduced, resulting in a higher survival rate of microorganisms after storage in a frozen or freeze-dried state compared to when the microbial protective agent is not applied. Furthermore, the conditions for freezing are the same as those described in the "<<Protein Protectant>>" section above, except that "protein" is replaced with "microorganism".

[0113] -Other ingredients- Other components in the aforementioned microbial protective agent are not particularly limited as long as they do not impair the effects of the present invention, and can be appropriately selected depending on the purpose. Examples include the additives described in "-Formulation Form-" of "<Composition for Blood Glucose Control>" described later. These may be used individually or in combination of two or more.

[0114] The content of the other components in the microbial protective agent is not particularly limited, as long as it does not impair the effects of the present invention, and can be appropriately selected depending on the purpose.

[0115] -Applications- Since the microbial protective agent contains a compound represented by the general formula (1) (4-trehalosamine), or a pharmaceutically acceptable salt thereof, or a solvate thereof, it can easily protect (prevent or inhibit damage or death of) various microorganisms by freezing or freeze-drying them together, and can be suitably used as a reagent for protecting microorganisms in clinical and research settings, as well as in methods for protecting and preserving microorganisms. Accordingly, the present invention also relates to a method for protecting microorganisms characterized by containing the microbial protective agent, a method for preserving microorganisms characterized by containing the microbial protective agent, and a microorganism-containing composition characterized by containing any microorganism and the microbial protective agent.

[0116] There are no particular restrictions on the microorganisms that the aforementioned microbial protective agent is intended to protect; they can be appropriately selected depending on the purpose. For example, Escherichia Microorganisms belonging to the genus (for example, Escherichia to be cultivated etc.), Saccharomyces Microorganisms belonging to the genus (for example, Saccharomyces yeast etc.), Propionibacterium Microorganisms belonging to the genus (for example, Propionibacterium freudenreichii etc.), Bacillus Microorganisms belonging to the genus (for example, Bacillus subtle etc.), Penicillium Microorganisms belonging to the genus (for example, Penicillium Roquefort etc.), Bifidobacterium Microorganisms belonging to the genus (for example, Bifidobacterium bifid , Bifidobacterium short , Bifidobacterium long subsp. child , Bifidobacterium long , Bifidobacterium of a young man etc.), Lactobacillus Microorganisms belonging to the genus (for example, Lactobacillus cheese etc.), Streptomyces Microorganisms belonging to the genus (for example, Streptomyces gray , Streptomyces kanamyceticus etc.), Mycobacterium Microorganisms belonging to the genus (for example, Mycobacterium smegmatis Examples include the following.

[0117] The microorganisms to which the microbial protective agent is applied (protected) may be any of the following: commercially available products, microorganisms owned by the applicant, or newly isolated strains of microorganisms of the above genus. for example, Saccharomyces cerevisiae teeth, Saccharomyces cerevisiae F-7 (owned by the Japan Society for Microbial Chemistry), Saccharomyces cerevisiae Examples include the JCM 7255 T. for example, Escherichia coli includes Escherichia coli K-12 (held by the Institute of Microbial Chemistry, a public interest incorporated foundation), Escherichia coli K-12 (National BioResource Project (NBPR)), and the like.

[0118] <<pH buffer>> The inventors of the present invention have conducted intensive studies and newly found that the compound represented by the general formula (1) has an excellent pH buffering action.

[0119] -Compound represented by general formula (1)- The compound represented by the general formula (1) contained in the pH buffer is a compound in which R 1 is -NH2, or a pharmaceutically acceptable salt thereof, or a solvate thereof.

[0120] In the general formula (1), the compound in which R 1 is -NH2 is the compound represented by the structural formula (1) in the item of "(Method for producing 4-trehalosamine)", and its physicochemical properties are as described in the item of "(Method for producing 4-trehalosamine)".

[0121] The total content of the compound (4-trehalosamine) represented by the general formula (1) in the pH buffer, or a pharmaceutically acceptable salt thereof, or a solvate thereof is not particularly limited and can be appropriately selected according to the purpose. The pH buffer may be the compound itself represented by the general formula (1).

[0122] -Other components- The other components in the pH buffer are not particularly limited as long as the effects of the present invention are not impaired, and can be appropriately selected according to the purpose, and examples include additives described in "-Dosage form-" of "<Composition for blood glucose control>" described later.

[0123] The content of the other components in the pH buffer is not particularly limited, as long as it does not impair the effects of the present invention, and can be appropriately selected depending on the purpose.

[0124] -Applications- The aforementioned pH buffer contains compounds represented by the general formula (1), or pharmaceutically acceptable salts thereof, or solvates thereof, and therefore possesses excellent pH buffering properties. For this reason, it can be used as a pH buffer in various applications, including household, medical, industrial, and agricultural uses. Specific examples include detergents, emulsifiers, dispersants, penetrating agents, recycled paper deinking agents, agricultural spreading agents, cosmetics, cell culture, microbial culture, plant cultivation, and treatments for acidosis. Furthermore, the aforementioned pH buffer can also be suitably used as a research reagent. Since the aforementioned pH buffer can suppress pH fluctuations simply and efficiently, the present invention also relates to a pH adjusting agent characterized by containing the aforementioned pH buffer, and to a pH buffering method characterized by using the aforementioned pH buffer.

[0125] <Surfactant composition and protein extractant> The inventors conducted diligent research and discovered that a novel compound represented by general formula (1) possesses excellent surfactant activity and excellent protein extraction activity.

[0126] - Compounds represented by general formula (1) - The compound represented by the general formula (1) contained in the surfactant composition and the protein extractant is R 1 However, -NH(CH2) m These are compounds (IMCTA-Cn) that are CH3, where m is an integer between 7 and 14, or pharmaceutically acceptable salts thereof, or solvates thereof. These may be used individually or in combination of two or more. In the above general formula (1), R 1 However, -N(CH2) m A compound that is CH3 and in which m is an integer from 7 to 14 is, in the section "(novel compounds, or pharmaceutically acceptable salts thereof, or solvates thereof)", in the general formula (2), R 2 However, -NH(CH2) m The compound is CH3, represented by any of the structural formulas (2) to (9) above (IMCTA-Cn), and its physicochemical properties are as described in the section "(Novel Compounds, or pharmaceutically acceptable salts thereof, or solvates thereof)".

[0127] The total content of the compound represented by general formula (1) (IMCTA-Cn), or pharmaceutically acceptable salts thereof, or solvates thereof in the surfactant composition and the protein extractant is not particularly limited and can be appropriately selected depending on the purpose. The surfactant composition and the protein extractant may be the compound represented by general formula (1) itself.

[0128] -Other ingredients- Other components in the surfactant composition and the protein extractant are not particularly limited as long as they do not impair the effects of the present invention, and can be appropriately selected according to the purpose. Examples include known surfactants such as anionic surfactants, cationic surfactants, and amphoteric surfactants, oily components, polymer compounds, ultraviolet absorbers, bactericides, excipients, fillers, binders, wetting agents, disintegrants, lubricants, dispersants, buffers, preservatives, solubilizers, flavoring and deodorizing agents, pain relievers, stabilizers, hydrotropes, emulsifiers, thickeners, zeolites, phosphates, sulfates, sulfites, silicones, enzymes, anti-redeposition agents, bleaching agents, fluorescent agents, fragrances, dyes, solvents, and various other additives. These may be used individually or in combination of two or more.

[0129] The anionic surfactant is not particularly limited and can be appropriately selected depending on the purpose. Examples include carboxylic acid-type surfactants, sulfate-ester-type surfactants, sulfonic acid-type surfactants, and phosphate-ester-type surfactants.

[0130] The cationic surfactant is not particularly limited and can be appropriately selected depending on the purpose. Examples include higher amine salts, higher alkyl (or alkenyl) quaternary ammonium salts, and higher alkyl (or alkenyl) pyridinium quaternary ammonium salts.

[0131] The aforementioned amphoteric surfactant is not particularly limited and can be appropriately selected depending on the purpose. Examples include alkyl betaine type surfactants, alkylamide betaine type surfactants, imidazoline type surfactants, alkylaminosulfonic acid type surfactants, alkylaminocarboxylic acid type surfactants, alkylamide carboxylic acid salt type surfactants, amide amino acid type surfactants, and phosphate type surfactants.

[0132] The content of the other components in the surfactant composition is not particularly limited, as long as it does not impair the effects of the present invention, and can be appropriately selected depending on the purpose.

[0133] -Applications- The surfactant composition contains compounds represented by the general formula (1), pharmaceutically acceptable salts thereof, or solvates thereof, and therefore possesses excellent surfactant properties. For this reason, it can be used as various surfactants in fields such as household, industrial, and agricultural applications. Specific examples include detergents, emulsifiers, dispersants, oil phase component adjusters, penetrating agents, recycled paper deinking agents, agricultural spreading agents, and cosmetics. Furthermore, the surfactant composition can also be suitably used as a reagent for research purposes.

[0134] <Composition for blood glucose control> Trehalose is used as a food additive, such as a sweetener. However, it has the problem of causing an increase in blood glucose levels because it is rapidly broken down into glucose in the body. Therefore, there has been a demand for a blood glucose control composition that does not break down in the body and can be used as a sweetener without raising blood glucose levels. In response to this, the present inventors conducted diligent research and newly discovered that the compound represented by the general formula (1) is highly safe, does not decompose in the body, and has excellent blood glucose control effects. In this specification, "blood glucose control" refers to suppressing the rise in blood glucose levels in an individual, maintaining normal blood glucose levels before they rise, etc.

[0135] - Compounds represented by general formula (1) - The compound represented by the general formula (1) contained in the blood glucose control composition is R 1 However, the compound is -NH2, or a pharmaceutically acceptable salt thereof, or a solvate thereof. In the above general formula (1), R 1 The compound in which is -NH2 is the compound represented by structural formula (1) in the section "(Method for producing 4-trehalosamine)" above, and its physicochemical properties are as described in the section "(Method for producing 4-trehalosamine)" above.

[0136] The total content of the compound represented by general formula (1) (4-trehalosamine), or pharmaceutically acceptable salts thereof, or solvates thereof in the blood glucose control composition is not particularly limited and can be appropriately selected depending on the purpose. The blood glucose control composition may be the compound represented by general formula (1) itself.

[0137] -Other ingredients- Other components in the blood glucose control composition are not particularly limited as long as they do not impair the effects of the present invention, and can be appropriately selected depending on the purpose. Examples include the additives described in the "-Formulation Form-" section below.

[0138] The content of the other components in the blood glucose control composition is not particularly limited, as long as it does not impair the effects of the present invention, and can be appropriately selected depending on the purpose.

[0139] -Applications- The blood glucose control composition contains a compound represented by the general formula (1), or a pharmaceutically acceptable salt thereof, or a solvate thereof. Therefore, when administered to an individual, it does not raise blood glucose levels and can be suitably used for the prevention or treatment of diseases caused by elevated blood glucose levels (e.g., diabetes, myocardial infarction, cirrhosis, arteriosclerosis, etc.). Accordingly, the present invention relates to a pharmaceutical composition characterized by containing the blood glucose control composition, and to a method for preventing or treating diseases caused by elevated blood glucose levels, characterized by administering the blood glucose control composition to an individual.

[0140] -Formulation Form- There are no particular restrictions on the formulation form of the blood glucose control composition, and it can be appropriately selected according to the purpose. Examples include injectable preparations mainly used for intravenous or intramuscular injection; oral preparations such as capsules, tablets, granules, powders, pills, fine granules, syrups, and lozenges; parenterally administered topical preparations such as ointments, eye drops, ear drops, nasal drops, eye ointments, skin and mucosal absorbents, topical preparations, inhalants, and suppositories; other dried powders; and atomized aerosol formulations.

[0141] The aforementioned formulation can be manufactured by conventional methods using additives such as excipients, bulking agents, binders, wetting agents, disintegrants, surfactants, lubricants, dispersants, buffers, preservatives, solubilizers, antiseptics, flavoring and odor-correcting agents, pain-relieving agents, and stabilizers. Specific examples of the aforementioned additives include, for example, in injections, eye drops, ear drops, and nasal drops, solvents or solubilizers that can constitute an aqueous or dissolvable dosage form (such as distilled water for injection, physiological saline, ethanol, glycerin, propylene glycol, corn oil, sesame oil, etc.), pH adjusters (such as inorganic acid addition salts like trisodium orthophosphate and sodium bicarbonate; organic acid salts like sodium citrate; organic basic salts like L-lysine and L-arginine, etc.), isotonic agents (such as sodium chloride, glucose, and glycerin), buffers (such as sodium chloride, benzalkonium chloride, and sodium citrate), surfactants (such as sorbitan monooleate and polysorbate 80), dispersants (such as D-mannitol), and stabilizers (such as antioxidants like ascorbic acid, sodium sulfite, and sodium pyrosulfite; and chelating agents like citric acid and tartaric acid, etc.). For example, suitable formulation components for ophthalmic ointments, skin and mucous membrane absorbents, and topical preparations include ointments, creams, and patches (such as white petrolatum, macrogol, glycerin, liquid paraffin, and cotton cloth). For example, liquid inhalants may contain pH adjusters (such as sodium citrate and sodium hydroxide), isotonic agents (such as sodium chloride, benzalkonium chloride, and sodium citrate), and buffering agents (such as sodium chloride, benzalkonium chloride, and sodium citrate). For example, in powder inhalants, lactose can be used as a carrier. For example, oral and suppository preparations may contain excipients (such as lactose, D-mannitol, corn starch, and crystalline cellulose), disintegrants (such as carboxymethylcellulose and calcium carboxymethylcellulose), binders (such as hydroxypropylcellulose, hydroxypropylmethylcellulose, and polyvinylpyrrolidone), lubricants (such as magnesium stearate and talc), coating agents (such as shellac, hydroxypropylmethylcellulose, sucrose, and titanium dioxide), plasticizers (such as glycerin and polyethylene glycol), and substrates (such as cocoa butter, polyethylene glycol, and hard fat).

[0142] -Administration- There are no particular restrictions on the administration route, dosage, timing of administration, or target population of the blood glucose control composition, and these can be appropriately selected according to the purpose. There are no particular restrictions on the route of administration, and it can be administered orally or parenterally depending on the type of pathogen or disease, the characteristics of the individual being administered to, etc. Examples of parenteral administration include intravenous injection, intramuscular injection, subcutaneous injection, rectal injection, transdermal injection, local ocular injection, and transpulmonary injection. There are no particular restrictions on the aforementioned dosage, and it can be appropriately selected considering various factors such as the method of use, the type of pathogen, the age, sex, weight, constitution of the individual being administered the drug, the severity of the disease, and whether or not other pharmaceuticals or drugs containing other active ingredients are being administered. When administered orally to humans, for example, it can be administered within the range of 100 mg / kg to 2,000 mg / kg per adult per day, and when administered intravenously, it can also be administered within the range of 100 mg / kg to 2,000 mg / kg. There are no particular restrictions on the timing of administration, and it can be selected as appropriate depending on the purpose. There are no particular restrictions on the animal species to which the above-mentioned drug can be administered; it can be appropriately selected according to the purpose. Examples include humans, monkeys, pigs, cattle, sheep, goats, dogs, cats, mice, rats, and birds, but among these, it can be suitably used in humans.

[0143] <Autophagy inducers> Autophagy refers to a series of processes in which an isolation membrane, originating from the rough endoplasmic reticulum and mitochondrial contact sites within a cell, surrounds a substrate, forming a double-membrane structure called an autophagosome. This autophagosome then fuses with a lysosome (containing hydrolytic enzymes) to form a single-membrane autolysosome, where the internal substrate is degraded. Autophagy has been found to play a fundamental role in various physiological and pathological functions of cells, and numerous diseases thought to be caused by abnormalities in autophagy have been reported during the course of research. It is known that alpha-synuclein (Syn), which is considered a cause of neurodegeneration in Parkinson's disease, and huntingtin (Htt), which is considered a cause of Huntington's disease, are among the substrates involved in autophagy. Trehalose is known to have autophagy-inducing activity. However, as mentioned above, it is rapidly broken down into glucose by trehalase in the body, which limits the amount that can be incorporated into pharmaceuticals, making it difficult to exert sufficient autophagy-inducing activity. Therefore, there has been a need for an autophagy inducer that does not break down in the body and has excellent autophagy-inducing activity. In response to this, the present inventors conducted diligent research and newly discovered that the compound represented by the general formula (1) is highly safe, does not decompose in the body, and has excellent autophagy-inducing activity.

[0144] The induction of autophagy can be confirmed by conventional methods, such as using Western blotting, immunohistochemistry, or PCR with known autophagy markers.

[0145] - Compounds represented by general formula (1) - The compound represented by the general formula (1) contained in the autophagy inducer is R 1 However, -NH2 or -NH(CH2) m These are compounds that are CH3, where m is an integer between 7 and 14, or pharmaceutically acceptable salts thereof, or solvates thereof. These may be used individually or in combination of two or more.

[0146] In the above general formula (1), R 1 The compound in which is -NH2 is the compound represented by structural formula (1) in the section "(Method for producing 4-trehalosamine)" above, and its physicochemical properties are as described in the section "(Method for producing 4-trehalosamine)" above.

[0147] In the above general formula (1), R 1 However, -N(CH2) m A compound that is CH3 and in which m is an integer from 7 to 14 is, in the section "(novel compounds, or pharmaceutically acceptable salts thereof, or solvates thereof)", in the general formula (2), R 2 However, -NH(CH2) m The compound is CH3, represented by any of the structural formulas (2) to (9) above (IMCTA-Cn), and its physicochemical properties are as described in the section "(Novel Compounds, or pharmaceutically acceptable salts thereof, or solvates thereof)".

[0148] The total content of the compound represented by general formula (1) (4-trehalosamine or IMCTA-Cn), or pharmaceutically acceptable salts thereof, or solvates thereof in the autophagy inducer is not particularly limited and can be appropriately selected depending on the purpose. The autophagy inducer may be the compound represented by general formula (1) itself.

[0149] -Other ingredients- Other components in the autophagy inducer are not particularly limited as long as they do not impair the effects of the present invention, and can be appropriately selected depending on the purpose. Examples include the additives described in "-Formulation Form-" of the "<Composition for Blood Glucose Control>" above.

[0150] The content of the other components in the autophagy inducer is not particularly limited, as long as it does not impair the effects of the present invention, and can be appropriately selected depending on the purpose.

[0151] -Applications- The autophagy inducer contains a compound represented by the general formula (1) (4-trehalosamine or IMCTA-Cn), or a pharmaceutically acceptable salt thereof, or a solvate thereof. Therefore, it is highly safe and does not decompose in the body, allowing for easy administration over a relatively long period. Consequently, the autophagy inducer can effectively prevent or treat various diseases or symptoms caused by autophagy abnormalities, such as neurodegenerative diseases (Alzheimer's disease, Huntington's disease, Parkinson's disease, etc.), pulmonary diseases, muscle atrophy diseases, muscle diseases, cardiomyopathy, cerebral swelling, fatigue, sleep deprivation, or cold sensitivity. Accordingly, the present invention relates to a composition for the prevention or treatment of diseases caused by autophagy abnormalities, characterized by containing the autophagy inducer, and to a method for the prevention or treatment of diseases caused by autophagy abnormalities, characterized by using the autophagy inducer.

[0152] <Staining agent for acid-fast bacteria> Mycobacteria are Gram-positive rod-shaped bacteria that possess acid-fast properties, and because many of them are pathogens that cause serious lesions, their testing is clinically extremely important. The aforementioned staining agent for acid-fast bacteria is capable of staining acid-fast bacteria. The acid-fast bacteria commonly possess a mycolic acid layer containing trehalose monomycolic acid (TMM) and trehalose dimycolic acid (TDM) as cell wall components. In the acid-fast bacteria, the outermost layer protects itself outside the arabinogalactan on the outside of the cell wall (peptidoglycan). The mycolic acid layer is bound to the inner arabinogalactan, and the mycolic acids are bound to trehalose. The aforementioned staining agent for acid-fast bacteria can suitably stain the acid-fast bacteria by being incorporated in place of trehalose in the mycolic acid layer of the acid-fast bacteria. In this specification, "staining" refers to the visualization of acid-fast bacteria by some method, and is synonymous with "labeling." Therefore, the aforementioned staining agent for acid-fast bacteria is also a labeling agent for acid-fast bacteria.

[0153] There are no particular restrictions on the mycobacteria to be stained with the aforementioned staining agent for mycobacteria; they can be appropriately selected depending on the purpose, for example, Mycobacterium smegmatis , Mycobacterium avium , Mycobacterium intracellulare , Mycobacterium kansasii , Mycobacterium xenopi , Mycobacterium scrofulaceum , Mycobacterium gordonae , Mycobacterium szulgai , Mycobacterium fortuitum , Mycobacterium chelonae , Mycobacterium haemophilum , Mycobacterium marinum , Mycobacterium shinjukuense , Mycobacterium tuberculosis , Mycobacterium leprae , Mycobacterium abscessus These are some examples.

[0154] - Compounds represented by general formula (1) - The compound represented by the general formula (1) contained in the aforementioned staining agent for acid-fast bacteria is R 1 However, these are the substituent represented by structural formula (A), or a compound that is the substituent represented by structural formula (B), or a pharmaceutically acceptable salt thereof, or a solvate thereof. These may be used individually or in combination of two or more.

[0155] In the compound represented by the general formula (1) above, R 1 A compound in which the substituent represented by the structural formula (A) is, in the section "(novel compounds, or pharmaceutically acceptable salts thereof, or solvates thereof)", in the general formula (2), R 2 The substituent represented by structural formula (A) is the compound represented by structural formula (10) (IMCTA-fluorescein), and its physicochemical properties are as described in the section "(Novel Compounds, or pharmaceutically acceptable salts thereof, or solvates thereof)".

