Identification and application of selective cell surface markers and further methods to enrich for human red / green cone photoreceptor precursors
By employing a detectably labeled binding agent for ALCAM/CD166 and MACS, along with negative selection markers, the method effectively isolates and enriches red/green cone photoreceptor precursors, improving transplantation outcomes and therapeutic agent identification.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-02-26
- Publication Date
- 2026-03-10
AI Technical Summary
Current methods lack the ability to selectively isolate human red/green cone photoreceptor precursors without genetic manipulation, which is crucial for effective cell replacement therapy and in vitro studies.
Utilizing a detectably labeled binding agent, such as an antibody specific for ALCAM/CD166, to sort human red/green cone photoreceptor precursors through magnetic-activated cell sorting (MACS), and optionally combining with negative selection using ITGA6/CD49f, TNFRSF10B/CD262, and NGFR/CD271 markers to enrich the population.
Enriches the population of red/green cone photoreceptor precursors, enhancing their integration and functionality post-transplantation, and facilitates the identification of therapeutic agents for retinal degenerative diseases.
Smart Images

Figure 2026508219000001 
Figure 2026508219000002 
Figure 2026508219000003
Abstract
Description
[Technical Field]
[0001] Cross-reference to application This application claims priority to U.S. Provisional Patent Application No. 63 / 486,903, filed February 24, 2023, the disclosure of which is incorporated herein by reference in its entirety. STATEMENT REGARDING FEDERALLY FUNDED RESEARCH This invention was made with government support under grants EY029890, EY032434 and EY033275 awarded by the National Institutes of Health. The government has certain rights in this invention. INCORPORATION-BY-REFERENCE OF ELECTRONICALLY PROVIDED SEQUENCE LISTINGS This application contains a Sequence Listing that has been submitted as an electronic text file named "22-0995-WO.xml" having a size of 9 kb bytes and created on February 26, 2024. The information contained in this electronic file is incorporated herein by reference in its entirety. [Background technology]
[0002] Retinal photoreceptors (PRs) are the primary visual sensory neurons, and therefore their proper connectivity and function are crucial for vision. Cone photoreceptors are required, for example, for daytime vision, as well as color and high-acuity vision. Cones can respond to short-wavelength (blue cones), medium-wavelength (green cones), and long-wavelength (red cones) light, but central high-acuity vision utilizes only red and green cones, referred to herein as red / green cones. Loss of PRs due to disease or injury leads to visual loss and irreversible blindness. Retinal degenerative diseases, such as age-related macular degeneration, retinitis pigmentosa, and cone-rod disorders, as well as some traumatic or other ocular injuries, result in the acute or progressive loss of cones. One potential treatment approach is cell replacement therapy using human pluripotent stem cell (hPSC)-derived PRs. Technology now exists to generate retinal cells from human pluripotent stem cells, including a mixture of photoreceptors that primarily contain rods (not required for daytime, color, or high-acuity vision). Cones can be generated in a mixture of retinal cells in three-dimensional (3D) organoids, but there are currently no methods to selectively isolate cone photoreceptor cells without genetic manipulation (e.g., fluorescent tagging). Sorting out cones at their respective stages (versus their mature stages) may result in better integration after transplantation. The previously unrealized ability to select human red / green cone photoreceptor precursors (CPPs) also has implications for in vitro studies such as drug discovery or gene therapy trials. Therefore, there is a need in the art for methods to detect and select red / green cone photoreceptor precursor (CPP) cells. Summary of the Invention
[0003] Provided herein are methods for obtaining an enriched population of human red / green CPP cells, comprising sorting a mixed population of retinal cells that have been contacted with a detectably labeled binding agent that specifically binds ALCAM / CD166 expressed on the cell surface of human red / green CPP cells. In certain embodiments, these methods further comprise contacting the cells with a detectably labeled binding agent specific for ALCAM / CD166 before or during sorting; in certain embodiments, the specific binding agent is an antibody or antigen-binding fragment thereof that specifically binds ALCAM / CD166. In certain embodiments, these methods further comprise sorting the cells by magnetic-activated cell sorting (MACS). Also provided herein is a population of human red / green cone photoreceptor precursor cells, wherein the cells constituting the population express ALCAM / CD166 on their cell surface. The population is advantageously produced by a method comprising sorting a mixed population of retinal cells to obtain an enriched population of human red / green CPP cells, the method comprising contacting the cells with a detectably labeled binding agent that specifically binds to ALCAM / CD166 expressed on the cell surface of human red / green CPP cells. In certain embodiments, the methods further comprise contacting the cells with a detectably labeled binding agent specific for ALCAM / CD166 before or during sorting; in certain embodiments, the specific binding agent is an antibody or antigen-binding fragment thereof that specifically binds to ALCAM / CD166. In certain embodiments, the methods further comprise sorting the cells by magnetic-activated cell sorting (MACS).
[0004] Further provided herein is a method for identifying a therapeutic agent specific for human red / green CPP cells, comprising contacting a population of human CPP cells that express ALCAM / CD166 on the cell surface with one or more drug candidates and detecting a physiological response thereto. Provided herein are methods for treating a disease or disorder in cone photoreceptor cells in an animal, the method comprising administering to an individual in need thereof a therapeutically effective amount of a therapeutic agent specific for cone photoreceptor cells. Also provided herein are methods for treating a disease or disorder of cone photoreceptor cells in an animal, comprising administering a therapeutically effective amount of a therapeutic agent to an individual in need thereof, wherein the disease or disorder involves the cone-rich macula and includes, but is not limited to, cone-rod dystrophy, macula-off retinal detachments, laser injury, retinopathy, or chloroquine or hydroxychloroquine toxicity or other disease, injury, or toxicity. In certain embodiments, the disease is age-related macular degeneration, myopic degeneration, Stargardt's disease, or Best's disease.
[0005] Further provided herein is a method for detecting red / green CPP cells, comprising identifying CPP cells from three-dimensional (3D) retinal organoids based on cell surface expression of the cell surface marker ALCAM / CD166, wherein the 3D retinal organoids are derived from stem cells and contain photoreceptor cells and other retinal cell types. In certain embodiments, the stem cells are induced pluripotent stem cells (iPSCs) or human embryonic stem cells (hESCs). In further embodiments, the stem cells are dual reporter lines containing two fluorescent proteins, one of which is red fluorescent protein (RFP) or another of which is green fluorescent protein (GFP). In certain embodiments, the RFP is tdTomato. In certain embodiments, the fluorescent protein is encoded by a nucleotide sequence operably linked to a promoter. In certain embodiments, the promoter is the thyroid hormone receptor beta 2 (THRB2) promoter. In certain embodiments, the RFP is linked to the THRB2 promoter. In certain embodiments, the THRB2-RFP reporter line expresses red / green cone precursors. In certain additional embodiments, the fluorescent protein is encoded by a nucleotide sequence operably linked to a neural retina-specific leucine zipper protein promoter (NRL). In certain embodiments, GFP is linked to the NRL promoter. In certain embodiments, the NRL-GFP reporter strain expresses rod precursors.
[0006] Provided herein is a population of red / green cone CPP cells from a subject, comprising enriched CPP cells, wherein the CPP cells comprising the population express ALCAM / CD166 on their cell surface. In certain embodiments, the subject is a mammal, and in certain embodiments, the mammal is a human. Also provided herein are methods for identifying therapeutic agents specific for a retinal degenerative disease or disorder or retinal injury or toxicity, comprising contacting a population of red / green CPP cells with one or more drug candidates and detecting a therapeutically beneficial physiological response thereto. Further provided herein is a method of treating a retinal degenerative disease or disorder or retinal disease or toxicity in a subject, the method comprising administering a therapeutically effective amount of a therapeutic agent to a subject in need thereof; the subject is a mammal; and the mammal is a human.
[0007] Further provided herein is a method for treating a retinal degenerative disease or disorder or retinal disease or toxicity in a subject, comprising administering a therapeutically effective amount of a therapeutic agent to a subject in need thereof; the disease or disorder involves the cone-rich macula, including, but not limited to, cone-rod dystrophy, macular detachment retinal detachment, laser injury, retinopathy, or chloroquine or hydroxychloroquine toxicity or other injury or toxicity. In certain embodiments, the disease is age-related macular degeneration, myopic degeneration, Stargardt's disease, or Best's disease.
