Phosphorus-containing compounds, pharmaceutical compositions, and their use
Novel phosphorus-containing compounds target the YAP/TAZ-TEAD complex to inhibit tumor activity, addressing safety and efficacy challenges in Hippo pathway treatments.
Patent Information
- Application Number
- JP2025524660
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-10-20
- Filing Date
- 2023-10-27
- Publication Date
- 2026-05-15
AI Technical Summary
Current treatments for tumors involving the Hippo signaling pathway, particularly those targeting the YAP/TAZ-TEAD protein complex, face challenges in achieving effective inhibition of oncogenic activity while maintaining safety and efficacy, as existing inhibitors may affect normal tissue homeostasis and have high toxicity.
Development of novel phosphorus-containing compounds that selectively inhibit the transcriptional activity of the YAP/TAZ-TEAD complex, offering improved physicochemical and pharmacokinetic properties, reduced toxicity, and fewer side effects.
The compounds effectively inhibit the oncogenic activity of the YAP/TAZ-TEAD complex, providing enhanced safety and efficacy in treating tumors with minimal impact on normal tissues.
Smart Images

Figure 2026515261000001_ABST
Abstract
Description
Detailed description of the invention
[0001] This application claims priority to Chinese patent application 202211328612.4, filed on 2022 / 10 / 27, and this application incorporates the full text of the aforementioned Chinese patent application.
[0002] This application claims priority to Chinese patent application 202310331481.3, filed on 2023 / 03 / 30, and this application incorporates the full text of the aforementioned Chinese patent application.
[0003] This application claims priority to Chinese patent application 202311368477.0, filed on 2023 / 10 / 20, and this application incorporates the full text of the aforementioned Chinese patent application.
[0004] This application claims priority to Chinese patent application 202311368432.3, filed on 2023 / 10 / 20, and this application incorporates the full text of the aforementioned Chinese patent application.
[0005] This application claims priority to Chinese patent application 202311368532.6, filed on 2023 / 10 / 20, and this application incorporates the full text of the aforementioned Chinese patent application.
[0006] [Technical Field] This invention relates to phosphorus-containing compounds, pharmaceutical compositions, and their uses.
[0007] [Background technology] The Hippo signaling pathway is a highly conserved cellular signaling pathway from Drosophila to mammals. Its major functions include regulating normal development, determining tissue and organ size ratios, maintaining the balance between cell proliferation and death, and preserving the stem cell properties of stem cells. The core elements of this signaling pathway mainly consist of (1) upstream signaling factors, (2) core kinase cascade reaction chains, and (3) downstream effector molecules. When activated by an upstream stimulator (e.g., cell contact inhibition), MST1 / 2 kinase and SAV1 are activated by interacting with the upstream regulator, resulting in phosphorylation. This phosphorylates MOB1A / B and LATS1 / 2, fully activating the LATS1 / 2 kinase complex. This complex further phosphorylates the transcriptional coactivator YAP / TAZ. The phosphorylated YAP / TAZ is blocked in the cytoplasm by the 14-3-3 protein and polyubiquitinated by the E3 ligase β-TrCP, which is then recognized and degraded by the proteasome. When the Hippo pathway is inhibited (e.g., by serum factor stimulation), unphosphorylated YAP / TAZ enters the cell nucleus and forms transcriptional complexes primarily with the TEAD protein family of transcription factors, thereby activating the transcription of downstream target genes (e.g., CTGF, FGF1, AMOTL2, and CYR61), promoting cell survival and proliferation. Simultaneously, this pathway can also regulate stem cell regeneration and differentiation, thereby contributing to tissue regeneration and wound healing. Therefore, under certain conditions, the YAP / TAZ-TEAD transcriptional complex functions as an oncogene, and the Hippo pathway plays a role in tumor inhibition.
[0008] Currently, inactivation or loss of upstream inhibitors of the Hippo signaling pathway, such as NF2, MST1 / 2, and LATS1 / 2, has been found in a variety of tumors, including but not limited to liver cancer, lung cancer, ovarian cancer, brain cancer, malignant mesothelioma, breast cancer, head and neck cancer, colorectal cancer, prostate cancer, and leukemia. Simultaneously, abnormal amplification of YAP / TAZ and TEAD family proteins has been found in various tumors, and numerous reports have identified TEAD family proteins as major mediators of YAP / TAZ's cancer-promoting capacity. Clinical studies suggest that YAP / TAZ amplification can be used as a biomarker for prognosis and diagnosis of various tumors.
[0009] Overactivation of YAP and TAZ is generally thought to regulate cell proliferation, migration, and apoptosis, be involved in tumor stem cell-associated regeneration and EMT (epithelial-mesenchymal transition) properties, and promote immunosuppressive effects for maintaining the tumor microenvironment, thereby mediating resistance of tumor cells to conventional chemotherapy, targeted therapy, and immunotherapy. Therefore, targeting the YAP / TAZ-TEAD protein complex is a very promising approach for treating various cancers involving functional alterations in this pathway.
[0010] The transcriptional complex formed by YAP / TAZ and TEAD is primarily maintained by three protein-protein interaction interfaces, where interfaces 2 and 3 are both crucial for the formation of this protein complex. Both interfaces possess the geometric properties necessary for small molecules to bind to the protein and lack pockets containing electrostatic enrichment. Recently, researchers discovered that the YAP-binding domain of the TEAD protein contains a pocket that binds to palmitic / myristic acid, and that palmitic acid molecules perform reversible palmitoyl modification of the TEAD protein at this site. Palmitoylation of the TEAD protein is important for its protein stability, as well as for the formation and transcriptional activity of the YAP / TAZ-TEAD transcriptional complex, and inhibition of TEAD family proteins does not significantly affect the homeostasis of adult tissues and organs. Therefore, by directly inhibiting palmitoylation of TEAD family proteins, the oncogenic activity of YAP / TAZ can be effectively inhibited, which may be useful in treating various tumors in which Hippo upstream genes are inactivated.
[0011] [Summary of the Invention] The present invention provides novel compounds that inhibit the transcriptional activity of one or more members of the Hippo pathway network, particularly the YAP / TAZ-TEAD protein complex. The compounds of the present invention also possess superior properties such as relatively good physicochemical properties (e.g., solubility, physical and / or chemical stability), improved pharmacokinetic properties (e.g., improved bioavailability, improved metabolic stability, appropriate half-life and duration of action), and improved safety (relatively low toxicity (e.g., reduced cardiotoxicity) and / or relatively few side effects).
[0012] The present invention provides compounds represented by formula I, pharmaceutically acceptable salts thereof, esters thereof, stereoisomers thereof, tautomers thereof, crystalline polymorphs thereof, solvates thereof, metabolites thereof, isotopic derivatives thereof, or prodrugs thereof.
[0013] [Chemical formula]
[0014] In the formula, R 1 and R 2 are independently a C1-C6 alkyl group, a C3-C6 cycloalkyl group or a C6-C 10 aryl group, or R 1 , R 2 form, together with the atoms to which they are attached, a 3- to 12-membered heterocycloalkyl group or a 3- to 12-membered heterocycloalkyl group substituted with one or more R 1-1 wherein the 3- to 12-membered heterocycloalkyl group further contains 0, 1, 2 or 3 heteroatoms selected from N, O and S, one, two or three heteroatoms, R 1-1 are independently C1-C6 alkyl groups, Ring B is a C3-C 12 saturated or unsaturated carbocyclic ring, "a 5- to 16-membered saturated or unsaturated heterocyclic ring in which the heteroatoms are one, two or three selected from N, O and S and the number of heteroatoms is 1, 2, 3, 4 or 5", Ring B is monocyclic or polycyclic. When ring B is monocyclic, ring B is an aromatic ring. When ring B is polycyclic,
[0015] [Chemical formula]
[0016] the ring linked to is an aromatic ring, and the remaining rings are saturated or unsaturated rings, m1 is 0 or 1, R 3 is "a 5- to 12-membered saturated or unsaturated heterocyclyl group in which the heteroatoms are one, two or three selected from N, O and S and the number of heteroatoms is 1, 2 or 3", one or more R 3-1A 5-12 member saturated or unsaturated heterocyclyl group with one, two, or three heteroatoms selected from N, O, and S, substituted with C6-C 10 An aryl group or one or more R groups 3-5 C6~C replaced by 10 It is an aryl group, R 3-1 and R 3-5 These are independently H, deuterium, halogen, C1-C6 alkyl group, C1-C6 alkoxy group, CN, and one or more R 3-2 A C1-C6 alkyl group substituted with, one or more R 3-3 C1-C6 alkoxy groups substituted with, "3-12 membered heterocycloalkyl groups with 1, 2, or 3 heteroatoms selected from N, O, and S", "5-12 membered heteroaryl groups with 1, 2, or 3 heteroatoms selected from N, O, and S", C(=O)NR c R d , C3-C6 cycloalkyl group, one or more R 3-4 A C3-C6 cycloalkyl group substituted with, R 3-2 and R 3-3 These are independently deuterium, halogen, OH, CN, C1-C6 alkoxy group, "one, two, or three heteroatoms selected from N, O, and S, and a 3-12 membered heterocycloalkyl group with one, two, or three heteroatoms", and C(=O)NR c R d or NR b C(=O)R a And, R 3-4 These are independently CN and C(=O)NR c R d Or C(=O)OR a And, m2 is 0, 1, 2, or 3. R 4These are independently oxo (=O), CN, halogen, C1-C6 alkyl group, C1-C6 haloalkyl group, C1-C6 alkoxy group, or C1-C6 haloalkoxy group. L is a single bond, -CR L1 R L2 -, -O-, -S-, -NR L3 -, -NR L3 CR L1 R L2 -, -CR L4 =CR L5 -,
[0017] [ka]
[0018] And, R L1 , R L2 and R L3 These are independently H, C1-C6 alkyl groups, or C3-C6 cycloalkyl groups. R L4 and R L5 These are independently H or C1-C6 alkyl groups. L 1 and L 2 These are independently -CH2-, -O-, -S-, or -NH-, Ring A is C3~C 12 A saturated or unsaturated carbon ring, "a 5-12 member saturated or unsaturated heterocycle with one, two, or three heteroatoms selected from N, O, and S," m3 is 0, 1, 2, or 3. R 5 These are independently SF5, halogens, C1-C6 alkyl groups, and one or more R 5-1 C1-C6 alkyl groups substituted with SR 5-2 , OR 5-3 , CN, S(=O)2R 5-4 , C(=O)R 5-5 , S(=O)2NR d R 5-6 , NR d R 5-6, C3-C6 cycloalkyl groups, or one or more R 5-7 A C3-C6 cycloalkyl group substituted with, R 5-1 These are independently a hydroxyl group, CN, or halogen. R 5-2 , R 5-3 , R 5-4 , R 5-6 These are independently H, C1-C6 haloalkyl groups, C1-C6 alkyl groups, C3-C6 cycloalkyl groups, or one or more R groups. 5-8 A C3-C6 cycloalkyl group substituted with, R 5-5 These are independently C1-C6 haloalkyl groups, H, C1-C6 alkyl groups, C1-C6 alkoxy groups, C1-C6 haloalkoxy groups, C3-C6 cycloalkyl groups, or one or more R 5-8 C3-C6 cycloalkyl groups substituted with NR d R 5-6 And, R 5-7 and R 5-8 These are independently halogens or C1-C6 haloalkyl groups. R a , R b , R c and R d These are independently H or C1-C6 alkyl groups.
[0019] In certain preferred embodiments of the present invention, certain groups in the compound represented by formula I above or its pharmaceutically acceptable salts, esters thereof, stereoisomers thereof, tautomers thereof, crystalline polymorphs thereof, solvates thereof, metabolites thereof, isotopic derivatives thereof, or prodrugs thereof are defined as follows, and any group not mentioned is the same as that described in any embodiment of the present invention (abbreviated as "in some embodiments"), R 5 These are independently C3-C6 cycloalkyl groups.
[0020] In some embodiments, R 1 and R 2These are independently C1-C6 alkyl groups, C3-C6 cycloalkyl groups, or C6-C 10 It is an aryl group, Alternatively, R 1 , R 2 These are 3-12 member heterocycloalkyl groups, or one or more R atoms, along with the atoms linked to them. 1-1 A 3- to 12-membered heterocycloalkyl group is formed by substitution with, where, in addition to the linked P atom, the above 3- to 12-membered heterocycloalkyl group further contains 0, 1, 2, or 3 heteroatoms selected from N, O, and S, one, two, or three types. R 1-1 These are independently C1-C6 alkyl groups, Ring B is C3~C 12 A saturated or unsaturated carbon ring, "a 5-16 member saturated or unsaturated heterocycle in which the heteroatoms are selected from N, O, and S (one, two, or three types), and the number of heteroatoms is 1, 2, 3, 4, or 5," Ring B is either monocyclic or polycyclic. If ring B is monocyclic, it is an aromatic ring. If ring B is polycyclic,
[0021] [ka]
[0022] The ring connected to it is an aromatic ring, and the remaining rings are saturated or unsaturated rings. m1 is either 0 or 1. R 3 "A 5-12 member saturated or unsaturated heterocyclyl group having one, two, or three heteroatoms selected from N, O, and S," and one or more R 3-1 A 5-12 member saturated or unsaturated heterocyclyl group with one, two, or three heteroatoms selected from N, O, and S, substituted with C6-C 10 An aryl group or one or more R groups 3-5replaced by C6~C 10 is an aryl group, R 3-1 and R 3-5 are independently H, deuterium, halogen, a C1~C6 alkyl group, a C1~C6 alkoxy group, CN, a C1~C6 alkyl group substituted with one or more R 3-2 a C1~C6 alkoxy group substituted with one or more R 3-3 a 3~12-member heterocycloalkyl group in which the heteroatom is one, two or three selected from N, O and S and the number of heteroatoms is one, two or three, a 5~12-member heteroaryl group in which the heteroatom is one, two or three selected from N, O and S and the number of heteroatoms is one, two or three, C(=O)NR c R d a C3~C6 cycloalkyl group, a C3~C6 cycloalkyl group substituted with one or more R 3-4 where R L2 -, -CR L4 =CR L5 -,
[0023] [ka]
[0024] And, R L1 , R L2 and R L3 These are independently H, C1-C6 alkyl groups, or C3-C6 cycloalkyl groups. R L4 and R L5 These are independently H or C1-C6 alkyl groups. L 1 and L 2 These are independently -CH2-, -O-, -S-, or -NH-, Ring A is C3~C 12 A saturated or unsaturated carbon ring, "a 5-12 member saturated or unsaturated heterocycle having 1, 2, or 3 heteroatoms selected from N, O, and S," m3 is 0, 1, 2, or 3. R 5 These are independently SF5, halogens, C1-C6 alkyl groups, and one or more R 5-1 C1-C6 alkyl groups substituted with SR 5-2 , OR 5-3 , CN, S(=O)2R 5-4 , C(=O)R 5-5 , S(=O)2NR d R 5-6 , NR d R 5-6 , or one or more R 5-7 A C3-C6 cycloalkyl group substituted with, R 5-1 These are independently a hydroxyl group, CN, or halogen. R 5-2 , R 5-3 , R 5-4 , R 5-6These are independently H, C1-C6 haloalkyl groups, C1-C6 alkyl groups, C3-C6 cycloalkyl groups, or one or more R groups. 5-8 A C3-C6 cycloalkyl group substituted with, R 5-5 These are independently C1-C6 haloalkyl groups, H, C1-C6 alkyl groups, C1-C6 alkoxy groups, C1-C6 haloalkoxy groups, C3-C6 cycloalkyl groups, or one or more R 5-8 C3-C6 cycloalkyl groups substituted with NR d R 5-6 And, R 5-7 and R 5-8 These are independently halogens or C1-C6 haloalkyl groups. R a , R b , R c and R d These are independently H or C1-C6 alkyl groups.