[0156] In the compound represented by the general formula (1) above, R 1 A compound in which the substituent represented by the structural formula (B) is, in the section "(novel compounds, or pharmaceutically acceptable salts thereof, or solvates thereof)", in the general formula (2), R 2 The substituent is represented by structural formula (B), and the compound represented by structural formula (11) is (IMCTA-biotin), and its physicochemical properties are as described in the section "(novel compounds, or pharmaceutically acceptable salts thereof, or solvates thereof)".

[0157] The total content of the compound represented by general formula (1) (IMCTA-fluorescein or IMCTA-biotin), or pharmaceutically acceptable salts thereof, or solvates thereof in the acid-fast bacilli staining agent is not particularly limited and can be appropriately selected depending on the purpose. The acid-fast bacilli staining agent may be the compound represented by general formula (1) itself.

[0158] -Other ingredients- Other components in the aforementioned staining agent for acid-fast bacteria are not particularly limited as long as they do not impair the effects of the present invention, and can be appropriately selected depending on the purpose. Examples include the additives described in "-Formulation Form-" of the "<Composition for Blood Glucose Control>" above. Furthermore, in the section "(novel compounds, or pharmaceutically acceptable salts thereof, or solvates thereof)" above, in general formula (3), R 3 The compound represented by structural formula (12), which is -N3 (IMCTA-azide), can also stain acid-fast bacteria, and may therefore be included as another component of the acid-fast bacilli staining agent.

[0159] The content of the other components in the aforementioned staining agent for acid-fast bacteria is not particularly limited, as long as it does not impair the effects of the present invention, and can be appropriately selected depending on the purpose.

[0160] -Applications- The aforementioned staining agent for mycobacteria contains a compound represented by the general formula (1) (IMCTA-fluorescein or IMCTA-biotin), or a pharmaceutically acceptable salt thereof, or a solvate thereof. Therefore, by culturing it together with mycobacteria, mycobacteria can be easily and efficiently stained. Accordingly, it can be suitably used as a reagent or detection method for detecting mycobacteria in clinical and research settings. Accordingly, the present invention also relates to a detection reagent for mycobacteria characterized by containing the aforementioned staining agent for mycobacteria, and to a method for detecting mycobacteria characterized by using the aforementioned staining agent for mycobacteria.

[0161] (microorganisms) The microorganism of the present invention is Streptomyces It is sp. MK186-mF5 (accession number: NITE BP-03495) and has the ability to produce 4-trehalosamine. The aforementioned Streptomyces sp. MK186-mF5 (MK186-mF5 strain) was isolated from soil in Japan by the Institute of Microbial Chemistry, Japan Microbial Chemistry Research Foundation. Streptomyces It is a fungus belonging to the genus.

[0162] The partial nucleotide sequence (1,446 bp) of the 16S rRNA gene of strain MK186-mF5 was determined and compared with data from known strains registered in DNA databases. The results showed that the nucleotide sequence of strain MK186-mF5 is represented by sequence number 1. Streptomyces cirratus It showed high homology to the 16S rRNA gene. That is, Streptomyces cirratus The homology value with the nucleotide sequence of NRRL B-3250 (accession number: AY999794) was 99.72% (1,439 / 1,443).

[0163] Based on the above results, strain MK186-mF5 is Streptomyces It is thought to belong to the genus. Therefore, Streptomyces Let's call it sp. MK186-mF5. Furthermore, an application for international deposit of strain MK186-mF5 was submitted to the Patent Microorganism Depositary Center of the National Institute of Technology and Evaluation (Room 122, 2-5-8 Kazusa-Kamatari, Kisarazu City, Chiba Prefecture), and it was accepted as MK186-mF5 on July 9, 2021.

[0164] Furthermore, as is observed in other bacteria, the MK186-mF5 strain is prone to changes in its properties. However, any mutant strain derived from the MK186-mF5 strain (for example, naturally occurring mutants or artificial mutants obtained through mutation treatments such as ultraviolet light, X-rays, radiation, or chemicals), zygotes, or genetically modified organisms that have the ability to produce 4-trehalosamine are included in the microorganisms of the present invention. [Examples]

[0165] The present invention will be specifically described below with reference to manufacturing examples, synthesis examples, and test examples, but the present invention is not limited in any way to these manufacturing examples, synthesis examples, and test examples. In the following manufacturing examples, synthesis examples, and test examples, "%" represents "mass %" unless otherwise specified.

[0166] (Manufacturing Example 1:4 - Trehalosamine Manufacturing 1) <Preparation of this culture medium> The following components were added to sterile water to achieve the following final concentrations (%) to prepare "Ko medium" with a pH of 7.2. [composition] • Soluble starch (manufactured by Kosou Chemical Co., Ltd.) 3% • Ebios (brewer's yeast, manufactured by Asahi Group Foods Co., Ltd.) 3% • Dipotassium hydrogen phosphate (K2HPO4) 0.3% • Potassium dihydrogen phosphate (KH2PO4) 0.1% • Magnesium sulfate heptahydrate (MgSO4·7H2O) 0.05% • Sodium chloride (NaCl) 0.2% • Calcium carbonate (CaCO3) 0.1%

[0167] <Culture process> Place 30 mL of the prepared culture medium into a flask (capacity 100 mL), and add the medium to the Streptomyces sp. MK186-mF5 (accession number: NITE BP-03495) was inoculated and cultured with shaking at 27°C and 220 rpm for 12 days.

[0168] (Manufacturing Example 2:4 - Trehalosamine Manufacturing 2) <Preparation of Modified Culture Medium 1> The following components were added to sterile water to achieve the following final concentrations (%) to prepare "Modified Medium 1" with a pH of 7.2. "Modified Medium 1" has the same composition as "Medium" in Production Example 1, but with the concentration of soluble starch doubled. [composition] • Soluble starch (manufactured by Kosou Chemical Co., Ltd.) 6% • Ebios (brewer's yeast, manufactured by Asahi Group Foods Co., Ltd.) 3% • Dipotassium hydrogen phosphate (K2HPO4) 0.3% • Potassium dihydrogen phosphate (KH2PO4) 0.1% • Magnesium sulfate heptahydrate (MgSO4·7H2O) 0.05% • Sodium chloride (NaCl) 0.2% • Calcium carbonate (CaCO3) 0.1%

[0169] <Culture process> In the <Culturing Process> of Production Example 1, the culture was performed in the same manner as in Production Example 1, except that "Ko-culture medium" was changed to "Modified Ko-culture medium 1".

[0170] (Manufacturing Example 3:4 - Trehalosamine Manufacturing 3) <Preparation of Modified Culture Medium 2> The following components were added to sterile water to achieve the following final concentrations (%) to prepare "Modified Medium 2" with a pH of 7.2. Note that "Modified Medium 2" has the same composition as "Medium 1" but with glucose instead of soluble starch. [composition] • Glucose (manufactured by Fujifilm Wako Pure Chemical Corporation) 3% • Ebios (brewer's yeast, manufactured by Asahi Group Foods Co., Ltd.) 3% • Dipotassium hydrogen phosphate (K2HPO4) 0.3% • Potassium dihydrogen phosphate (KH2PO4) 0.1% • Magnesium sulfate heptahydrate (MgSO4·7H2O) 0.05% • Sodium chloride (NaCl) 0.2% • Calcium carbonate (CaCO3) 0.1%

[0171] <Culture process> In the <Culturing Process> of Production Example 1, the culture was performed in the same manner as in Production Example 1, except that "Ko-culture medium" was changed to "Modified Ko-culture medium 2".

[0172] (Manufacturing Example 4:4 - Trehalosamine Manufacturing 4) <Preparation of Modified Culture Medium 3> The following components were added to sterile water to achieve the following final concentrations (%) to prepare "Modified Medium 3" with a pH of 7.2. Note that "Modified Medium 3" has the same composition as "Medium 1" but with baker's yeast instead of Ebios (brewer's yeast). [composition] • Soluble starch (manufactured by Kosou Chemical Co., Ltd.) 3% • Dry yeast (baker's yeast, manufactured by Oriental Yeast Co., Ltd.) 3% • Dipotassium hydrogen phosphate (K2HPO4) 0.3% • Potassium dihydrogen phosphate (KH2PO4) 0.1% • Magnesium sulfate heptahydrate (MgSO4·7H2O) 0.05% • Sodium chloride (NaCl) 0.2% • Calcium carbonate (CaCO3) 0.1%

[0173] <Culture process> In the <Culturing Process> of Production Example 1, the culture was performed in the same manner as in Production Example 1, except that "Ko-culture medium" was changed to "Modified Ko-culture medium 3".

[0174] (Manufacturing Example 5:4 - Trehalosamine Manufacturing 5) <Preparation of Modified Culture Medium 4> The following components were added to sterile water to achieve the following final concentrations (%) to prepare "Modified Medium 4" with a pH of 7.2. "Modified Medium 4" has the same composition as "Medium" in Production Example 1, but with the addition of zinc chloride. [composition] • Soluble starch (manufactured by Kosou Chemical Co., Ltd.) 3% • Ebios (brewer's yeast, manufactured by Asahi Group Foods Co., Ltd.) 3% • Dipotassium hydrogen phosphate (K2HPO4) 0.3% • Potassium dihydrogen phosphate (KH2PO4) 0.1% • Magnesium sulfate heptahydrate (MgSO4·7H2O) 0.05% • Sodium chloride (NaCl) 0.2% • Calcium carbonate (CaCO3) 0.1% • Zinc chloride (ZnCl2) 0.011%

[0175] <Culture process> In the <Culturing Process> of Production Example 1, the culture was performed in the same manner as in Production Example 1, except that "Ko-culture medium" was changed to "Modified Ko-culture medium 4".

[0176] (Manufacturing Example 6:4 - Trehalosamine Manufacturing 6) <Preparation of Modified Culture Medium 5> The following components were added to sterile water to achieve the following final concentrations (%) to prepare "Modified Medium 5" with a pH of 7.2. Note that "Modified Medium 5" has the same composition as "Medium" in Production Example 1, but without magnesium sulfate heptahydrate. [composition] • Soluble starch (manufactured by Kosou Chemical Co., Ltd.) 3% • Ebios (brewer's yeast, manufactured by Asahi Group Foods Co., Ltd.) 3% • Dipotassium hydrogen phosphate (K2HPO4) 0.3% • Potassium dihydrogen phosphate (KH2PO4) 0.1% • Sodium chloride (NaCl) 0.2% • Calcium carbonate (CaCO3) 0.1%

[0177] <Culture process> In the <Culturing Process> of Production Example 1, the culture was performed in the same manner as in Production Example 1, except that "Ko-culture medium" was changed to "Modified Ko-culture medium 5".

[0178] (Manufacturing Example 7:4 - Trehalosamine Manufacturing 7) <Preparation of Modified Culture Medium 6> The following components were added to sterile water to achieve the following final concentrations (%) to prepare "Modified Medium 6" with a pH of 7.2. Note that "Modified Medium 6" has the same composition as "Medium" in Production Example 1, but with the calcium carbonate concentration reduced to 1 / 10th. [composition] • Soluble starch (manufactured by Kosou Chemical Co., Ltd.) 3% • Ebios (brewer's yeast, manufactured by Asahi Group Foods Co., Ltd.) 3% • Dipotassium hydrogen phosphate (K2HPO4) 0.3% • Potassium dihydrogen phosphate (KH2PO4) 0.1% • Sodium chloride (NaCl) 0.2% • Calcium carbonate (CaCO3) 0.01%

[0179] <Culture process> In the <Culturing Process> of Production Example 1, the culture was performed in the same manner as in Production Example 1, except that "Ko-culture medium" was changed to "Modified Ko-culture medium 6".

[0180] (Manufacturing Example 8:4 - Trehalosamine Manufacturing 8) <Preparation of Modified Culture Medium 7> The following components were added to sterile water to achieve the following final concentrations (%) to prepare "Modified Medium 7" with a pH of 7.2. Note that "Modified Medium 7" has the same composition as "Medium" in Production Example 1, but with dipotassium hydrogen phosphate and potassium dihydrogen phosphate replaced by potassium chloride. [composition] • Soluble starch (manufactured by Kosou Chemical Co., Ltd.) 3% • Ebios (brewer's yeast, manufactured by Asahi Group Foods Co., Ltd.) 3% • Potassium chloride (KCl) 0.4% • Sodium chloride (NaCl) 0.2% • Calcium carbonate (CaCO3) 0.1%

[0181] <Culture process> In the <Culturing Process> of Production Example 1, the culture was performed in the same manner as in Production Example 1, except that "Ko-culture medium" was changed to "Modified Ko-culture medium 7".

[0182] (Manufacturing Example 9:4 - Trehalosamine Manufacturing 9) <Preparation of Modified Culture Medium 8> The following components were added to sterile water to achieve the following final concentrations (%) to prepare "Modified Medium 8" with a pH of 7.2. [composition] • Soluble starch (manufactured by Kosou Chemical Co., Ltd.) 6% • Ebios (brewer's yeast, manufactured by Asahi Group Foods Co., Ltd.) 3% • Potassium chloride (KCl) 0.4% • Sodium chloride (NaCl) 0.2% • Calcium carbonate (CaCO3) 0.01% • Zinc chloride (ZnCl2) 0.11%

[0183] <Culture process> In the <Culturing Process> of Production Example 1, the culture was performed in the same manner as in Production Example 1, except that "Ko-culture medium" was changed to "Modified Ko-culture medium 8".

[0184] <Purification process> Streptomyces Most of the 4-trehalosamine obtained by culturing sp. MK186-mF5 is released into the culture medium after cultivation. Therefore, 8 L of the culture medium obtained in the above <culturing step> was filtered using filter paper to remove the bacterial cells and the filtrate was collected. The pH of the obtained filtrate was adjusted from 8.2 to 2.0 using 1 M hydrochloric acid aqueous solution, and then passed through a 200 mL carbon column (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.) to collect the pass-through fraction. The carbon column was washed once with 1 L of water, and the wash fraction was also collected. The pass-through fraction and the wash fraction were mixed and then put into a column (DOWEX TM The 4-trehalosamine was subjected to a 250 mL column (50W x 4, 50-100 mesh, strongly acidic cation exchange resin, manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.). The column was washed once with 1.25 L of water, and 4-trehalosamine was eluted with 0.1 M ammonium hydroxide (NH4OH). After concentrating the eluate in an evaporator, it was subjected to a 1 L column (weakly acidic cation exchange resin FPC3500, manufactured by Organo Corporation). The column was washed once with 5 L of water, and eluted with 0.1 M ammonium hydroxide (NH4OH). After concentrating the eluate in an evaporator, centrifugation was performed, the supernatant was vacuum filtered, and freeze-dried to obtain a purified product of 4-trehalosamine.

[0185] (Manufacturing Example 10:4 - Trehalosamine Manufacturing 10) <Preparation of Modified Culture Medium 9> The following components were added to sterile water to achieve the following final concentrations (%) to prepare "Modified Medium 9" with a pH of 7.2. [composition] • Soluble starch (manufactured by Kosou Chemical Co., Ltd.) 6% • Ebios (brewer's yeast, manufactured by Asahi Group Foods Co., Ltd.) 3% • Potassium chloride (KCl) 0.7% • Sodium chloride (NaCl) 0.2% • Zinc chloride (ZnCl2) 0.0073%

[0186] <Culture process> In the <Culturing Process> of Production Example 1, the culture was performed in the same manner as in Production Example 1, except that "Ko-culture medium" was changed to "Modified Ko-culture medium 9".

[0187] (Production Example 11: Production of 4-Trehalosamine 11) <Cultivation Step> 130 L of a medium obtained by adding an antifoaming agent (0.05% KS-496A, manufactured by Shin-Etsu Chemical Co., Ltd.) to the "Modified Koji Medium 8" prepared in Production Example 9 was placed in a large-scale cultivation apparatus (MPF-U3 type, 200 L, manufactured by Marubishi Bio-Engineering Co., Ltd.), and Streptomyces sp. MK186-mF5 was inoculated, air was supplied at 100 NL / min at 27°C, and the mixture was cultured for 10 days while stirring at 370 rpm to obtain a culture (first cultivation). Next, 140 L of a medium obtained by adding an antifoaming agent (0.05% KS-496A, manufactured by Shin-Etsu Chemical Co., Ltd.) to the "Modified Koji Medium 8" prepared in Production Example 9 was placed in the large-scale cultivation apparatus, and Streptomyces sp. MK186-mF5 was inoculated, air was supplied at 100 NL / min at 27°C, and the mixture was cultured for 10 days while stirring at 370 rpm (first cultivation).

[0188] <Purification Step> From the culture solutions obtained in the first and second cultivations, 520 g or more of a purified product of 4-trehalosamine was obtained by the same method as described in the purification step of Production Example 9.

[0189] -Physicochemical Properties of the Compound Represented by Structural Formula (1) (4-Trehalosamine)- The physicochemical properties of the 4-trehalosamine obtained in Production Example 9 were as follows. From these, Streptomyces It was confirmed that the compound obtained by culturing sp. MK186-mF5 is 4-trehalosamine having a structure represented by the following structural formula (1). In addition, the compounds obtained in Production Examples 1 to 8, 10, and 11 also had the same physicochemical properties. (1) Appearance: White powder (2) Molecular formula: C 12 H 24 NO 10 In the normal state, it becomes a monohydrate, and in elemental analysis, C 12 H 24 NO 10 It is represented as ·H2O. (3) High-resolution mass spectrometry (HRMS: ESI positive ion mode): Experimental value: m / z 342.1397 (M+H) + Calculated value: m / z 342.1400 (C 12 H 24 NO 10 as) (4) Elemental analysis: Experimental value: C 40.27±0.06%, H 6.91±0.02%, N 3.81±0.01% (n = 3, mean±S.D.) Calculated value (C 12 H 24 NO 10 ·H2O): C 40.11% H 7.01% N 3.90% (5) Specific rotation: [α] D 25 = +147.5° (c = 1.065, methanol) (6) Infrared absorption spectrum: The measurement results by infrared spectroscopy were as shown in Fig. 1A and below. ν max (KBr) cm -1 : 3,403, 2,929, 1,607, 1,455, 1,347, 1,149, 1,040, 987, 803, 607 (7) Proton nuclear magnetic resonance spectrum: The results measured in deuterated water at 25 °C at 600 MHz were as shown in Fig. 1B and below. 1 H NMR(600MHz,D2O):5.21(d,J=3.7Hz,1H,H-1),5.18(d,J=3.7Hz,1H,H-1'),3.84(t,J=9.8Hz,1H,H-3'), 3.84(dd,J=12.0,2.1Hz,1H,H-6),3.84(m,1H,H-6'),3.82(m,1H,H-5'),3.78(m,1H,H-5),3.75(dd,J=12 .0,5.2Hz,1H,H-6'),3.74(dd,J=12.0,5.0Hz,1H,H-6),3.72(t,J=9.8Hz,1H,H-3),3.643(dd,J=9.8,3,7 Hz,1H,H-2),3.636(dd,J=9.8,3,7Hz,1H,H-2'),3.44(t,J=9.8Hz,1H,H-4'),2.73(t,J=9.8Hz,1H,H-4). (8) Carbon-13 nuclear magnetic resonance spectrum: The results measured at 150 MHz in heavy water at 25°C are shown in Figure 1C and below. 13 C NMR(150MHz,D2O):96.2(C-1),96.0(C-1'),75.6(C-5),75.3(C-3'),75.2(C-3),74. 9(C-5'),74.1(C-2),73.8(C-2'),72.5(C-4'),63.6(C-6),63.3(C-6'),55.3(C-4).

[0190] [ka]

[0191] -4- Measurement of Trehalosamine Purity - Approximately 4-trehalosamine obtained in the purification step of Production Example 9 or the purification step of Production Example 11, along with approximately 1 mg of DSS-d6 (internal standard), were precisely weighed out and dissolved in approximately 0.75 mL of heavy water to prepare the test solution. The test solution was then prepared under the following conditions. 1 H was measured (n=3). [Quantitative NMR analysis conditions] · Equipment: Varian NMR System 500 [Varian, Inc.] (Hydrogen nuclear 500 MHz-NMR) • Observation center and width: δ2ppm±20ppm • Import time: 4.0 seconds • Pulse angle: 90° Waiting time: 60 seconds • Total time: 16 times · Measurement temperature: 50℃ • Dummy scan: 2 times Spinning: Off · 13 C decoupling: on

[0192] The quantitative value of 4-trehalosamine was calculated using the following formula.

number

[0193] Based on the quantitative NMR purity measurements described above, the purity of 4-trehalosamine from Production Example 9 was 92.7 ± 0.3%. Assuming that all molecules are monohydrate, the purity of 4-trehalosamine monohydrate was estimated to be approximately 97.6%. The purity of 4-trehalosamine from Production Example 11 yielded similar results.

[0194] (Synthesis Example 1: Synthesis of IMCTA-C8) <4. Preparation of Trehalosamine Aqueous Solution> 400 mg of the purified product of 4-trehalosamine obtained in the <Purification step> of Production Example 10 was dissolved in 2 mL of water to prepare an aqueous solution of 4-trehalosamine (1.11 mmol).

[0195] <Preparation of octanal solution> 200 mg of octanal was dissolved in 4 mL of 1-propanol (1-PrOH) to prepare an octanal solution (1.56 mmol).

[0196] <Preparation of sodium cyanoborohydride aqueous solution> 4 g of sodium cyanoborohydride was dissolved in 40 mL of water to prepare an aqueous solution of sodium cyanoborohydride (NaCNBH3, 63.7 mmol).