[0008] Also provided herein is a method for obtaining an enriched population of red / green CPP cells, comprising sorting a mixed population of retinal cells that has been contacted with one or more detectably labeled binding agents, each of which specifically binds to ITGA6 / CD49f, TNFRSF10B / CD262, NGFR / CD271, or a combination thereof, expressed on the cell surface of non-CPP cells, and sorting to obtain ITGA6 / CD49f-, TNFRSF10B / CD262-, and NGFR / CD271-negative CPP cells. In certain embodiments, the binding agents are antibodies or antigen-binding fragments, each of which specifically binds to ITGA6 / CD49f, TNFRSF10B / CD262, NGFR / CD271, or a combination thereof. In certain embodiments, the antibody is one or more biotin-conjugated antibodies, and the biotin-conjugated antibodies are one or more of ITGA6 / CD49f, TNFRSF10B / CD262, NGFR / CD271, or a combination thereof. In certain embodiments, cells are incubated with one or more biotin-conjugated antibodies, incubated with anti-biotin microbeads, and then sorted by magnetic-activated cell sorting (MACS). In certain embodiments, the sorted cells are separated into one or more cell fractions that are ITGA6 / CD49f-negative, TNFRSF10B / CD262-negative, NGFR / CD271-negative, or a combination thereof, and ITGA6 / CD49f-positive, TNFRSF10B / CD262-positive, NGFR / CD271-positive, or a combination thereof.
[0009] Provided herein is a population of human CPP cells, wherein the CPP cells comprising the population do not express at least one of ITGA6 / CD49f, TNFRSF10B / CD262, NGFR / CD271, or a combination thereof, on the cell surface. The cells are advantageously produced by a method for obtaining an enriched population of red / green CPP cells, which comprises sorting a mixed population of retinal cells contacted with detectably labeled binding agents that specifically bind to ITGA6 / CD49f, TNFRSF10B / CD262, NGFR / CD271, or a combination thereof, expressed on the cell surface, and sorting the cells for ITGA6 / CD49f-negative, TNFRSF10B / CD262-negative, NGFR / CD271-negative cells, or a combination thereof. In certain embodiments, the binding agents are antibodies or antigen-binding fragments that specifically bind to ITGA6 / CD49f, TNFRSF10B / CD262, NGFR / CD271, or a combination thereof. In certain embodiments, the antibody is one or more biotin-conjugated antibodies, and the biotin-conjugated antibodies are one or more of ITGA6 / CD49f, TNFRSF10B / CD262, NGFR / CD271, or a combination thereof. In certain embodiments, the cells are incubated with one or more biotin-conjugated antibodies. In further embodiments, the cells are then incubated with anti-biotin microbeads. In certain embodiments, the methods further comprise sorting the cells by magnetic-activated cell sorting (MACS). In certain embodiments, the sorted cells are separated into one or more cell fractions that are ITGA6 / CD49f-negative, TNFRSF10B / CD262-negative, NGFR / CD271-negative, or a combination thereof, and ITGA6 / CD49f-positive, TNFRSF10B / CD262-positive, NGFR / CD271-positive, or a combination thereof.
[0010] Also provided herein are methods for obtaining microaggregates from a population of CPP cells. CPP microaggregates are advantageously produced by the methods for research use or transplantation purposes. The methods include seeding at least one of ALCAM / CD166-positive, ITGA6 / CD49f-negative, TNFRSF10B / CD262-negative, and NGFR / CD271-negative CPP cells, or a combination thereof, at a seeding density. In some embodiments, at least one of ALCAM / CD166-positive, ITGA6 / CD49f-negative, TNFRSF10B / CD262-negative, and NGFR / CD271-negative cells, or a combination thereof, are seeded into agarose microwells. In some embodiments, the seeding density is 250 to 8,000 cells / microwell, and the cells are seeded at the seeding density. Further provided herein are methods for obtaining CPP cell microaggregates for transplantation. The methods include treating a population of CPP cell microaggregates advantageously produced by the method for obtaining microaggregates from a population of CPP cells. In further embodiments, the methods include treating the population of CPP cells with a cell growth inhibitor and incubating the CPP cell microaggregates for a period of time in 3D retinal differentiation medium (RDM) containing the cell growth inhibitor, wherein after incubation the cells are washed with 3D-RDM. In some embodiments, the cell growth inhibitor is mitomycin C. In some embodiments, the CPP cell microaggregates are incubated for 24 to 72 hours.
[0011] These and other features, objects, and advantages of the present invention will be better understood from the ensuing description. In this description, reference is made to the accompanying drawings, which form a part of this document and which are shown by way of illustration, not limitation, of embodiments of the present invention. The description of the preferred embodiment does not limit the invention to encompass all modifications, equivalents, and alternatives. Accordingly, reference should be made to the claims recited herein to interpret the scope of the invention. The present disclosure will be better understood, and features, aspects and advantages thereof, in addition to those described above, will become apparent, in consideration of the following detailed description, which refers to the following drawings: [Brief explanation of the drawings]
[0012] [Figure 1] This is a model of the human retina. Two types of photoreceptor cells (rods and cones) within the retina convert light into nerve impulses that are ultimately transmitted to the brain, enabling vision. Rod photoreceptors are required for peripheral vision and dark vision. Cone photoreceptors, particularly the red-green cones mentioned above, are required for central vision and color vision. [Figure 2] A diagram showing a model of stem cells used as a source for growing retinal organoids. A schematic diagram of the organoids (right panel) illustrates that these organoids contain predominantly rod photoreceptors, with a more sparse population of cone photoreceptors. [Figure 3] Schematic diagram of two genomic loci in the same cell line (cone-rod reporter (CRR) line) with fluorescent reporter genes integrated at each locus on a single chromosome. The THRB2-tdTomato reporter specifically labels cone photoreceptors, and the NRL-eGFP reporter specifically labels rod photoreceptors. [Figure 4A] Figure 4 shows the expression of fluorescent reporter proteins in cone and rod cells, respectively, of D45 and D100 CRR retinal organoids. More specifically, THRB2 and NRL are intracellular markers of early red / green cones and rods, respectively. Figure 4A shows THRB2-tdTomato expression in early red / green cone photoreceptor precursor (CPP) cells, but not NRL-eGFP expression, due to the absence of early rods at D45 of development. Figure 4B shows THRB2-tdTomato expression in late (mature) cone photoreceptor cells and NRL-eGFP expression in early rod cells at D100, the latter beginning to occur around D70. Scale bar: 50 μm. [Figure 4B]Figure 4 shows the expression of fluorescent reporter proteins in cone and rod cells, respectively, of D45 and D100 CRR retinal organoids. More specifically, THRB2 and NRL are intracellular markers of early red / green cones and rods, respectively. Figure 4A shows THRB2-tdTomato expression in early red / green cone photoreceptor precursor (CPP) cells, but not NRL-eGFP expression, due to the absence of early rods at D45 of development. Figure 4B shows THRB2-tdTomato expression in late (mature) cone photoreceptor cells and NRL-eGFP expression in early rod cells at D100, the latter beginning to occur around D70. Scale bar: 50 μm. [Figure 5] Venn diagram of 1,891 genes upregulated in photoreceptors (early red / green cones, late red / green cones, and rods) versus nonphotoreceptor cells. The upregulated genes were identified by bulk RNA-seq analysis of FAC-sorted retinal organoid cells derived from the CRR dual reporter line [D50 nonphotoreceptors (D50 N), D50 red / green cones (D50 Th-C), D100 nonphotoreceptors (D100 N), D100 red / green cones (D100 Th-C), D100 rods (D100 R)]. 