[0025] In some embodiments, the "halogen" is independently fluorine, chlorine, bromine, or iodine, preferably fluorine or chlorine, for example, F.
[0026] In some embodiments, the "C1-C6 alkyl group" is independently a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, or a tert-butyl group, preferably a methyl group or an ethyl group, such as a methyl group.
[0027] In some embodiments, the "C1-C6 alkoxy group" is independently a methoxy group, an ethoxy group, an n-propoxy group, an isopropoxy group, an n-butoxy group, an isobutoxy group, or a tert-butoxy group, preferably a methoxy group or an ethoxy group.
[0028] In some embodiments, the "C1-C6 haloalkyl group" is independently -CHF2, -CH2F, or -CF3, for example, -CF3.
[0029] In some embodiments, the above-mentioned "C1-C6 haloalkoxy groups" are each independently -OCHF2, -OCH2F, or -OCF3.
[0030] In some embodiments, the "C3-C6 cycloalkyl group" is independently a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, or a cyclohexyl group, preferably a cyclopropyl group or a cyclobutyl group, such as a cyclopropyl group.
[0031] In some embodiments, the above "C6~C 10 Each "aryl group" is independently a phenyl group or a naphthyl group, and is preferably a phenyl group.
[0032] In some embodiments, the above-mentioned "3- to 12-membered heterocycloalkyl group having one, two, or three heteroatoms selected from N, O, and S, and having one, two, or three heteroatoms" is independently a "5- to 6-membered heterocycloalkyl group having one or two heteroatoms selected from N and O, and having one or two heteroatoms."
[0033] In some embodiments, the above-mentioned "5-12 membered heteroaryl group having one, two, or three heteroatoms selected from N, O, and S, and having one, two, or three heteroatoms" is equivalent to "5-6 membered heteroaryl group having one, two, or three heteroatoms selected from N, O, and S, and having one, two, or three heteroatoms."
[0034] In some embodiments, ring B is defined as "C3~C" above. 12 A "saturated or unsaturated carbon ring" is C6~C 10 An unsaturated carbon ring, for example, a benzene ring, a naphthalene ring, or an indan ring, preferably C6-C6. 10 An aryl ring, for example, a benzene ring.
[0035] In some embodiments, ring B is defined as "a 5-16 member saturated or unsaturated heterocycle having 1, 2, 3, 4, or 5 heteroatoms, where the heteroatoms are selected from N, O, and S (one, two, or three types)," or "a 6-15 member unsaturated heterocycle having 1, 2, 3, 4, or 5 heteroatoms, where the heteroatoms are selected from N, O, and S (one, two, or three types), for example, a pyridine ring (for example,
[0036] [ka]
[0037] ), indole ring (for example,
[0038] [ka]
[0039] ), carbazole ring (for example,
[0040] [ka]
[0041] )
[0042] [ka]
[0043] That is the case.
[0044] In some embodiments, R 3 So, the above-mentioned "heterocyclyl group having 1, 2, or 3 heteroatoms selected from N, O, and S, and a 5-12 member saturated or unsaturated heterocyclyl group with 1, 2, or 3 heteroatoms" is equivalent to "heterocyclyl group having 1, 2, or 3 heteroatoms selected from N, O, and S, and a 5-10 member unsaturated heterocyclyl group with 1, 2, or 3 heteroatoms," for example, a pyrrolyl group (for example,
[0045] [ka]
[0046] ), pyrazolyl group (for example)
[0047] [ka]
[0048] ), imidazolyl group (for example,
[0049] [ka]
[0050] ), triazolyl group (for example)
[0051] [ka]
[0052] ), thiazolyl group (for example,
[0053] [ka]
[0054] ), oxazolyl group (for example,
[0055] [ka]
[0056] ), isoxazolyl group (for example,
[0057] [ka]
[0058] ), pyridyl group (for example,
[0059] [ka]
[0060] ), pyrimidinyl group (for example,
[0061] [ka]
[0062] ), pyrazinyl group (for example,
[0063] [ka]
[0064] ), pyridadinyl group (for example,
[0065] [ka]
[0066] ),
[0067] [ka]
[0068] And, for example, an imidazolyl group (for example,
[0069] [ka]
[0070] ), pyrazolyl group (for example,
[0071] [ka]
[0072] )
[0073] [Chem.]
[0074] , a pyridyl group (e.g., [[ID=!17]]
[0075] [Chem.]
[0076] ) or a pyrimidinyl group (e.g.,
[0077] [Chem.]
[0078] ).
[0079] In some embodiments, in Ring A, the above-mentioned "C3-C 12 saturated or unsaturated carbocyclic ring" is a C4-C 10 saturated or unsaturated carbocyclic ring, such as a cyclobutane ring (e.g., !
[0080] [Chem.]
[0081] ), a cyclohexane ring (e.g.,
[0082] [Chem.] [[ID=6!6]]
[0083] ), spiro[2.5]octane (e.g.,
[0084] [Chem.] It should be noted that there seems to be some incorrect or incomplete information in the original text (such as the "!17" and "!66" marked). This translation is based on the best understanding of the provided content.
[0085] ) a spiro[3.3]heptane ring (for example,
[0086] [Chemical Formula]
[0087] ) a benzene ring (for example,
[0088] [Chemical Formula]
[0089] ) a naphthalene ring (for example,
[0090] [Chemical Formula]
[0091] ) an indane ring or a tetralin ring, and for example, C4-C 10 a saturated carbon ring or C6-C 10 an aryl ring, preferably C6-C 10 an aryl ring, more preferably a cyclobutane ring (for example,
[0092] [Chemical Formula]
[0093] [[ID=5८]]) a cyclohexane ring (for example,
[0094] [Chemical Formula]
[0095] ) a spiro[3.3]heptane ring (for example,
[0096] [Chemical Formula]
[0097] ), benzene ring (for example,
[0098] [ka]
[0099] ), naphthalene ring (for example,
[0100] [ka]
[0101] ), indene ring or tetralin ring, more preferably C6-C 10 It is an allure ring.
[0102] In some embodiments, ring A is defined as "C3~C 12 A "saturated or unsaturated carbon ring" is a cyclohexane ring (for example,
[0103] [ka]
[0104] ) or a benzene ring (for example,
[0105] [ka]
[0106] )
[0107] In some embodiments, ring A is defined as a "5-12 member saturated or unsaturated heterocycle having 1, 2, or 3 heteroatoms selected from N, O, and S" (e.g., a 5-10 member saturated or unsaturated heterocycle), or a "5-6 member monocyclic heteroaryl ring or a 9-10 member bicyclic heterocycle having 1, 2, or 3 heteroatoms selected from N, O, and S", for example, a benzoxapentane ring (e.g.,
[0108] [ka]
[0109] ), pyridine ring (for example,
[0110] [ka]
[0111] ) or thiophene ring (for example,
[0112] [ka]
[0113] ) and also, for example, "a 5-6 membered heteroaryl ring in which one, two, or three heteroatoms are selected from N, O, and S, and the number of heteroatoms is one, two, or three," and further, for example, a pyridine ring (for example,
[0114] [ka]
[0115] ) or thiophene ring (for example,
[0116] [ka]
[0117] ) and preferably a pyridine ring (for example,
[0118] [ka]
[0119] )
[0120] In some embodiments, R 1 and R 2 These are independently C1-C6 alkyl groups, or R 1 , R 2 These atoms, together with the atoms to which they are linked, form a 3- to 12-membered heterocycloalkyl group, where the above 3- to 12-membered heterocycloalkyl group further contains, in addition to the linked P atoms, 0, 1, 2, or 3 heteroatoms selected from N, O, and S, of one, two, or three types, for example, a C1- to C6 alkyl group.
[0121] In some embodiments, R 3 This refers to "a 5-12 member saturated or unsaturated heterocyclyl group having one, two, or three heteroatoms selected from N, O, and S," or one or more R 3-1 A heterocyclyl group with 1, 2, or 3 heteroatoms selected from N, O, and S, and having 1, 2, or 3 heteroatoms, and being 5-12 member saturated or unsaturated.
[0122] In some embodiments, R 3-1 These are independently C1-C6 alkyl groups, or one or more R 3-2 A C1-C6 alkyl group substituted with a C1-C6 alkyl group, for example.
[0123] In some embodiments, R 3-2 These are halogens, independently of each other.
[0124] In some embodiments, R 4 These are independently a halogen, a C1-C6 alkyl group, or a C1-C6 alkoxy group, such as a C1-C6 alkyl group.
[0125] In some embodiments, ring B is C6~C 10 An unsaturated carbon ring, or "a 6- to 15-membered unsaturated heterocycle in which the heteroatoms are selected from N, O, and S (one, two, or three types), and the number of heteroatoms is 1, 2, 3, 4, or 5."
[0126] In some embodiments, L is a single bond, -CR L1 R L2 -, -O-, -S-, or -NR L3 -and preferably L is a single bond, -O-, -S-, or -NR L3 -and more preferably, L is -NR L3 - is
[0127] In some embodiments, R L3 H is H.
[0128] In some embodiments, ring A is C4~C 10 Saturated carbocycle, C6~C 10 An aryl ring, or "a 5- to 9-membered saturated or unsaturated heteroring with one, two, or three heteroatoms selected from N, O, and S," for example, ring A is C6-C 10 An aryl ring, or "a 5-6 membered heteroaryl ring in which one, two, or three heteroatoms are selected from N, O, and S, and the number of heteroatoms is one, two, or three."
[0129] In some embodiments, m3 is 0, 1, or 2, for example, 1.
[0130] In some embodiments, R 5 These are independently SF5, C3-C6 cycloalkyl groups, halogens, C1-C6 alkyl groups, and one or more R5-1 C1-C6 alkyl groups or OR substituted with 5-3 For example, R 5 These are independently halogens, C1-C6 alkyl groups, and one or more R 5-1 A C1-C6 alkyl group substituted with, for example, one or more R 5-1 A C1-C6 alkyl group substituted with, and also, for example, R 5 This is independently SF5, halogen, or one or more R 5-1 These are C1-C6 alkyl groups substituted with [the specified character].
[0131] In some embodiments, R 5-1 These are halogens, independently of each other.
[0132] In some embodiments, R 5-3 These are independently C1-C6 haloalkyl groups.
[0133] In some embodiments, m2 is 0 or 1, for example, 0.
[0134] In some embodiments, m1 is 1.
[0135] In some embodiments,
[0136] [ka]
[0137] teeth,
[0138] [ka]
[0139] And, During the ceremony,
[0140] [ka]
[0141] This indicates a single bond or a double bond. X 1 is S, -CR X1 =CR X1 -, -N=CR X1 -or -CR X1 =N-, X 2 CR X1 , N or S, X 3 C, CR X1 or N, X 4 CR X1 , N, -C(O)- or CR X1 R X2 And, X 5 N, NR X3 CR X1 CR X1 R X2 ,-CR X1 =CR X1 -, -N=CR X1 -, -CR X1 =N-, -CR X1 R X2 -CR X1 R X2 -, -O-CR X1 R X2 -, -C(O)-N=, -C(O)-CR X1 = or -NR X3 -CR X1 R X2 -and, X 6 CR X1 or N, X 7 CR X1 or N, X 8 CR X1 CR X1 R X2 , N, NR X3 , -C(O)-, O or S, X 9 CR X1 , N, NR X3 ,-CR X1 =CR X1-, =CR X1 -CR X1 =, -CR X1 R X2 -, -CR X1 R X2 -CR X1 R X2 -, =N-CR X1 =,=CR X1 -N=, =CR X1 -NR X3 -, -NR X3 -CR X1 =, -NR X3 -N=, =N-NR X3 -and, X 10 CR X1 CR X1 R X2 , N, NR X3 , -C(O)-, O or S, X 11 is non-existent, O or S, X 12 CR X1 or N, X 16 is C or N, X 13 CR X1 or N, X 14 CR X4 or N, X 15 CR X1 or N, X 17 CR X1 or N, Each R X1 and R X2 These are independently H, C1-C6 alkyl groups, halogens, or CN, or R X1 , R X2 These, together with the atoms linked to them, form a C3-C4 cycloalkyl group. Each R X3 These are independently H, C1-C6 alkyl groups, halogens, or CN. R X4H is "a 5-12 member saturated or unsaturated heterocyclyl group having 1, 2, or 3 heteroatoms selected from N, O, and S", and one or more R X4-1 A 5-12 member saturated or unsaturated heterocyclyl group with one, two, or three heteroatoms selected from N, O, and S, substituted with C6-C 10 An aryl group or one or more R groups X4-5 C6~C replaced by 10 It is an aryl group, R X4-1 and R X4-5 These are independently H, deuterium, halogen, C1-C6 alkyl group, C1-C6 alkoxy group, CN, and one or more R X4-2 A C1-C6 alkyl group substituted with, one or more R X4-3 C1-C6 alkoxy groups substituted with, "3-12 membered heterocycloalkyl groups with 1, 2, or 3 heteroatoms selected from N, O, and S", "5-12 membered heteroaryl groups with 1, 2, or 3 heteroatoms selected from N, O, and S", C(=O)NR c R d , C3-C6 cycloalkyl group, one or more R X4-4 A C3-C6 cycloalkyl group substituted with, R X4-2 and R X4-3 These are independently deuterium, halogen, OH, CN, C1-C6 alkoxy group, "one, two, or three heteroatoms selected from N, O, and S, and a 3-12 membered heterocycloalkyl group with one, two, or three heteroatoms", and C(=O)NR c R d or NR b C(=O)R a And, R X4-4 These are independently CN and C(=O)NR c R d Or C(=O)OR a And, R a , R b , R c and R d These are independently H or C1-C6 alkyl groups.
[0142] In some embodiments,
[0143] [ka]
[0144] teeth,
[0145] [ka]
[0146] Preferably,
[0147] [ka]
[0148] teeth,
[0149] [ka]
[0150] That is the case.
[0151] In some embodiments,
[0152] [ka]
[0153] teeth,
[0154] [ka] TIFF2026515261000056.tif82169
[0155] Preferably,
[0156] [ka]
[0157] teeth,
[0158] [ka]
[0159] That is the case.