[0197] <Synthesis of IMCTA-C8> To 2 mL of the above-mentioned aqueous solution of 4-trehalosamine, 4 mL of the above-mentioned octanal solution was added, and the mixture was allowed to stand at room temperature (15 ± 2°C) for 2 hours. Then, 40 mL of the above-mentioned aqueous solution of sodium cyanoborohydride was added, and 4 mL of 1-propanol was added to remove foam. The reaction was carried out at room temperature for 12 hours to synthesize a trehalose analog. The synthesized trehalose analog may be referred to as "IMCTA-C8". The solution containing the synthesized IMCTA-C8 was passed through a 100 mL ODS column (YMC GEL ODS-A, pore size 6 nm, particle size 150 μm, manufactured by YMC Co., Ltd.) to bind IMCTA-C8 to the column. Then, the column was washed three times with 100 mL of water to remove water-soluble impurities. Thereafter, IMCTA-C8 was eluted with 300 mL of methanol. After the solvent was removed by drying, reverse-phase column (Hydrosphere C18, length 250 mm, diameter 20 mm, particle size 5 μm, pore size 12 nm, manufactured by YMC Co., Ltd.) was used with water-methanol as the solvent, and HPLC purification was repeated several times with a gradient from 100% water to 100% methanol. As a result, 129.6 mg of IMCTA-C8 was obtained with a yield of 25.7%.

Chemical formula

[0198] -Physicochemical properties of the compound (IMCTA-C8) represented by structural formula (2)- The physicochemical properties of the obtained IMCTA-C8 were as follows. From these findings, it was confirmed that the compound obtained in Synthesis Example 1 is a compound (IMCTA-C8) having the structure represented by structural formula (2) above. (1) Appearance: White powder (2)Molecular formula:C 20 H 40 NO 10 (3) High-resolution mass spectrometry (HRMS: ESI positive ion mode): Experimental value: m / z 454.2651 (M+H) + Calculated value: m / z 454.2652 (C 20 H 40 NO 10 (as) (4) Specific rotation: [α] D 23 = +153.3° (c=1.015, methanol) (5) Infrared absorption spectrum: The results obtained by infrared spectroscopy are shown in Figure 2A and below. ν max (KBr)cm -1 :3,389, 2,925, 2,854, 1,632, 1,462, 1,369, 1,148, 1,044, 992, 803, 606 (6) Proton nuclear magnetic resonance spectrum: The results measured at 600 MHz in heavy methanol at 25°C are shown in Figure 2B and below. 1 1H NMR (600 MHz, CD3OD): δ 5.11 (d, J = 3.8 Hz, 1H), 5.09 (d, J = 3.8 Hz, 1H), 3.74 - 3.85 (m, 6H), 3.65 - 3.69 (m, 2H), 3.48 (dd, J = 9.4, 3.8 Hz, 1H), 3.46 (dd, J = 9.8, 3.7 Hz, 1H), 3.31 (m, 1H), 2.71 (m, 2H), 2.49 (t, J = 10.0 Hz, 1H), 1.47 (m, 2H), 1.25 - 1.38 (m, 10H), 0.90 (t, J = 6.9 Hz, 3H). (7) Carbon-13 nuclear magnetic resonance spectrum: The results measured at 150 MHz in deuterated methanol at 25 °C were as shown in Figure 2C and as follows. 13 13C NMR (150 MHz, CD3OD): δ 95.0 × 2, 74.6, 74.0, 73.8, 73.2, 72.8, 72.7, 72.0, 63.7, 62.6, 62.1, 49.4, 33.0, 31.5, 30.7, 30.4, 28.4, 23.7, 14.4.

[0199] (Synthesis Example 2: Synthesis of IMCTA-C9) A trehalose analog was synthesized in the same manner as in Synthesis Example 1, except that the <Preparation of octanal solution> in Synthesis Example 1 was changed to the following <Preparation of nonanal solution>, and the <Synthesis of IMCTA-C8> was changed to the following <Synthesis of IMCTA-C9>. The obtained trehalose analog may be referred to as "IMCTA-C9".

[0200] <Preparation of nonanal solution> 200 mg of nonanal was dissolved in 4 mL of 1-propanol to prepare a nonanal solution (1.41 mmol).

[0201] <Synthesis of IMCTA-C9> In the <Synthesis of IMCTA-C8> of Synthesis Example 1, IMCTA-C9 (purified product) was obtained in the same manner as in the <Synthesis of IMCTA-C8> of Synthesis Example 1, except that the octanal solution was changed to a nonanal solution. The obtained IMCTA-C9 was 138 mg, and the yield was 26.6%. [ka]

[0202] -Physicochemical properties of the compound (IMCTA-C9) represented by structural formula (3)- The physicochemical properties of the obtained IMCTA-C9 were as follows. From these findings, it was confirmed that the compound obtained in Synthesis Example 2 is a compound (IMCTA-C9) having the structure represented by structural formula (3) above. (1) Appearance: White powder (2)Molecular formula:C 21 H 42 NO 10 (3) High-resolution mass spectrometry (HRMS: ESI positive ion mode): Experimental value: m / z 468.2803 (M+H) + Calculated value: m / z 468.2809 (C 21 H 42 NO 10 (as) (4) Specific rotation: [α] D 23 = +155.5° (c=1.025, methanol) (5) Infrared absorption spectrum: The results obtained by infrared spectroscopy are shown in Figure 3A and below. ν max (KBr)cm -1 :3,370, 2,925, 2,854, 1,643, 1,466, 1,371, 1,148, 1,077, 1,048, 992, 942, 802, 606 (6) Proton nuclear magnetic resonance spectrum: The results measured at 600 MHz in heavy methanol at 25°C are shown in Figure 3B and below. 1 1H NMR (600 MHz, CD3OD): δ 5.11 (d, J = 3.7 Hz, 1H), 5.09 (d, J = 3.7 Hz, 1H), 3.74 - 3.85 (m, 6H), 3.64 - 3.69 (m, 2H), 3.48 (dd, J = 9.5, 3.7 Hz, 1H), 3.46 (dd, J = 9.8, 3.7 Hz, 1H), 3.31 (m, 1H), 2.71 (m, 2H), 2.49 (t, J = 10.0 Hz, 1H), 1.47 (m, 2H), 1.24 - 1.38 (m, 12H), 0.90 (t, J = 7.1 Hz, 3H). (7) Carbon-13 Nuclear Magnetic Resonance Spectrum: The results measured at 150 MHz in deuterated methanol at 25 °C were as shown in Figure 3C and as follows. 13 13C NMR (150 MHz, CD3OD): δ 95.0, 94.9, 74.6, 74.0, 73.8, 73.2, 72.8, 72.7, 72.0, 63.7, 62.�, 62.1, 49.4, 33.1, 31.5, 30.7 × 2, 30.4, 28.4, 23.7, 14.4.

[0203] [[ID=͡11]](Synthesis Example 3: Synthesis of IMCTA-C10) A trehalose analog was synthesized in the same manner as in Synthesis Example 1, except that in Synthesis Example 1, the preparation of the <octanal solution> was changed to the following <decanal solution preparation>, and the synthesis of <IMCTA-C8> was changed to the following <IMCTA-C10 synthesis>. The obtained trehalose analog may be referred to as "IMCTA-C10".

[0204] (Preparation of Decanal Solution) ) 200 mg of decanal was dissolved in 4 mL of 1-propanol to prepare a decanal solution (1.28 mmol).

[0205] (Synthesis of IMCTA-C10) In the synthesis of <IMCTA-C8> in Synthesis Example 1, IMCTA-C10 (purified product) was obtained in the same manner as in the synthesis of <IMCTA-C8> in Synthesis Example 1, except that the octanal solution was changed to a decanal solution. The obtained IMCTA-C10 was 172.4 mg, with a yield of 32.2%. [ka]

[0206] -Physicochemical properties of the compound (IMCTA-C10) represented by structural formula (4)- The physicochemical properties of the obtained IMCTA-C10 were as follows. From these findings, it was confirmed that the compound obtained in Synthesis Example 3 is a compound (IMCTA-C10) having the structure represented by structural formula (4) above. (1) Appearance: White powder (2)Molecular formula:C 22 H 44 NO 10 (3) High-resolution mass spectrometry (HRMS: ESI positive ion mode): Experimental value: m / z 482.2962 (M+H) + Calculated value: m / z 482.2965 (C 22 H 44 NO 10 (as) (4) Specific rotation: [α] D 23 = +146.0° (c=1.010, methanol) (5) Infrared absorption spectrum: The results obtained by infrared spectroscopy are shown in Figure 4A and below. ν max (KBr)cm -1 :3,372, 2,925, 2,853, 1,645, 1,466, 1,370, 1,148, 1,077, 1,042, 994, 942, 802, 607 (6) Proton nuclear magnetic resonance spectrum: The results measured at 600 MHz in heavy methanol at 25°C are shown in Figure 4B and below. 1 1H NMR (600 MHz, CD3OD): δ 5.11 (d, J = 3.8 Hz, 1H), 5.09 (d, J = 3.8 Hz, 1H), 3.74 - 3.85 (m, 6H), 3.64 - 3.69 (m, 2H), 3.48 (dd, J = 9.7, 3.6 Hz, 1H), 3.46 (dd, J = 9.7, 3.7 Hz, 1H), 3.31 (m, 1H), 2.71 (m, 2H), 2.49 (t, J = 10.0 Hz, 1H), 1.47 (m, 2H), 1.24 - 1.38 (m, 14H), 0.90 (t, J = 7.0 Hz, 3H). (7) Carbon-13 nuclear magnetic resonance spectrum: The results measured at 25 °C in deuterated methanol at 150 MHz were as shown in Figure 4C and below. 13 13C NMR (150 MHz, CD3OD): δ 95.0, 94.9, 74.6, 74.0, 73.8, 73.2, 72.8, 72.7, 72.0, 63.7, 62.6, 62.1, 49.4, 33.1, 31.5, 30.8, 30.7×2, 30.5, 28.4, 23.7, 14.4.

[0207] (Synthesis Example 4: Synthesis of IMCTA-C11) A trehalose analog was synthesized in the same manner as in Synthesis Example 1, except that <Preparation of octanal solution> in Synthesis Example 1 was changed to <Preparation of undecanal solution> below, and <Synthesis of IMCTA-C8> was changed to <Synthesis of IMCTA-C11> below. The obtained trehalose analog may be referred to as "IMCTA-C11".

[0208] <Preparation of undecanal solution> 200 mg of undecanal was dissolved in 4 mL of 1-propanol to prepare an undecanal solution (1.17 mmol).

[0209] <Synthesis of IMCTA-C11> In the synthesis of <IMCTA-C8> in Synthesis Example 1, IMCTA-C11 (purified product) was obtained in the same manner as in the synthesis of <IMCTA-C8> in Synthesis Example 1, except that the octanal solution was changed to an undecanal solution. The obtained IMCTA-C11 was 144.0 mg, and the yield was 26.2%. [Chemical formula]

[0210] - Physicochemical properties of the compound (IMCTA-C11) represented by Structural Formula (5)- The physicochemical properties of the obtained IMCTA-C11 were as follows. From these, it was confirmed that the compound obtained in Synthesis Example 4 was the compound (IMCTA-C11) having the structure represented by the said Structural Formula (5). (1) Appearance: White powder (2) Molecular formula: C 23 H 46 NO 10 (3) High-resolution mass spectrometry (HRMS: ESI positive ion mode): Experimental value: m / z 496.3110 (M+H) + Calculated value: m / z 496.3122 (C 23 H 46 NO 10 as) (4) Specific rotation: [α] D 23 = +141.3° (c = 1.085, methanol) (5) Infrared absorption spectrum: The measurement results by infrared spectroscopy were as shown in Figure 5A and below. ν max (KBr) cm -1 : 3,369, 2,924, 2,853, 1,467, 1,370, 1,148, 1,078, 1,048, 993, 939, 840, 802, 607 (6) Proton nuclear magnetic resonance spectrum: The results measured in deuterated methanol at 25 °C at 600 MHz were as shown in Figure 5B and as follows. 1 1H NMR (600 MHz, CD3OD): δ 5.11 (d, J = 3.7 Hz, 1H), 5.09 (d, J = 3.7 Hz, 1H), 3.74 - 3.85 (m, 6H), 3.64 - 3.69 (m, 2H), 3.48 (dd, J = 9.5, 3.7 Hz, 1H), 3.46 (dd, J = 9.7, 3.7 Hz, 1H), 3.31 (m, 1H), 2.71 (m, 2H), 2.49 (t, J = 10.0 Hz, 1H), 1.47 (m, 2H), 1.24 - 1.38 (m, 16H), 0.90 (t, J = 7.1 Hz, 3H). (7) Carbon-13 nuclear magnetic resonance spectrum: The results measured in deuterated methanol at 25 °C at 150 MHz were as shown in Figure 5C and as follows. 13 13C NMR (150 MHz, CD3OD): δ 95.0, 94.9, 74.6, 74.0, 73.8, 73.2, 72.8, 72.7, 72.0, 63.7, 62.6, 62.1, 49.4, 33.1, 31.5, 30.8 × 3, 30.7, 30.5, 28.4, 23.7, 14.4.

[0211] (Synthesis Example 5: Synthesis of IMCTA-C12) In Synthesis Example 1, except that <Preparation of octanal solution> was changed to the following <Preparation of dodecanal solution> and <Synthesis of IMCTA-C8> was changed to the following <Synthesis of IMCTA-C12>, a trehalose analog was synthesized in the same manner as in Synthesis Example 1. The obtained trehalose analog may be referred to as "IMCTA-C12".

[0212] <Preparation of dodecanal solution> 200 mg of dodecanal was dissolved in 4 mL of 1-propanol to prepare a dodecanal solution (1.09 mmol).

[0213] <Synthesis of IMCTA-C12> In the <Synthesis of IMCTA-C8> of Synthesis Example 1, IMCTA-C12 (purified product) was obtained in the same manner as in the <Synthesis of IMCTA-C8> of Synthesis Example 1, except that the octanal solution was changed to a dodecanal solution. The obtained IMCTA-C12 was 96.0 mg, and the yield was 17.0%. [Chemical formula]

[0214] -Physicochemical properties of the compound (IMCTA-C12) represented by Structural Formula (6)- The physicochemical properties of the obtained IMCTA-C12 were as follows. From these results, it was confirmed that the compound obtained in Synthesis Example 5 was the compound (IMCTA-C12) having the structure represented by the above Structural Formula (6). (1) Appearance: White powder (2) Molecular formula: C 24 H 48 NO 10 (3) High-resolution mass spectrometry (HRMS: ESI positive ion mode): Experimental value: m / z 510.3278 (M+H) + Calculated value: m / z 510.3278 (C 24 H 48 NO 10 as) (4) Specific rotation: [α] D 24 = +139.7° (c = 1.015, methanol) (5) Infrared absorption spectrum: The measurement results by infrared spectroscopy were as shown in Figure 6A and below. ν max (KBr) cm -1 : 3,371, 2,924, 2,853, 1,467, 1,370, 1,149, 1,043, 994, 942, 803, 607 (6) Proton nuclear magnetic resonance spectrum: The results measured at 600 MHz in deuterated methanol at 25 °C were as shown in Figure 6B and below. 1 1H NMR (600 MHz, CD3OD): δ 5.11 (d, J = 3.7 Hz, 1H), 5.09 (d, J = 3.7 Hz, 1H), 3.74 - 3.85 (m, 6H), 3.64 - 3.69 (m, 2H), 3.49 (dd, J = 9.5, 3.7 Hz, 1H), 3.46 (dd, J = 9.8, 3.7 Hz, 1H), 3.31 (m, 1H), 2.71 (m, 2H), 2.49 (t, J = 10.0 Hz, 1H), 1.47 (m, 2H), 1.22 - 1.41 (m, 18H), 0.90 (t, J = 7.1 Hz, 3H). (7) Carbon-13 Nuclear Magnetic Resonance Spectrum: The results measured at 25 °C in deuterated methanol at 150 MHz were as shown in Figure 6C and as follows. 13 13C NMR (150 MHz, CD3OD): δ 95.0, 94.9, 74.6, 74.0, 73.8, 73.2, 72.8, 72.7, 72.0, 63.7, 62.6, 62.1, 49.4, 33.1, 31.5, 30.8 × 4, 30.7, 30.5, 28.3, 23.7, 14.4.

[0215] (Synthesis Example 6: Synthesis of IMCTA-C13) A trehalose analog was synthesized in the same manner as in Synthesis Example 1, except that <Preparation of Octanal Solution> in Synthesis Example 1 was changed to <Preparation of Tridecanal Solution> below, and <Synthesis of IMCTA-C8> was changed to <Synthesis of IMCTA-C13> below. The obtained trehalose analog may be referred to as "IMCTA-C13".

[0216] <Preparation of Tridecanal Solution> 200 mg of tridecanal was dissolved in 4 mL of 1-propanol to prepare a tridecanal solution (1.01 mmol).

[0217] <Synthesis of IMCTA-C13> In the synthesis of <IMCTA-C8> in Synthesis Example 1, IMCTA-C13 (purified product) was obtained in the same manner as in the synthesis of <IMCTA-C8> in Synthesis Example 1, except that the octanal solution was changed to a tridecanal solution. The obtained IMCTA-C13 was 43.6 mg, and the yield was 7.5%. [Chemical formula]

[0218] -Physicochemical properties of the compound (IMCTA-C13) represented by Structural Formula (7)- The physicochemical properties of the obtained IMCTA-C13 were as follows. From these results, it was confirmed that the compound obtained in Synthesis Example 6 was the compound (IMCTA-C13) having the structure represented by the above Structural Formula (7). (1) Appearance: White powder (2) Molecular formula: C 25 H 50 NO 10 (3) High-resolution mass spectrometry (HRMS: ESI positive ion mode): Experimental value: m / z 524.3428 (M+H) + Calculated value: m / z 524.3435 (C 25 H 50 NO 10 as) (4) Specific rotation: [α] D 24 = +134.6° (c = 1.000, methanol) (5) Infrared absorption spectrum: The measurement results by infrared spectroscopy were as shown in Figure 7A and below. ν max ' (KBr) cm -1 : 3,358, 2,924, 2,853, 1,675, 1,468, 1,204, 1,147, 1,080, 1,043, 994, 837, 801, 721, 605 (6) Proton nuclear magnetic resonance spectrum: The results measured in deuterated methanol at 25 °C at 600 MHz were as shown in Figure 7B and below. 1 1H NMR (600 MHz, CD3OD): δ 5.11 (d, J = 3.7 Hz, 1H), 5.09 (d, J = 3.7 Hz, 1H), 3.74 - 3.85 (m, 6H), 3.64 - 3.69 (m, 2H), 3.48 (dd, J = 9.6, 3.7 Hz, 1H), 3.46 (dd, J = 9.8, 3.7 Hz, 1H), 3.31 (m, 1H), 2.71 (m, 2H), 2.49 (t, J = 10.0 Hz, 1H), 1.47 (m, 2H), 1.23 - 1.39 (m, 20H), 0.90 (t, J = 7.1 Hz, 3H). (7) Carbon-13 nuclear magnetic resonance spectrum: The results measured in deuterated methanol at 25 °C at 150 MHz were as shown in Figure 7C and below. 13 13C NMR (150 MHz, CD3OD): δ 95.0, 94.9, 74.6, 74.0, 73.8, 73.2, 72.8, 72.7, 72.0, 63.7, 62.6, 62.1, 49.4, 33.1, 31.5, 30.8×5, 30.7, 30.5, 28.3, 23.7, 14.4.

[0219] (Synthesis Example 7: Synthesis of IMCTA-C14) In Synthesis Example 1, except that <Preparation of octanal solution> was changed to the following <Preparation of tetradecanal solution> and <Synthesis of IMCTA-C8> was changed to the following <Synthesis of IMCTA-C14>, a trehalose analog was synthesized in the same manner as in Synthesis Example 1. The obtained trehalose analog may be referred to as "IMCTA-C14".

[0220] <Preparation of tetradecanal solution> 200 mg of tetradecanal was dissolved in 4 mL of 1-propanol to prepare a tetradecanal solution (942 μmol).

[0221] <Synthesis of IMCTA-C14> In the <Synthesis of IMCTA-C8> of Synthesis Example 1, IMCTA-C14 (purified product) was obtained in the same manner as in the <Synthesis of IMCTA-C8> of Synthesis Example 1, except that the octanal solution was changed to a tetradecanal solution. The obtained IMCTA-C14 was 370 mg, and the yield was 73%. [Chemical formula]

[0222] -Physicochemical properties of the compound (IMCTA-C14) represented by Structural Formula (8)- The physicochemical properties of the obtained IMCTA-C14 were as follows. From these results, it was confirmed that the compound obtained in Synthesis Example 7 was the compound (IMCTA-C14) having the structure represented by the above Structural Formula (8). (1) Appearance: White powder (2) Molecular formula: C 26 H 52 NO 10 <� (3) High-resolution mass spectrometry (HRMS: ESI positive ion mode): Experimental value: m / z 538.3589 (M+H) + Calculated value: m / z 538.3591 (C 26 H 52 NO 10 as) <� (4) Specific rotation: [α] D 22 =+121.0° (c=1.045, methanol) (5) Infrared absorption spectrum: The measurement results by infrared spectroscopy were as shown in Figure 8A and below. ν max (KBr) cm -1 : 3,372, 2,919, 2,850, 1,468, 1,149, 1,042, <�002, 802, 719, 607 s(6) Proton nuclear magnetic resonance spectrum: The results measured at 600 MHz in deuterated methanol at 25 °C were as shown in Figure 8B and below. 1 1H NMR (600 MHz, CD3OD): δ 5.11 (d, J = 3.7 Hz, 1H), 5.09 (d, J = 3.7 Hz, 1H), 3.74 - 3.85 (m, 6H), 3.64 - 3.69 (m, 2H), 3.48 (dd, J = 9.5, 3.7 Hz, 1H), 3.46 (dd, J = 9.8, 3.7 Hz, 1H), 3.31 (m, 1H), 2.71 (m, 2H), 2.49 (t, J = 10.0 Hz, 1H), 1.47 (m, 2H), 1.23 - 1.39 (m, 22H), 0.90 (t, J = 7.1 Hz, 3H). (7) Carbon-13 Nuclear Magnetic Resonance Spectrum: The results measured at 25 °C in deuterated methanol at 150 MHz were as shown in Figure 8C and as follows. 13 13C NMR (150 MHz, CD3OD): δ 95.0, 94.9, 74.6, 74.0, 73.8, 73.2, 72.8, 72.7, 72.0, 63.7, 62.6, 62.1, 49.4, 33.1, 31.5, 30.8×6, 30.7, 30.5, 28.4, 23.7, 14.4.