313 genes (yellow boxes) expressed exclusively in D50 red / green cones are shown in heatmap form in Figure 6A. [Figure 6A] Figures 6A-6B show heat maps of gene expression in red / green cone CPPs. Figure 6A shows a heat map of 313 genes expressed exclusively in D50 early red / green cone precursors. (Red = higher expression, Blue = lower expression). [Figure 6B] FIG. 6B identifies five early red / green CPP-specific cell surface differentiation (CD) markers present within these 313 genes, including ALCAM / CD166 (highlighted). [Figure 7] 10 is a photomicrograph showing ALCAM / CD166 expression in D50 retinal organoids of a second (non-CRR reporter) human pluripotent stem cell line (WA09). Scale bar: 50 μm. [Figure 8]Figures 8A-8F show micrographs of ALCAM / CD166 expression in D50-WA09 retinal organoids but not in D100-WA09. The RNA-seq results for CRR retinal organoids are confirmed. Figure 8A shows a merged image of all fluorescent channels (enlarged inset in Figure 9), and Figure 8B shows nuclei stained with DAPI (blue), a nucleic acid-specific dye. Figure 8C shows the presence of proliferating KI67-positive cells (green) in both D50 and D100 organoids. Figure 8D shows that ALCAM / CD166-positive cells are present only in D50 organoids but not in D100 organoids (red). Figure 8E shows the presence of recoverin (RCVRN)-positive photoreceptors (purple) in both D50 and D100 organoids. Note that the number of RCVRN-positive photoreceptors increases over time. Figure 8F shows ALCAM / CD166 expression in RCVRN-positive / KI67-negative postmitotic CPPs in cells deep within the organoid in a layer corresponding to nascent postmitotic photoreceptors. Scale bar: 100 μm. [Figure 9] Figures 9A-9E show higher magnification micrographs of the boxed inset in Figure 8. The pseudocolors for KI67 (purple) and RCVRN (green) are swapped for better visualization. Figure 9A shows purple immunostaining for KI67, indicating proliferating cells within both D50 and D100 retinal organoids. Figure 9B shows red immunostaining for ALCAM / CD166, indicating that ALCAM / CD166-positive CPPs are present only in D50 organoids but not in D100 organoids. Figure 9C shows green immunostaining for RCVRN, indicating increased photoreceptor presence in D100 vs. D50 organoids. Figure 9D shows three fluorescent channels merged to show ALCAM / CD166 expression within RCVRN-positive / KI67-negative postmitotic CPPs (scale bar: 200 µm). FIG. 9E shows an enlarged inset from FIG. 9D illustrating the absence of KI67 immunostaining in postmitotic ALCAM / CD166-positive / RCVRN-positive CPPs. [Figure 10]10 is a photomicrograph illustrating enrichment of CPP cells after ALCAM / CD166-based magnetic-activated cell sorting (MACS) from dissociated CRR D50 retinal organoids. Scale bar: 50 μm. [Figure 11A] Figures 11A-11C show quantification of THRB:tdTomato-positive red / green CPP cells by flow cytometry (FC) in CRR retinal organoids at D50 after ALCAM / CD166-based MACS. Figure 11A shows the percentage of THRB:tdTomato-positive red / green CPP cells in unsorted and ALCAM / CD166-based MAC-sorted positive and negative fractions. Initial MACS was performed using the manufacturer's recommended ALCAM / CD166 dilution of 1:50. [Figure 11B] Figure 11B shows the percentage of THRB2:tdTomato-positive red / green CPP cells in the positive and negative fractions after ALCAM / CD166-based MACS using different dilutions of ALCAM / CD166: 1:50 (blue square), 1:250 (purple square), and 1:500 (pink square). Black squares—no fluorescence control; brown squares—dissociated and unsorted CRR retinal organoid cells at D50. [Figure 11C] Figure 11C shows a bar graph of the percentage of THRB:tdTomato-positive red / green CPP cells among ALCAM / CD166-positive and ALCAM / CD166-negative cells after MACS using unsorted ALCAM / CD166 at different dilutions. It can be noted that the percentage of THRB2:tdTomato-positive red / green CPP cells increases with increasing dilution. [Figure 12] FIG. 1 shows a heat map of 26 CD markers that can be used for negative selection of red / green CPP cells. [Figure 13A]Figures 13A-13B show flow cytometric quantification of THRB2:tdTomato-positive red / green CPP cells in CRR D50-D56 ROs obtained by MACS negative sorting compared with unsorted or CD166-sorted ROs. Figure 13A shows the percentage of THRB2:tdTomato-positive red / green CPP cells in unsorted ROs (13A.i), the CD166-positive fraction of CD166-sorted ROs (Figure 13A.ii), and the negative fraction of ROs sorted using CD49f-, CD262-, or CD271-, individually (13A.iv-13A.vi) or in combination (13A.vii-13A.x). Negative MACS was performed using the manufacturer's recommended dilution. [Figure 13B] Figure 13B shows a bar graph of the percentage of THRB2:tdTomato-positive red / green CPP cells obtained by negative MACS (using individual antibodies or specific combinations) compared to the CD166+ fraction of unsorted and CD166-sorted ROs (antibody dilution 1:50). [Figure 14] Figure 14.i shows a schematic of CPP microaggregate preparation using D50 CRR retinal organoids for ALCAM / CD166-based MACS. The same method was used to prepare WA09 CPP microaggregates used in the rat transplantation experiments shown in Figure 17. Figure 14.i shows CPP microaggregates and tdTomato expression in individual agarose microwells. Scale bar: 200 μm. [Figure 15] Diagram of mitomycin C (MMC) treatment of ALCAM / CD166-based MAC-sorted cells during CPP microaggregate formation, and ICC images of microaggregates cut during 7 days post-treatment (dpt) for both control (Figures 15.ii-iii) or MMC-treated CPP microaggregates (Figures 15.iv-15.vi). Scale bar: 15.i - 200 μm, 15.ii-vi - 50 μm. [Figure 16]FIG. 1 shows flow cytometric quantification of THRB2:tdTomato-positive red / green CPP cells in CPP microaggregates treated with DMSO (control) or MMC (250 ng / mL) at 10 days post microaggregate formation (dpbf) compared to unsorted CRR RO at D60. [Figure 17] Figures 17A-7C show photomicrographs of IHC analysis of retinal cross sections from Foxn1-S334ter rats. This immunodeficient rat model has a rhodopsin mutation that results in rapid rod photoreceptor loss and progressive cone loss, similar to that seen in patients with retinitis pigmentosa. At 2 months of age, rods are essentially lost, and cone degeneration is ongoing. Two-month-old rats were injected with unsorted CPP microaggregates derived from the WA09 human embryonic stem cell line treated with DMSO (Figure 17A) or CPP microaggregates treated with 250 ng / mL MMC (Figure 17B) and followed for 3 months. Eyes were collected for histological examination. Age-matched, uninjected Foxn1-S334ter rat eyes served as controls (Figure 17C). Scale bar: 50 μm. DETAILED DESCRIPTION OF THE INVENTION
[0013] For the purposes of illustrating and understanding the principles of the present disclosure, reference will be made to embodiments and specific terminology used to describe the present disclosure. Those skilled in the art will nevertheless understand that no limitation of the scope of the present disclosure is thereby intended, and such variations and further modifications of the present disclosure as exemplified herein are contemplated as would be understood by those skilled in the art to which the present disclosure pertains.
[0014] definition As used herein, the articles "a" and "an" refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. For example, "an element" means at least one element and can include two or more elements. "About" is used to provide flexibility at the endpoints of a numerical range by providing that a given value can be "slightly above" or "slightly below" the endpoint without affecting the therapeutically beneficial result. The term "about" in connection with a numerical value means that the numerical value can vary by less than plus or minus 5% of the numerical value. Throughout this specification, unless the context otherwise requires, the words "comprise" and "include" and variations (e.g., "comprises," "comprising," "includes," "including") will be understood to mean the inclusion of the stated component, feature, element or step or group of components, features, elements or steps, but not the exclusion of any other integer or step or group of integers or steps. As used herein, "and / or" refers to and includes any and all possible combinations of one or more of the associated listed items, and when interpreted as an alternative ("or"), refers to and includes no combinations.
[0015] Unless otherwise indicated herein, the recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each individual value falling within the range. Furthermore, each separate value is incorporated herein as if it were individually recited herein. For example, if a range is recited as 1 to 50, values such as 2 to 4, 10 to 30, or 1 to 3, etc. are intended to be expressly recited in the disclosure. These are merely examples of values specifically intended, and all possible combinations of numerical values between and including the lowest and highest values recited should be considered to be expressly recited within the disclosure. Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The term "express" or "expression" refers to the transcription and translation of a nucleic acid coding sequence, resulting in the production of the encoded polypeptide. "Express" or "expression" also refers to an antigen being expressed on the cell surface. As used herein, the term "subject" refers to humans and non-human animals. The term "non-human animal" in the present disclosure includes all vertebrates, e.g., mammals and non-mammals, such as non-human primates, sheep, dogs, cats, horses, cows, chickens, amphibians, reptiles, etc. A subject can be a human patient at risk for or suffering from one or more retinal diseases or disorders. A human subject can be of any age (e.g., infant, child, or adult).