[0160] In some embodiments,
[0161] [ka]
[0162] teeth,
[0163] [ka]
[0164] That is the case.
[0165] In some embodiments, ring B is
[0166] [ka]
[0167] That is the case.
[0168] In some embodiments, each R X1 These are H independently.
[0169] In some embodiments, RX4 This refers to "a 5-12 member saturated or unsaturated heterocyclyl group having one, two, or three heteroatoms selected from N, O, and S," or one or more R X4-1 A heterocyclyl group with 1, 2, or 3 heteroatoms selected from N, O, and S, and having 1, 2, or 3 heteroatoms, and being 5-12 member saturated or unsaturated.
[0170] In some embodiments, R X4-1 and R X4-5 These are independently H or C1-C6 alkyl groups, for example, C1-C6 alkyl groups.
[0171] In some embodiments, R X4 So, the above-mentioned "heterocyclyl group having 1, 2, or 3 heteroatoms selected from N, O, and S, and a 5-12 member saturated or unsaturated heterocyclyl group with 1, 2, or 3 heteroatoms" is equivalent to "heterocyclyl group having 1, 2, or 3 heteroatoms selected from N, O, and S, and a 5-10 member unsaturated heterocyclyl group with 1, 2, or 3 heteroatoms," for example, a pyrrolyl group (for example,
[0172] [ka]
[0173] ), pyrazolyl group (for example,
[0174] [ka]
[0175] ), imidazolyl group (for example,
[0176] [ka]
[0177] ), triazolyl group (for example,
[0178] [ka]
[0179] ), thiazolyl group (for example,
[0180] [ka]
[0181] ), oxazolyl group (for example,
[0182] [ka]
[0183] ), isoxazolyl group (for example,
[0184] [ka]
[0185] ), pyridyl group (for example,
[0186] [ka]
[0187] ), pyrimidinyl group (for example,
[0188] [ka]
[0189] ), pyrazinyl group (for example,
[0190] [ka]
[0191] ), pyridadinyl group (for example,
[0192] [ka]
[0193] ),
[0194] [ka]
[0195] And, for example, an imidazolyl group (for example,
[0196] [ka]
[0197] ), pyrazolyl group (for example,
[0198] [ka]
[0199] ),
[0200] [ka]
[0201] , pyridyl group (for example,
[0202] [ka]
[0203] ) or pyrimidinyl group (for example,
[0204] [ka]
[0205] )
[0206] In some embodiments, R X4 teeth,
[0207] [ka]
[0208] For example, R X4 teeth,
[0209] [ka]
[0210] And, for example, R X4 teeth,
[0211] [ka]
[0212] That is the case.
[0213] In some embodiments,
[0214] [ka]
[0215] teeth,
[0216] [ka]
[0217] That is the case.
[0218] In some embodiments,
[0219] [ka]
[0220] teeth,
[0221] [ka] TIFF2026515261000086.tif104169
[0222] And, for example,
[0223] [ka]
[0224] teeth,
[0225] [ka]
[0226] That is the case.
[0227] In some embodiments, L is a single bond, -CR L1 R L2 It is -, -O-, -S-, or -NH-, for example, L is a single bond, -O-, or -NH-.
[0228] In some embodiments,
[0229] [ka]
[0230] teeth,
[0231] [ka]
[0232] ,for example
[0233] [ka]
[0234] For example,
[0235] [ka]
[0236] teeth,
[0237] [ka]
[0238] That is the case.
[0239] In some embodiments, the compound represented by formula I is the compound represented by the following formulas I-1, I-2, I-3, I-4, I-5, I-6, or I-7:
[0240] [ka]
[0241] , In the formula, X 3 is C or N, X 4 CR X1 , N, -C(O)- or CR X1 R X2 And, X 5 -CR X1 =CR X1 -, -N=CR X1 -, -CR X1 =N-, -O-CR X1 R X2 -or-NR X3 -CR X1 R X2 -and, X 8CR X1 or N, X 10 CR X1 Or it is N.
[0242] In some embodiments, the compound represented by formula I is one of the following compounds:
[0243] [ka] TIFF2026515261000096.tif250169TIFF2026515261000097.tif244169TIFF2026515261000098.tif232169TIFF202 6515261000099.tif255168TIFF2026515261000100.tif250169TIFF2026515261000101.tif255165TIFF20265152610 00102.tif187169TIFF2026515261000103.tif217169TIFF2026515261000104.tif201169TIFF2026515261000105.t if233169TIFF2026515261000106.tif252169TIFF2026515261000107.tif229169TIFF2026515261000108.tif127169
[0244] .
[0245] The present invention provides a pharmaceutical composition, and the above pharmaceutical composition (1) Compounds represented by formula I above, pharmaceutically acceptable salts thereof, esters thereof, stereoisomers thereof, tautomers thereof, crystalline polymorphs thereof, solvates thereof, metabolites thereof, isotopic derivatives thereof or their prodrugs, and (2) Contains pharmaceutically acceptable additives.
[0246] The present invention further provides the use in the manufacture of drugs the compound represented by formula I, its pharmaceutically acceptable salts, its esters, its stereoisomers, its tautomers, its crystalline polymorphs, its solvates, its metabolites, its isotopic derivatives or prodrugs, or the pharmaceutical compositions thereof, which are used to treat diseases and conditions mediated by TEAD, such as cancer (e.g., solid tumors, leukemia, etc.), organ regeneration, wound healing, and fibrosis.
[0247] Explanation of terms In this invention, the term "pharmaceutically acceptable salt" refers to a salt obtained by reacting a compound with a pharmaceutically acceptable acid or base. When the compound contains a relatively acidic functional group, a base addition salt can be obtained by contacting the compound with a sufficient amount of a pharmaceutically acceptable base in a suitable inert solvent. When the compound contains a relatively basic functional group, an acid addition salt can be obtained by contacting the compound with a sufficient amount of a pharmaceutically acceptable acid in a suitable inert solvent. For specifics, refer to Handbook of Pharmaceutical Salts: Properties, Selection, and Use (P. Heinrich Stahl, Camille G. Wermuth, 2011, 2nd Revised Edition).
[0248] The term "ester" includes physiologically hydrolyzable esters (compounds of the present invention in a form that hydrolyzes under physiological conditions to release a free acid or alcohol). Otherwise, the compounds of the present invention may be esters themselves.
[0249] The term "stereoisomer" refers to cis-trans isomers or optical isomers. Cis-trans isomers are isomers resulting from the inability of double bonds or single bonds of ring-forming carbon atoms to rotate freely, while optical isomers are stereoisomers with different optical properties resulting from the absence of rotational antisymmetry within the molecule.
[0250] The term "tautomer" refers to a state of dynamic equilibrium between different functional isomers at room temperature, where they can rapidly transform into each other. If tautomerism is possible (e.g., in solution), then chemical equilibrium between the tautomers can be reached. For example, proton tautomers (also called prototropic tautomers) include interconversions that occur via proton transitions, such as keto-enol isomerization and imine-enamine isomerization. Valence tautomers include interconversions that occur through the rearrangement of several bonding electrons. A concrete example of keto-enol tautomerization is the intertransformation between two tautomers, pentane-2,4-dione and 4-hydroxypento-3-en-2-one.
[0251] The term "crystalline polymorph" refers to a compound that exists in multiple crystalline forms.
[0252] The term "solvate" refers to a substance formed when a compound combines with a solvent. Solvates are classified into stoichiometric solvates and non-stoichiometric solvates.
[0253] The term "metabolite" refers to a substance formed in the body after administration of the compound of the present invention.
[0254] The term "isotope derivative" refers to a compound in which the isotopic abundance of one or more atoms differs from its natural abundance. For example, one or more atoms in a compound may be replaced by atoms that have relatively low mass numbers in nature—for example, one hydrogen atom in a compound may be replaced by deuterium.
[0255] The term "prodrug" refers to a derivative of a compound containing a biologically reactive functional group, which can be obtained by decomposition of the biologically reactive functional group from the compound or by other reaction under biological conditions (in vitro or in vivo) to provide the compound. Typically, prodrugs are inert or at least less active than the compound itself, so that they cannot exert their activity until the compound is decomposed from the biologically reactive functional group. The biologically reactive functional group can be hydrolyzed or oxidized under biological conditions to provide the compound. For example, a prodrug may contain a biologically hydrolyzable group. Examples of biologically hydrolyzable groups include, but are not limited to, biologically hydrolyzable phosphates, biologically hydrolyzable esters, biologically hydrolyzable amides, biologically hydrolyzable carbonates, biologically hydrolyzable carbamates, and biologically hydrolyzable ureids.
[0256] In this invention, a single dash "-" may be placed before the substituent used to indicate that the named substituent is linked to the parent portion via a single bond. In this invention, unless the linking direction is explicitly stated, the linking direction follows the same direction as the reading order from left to right. An example is given below:
[0257] [ka]
[0258] If the linking group L is -CD-, then -CD- links ring B and ring A in the same direction as the reading order from left to right.
[0259] [ka]
[0260] Constitute,
[0261] [ka]
[0262] It does not constitute. Specifically, in the present invention, L is "-NR L3 CR L1 R L2 The presence of "-" indicates that N is connected to ring B in the matrix via a single bond, rather than the C-terminus being connected to ring B in the matrix.
[0263] In the present invention, the structural fragment is
[0264] [ka]
[0265] " " refers to the linkage of the structural fragment to the rest of the molecule via that bond. For example,
[0266] [ka]
[0267] This refers to the pyridyl group.
[0268] In this invention, the term "one or more" means one, two, three, four or five, for example, one, two or three.
[0269] In this invention, the term "halogen" refers to fluorine, chlorine, bromine, or iodine.
[0270] The term "oxo" refers to =O, where the oxygen atom substitutes two hydrogen atoms on the same carbon atom, that is, it substitutes a methylene group with a carbonyl group.
[0271] In the present invention, the term "alkyl group" refers to a linear or branched saturated monovalent hydrocarbon group having a specified number of carbon atoms (e.g., C1 to C6). Alkyl groups include, but are not limited to, methyl groups, ethyl groups, n-propyl groups, isopropyl groups, n-butyl groups, isobutyl groups, sec-butyl groups, tert-butyl groups, n-pentyl groups, n-hexyl groups, and the like.
[0272] In the present invention, the term "alkoxy group" refers to the group R Y -O- refers to R Y The definition is the same as the term "alkyl group". Alkoxy groups include, but are not limited to, methoxy, ethoxy, n-propoxy, and isopropoxy groups.
[0273] In this invention, the term "cycloalkyl group" refers to a cyclic saturated monovalent hydrocarbon group having a specified number of carbon atoms (e.g., C3 to C6). Cycloalkyl groups are,
[0274] [ka]
[0275] This includes, but is not limited to, the following.
[0276] In this invention, the term "heterocycloalkyl group" refers to a cyclic saturated monovalent group having a specified number of ring atoms (e.g., 3-12 members, 5-6 members), a specified number of heteroatoms (e.g., 1, 2, or 3), and a specified type of heteroatom (one or more of N, O, and S). Heterocycloalkyl groups are linked to the rest of the molecule via carbon atoms or heteroatoms. Heterocycloalkyl groups are,
[0277] [ka]
[0278] This includes, but is not limited to, the following.
[0279] In the present invention, the term "heteroaryl group" refers to a cyclic unsaturated group that is a monocyclic or polycyclic ring, and in the case of a polycyclic ring, shares two atoms and one bond between monocyclic rings, and each ring is aromatic, having a specified number of ring atoms (e.g., 5-12 members, 5-6 members), a specified number of heteroatoms (e.g., 1, 2, or 3), and a specified type of heteroatom (one or more of N, O, and S). A heteroaryl group is linked to the rest of the molecule via carbon atoms or heteroatoms, and a heteroaryl group is linked to the rest of the molecule via rings having heteroatoms or rings not having heteroatoms. A heteroaryl group is,
[0280] [ka]
[0281] This includes, but is not limited to, the following.
[0282] In the present invention, the term "aryl group" refers to a monocyclic or polycyclic ring (e.g., two or three rings) that, in the case of a polycyclic ring, shares two atoms and one bond between monocyclic rings, and each ring is aromatic, with a specified number of carbon atoms (e.g., C6-C6). 10 This refers to a cyclic unsaturated hydrocarbon group having aryl groups. Aryl groups include, but are not limited to, phenyl groups and naphthyl groups.
[0283] In this invention, the term "pharmaceutically acceptable additives" refers to all substances contained in a drug formulation other than the active drug component, and is generally divided into two categories: excipients and additives. Specifically, one can refer to the "Pharmacopoeia of the People's Republic of China (2020 Edition)" and the "Handbook of Pharmaceutical Excipients" (Paul J Sheskey, Bruno C Hancock, Gary P Moss, David J Goldfarb, 2020, 9th Edition).
[0284] By arbitrarily combining the above preferred conditions without deviating from the common sense of the field, relatively suitable examples of the present invention can be obtained.
[0285] The reagents and raw materials used in this invention are all commercially available.
[0286] [Modes for carrying out the invention] The present invention will be further described below with reference to examples, but this does not limit the present invention to the scope of the examples described. In the following examples, experimental methods for which specific conditions are not specified are selected according to usual methods and conditions or according to the product description.
[0287] The compound represented by formula I of the present invention can be obtained by the following route.
[0288] Route 1:
[0289] [ka]
[0290] Step 1: Compound I-1 and compound I-2 are reacted to obtain compound I-3.
[0291] In the formula, W is selected from a halogen or an alkyl / aryl sulfonate group, where the halogen is preferably chlorine, bromine, and iodine; the alkyl / aryl sulfonate group includes, but is not limited to, methanesulfonate, trifluoromethanesulfonate, benzenesulfonate, p-toluenesulfonate, or naphthalenesulfonate, but is preferably methanesulfonate and p-toluenesulfonate; and U is H, OH, SH, or NHR L3 CR L1 R L2 Tin reagent, CR L1 R L2 Zinc reagent DHCR L1 R L2V is selected from magnesium reagents, etc., and V is selected from boric acid, boric acid esters, halogens, or alkyl / aryl sulfonate groups, where halogens are preferably chlorine, bromine, and iodine, and alkyl / aryl sulfonate groups include, but are not limited to, methanesulfonate, trifluoromethanesulfonate, benzenesulfonate, p-toluenesulfonate, or naphthalenesulfonate, but are preferably methanesulfonate and p-toluenesulfonate. The reaction is carried out in the presence of a suitable catalyst, such as tetrakis(triphenylphosphine)palladium, bis(triphenylphosphine)palladium dichloride, 1,1'-bisdiphenylphosphinoferrocenedichloropalladium, trisdibenzylideneacetonedipalladium, palladium chloride, palladium acetate, chloro(2-dicyclohexylphosphino-2',6'-di-isopropoxy-1,1'-biphenyl)(2-amino-1,1'-biphenyl-2-yl)palladium, preferably 1,1'-bisdiphenylphosphinoferrocenedichloropalladium. The reaction is carried out in the presence of a suitable base, such as sodium carbonate, cesium carbonate, potassium tert-butoxide, or sodium tert-butoxide, preferably sodium carbonate. The reaction is carried out in a suitable solvent, such as 1,4-dioxane, 1,4-dioxane / water, 1,2-dichloroethane, 1,2-dichloroethane / water, N,N-dimethylformamide, N,N-dimethylformamide / water, dimethyl sulfoxide, dimethyl sulfoxide / water, N-methylpyrrolidone, N-methylpyrrolidone / water, preferably 1,4-dioxane / water and N,N-dimethylformamide. The reaction is carried out at an appropriate temperature, for example, 25 to 140°C, preferably 80 to 110°C.