[0223] (Synthesis Example 8: Synthesis of IMCTA-C15) A trehalose analog was synthesized in the same manner as in Synthesis Example 1, except that <Preparation of Octanal Solution> in Synthesis Example 1 was changed to the following <Preparation of Pentadecanal Solution>, and <Synthesis of IMCTA-C8> was changed to the following <Synthesis of IMCTA-C15>. The obtained trehalose analog may be referred to as "IMCTA-C15".

[0224] <Preparation of Pentadecanal Solution> 200 mg of pentadecanal was dissolved in 4 mL of 1-propanol to prepare a pentadecanal solution (883 μmol).

[0225] <Synthesis of IMCTA-C15> In the synthesis of <IMCTA-C8> in Synthesis Example 1, IMCTA-C15 (purified product) was obtained in the same manner as in the synthesis of <IMCTA-C8> in Synthesis Example 1, except that the octanal solution was changed to a pentadecanal solution. The obtained IMCTA-C15 was 41.6 mg, and the yield was 6.8%. [Chemical Formula]

[0226] - Physicochemical properties of the compound (IMCTA-C15) represented by Structural Formula (9) - The physicochemical properties of the obtained IMCTA-C15 were as follows. From these results, it was confirmed that the compound obtained in Synthesis Example 8 was the compound (IMCTA-C15) having the structure represented by the above Structural Formula (9). (1) Appearance: White powder (2) Molecular formula: C 27 H 54 NO 10 (3) High-resolution mass spectrometry (HRMS: ESI positive ion mode): Experimental value: m / z 552.3741 (M + H) + Calculated value: m / z 552.3748 (C 27 H 54 NO 10 as) (4) Specific rotation: [α] D 24 = +124.7° (c = 1.025, methanol) (5) Infrared absorption spectrum: The measurement results by infrared spectroscopy were as shown in Figure 9A and below. ν max ​​​​​​​​​1H NMR (600 MHz, DMSO-d6): 4.86 (d, J = 3.5 Hz, 1H), 4.84 (d, J = 3.5 Hz, 1H), 4.74 (d, J = 5.2 Hz, 1H), 4.71 (d, J = 4.9 Hz, 1H), 4.69 (d, J = 5.2 Hz, 1H), 4.58 (d, J = 6.5 Hz, 1H), 4.55 (d, J = 6.1, 1H), 4.32 (t, J = 5.9, 1H), 3.57 - 3.65 (m, 3H), 3.50 - 3.56 (m, 3H), 3.43 - 3.49 (m, 2H), 3.23 (m, 2H), 3.12 (ddd, 9.7, 8.8, 5.3 Hz, 1H), 2.62 (m, 1H), 2.53 (m, 1H), 2.25 (t, J = 9.8 Hz, 1H), 1.16 - 1.35 (m, 13H), 0.84 (t, J = 7.0 Hz, 3H). (7) Carbon-13 Nuclear Magnetic Resonance Spectrum: The results measured at 150 MHz in heavy DMSO at 25 °C were as shown in Figure 9C and below. 13 13C NMR (150 MHz, CD3OD): 93.1, 92.9, 72.9, 72.4, 72.3, 71.6, 71.5, 71.0, 70.1, 62.1, 60.7 × 2, 47.5, 31.3, 30.5, 29.1, 29.0 × 7, 28.7, 26.8, 22.1, 13.9.

[0227] (Synthesis Example 9: Synthesis of IMCTA-Fluorescein) (Preparation of 4-Trehalosamine Aqueous Solution) 200 mg of the purified product of 4-trehalosamine obtained in the <Purification Step> of Production Example 10 was dissolved in 1 mL of water to prepare a 4-trehalosamine aqueous solution (557 μmol).

[0228] (Preparation of 5-Carboxyfluorescein N-Succinimidyl Ester Solution) 20 mg of 5-carboxyfluorescein N-succinimidyl ester was dissolved in 200 μL of DMSO to prepare a 5-carboxyfluorescein N-succinimidyl ester solution (44.2 μmol).

[0229] (Synthesis of IMCTA-Fluorescein) To 200 μL of the 5-carboxyfluorescein N-succinimidyl ester solution, 1 mL (overload) of the 4-trehalosamine aqueous solution was added and allowed to stand at room temperature for 48 hours to synthesize a trehalose analog. The synthesized trehalose analog is sometimes referred to as "IMCTA-fluorescein". Using 0.05% trifluoroacetic acid-containing water-acetone as the solvent, two HPLC purifications were performed using a reversed-phase column (Hydrosphere C18, 250 mm length, 20 mm diameter, 5 μm particle size, 12 nm pore size, manufactured by YMC Co., Ltd.) with a gradient from 100% 0.05% trifluoroacetic acid-containing water to 100% acetone. This yielded 16.5 mg of IMCTA-fluorescein in a yield of 56%. [ka]

[0230] -Physicochemical properties of the compound (IMCTA-fluorescein) represented by structural formula (10)- The physicochemical properties of the obtained IMCTA-fluorescein were as follows. From these findings, it was confirmed that the compound obtained in Synthesis Example 9 is a compound (IMCTA-fluorescein) having the structure represented by the structural formula (10) above. (1) Appearance: Turmeric-colored powder (2)Molecular formula:C 33 H 33 NO 16 Na (3) High-resolution mass spectrometry (HRMS: ESI positive ion mode): Experimental value: m / z 722.1698 (M+H) + Calculated value: m / z 722.1697 (C 33 H 33 NO 16 (As Na) (4) Specific rotation: [α] D 23 = +89.0° (c=0.255, methanol) (5) Infrared absorption spectrum: The results obtained by infrared spectroscopy are shown in Figure 10A and below. ν max (KBr)cm -1 :3,361, 1,593, 1,459, 1,369, 1,308, 1,241, 1,210, 1,173, 1,119, 992, 875, 850, 761, 722, 671 (6) Proton nuclear magnetic resonance spectrum: The results measured at 600 MHz in heavy methanol at 25°C are shown in Figure 10B and below. 1 H NMR(600MHz,CD3OD):8.50(brs,1H),8.26(dd,J=8.0,1.5,1H),7.33(d,J=8.0,1H),6.71(d,J=1.5,2H),6.62(d,J =8.0,2H),6.56(dd,J=8.6,1.6,2H),5.22(d,J=3.5,1H),5.16(d,J=3.7,1H),4.11(t,J=9.6Hz,1H),4.04(t,J=9. 6Hz,1H),3.99(ddd,J=10.6,5.3,2.1,1H),3.87(ddd,J=10.1,5.3,2.2,1H),3.83(t,J=9.3Hz,1H),3.82(dd,J=11 .8,2.2,1H),3.70(dd,J=11.8,5.3,1H),3.60~3.67(m,3H),3.55(dd,J=9.7,3.6,1H),3.35(dd,J=9.8,9.1Hz,1H). (7) Carbon-13 nuclear magnetic resonance spectrum: The results measured at 150 MHz in deuterium methanol at 25°C are shown in Figure 10C and below. 13 C NMR(150MHz,CD3OD):170.4,168.8,161.7×2,154.3×2,137.7,135.7,130.3×2,128.8,125.9,125.0,1 13.9×2,111.0×2,103.6×2,95.0,94.9,74.6,73.9,73.7,73.2×2,72.7,72.0,71.9,63.1,62.6,54.1.

[0231] (Synthesis Example 10: Synthesis of IMCTA-Biotin) <Preparation of Aqueous Solution of 4-Trehalosamine 200 mg of the purified product of 4-trehalosamine obtained in the <Purification Step> of Production Example 10 was dissolved in 1 mL of water to prepare an aqueous solution of 4-trehalosamine (557 μmol).

[0232] <Preparation of Solution of D-Biotin N-Succinimidyl 20 mg of D-biotin N-succinimidyl was dissolved in 200 μL of DMSO to prepare a solution of D-biotin N-succinimidyl (58.6 μmol).

[0233] <Synthesis of IMCTA-Biotin 1 mL (excess amount) of the aqueous solution of 4-trehalosamine was added to 200 μL of the solution of D-biotin N-succinimidyl, and the mixture was allowed to stand at room temperature for 48 hours to synthesize a trehalose analog. The synthesized trehalose analog may be referred to as "IMCTA-biotin". Using water-methanol as a solvent, reverse-phase column (Hydrosphere C18, length 250 mm, diameter 20 mm, particle size 5 μm, pore size 12 nm, manufactured by WMC Co., Ltd.), HPLC purification was repeated twice with a gradient from 100% water to 100% methanol. As a result, 26 mg of IMCTA-biotin was obtained with a yield of 78%.

Chemical Structure

[0234] -Physicochemical Properties of the Compound Represented by Structural Formula (11) (IMCTA-Biotin)- The physicochemical properties of the obtained IMCTA-biotin were as follows. From these results, it was confirmed that the compound obtained in Synthesis Example 10 was a compound (IMCTA-biotin) having the structure represented by the structural formula (11). (1) Appearance: White powder (2) Molecular formula: C 22 H 37 N3O 12 SNa (3) High-resolution mass spectrometry (HRMS: ESI positive ion mode): Experimental value: m / z 590.1997 (M+H) + Calculated value: m / z 590.1996 (C 22 H 37 N3O 12 (As SNa) (4) Specific rotation: [α] D 23 = +143.5° (c=1.06, methanol) (5) Infrared absorption spectrum: The results obtained by infrared spectroscopy are shown in Figure 11A and below. ν max (KBr)cm -1 :3,388, 2,931, 2,348, 1,680, 1,550, 1,464, 1,044, 990, 574 (6) Proton nuclear magnetic resonance spectrum: The results measured at 600 MHz in heavy methanol at 25°C are shown in Figure 11B and below. 1 H NMR(600MHz,CD3OD):5.16(d,J=3.7Hz,1H),5.11(d,J=3.7Hz,1H),4.49(dd,J=7.9,5.0, 1H),4.31(dd,J=7.8,4.5,1H),3.88(t,J=9.7Hz,1H),3.71~3.85(m,5H),3.68(dd,J=11.8 ,5.4Hz,1H),3.49~3.59(m,4H),3.33(dd,J=9.8,8.8,1H),3.21(m,1H),2.93(dd,J=12.8 ,5.0,1H),2.71(d,J=12.8Hz,1H),2.27(t,J=7.3Hz,2H),1.57~1.78(m,4H),1.47(m,2H). (7) Carbon-13 nuclear magnetic resonance spectrum: The results measured at 150 MHz in heavy methanol at 25°C are shown in Figure 11C and below. 13 13C NMR (150 MHz, CD3OD): 176.9, 166.2, 95.0, 94.9, 74.5, 73.8×2, 73.1×2, 72.0, 71.8, 63.3, 63.0, 62.6, 61.6, 56.9, 53.2, 41.0, 37.0, 29.8, 29.4, 26.7.

[0235] (Synthesis Example 11: Synthesis of IMCTA - Azide) <Preparation of Aqueous Solution of 4 - Trehalosamine> 15 mg of the purified product of 4 - trehalosamine obtained in the <Purification Step> of Production Example 10 was dissolved in 150 μL of water to prepare an aqueous solution of 4 - trehalosamine (41.2 μmol).

[0236] <Preparation of 2 - Azido - 1,3 - Dimethylimidazolinium Hexafluorophosphate Solution> 100 mg of 2 - azido - 1,3 - dimethylimidazolinium hexafluorophosphate was dissolved in 200 μL of DMSO to prepare a 2 - azido - 1,3 - dimethylimidazolinium hexafluorophosphate solution (351 μmol).

[0237] <Preparation of N,N - Dimethyl - 4 - Aminopyridine Solution> 100 mg of N,N - dimethyl - 4 - aminopyridine (DMAP) was dissolved in 600 μL of 50% by volume aqueous DMSO solution to prepare a N,N - dimethyl - 4 - aminopyridine solution (819 μmol).

[0238] <Synthesis of IMCTA - Azide> To 150 μL of the above aqueous solution of 4 - trehalosamine, 200 μL of the above 2 - azido - 1,3 - dimethylimidazolinium hexafluorophosphate solution and 600 μL of the above N,N - dimethyl - 4 - aminopyridine solution were added and mixed, and the mixture was allowed to stand at room temperature for 24 hours to synthesize a trehalose analog. The synthesized trehalose analog may be referred to as "IMCTA - Azide". To a solution containing the synthesized IMCTA-azide, 1.2 mL of 8% sodium bicarbonate (NaHCO3) aqueous solution was added. Then, HPLC purification was repeatedly performed using a reversed-phase column (Hydrosphere C18, 250 mm in length, 20 mm in diameter, 5 μm particle size, 12 nm pore size, manufactured by YMC Corporation) and a YMC-Pack Polyamine II column (5 μm particle size, 12 nm pore size, manufactured by YMC Corporation) with water-methanol as the solvent. This yielded 9.9 mg of IMCTA-azide (4-azide-4-deoxy-trehalose) in a yield of 61%. [ka]

[0239] -Physicochemical properties of the compound (IMCTA-azide) represented by structural formula (12)- The physicochemical properties of the obtained IMCTA-azide were as follows. From these findings, it was confirmed that the compound obtained in Synthesis Example 11 is a compound (IMCTA-azide) having the structure represented by the structural formula (12) above. (1) Appearance: White powder (2)Molecular formula:C 12 H 21 N3O 10 Na (3) High-resolution mass spectrometry (HRMS: ESI positive ion mode): Experimental value: m / z 390.1117 (M+H) + Calculated value: m / z 390.1125 (C 12 H 21 N3O 10 (As Na) (4) Specific rotation: [α] D 21 = +184.1° (c=0.500, methanol) (5) Infrared absorption spectrum: The results obtained by infrared spectroscopy are shown in Figure 12A and below. ν max (KBr)cm -1 : 3,374、2,934、2,115、1,637、1,264、1,149、1,078、1,045、992、935、842、801、567 (6) Proton nuclear magnetic resonance spectrum: The results measured at 25 °C in deuterated methanol at 600 MHz were as shown in Figure 12B and below. 1 1H NMR (600 MHz, CD3OD): 5.14 (d, J = 3.8 Hz, 1H), 5.06 (d, J = 3.8 Hz, 1H), 3.92 (t, J = 9.5 Hz, 1H), 3.72 - 3.83 (m, 5H), 3.65 - 3.70 (m, 2H), 3.53 (dd, J = 9.7, 3.8 Hz, 1H), 3.46 (dd, J = 9.8, 3.8 Hz, 1H), 3.40 (t, J = 10.0 Hz, 1H), 3.33 (t, J = 9.4 Hz, 3H). (7) Carbon-13 nuclear magnetic resonance spectrum: The results measured at 25 °C in deuterated methanol at 150 MHz were as shown in Figure 12C and below. 13 13C NMR (150 MHz, CD3OD): 95.2 × 2, 74.5, 73.8, 73.6, 73.3, 73.1, 72.1, 71.9, 63.8, 62.6, 62.3.

[0240] (Test Example 1: Content of 4-trehalosamine in the culture solution) The content (production amount) of 4-trehalosamine in each culture solution after 12-day culture obtained in the culture processes of Production Examples 1 to 10 was confirmed by two methods: simple evaluation by thin-layer chromatography (TLC) and precise evaluation by liquid chromatography-mass (LC-MS) analysis.

[0241] <TLC analysis> After diluting each culture solution obtained in the culture processes of Production Examples 1 to 10 to 1 / 10 with methanol, centrifuging at 25,300 × g for 5 minutes, and obtaining the supernatant. The obtained culture supernatant was applied to a TLC plate (silica gel 60F with a thickness of 2 mm) 254 、5 μL each were spotted onto a TLC plate (Merck, Darmstadt, Germany) and dried. Next, the TLC plate was immersed in 60% by volume of 1-propanol as a developing solvent, developed, and then dried. A phosphomolybdic acid solution [2.4% sodium molybdate (Na2MoO4), 1.28% phosphoric acid (H3PO4), and 5% sulfuric acid (H2SO4)] was sprayed onto the dried TLC plate, heated on a hot plate, and developed color to detect 4-trehalosamine. The results are shown in Fig. 13A. The numbers 1 to 10 on the horizontal axis of Fig. 13A represent Production Examples 1 to 10.

[0242] <LC-MS Analysis> Each culture solution obtained in the culture steps of Production Examples 1 to 10 was diluted 1 / 10 with methanol, centrifuged at 25,300 × g for 5 minutes, and the supernatant was obtained. The obtained culture supernatant further diluted 1 / 10 with methanol was used as a test sample, and 4-trehalosamine in each culture solution was detected by LC-MS analysis under the following analysis conditions. Also, a calibration curve was prepared using purified 4-trehalosamine held by the present inventors under the following analysis conditions. Based on the calibration curve, the concentration (mg / mL) of 4-trehalosamine in each culture solution obtained in the culture steps of Production Examples 1 to 10 was calculated. The LC-MS analysis was performed at n = 3 (mean ± S.D.). The results are shown in Fig. 13B. The numbers 1 to 10 on the horizontal axis of Fig. 13B represent Production Examples 1 to 10. <L [LC-MS Analysis Conditions] · Apparatus: Q-Exactive (manufactured by Thermo Fisher Scientific) · Column: Hydrophilic Interaction Chromatography column (ACQUITY UPLC, ethylene-bridged hybrid (BEH) amide, particle size: 1.7 μm, diameter: 2.1 mm, length: 100 mm, manufactured by Waters, Milford, MA) · Column temperature: 40°C · Eluent: Solution A Acetonitrile: 5 mM ammonium acetate aqueous solution (9:1, v / v) Solution B 5 mM ammonium acetate aqueous solution • Elution conditions: Gradient elution from 0 minutes (A:B=90:10) to 5.25 minutes (A:B=40:60) to 6.25 minutes (A:B=40:60). Flow rate: 0.4 mL / min • Retention time: Retention time of 4-trehalosamine (3.42 ± 0.2 minutes) Ionization: ESI, positive ion mode • Spray voltage: 4KV • Capillary temperature: 350℃ Capillary voltage: 5V • Probe heater temperature: 400℃ • Detection: Experimental value: m / z 342.1397 (M+H) + Calculated value: m / z 342.1400 (C 12 H 24 NO 10 (as)

[0243] The results in Figures 13A and 13B show that, compared to using "Ko-culture medium" in Production Example 1, using "Modified Ko-culture medium 8" in Production Example 9 and "Modified Ko-culture medium 9" in Production Example 10 resulted in a 10-fold or more increase in the production of 4-trehalosamine during the culture process. More specifically, LC-MS analysis revealed that in Production Example 9, 4.72 g of 4-trehalosamine was produced per liter of "Modified Medium 8" (96.2 g of solid components). In Production Example 10, 5.48 g of 4-trehalosamine was produced per liter of "Modified Medium 9" (99.1 g of solid components).

[0244] (Test example 2: Sweetness test) The sweetness test of 4-trehalosamine was performed using the following method. For each of the purified 4-trehalosamine product obtained in the <purification process> of Production Example 10, trehalose (manufactured by Hayashibara Co., Ltd., the same applies to the following test examples), and sucrose, a 50 mg / 100 μL aqueous solution was prepared and used as the test sample. Twelve professional panelists licked 10 μL of each test sample, scored the sweetness of each test sample with the sweetness of only water set as "0" and the sweetest one as "10", and calculated the average value of the scores of each professional panelist for each test sample. When licking each test sample, a blind test was conducted with the name of the material covered. The results are shown in Table 1 below.

[0245]

Table 1

[0246] (Test Example 3: Properties of IMCTA-C8 to IMCTA-C15) Regarding IMCTA-C8, IMCTA-C9, IMCTA-C10, IMCTA-C11, IMCTA-C12, IMCTA-C13, IMCTA-C14, and IMCTA-C15 (IMCTA-Cn) obtained in Synthesis Examples 1 to 8, and n-dodecyl-β-D-maltoside (DDM) as a control, the "critical micelle concentration (CMC)", "micelle size", and "Hydrophilic-Lipophilic Balance (HLB) value" were measured or calculated by the following method. The results are shown in Table 2 below.

[0247] <Measurement of Critical Micelle Concentration (CMC)> The CMC was measured using a Detergent Critical Micelle Concentration (CMC) Assay Kit (CMC1000, manufactured by ProFoldin) according to the product protocol.

[0248] <Measurement of Micelle Size> The micelle size was measured by the dynamic light scattering method using a Zetasizer Nano S (manufactured by Malvern Panalytical).

[0249] <Measurement of HLB Value> HLB values ​​were calculated using the Griffin method with a Marvin Sketch (ChemAxon).

[0250] [Table 2]

[0251] The results in Table 2 show that IMCTA-Cn possesses surfactant properties. Furthermore, in a comparison between IMCTA-C12 and DDM, which both have similar fatty acid chains, IMCTA-C12 had a higher CMC value and larger micelle size compared to DDM.