[0016] The term "construct" refers to an artificially designed segment of DNA that can be used to introduce genetic material into a target cell. The term "sequence identity" refers to the number of identical or similar nucleotide bases in a comparison between a test and a reference oligonucleotide or nucleotide sequence. Sequence identity can be determined by aligning a first nucleic acid sequence to a second nucleic acid sequence to identify regions of similarity or identity. As described herein, sequence identity is generally determined by alignment to identify identical residues. Matches, mismatches, and gaps can be identified between the compared sequences by techniques known to those of skill in the art. Alternatively, sequence identity can be determined without taking gaps into account as the number of identical positions / length of the entire aligned sequence multiplied by 100. In one embodiment, the term "at least 90% sequence identity" refers to a percent identity of 90-100% compared to the reference nucleotide sequence. A level of identity of 90% or greater indicates that, for typical purposes, 100% or fewer of the nucleotides in the test oligonucleotide (i.e., 10 out of 100) differ from the reference oligonucleotide, assuming test and reference polynucleotide sequences 100 nucleotides in length are being compared. Differences are defined as nucleic acid substitutions, insertions or deletions.
[0017] As used herein, the term "enriched" refers to a population of cells of a particular cell type (e.g., cone photoreceptor cells) that has been isolated or sorted from a mixed cell population. As used herein, the term "physiological response" refers to any response related to the survival and function of cone photoreceptors in response to a stimulus, including, but not limited to, effects on light detection, metabolism, signal transduction, and cone survival. As used herein, the term "red / green cone photoreceptor precursors (CPPs)" refers to a transient, early [before day (d) of differentiation] population of recent mitotic red / green cone photoreceptors that express thyroid hormone receptor beta 2 (THRB2) and do not express neural retina-specific leucine zipper protein (NRL). As used herein, the term "cell surface marker" refers to a protein expressed on the cell surface of a particular cell type or a carbohydrate associated with the cell membrane of a particular cell type, whose expression allows for the identification of cells expressing the marker. As used herein, the term "cell surface marker sorting technique" refers to any method for separating cells expressing a specific cell surface marker from cells lacking expression of that cell surface marker.
[0018] In some embodiments, cell surface marker sorting techniques include, but are not limited to, fluorescence activated cell sorting (FACS), magnetic activated cell sorting (MACS), immunoprecipitation, immunodensity cell isolation, and centrifugation. In certain embodiments, the cell surface marker sorting technique is FACS or MACS. As used herein, the term "reporter line" or "reporter cell line" refers to a cell line that can be used to visualize, track, and sort cells in real time. As used herein, the term "blocking solution" refers to any solution consisting of a protein or compound or mixture of proteins or compounds that passively adsorbs to non-targeted binding surfaces in a sample being subjected to immunocytochemistry (ICC), thus reducing or eliminating non-specific background signals. In addition to preventing or blocking background interference (e.g., cellular autofluorescence or endogenous non-specific enzymatic activity), blocking solutions prevent non-specific binding of primary and secondary antibodies. In some embodiments, CPPs are identified by the expression of cell surface markers in three-dimensional (3D) retinal organoids.
[0019] In some embodiments, the 3D retinal organoids are derived from stem cells. In some embodiments, the stem cells are induced pluripotent stem cells (iPSCs) or human embryonic stem cells (hESCs). In a further embodiment, the 3D retinal organoids are labeled with a detectable label. As used herein, the terms "detectable label" and "detectably labeled" are intended to encompass molecules that can be detected because they have physical properties, including but not limited to, fluorescence when illuminated with a particular wavelength, because they have a particular color when illuminated with light within the visible spectrum, or because they have magnetic properties that respond to a magnetic field. In some embodiments, the detectable label is a fluorescent protein. In some embodiments, the fluorescent protein is a red fluorescent protein (RFP). In an exemplary embodiment, the RFP is tdTomato. In other embodiments, the fluorescent protein is green fluorescent protein (GFP). In some embodiments, the fluorescent protein is regulated by a promoter. In some embodiments, the promoter is the human thyroid hormone receptor beta gene (THRB2) promoter.
[0020] In certain embodiments, the promoter is the neural retina-specific leucine zipper gene (NRL) promoter. In a further embodiment, expression of GFP under the NRL promoter indicates rod precursors. In yet a further embodiment, tdTomato expressed under the THRB2 promoter represents a red / green cone precursor. In some embodiments, RNAseq analysis is used to detect cell surface markers in red / green cone precursors. In an exemplary embodiment, the cell surface marker is ALCAM / CD166, which is transiently expressed in red / green CPP cells. As used herein, the term "positively selected" refers to CD166+ CPP cells being retained in a column using MACS using the disclosed methods. As used herein, the term "negative selection" refers to CPP cells that are sorted using MACS to remove non-CPP cells; CPP cells are not retained in the column using the disclosed methods. Generally, CPP cells remain in the flow-through eluate after MACS. An enriched population of red / green CPP cells can be obtained by positive MACS sorting, negative MACS sorting, or a combination of negative and positive MACS sorting.
[0021] As used herein, the term "specific binding agent" is intended to encompass any molecule that specifically binds to ALCAM / CD166, ITGA6 / CD49f, TNFRSF10B / CD262, NGFR / CD271, or a combination thereof. In typical embodiments, the specificity of such molecules is sufficient to have low, minimal, or no binding specificity for other molecules expressed on the cell surface of cells in a mixture containing cells expressing cell surface ALCAM / CD166, ITGA6 / CD49f, TNFRSF10B / CD262, NGFR / CD271, or a combination thereof. In certain embodiments, the present invention provides methods for using an agent that specifically binds to ALCAM / CD166, ITGA6 / CD49f, TNFRSF10B / CD262, NGFR / CD271, or a combination thereof, where the agent is an antibody or antigen-binding fragment thereof of ALCAM / CD166, ITGA6 / CD49f, TNFRSF10B / CD262, NGFR / CD271, or a combination thereof. The antibodies can be produced as monoclonal antibodies prepared by immunizing animals, as understood by those skilled in the art, or by recombinant genetic methods. In certain embodiments, antibodies to ALCAM / CD166, ITGA6 / CD49f, TNFRSF10B / CD262, NGFR / CD271, or combinations thereof, or antigen-binding fragments thereof to ALCAM / CD166, ITGA6 / CD49f, TNFRSF10B / CD262, NGFR / CD271, or combinations thereof, are commercially available (e.g., Miltenyi Biotec, catalog number: 130-126-100 and BioLegend, catalog number: 343902).
[0022] In certain embodiments, the specific binding agent is detectably labeled as disclosed herein. In further embodiments, the specific binding agent is an antibody or antigen-binding fragment thereof that specifically binds to ALCAM / CD166. In an exemplary embodiment, cells expressing ALCAM / CD166 are contacted with a specific binding agent that specifically binds to ALCAM / CD166 expressed on the cell surface. In a further embodiment, ALCAM / CD166 positive cells are selected by using cell surface marker sorting techniques. In a typical embodiment, CPP cells are positively selected and purified from a mixed population of retinal cells by magnetic-activated cell sorting (MACS). A population of human red / green CPP cells expresses ALCAM / CD166 on the cell surface. Purified ALCAM / CD166-positive (ALCAM / CD166+) CPP cells can be used in transplantation therapy to treat cone-specific retinal (or macular) diseases, and the cells are more plastic than mature cells.
[0023] In some embodiments, cells are positively or negatively sorted using one or more detectably labeled binding agents, which may be antibodies or antigen-binding fragments. In an exemplary embodiment, the population of cells comprises CPP cells that can be positively selected using a CD166-specific antibody. These sorted populations contain two components: a CD166+ component and a CD166-negative component that also expresses at least one of three other cell surface markers that are not expressed by CD166+ cells. In some embodiments, the specific binding agent is an antibody or antigen-binding fragment thereof that specifically binds to ALCAM / CD166. In some embodiments, the binding agent specifically binds to ITGA6 / CD49f, TNFRSF10B / CD262, NGFR / CD271, or a combination thereof. In some embodiments, the antibody is one or more biotin-conjugated antibodies selected from ITGA6 / CD49f, TNFRSF10B / CD262, NGFR / CD271, or combinations thereof. In a further embodiment, ITGA6 / CD49f negative, TNFRSF10B / CD262 negative, NGFR / CD271 negative cells or a combination thereof are negatively selected.