[0292] Step 2: Compound I-3 is reacted with phosphine oxide I-4 to obtain compound I.
[0293] Here, the reaction is carried out in the presence of a suitable catalyst, such as tetrakis(triphenylphosphine)palladium, bis(triphenylphosphine)palladium dichloride, 1,1'-bisdiphenylphosphinoferocenedichloropalladium, trisdibenzylideneacetonedipalladium, palladium chloride, palladium acetate, chloro(2-dicyclohexylphosphino-2',6'-di-isopropoxy-1,1'-biphenyl)(2-amino-1,1'-biphenyl-2-yl)palladium, preferably chloro(2-dicyclohexylphosphino-2',6'-di-isopropoxy-1,1'-biphenyl)(2-amino-1,1'-biphenyl-2-yl)palladium and trisdibenzylideneacetonedipalladium. The reaction is carried out in the presence of a suitable base, such as sodium carbonate, cesium carbonate, potassium tert-butoxide, sodium tert-butoxide, preferably cesium carbonate. The reaction is carried out in a suitable solvent, such as 1,4-dioxane, 1,4-dioxane / water, 1,2-dichloroethane, 1,2-dichloroethane / water, N,N-dimethylformamide, N,N-dimethylformamide / water, dimethyl sulfoxide, dimethyl sulfoxide / water, N-methylpyrrolidone, N-methylpyrrolidone / water, preferably in 1,4-dioxane and N,N-dimethylformamide. The reaction is carried out at an appropriate temperature, for example, 25 to 140°C, preferably 40 to 110°C.
[0294] Route 2:
[0295] [ka]
[0296] Step 1: Compound I-7-1 and Compound R X4 Compound I-7-2 is obtained by reacting with -Z.
[0297] In the formula, Y is selected from a halogen or an alkyl / aryl sulfonate group, where the halogen is preferably chlorine, bromine, and iodine; the alkyl / aryl sulfonate group includes, but is not limited to, methanesulfonate, trifluoromethanesulfonate, benzenesulfonate, p-toluenesulfonate, or naphthalenesulfonate, but is preferably methanesulfonate and p-toluenesulfonate; and Z is selected from boric acid, boric acid ester, tin reagent, zinc reagent, or magnesium reagent, preferably boric acid and boric acid ester. The reaction is carried out in the presence of a suitable catalyst, such as tetrakis(triphenylphosphine)palladium, bis(triphenylphosphine)palladium dichloride, 1,1'-bisdiphenylphosphinoferrocenedichloropalladium, trisdibenzylideneacetonedipalladium, palladium chloride, palladium acetate, chloro(2-dicyclohexylphosphino-2',6'-di-isopropoxy-1,1'-biphenyl)(2-amino-1,1'-biphenyl-2-yl)palladium, preferably tetrakis(triphenylphosphine)palladium and 1,1'-bisdiphenylphosphinoferrocenedichloropalladium. The reaction is carried out in the presence of a suitable base, such as sodium carbonate, cesium carbonate, potassium tert-butoxide, or sodium tert-butoxide, preferably sodium carbonate. The reaction is carried out in a suitable solvent, such as 1,4-dioxane, 1,4-dioxane / water, 1,2-dichloroethane, 1,2-dichloroethane / water, N,N-dimethylformamide, N,N-dimethylformamide / water, dimethyl sulfoxide, dimethyl sulfoxide / water, N-methylpyrrolidone, N-methylpyrrolidone / water, preferably 1,4-dioxane / water and N,N-dimethylformamide. The reaction is carried out at an appropriate temperature, for example, 25 to 140°C, preferably 40 to 110°C.
[0298] Step 2: Compound I-7-2 and compound I-7-3 are reacted to obtain compound I-7-4.
[0299] Here, the reaction is carried out in the presence of a suitable catalyst, such as tetrakis(triphenylphosphine)palladium, bis(triphenylphosphine)palladium dichloride, 1,1'-bisdiphenylphosphinoferrocenedichloropalladium, trisdibenzylideneacetonedipalladium, palladium chloride, palladium acetate, chloro(2-dicyclohexylphosphino-2',6'-di-isopropoxy-1,1'-biphenyl)(2-amino-1,1'-biphenyl-2-yl)palladium, preferably 1,1'-bisdiphenylphosphinoferrocenedichloropalladium. The reaction is carried out in the presence of a suitable base, such as sodium carbonate, cesium carbonate, potassium tert-butoxide, or sodium tert-butoxide, preferably sodium carbonate. The reaction is carried out in a suitable solvent, such as 1,4-dioxane, 1,4-dioxane / water, 1,2-dichloroethane, 1,2-dichloroethane / water, N,N-dimethylformamide, N,N-dimethylformamide / water, dimethyl sulfoxide, dimethyl sulfoxide / water, N-methylpyrrolidone, N-methylpyrrolidone / water, preferably 1,4-dioxane / water and N,N-dimethylformamide. The reaction is carried out at an appropriate temperature, for example, 25 to 140°C, preferably 80 to 110°C.
[0300] Step 3: Compound I-7-4 is reacted with phosphine oxide I-7-5 to obtain compound I-7.
[0301] Here, the reaction is carried out in the presence of a suitable catalyst, such as tetrakis(triphenylphosphine)palladium, bis(triphenylphosphine)palladium dichloride, 1,1'-bisdiphenylphosphinoferocenedichloropalladium, trisdibenzylideneacetonedipalladium, palladium chloride, palladium acetate, chloro(2-dicyclohexylphosphino-2',6'-di-isopropoxy-1,1'-biphenyl)(2-amino-1,1'-biphenyl-2-yl)palladium, preferably chloro(2-dicyclohexylphosphino-2',6'-di-isopropoxy-1,1'-biphenyl)(2-amino-1,1'-biphenyl-2-yl)palladium and trisdibenzylideneacetonedipalladium. The reaction is carried out in the presence of a suitable base, such as sodium carbonate, cesium carbonate, potassium tert-butoxide, sodium tert-butoxide, preferably cesium carbonate. The reaction is carried out in a suitable solvent, such as 1,4-dioxane, 1,4-dioxane / water, 1,2-dichloroethane, 1,2-dichloroethane / water, N,N-dimethylformamide, N,N-dimethylformamide / water, dimethyl sulfoxide, dimethyl sulfoxide / water, N-methylpyrrolidone, N-methylpyrrolidone / water, preferably in 1,4-dioxane and N,N-dimethylformamide. The reaction is carried out at an appropriate temperature, for example, 25 to 140°C, preferably 40 to 110°C.
[0302] Example 1: (Compound 1)
[0303] [ka]
[0304] Step 1: (Compound 1b) 1a (1 g, 4.06 mmol), p-trifluoromethyliodobenzene (1.33 g, 4.88 mmol), N,N-diisopropylethylamine (106 mg, 813 μmol), potassium hydroxide (456 mg, 8 mmol), and cuprous iodide (155 mg, 813 μmol) are dissolved in N,N-dimethylformamide (15 mL), the mixture is purged three times with nitrogen gas, and the mixture is stirred at 110 °C for 12 hours to allow it to react. Complete reaction is monitored by LC-MS. The reaction mixture is diluted with water (15 mL), extracted with ethyl acetate (15 mL x 3), the organic phase is dried and concentrated, and the resulting solid is slurryed with acetonitrile (10 mL) to obtain a grayish-white solid 1b (0.78 g, 1.93 mmol, yield: 48%). 1 HNMR (400 MHz, DMSO-d6) δ 8.54 (d, J = 2.0 Hz, 1H), 8.33 (d, J = 7.6 Hz, 1H), 8.04 (d, J = 8.4 Hz, 2H), 7.89 (d, J = 8.4 Hz, 2H), 7.57 (dd, J = 8.8, 2.0 Hz, 1H), 7.46 - 7.51 (m, 2H), 7.43 (d, J = 8.8 Hz, 1H), 7.34 - 7.36 (m, 1H) Step 2: (Compound 1) Compound 1b (0.1 g, 256 μmol), dimethylphosphine oxide (40 mg, 512 μmol), Pd(dba)2 (15 mg, 26 μmol), 4,5-bis(diphenylphosphin)-9,9-dimethylxanthene (30 mg, 51 μmol), and cesium carbonate (84 mg, 256 μmol) were dissolved in 1,4-dioxane (3 mL). The mixture was purged three times with nitrogen gas and stirred at 110 °C for 12 hours to allow the reaction to proceed. Complete reaction was monitored by LC-MS. The reaction solution was diluted with water (5 mL), extracted with ethyl acetate (5 mL x 3), and the organic phase was dried and concentrated. The resulting crude product was purified by reverse phase preparative separation to obtain a yellow gel 1 (0.083 g, 214 μmol, yield: 83%). LC-MS m / z [M+H] + : 388.3 1HNMR (400 MHz, DMSO-d6) δ 8.71 (d, J = 11.6 Hz, 1H), 8.36 (d, J = 7.6 Hz, 1H), 8.06 (d, J = 8.4 Hz, 2H), 7.93 (d, J = 8.4 Hz, 2H), 7.81 - 7.83 (m, 1H), 7.57 (d, J = 8.4 Hz, 1H), 7.48 - 7.54 (m, 2H), 7.38 - 7.40 (m, 1H), 1.74 (d, J = 13.2 Hz, 6H) Example 2: (Compound 2)
[0305] [ka]
[0306] Step 1: (Compound 2b) 2a (5g, 19.9 mmol), 4-trifluoromethylbenzeneboronic acid (4.5g, 23.9 mmol), and sodium carbonate (6.3g, 59.7 mmol) were added to 1,4-dioxane (100 mL) and water (12 mL). At room temperature, [1,1'-bis(diphenylphosphino)ferrocene]palladium dichloride (0.6g, 0.8 mmol) was added, the mixture was purged three times with nitrogen gas, and the temperature was raised to 90°C and the reaction was allowed to proceed for 16 hours. TLC showed that the reaction was complete, the temperature was lowered, the mixture was filtered, the filtered cake was washed with ethyl acetate, 1M hydrochloric acid solution was added until the pH was 1, and ethyl acetate was added to wash the organic phase with brine, dried over anhydrous sodium sulfate, concentrated, and the crude product was separated by column chromatography to obtain a brown solid. The solid was slurryed with dichloromethane / methanol to obtain a white solid 2b (6g, yield 95%).
[0307] Step 2: (Compound 2c) 2b (6 g, 19 mmol) was added to tert-butyl alcohol (100 mL) at room temperature, diphenyl azidophosphate (6.3 g, 22.8 mmol) and triethylamine (5.8 g, 56.9 mmol) were added, the mixture was purged three times with nitrogen gas, and the temperature was raised to 90°C and the reaction was allowed to proceed for 16 hours. LC-MS confirmed that the reaction was complete, the mixture was cooled, washed with ethyl acetate and water, the organic phase was washed with brine, dried over anhydrous sodium sulfate, concentrated, and then separated and purified by column chromatography to obtain compound 2c (5.5 g, yield: 75%) as a pale yellow solid.
[0308] Step 3: (Compound 2d) To a 20 mL solution of compound 2c (5.5 g, 14.2 mmol) in dichloromethane, trifluoroacetic acid (16.2 g, 142 mmol) was added dropwise, and the mixture was stirred at room temperature for 1 hour. LC-MS confirmed complete reaction, and the reaction mixture was concentrated and purified by column chromatography to obtain compound 2d (5 g, yield: 88%). LC-MS m / z[M+H] + : 288.2 Step 4: (Compound 2e) 2d (300 mg, 1.04 mmol) and copper bromide (260 mg, 1.14 mmol) were added to acetonitrile (10 mL), the mixture was cooled to 0°C in an ice bath, and tert-butyl nitrite (320 mg, 3.12 mmol) was slowly added. The mixture was reacted at 0°C for 1 hour. LC-MS confirmed complete reaction, and the reaction mixture was concentrated and purified by column chromatography to obtain solid 2e (280 mg, yield: 76.4%).
[0309] Step 2: (Compound 2) 2e (280 mg, 0.8 mmol), cesium carbonate (260 mg, 0.8 mmol), palladium acetate (18 mg, 0.08 mmol), and 4,5-bisdiphenylphosphin-9,9-dimethylxanthene (93 mg, 0.16 mmol) were added to 1,4-dioxane (10 mL), dimethylphosphine oxide (120 mg, 1.6 mmol) was added, the mixture was purged three times with nitrogen gas, and the temperature was raised to 90°C and the reaction was allowed to proceed for 16 hours. Complete reaction was confirmed by LC-MS, the mixture was cooled, filtered, washed with ethyl acetate, the filtrate and washings were combined, concentrated, and purified by reverse-phase preparative fractionation to obtain a white solid 2 (13 mg, yield: 5%). LC-MS m / z[M+H] + : 349.2.