[0252] (Test Example 4: Protein extraction test of IMCTA-C8 to IMCTA-C15) The protein extraction effect of IMCTA-Cn obtained in synthesis examples 1-8 was evaluated by the following method.

[0253] <Preparation of test samples> IMCTA-Cn obtained in Synthesis Examples 1-8, as well as trehalose-C8 (hereinafter sometimes referred to as "T8") (manufactured by Dojin Chemical Laboratories Co., Ltd.), trehalose-C12 (hereinafter sometimes referred to as "T12") (manufactured by Dojin Chemical Laboratories Co., Ltd.), n-octyl-β-D-glucoside (hereinafter sometimes referred to as "OG") (manufactured by Dojin Chemical Laboratories Co., Ltd.), Triton X-100 (hereinafter sometimes referred to as "TR") (manufactured by MP Biomedicals), and Tween Test samples were prepared at various concentrations of 0%, 0.005%, 0.01%, 0.02%, 0.05%, 0.1%, 0.2%, 0.5%, and 1% by suspending each of the following in Tris-buffered saline (TBS, manufactured by Takara Bio Inc.): 20 (hereinafter sometimes referred to as "TW") (manufactured by Tokyo Chemical Industry Co., Ltd.), n-dodecyl-β-D-maltoside (DDM) (manufactured by Dojin Chemical Laboratories Co., Ltd.), 3-[(3-collamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS, hereinafter sometimes referred to as "CPS") (manufactured by Dojin Chemical Laboratories Co., Ltd.), sodium deoxycholate (hereinafter sometimes referred to as "DC") (manufactured by Tokyo Chemical Industry Co., Ltd.), and sodium dodecyl sulfate (SDS) (manufactured by Sigma-Aldrich).

[0254] <Evaluation of protein extraction efficiency> -Measurement of protein concentration- Human ovarian cancer cells OVK18 (obtained from the RIKEN BioResource Research Center (BRC)) were grown in a petri dish until confluent. After removing the culture medium, the cells were washed once with phosphate-buffered saline (PBS, Takara Bio Inc.) and treated with 0.05% trypsin-EDTA (Thermo Fisher Scientific) for 5 minutes. After trypsin treatment, three times the volume (V / V) of 0.05% trypsin-EDTA was added to DMEM medium (Dulbecco's modified Eagle medium "Nissui" 2 (Nissui Pharmaceutical Co., Ltd.) containing 10% fetal bovine serum (FBS, Sigma-Aldrich), 1 / 100 volume of penicillin-streptomycin-L-glutamine solution (×100) (Fujifilm Wako Pure Chemical Industries, Ltd.), and 0.12% sodium bicarbonate (Fujifilm Wako Pure Chemical Industries, Ltd.); in the following test examples, "DMEM medium" with the same composition was used) to stop the trypsin reaction. Next, the cells were collected by detaching them from the petri dish by pipetting seven times. The collected cells were centrifuged at 400 × g for 3 minutes to precipitate, and then washed once with Tris-buffered saline (TBS). The cell precipitate was weighed and suspended in TBS at 40 mg / mL. This was dispensed in 100 μL portions, each containing the aforementioned test sample at its respective concentration, and rotated at 4°C and 40 rpm for 1 hour. The mixture was centrifuged at 700 × g for 5 minutes, and the protein concentration of the supernatant was measured using the BCA protein assay kit (Thermo Fisher Scientific) to evaluate the protein extraction efficiency (mean ± SD, n=3). The results are shown in Figure 14A.

[0255] -Polyacrylamide electrophoresis (SDS-PAGE)- Using the test samples prepared to 0.05% or 0.5% in the above-mentioned <Preparation of Test Samples>, the cell supernatant obtained in the above-mentioned <Evaluation of Protein Extraction Efficiency> was used, and the same amount of 2×SDS-PAGE sample buffer (125 mM Tris (tris(hydroxymethyl)aminomethane), 4% SDS, 10% sucrose, 10% 2-mercaptoethanol (2-ME), and 0.004% bromophenol blue (BPB), pH 6.8) was added to the cell supernatant, and the mixture was boiled for 5 minutes to prepare the test samples for SDS-PAGE. These SDS-PAGE test samples were separated by SDS-PAGE using a 12.5% ​​acrylamide gel (manufactured by Antegral) and stained with Quick-CBB (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.). The results for a 0.05% test sample are shown in Figure 14B, and the results for a 0.5% test sample are shown in Figure 14C.

[0256] The results shown in Figures 14A-C indicate that IMCTA-Cn has the ability to extract proteins from cells. In particular, IMCTA-C11-IMCTA-C14 showed extraction efficiencies comparable to those of highly efficient surfactants such as DDM and Triton X-100.

[0257] -Confirmation of membrane protein extraction efficiency- Using the aforementioned polyacrylamide electrophoresis (SDS-PAGE) gel, the samples were transferred to an Immobilon-P membrane, PVDF (Merck), and Western blotting was performed. The primary antibody used was β-tubulin (Cell Signaling Technology) as the control soluble protein, and EGFR and Na as the membrane proteins. + / K + Antibodies against -ATPase (both from Cell Signaling Technology) and TRPV6 (from Proteintech) were reacted at 1 / 1,000 dilution at 6°C for 12 hours. For the secondary antibody, HRP-conjugated anti-rabbit IgG or HRP-conjugated anti-mouse IgG (both from Cell Signaling Technology) were used at 1 / 5,000 dilution, depending on the primary antibody, and detected using the FastGene Western ECL kit (from Genetics Japan Co., Ltd.). The results are shown in Figure 14D.

[0258] As shown in Figure 14D, the extraction efficiency of membrane proteins using each test sample was almost identical to the patterns for total proteins and the soluble protein tubulin using CBB. In particular, high extraction efficiency of membrane proteins was confirmed with IMCTA-C11, IMCTA-C12, IMCTA-C13, and IMCTA-C14.

[0259] -Confirmation of denaturation effect- One μg of protein extracted from human ovarian cancer cells (OVK18) using the above-described test sample (1%) was mixed with 200 mM p-nitrophenyl phosphate (pNPP) in a TBS containing 20 mM magnesium chloride and 0.5 mM dithiothreitol (DTT), and reacted at 37°C for 1 hour. After the reaction, the absorbance at 420 nm was measured using a microplate reader (Cytation5, Bio Tek Instruments), and the CIP activity was determined by the amount of the enzymatic reaction product p-nitrophenol (n=3, mean±SD). The results are shown in Figure 14E.

[0260] As shown in Figure 14E, SDS, DC, and OG reduced CIP activity, indicating protein denaturation. However, other surfactants, including various IMCTA-Cn types, did not reduce CIP activity and did not exhibit general protein denaturation. Therefore, IMCTA-Cn is a mild surfactant that does not denature proteins and is suitable for use, for example, in the extraction of membrane proteins while preserving their function.

[0261] (Test Example 5:4 - Inhibitory effect of trehalosamine on starch aging) Using the purified 4-trehalosamine product obtained in the <purification process> of Production Example 10, the anti-retrogradation effect of 4-trehalosamine on starch was confirmed by the following two methods: enzyme assay and dynamic viscoelasticity measurement.

[0262] <Enzyme Assay 1> Each test sample was mixed in corn starch gel and left to stand at low temperature for 96 hours. The degree of aging was evaluated by decomposition experiments using β-amylase. The following method is an evaluation system using only β-amylase, which is an improved version of the BAP method (K. Kainuma, et al, Journal of the Japanese Society of Starch Science 1981, 28, 235).

[0263] -Preparation of the sample for measurement- In Production Example 10, 4-trehalosamine (4TA), along with trehalose (TRH), sucrose (SCR), and glycerol (hereinafter sometimes referred to as "GOL") were dissolved in water to a final concentration of 10% (w / w) to prepare aqueous solutions. Corn starch (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.) was added to each of these aqueous solutions containing sugars or to a control of water to a final concentration of 15% (w / w) to create a uniform suspension, and 33.3 μL of each solution was dispensed into four tubes. Next, all tubes were treated with a heat block at 100°C for 5 minutes to gel. One of the four tubes was used as the 0-hour sample and was used for the "-Confirmation of starch retrogradation inhibitory effect-" described below. The remaining three tubes were left to stand at 6°C for 24 hours, 48 ​​hours, and 96 hours, respectively, to obtain the 24-hour sample, 48-hour sample, and 96-hour sample.

[0264] -Preparation of active and inactive enzymes- β-amylase (derived from barley, manufactured by Sigma-Aldrich) was dissolved at a concentration of 33 μg / mL (1.37 units / mL) in 0.8 M acetate-sodium hydroxide (NaOH) buffer (pH 6.0) to obtain the active enzyme. A portion of the aforementioned active enzyme was isolated and treated with a heat block at 100°C for 30 minutes to obtain an inactive enzyme.

[0265] -Confirmation of the anti-aging effect of starch- After 0 hours, immediately after gelation, 0.9 mL of 0.8 M acetate-sodium hydroxide (NaOH) buffer (pH 6.0) was added to the sample. The gel in the buffer was loosened by pipetting and suspended as uniformly as possible, then divided into two 0.4 mL portions and placed into separate tubes. 100 μL of the active enzyme was added to one tube, and 100 μL of the inactive enzyme was added to the other tube. After thoroughly mixing by vortexing, the mixture was reacted at 37°C for 30 minutes. After the reaction, the enzyme was inactivated by treating at 100°C for 5 minutes, then thoroughly mixed. 10 μL was transferred to another tube, and 40 μL of water and 50 μL of Somogyi solution (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.) were added. The mixture was treated at 100°C for 15 minutes. After cooling to room temperature, 80 μL was transferred to a 96-well plate, and 40 μL of Nelson solution (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.) was added. After 5 minutes, the absorbance at 660 nm was measured using a Cytation 5 plate reader (manufactured by Bio Tek Instruments). The absorbance value of the sample with the inactive enzyme was subtracted from the absorbance value of the sample with the active enzyme, using the inactive enzyme as the background value.

[0266] In the enzymatic reaction and sugar quantification (absorbance measurement) of the sample after 0 hours, the 24-hour, 48-hour, or 96-hour samples were subjected to the same method as the enzymatic reaction and sugar quantification (absorbance measurement) of the sample after 0 hours, except that the sample used for measurement was changed to the sample after 24 hours, the sample after 48 hours, or the sample after 96 hours.

[0267] The degradation efficiency was defined as 100% when the absorbance value of the sample with active enzyme added was subtracted from the absorbance value of the sample with inactive enzyme added at 0 hours. The degradation efficiency of the starch retrogradation was then calculated based on the absorbance value of the sample with active enzyme added at 24 hours, 48 ​​hours, or 96 hours, subtracted from the absorbance value of the sample with inactive enzyme added (as background), and the degree of starch retrogradation was evaluated (n=5, mean±SD). The results are shown in Figure 15A.

[0268] As shown in Figure 15A, the corn starch gel containing 4-trehalosamine (4TA) showed a significantly higher rate of degradation by β-amylase compared to other gels after 24 hours, indicating that 4-trehalosamine (4TA) has a higher anti-aging effect compared to trehalose (TRH), sucrose (SCR), and glycerol (GCL).

[0269] <Enzyme assay 2> In the "Preparation of Samples for Measurement" step of <Enzyme Assay 1> described above, the final concentrations of the aqueous solutions of 4-trehalosamine (4TA), trehalose (TRH), sucrose (SCR), and glycerol (GOL) were changed from 10% (w / w) to 2% (w / w), 5% (w / w), or 15% (w / w), respectively, to confirm the anti-retrogradation effect of starch using the same method as in <Enzyme Assay 1> described above. The results when the final concentration of each sugar aqueous solution was 2% (w / w) are shown in Figure 15B, the results when the final concentration of each sugar aqueous solution was 5% (w / w) are shown in Figure 15C, and the results when the final concentration of each sugar aqueous solution was 15% (w / w) are shown in Figure 15D.

[0270] The results shown in Figures 15B-D indicate that when the final concentration of 4-trehalosamine aqueous solution was 5% to 15%, the corn starch gel maintained a significantly higher β-amylase degradation rate after 96 hours compared to the other gels, demonstrating an even stronger starch retrogradation inhibitory effect.

[0271] <Enzyme Assay 3> The starch retrogradation inhibitory effect was confirmed in the same manner as in <Enzyme Assay 1>, except that the steps for "-Preparation of the sample for measurement-" and "-Confirmation of the retrogradation inhibitory effect of starch-" were changed to the following methods.

[0272] -Preparation of the sample for measurement- In Production Example 10, 4-trehalosamine (4TA), along with trehalose (TRH), sucrose (SCR), and glycerol (GOL), were dissolved in water to prepare aqueous solutions with a final concentration of 10% (w / w) or 15% (w / w), respectively. Potato starch (manufactured by Yoshida Pharmaceutical Co., Ltd.) was added to each of these aqueous solutions containing sugars or to a control of water to a final concentration of 15% (w / w), and the mixture was homogenized. 33.3 μL of each solution was then dispensed into three tubes. All tubes were then treated with a heat block at 100°C for 5 minutes to induce gelation. One of the three tubes was used as the 0-hour sample and was used for the "Confirmation of Starch Retrogradation Inhibitory Effect" described below. The remaining two tubes were left to stand at 6°C for 48 hours and 96 hours, respectively, to obtain the 48-hour and 96-hour samples.

[0273] -Confirmation of the anti-aging effect of starch- In the "Confirmation of Starch Retrogradation Inhibitory Effect" step of <Enzyme Assay 1> described above, the measurement of absorbance at 660 nm was changed to the measurement of absorbance at 620 nm, and the enzyme reaction and quantification of sugars (absorbance measurement) were performed on the sample after 0 hours, the sample after 48 hours, and the sample after 96 hours. Except for these changes, the retrogradation inhibitory effect of starch was confirmed using the same method as in the "Confirmation of Starch Retrogradation Inhibitory Effect" step of <Enzyme Assay 1> described above. The results when the final concentration of each sugar aqueous solution was 10% (w / w) are shown in Figure 15E, and the results when the final concentration of each sugar was 15% (w / w) are shown in Figure 15F.

[0274] The results shown in Figures 15E and 15F indicate that the potato starch gel containing 4-trehalosamine (4TA) showed a significantly higher rate of degradation by β-amylase after 48 hours compared to other gels, demonstrating that 4-trehalosamine (4TA) has a higher anti-aging effect compared to trehalose (TRH), sucrose (SCR), and glycerol (GCL).

[0275] <Enzyme Assay 4> In the "Preparation of Sample for Measurement" step of the aforementioned <Enzyme Assay 3>, the anti-retrogradation effect of starch was confirmed using the same method as in the aforementioned <Enzyme Assay 3>, except that potato starch was replaced with rice flour (manufactured by Ohsawa Japan Co., Ltd.). The results when the final concentration of each sugar was 10% (w / w) are shown in Figure 15G, and the results when the final concentration of each sugar was 15% (w / w) are shown in Figure 15H.

[0276] The results in Figures 15G and 15H show that the rice flour gel containing 4-trehalosamine (4TA) had a significantly higher rate of degradation by β-amylase after 48 hours compared to other gels, indicating that 4-trehalosamine (4TA) has a higher anti-aging effect compared to trehalose (TRH), sucrose (SCR), and glycerol (GCL).

[0277] <Enzyme Assay 5> In the "Preparation of Sample for Measurement" step of the aforementioned <Enzyme Assay 3>, the anti-retrogradation effect of starch was confirmed using the same method as in the aforementioned <Enzyme Assay 3>, except that potato starch was replaced with wheat flour (organic wheat flour, Kanazawa Daichi Co., Ltd.). Figure 15I shows the results when the final concentration of each sugar was 10% (w / w), and Figure 15J shows the results when the final concentration of each sugar was 15% (w / w).

[0278] The results in Figures 15I and 15J show that the wheat flour gel containing 4-trehalosamine (4TA) had a significantly higher rate of degradation by β-amylase after 48 hours compared to other gels, indicating that 4-trehalosamine (4TA) has a higher anti-aging effect compared to trehalose (TRH), sucrose (SCR), and glycerol (GCL).

[0279] <Dynamic Viscoelasticity Measurement> In 20 mL glass vials, corn starch (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.) was added to either a 10% 4-trehalosamine (4TA) aqueous solution, a 10% trehalose (TRH) aqueous solution, a 10% sucrose (SCR) aqueous solution, or a 10% glycerol (GOL) aqueous solution, or water as a control, to a final concentration of 15% (w / w), and the mixture was homogenized. The mixture was then autoclaved at 121°C for 20 minutes to gel. Samples for 0 hours and 96 hours were prepared for each sample. After cooling to room temperature, dynamic viscoelasticity measurements were performed within 4 hours for the 0-hour sample. For the 96-hour sample, dynamic viscoelasticity measurements were performed after standing at 4°C for 96 hours. Dynamic viscoelasticity measurements were performed using an MCR300 rheometer (Physica, Stuttgart, Germany) with a 25mm parallel plate measuring fixture and a 1.0mm gap. The storage modulus (G') and loss modulus (G'') were measured under fixed frequency of 1.0Hz, strain amplitude of 1%, and temperature of 25°C, and the loss tangent (tanδ = G'' / G') was calculated. The results are shown in Figure 15K. Note that in Figure 15K, the tanδ value is shown on the vertical axis (n=5, mean±SD).

[0280] As shown in Figure 15K, the corn starch gel containing 4-trehalosamine (4TA) showed little change or a slight increase in the loss tangent value after 96 hours. In contrast, the corn starch gel containing other sugars showed increased elasticity, resulting in a decrease in the loss tangent value. This indicates that 4-trehalosamine (4TA) has a higher anti-aging effect compared to trehalose (TRH), sucrose (SCR), and glycerol (GCL).

[0281] (Test Example 6-1: Protective effect of 4-trehalosamine on protein (CIP)) Test samples 1-12 containing bovine alkaline phosphatase (CIP) were prepared as follows, and the protein protection activity under freeze-drying conditions with various added sugars was evaluated.

[0282] <Preparation of test samples> Test sample 1. Enzyme solution Bovine alkaline phosphatase (10 units / μL, New England Biolabs product) was diluted to 1 / 40 with TBS (Takara Bio Inc.), and then dialyzed at 4°C for 2 hours in 1,000 times the volume of TBS of the enzyme dilution to remove glycerol. 40 μL of the enzyme solution after dialyzing was mixed with 40 μL of TBS and allowed to stand at 4°C for 20 hours to prepare the enzyme solution.

[0283] Test sample 2. Freeze-thawed enzyme An enzyme solution was prepared using the same method as for test sample 1, and after freezing at -80°C for 20 hours, the freeze-thaw product of the enzyme was prepared.

[0284] Test sample 3. Freeze-dried enzyme An enzyme solution was prepared in the same manner as for test sample 1, frozen at -80°C for 10 minutes, and then freeze-dried for 20 hours in a freeze-dryer (FLEXI-DRY, FTSsystems INC., Warminster) connected to a vacuum pump (P65D, PHIL Sato Vac INC.) to prepare a freeze-dried enzyme product.

[0285] Test sample 4. Freeze-dried product of enzyme with 1% TRH added. Bovine alkaline phosphatase (10 units / μL, New England Biolabs product) was diluted to 1 / 40 with TBS (Takara Bio Inc.), and then dialyzed at 4°C for 2 hours in 1,000 times the volume of TBS of the enzyme dilution to remove glycerol. 40 μL of the dialyzed enzyme solution was mixed with 40 μL of TBS containing 2% trehalose (TRH), frozen at -80°C for 10 minutes, and then freeze-dried for 20 hours in a freeze-dryer (FLEXI-DRY, FTSsystems INC., Warminster) connected to a vacuum pump (P65D, PHIL Sato Vac INC.) to prepare a freeze-dried product of the 1% TRH-added enzyme.

[0286] Test sample 5. Freeze-dried product of enzyme with 3% TRH added. The freeze-dried 3% TRH-added enzyme was prepared using the same method as for test sample 4, except that the final concentration of trehalose was changed to 3%.

[0287] Test sample 6. Freeze-dried product of enzyme with 1% 4TA added. A freeze-dried product of the enzyme with 1% 4TA added was prepared using the same method as for test sample 4, except that trehalose was replaced with 4-trehalosamine (4TA).

[0288] Test sample 7. Freeze-dried product of enzyme with 3% 4TA added. The freeze-dried enzyme with 3% 4TA added was prepared using the same method as for test sample 5, except that trehalose was replaced with 4-trehalosamine (4TA).

[0289] Test sample 8. Freeze-dried product of enzyme with 1% MLT added. A freeze-dried 1% MLT-added enzyme was prepared using the same method as for test sample 4, except that trehalose was replaced with maltose (MLT).

[0290] Test sample 9. Freeze-dried product of enzyme with 3% MLT added. A freeze-dried product of enzyme with 3% MLT added was prepared using the same method as for test sample 5, except that trehalose was replaced with maltose (MLT).

[0291] Test sample 10. Freeze-dried product of enzyme with 1% SCR added. The freeze-dried enzyme with 1% SCR added was prepared using the same method as for test sample 4, except that trehalose was replaced with sucrose (SCR).

[0292] Test sample 11. Freeze-dried product of enzyme with 3% SCR added. In the method for preparing Test Sample 5, a lyophilized product of the enzyme with 3% SCR added was prepared in the same manner as the method for preparing Test Sample 5, except that trehalose was changed to sucrose (SCR).

[0293] Test Sample 12. Lyophilized product of the enzyme with 3% GOL added In the method for preparing Test Sample 5, a lyophilized product of the enzyme with 3% GOL added was prepared in the same manner as the method for preparing Test Sample 5, except that trehalose was changed to glycerol (GOL).