[0024] In some embodiments, ITGA6 / CD49f-negative, TNFRSF10B / CD262-negative, NGFR / CD271-negative cells, or a combination thereof, are incubated with anti-biotin microbeads. The cells can be sorted by MACS. In some embodiments, ITGA6 / CD49f-negative, TNFRSF10B / CD262-negative, NGFR / CD271-negative cells, or a combination thereof, and ITGA6 / CD49f-positive, TNFRSF10B / CD262-positive, NGFR / CD271-positive cells, or a combination thereof, are separated into fractions. Thus, CPPs can be sorted to obtain an enriched population of cells using magnetic microbeads conjugated to at least one of three cell surface markers not expressed in CPP cells, and ITGA6 / CD49f-positive, TNFRSF10B / CD262-positive, NGFR / CD271-positive cells, or a combination thereof, are retained in the column but not in the flow-through.
[0025] In some embodiments, the population of human red / green CPP cells does not express ITGA6 / CD49f, TNFRSF10B / CD262, NGFR / CD271, or a combination thereof, on the cell surface. Purified ITGA6 / CD49f-negative, TNFRSF10B / CD262-negative, NGFR / CD271-negative cells, or a combination thereof, can be used in transplantation therapy to treat cone-specific retinal (or macular) diseases, and the cells are more plastic than mature cells. The term "microaggregates" refers to CPP microspheres formed on agarose microwells. In some embodiments, the microaggregates are obtained from a population of positively or negatively sorted CPP cells. ALCAM / CD166-positive, ITGA6 / CD49f-negative, TNFRSF10B / CD262-negative, NGFR / CD271-negative cells, or a combination thereof, may be seeded onto agarose microwells, among other options. In some embodiments, the ALCAM / CD166-positive, ITGA6 / CD49f-negative, TNFRSF10B / CD262-negative, NGFR / CD271-negative cells, or a combination thereof, are seeded for at least 24 hours.
[0026] In a further embodiment, at least one of ALCAM / CD166-positive, ITGA6 / CD49f-negative, TNFRSF10B / CD262-negative, NGFR / CD271-negative cells or a combination thereof are seeded onto agarose microwells. In still further embodiments, the seeding density is between 250 and 8000 cells / microwell. In some embodiments, the CPP microaggregates are treated with a cell proliferation inhibitor. In certain embodiments, the cell proliferation inhibitor is mitomycin C. In a further embodiment, the CPP microaggregates are incubated in 3D retinal differentiation medium (RDM) containing a cell proliferation inhibitor. In some embodiments, the microaggregates are incubated for 24 to 72 hours. CPPs result in better and more stable photoreceptor layer remodeling and integration after transplantation. Furthermore, CPPs have optimal plasticity compared to more mature cones [Rempel et al., 2022, Cell Rep. 39(7):110827]. CPPs can also be used for in vitro studies.
[0027] In some embodiments, a therapeutic agent for treating a red / green cone photoreceptor disease or disorder in an animal is identified by contacting a population of human red / green CPP cells with one or more drug candidates and detecting a physiological response thereto. In some embodiments, the therapeutic agent treats a disease or disorder, where the disease or disorder affects the red / green cone-rich macula. In exemplary embodiments, the disease or disorder is any disease or disorder that results in the degeneration or death of the red / green cones-rich macula, including, but not limited to, age-related macular degeneration, Best's disease, Stargardt's disease, myopic degeneration, cone-rod dystrophy, retinal detachment of the macular detachment, laser injury, retinopathy, chloroquine or hydroxychloroquine toxicity, or any other macular disease, injury, or toxin-induced cone dysfunction or degeneration. Various illustrative embodiments of the compositions and methods described herein will now be described in the following non-limiting examples. The examples are provided for illustrative purposes only and are not intended to limit the scope of the invention in any way. Indeed, various modifications of the invention, in addition to those shown and described herein, will become apparent to those skilled in the art from the foregoing description and examples below and fall within the scope of the appended claims. [Example]
[0028] The examples described herein integrate and utilize certain experimental and preliminary methods and techniques that have been preformed as exemplified herein. Example 1 Generation of cone-rod reporter (CRR) cell lines A reporter cell line, NRL-eGFP, was created as described in Phillips and Capowski et al. [2018 Sci Rep. 8(1): 2370]. Briefly, the eGFP gene (SEQ ID NO: 2) was amplified from Addgene plasmid 80945 by polymerase chain reaction (PCR) and introduced into cellular genomic DNA by CRISPR-Cas9-based gene editing, replacing the original NRL gene under the control of the NRL promoter. The cone-rod reporter (CRR) strain was created by adding another fluorescent reporter (tdTomato) to the NRL-reporter strain. Briefly, the tdTomato gene (SEQ ID NO: 4), excluding the stop codon, was amplified by PCR from pCAG-tdTomato (Addgene 83029), and a P2A sequence (a self-cleaving viral DNA element) was added to the 3' end. The resulting tdTomato-P2A construct was then fused in-frame to the THRB2 start codon (illustrated in Figure 3). The purpose of the CRR strain was to track red / green cone and rod photoreceptors in real time during differentiation into live organoids. This strain also allowed for the separate purification of red / green cone and rod cells for bulk RNA-seq performed at two different time periods: 50 days (D50) and 100 days (D100).
[0029] Differentiation of hPSC retinal organoids CRR line-derived stem cells were cultured and differentiated into retinal organoids using a previously published protocol (Capowski et al., 2019, Develop. 146: dev171868). Briefly, pluripotent stem cell colonies were detached from cell culture plates and allowed to form embryoid bodies (EBs). EBs were transferred from mTeSR plus to neural induction medium [NIM; DMEM:F12 1:1, 1% N2 supplement, 1x MEM non-essential amino acids (MEM NEAA), 1x GlutaMAX (Thermo Fisher Scientific), and 2 μg / mL heparin (Sigma)] for 4 days. On day 6 (D), 0.75 nM BMP4 (R&D Systems) was added to fresh NIM. One day later, EBs were plated on Matrigel at a density of 200 EBs per well in a 6-well plate. Half of the medium was replaced with fresh NIM on D9, D12, and D15, and the medium was replaced with retinal differentiation medium [RDM; DMEM:F12 3:1, 2% B27 supplement, MEM NEAA, 1x antibiotic-antimycotic (Thermo Fisher), and 1x GlutaMAX] on D16. From D25 to D30, optic vesicle-like colonies became visually distinct by bright-field microscopy and were dissected using an MSP ophthalmic knife (Surgical Specialties Corporation). The resulting free-floating retinal organoids were maintained in polyHEMA-coated flasks (Sigma polyHEMA) with 3D-RDM [DMEM:F12 3:1, 2% B27 supplement, 1x MEM NEAA, 1x antibiotic-antimycotic, and 5% FBS containing 1x GlutaMAX, 100 μM taurine, and 1:1000 chemically defined lipid supplement (product number 11905031, Thermo Fisher Scientific)], with feeding twice weekly. Live retinal organoid cultures were imaged using a Nikon Ts2-FL microscope equipped with a DS-Fi3 camera or a Nikon Ts100 microscope equipped with a QImaging CE CCD camera. CRR retinal organoids began to exhibit THRB2-tdTomato fluorescence in early red / green cone photoreceptor precursor cells at approximately day 40 and NRL-eGFP fluorescence in rod photoreceptors at approximately day 70. Figure 4A shows a D50 CRR retinal organoid containing THRB2-tdTomato-positive CPP cells.Figure 4B shows a D100 CRR retinal organoid containing THRB2-tdTomato-positive red / green cone cells and NRL-eGFP-positive rod cells.