[0310] 1 H NMR (400 MHz, DMSO-d6) δ 8.49 (d, J = 12.8 Hz, 1H), 8.15 (d, J = 8.0 Hz, 1H), 7.91 (d, J = 8.0 Hz, 2H), 7.86 - 7.78 (m, 2H), 7.75 - 7.70 (m, 3H), 7.61 (dd, J = 7.2, 1.2 Hz, 1H), 1.75 (s, 3H), 1.71 (s, 3H) Example 3: (Compound 3)
[0311] [ka]
[0312] Step 1: (Compound 3b) Add 3a (1.11 g, 4.08 mmol), cuprous iodide (78 mg, 408 μmol), and potassium carbonate (564 mg, 4.08 mmol) to N,N dimethylformamide (16 mL), raise the temperature to 140 °C, and stir for 12 hours. Monitor the completion of the reaction by LC-MS. Dilute the reaction mixture with ethyl acetate (50 mL), wash the organic phase with water (20 mL x 2) and saturated sodium chloride solution (20 mL x 2), dry over anhydrous sodium sulfate, filter, concentrate to obtain the crude product, and purify the crude product by column chromatography to obtain a colorless oily substance 3b (1.5 g, 3.86 mmol, yield: 94.6%). LC-MS m / z [M+H] + : 342.2 Step 2: (Compound 3) Under a nitrogen gas atmosphere, 3b (1.3 g, 3.82 mmol), dimethylphosphine oxide (597 mg, 7.64 mmol), Pd(dba)2 (220 mg, 382 μmol), 4,5-bis(diphenylphosphin)-9,9-dimethylxanthene (442 mg, 764 μmol), and cesium carbonate (1.25 g, 3.82 μmol) were added to 1,4-dioxane (26 mL), and the mixture was heated to 80°C and stirred for 1 hour. The reaction was monitored by LC-MS to confirm completion. The reaction mixture was rotate-dried to obtain the crude product, which was purified by column chromatography. The resulting product was subjected to reverse-phase preparative chromatography and freeze-dried to obtain a yellow gel 3 (28 mg, 83 μmol, yield: 6.96%). LC-MS m / z[M+H] + : 338.3 1 HNMR (400 MHz, CDCl3) δ 8.16 (m, 1H), 7.84 (d, J = 8.4 Hz, 2H), 7.64 - 7.69 (m, 3H), 7.53 - 7.60 (m, 1H), 7.46 (d, J = 3.2 Hz, 1H), 6.84 (d, J = 3.2 Hz, 1H), 1.86 (s, 3H), 1.83 (s, 3H) Example 4: (Compound 4)
[0313] [ka]
[0314] Step 1: (Compound 4b) Add 4a (0.9 g, 5.4 mmol), N-bromosuccinimide (0.95 g, 5.4 mmol), and dichloromethane (5 mL) to the reaction flask. Stir at room temperature for 2 hours. Confirm complete reaction by LC-MS. Concentrate the reaction mixture and purify the crude product by column chromatography to obtain a white solid 4b (1 g, yield 75.6%). LC-MS m / z[M+H] + : 247.0 Step 2: (Compound 4c) Add 4b (500 mg, 2.0 mmol), p-trifluoromethyliodobenzene (550 mg, 2.0 mmol), cuprous iodide (77 mg, 0.40 mmol), potassium hydroxide (230 mg, 4.40 mmol), N,N-diisopropylethylamine (52 mg, 0.40 mmol), and N,N-dimethylformamide (5 mL) to the reaction flask. Stir at 110°C for 5 hours. Complete reaction is confirmed by LC-MS. The reaction mixture is concentrated, and the crude product is purified by column chromatography to obtain a yellow solid 4c (500 mg, yield 63.2%). LC-MS m / z [M+H] + : 391.1 Step 3: (Compound 4) Add 4c (500 mg, 1.3 mmol), dimethylphosphine oxide (200 mg, 2.6 mmol), cesium carbonate (830 mg, 2.6 mmol), palladium acetate (57 mg, 0.3 mmol), 4,5-bis(diphenylphosphin)-9,9-dimethylxanthene (300 mg, 0.5 mmol), and dioxane (5 mL) to the reaction flask. Stir at 110°C for 12 hours. Complete reaction is confirmed by LC-MS. The reaction mixture is concentrated, and the crude product is purified by reverse-phase column chromatography to obtain a white solid 4 (75 mg, yield 15.1%). LC-MS m / z [M+H] + : 389.3 1HNMR (400 MHz, DMSO-d6) δ 8.73 (dd, J = 11.6, 1.2 Hz, 1H), 8.66 (dd, J = 4.8, 1.2 Hz, 1H), 8.08 (d, J = 8.4 Hz, 2H), 8.00 - 7.93 (m, 4H), 7.72 - 7.67 (m, 1H), 7.53 (dd, J = 8.4, 4.8 Hz, 1H), 1.77 (s, 3H), 1.74 (s, 3H) Example 5: (Compound 5)
[0315] [ka]
[0316] Step 1: (Compound 5b) Add 5a (3g, 17.84 mmol) and N-bromosuccinimide (2.54g, 14.27 mmol) to dichloromethane (30 mL). Stir at room temperature for 2 hours. Complete reaction is confirmed by LC-MS. Concentrate the reaction mixture and purify the crude product by column chromatography to obtain white solid 2 (2.4g, yield: 54.45%). LC-MS m / z[M+H] + : 247.0. Step 2: (Compound 5c) Add N,N-dimethylformamide (5 mL) to 5b (500 mg, 2.0 mmol), p-trifluoromethyliodobenzene (660 mg, 2.4 mmol), cuprous iodide (77 mg, 0.4 mmol), potassium hydroxide (230 mg, 4.4 mmol), and N,N-diisopropylethylamine (52 mg, 0.4 mmol). Stir at 110°C for 5 hours. Complete reaction is confirmed by LC-MS. The reaction mixture is concentrated, and the crude product is purified by column chromatography to obtain yellow solid 3 (500 mg, yield: 63.17%). LC-MS m / z [M+H] + : 391.1 Step 3: (Compound 5) Add 2 mL of dioxane to 5c (200 mg, 0.5 mmol), dimethylphosphine oxide (80 mg, 1.0 mmol), cesium carbonate (330 mg, 1.0 mmol), palladium acetate (23 mg, 0.1 mmol), and 4,5-bis(diphenylphosphin)-9,9-dimethylxanthene (120 mg, 0.2 mmol). Stir at 110°C for 12 hours. Complete reaction is confirmed by LC-MS. The reaction mixture is concentrated, and the crude product is purified by reverse-phase column chromatography to obtain a white solid 5 (110 mg, yield: 55.10%). LC-MS m / z [M+H] + : 389.3. 1 H NMR (400 MHz, DMSO-d6) δ 8.82 (t, J = 1.6 Hz, 1H), 8.79 (t, J = 1.6 Hz, 1H), 8.53 (dd, J = 4.8, 1.6 Hz, 1H), 8.07 (d, J = 8.4 Hz, 2H), 8.02 (d, J = 8.4 Hz, 2H), 7.94 (ddd, J = 10.4, 8.4, 1.6 Hz, 1H), 7.72 (dd, J =8.4, 1.6 Hz, 1H), 7.49 (dd, J = 7.6, 4.8 Hz, 1H), 1.79 (s, 3H), 1.76 (s, 3H) Example 6: (Compound 6)
[0317] [ka]
[0318] Step 1: (Compound 6b) 6a (202 mg, 1.1 mmol), 4-iodobenzotrifluoride (345 mg, 1.3 mmol), potassium phosphate (450 mg, 2.1 mmol), 2-picolinic acid (12 mg, 101.5 μmol), and cuprous iodide (12 mg, 63.4 μmol)) are added to DMSO (5 mL), purged with nitrogen gas, and reacted at 120 °C for 12 hours. LC-MS is used to indicate completion of the reaction. 50 mL of water is added to the reaction mixture, extracted with ethyl acetate (50 mL x 2), washed with saturated brine (20 mL), dried over anhydrous sodium sulfate to concentrate, and purified by preparative plate to obtain a colorless liquid 6b (199 mg, yield: 47%).
[0319] Step 2: (Compound 6) 6b (50 mg, 151 μmol), dimethylphosphine oxide (12 mg, 151 μmol), Pd2(dba)3 (14 mg, 15 μmol), 4,5-bis(diphenylphosphin)-9,9-dimethylxanthene (17 mg, 30 μmol), and cesium carbonate (148 mg, 453 μmol) are mixed with 1,4-dioxane (5 mL), purged with nitrogen gas, and reacted at 50°C for 12 hours. LC-MS is used to indicate the completion of the reaction. Water (20 mL) is added to the reaction mixture, extracted with ethyl acetate (20 mL x 2), washed with saturated brine (10 mL), dried over anhydrous sodium sulfate, concentrated, and purified by preparative plate to obtain a colorless oily liquid 6 (5 mg, yield: 10%). LC-MS m / z [M+H] + : 329.1 1 HNMR(400 MHz, DMSO-d6) δ 7.75 (d, J =8.4 Hz, 2H), 7.47 - 7.44 (d, J =11.2 Hz, 1H), 7.31 - 7.28 (d, J =12.0 Hz, 1H), 7.14 - 7.18 (m, 3H), 2.37 (s, 3H), 1.65 (s, 3H), 1.62 (s, 3H) Example 7: (Compound 7)
[0320] [ka]
[0321] Step 1: (Compound 7b) Add 7a (0.35 g, 1.6 mmol), p-trifluoromethyliodobenzene (853 mg, 3.1 mmol), potassium phosphate (556 mg, 2.6 mmol), cuprous iodide (15 mg, 78.5 μmol), and 2-picolinic acid (15 mg, 125.5 μmol) to dimethyl sulfoxide (18 mL). Heat to 120 °C and stir for 12 hours, then detect complete reaction by LC-MS. Pour the reaction mixture into water (60 mL) and ethyl acetate (60 mL), wash the organic phase with saturated brine (60 mL x 2), dry over anhydrous sodium sulfate, filter, concentrate, and purify by column chromatography to obtain a colorless oily substance 7b (1.5 g, yield: 94.6%). 1 HNMR (400 MHz, CDCl3) δ 7.72-8.32 (m, 3H), 7.56-7.65 (m, 3H), 7.46-7.50 (m, 1H), 7.36 (d, J = 8.0 Hz, 1H), 7.05-7.08 (m, 2H) Step 2: (Compound 7) 7b (500 mg, 1.4 mmol), dimethylphosphine oxide (159 mg, 2.04 mmol), Pd2(dba)3 (125 mg, 136 μmol), 4,5-bis(diphenylphosphin)-9,9-dimethylxanthene (181 mg, 313 μmol), and cesium carbonate (1.33 g, 4.1 mmol) were added to dioxane (10 mL), and the mixture was heated to 50°C and stirred for 1 hour. Complete reaction was detected by LC-MS. The reaction mixture was concentrated, and yellow solid 7 (76 mg, yield 15.0%) was obtained by reverse-phase preparation. LC-MS m / z [M+H] + : 365.1 1HNMR (400 MHz, CDCl3) δ 8.50 (d, J = 13.2 Hz, 1H), 8.04 (dd, J = 2.4, 8.8 Hz, 1H), 8.00 (d, J = 8.0 Hz, 1H), 7.86 (td, J = 1.2, 9.6 Hz, 1H), 7.74 (d, J = 8.8 Hz, 2H), 7.66 (t, J = 8.8 Hz, 1H), 7.37 (t, J = 7.6 Hz, 1H), 7.16 (d, J = 7.6 Hz, 2H), 1.75 (s, 3H), 1.71 (s, 3H) Example 8: (Compound 8)
[0322] [ka]
[0323] Step 1: (Compound 8b) Compound 8a (330 mg, 1.1 mmol), 1-methyl-4-tri-n-butylstanylimidazole (408 mg, 1.1 mmol), and tetrakis(triphenylphosphine)palladium (127 mg, 0.1 mmol) were added to 1,4-dioxane (10 mL). The mixture was purged three times with nitrogen gas, heated to 60°C, and stirred for 14 hours. Complete reaction was confirmed by LC-MS. The reaction mixture was cooled to room temperature, filtered over diatomaceous earth, and obtained by column chromatography as a bright blue solid 8b (263.0 mg, yield: 94.1%). LC-MS m / z[M+H] + : 253.1. 1 HNMR(400 MHz, DMSO-d6) δ 7.88 (q, J = 2.4 Hz, 2H), 7.79 - 7.73 (m, 2H), 7.19 (s, 2H), 3.71 (s, 3H) Step 2: (Compound 8c) Dissolve 8b (260 mg, 1.0 mmol) in 1,2-dichloroethane (5 mL), add p-trifluoromethylphenylboronic acid (300 mg, 1.6 mmol) and copper acetate (920 mg, 0.1 mmol), and stir the reaction mixture under an air atmosphere for 4 days. LC-MS showed the formation of most of the product. Filter the reaction mixture through a diatomaceous earth bed, rinse with dichloromethane, concentrate, and obtain a brown solid 8c (80 mg, yield: 19.6%) by column chromatography. LC-MS m / z[M+H] + : 397.2. 1 HNMR (400 MHz, DMSO-d6) δ 12.06 (s, 1H), 8.24 - 8.19 (m, 2H), 8.03 (d, J = 1.2 Hz, 1H), 7.96 (d, J = 1.2 Hz, 1H), 7.92 (d, J = 8.4 Hz, 2H), 7.64 (d, J = 8.4 Hz, 2H), 3.77 (s, 3H) Step 3: (Compound 8) Compound 8c (70 mg, 0.2 mmol), dimethylphosphine oxide (29 mg, 0.4 mmol), and cesium carbonate (65 mg, 0.2 mmol) were dissolved in 1,4-dioxane (7 mL), purged three times with nitrogen gas, and palladium acetate (9 mg, 0.04 mmol) and 4,5-bis(diphenylphosphin)-9,9-dimethylxanthene (46 mg, 0.08 mmol) were added under nitrogen gas protection. After addition, the temperature was raised to 110°C and stirred for 12 hours. LC-MS confirmed that the starting materials had reacted completely. The reaction mixture was poured into water, extracted with ethyl acetate, the organic phase was washed once with brine, dried over anhydrous sodium sulfate, concentrated, and obtained by column chromatography as a brown, viscous solid 8 (20 mg, yield: 28.8%). LC-MS m / z[M+H] + : 395.2. 1HNMR (400 MHz, DMSO-d6) δ 12.27 (s, 1H), 8.43 (dd, J = 6.0, 2.0 Hz, 1H), 8.25 (dd, J = 11.2, 2.0 Hz, 1H), 8.06 - 7.94 (m, 4H), 7.67 (d, J = 8.8 Hz, 2H), 3.79 (s, 3H), 1.72 (s, 3H), 1.69 (s, 3H) Example 9: (Compound 9)
[0324] [ka]
[0325] Step 1: (Compound 9b) Compound 9a (4g, 28 mmol) was added to phosphorus oxybromide (20 mL), purged three times with nitrogen gas, heated to 70°C, stirred for 14 hours, and LC-MS was used to confirm complete reaction. The reaction mixture was poured into ice water, and sodium bicarbonate aqueous solution and potassium carbonate aqueous solution were added to adjust the pH to 9-10. Extraction was performed with dichloromethane, the organic phase was washed with brine, dried over anhydrous sodium sulfate, and concentrated to obtain brown solid 9b (4.8g, yield: 91%). LC-MS m / z[M+H] + : 186.9. 1 HNMR (400 MHz, CDCl3) δ 6.85 (d, J = 1.2 Hz, 1H), 4.04 - 3.92 (m, 2H), 2.86 (t, J = 7.6 Hz, 2H), 2.56 (q, J = 7.6 Hz, 2H) Step 2: (Compound 9d) 9c (2.0 g, 10 mmol) is added to tetrahydrofuran (15 mL), and under nitrogen gas protection, DMAP (3.84 g, 31 mmol) and di-tert-butyl dicarbonate (5.71 g, 26 mmol) are added. After addition, the temperature is raised to 45°C and stirred for 2 hours. LC-MS is used to show that no residue remains, the reaction mixture is poured into an aqueous citric acid solution, extracted with ethyl acetate, the organic phase is washed with brine, dried over anhydrous sodium sulfate, concentrated, purified by column chromatography, then slurryed with petroleum ether, filtered, and dried to obtain a white solid 9d (2.3 g, yield: 75%). LC-MS m / z[M+H] + : 291.0 Step 3: (Compound 9e) Compound 9d (2.6 g, 7 mmol) was added to DMSO (20 mL), purged three times with nitrogen gas, and p-trifluoromethylphenol (1.3 g, 8 mmol) and cesium carbonate (4.34 g, 13 mmol) were added. After adding these, the temperature was raised to 110°C and stirred for 1 hour. Complete reaction was confirmed by LC-MS, the reaction mixture was cooled to room temperature, diluted with ethyl acetate, a small amount of water was added, liquid-liquid separation was performed, and the mixture was extracted with ethyl acetate. The organic phase was washed once with brine, dried over anhydrous sodium sulfate, concentrated, and the crude product was purified by column chromatography to obtain a yellow solid 9e (1.8 g, yield: 81.31%). LC-MS m / z[M+H] + : 333.1. 