[0294] <Evaluation of CIP protection activity> 80 μL of water was added to each of the lyophilized products of Test Samples 3 to 12 and diluted 1 / 100 with TBS. Also, Test Samples 1 and 2 were diluted 1 / 100 with TBS. To 70 μL of TBS, 10 μL of the diluted Test Samples 1 to 12 and 20 μL of a 0.1 M p-nitrophenyl phosphate (pNPP)-TBS solution were added, and an enzyme reaction was carried out at 37°C for 1 hour. After the reaction, the absorbance at 420 nm was measured using a microplate reader (Cytation5, manufactured by Bio Tek Instruments), and the CIP activity was measured based on the amount of the enzyme reaction product p-nitrophenol (n = 3, mean ± S.D.). The results are shown in Fig. 16A.

[0295] From the results in Fig. 16A, the enzyme activity significantly decreased in Test Sample 2 (the freeze-thawed product of the enzyme) and Test Sample 12 (the lyophilized product of the enzyme with 3% GOL added). In contrast, those freeze-dried with 3% 4-trehalosamine, trehalose, maltose, or sucrose added retained suitable activity. Among them, the protective effect by 4-trehalosamine was higher than that of other sugars.

[0296] (Test Example 6-2: Protective effect of 4-trehalosamine on protein (ADH)) Test Samples 1 to 12 containing yeast alcohol dehydrogenase (ADH) were prepared as follows, and the protein protection activity under lyophilization with various added sugars was evaluated.

[0297] <Preparation of test samples> Test sample 1. Enzyme solution Yeast alcohol dehydrogenase (manufactured by Oriental Yeast Co., Ltd.) was dissolved in water at a concentration of 1,000 units / mL, and then diluted to 6 units / mL with TBS (manufactured by Takara Bio Inc.). 50 μL of this enzyme solution was mixed with 50 μL of TBS, and the mixture was allowed to stand at 4°C for 20 hours to prepare the enzyme solution.

[0298] Test sample 2. Freeze-thawed enzyme An enzyme solution was prepared using the same method as for test sample 1, and after freezing at -80°C for 20 hours, the freeze-thaw product of the enzyme was prepared.

[0299] Test sample 3. Freeze-dried enzyme An enzyme solution was prepared in the same manner as for test sample 1, frozen at -80°C for 10 minutes, and then freeze-dried for 20 hours in a freeze-dryer (FLEXI-DRY, FTSsystems INC., Warminster) connected to a vacuum pump (P65D, PHIL Sato Vac INC.) to prepare a freeze-dried enzyme product.

[0300] Test sample 4. Freeze-dried product of enzyme with 1% TRH added. Yeast alcohol dehydrogenase (manufactured by Oriental Yeast Co., Ltd.) was dissolved in water at a concentration of 1,000 units / mL, and then diluted to 6 units / mL with TBS (manufactured by Takara Bio Inc.). 50 μL of this enzyme solution was mixed with 50 μL of TBS containing 2% trehalose (TRH), frozen at -80°C for 10 minutes, and then freeze-dried for 20 hours in a freeze-dryer (FLEXI-DRY, manufactured by FTSsystems Inc., Warminster) connected to a vacuum pump (P65D, manufactured by PHIL Sato Vac INC.) to prepare a freeze-dried product of the enzyme with 1% TRH added.

[0301] Test sample 5. Freeze-dried product of enzyme with 3% TRH added. The freeze-dried 3% TRH-added enzyme was prepared using the same method as for test sample 4, except that the final concentration of trehalose was changed to 3%.

[0302] Test sample 6. Freeze-dried product of enzyme with 1% 4TA added. A freeze-dried product of the enzyme with 1% 4TA added was prepared using the same method as for test sample 4, except that trehalose was replaced with 4-trehalosamine (4TA).

[0303] Test sample 7. Freeze-dried product of enzyme with 3% 4TA added. The freeze-dried enzyme with 3% 4TA added was prepared using the same method as for test sample 5, except that trehalose was replaced with 4-trehalosamine (4TA).

[0304] Test sample 8. Freeze-dried product of enzyme with 1% MLT added. A freeze-dried 1% MLT-added enzyme was prepared using the same method as for test sample 4, except that trehalose was replaced with maltose (MLT).

[0305] Test sample 9. Freeze-dried product of enzyme with 3% MLT added. A freeze-dried product of enzyme with 3% MLT added was prepared using the same method as for test sample 5, except that trehalose was replaced with maltose (MLT).

[0306] Test sample 10. Freeze-dried product of enzyme with 1% SCR added. The freeze-dried enzyme with 1% SCR added was prepared using the same method as for test sample 4, except that trehalose was replaced with sucrose (SCR).

[0307] Test sample 11. Freeze-dried product of enzyme with 3% SCR added. The freeze-dried enzyme with 3% SCR added was prepared using the same method as for test sample 5, except that trehalose was replaced with sucrose (SCR).

[0308] Test sample 12. Freeze-dried product of enzyme with 3% GOL added. In the method for preparing Test Sample 5, a lyophilized product of the 3% GOL-added enzyme was prepared in the same manner as the method for preparing Test Sample 5, except that trehalose was changed to glycerol (GOL).

[0309] <Evaluation of ADH protection activity> The enzyme solution of Test Sample 1, the freeze-thawed product of the enzyme of Test Sample 2, and the lyophilized products of Test Samples 3 to 12 were diluted with TBS to a concentration of 0.012 units / mL, and 0.5 mM β-NAD + (manufactured by Oriental Yeast Co., Ltd.) and 0.62 M ethanol were added, and an enzyme reaction was carried out at room temperature for 1 hour. After the reaction, the absorbance at 340 nm was measured using a microplate reader (Cytation5, manufactured by Bio Tek Instruments) (n = 3, mean ± S.D.). The ADH activity was determined by dividing the absorbance value at 340 nm by the absorbance value at 340 nm of the enzyme solution of Test Sample 1 (control). The results are shown in Fig. 16B.

[0310] From the results in Fig. 16B, similar to Test Example 6-1, the enzyme activity was significantly reduced in Test Sample 2 (the freeze-thawed product of the enzyme) and Test Sample 12 (the lyophilized product of the 3% GOL-added enzyme). In contrast, those freeze-dried with the addition of 1% or 3% of 4-trehalosamine, trehalose, maltose, or sucrose retained suitable activity. Among them, the protective effect of 4-trehalosamine was higher than that of other sugars.

[0311] (Test Example 7-1: Protective effect of 4-trehalosamine on microorganisms (Saccharomyces cerevisiae)) Using Test Samples 1 to 8 containing Saccharomyces cerevisiae prepared by the following method, the microbial protection activity under lyophilization with various sugars was evaluated.

[0312] <Preparation of test samples> Test Sample 1. Control (NF: Non-freezing) Saccharomyces cerevisiae ( Saccharomyces cerevisiae Frozen stock of F-7 (owned by the Japan Society for Microbial Chemistry) was inoculated into 10 mL of YPD culture medium (1% yeast extract, 2% polypeptone, 2% glucose) and cultured at 27°C for 2 days with shaking at 220 rpm. After culturing, the mixture was centrifuged at 1,000 × g for 5 minutes, washed once with 10 mL of water, and then suspended in 10 mL of water to obtain a yeast suspension. 50 μL of this yeast suspension was mixed with 50 μL of water and allowed to stand at 4°C for 12 hours to serve as the control (NF).

[0313] Test sample 2. Freeze-thaw (FT) yeast A yeast suspension was prepared in the same manner as in test sample 1, and then frozen at -80°C for 12 hours to obtain the yeast freeze-thaw product (FT).

[0314] Test sample 3. Freeze-dried yeast (FD) After preparing a yeast suspension in the same manner as for test sample 1, it was frozen at -80°C for 1 hour and then freeze-dried for 12 hours in a freeze-dryer (FLEXI-DRY, FTSsystems INC., Warminster) connected to a vacuum pump (P65D, PHIL Sato Vac INC.) to obtain freeze-dried yeast (FD).

[0315] Test sample 4. Freeze-dried yeast with added TRH After preparing a yeast suspension in the same manner as in test sample 1, 50 μL of 6% trehalose aqueous solution was added to 50 μL of the yeast suspension and mixed. The mixture was frozen at -80°C for 1 hour, and freeze-dried for 12 hours using a freeze-dryer (FLEXI-DRY, FTSsystems INC., Warminster) connected to a vacuum pump (P65D, PHIL Sato Vac INC.) to obtain freeze-dried TRH-added yeast (TRH).

[0316] Test sample 5. Freeze-dried yeast with 4TA added. In the preparation method for test sample 4, 4TA-added yeast freeze-dried product (4TA) was obtained using the same method as for test sample 4, except that trehalose was replaced with 4-trehalosamine (4TA).

[0317] Test sample 6. Freeze-dried yeast with added MLT. In the preparation method for test sample 4, refractory-dried yeast with added MLT (MLT) was obtained using the same method as for test sample 4, except that trehalose was replaced with maltose (MLT).

[0318] Test sample 7. Freeze-dried yeast with SCR added. In the preparation method for test sample 4, refractory-dried yeast with added sucrose (SCR) was obtained using the same method as for test sample 4, except that trehalose was replaced with sucrose (SCR).

[0319] Test sample 8. Freeze-dried yeast with added GOL In the preparation method for test sample 4, freeze-dried yeast with added GOL was obtained using the same method as for test sample 4, except that trehalose was replaced with glycerol (GOL).

[0320] <Evaluation of baker's yeast protective activity> Test samples 1 and 2 were prepared as series suspensions by diluting them 1 / 10 each with physiological saline. 100 μL of water was added to each of the lyophilized test samples 3-8, and series suspensions were prepared by diluting them 1 / 10 each with physiological saline. 60 μL of water was added to 30 μL of each dilution. 2% Agar-YPD was prepared in 6-well microplates at a concentration of 3 mL / well. 90 μL of each dilution was inoculated onto the 2% Agar-YPD, and the samples were incubated at 30°C for 2 days. The results are shown in Figure 17A. Furthermore, by selecting wells in which the number of colonies could be measured, and setting the number of viable cells per well in test sample 3 (FD) to "1", the number of viable cells per well (relative number) in test samples 1, 2, and 4-8 was calculated considering the dilution concentration of each test sample, and the results are shown in Table 3 below.

[0321] [Table 3]

[0322] From the results in Figure 17A and Table 3, comparing test sample 1 (NF) and test sample 3 (FD), baker's yeast ( Saccharomyces cerevisiae Freeze-drying of the bacterial cells showed a significant decrease in survival rate. In contrast, when 6% (final concentration 3%) of sugars other than glycerol was added, the survival rate improved by more than 10 times. In particular, the protective effect on microorganisms was stronger when 4-trehalosamine was added than when maltose or sucrose was added.

[0323] (Test Example 7-2: Protective effect of 4-trehalosamine on microorganisms (Escherichia coli)) Using test samples 1-8 containing Escherichia coli prepared by the following method, the microbial protective activity of various sugars under freeze-drying conditions was evaluated.

[0324] <Preparation of test samples> Test sample 1. Control (NF: Non-freezing) E. coli ( Escherichia coli Frozen stock of K-12 (owned by the Japan Society for Microbial Chemistry) was inoculated into 10 mL of Luria-Bertani (LB) medium (Difco) and incubated at 37°C for 24 hours with shaking at 220 rpm. After incubation, the cells were centrifuged at 3,000 × g for 5 minutes, washed once with 10 mL of water, and then suspended in 10 mL of water to obtain an E. coli suspension. 50 μL of this E. coli suspension was mixed with 50 μL of water and allowed to stand at 4°C for 12 hours to serve as the control (NF).

[0325] Test sample 2. Freeze-thaw product (FT) of E. coli After preparing an E. coli suspension in the same manner as for test sample 1, it was frozen at -80°C for 12 hours to obtain E. coli freeze-thaw products (FT).

[0326] Test sample 3. Freeze-dried (FD) E. coli After preparing an E. coli suspension in the same manner as for test sample 1, it was frozen at -80°C for 1 hour and then freeze-dried for 12 hours using a freeze-dryer (FLEXI-DRY, FTSsystems INC., Warminster) connected to a vacuum pump (P65D, PHIL Sato Vac INC.) to obtain freeze-dried E. coli (FD).

[0327] Test sample 4. Freeze-dried E. coli with added TRH After preparing an E. coli suspension in the same manner as in test sample 1, 50 μL of 6% trehalose aqueous solution was added to 50 μL of the E. coli suspension and mixed. The mixture was frozen at -80°C for 1 hour, and freeze-dried for 12 hours using a freeze-dryer (FLEXI-DRY, FTSsystems INC., Warminster) connected to a vacuum pump (P65D, PHIL Sato Vac INC.) to obtain freeze-dried E. coli with added TRH (TRH).

[0328] Test sample 5. Freeze-dried E. coli with 4TA added. In the preparation method for test sample 4, 4TA-added freeze-dried Escherichia coli (4TA) was obtained using the same method as for test sample 4, except that trehalose was replaced with 4-trehalosamine (4TA).

[0329] Test sample 6. Freeze-dried E. coli with added MLT. Lipo-dried Escherichia coli (MLT) with added MLT was obtained using the same method as for preparing test sample 4, except that trehalose was replaced with maltose (MLT).

[0330] Test sample 7. Freeze-dried E. coli with SCR added. In the preparation method for test sample 4, lyophilized Escherichia coli (SCR) was obtained using the same method as for test sample 4, except that trehalose was replaced with sucrose (SCR).

[0331] Test sample 8. Freeze-dried E. coli with added GOL Lipo-dried Escherichia coli (GOL) with added GOL was obtained using the same method as for preparing test sample 4, except that trehalose was replaced with glycerol (GOL).

[0332] <Evaluation of E. coli protective activity> Test samples 1 and 2 were prepared as series suspensions by diluting them 1 / 10 each with water. 100 μL of water was added to each of the lyophilized test samples 3-8, and series suspensions were prepared by diluting them 1 / 10 each with water. 80 μL of water was added to 10 μL of each dilution. 2% Agar-LB was prepared in 6-well microplates at a concentration of 3 mL / well. 90 μL of each dilution was inoculated onto the 2% Agar-LB, and the samples were incubated at 37°C for 24 hours. The results are shown in Figure 17B. Furthermore, by selecting wells in which the number of colonies could be measured, and setting the number of viable cells per well in test sample 3 (FD) to "1", the number of viable cells per well (relative number) in test samples 1, 2, and 4-8 was calculated considering the dilution concentration of each test sample, and the results are shown in Table 4 below.

[0333] [Table 4]

[0334] From the results in Figure 17B and Table 4, when comparing test sample 1 (NF) and test sample 3 (FD), E. coli ( Escherichia coli The bacterial cells of ) showed a significant decrease in survival rate after freeze-drying. In contrast, when 6% (final concentration 3%) of sugars other than glycerol was added, the survival rate improved by more than 10 times. In particular, when 4-trehalosamine was added, the protective effect on the microorganisms was stronger than when other sugars were added, and the survival rate of the bacteria improved to the same level as that of test sample 1 (NF), which was not freeze-dried.

[0335] (Test Example 7-3: Protective effect of 4-trehalosamine on microorganisms (Bacillus subtilis)) Using test samples 1-5 containing Bacillus subtilis prepared by the following method, the microbial protective activity under freeze-drying conditions with trehalose or 4-trehalosamine was evaluated.

[0336] <Preparation of test samples> Test sample 1. Control (NF: Non-freezing) Bacillus subtilis ( Bacillus subtilis Frozen stock of Bacillus subtilis 168 (obtained from ATCC) was inoculated into 10 mL of Luria-Bertani (LB) medium (Difco) and incubated at 37°C for 24 hours with shaking at 220 rpm. After incubation, the culture was centrifuged at 3,000 × g for 5 minutes, washed once with 10 mL of water, and then suspended in 10 mL of water to obtain a Bacillus subtilis suspension. 50 μL of this Bacillus subtilis suspension was mixed with 50 μL of water and allowed to stand at 4°C for 20 hours to serve as the control (NF).

[0337] Test sample 2. Freeze-thaw product (FT) of Bacillus subtilis A Bacillus subtilis suspension was prepared using the same method as for test sample 1, and then frozen at -80°C for 20 hours to obtain the freeze-thaw product (FT) of Bacillus subtilis.

[0338] Test sample 3. Freeze-dried (FD) product of Bacillus subtilis. A Bacillus subtilis suspension was prepared in the same manner as for test sample 1. After freezing at -80°C for 10 minutes, it was freeze-dried for 20 hours using a freeze-dryer (FLEXI-DRY, FTSsystems INC., Warminster) connected to a vacuum pump (P65D, PHIL Sato Vac INC.) to obtain freeze-dried Bacillus subtilis (FD).

[0339] Test sample 4. Freeze-dried Bacillus subtilis with added TRH After preparing a Bacillus subtilis suspension in the same manner as in test sample 1, 50 μL of 6% trehalose aqueous solution was added to 50 μL of the Bacillus subtilis suspension and mixed. The mixture was frozen at -80°C for 10 minutes, and freeze-dried for 20 hours using a freeze-dryer (FLEXI-DRY, FTSsystems INC., Warminster) connected to a vacuum pump (P65D, PHIL Sato Vac INC.) to obtain freeze-dried Bacillus subtilis with added TRH (TRH).

[0340] Test sample 5. Freeze-dried Bacillus subtilis with 4TA added. In the preparation method for test sample 4, 4TA-added freeze-dried Bacillus subtilis (4TA) was obtained using the same method as for test sample 4, except that trehalose was replaced with 4-trehalosamine (4TA).

[0341] <Evaluation of Bacillus subtilis protective activity> Test samples 1 and 2 were prepared as series suspensions by diluting them 1 / 10 each with water. 100 μL of water was added to each of the lyophilized test samples 3-5, and series suspensions were prepared by diluting them 1 / 10 each with water. 80 μL of water was added to 10 μL of each dilution. 2% Agar-LB was prepared in 6-well microplates at a concentration of 3 mL / well. 90 μL of each dilution was inoculated onto the 2% Agar-LB, and the samples were incubated at 37°C for 24 hours. The results are shown in Figure 17C. Furthermore, by selecting wells in which the number of colonies could be measured, and setting the number of viable cells per well in test sample 3 (FD) to "1", the number of viable cells per well (relative number) in test samples 1, 2, 4, and 5 was calculated considering the dilution concentration of each test sample, and the results are shown in Table 5 below.

[0342] [Table 5]

[0343] From the results in Figure 17C and Table 5, comparing test sample 1 (NF) and test sample 3 (FD), Bacillus subtilis ( Bacillus subtilis Freeze-drying of the bacterial cells showed a significant decrease in survival rate. In contrast, when 6% (final concentration 3%) of trehalose or 4-trehalosamine was added, the survival rate improved by more than 10 times. In particular, the protective effect on microorganisms was stronger when 4-trehalosamine was added than when trehalose was added.

[0344] (Test Example 7-4: Protective effect of 4-trehalosamine on microorganisms (mycobacteria)) Using test samples 1-5 containing acid-fast bacteria prepared by the following method, the microbial protective activity under freeze-drying conditions with trehalose or 4-trehalosamine was evaluated.

[0345] <Preparation of test samples> Test sample 1. Control (NF: Non-freezing) Acid-fast bacteria ( Mycobacterium smegmatis mc 2 Frozen stocks of 155 strains (American Type Culture Collection (ATCC) 700084) were inoculated into 10 mL of Middlebrook 7H9 medium (Becton, Dickinson and Company) and incubated at 37°C for 72 hours with shaking at 220 rpm. After incubation, the cultures were centrifuged at 3,000 × g for 5 minutes, washed once with 10 mL of water, and then suspended in 10 mL of water to obtain an acid-fast bacilli suspension. 50 μL of this acid-fast bacilli suspension was mixed with 50 μL of water and allowed to stand at 4°C for 20 hours to serve as the control (NF).

[0346] Test sample 2. Freeze-thaw (FT) product of mycobacteria. After preparing an acid-fast bacilli suspension in the same manner as for test sample 1, the suspension was frozen at -80°C for 20 hours to obtain the freeze-thaw product (FT) of the acid-fast bacilli.

[0347] Test sample 3. Freeze-dried (FD) product of mycobacteria. After preparing an acid-fast bacilli suspension in the same manner as for test sample 1, it was frozen at -80°C for 10 minutes and freeze-dried for 20 hours in a freeze-dryer (FLEXI-DRY, FTSsystems INC., Warminster) connected to a vacuum pump (P65D, PHIL Sato Vac INC.) to obtain freeze-dried acid-fast bacilli (FD).

[0348] Test sample 4. Freeze-dried mycobacteria with added TRH After preparing an acid-fast bacilli suspension in the same manner as in test sample 1, 50 μL of 6% trehalose aqueous solution was added to 50 μL of the acid-fast bacilli suspension and mixed. The mixture was frozen at -80°C for 10 minutes, and freeze-dried for 20 hours using a freeze-dryer (FLEXI-DRY, FTSsystems INC., Warminster) connected to a vacuum pump (P65D, PHIL Sato Vac INC.) to obtain a freeze-dried product of TRH-added acid-fast bacilli (TRH).

[0349] Test sample 5. Freeze-dried mycobacteria with 4TA added. In the preparation method for test sample 4, 4TA-added mycobacteria freeze-dried product (4TA) was obtained using the same method as for test sample 4, except that trehalose was replaced with 4-trehalosamine (4TA).