[0030] Bulk RNA sequencing and data processing CRR retinal organoids were dissociated into single cells using papain (Worthington Biochemical papain dissociation system) on a BD FACSAria (1) housed in a biological safety cabinet and sorted into THRB2-tdTomato-negative (D50-N) non-photoreceptor and THRB2-tdTomato-positive red / green cone progenitors (D50 Th-C) at day 50 (i.e., D50), and into THRB2-tdTomato-negative / eGFP-negative non-photoreceptor cells (D100-N), THRB2-tdTomato-positive red / green cone cells (D100 Th-C), and NRL-eGFP-positive rod cells (D100 R) at day 100. RNA was isolated from each sample using the RNAeasy mini spin kit (Qiagen) according to the manufacturer's instructions, and sequencing libraries were prepared using the Illumina TruSeq Stranded Total RNA Library Prep kit for humans. Libraries were sequenced on a NovaSeq6000, collecting 30 million 2 × 150 nucleotide (nt) reads for each sample. Bioinformatics analysis of transcriptome data followed the recommended ENCODE guidelines and best practices for RNA-Seq (Encode Consortium, 2016). Alignment of adapter-trimmed (Skewer v0.1.123; Jiang et al., 2014, Sci Rep 4: 7175) 2 × 150 bp (paired-end; PE) strand-specific Illumina reads to the Homo sapiens GRCh38.p10 genome (assembly accession NCBI: GCA 000001405.25) was achieved with Spliced Transcripts Alignment to a Reference (STAR v2.5.3a) software (Dobin et al., 2013, Bioinformatics 29: 15-21).Expression estimation was performed using RSEM v1.3.0 (RNASeq by Expectation Maximization; Li and Dewey, 2011, BMC Bioinformatics 12: 323). To test for differential gene expression between individual group contrasts, expected read counts obtained from RSEM were used as input into edgeR (v3.16.5; Robinson et al., 2010, Bioinformatics 26: 139-40). Inter-sample normalization was achieved using the trimmed mean M-value (TMM; Robinson and Oshlack, 2010, Genome Biol. 11: R25) method. Statistical significance of negative binomial regression tests was adjusted using the Benjamini-Hochberg FDR correction at the 5% level (Reiner, Yekutieli, and Benjamini 2003, Bioinformatics 19: 368-375). Prior to statistical analysis with edgeR, independent filtering was applied, requiring genes to have a counts per million (CPM) higher than k in n samples, where k is determined by the minimum read count (10 reads) and the size of the sample library, and n is determined by the number of biological replicates in each group. The validity of the Benjamini-Hochberg FDR multiple testing procedure was assessed by inspection of the uncorrected p-value distribution.
[0031] Example 2 RNA-Seq analysis to identify surface markers A list of genes with significant differential expression between two given samples was obtained by retaining only genes with a minimum 1.5-fold change (either up- or down-regulated) and a false discovery rate (FDR) of less than 0.0001. The 313 genes (illustrated in Figures 5 and 6A) that were up-regulated only in D50 Th-C (red / green CPPs) were further analyzed by gene set enrichment analysis (GSEA) to identify gene families, including cell differentiation (CD) markers. Figure 6B shows CD markers (including ALCAM, also known as ALCAM / CD166) extracted from the 313 genes. Figure 12 shows a list of CD markers that can be used for negative selection of early red / green CPPs.
[0032] Example 3 Retinal organoid (RO) immunohistochemistry (IHC) Retinal organoids were fixed in 4% paraformaldehyde (Electron Microscopy Sciences) at room temperature (RT) for 1 hour with gentle agitation, washed with 1x PBS, cryopreserved in 15% sucrose in PBS for 40 minutes, and then equilibrated in 30% sucrose for 40 minutes. After equilibration, the retinal organoids were immediately flash-frozen and then cryosectioned at 15 μm thickness. The cryosections were blocked in blocking solution (10% normal donkey serum, 5% BSA, and 0.5% Triton X-100 in 1x PBS) for 1 hour at room temperature and then incubated overnight at 4°C with a primary antibody (e.g., anti-ALCAM / CD166, BioLegend, Cat. No. 343902) prepared in blocking solution. After incubation, the cryosections were washed three times in phosphate-buffered saline (PBS) and then incubated with the appropriate fluorophore-conjugated secondary antibody prepared in blocking solution for 30 minutes at room temperature in the dark. Immunostained cryosections were then washed three times in PBS, mounted in Prolong Gold Antifade with DAPI (Thermo Fisher Scientific), and imaged using a Nikon A1 laser scanning confocal microscope equipped with NIS Elements AR 5.0 software. Figure 7 shows ALCAM / CD166 expression in individual cells of D50 WA09 retinal organoids (i.e., organoids without any fluorescent reporter). Figures 8 and 9 show that ALCAM / CD166-positive cells are present in D50 retinal organoids but not in D100 retinal organoids.
[0033] Example 4 Human red / green cones Photoreceptor precursor (CPP) isolation (i.e., positive MACS) Using ALCAM / CD166 as a selective cell surface marker for Colocalization of ALCAM / CD166 expression and tdTomato in D50 CRR retinal organoids was first confirmed by immunocytochemistry (ICC; see Figure 10). D50 CRR retinal organoids were then dissociated into single cells using 10x TrypLE select (Thermo Fisher Scientific). Dissociated cells were incubated with biotin-conjugated ALCAM / CD166 (Miltenyi Biotec, catalog number: 130-126-100) for 20 minutes at 4°C and then washed three times with MACS buffer containing 0.5% bovine serum albumin (BSA; Miltenyi Biotec). The cells were then incubated with anti-biotin microbeads and passed through an LS column (Miltenyi Biotec) placed on a magnetic stand. The ALCAM / CD166-negative fraction was collected. The column was then removed from the magnetic stand, and the remaining cells were washed off to obtain the ALCAM / CD166-positive fraction. This is referred to as positive MACS sorting. The percentage of tdTomato-positive cells in the unsorted, ALCAM / CD166-positive, and ALCAM / CD166-negative cell populations was then quantified using flow cytometry (Figures 11A-C).
[0034] Example 5 Negative MACS to enrich human red / green cone photoreceptor precursors (CPPs) Positive enrichment by MACS has the potential disadvantage that antibodies and magnetic particles remain bound to CPPs after sorting. An alternative approach is negative MACS, in which unwanted cell types (non-CPPs) are magnetically labeled so that they remain in the magnetic column, while the cells of interest (CPPs) flow through and are collected. Thus, the cells of interest (CPPs) separated by negative MACS are free of antibody and magnetic particle binding, making them a more desirable source for human transplantation. Cell surface proteins found to be present in non-CPPs are listed in Figure 12. Cell surface antibodies specifically selected for testing with negative MACS are boxed in Figure 12. D50-56 CRR retinal organoids were dissociated into single cells using 10x TrypLE select (Thermo Fisher). Dissociated cells were incubated with the following biotin-conjugated antibodies: ITGA6 / CD49f (Miltenyi Biotec, Cat. No. 130-123-243), used at a 1:50 dilution TNFRSF10B / CD262 (Miltenyi Biotec, Catalog No.: 130-097-303), used at a 1:11 dilution NGFR / CD271 (Miltenyi Biotec, Catalog No.: 130-112-608), used at a 1:50 dilution
[0035] The cells were incubated with either a single or combination of these for 20 minutes at 4°C. They were then washed three times with MACS buffer containing 0.5% bovine serum albumin (BSA; Miltenyi Biotec). The cells were then incubated with anti-biotin microbeads and passed through an LS column (Miltenyi Biotec) placed on a magnetic stand. The cells that flowed through the column were collected as the negative fraction. The percentage of tdTomato-positive cells in the unsorted, ALCAM / CD166-positive, and ALCAM / CD166-negative cell populations was then quantified using flow cytometry (Figures 13A and 14B).
[0036] Example 6 Formation of microaggregates from ALCAM / CD166-sorted CPPs Preliminary transplantation experiments with single-cell suspensions of fully dissociated ALCAM / CD166-selected CPPs in rats resulted in significant cell loss due to reflux during cell injection. Therefore, we investigated the option of culturing CPPs in the form of small aggregates, termed CPP microaggregates. To this end, agarose microwells were prepared using micromolds (microtissues, Inc.) according to the manufacturer's instructions. ALCAM / CD166-positive selected CPPs derived from D50 CRR / WA09 RO resuspended in 3D-RDM were seeded onto the agarose microwells (Figure 14). The seeding density varied from 250 to 8,000 cells / microwell. After 24 hours, the CPPs on the agarose microwells coalesced to form tiny spheres, termed CPP microaggregates. These CPP microaggregates were maintained on agarose microwells for 7-10 days before proceeding with immunohistochemistry (Figure 15) or flow cytometry (Figure 16). CPP microaggregates can be maintained on agarose microwells for up to 6 months (Figure 14i). Both untreated and DMSO control-treated CPP microaggregates increased in size due to proliferation as indicated by Ki-67 immunostaining (Figure 15ii-iii). At 7 dpt, there were very few Ki-67-positive cells in CPP microaggregates treated with 100 ng / mL MMC (Figure 15iv), whereas there were almost no Ki-67-positive cells in CPP microaggregates treated with 250 and 500 ng / mL MMC. There was significant disruption in the morphology of CPP microaggregates treated with 500 ng / mL MMC. Due to this disruption, 250 ng / mL was selected as the ideal concentration for further experiments. The methods disclosed herein for forming CPP microaggregates can be applied to both positively and negatively sorted cells.