1 HNMR (400 MHz, DMSO-d6) δ 7.70 (d, J = 8.8 Hz, 2H), 7.60 (d, J = 2.4 Hz, 1H), 7.40 (d, J = 2.4 Hz, 1H), 7.10 (d, J = 8.8 Hz, 2H), 5.52 (s, 2H) Step 4: (Compound 9f) Compound 9e (1.8 g, 5 mmol) was added to tetrahydrofuran (20 mL), and under nitrogen gas protection, DMAP (2.0 g, 16 mmol) and di-tert-butyl dicarbonate (3.6 g, 16 mmol) were added. After addition, the mixture was stirred at room temperature for 2 hours, and complete reaction was confirmed by LC-MS. The reaction mixture was poured into an aqueous citric acid solution, extracted with ethyl acetate, washed with brine, dried over anhydrous sodium sulfate, concentrated, the crude product was slurryed with petroleum ether, filtered, and dried to obtain a white solid 9f (1.2 g, yield: 41%). 1 HNMR (400 MHz, DMSO-d6) δ 8.34 (d, J = 2.4 Hz, 1H), 8.08 (d, J = 2.4 Hz, 1H), 7.82 (d, J = 8.4 Hz, 2H), 7.38 (d, J = 8.4 Hz, 2H), 1.40 (s, 18H) Step 5: (9g of compound) 9f (1.4g, 3 mmol), bis(pinacolato)diborone (1.38g, 5 mmol), and potassium acetate (645mg, 7 mmol) were added to 1,4-dioxane (28 mL). The mixture was purged three times with nitrogen gas, and Pd(dppf)Cl2 (190 mg, 0.3 mmol) was added under nitrogen gas protection. After addition, the temperature was raised to 100°C and stirred for 2 hours. Complete reaction was confirmed by LC-MS. The reaction mixture was cooled to room temperature, diluted with ethyl acetate, filtered through diatomaceous earth, rinsed twice with ethyl acetate, and the filtrate was concentrated to obtain 9 g (1.2 g, yield: 92%) of the crude product by column chromatography. LC-MS m / z[M+H] + : 499.3. 1 HNMR (400 MHz, DMSO-d6) δ 8.17 (d, J = 2.8 Hz, 1H), 7.89 (d, J = 2.8 Hz, 1H), 7.77 (d, J = 8.4 Hz, 2H), 7.27 (d, J = 8.4 Hz, 2H), 1.41 (s, 18H), 1.27 (s, 12H) Step 6: (Compound 9h) 9g (500mg, 1mmol), 9b (225mg, 1mmol), and potassium carbonate (280mg, 2mmol) were added to 1,4-dioxane (10mL) and water (1mL). The mixture was purged three times with nitrogen gas, and Pd(dppf)Cl2 (74mg, 0.1mmol) was added under nitrogen gas protection. After addition, the mixture was heated to 80°C and stirred for 3 hours. Complete reaction was confirmed by LC-MS, the reaction mixture was cooled to room temperature, filtered through diatomaceous earth, and the filtrate was concentrated to obtain the crude product. The crude product was purified by column chromatography to obtain an off-white solid 9h (400mg, yield: 71%). LC-MS m / z[M+H] + : 561.3. 1 HNMR (400 MHz, DMSO-d6) δ 8.22 (d, J = 2.8 Hz, 1H), 7.86 (d, J = 2.8 Hz, 1H), 7.81 (d, J = 8.4 Hz, 2H), 7.67 (s, 1H), 7.37 (d, J = 8.4 Hz, 2H), 4.00 (t, J = 7.2 Hz, 2H), 2.79 (t, J = 7.6 Hz, 2H), 2.53 (d, J = 7.2 Hz, 2H), 1.41 (s, 18H) Step 7: (Compound 9i) 9h (350 mg, 0.6 mmol) was added to a 4 M, 15 mL solution of dioxane hydrogen chloride, and the mixture was stirred at room temperature for 2 hours. LC-MS was used to confirm complete reaction. The reaction mixture was concentrated, poured into an aqueous sodium bicarbonate solution, extracted with ethyl acetate, washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated to obtain an off-white solid 9i (225 mg, yield: 100%). LC-MS m / z[M+H] + : 361.2. 1H NMR (400 MHz, DMSO-d6) δ 7.80 (d, J = 2.8 Hz, 1H), 7.68 (d, J = 8.4 Hz, 2H), 7.42 (d, J = 2.8 Hz, 1H), 7.36 (s, 1H), 7.11 (d, J = 8.4 Hz, 2H), 5.23 (s, 2H), 3.92 (t, J = 7.2 Hz, 2H), 2.74 (t, J = 7.6 Hz, 2H), 2.47 (d, J = 7.2 Hz, 2H) Step 8: (Compound 9J) 9i (350 mg, 0.6 mmol) and cuprous bromide (320 mg, 2 mmol) are dissolved in hydrobromic acid (560 mg, 7 mmol) aqueous solution (3 mL). At 0-5°C, sodium nitrite (80 mg, 1 mmol) aqueous solution (1 mL) is added dropwise. After addition, the mixture is slowly returned to room temperature and stirred for 5 hours. LC-MS shows the formation of the product. The reaction mixture is poured into an aqueous sodium bisulfite solution, the pH is adjusted to 10 with an aqueous sodium hydroxide solution, extracted with ethyl acetate, the organic phase is washed with saturated brine, dried over anhydrous sodium sulfate, concentrated, and purified by column chromatography to obtain a white solid 9j (100 mg, yield: 42%). LC-MS m / z[M+H] + : 424.1. 1 HNMR (400 MHz, DMSO-d6) δ 8.54 (d, J = 2.4 Hz, 1H), 8.08 (d, J = 2.4 Hz, 1H), 7.80 (d, J = 8.4 Hz, 2H), 7.69 (s, 1H), 7.40 (d, J = 8.4 Hz, 2H), 4.00 (t, J = 7.2 Hz, 2H), 2.80 (t, J = 7.6 Hz, 2H), 2.54 (t, J = 7.2 Hz, 2H) Step 9: (Compound 9) Dissolve 9j (80 mg, 0.2 mmol), dimethylphosphine oxide (30 mg, 2 mmol), and potassium phosphate (80 mg, 0.4 mmol) in 1,4-dioxane (2 mL), purge three times with nitrogen gas, and add palladium acetate (10 mg, 0.05 mmol) and 4,5-bis(diphenylphosphin)-9,9-dimethylxanthene (51 mg, 0.09 mmol) under nitrogen gas protection. After adding, raise the temperature to 110°C and stir for 1 hour. LC-MS confirms that the starting materials have reacted completely. Pour the reaction mixture into water, extract with ethyl acetate, wash the organic phase once with brine, dry over anhydrous sodium sulfate, concentrate, and reverse fractionate the crude product to obtain off-white solid 9 (25 mg, yield: 31%). LC-MS m / z[M+H] + : 422.2. 1 HNMR (400 MHz, DMSO-d6) δ 8.77 (dd, J = 10.8, 2.4 Hz, 1H), 8.26 (dd, J = 6.0, 2.4 Hz, 1H), 7.82 (d, J = 8.4 Hz, 2H), 7.71 (s, 1H), 7.43 (d, J = 8.4 Hz, 2H), 4.01 (t, J = 7.2 Hz, 2H), 2.81 (t, J = 7.6 Hz, 2H), 2.54 (q, J = 7.2 Hz, 2H), 1.73 (s, 3H), 1.70 (s, 3H) Example 10: (Compound 10)
[0326] [ka]
[0327] Step 1: (Compound 10b) Dissolve 10a (2.0 g, 7 mmol) in 1,4-dioxane (20 mL), add dimethylphosphine oxide (0.58 g, 7 mmol), potassium phosphate (1.56 g, 7 mmol), 4,5-bisdiphenylphosphin-9,9-dimethylxanthene (0.23 g, 0.4 mmol), and tris(dibenzylideneacetone)dipalladium (0.18 g, 0.2 mmol), purge three times with nitrogen gas, and heat to 100°C and stir for 3 hours. After monitoring the completion of the reaction by LC-MS, concentrate the reaction mixture, rotate dry to obtain the crude product, and separate and purify it by column chromatography to obtain a brown solid 10b (1.5 g, yield 89%). LC-MS m / z[M+H] + : 248.0 Step 2: (Compound 10c) Dissolve 10b (500 mg, 2.0 mmol) in tetrahydrofuran (10 mL), add sodium hydride (242 mg, 6 mmol, 60 w%), and heat to 65°C, stirring for 1 hour. Add di-tert-butyl dicarbonate (660 mg, 3 mmol) and stir at 65°C for 16 hours. After monitoring the completion of the reaction by LC-MS, add ice water (20 mL) to the reaction mixture, add ethyl acetate and extract three times, wash with saturated brine, dry over anhydrous sodium sulfate, concentrate under reduced pressure, and purify the crude product by column chromatography to obtain a yellow solid 10c (420 mg, yield 59%). LC-MS m / z[M+H] + : 348.0 Step 3: (Compound 10d) Dissolve 10c (400 mg, 1 mmol) in dioxane (10 mL), add 2-(tributylstannyl)pyridine (590 mg, 2 mmol), anhydrous lithium chloride (97 mg, 2 mmol), and tetrakis(triphenylphosphine)palladium (132 mg, 0.1 mmol), purge three times with nitrogen gas, then raise the temperature to 100°C and react for 16 hours. After monitoring the completion of the reaction by LC-MS, concentrate the reaction mixture. Separate and purify the crude product by column chromatography to obtain a white solid 10d (200 mg, yield 50%). LC-MS m / z [M+H] + : 347.0 Step 4: (Compound 10e) Dissolve 10d (150 mg, 0.4 mmol) in dichloromethane (3 mL), then add trifluoroacetic acid (1 mL). Stir for 2 hours while maintaining room temperature. After monitoring the completion of the reaction by LC-MS, concentrate the reaction mixture, dilute with ethyl acetate, wash the organic phase three times with aqueous sodium bicarbonate solution, wash with aqueous sodium chloride solution, dry over anhydrous sodium sulfate, and concentrate under reduced pressure. Separate and purify the crude product by column chromatography to obtain a yellow solid 10e (120 mg, 90% yield). LC-MS m / z[M+H] + : 247.1 Step 5: (Compound 10) Dissolve 10e (30 mg, 0.1 mmol) in acetonitrile (2 mL), add 4-trifluoromethylphenylboronic acid (35 mg, 0.2 mmol), 2,6-dimethylpyridine (20 mg, 0.2 mmol), copper acetate (22 mg, 0.1 mmol), and triethylamine (19 mg, 0.2 mmol), purge three times with oxygen gas, and stir at room temperature for 3 hours to react. After monitoring the completion of the reaction by LC-MS, concentrate the reaction mixture, separate and purify the crude product by column chromatography, and then reverse-phase fractionate to obtain a white solid 10 (21 mg, yield 44.4%). LC-MS m / z [M+H] + : 391.1. 1 HNMR (400 MHz, DMSOd6) δ 10.53 (s, 1H), 8.73 (d, J = 4.0 Hz, 1H), 8.07 (dd, J = 11.6, 1.6 Hz, 1H), 8.00 - 7.88 (m, 2H), 7.79 - 7.68 (m, 1H), 7.63 - 7.53 (m, 3H), 7.45 - 7.39 (m, 1H), 7.27 (d, J = 8.4 Hz, 2H), 1.69 (m, 6H) Example 11: (Compound 11)
[0328] [ka]
[0329] Step 1: (Compound 11a) 9g (550mg, 1 mmol), 1-methyl-4-bromoimidazole (200mg, 1 mmol), and potassium carbonate (265mg, 2 mmol) were added to 1,4-dioxane (20 mL) and water (2 mL). The mixture was purged three times with nitrogen gas, and Pd(dppf)Cl2 (76 mg, 0.1 mmol) was added under nitrogen gas protection. After addition, the temperature was raised to 80°C and stirred for 3 hours. Complete reaction was confirmed by LC-MS, the reaction mixture was cooled to room temperature, filtered through diatomaceous earth, the filtrate was concentrated, and purified by column chromatography to obtain a brown solid 11a (300 mg, yield: 59%). LC-MS m / z[M+H] + : 535.2. 1 HNMR (400 MHz, DMSO-d6) δ 8.25 (d, J = 2.8 Hz, 1H), 7.87 (d, J = 2.8 Hz, 1H), 7.82 (d, J = 8.4 Hz, 2H), 7.77 (d, J = 1.2 Hz, 1H), 7.73 (d, J = 1.2 Hz, 1H), 7.40 (d, J = 8.4 Hz, 2H), 3.71 (s, 3H), 1.41 (s, 18H) Step 2: (Compound 11b) 11a (270 mg, 0.51 mmol) was added to a 4 M, 5 mL solution of dioxane hydrogen chloride, and the mixture was stirred at room temperature for 2 hours. LC-MS was used to confirm complete reaction. The reaction mixture was concentrated, poured into an aqueous sodium bicarbonate solution (pH=9), extracted with ethyl acetate, the organic phase was washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated to obtain a brown solid 11b (200 mg, yield: 100%). LC-MS m / z[M+H] + : 335.1. 1 HNMR (400 MHz, DMSO-d6) δ 7.82 (d, J = 2.8 Hz, 1H), 7.72 - 7.65 (m, 3H), 7.43 (dd, J = 4.4, 2.0 Hz, 2H), 7.19 - 7.12 (m, 2H), 5.25 (s, 2H), 3.64 (s, 3H) Step 3: (Compound 11c) Compound 11b (180 mg, 0.5 mmol) and cuprous bromide (306 mg, 2 mmol) are dissolved in hydrobromic acid (530 mg, 7 mmol) aqueous solution (4 mL). Sodium nitrite (72 mg, 1 mmol) aqueous solution (1 mL) is added dropwise at 0-5°C. After addition, the mixture is slowly returned to room temperature and stirred for 5 hours. LC-MS shows product formation. The reaction mixture is poured into an aqueous sodium bisulfite solution, the pH is adjusted to 10 with an aqueous sodium hydroxide solution, extracted with ethyl acetate, the organic phase is washed once with brine, dried over anhydrous sodium, concentrated, and purified by column chromatography to obtain a yellow solid 11c (40 mg, yield: 18%). LC-MS m / z[M+H] + : 398.0. 1 HNMR (400 MHz, DMSO-d6) δ 8.57 (d, J = 2.4 Hz, 1H), 8.10 (d, J = 2.4 Hz, 1H), 7.84 - 7.78 (m, 3H), 7.75 (d, J = 1.2 Hz, 1H), 7.43 (d, J = 8.4Hz, 2H), 3.71 (s, 3H) Step 4: (Compound 11) Dissolve 11c (30 mg, 0.08 mmol), dimethylphosphine oxide (12 mg, 0.2 mmol), and cesium carbonate (29 mg, 0.09 mmol) in 1,4-dioxane (3 mL), purge three times with nitrogen gas, and add palladium acetate (12 mg, 0.05 mmol) and 4,5-bis(diphenylphosphin)-9,9-dimethylxanthene (65 mg, 0.1 mmol) under nitrogen gas protection. After adding, raise the temperature to 110°C and stir for 4 hours. LC-MS confirms that the starting materials have reacted completely. Pour the reaction mixture into water, extract with ethyl acetate, wash the organic phase once with brine, dry over anhydrous sodium sulfate, concentrate, and reverse fractionate the crude product to obtain a white solid 11 (3 mg, yield: 10%). LC-MS m / z[M+H] + : 396.2. 1HNMR (400 MHz, DMSO-d6) δ 8.80 (dd, J = 10.8, 2.4 Hz, 1H), 8.28 (dd, J = 5.6, 2.4 Hz, 1H), 7.83 (d, J = 8.4 Hz, 2H), 7.79 (d, J = 1.2 Hz, 1H), 7.76 (d, J = 1.2 Hz, 1H), 7.46 (d, J = 8.4 Hz, 2H), 3.72 (s, 3H), 1.73 (s, 3H), 1.70 (s, 3H) Example 12: (Compound 12)
[0330] [ka]
[0331] Step 1: (Compound 12b) 10a (5.7g, 19 mmol) and p-trifluoromethylphenylboronic acid (7.8g, 38 mmol) are dissolved in dichloromethane (114 mL), and triethylamine (3.9g, 38 mmol) and Cu(OAc)2 (5.2g, 29 mmol) are added. The mixture is reacted at room temperature under an oxygen gas atmosphere for 2 hours. Product formation is shown by LC-MS. The reaction mixture is concentrated and purified by column chromatography to obtain an orange oily liquid 12b (2.31g, yield: 24.5%). LC-MS m / z[M+H] + : 443.9 Step 2: (Compound 12c) 1,4-dioxane (231 mL) was added to 12b (2.3 g, 5 mmol), dimethylphosphine oxide (366 mg, 5 mmol), Pd2(dba)3 (429 mg, 469 μmol), 4,5-bis(diphenylphosphin)-9,9-dimethylxanthene (543 mg, 938 μmol), and Cs2CO3 (4.6 g, 14 mmol). The mixture was then purged with nitrogen gas and reacted at 50°C for 12 hours. Complete reaction was confirmed by TLC. The reaction mixture was filtered, concentrated, and purified by column chromatography to obtain a brown oily liquid 12c (1.80 g, yield: 97.8%).