[0350] <Evaluation of mycobacterial protective activity> Test samples 1 and 2 were prepared as series suspensions by diluting them 1 / 10 each with water. 100 μL of water was added to each of the lyophilized test samples 3-5, and series suspensions were prepared by diluting them 1 / 10 each with water. 80 μL of water was added to 10 μL of each dilution. 3 mL / well of 2% Agar-Middlebrook 7H9 medium was prepared in a 6-well microplate. 90 μL of each dilution was inoculated onto the 2% Agar-Middlebrook 7H9 medium, and the samples were incubated at 37°C for 24 hours. The results are shown in Figure 17D. Furthermore, by selecting wells in which the number of colonies could be measured and setting the number of viable cells per well in test sample 3 (FD) to "1", the number of viable cells per well (relative number) in test samples 1, 2, 4, and 5 was calculated considering the dilution concentration of each test sample, and the results are shown in Table 6 below.

[0351] [Table 6]

[0352] From the results in Figure 17D and Table 5, when comparing test sample 1 (NF) and test sample 3 (FD), mycobacteria ( Mycobacterium smegmatis Freeze-drying of the bacterial cells showed a significant decrease in survival rate. In contrast, when 6% (final concentration 3%) of trehalose or 4-trehalosamine was added, the survival rate improved by more than 10 times. In particular, the protective effect on microorganisms was stronger when 4-trehalosamine was added than when trehalose was added.

[0353] (Test Example 8: 4-Trehalosamine's pH buffering effect) Using the purified 4-trehalosamine product obtained in the <purification step> of Production Example 10, the function of 4-trehalosamine as a buffer reagent was confirmed by the following method.

[0354] The pH change was measured using a pH meter (LAQUA F-51, Horiba, Ltd.) when 50 mL of 1M hydrochloric acid (HCl) or 1M sodium hydroxide (NaOH) was added in increments of 50 mL to 100 μL to 50 mL of either 10 mM 4-trehalosamine aqueous solution (Production Example 10), 10 mM trehalose aqueous solution, 10 mM Tris, 10 mM MES (2-(N-morpholino)ethanesulfonic acid) aqueous solution, or 10 mM HEPES (4-(2-hydroxyethyl)-1-piperazinylethanesulfonic acid) aqueous solution. The results are shown in Figure 18.

[0355] From the results of Fig. 18, 4-trehalosamine (4TA) was found to have a strong pH buffering effect comparable to that of Tris. The pH range with a strong buffering effect was about 1.0 lower than that of Tris, around pH 5.5 to pH 8.0, and the pKa was estimated to be 6.99.

[0356] (Test Example 9-1: Confirmation of the degradation of 4-trehalosamine by trehalase 1) Trehalose (TRH) or 4-trehalosamine (4TA) obtained in the <Purification step> of Production Example 10 was added to 135 mM sodium citrate buffer (pH 5.7) so that the final concentrations were 0 mM, 0.01 mM, 0.1 mM, 1 mM, or 10 mM, respectively, and mixed. Porcine kidney-derived trehalase (0.24 units / mL, manufactured by Sigma-Aldrich) was added thereto, and the reaction was carried out at 37 °C for 20 minutes. To the solution after the reaction, three times the amount of Glucose assay reagent (manufactured by Sigma-Aldrich) was added, and after reacting at room temperature for 15 minutes, the absorbance at 340 nm was measured with a plate reader Cytation 5 (manufactured by Bio Tek Instruments), and the amount of glucose released as a degradation product was estimated. The results are shown in Figs. 19A and B. Note that Fig. 19B is an enlarged view of Fig. 19A.

[0357] From the results of Figs. 19A and B, it was confirmed that trehalose was decomposed in this reaction and the release of glucose was observed, but for 4-trehalosamine, no release of glucose was observed, indicating that it is not decomposed by porcine trehalase.

[0358] (Test Example 9-2: Confirmation of the degradation of 4-trehalosamine by trehalase 2) <Preparation of KP4-TREH10 strain> In order to perform a degradation experiment using human trehalase, a high-expression strain thereof was prepared. First, cDNA was synthesized from human small intestine total RNA (manufactured by Takara Bio Inc.) using PrimeScript II Reverse Transcriptase (manufactured by Takara Bio Inc.). From this cDNA, PCR was performed using primers TREH1F (TTAGCGGCCGCGCCACCATGCCAGGGAGGAC) represented by SEQ ID NO: 2 and TREH1R (GGGAATTCTCACCATGGCAGGAGGCTGA) represented by SEQ ID NO: 3, along with KOD-Plus DNA polymerase (Toyobo Co., Ltd.) to amplify the DNA of the human trehalase gene TREH. This amplified DNA was degraded with restriction enzymes EcoRI and NotI, and then ligated to pSF-CMV-FMDV-Neo / G418 (Oxford Genetics), which had also been degraded with these enzymes, using the Quick Ligation Kit (New England BioLabs). The resulting cells were then introduced into E. coli DH5α competent cells (Biodynamics Laboratories, Inc.). After plasmid introduction, E. coli were cultured in 2% Agar-LB medium containing 100 μg / mL kanamycin, and E. coli clones retaining the target plasmid were selected. For each of the several (approximately 10) clones, individual cells were cultured in LB medium containing 100 μg / mL kanamycin, and the plasmids were purified using the Wizard plasmid purification system (Promega). For each plasmid clone, the DNA sequence of the TREH region was confirmed using the ABI Prism 3130 Genetic Analyzer (ABI), and plasmid clone pSF-TREH 3-3 with the target sequence correctly inserted was obtained.

[0359] This plasmid was introduced into various human cultured cells using Viafect (Promega), and the transient trehalase protein expression level was analyzed by Western blotting with a 1 / 2,000 dilution of anti-trehalase antibody (Santa Cruz). Based on this analysis, human pancreatic ductal carcinoma cells KP4 that showed high trehalase expression were selected to be used as expression cells in subsequent experiments. Human pancreatic ductal carcinoma cells KP4 into which the pSF-TREH 3-3 plasmid was introduced as described above were diluted to less than 1 cell per well, plated in a 96-well microplate, and cultured in DMEM medium containing 400 μg / mL G418 (Thermo Fisher Scientific). Trehalase stable expression clones were selected and grown. Ten KP4-TREH clones, which showed the highest trehalase expression level, were selected to be used in subsequent experiments.

[0360] <Confirmation of trehalase expression in cultured cells> The expression patterns of trehalase in human pancreatic ductal carcinoma cells KP4 (obtained from RIKEN BRC) and the KP4-TREH10 cell line, which stably expresses human trehalase at high levels, were confirmed by Western blotting. For trehalase detection (primary antibody), an anti-trehalase antibody (Santa Cruz) was used at a dilution of 1 / 2,000. An anti-tubulin antibody (Cell Signaling Technology) was used as a control at a dilution of 1 / 5,000. The results are shown in Figure 19C. Furthermore, when compared with the protein content and number of units of trehalase derived from pig kidney used in Test Example 9-1, the amount of trehalase in the total extracted protein of the KP4-TREH10 strain was estimated to be 0.32 units / mg to 0.45 units / mg.

[0361] <Confirmation of decomposition by human trehalase> The degradation of 4-trehalosamine and trehalose by cell extracts from human pancreatic ductal carcinoma cells (KP4) and the human trehalase-high-expressing cell line (KP4-TREH10) was investigated. Human pancreatic ductal carcinoma cells, strains KP4 and KP4-TREH10, were grown in DMEM medium in a CO2 incubator at 37°C until confluence. The medium was then removed, the cells were washed three times with PBS (Takara Bio Inc.), and collected in PBS using a cell scraper. The collected cell suspensions were centrifuged at 400×g for 3 minutes, the supernatant was removed, and 135 mM citrate buffer (pH 5.7) containing 15 times the volume of precipitated cells (0.5% Triton®) was added. Homogenization was performed, and the mixture was centrifuged at 21,300×g for 10 minutes. Each supernatant was then collected. To each supernatant, 20 μg / mL of 4-trehalosamine aqueous solution or trehalose aqueous solution was added, and the mixture was allowed to stand at 37°C. After 0, 2, 8, or 24 hours from the start of the reaction, the reaction mixture was collected, diluted to 1 / 10 with methanol, and centrifuged at 21,300×g for 10 minutes. Each supernatant was collected and analyzed by LC-MS under the same conditions as in Test Example 1 to confirm the residual rates of 4-trehalosamine and trehalose in the reaction solutions of 4-trehalosamine and human pancreatic ductal carcinoma cell KP4 cell extract (4TA C), 4-trehalosamine and KP4-TREH10 cell extract (4TA T), trehalose and human pancreatic ductal carcinoma cell KP4 cell extract (TRH C), and trehalose and KP4-TREH10 cell extract (TRH T). The results are shown in Figure 19D.

[0362] As shown in Figure 19D, neither trehalose nor 4-trehalosamine were degraded by the cell extract of human pancreatic ductal carcinoma cells KP4. On the other hand, trehalose was degraded by the cell extract of the KP4-TREH10 cell line, which is a human trehalase-high-expressing cell line, and was almost completely gone after 8 hours. In contrast, 4-trehalosamine showed almost no degradation or reduction by the KP4-TREH10 cell extract.

[0363] (Test Example 9-3:4-Phenomenon confirmation after oral administration of trehalosamine to mice) ICR mice (9-10 weeks old, female, n=5) that had been fasted overnight were orally administered a single dose of 4-trehalosamine or trehalose dissolved in physiological saline at a concentration of 0.5 mg / 10 μL per gram of body weight. Five mice treated in the same way were placed in the same cage.

[0364] <Confirmation of cumulative excretion of 4-trehalosamine in urine and feces> Urine and feces were collected regularly in batches. The collected feces were suspended in water at 200 mg / mL and centrifuged at 21,300 × g for 5 minutes. The supernatant of the fecal suspension and the collected urine were each diluted to 1 / 1,000 with methanol, and LC-MS analysis was performed under the same conditions as in Test Example 1 to calculate the cumulative excretion of 4-trehalosamine (4TA) or trehalose (TRH) over time. The results for urine are shown in Figure 19E, and the results for feces are shown in Figure 19F.

[0365] <4. Confirmation of trehalosamine blood concentration> Blood was collected periodically from the tail vein in volumes of approximately 10-20 μL. After weighing, 200 μL of methanol was added. After mixing by vortexing, the mixture was centrifuged at 21,000 × g for 5 minutes. The supernatant was diluted to 1 / 5 with methanol, and LC-MS analysis was performed under the same conditions as in Test Example 1. The results for 4-trehalosamine from each individual are shown in Figure 19G, and the results for trehalose are shown in Figure 19H (n=5).

[0366] Figure 19G shows that some of the orally administered 4-trehalosamine is absorbed and circulates in the blood for a certain period of time. Furthermore, it was found that the majority of the absorbed 4-trehalosamine is excreted in feces and urine without being broken down or modified.

[0367] <Checking changes in blood glucose levels> In a 96-well plate, 5 μL / well of the supernatant sample of methanol dilution of blood prepared in <Confirmation of blood concentration of 4-trehalosamine> (the same sample as the one used for LC-MS analysis) was added, dried by aspiration with a vacuum pump, dissolved in 25 μL of water, and 75 μL of glucose assay reagent (Sigma-Aldrich) was added. After standing at 37°C for 1 hour, the absorbance at 340 nm was measured using a plate reader Cytation 5 (Bio Tek Instruments) to estimate the amount of glucose. The results for 4-trehalosamine are shown in Figure 19I, and the results for trehalose are shown in Figure 19J (n=5).

[0368] As shown in Figure 19J, the group administered trehalose orally showed an increase in blood glucose levels 30 minutes to 1 hour after administration, but the group administered 4-trehalosamine did not show an increase in blood glucose levels.

[0369] (Test Example 10-1: Autophagy induction effect on cultured cells by 4-trehalosamine and trehalose analogs) The expression and phosphorylation patterns of autophagy-related proteins were examined by Western blotting after treating human ovarian cancer cells or human malignant melanoma cells with 4-trehalosamine and trehalose analogs for 24 hours.

[0370] Human ovarian cancer cells OVK18 (obtained from RIKEN BRC) and human malignant melanoma cells Mewo (JCRB0066) were each placed in 12-well microplates in 8 × 10⁶ layers. 4 Cells were seeded at a concentration of / mL / well, cultured in DMEM medium at 37°C for 72 hours, and then treated with the test sample.

[0371] The test samples used were 4-trehalosamine (4TA) and trehalose (TRH) obtained in the purification step of Production Example 10, IMCTA-Cn compounds obtained in Synthesis Examples 1-8, trehalose ester (TRH-Cn) (manufactured by Dojin Chemical Laboratories), n-dodecyl-β-D-maltoside (DDM), maltose (MLT), sucrose (SCR), and rapamycin (RM). Untreated cells without the addition of any compounds were used as a control. During treatment with the aforementioned test sample, in order to avoid localized contact of high concentrations of the compound with the cells, half of the culture medium in the well was taken, the required amount of the test sample was dissolved in it, and after complete dissolution, it was returned to the original well and treated at 37°C for 24 hours.

[0372] Subsequently, the culture medium containing the test sample was removed, washed once with PBS, and then dissolved in 2× SDS sample buffer without 2-mercaptoethanol (2-ME) and bromophenol blue (BPB). After measuring the protein concentration in the dissolved sample using the BCA protein assay kit (Thermo Fisher Scientific), 2-ME and BPB were added, and the mixture was boiled for 5 minutes to prepare the sample for Western blotting.

[0373] Western blotting was performed in the same manner as in Test Example 4, except that the primary antibody used was an autophagy marker such as anti-LC3 antibody, anti-p62, anti-cathepsin D antibody, anti-Phospho-Akt (Ser473) antibody, anti-Akt antibody, anti-Phospho-p70 S6K (T389) antibody, or anti-p70 S6K antibody (all from Cell Signaling Technology), diluted 1 / 2,000. The results for human ovarian cancer cells OVK18 are shown in Figures 20A-C, and the results for human malignant melanoma cells Mewo are shown in Figures 20D-F. In Figures 20A, B, D, and E, "PCD" indicates precursors of cathepsin D, and "CD-HC" indicates the cathepsin D heavy chain.

[0374] As shown in Figures 20A-F, cells treated with 4-trehalosamine and trehalose analogs showed increased expression of the autophagy marker LC3-II, although this varied depending on the treatment concentration. IMCTA-C13, IMCTA-C14, and IMCTA-C15 showed particularly strong expression, with levels equal to or greater than trehalose at concentrations several thousand times lower. Trehalose ester (TRH-Cn) also showed increased LC3-II expression at low concentrations, but the activity was not as strong as that of IMCTA-Cn. Furthermore, LC3-II expression was also observed with high concentrations of sucrose (SCR). Unlike treatment with trehalose, treatment with IMCTA-C13, IMCTA-C14, and IMCTA-C15 did not result in PCD accumulation. However, they showed similar results to trehalose in terms of the tendency for p62 accumulation, the tendency for pAkt to decrease, and the absence of p70 S6K dephosphorylation. From this, it was considered that the mechanism of autophagy induction by IMCTA-Cn is basically the same as that of trehalose.

[0375] (Test Example 10-2: Confirmation of the property of increasing autophagy marker expression by 4-trehalosamine or trehalose analogues in combination with autophagy inhibitors) Increased LC3-II expression is observed not only when autophagy is actively occurring, but also in situations where autophagy is inhibited midway, leading to the accumulation of autophagosomes. Therefore, to confirm whether the increase in LC3-II expression induced by 4-trehalosamine or a trehalose analog in Test Example 10-1 was due to autophagy induction or inhibition, a combination experiment was conducted using 4-trehalosamine or a trehalose analog with the autophagy inhibitors bafilomycin (BM) or chloroquine (CQ). If LC3-II expression increases in the presence of the inhibitor, 4-trehalosamine or a trehalose analog is judged to induce autophagy; if LC3-II expression does not change, 4-trehalosamine or a trehalose analog is judged to inhibit autophagy.

[0376] Similar to Test Example 10-1, human ovarian cancer cells OVK18 (obtained from RIKEN BRC) and human malignant melanoma cells Mewo (JCRB0066) were each placed in 12-well microplates in 8 × 10⁶ layers. 4 Cells were seeded at a concentration of / mL / well and cultured in DMEM medium at 37°C for 72 hours. Then, half of the culture medium from each well was taken, and each compound was dissolved to a final concentration of 50 mM 4-trehalosamine, 50 μM IMCTA-C14, or 100 mM trehalose. After complete dissolution, the culture medium was returned to the original well and treated at 37°C for 14 hours. Untreated cells without compound addition were used as the control.

[0377] Subsequently, each autophagy inhibitor was added to achieve a final concentration of 200 nM bafilomycin (BM) or 100 μM chloroquine (CQ), and the cells were incubated at 37°C for 4 hours. The group without inhibitors was incubated in the same manner. After incubation, the samples were prepared for Western blotting using the same method as in Test Example 10-1.

[0378] Western blotting was performed in the same manner as in Test Example 4, except that the primary antibody used was an anti-LC3 antibody (Cell Signaling Technology) diluted 1 / 2,000. The results for human ovarian cancer cells OVK18 are shown in Figure 21A, and the results for human malignant melanoma cells Mewo are shown in Figure 21B. Furthermore, the results of image analysis (graphs) of the Western blot results using Image J (National Institutes of Health) are also shown in Figures 21A and 21B (n=10, mean±SD). The vertical axis of this graph shows the expression level (expression ratio) of LC3-II in each compound-added group, with the expression level of LC3-II in the control (untreated cells) set to 1. The bars in the graph are indicated by diagonal dots if there is a significant difference (p<0.05) compared to the control based on the Dunnett test results, by gray if there is a significant difference (p<0.05) compared to the case without inhibitor, and by black if there is a significant difference (p<0.05) compared to either the case without compound (control) or the case without inhibitor.

[0379] The results in Figures 21A and 21B suggest that 4-trehalosamine, trehalose, and IMCTA-C14 all increased LC3-II expression when used in combination with bafilomycin (BM) or chloroquine (CQ), indicating that they exert an autophagy-inducing effect on cultured cells.

[0380] (Test Example 10-3: Confirmation of the effect of 4-trehalosamine or trehalose analogs on the de-aggregation of intracellular proteins) The effects of 4-trehalosamine or trehalose analogs on Q74, a partial peptide of huntingtin (Htt), the causative protein of Huntington's disease, and SynA53T, a mutant of α-synuclein, the causative protein of Parkinson's disease (both are aggregated proteins), were confirmed by the following method.

[0381] Neuroblastoma cells SH-SY5Y (obtained from the European Collection of Authenticated Cell Cultures (ECACC)) and human neuroblastoma cells NH-12 (obtained from the RIKEN BRC) were each measured in 14 × 10⁻¹⁰⁶ cells. 4 Cells were seeded at a concentration of 1 / mL and cultured in DMEM medium at 37°C for 48 hours.

[0382] After culturing SH-SY5Y and NH-12 cells as described above, the cells were transfected with either the pEGFP-Q74 vector or EGFP-alphasynuclein-A53T (both obtained from addgene), which are expression vectors for aggregated proteins, using a transfection reagent (Viafect, Promega). 24 hours after transfection, 100 mM 4-trehalosamine, 70 μM IMCTA-C14, or 100 mM trehalose were added, and the cells were treated for a further 14 hours. Untreated cells, to which no compound was added, were used as a control. After washing the cells three times with PBS, a hypotonic solution (a solution prepared by dissolving one tablet of cOmplete, Mini, EDTA-free Protease Inhibitor Cocktail (CM, Merck) in 50 mL of pure water) was added, and the mixture was shaken on ice for 10 minutes. The mixture was then centrifuged at 21,300 × g for 10 minutes, and the supernatant was separated into solubilized protein (Sol) and aggregated protein (Agg). Subsequently, each was prepared as a sample for Western blotting using the same method as in Test Example 10-1.

[0383] Western blotting was performed in the same manner as in Test Example 4, except that the primary antibody used was an anti-GFP antibody (Proteintech) diluted 1 / 5,000 and an anti-LC3 antibody (Cell Signaling Technology) diluted 1 / 2,000. The results for neuroblastoma cells SH-SY5Y are shown in Figures 22A and B, and the results for human neuroblastoma cells NH-12 are shown in Figures 22C and D. Furthermore, the results of image analysis (graphs) of the Western blot results using Image J (National Institutes of Health) are also shown in Figures 22A-D (n=5, mean±SD). The vertical axis of this graph shows the expression levels (expression ratio) of each protein in each compound-treated group, with the expression level of each protein in the control (untreated cells) set to 1. The bars in the graph are indicated by "*" if there is a significant difference (p<0.01) compared to the control based on the t-test results.

[0384] As shown in Figures 22A-D, aggregates of the partial peptide Q74 of the Huntington's disease causative protein and aggregates of the Parkinson's disease causative protein SynA53T, expressed in SH-SY5Y and NH-12 cells used as neuronal cell models, were significantly reduced by 4-trehalosamine, IMCTA-C14, and trehalose. In particular, IMCTA-C14 showed activity equivalent to or greater than trehalose at a concentration of less than 1 / 1,000th that of trehalose.

[0385] (Test Example 10-4: Confirmation of increased expression and nuclear translocation of autophagy-related transcription factor TFEB by 4-trehalosamine or trehalose analog) The increased expression and nuclear translocation of the autophagy-related transcription factor EB (TFEB) in human ovarian cancer cells or human malignant melanoma cells treated with 4-trehalosamine or a trehalose analog was confirmed by Western blotting and immunohistochemistry. Nuclear and cytoplasmic fractionation was performed using a modified buffer based on the buffer reported by Dignam et al. (JD Dignam et al., Nucleic Acids Res, 1983, 11(5), p.1475-1489), and was carried out by the following method.