[0037] Example 7 Mitomycin C (MMC) treatment of ALCAM / CD166-selected CPPs Immunohistochemistry of D7 CPP microaggregates (7 days after bead formation) revealed the presence of proliferating cells characterized by Ki-67 expression (Figure 15ii). Their presence is unfavorable for transplantation because they significantly proliferate and form large, disorganized grafts, gradually reducing the percentage of CPPs. To minimize non-CPP proliferation and maximize the localization and overall percentage of CPPs in subretinal transplants, CD166-sorted CPPs were treated with mitomycin C (MMC), a cell proliferation inhibitor. CPP microaggregates were maintained in 3D-RDM containing mitomycin C for 24–72 h, after which the CPP microaggregates were washed in 3D-RDM and maintained in 3D-RDM for an additional 4–11 days before immunohistochemistry (Figures 15iv–vi) or flow cytometry (Figure 16). Notably, the formation of CPP microaggregates in combination with MMC treatment increased the percentage of THRB2:tdTomato-positive red / green CPP cells from 17% to 89.5%. Both positively and negatively sorted CPP cells and microaggregates can be treated with mitomycin C to increase the CPP percentage.
[0038] Example 8 Transplantation of MMC-treated or untreated CPP microaggregates into the retina of 2-month-old S334ter rats To assess the ability of CPP microaggregates to survive and mature into the desired red / green cone cells in the host retina, CPP microaggregates were transplanted into the subretinal space of S334ter rats along with their respective controls. This immunodeficient rat model harbors a rhodopsin mutation that results in rapid rod photoreceptor loss and progressive cone loss, similar to that seen in patients with retinitis pigmentosa. For transplantation, beads derived from the WA09 non-fluorescent cell line were generated. Microaggregates from two conditions: 1) unsorted / DMSO-treated (control) and 2) CD166-positive sorted / MMC250-treated were collected from microwells and resuspended in balanced salt solution (BSS) at a concentration of 800 beads per microliter (250 cells per microaggregate, thus approximately 200,000 cells per microliter). S334ter rats (n=3) were anesthetized, and 2 μL of microaggregate suspension from each condition was transplanted into the subretinal space (SRS) per eye. Animals were sacrificed 3 months post-surgery (age 5 months) for IHC analysis (Figure 17).
[0039] Figure 17A shows that S334ter rat retinas transplanted with DMSO control-treated unsorted microaggregates showed significant expansion of transplanted human cells characterized by the human nuclear marker Ku80 (red). The grafts contained neural rosettes (white arrows) containing primarily rod photoreceptors (data not shown) and few red / green cone photoreceptors, characterized by the presence of M / L opsin+ cells (green). The grafts also contained a majority of Ki67+ proliferating cells and retinal progenitors (data not shown). Figure 17B shows that S334ter rat retinas transplanted with MMC-treated CPP microaggregates showed only slight expansion of transplanted human cells (Ku-80, red), consisting primarily of cones. The grafts did not form neural rosettes, indicating enhanced integration of transplanted human cells (Ku-80, red) in the host retina (DAPI-positive / Ku80-negative cells). The transplanted cells developed primarily into mature red / green cones characterized by expression of M / L opsin (see Figure 17B', enlarged image). Rod photoreceptors were largely absent (data not shown). Figure 17C shows that the retinas of uninjected age-matched (5-month-old) S334ter rats are thinned due to loss of the outer nuclear layer (i.e., the layer containing photoreceptors) caused by the underlying photoreceptor degeneration disease due to a rhodopsin mutation. M / L opsin immunostaining in uninjected control retinas demonstrated an almost complete absence of host M / L cone photoreceptors in 5-month-old S334ter rats (very few disorganized cones remained at this time point).
[0040] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, and patent application was specifically and individually indicated to be incorporated by reference. While certain embodiments have been illustrated and described in detail in the accompanying drawings and the foregoing description, such illustration and description should be considered as illustrative and not restrictive. Other variations to the disclosed embodiments can be understood and implemented in practicing the claims, from a study of the drawings, the disclosure, and the appended claims. The mere fact that certain measures or features are recited in mutually different dependent claims does not indicate that a combination of these measures or features cannot be used. Any reference signs in the claims should not be construed as limiting their scope.
[0041] Sequence Listing Endogenous sequence encompassing the intron 1 / exon 2 junction of the NRL gene [lowercase - intron 1, uppercase - exon 2, translation start site (TSS) underlined]: (SEQ ID NO: 1) aagggaaaacgggtcagaagggtgaaggtgatctgccaagttcacacaacgtaacaagttctgaatagaaggaaaatcaatcttggtctgttccccttggagagactggccttgaggaaagatggtggccagttgattctgatctttctagaactaattctaggacctttcttttttccatataaagcctcttgcccctacaaaagggattcattgattgattaatccatagaacaaatgtacactgagggtcttctataggcaaggcacttccctgagtgctttgagagacagagagctataagaacacattatccttggctcttaaaattcacagcatacatgccttcccactgtcctaaaatatacactcactttgtcacagttaattaagcaatttaaaaaaatggcttggaaatggaatgatgcctcttgagatgacagacctctcggcatgtctcagcactagggttgggagcactgccatactgctcttgcttttcatagatcctgaggcatcagtggggcgagaggctgtgctgtcctcttcctccttcaggaattcagctgcttgtcccctgtcaggagcccctgccctctgaaaggttactcttcagcctggtggggactctgcagtgaacagagctgcaccatccctctggctttcccaaactcttgctccagggcacttgggctttgagggaagagggacttggtgaagaggggatggcaggtggcctccatgtgctccagacctctcctcctctttgcagGTGCACTCCTCCCAGCCCAGCTCCAGA ATGGCCCTGCCCCCCAGCCCCCTGGCCATGGAATATGTCAATGACTTTGACTTGATGAAGTTTGAGGTAAAGCGGGAACCCTCTGAGGGCCGACCTGGCCCCCCTACAGCCTCACTGGGCTCCACACCTTACAGCTCAGTGCCTCCTTCACCCACCTTCAGTGAACCAGGCATGGTGGGGGCAACCGAGGGCACCCGGCCAGGCCTGGAGGAGCTGTACTGGCTGGCTACCCTGCAGCAGCAGCTGGGGGCTGGGGAGGCATTGGGGCTGAGTCCTGAAGAGGCCATGGAGCTGCTGCAGGGTCAGGGCCCAGTCCCTGTTGATGGGCCCCATGGCTACTACCCAGGGAGCCCAGAGGAGACAGGAGCCCAGCACGTCCAG
[0042] eGFP sequence (SEQ ID NO: 2): ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACC CTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTG GTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCC GACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA
[0043] Endogenous sequence encompassing the 5'UTR / exon 1 junction of the THRB2 gene [lowercase - 5'UTR, uppercase - exon 1, transcription start site (TSS) underlined]: (SEQ ID NO: 3) attcaacaacagattcaaccaccaatatttgcacagctagattaatgttttggagtcagtcagtcatcaggctcattactactggattttctctggttcatgctaataaactagattattgattttaggattttctttgtatccaaggatattctctaagatgtctttataatgtttcatgcttaagctgtcaaccaaaatgacataacaatgagtaatcgttttataatcatgttgaaaggggttaaaaacagcatataaaatgcatcttagcagcttcagagtaacattctcgctgtcacttccctatctgggtggaggtcattcctacctgcctgccatcttccccaggaattaactagctgcatgcacagcttaagacctttgatagtcataaatctgctttccaatatgtttggatggCAGAAGAGCTCAAAAGACACCTCGGTCTAAATAGGATTTTAGCACATCAGGTGCTATTACAAAGTAAAGCAGGCTGGGTTGCTGTGTTGGTGGTGGTGTTTATTCATCTTCCCTTCGCGTTTCATGTGTATGTATGTATGCTTCTCTGCGTATATGCCCAGCTCTCAGGGTGTATGGGGCTGGAGAATGCATGCGTAGACTGTGTGTATATGTAAACTAGAAACTGAACCAGGGAAACAAA ATGAACTACTGTATGCAAGAAATATATGAAGTGCACCCAGCTGCCGGCAGCAATTGCTACATGCAGTCCACTGATTATTACGCGTATTTTGAAGATAGTCCGGGTTACAGCGTTGCGATGCTCAGGCTGTGCCCAGTAACAACATATATATGGAACAGGCCTGGGCAGTGAATCAGCCTTATACCTGTAGTTACCCTGGAAACATGTTTAAAAGCAAGGACTCTGACTTGGACATGGCCCTGAATCAATACAGCCAACCTGAATATTTCAGGAAAAGCCTACTTTTTCTCAAGTGCAGTCGCCATCGTATTCTCAAAAAAAG
[0044] tdTomato sequence(sequence number4):
Claims
1. A method for obtaining an enriched population of human red / green cone photoreceptor precursor (CPP) cells, comprising sorting a mixed population of retinal cells that have been contacted with a detectably labeled binding agent that specifically binds to ALCAM / CD166 expressed on the cell surface.