[0332] Step 3: (Compound 12) Dissolve 12c (200 mg, 510 μmol), 2-bromopyrimidine (81 mg, 510 μmol), Pd(dtbpf)Cl2 (33 mg, 51 μmol), and hexamethyldistannan (184 mg, 561 μmol) in 1,4-dioxane (5 mL) and react at 110 °C for 24 hours under a nitrogen atmosphere. LC-MS indicates completion of the reaction. Add water (30 mL) to the reaction mixture, extract with ethyl acetate (30 mL x 3), wash the organic phase with saturated potassium fluoride aqueous solution (20 mL x 2), dry over anhydrous sodium sulfate, and concentrate. After preparative plate purification, reverse-phase preparative purification yields a gray solid 12 (7 mg, yield: 3.4%). LC-MS m / z[M+H] + : 392.1 1 HNMR (400 MHz, DMSO-d6) δ 11.39 (s, 1H), 9.01 (d, J = 4.8 Hz, 2H), 8.86 (d, J = 12.4 Hz, 1H), 7.71 - 7.74 (m, 1H), 7.67 (d, J = 8.8 Hz, 2H), 7.46 - 7.53 (m, 4H), 1.67 (s, 3H), 1.64 (s, 3H) Example 13: (Compound 13)
[0333] [ka]
[0334] Step 1: (Compound 13a) Dissolve 10a (5.0 g, 17 mmol) and 2-chloro-5-trifluoromethylpyridine (3.1 g, 17 mmol) in N,N-dimethylformamide (50 mL), then add sodium tert-butoxide (4.8 g, 50 mmol), and react at 120°C for 12 hours. LC-MS shows the formation of the product. Pour the reaction mixture into water (200 mL), extract with ethyl acetate (100 mL x 3), wash with saturated brine (50 mL x 2), dry over anhydrous sodium sulfate, and concentrate. Purify by column chromatography to obtain a yellow oily liquid 13a (490 mg, yield: 6.59%). LC-MS m / z[M+H] + : 445.0 Step 2: (Compound 13b) 1,4-dioxane (10 mL) is added to 13a (200 mg, 451 μmol), dimethylphosphine oxide (35 mg, 451 μmol), Pd2(dba)3 (41 mg, 45 μmol), 4,5-bis(diphenylphosphin)-9,9-dimethylxanthene (52 mg, 90 μmol), and cesium carbonate (441 mg, 1.4 mmol). The mixture is purged with nitrogen gas and reacted at room temperature for 2 hours. LC-MS is used to indicate completion of the reaction. Water (20 mL) is added to the reaction mixture, extracted with ethyl acetate (20 mL x 3), washed with saturated brine (5 mL x 2), and dried over anhydrous sodium sulfate to concentrate. Purified by preparative plate separation, a yellow oily liquid 13b (70.0 mg, yield: 38.9%) is obtained. LC-MS m / z[M+H] + : 395.1 Step 3: (Compound 13) Dissolve 13b (65 mg, 162 μmol), 4-bromo-1-methyl-1H-imidazole (26 mg, 162 μmol), Pd(dtbpf)Cl2 (10 mg, 16 μmol), and hexamethyldistannan (58 mg, 178 μmol) in 1,4-dioxane (7 mL) and react at 110 °C for 24 hours under a nitrogen atmosphere. LC-MS indicates completion of the reaction. Filter the reaction mixture and concentrate it. Purify by reverse-phase preparative fractionation to obtain a grayish-brown gel-like solid 13 (6.6 mg, yield: 10%). LC-MS m / z[M+H] + : 395.1 1 HNMR (400 MHz, CDCl3) δ 12.03 (s, 1H), 8.77 (dd, J = 2.8, 8.4 Hz, 1H), 8.51 (s, 1H), 8.04 (dd, J = 1.6, 12.4 Hz, 1H), 7.68 (dd, J = 2.4, 8.8 Hz, 1H), 7.55 (s, 1H), 7.36 - 7.41 (m, 2H), 6.92 (d, J = 8.8 Hz, 1H), 3.78 (s, 3H), 1.76 (s, 3H), 1.73 (s, 3H) Example 14: (Compound 14)
[0335] [ka]
[0336] Dissolve 12c (100 mg, 255 μmol), 4-bromo-1-methyl-1H-imidazole (41 mg, 255 μmol), Pd(dtbpf)Cl2 (17 mg, 26 μmol), and hexamethyldistannan (92 mg, 280 μmol) in 1,4-dioxane (3 mL) and react at 110 °C for 24 hours under a nitrogen atmosphere. LC-MS indicates completion of the reaction. Filter the reaction mixture and rotate dry it. Purify by reverse phase preparative separation to obtain a brown gel-like solid 14 (16 mg, yield: 16.2%). LC-MS m / z[M+H] + : 394.2 1 HNMR (400 MHz, DMSO-d6) δ 10.77 (s, 1H), 7.99 - 8.02 (m, 1H), 7.85 - 7.79 (m, 2H), 7.60 - 7.51 (m, 4H), 7.29 (d, J = 8.4 Hz, 2H), 3.74 (s, 3H), 1.67 (s, 3H), 1.63 (s, 3H) Example 15: (Compound 15)
[0337] [ka]
[0338] Step 1: (Compound 15b) Compound 15a (200 mg, 0.8 mmol), dimethylphosphine oxide (120 mg, 1.6 mmol), cesium carbonate (510 mg, 1.6 mmol), palladium acetate (35 mg, 0.2 mmol), and 4,5-bisdiphenylphosphin-9,9-dimethylxanthene (180 mg, 0.3 mmol) were added to a 5 mL solution of dioxane. The mixture was purged three times with nitrogen gas, and the temperature was raised to 110 °C and stirred for 4 hours. The reaction mixture was directly concentrated and separated by column chromatography to obtain compound 15b (150 mg, yield: 76%). LCMS m / z[M+H] + : 250.1 Step 2: (Compound 15c) Compound 15b (150 mg, 0.6 mmol), iron powder (0.34 g, 6 mmol), ammonium chloride (0.32 g, 6 mmol), and water (1 mL) are added to methanol (5 mL). The mixture is heated to 50°C and stirred for 16 hours. The reaction mixture is filtered through diatomaceous earth, and the filtrate is concentrated to obtain crude compound 15c (0.12 g), which is used directly in the next step. LCMS m / z[M+H] + : 220.1 Step 3: (Compound 15) Compound 15c (0.12 g, 0.54 mmol), 4-trifluoromethylphenylboronic acid (0.21 g, 1.1 mmol), copper acetate (54 mg, 0.3 mmol), and triethylamine (0.16 g, 1.6 mmol) are added to a solution of dioxane (1 mL). The mixture is heated to 60°C and stirred for 3 hours with the vent open. The reaction mixture is concentrated directly and separated by column chromatography to obtain yellow solid compound 15 (4 mg, yield: 2%). LCMS m / z[M+H] + : 364.1 1HNMR (400 MHz, DMSO-d6) δ 8.85 (s, 1H), 8.44 (dd, J = 13.1, 1.5 Hz, 1H), 8.18 (dd, J = 8.7, 2.5 Hz, 1H), 7.93 - 7.80 (m, 2H), 7.66 - 7.56 (m, 2H), 7.53 (d, J = 8.5 Hz, 2H), 7.04 (d, J = 8.4 Hz, 2H), 1.78 (s, 3H), 1.75 (s, 3H) Example 16: (Compound 16)
[0339] [ka]
[0340] Step 1: (Compound 16b) Compound 16a (2.1g, 11.93 mmol), 2-chloro-5-nitrophenylboronic acid (3.87g, 19.22 mmol), potassium carbonate (6.27g, 45.33 mmol), and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium dichloromethane complex (1.75g, 2.39 mmol) were added to 1,4-dioxane (50 mL) and water (10 mL). The mixture was stirred at 85°C for 6 hours under nitrogen gas protection. The reaction mixture was allowed to return to room temperature, silica gel was added, and the mixture was separated by column chromatography to obtain compound 16b (700 mg, yield: 15%). LCMS m / z[M+H] + : 253.1 Step 2: (Compound 16c) Compound 16b (700 mg, 2.77 mmol), p-bromobenzotrifluoride (0.81 g, 3.6 mmol), cesium carbonate (2.71 g, 8.31 mmol), and methanesulfonic acid (2-dicyclohexylphosphino-2',4',6'-triisopropyl-1,1'-biphenyl)(2'-amino-1,1'-biphenyl-2-yl)palladium(II) (0.12 g, 0.14 mmol) were added to 1,4-dioxane (20 mL). The mixture was stirred at 120 °C for 16 hours under nitrogen gas protection. The reaction mixture was allowed to return to room temperature, silica gel was added, and the compounds were separated by column chromatography to obtain compound 16c (800 mg, yield: 40%). LCMS m / z[M+H] + : 361.2 Step 3: (Compound 16d) 16c (850 mg, 2.36 mmol), zinc powder (2.31 g, 35.4 mmol), and saturated ammonium chloride aqueous solution (4 mL) were added to ethanol (20 mL). The mixture was stirred at 80°C for 2 hours under nitrogen gas protection. The reaction mixture was allowed to cool to room temperature, filtered, and silica gel was added to the filtrate. Separation by column chromatography yielded compound 16d (330 mg, yield: 42%). LCMS m / z[M+H] + : 331.1 Step 4: (Compound 16e) 16d (250 mg, 0.76 mmol) and cuprous bromide (220 mg, 1.52 mmol) were added to acetonitrile (5 mL), and tert-butyl nitrite (240 mg, 2.28 mmol) was added at 0°C. The mixture was stirred at room temperature for 2 hours under nitrogen gas protection, and aqueous sodium bicarbonate and ethyl acetate were added. Separation extraction was performed, the organic phase was dried over anhydrous sodium sulfate, silica gel was added to the organic phase, and the mixture was separated by column chromatography to obtain compound 16e (100 mg, yield: 34%). LCMS m / z[M+H] + : 394.0 Step 5: (Compound 16) 16e (42 mg, 0.11 mmol), dimethylphosphine oxide (17 mg, 0.22 mmol), cesium carbonate (220 mg, 1.52 mmol), 4,5-bisdiphenylphosphin-9,9-dimethylxanthene (13 mg, 0.02 mmol), and tris(dibenzylideneacetone)palladium (10 mg, 0.01 mmol) were added to 1,4-dioxane (1.5 mL). The mixture was stirred at 110 °C for 12 hours under nitrogen gas protection, and the reaction mixture was allowed to return to room temperature. Compound 16 (12 mg, yield: 29%) was obtained by high-performance liquid chromatography. LCMS m / z[M+H] + : 392.1 1 HNMR (400 MHz, DMSO-d6) δ 8.21 (dd, J = 12.0, 1.5 Hz, 1H), 7.92 (d, J = 8.4 Hz, 2H), 7.82 (d, J = 8.4 Hz, 2H), 7.69 (q, J = 3.1, 2.2 Hz, 2H), 7.56 (ddd, J = 11.4, 8.4, 1.6 Hz, 1H), 4.08 (s, 3H), 1.80 (d, J = 13.0 Hz, 6H) Example 17: (Compound 17)
[0341] [ka]
[0342] Step 1: (Compound 17b) Dissolve 17a (3.0 g, 10 mmol) in dioxane (50 mL), add dimethylphosphine oxide (0.86 g, 11 mmol), potassium phosphate (2.33 g, 11 mmol), 4,5-bisdiphenylphosphin-9,9-dimethylxanthene (0.35 g, 0.6 mmol), and tris(dibenzylideneacetone)dipalladium (0.27 g, 0.3 mmol), purge three times with nitrogen gas, and heat to 100 °C and stir for 3 hours. Concentrate the reaction mixture to obtain the crude product, and separate the crude product by column chromatography to obtain the brown solid 17b (2 g, yield: 80%). LCMS m / z[M+H] +: 249.0 Step 2: (Compound 17c) Dissolve 17b (500 mg, 2.01 mmol) in acetonitrile (10 mL), add 4-trifluoromethylphenylboronic acid (766.7 mg, 4.02 mmol), 2,6-dimethylpyridine (430 mg, 4.02 mmol), copper acetate (547 mg, 3.01 mmol), and triethylamine (406.3 mg, 4.02 mmol), purge three times with oxygen gas, raise the temperature to 80°C, and stir for 24 hours to allow the reaction to proceed. Concentrate the reaction mixture, and separate the crude product by column chromatography to obtain a brown solid 17c (200 mg, yield: 25%). LCMS m / z[M+H] + : 393.0 Step 3: (Compound 17) Dissolve 17c (90 mg, 0.23 mmol) in dioxane (3 mL) and water (1 mL). Add 1-methylpyrazole-3-boronic acid (43.2 mg, 0.34 mmol), potassium carbonate (63.3 mg, 0.46 mmol), and [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium (16.8 mg, 0.023 mmol). The mixture is purged three times with nitrogen gas, then heated to 100°C and reacted for 16 hours. Concentrate the reaction mixture. Separate the crude product by column chromatography and then by high-performance liquid chromatography to obtain a white solid 17 (50.8 mg, yield: 56%). LCMS m / z[M+H] + : 395.1 1 HNMR (400 MHz, MeOD) δ 8.53 (dd, J = 6.0, 2.1 Hz, 1H), 8.36 (dd, J = 11.4, 2.2 Hz, 1H), 8.06 (d, J = 8.5 Hz, 2H), 7.76 (d, J = 2.4 Hz, 1H), 7.63 (d, J = 8.6 Hz, 2H), 6.97 (d, J = 2.4 Hz, 1H), 4.09 (s, 3H), 1.89 (s, 3H), 1.86 (s, 3H) Example 18: (Compound 18)
[0343] [ka]