[0386] <Confirmation using Western blot method> Human ovarian cancer cells OVK18 (obtained from RIKEN BRC) and human malignant melanoma cells Mewo (JCRB0066) were each placed in 6-well plates in 2 × 10⁶ layers. 5 Cells were seeded in 2 mL / well and cultured in DMEM medium at 37°C for 48 hours. Then, in the same manner as in Test Example 10-1, half of the culture medium from the well was taken, and each compound was dissolved to a final concentration of 50 mM 4-trehalosamine, 50 μM IMCTA-C14, 100 μM IMCTA-C14, or 100 mM trehalose. After complete dissolution, the mixture was returned to the original well and treated at 37°C for 14 hours. Untreated cells without compound addition were used as the control.

[0387] After treating the cells with each of the aforementioned compounds, they were washed once with PBS and then treated on ice for 30 minutes with lysis buffer (10 mM HEPES (pH 7.9), 10 mM potassium chloride, 1.5 mM magnesium chloride, 0.4% Igepal CA-630 (Sigma-Aldrich), 1 mM DTT, 1 tablet / 50 mL CM (Merck)). Next, the cells were scraped off with a cell scraper and collected, then gently shaken at 6°C for 10 minutes. After centrifugation at 21,300 × g for 5 minutes, the supernatant was collected as the cytoplasmic fraction.

[0388] The precipitate was washed once with lysis buffer and then dissolved in nuclear buffer (20 mM HEPES (pH 7.9), 0.4 M sodium chloride, 1.5 mM magnesium chloride, 5% glycerol, 1 mM DTT, 1 tablet / 50 mL CM). After centrifugation at 21,300 × g for 5 minutes, the supernatant was collected as the nuclear fraction.

[0389] The protein concentration of each fraction was measured using protein quantification reagents (XL-Bradford, Integrale), and the expression level of TFEB in each fraction was examined by Western blotting. Western blotting was performed in the same manner as in Test Example 4, except that anti-TFEB antibody (Cell Signaling Technology) was used as the primary antibody at a 1 / 2,000 dilution, anti-GAPDH antibody (Medical & Biological Laboratories, Inc.) was used at a 1 / 40,000 dilution to show the accuracy of the cytoplasmic (Cyt) and nuclear (Nuc) fractions, and anti-PARP antibody (Cell Signaling Technology) was used at a 1 / 10,000 dilution. The results for human ovarian cancer cells OVK18 are shown in Figure 23A, and the results for human malignant melanoma cells Mewo are shown in Figure 23B.

[0390] <Confirmation by immunostaining method> Human ovarian cancer cells OVK18 and human malignant melanoma cells Mewo were each placed in 48-well microplates in 2.4 × 10⁶ units. 4 Cells were seeded in 0.6 mL / well and cultured in DMEM medium at 37°C for 48 hours. Then, in the same manner as in Test Example 10-1, half of the culture medium from the well was taken, and each compound was dissolved to a final concentration of 50 mM 4-trehalosamine, 100 μM IMCTA-C14, or 100 mM trehalose. After complete dissolution, the mixture was returned to the original well and treated at 37°C for 14 hours. Untreated cells without compound addition were used as the control.

[0391] All subsequent reactions were carried out at room temperature with gentle shaking. After treatment, the culture medium was removed from the cells, and 300 μL / well of 4% paraformaldehyde-PBS (Fujifilm Wako Pure Chemical Industries, Ltd.) was added, followed by fixation for 15 minutes. After washing three times with PBS, 300 μL / well of 0.3% Triton X-100-PBS containing 5% BSA was added, and the cells were blocked for 1 hour. After removing the blocking solution, 50 μL / well of anti-TFEB antibody (Santa Cruz Biotechnology), diluted 1 / 33 times with 0.3% Triton X-100-PBS containing 1% BSA, was added, and the cells were reacted for 4 hours. After washing three times with PBS, 50 μL / well of Alexa Fluor 488-conjugated anti-mouse IgG antibody (Cell Signaling Technology), diluted 1 / 500 times with 0.3% Triton X-100-PBS containing 1% BSA, was added, and the cells were reacted for 2 hours. After removing the antibody solution, cells were washed three times with 1 mL / well of 0.3% Triton X-100-PBS for 5 minutes, and then microscopically observed with 300 μL / well of PBS. Alexa Fluor 488 was detected using a B filter (excitation filter (Ex) 420 nm~490 nm, absorption filter (Em) 520 nm). After acquiring phase contrast and fluorescence images, cells were treated with 50 ng / mL of DAPI (4',6-diamidino-2-phenylindole)-PBS solution at 50 μL / well for 2 hours, and then washed three times with PBS. Stained nuclei were observed using a UV filter (Ex. 330 nm~350 nm, Em. 420 nm). The results for human ovarian cancer cells OVK18 are shown in Figure 23C, and the results for human malignant melanoma cells Mewo are shown in Figure 23D. In Figures 23C and D, "PC" shows the phase-contrast observation image, and "DAPI" shows the nuclear staining pattern.

[0392] As shown in Figures 23A-D, treatment of cells with 4-trehalosamine and trehalose analogs confirmed increased expression and nuclear translocation of TFEB, which is known to be upregulated and translocate to the nucleus during autophagy induction. In particular, IMCTA-C14 showed activity equivalent to or greater than trehalose at concentrations less than one-thousandth of trehalose.

[0393] (Test Example 11-1: Staining of acid-fast bacteria with IMCTA-fluorescein, IMCTA-biotin, or IMCTA-azide) Using IMCTA-fluorescein obtained in Synthesis Example 9, IMCTA-biotin obtained in Synthesis Example 10, and IMCTA-azide obtained in Synthesis Example 11, acid-fast bacteria ( Mycobacterium smegmatis A staining test was conducted.

[0394] It was stored at 4°C. Mycobacterium smegmatis mc 2 155 strains (ATCC 700084) were inoculated at 0.5 μL / mL into Middlebrook 7H9 medium (Becton, Dickinson and Company) supplemented with 0.5% glycerol, 0.05% Tween 80, and 10% BD BBL Middlebrook OADC Enrichment (Becton, Dickinson and Company), and incubated at 37°C for 24 hours. Trehalose aqueous solution or sucrose aqueous solution for blocking was added to this culture medium to a final concentration of 1% or 3%, and then 0.1% DMSO, 10 μg / mL 5-carboxyfluorescein (5-FC), 10 μg / mL IMCTA-fluorescein (Synthesis Example 9), 30 μg / mL IMCTA-biotin (Synthesis Example 10), or 10 μg / mL IMCTA-azide (Synthesis Example 11) were added to achieve final concentrations of 0.1% DMSO, 10 μg / mL 5-carboxyfluorescein (5-FC), 10 μg / mL IMCTA-fluorescein (Synthesis Example 9), 30 μg / mL IMCTA-biotin (Synthesis Example 10), or 10 μg / mL IMCTA-azide (Synthesis Example 11), respectively. After culturing at 37°C for 8 hours, the culture medium was centrifuged at 21,300 × g for 1 minute, and the precipitate was washed three times with 0.05% Tween 80-PBS. The bacterial cells were suspended in 0.05% Tween 80-PBS to obtain a bacterial suspension. Samples cultured in the same manner without the addition of trehalose aqueous solution or sucrose aqueous solution were designated as "No block".

[0395] The bacterial cell suspensions obtained using IMCTA-fluorescein were observed using a fluorescence microscope (ECLIPSE-TE2000-U, Nikon Corporation) for phase contrast and fluorescence imaging. A B filter (Ex. 420nm~490nm, Em. 520nm) was used for fluorescence observation. The results are shown in Figure 24A. After capturing phase contrast and fluorescence images, the fluorescence intensity per unit of bacterial mass was analyzed using ImageJ (National Institutes of Health), and the fluorescence intensity per unit of bacterial mass was quantified and graphed (n=3, mean±SD). The results are shown in Figure 25A.

[0396] The bacterial cell suspension obtained using IMCTA-biotin was treated with 30 μg / mL DyLight 488 Streptavidin (Vector Laboratories), incubated at 37°C for 1 hour, washed three times with 0.05% Tween 80-PBS, and then under the same conditions as for the bacterial cell suspension obtained using IMCTA-fluorescein, fluorescence microscopy observation and image analysis were performed in 0.05% Tween 80-PBS. The results of fluorescence microscopy observation are shown in Figure 24B, and the results of image analysis are shown in Figure 25B.

[0397] The bacterial cell suspension obtained using IMCTA-azide was treated with 5-FAM-Alkyne (final concentration 10 μg / mL, Jena Bioscience), CuSO4·5H2O (100 μg / mL), and ascorbic acid (100 μg / mL), which had been pre-mixed in 0.05% Tween 80-PBS, and was treated at 37°C for 1 hour. The bacterial cells were washed three times with 2% SDS aqueous solution, suspended in 2% SDS aqueous solution, and observed using a fluorescence microscope and image analysis under the same conditions as for the bacterial cell suspension obtained using IMCTA-fluorescein. The results of the fluorescence microscope observation are shown in Figure 24C, and the results of the image analysis are shown in Figure 25C.

[0398] In the fluorescent substance treatment of raw materials Mycobacterium smegmatis The bacterial cells did not emit fluorescence and were thought not to be taken up, but the results in Figures 24A-C show that IMCTA-fluorescein, IMCTA-biotin, and IMCTA-azide all... Mycobacterium smegmatis It was incorporated into the bacterial cells and emitted fluorescence. IMCTA-fluorescein uptake was not significantly inhibited in the presence of excess sucrose, but inhibition was observed in the presence of 1% trehalose. This indicates that it is taken up competitively with trehalose. However, slight differences were observed in the staining patterns of IMCTA-fluorescein, IMCTA-biotin, and IMCTA-azide. When using the same amount of label, the strongest fluorescence was observed with treatment using IMCTA-azide. On the other hand, although the reason is unknown, inhibition of uptake was observed not only by trehalose but also by sucrose. A patchy staining pattern was observed with IMCTA-biotin. Slight inhibition of uptake by sucrose was also observed in the case of IMCTA-biotin treatment.

[0399] (Test Example 11-2: TLC analysis of lipid components in IMCTA-fluorescein stained cells) In Test Example 11-1, staining was performed using IMCTA-fluorescein. Mycobacterium smegmatis Bacterial cells in a bacterial cell suspension or treated with DMSO Mycobacterium smegmatis TLC analysis was performed on the lipid components of the bacterial cell suspension. TLC analysis was performed based on the method of Kai et al. (M. Kai et al., FEBS Lett 2007, 581, p.3345-3350).

[0400] In Test Example 11-1, staining was performed using IMCTA-fluorescein. Mycobacterium smegmatis Bacterial cells in a bacterial cell suspension or treated with DMSO Mycobacterium smegma The bacterial cell suspension was centrifuged at 21,300 × g for 1 minute. Twenty times the volume of chloroform / methanol (2:1, v / v) was added to the precipitate, and the mixture was vigorously stirred for 5 minutes using a tube mixer (TWIN3-28N, AGC Technoglass Co., Ltd.). The solution was centrifuged at 21,300 × g for 1 minute, and the supernatant was collected. The precipitate was subjected to the same extraction procedure two more times, and the supernatants were collected and dried using a Savant SpeedVac (Thermo Fisher Scientific) to remove the solvent. The dried material was suspended in 0.75% of the initial culture volume in Test Example 11-1 in chloroform / methanol, vigorously stirred for 5 minutes, and then centrifuged at 21,300 × g for 1 minute. The supernatant was used as the TLC sample.

[0401] For TLC analysis, a Silica gel 60 TLC plate (Merck) was used, and the solvent was chloroform / methanol / acetone / acetonitrile (90:10:6:1, v / v). The total lipid content was detected using a phosphomolybdic acid solution similar to that used in Test Example 1, and fluorescence was detected using a UV transilluminator (NTFM-20, Analytik Jena US LLC). Figure 26A shows the phosphomolybdate staining pattern of the entire component, and Figure 26B shows the fluorescence detection pattern. In Figures 26A and B, "1" represents the result of bacterial cells treated with DMSO, "2" represents the result of bacterial cells treated with IMCTA-fluorescein, and "3" represents the result of spotting 1.3 μg of IMCTA-fluorescein itself. In Figure 26B, the arrows indicate components that show fluorescence only in the IMCTA-fluorescein treated sample.

[0402] The results in Figures 26A and 26B show that two fluorescent lipids were detected in bacterial cells that incorporated IMCTA-fluorescein, suggesting that IMCTA-fluorescein was incorporated in place of trehalose in the trehalose portion of trehalose monomycolic acid and trehalose dimycolic acid.

[0403] (Test Example 12-1: Confirmation of microbial degradation of 4-trehalosamine) The degradation of 4-trehalosamine by the following 12 types of microorganisms was investigated.

[0404] <Microorganisms> 1.EC: Escherichia to be cultivated K-12 (Owned by the Japan Society for Microbial Chemistry) 2.SM: Serratia decaying B-0524 (Held by the Japan Society for Microbial Chemistry) 3.EF: Enterococcus fecal JCM5803 (obtained from RIKEN BRC) 4.AN: Aspergillus black F16 (owned by the Japan Society for Microbial Chemistry) 5.SE: Salmonella enteritis 1891 (owned by the Japan Society for Microbial Chemistry) 6.MS: Mycobacterium smegma ATCC-607 (obtained from ATCC) 7. BS: Bacillus subtle 168 (Obtained from ATCC) 8.PA: Pseudomonas aeruginosa A3 (Held by the Japan Society for Microbial Chemistry) 9.ML: Micrococci yellow IFO3333 (obtained from IFO) 10.BF: Bacteroides fragile JCM11019 (obtained from RIKEN BRC) 11.SC: Saccharomyces yeast F-7 (Owned by the Japan Society for Microbial Chemistry) 12.CA: White albicans 3147 (Obtained from IFO)

[0405] -Culture method- EC, SM, PA, and ML were pre-cultured in Nutrient medium (1% polypeptone (manufactured by Nippon Pharmaceutical Co., Ltd.), 1% bacterial fish extract (manufactured by Kyokuto Pharmaceutical Co., Ltd.), 0.2% sodium chloride). MSs were pre-cultured in Nutrient medium supplemented with 2% glycerol. EF and SE were pre-cultured in Bactohart infusion medium (HI, Becton, Dickinson and Company (BD)). BF was pre-cultured in Gifu anaerobic medium (GAM medium, manufactured by Nissui Pharmaceutical Co., Ltd.). SC, CA, and AN were pre-cultured in RPMI-1640 medium (manufactured by Nissui Pharmaceutical Co., Ltd.). BS was pre-cultured in LB medium (Difco).

[0406] In a 96-well plate, 196 μL of culture medium for each of microorganisms 1-12 was placed, followed by 2 μL of the pre-cultured suspension of each microorganism. Then, 2 μL of a mixture of 5 mg / L 4-trehalosamine aqueous solution and 5 mg / L trehalose aqueous solution was added (each at a final concentration of 50 μg / mL). The cells were incubated under humid conditions at 37°C for bacteria and 30°C for fungi for 5 days. The aforementioned high humidity conditions refer to a state where a 96-well plate is wrapped in a water-saturated paper towel, placed inside a zip-top bag, and the zipper is loosened by about 2-3 cm to allow for ventilation. After incubation, the culture medium was diluted to 1 / 10 with methanol, vigorously stirred with a vortex mixer, and then centrifuged at 21,300 × g for 5 minutes. The obtained supernatant was subjected to LC-MS analysis under the same conditions as in Test Example 1, and the residual percentage (%) of 4-trehalosamine or trehalose was calculated. The results are shown in Figure 27A.

[0407] As shown in Figure 27A, 4-trehalosamine was almost undetectable in 8 out of 12 microorganisms.

[0408] (Test Example 12-2: Confirmation of microbial assimilation of 4-trehalosamine) The assimilation of 4-trehalosamine by the 12 types of microorganisms described in Test Example 12-1 was confirmed.

[0409] The 12 types of microorganisms described in Test Example 12-1 were cultured to saturation in the respective culture media, and then each was added in 1 / 100th volume to the following carbon source-deficient culture media. -Carbon source deficient culture medium- EC, SM, AN, SE, ML, and BF were prepared using RPMI-1640 (glucose-free) (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.). MS, BS, and CA used an improved 805 medium (0.1% yeast extract (BD), 0.07% dipotassium hydrogen phosphate, 0.01% potassium dihydrogen phosphate, 0.1% magnesium sulfate heptahydrate), which is a modified version of NBRC805-1 medium (National Institute of Technology and Evaluation). PA used modified 805-4 medium (0.025% tryptone (BD), 0.07% dipotassium hydrogen phosphate, 0.01% potassium dihydrogen phosphate, 0.1% magnesium sulfate heptahydrate). EF and SC were prepared using LB medium without yeast extract (1% tryptone (BD), 0.05% sodium chloride).

[0410] Next, 4-trehalosamine, trehalose, or glucose was added to the PA sample to a final concentration of 0.1%, and to the other microorganisms to a final concentration of 0.4%. Under humid conditions (same conditions as in Test Example 12-1), bacteria were cultured at 37°C and fungi at 30°C for 5 days. After 5 days, the absorbance of the culture medium at 620 nm was measured using a Cytation 5 plate reader (Bio Tek Instruments) to confirm the growth of each microorganism. The results are shown in Figure 27B. In Figure 27B, "1" represents the control group without the addition of 4-trehalosamine, trehalose, and glucose; "2" represents the group cultured with glucose added; "3" represents the group cultured with trehalose added; and "4" represents the group cultured with 4-trehalosamine added.

[0411] In Test Example 12-2, experiments were conducted under conditions where the growth rate of each microorganism increased when glucose was added. As shown in Figure 27B, when trehalose was added, growth activation was observed in 6 types of bacteria, suggesting that trehalose was decomposed and utilized by these bacteria. On the other hand, when 4-trehalosamine was added, no growth activation was observed in any of the 12 types of microorganisms. From the results in Figures 27A and B, it is thought that 4-trehalosamine was not decomposed by the various microorganisms in a way that released glucose, but rather that part of its structure was modified so that it could no longer be detected as 4-trehalosamine, confirming that it does not serve as a carbon source or nutrient source.

[0412] (Test example 13: Model of 4-trehalosamine binding to human trehalase) A homology model of human trehalose (O43280) was constructed using SWISS-MODEL web server Promod3 3.1.1 (see A. Waterhouse et al., Nucleic Acids Res, 2018, 46, W296., N. Guex et al., Electrophoresis, 2009, 30 Suppl 1, S162., and S. Bienert et al., Nucleic Acids Res, 2017, 45, D313.). Of the 148 templates, one showing 39% sequence homology (PDB 5z66) (see A. Adhav et al., FEBS J, 2019, 286, 1700.) was selected and used as the base model. The model quality was evaluated using Qmean and QMEANDisCo scoring from QMEAN-Server (https: / / swissmodel.expasy.org / qmean) (see G. Studer et al., Bioinformatics, 2020, 36, 1765., M. Bertoni et al., Sci Rep, 2017, 7, 10480., C. Camacho et al., BMC Bioinformatics, 2009, 10, 421., M. Steinegger et al., BMC Bioinformatics, 2019, 20, 473., and M. Mirdita et al., Nucleic Acids Res, 2017, 45, D170.). The QMEAN score was -3.15, and the QMEANDisCo Global score was 0.70±0.05. Next, a binding model of trehalase and trehalose (ZINC4095531) was constructed using the AutoDock Vina on Chimera (see O. Trott et al., J Comput Chem, 2010, 31, 455. and EF Pettersen et al., J Comput Chem, 2004, 25, 1605.). Charge assignment was performed using AMBER ff14SB for standard amino acid residues and Gasteiger for others. The docking pose of 4-trehalosamine was constructed in the same manner as described above. PyMOL (The PyMOL Molecular Graphics System, Version 2.1, Schrodinger, LLC. 2010.) was used to create the coupling model diagrams.

[0413] Figure 28A shows the binding model of trehalose to human trehalase, and Figure 28B shows the binding model of 4-trehalosamine to human trehalase. The trehalose binding model to human trehalose shown in Figure 28A was the optimal model, yielding an AutoDock score of -9.4 kcal / mol. The catalytic region of trehalose is small, and when trehalose binds, there is almost no extra space left. It is thought that molecules larger than trehalose cannot enter and are therefore not degraded. For 4-trehalosamine, which is almost the same size as trehalose, we constructed several binding models, but in all of them, it was thought that binding was difficult because the catalytic site contained an amino acid residue that repelled the amino group of 4-trehalosamine. [Accession Number]

[0414] NITE BP-03495

Claims

1. A protective agent characterized by containing a compound represented by the following general formula (1), or a pharmaceutically acceptable salt thereof, or a solvate thereof, A protective agent having the following effects: inhibiting starch retrogradation, preventing or suppressing the decrease in activity of proteins during storage in a frozen or freeze-dried state, preventing or suppressing damage or death of microorganisms during storage in a frozen or freeze-dried state, or having a pH buffering effect. 【Chemistry 1】 However, in the general formula (1) above, R 1 is, -NH 2 Here, m represents an integer between 7 and 14.

2. A blood glucose control composition characterized by containing a compound represented by the following general formula (1), or a pharmaceutically acceptable salt thereof, or a solvate thereof: 【Chemistry 2】 However, in the general formula (1) above, R 1 is, -NH 2 Here, m represents an integer between 7 and 14.

3. Autophagy inducers characterized by containing a compound represented by the following general formula (1), or a pharmaceutically acceptable salt thereof, or a solvate thereof: 【Transformation 3】 However, in the general formula (1) above, R 1 is, -NH 2 Here, m represents an integer between 7 and 14.

4. A pH buffer characterized by containing a compound represented by the following general formula (1), or a pharmaceutically acceptable salt thereof, or a solvate thereof: 【Chemistry 4】 However, in the general formula (1) above, R 1 is, -NH 2 Here, m represents an integer between 7 and 14.