2. 2. The method of claim 1, wherein the cells are contacted with the detectably labeled binding agent specific for ALCAM / CD166 before or during sorting.
3. The method of claim 2 , wherein the specific binding agent is an antibody or an antigen-binding fragment thereof that specifically binds to ALCAM / CD166.
4. The method of claim 2 or 3, wherein the ALCAM / CD166 positive cells are selected by using a cell surface marker sorting technique.
5. 4. The method of claim 2 or 3, wherein the detectable label is a fluorescent label.
6. 6. The method of claim 5, wherein the cells are sorted by fluorescence-activated cell sorting (FACS).
7. The method of claim 2 or 3, wherein the detectable label is a magnetic label.
8. 8. The method of claim 7, wherein the cells are sorted by magnetic activated cell sorting (MACS).
9. 9. A population of enriched human red / green cone photoreceptor precursor (CPP) cells, wherein the cells comprising said population express ALCAM / CD166 on the cell surface, and wherein said population is produced by the method of claims 1 to 8.
10. 10. A method for identifying a therapeutic agent specific for a retinal degenerative disease or disorder or retinal injury or toxicity, comprising contacting a population of red / green CPP cells described in claim 9 with one or more drug candidates and detecting a therapeutically beneficial physiological response thereto.
11. 11. The method of claim 10, wherein the disease or disorder involves the cone-rich macula, including but not limited to cone-rod dystrophy, macular detachment retinal detachment, laser injury, retinopathy, or chloroquine or hydroxychloroquine toxicity or other injury or toxicity.
12. 12. The method of claim 11, wherein the disease is age-related macular degeneration, myopic degeneration, Stargardt's disease, or Best's disease.
13. A method for treating a disease or disorder in human cone photoreceptor cells, comprising administering to an individual in need thereof a therapeutically effective amount of the therapeutic agent of claim 10.
14. 14. The method of claim 13, wherein the disease or disorder involves the cone-rich macula.
15. 14. The method of claim 13, wherein the disease or disorder is age-related macular degeneration, myopic degeneration, Stargardt's disease, Best's disease, cone-rod dystrophy, retinal detachment with macular detachment, laser injury, retinopathy, or chloroquine or hydroxychloroquine toxicity or other disease, injury or toxicity.
16. 1. A method for detecting red / green cone photoreceptor precursor (CPP) cells from three-dimensional (3D) retinal organoids based on cell surface expression of cell surface markers, comprising: obtaining the 3D retinal organoids from stem cells; the 3D retinal organoids comprise photoreceptor cells and other retinal cell types; The method, wherein the cell surface marker is ALCAM / CD166.
17. 17. The method of claim 16, wherein the stem cells are induced pluripotent stem cells (iPSCs) or human embryonic stem cells (hESCs).
18. 18. The method of claim 17, wherein the stem cells are iPSCs.
19. 18. The method of claim 17, wherein the stem cells are hESCs.
20. 20. The method of claim 18 or 19, wherein the stem cells are a dual reporter line.
21. 21. The method of claim 20, wherein the reporter strain comprises two fluorescent proteins.
22. 22. The method of claim 21, wherein one of the fluorescent proteins is a red fluorescent protein (RFP).
23. 23. The method of claim 22, wherein the RFP is tdTomato.
24. 22. The method of claim 21, wherein one of the fluorescent proteins is green fluorescent protein (GFP).
25. 22. The method of claim 21, wherein the fluorescent protein is encoded by a nucleotide sequence operably linked to a promoter.
26. 26. The method of claim 25, wherein the promoter is thyroid hormone receptor beta 2 (THRB2) protein.
27. 27. The method of claim 26, wherein the promoter is a neural retina-specific leucine zipper protein.
28. 27. The method of claim 26, wherein the fluorescence of proteins bound to the THRB2 promoter indicates red / green cone precursors.
29. 1. A method for obtaining an enriched population of red / green CPP cells, comprising sorting a mixed population of retinal cells that has been contacted with one or more detectably labeled binding agents that each specifically bind to ITGA6 / CD49f, TNFRSF10B / CD262, NGFR / CD271, or a combination thereof, expressed on the cell surface, and sorting to obtain ITGA6 / CD49f-negative, TNFRSF10B / CD262-negative, NGFR / CD271-negative cells, or a combination thereof.
30. 30. The method of claim 29, wherein the specific binding agents are antibodies or antigen-binding fragments thereof that specifically bind to ITGA6 / CD49f, TNFRSF10B / CD262, NGFR / CD271, or a combination thereof, respectively.
31. 31. The method of claim 30, wherein the antibody is one or more biotin-conjugated antibodies.
32. 32. The method of claim 31, wherein the biotin-conjugated antibody is one or more of ITGA6 / CD49f, TNFRSF10B / CD262, NGFR / CD271, or a combination thereof.
33. 33. The method of claim 32, wherein the cells are incubated with the one or more biotin-conjugated antibodies.
34. 34. The method of claim 33, wherein the cells are further incubated with anti-biotin microbeads.
35. 35. The method of claim 34, wherein the cells are sorted by magnetic activated cell sorting (MACS).
36. 36. The method of claim 35, wherein the ITGA6 / CD49f-negative cells, TNFRSF10B / CD262-negative cells, NGFR / CD271-negative cells, or a combination thereof, and the ITGA6 / CD49f-positive cells, TNFRSF10B / CD262-positive cells, NGFR / CD271-positive cells, or a combination thereof, are separated into fractions.
37. 37. A population of human red / green CPP cells, wherein the cells comprising said population do not express one or more of ITGA6 / CD49f, TNFRSF10B / CD262, NGFR / CD271, or a combination thereof, on the cell surface, and wherein said population is produced by the method of claims 29 to 36.
38. 38. A method for identifying a therapeutic agent specific for a retinal degenerative disease or disorder or retinal injury or toxicity, comprising contacting a population of red / green CPP cells described in claim 37 with one or more drug candidates and detecting a therapeutically beneficial physiological response thereto.
39. 39. The method of claim 38, wherein the disease or disorder involves the cone-rich macula, including but not limited to cone-rod dystrophy, macular detachment retinal detachment, laser injury, retinopathy, or chloroquine or hydroxychloroquine toxicity or other injury or toxicity.
40. 40. The method of claim 39, wherein the disease is age-related macular degeneration, myopic degeneration, Stargardt's disease, or Best's disease.
41. 40. A method for treating a disease or disorder in human cone photoreceptor cells, comprising administering to an individual in need thereof a therapeutically effective amount of the therapeutic agent of claim 38.
42. 42. The method of claim 41, wherein the disease or disorder involves the cone-rich macula.
43. 43. The method of claim 42, wherein the disease or disorder is age-related macular degeneration, myopic degeneration, Stargardt's disease, Best's disease, cone-rod dystrophy, retinal detachment of the macular detachment, laser injury, retinopathy, or chloroquine or hydroxychloroquine toxicity or other disease, injury or toxicity.
44. 37. A method for obtaining microaggregates from a population of CPP cells produced by the method of claims 1 to 8 or 29 to 36, comprising the step of seeding at least one of ALCAM / CD166 positive cells, ITGA6 / CD49f negative cells, TNFRSF10B / CD262 negative cells, NGFR / CD271 negative cells, or a combination thereof, wherein the cells are seeded for at least 24 hours, and the cells are seeded at a seeding density.
45. 45. The method of claim 44, wherein the at least one ALCAM / CD166 positive cell, ITGA6 / CD49f negative cell, TNFRSF10B / CD262 negative cell, NGFR / CD271 negative cell, or a combination thereof is plated onto an agarose microwell.
46. 46. The method of claim 45, wherein the seeding density is 250 to 8000 cells / microwell.
47. 47. A method for obtaining CPP microaggregates for research use or transplantation purposes, comprising treating a population of CPP cells produced by the method of claims 44-46 with a cell proliferation inhibitor and incubating the CPP microaggregates for a period of time in a 3D-RDM containing said cell proliferation inhibitor, wherein after incubation the cells are washed in the 3D-RDM.
48. 48. The method of claim 47, wherein the cell proliferation inhibitor is mitomycin C.
49. 48. The method of claim 47, wherein the CPP microaggregates are incubated for 24 to 72 hours.