[0344] Dissolve 17c (200 mg, 0.51 mmol) in dioxane (10 mL), add pyrazole (173.2 mg, 2.55 mmol), cuprous oxide (36.4 mg, 0.25 mmol), cesium carbonate (331.5 mg, 1.02 mmol), and salicylate oxime (69.8 mg, 0.51 mmol), and then react at 120°C for 60 hours under nitrogen gas protection. Concentrate the reaction mixture and separate by column chromatography. Further separation of the crude product by high-performance liquid chromatography yields a white solid (53.3 mg, yield: 28%). LCMS m / z[M+H] + : 381.2 1 HNMR (400 MHz, DMSO-d6) δ 8.53 (dd, J = 6.0, 2.0 Hz, 1H), 8.33 - 8.28 (m, 1H), 8.09 (dd, J = 11.2, 2.0 Hz, 1H), 7.91 (dd, J = 12.1, 5.2 Hz, 3H), 7.58 (d, J = 8.6 Hz, 2H), 6.66 - 6.61 (m, 1H), 1.86 (s, 3H), 1.82 (s, 3H) Example 19: (Compound 19)
[0345] [ka]
[0346] Step 1: (Compound 19b) 19a (2.0 g, 11.45 mmol) is added to dry dichloromethane (50 mL), purged with argon gas, and stirred at room temperature. Bromine (680 μL, 13.28 mmol) is added dropwise, and the mixture is stirred for 20 minutes. The solvent is removed under reduced pressure, and the residue is dispersed in petroleum ether (20 mL). The brown solid is filtered, the filter cake is washed with petroleum ether (2 × 10 mL), and dried under vacuum to obtain compound 19b (1.9 g, yield: 68%). LCMS m / z[M+H] + : 253.1 Step 2: (Compound 19c) At room temperature, under an argon gas atmosphere, a 1.9 g, 7.6 mmol solution of compound 19b in 1,4-dioxane (50 mL) is added dropwise to a 1:1 solution (20 mL) of 3,4-diaminopyridine (1.63 g, 15.2 mmol) in 1,4-dioxane and methanol. After 2 hours of reaction, the solvent is removed under reduced pressure, and the resulting residue is dissolved in a mixed solvent of methanol and ethyl acetate (20 mL / 20 mL). The mixture is then heated to 80°C under an oxygen gas (1 atm) atmosphere and reacted for 3 hours. The solvent is removed under reduced pressure, and the residue is separated by column chromatography to obtain the yellow solid compound 19c (450 mg, yield: 37%). LCMS m / z[M+H] + : 170.1 Step 3: (Compound 19d) At 0°C, a solution of compound 19c (450 mg, 1.57 mmol) in tetrahydrofuran (12 mL) is mixed with N-bromosuccinimide (396 mg, 9.42 mmol), and the temperature is further increased to 60°C, with stirring continued for 2 hours. After the reaction is complete, the system is quenched with saturated sodium bicarbonate aqueous solution, extracted with ethyl acetate, and the organic phase is concentrated and separated by column chromatography to obtain a grayish-white solid 19d (512 mg, yield: 78%). LCMS m / z[M+H] + : 248.1 Step 4: (Compound 19e) 19d (350 mg, 1.4 mmol), 4-trifluoromethylphenylboronic acid (532 mg, 2.8 mmol), copper acetate (126 mg, 0.7 mmol), 4,5-bis(diphenylphosphin)-9,9-dimethylxanthene (404 mg, 0.7 mmol), and pyridine (332 mg, 4.2 mmol) were added to dichloromethane (40 mL) and reacted at 60°C under an oxygen gas atmosphere for 16 hours. The reaction mixture was cooled and concentrated, and the resulting residue was separated by column chromatography to obtain a grayish-white solid 19e (289 mg, yield: 53%). LCMS m / z[M+H] + : 392.1 Step 5: (Compound 19) 19e (150 mg, 0.38 mmol), dimethylphosphine oxide (292 mg, 3.8 mmol), palladium acetate (16 mg, 0.07 mmol), 4,5-bis(diphenylphosphin)-9,9-dimethylxanthene (45 mg, 0.076 mmol), and cesium carbonate (247 mg, 0.76 mmol) were added to 1,4-dioxane (10 mL) and reacted at 110 °C for 16 hours under a nitrogen atmosphere. The reaction mixture was cooled and concentrated, and the resulting residue was separated by column chromatography and then by high-performance liquid chromatography to obtain a white solid 19 (67 mg, yield: 54%). LCMS m / z[M+H] + : 390.1 1 HNMR (400 MHz, MeOD) δ 8.87 - 8.82 (m, 1H), 8.65 (d, J = 2.4Hz, 1H), 8.51 (d, J = 2.4Hz, 1H), 8.07 - 7.94 (m, 5H), 7.83 - 7.80 (m, 1H), 1.92 (s, 3H), 1.88 (s, 3H). Example 20: (Compound 20)
[0347] [ka]
[0348] Dissolve 17c (200 mg, 0.51 mmol) in 1,4-dioxane (10 mL), add 4-(trifluoromethyl)-1H-pyrazole (348.7 mg, 2.54 mmol), cuprous oxide (36.4 mg, 0.25 mmol), cesium carbonate (331.5 mg, 1.02 mmol), and salicylate oxime (69.8 mg, 0.51 mmol), and then react at 120°C for 72 hours under nitrogen gas protection. Concentrate the reaction mixture, separate the residue by column chromatography, and further separate the crude product by high-performance liquid chromatography to obtain a white solid 20 (28.8 mg, yield: 13%). LCMS m / z[M+H] + : 449.1 1 HNMR (400 MHz, DMSO-d6) δ 8.82 (d, J = 0.7 Hz, 1H), 8.60 (dd, J = 5.9, 2.0 Hz, 1H), 8.20 (s, 1H), 8.14 (dd, J = 11.1, 2.0 Hz, 1H), 7.86 (d, J = 8.5 Hz, 2H), 7.58 (d, J = 8.6 Hz, 2H), 1.86 (s, 3H), 1.82 (s, 3H). Example 21: (Compound 21)
[0349] [ka]
[0350] Step 1: (Compound 21b) Compound 9b (500 mg, 2.67 mmol) is dissolved in anhydrous tetrahydrofuran (10 mL), the mixture is purged three times with argon gas, cooled to -5 to 0°C, isopropyl magnesium chloride (412 mg, 4.01 mmol) in a tetrahydrofuran solution (2 M) is added dropwise, the mixture is stirred for 1 hour, tributyltin chloride (956 mg, 2.94 mmol) is added dropwise, the mixture is stirred for 4 hours, aqueous potassium fluoride is added dropwise to the reaction mixture, the mixture is stirred for 1 hour, the mixture is filtered over diatomaceous earth, the filtrate is extracted with ethyl acetate, the organic phase is washed once with brine, dried over anhydrous sodium sulfate, and concentrated to obtain crude oily substance 21b (1060 mg, yield: 100%). LCMS m / z[M+H] + : 399.2 Step 2: (Compound 21d) Compounds 21c (950 mg, 3.2 mmol), 21b (1270 mg, 3.2 mmol), tetrakis(triphenylphosphine)palladium (370 mg, 0.32 mmol), and cuprous iodide (61 mg, 0.32 mmol) were added to 1,4-dioxane (10 mL). The mixture was purged three times with argon gas, heated to 80°C, and stirred for 16 hours. The reaction mixture was concentrated and separated by column chromatography to obtain a brown solid 21d (740 mg, yield: 83%). LCMS m / z[M+H] + : 278.0 Step 3: (Compound 21e) Compound 21d (300 mg, 1.08 mmol) is dissolved in acetonitrile (6 mL), and 4-trifluoromethylphenylboronic acid (308 mg, 1.62 mmol), triethylamine (110 mg, 1.09 mmol), 2,6-dimethylpyridine (12 mg, 0.11 mmol), and copper acetate (20 mg, 0.11 mmol) are added. After adding these, the reaction mixture is exposed to air and stirred for 3 hours. The reaction solution is diluted with ethyl acetate, concentrated, and separated by column chromatography to obtain a brown oily substance 21e (180 mg, yield: 39%). LCMS m / z[M+H] + : 422.1 Step 4: (Compound 21) Compound 21e (180 mg, 0.43 mmol), dimethylphosphine oxide (50 mg, 0.64 mmol), and potassium phosphate (183 mg, 0.86 mmol) were dissolved in 1,4-dioxane (10 mL), substituted three times with argon gas, and then protected with argon gas to remove trisdibenzylideneacetone dipalladium (40 mg, 0.044 mmol) and 4,5-bis(diphenylphosphine)-9,9-dimethylxanthene (50 mg, 0.0 Add 86 mmol of ethyl acetate, raise the temperature to 110°C, stir for 12 hours, combine the reaction mixtures, filter through a diatomaceous earth layer, rinse with ethyl acetate, wash the organic phase once with brine, dry over anhydrous sodium sulfate, concentrate, separate by column chromatography to obtain a white solid, further slurry with petroleum ether / ethyl acetate = 5 / 1 (5 mL), filter, and dry the filtered cake under vacuum to obtain a yellow solid 21 (100 mg, yield: 56%). LCMS m / z[M+H] + : 420.2 1 HNMR (400 MHz, DMSO-d6) δ 10.79 (s, 1H), 8.04 - 7.94 (m, 1H), 7.72 (s, 1H), 7.59 (d, J = 8.4 Hz, 2H), 7.54 -7.46 (m, 2H), 7.27 (d, J = 8.4 Hz, 2H), 4.03 (t, J = 7.1 Hz, 2H), 2.86 (t, J = 7.5 Hz, 2H), 2.56 (q, J = 7.3 Hz, 2H), 1.66 (s, 3H), 1.63 (s, 3H) Example 22: (Compound 22)
[0351] [ka]
[0352] Step 1: (Compound 22a) Compounds 8a (980 mg, 3.28 mmol), 21b (1200 mg, 2.72 mmol), tetrakis(triphenylphosphine)palladium (314 mg, 0.27 mmol), and cuprous iodide (52 mg, 0.27 mmol) were added to 1,4-dioxane (10 mL). The mixture was purged three times with argon gas, heated to 80°C, and stirred for 26 hours. The reaction mixture was concentrated and separated by column chromatography to obtain a brown solid 22a (450 mg, yield: 59%). LCMS m / z[M+H] + : 279.1 Step 2: (Compound 22b) Compound 22a (330 mg, 1.18 mmol) is dissolved in 1,2-dichloroethane (10 mL), and 4-trifluoromethylphenylboronic acid (240 mg, 1.26 mmol) and copper acetate (200 mg, 1.1 mmol) are added. After adding these, the reaction mixture is exposed to air and stirred for 3 hours. The reaction solution is diluted with ethyl acetate, concentrated, and separated by column chromatography to obtain a yellow solid 22b (250 mg, yield: 50%). LCMS m / z[M+H] + : 423.1 Step 3: (Compound 22) Compound 22b (170 mg, 0.40 mmol), dimethylphosphine oxide (51 mg, 0.65 mmol), and potassium phosphate (170 mg, 0.80 mmol) were dissolved in 1,4-dioxane (10 mL), substituted three times with argon gas, and then protected with argon gas to remove trisdibenzylideneacetone dipalladium (44 mg, 0.048 mmol) and 4,5-bis(diphenylphosphine)-9,9-dimethylxanthene (54 mg, 0.0 Add 93 mmol of ethyl acetate, raise the temperature to 110°C, stir for 12 hours, combine the reaction mixtures, filter through a diatomaceous earth layer, rinse with ethyl acetate, wash the organic phase once with brine, dry over anhydrous sodium sulfate, concentrate, separate by column chromatography to obtain a white solid, further slurry with petroleum ether / ethyl acetate = 5 / 1 (5 mL), filter, and dry the filtered cake under vacuum to obtain a yellow solid 22 (120 mg, yield: 71%). LCMS m / z[M+H] + : 421.2 1HNMR (400 MHz, DMSO-d6) δ 12.35 (d, J = 3.5 Hz, 1H), 8.41 (dq, J = 4.4, 2.1 Hz, 1H), 8.22 (dq, J = 11.1, 2.1 Hz, 1H), 7.99 (dt, J = 8.7, 3.5 Hz, 3H), 7.70 - 7.61 (m, 2H), 4.09 (q, J = 6.0, 3.7 Hz, 2H), 2.98 - 2.88 (m, 2H), 2.60 (d, J = 10.0 Hz, 2H), 1.72 (d, J = 3.8 Hz, 3H), 1.69 (d, J = 3.6 Hz, 3H). Example 23: (Compound 23)
[0353] [ka]
[0354] Step 1: (Compound 23b) Add 23a (6g, 25.87 mmol), ammonium hypophosphate (3.22g, 38.8 mmol), and hexamethyldisilazane (16.7g, 103.48 mmol) to 1,2,4-trimethylbenzene (42 mL). Stir at 150°C for 12 hours under nitrogen gas protection. Allow the reaction mixture to cool to room temperature, filter, concentrate the filtrate under reduced pressure until a solid precipitates, filter again, concentrate the filtrate again under reduced pressure until a solid precipitates, filter again, and concentrate again to obtain the oily substance 23b (4g, yield: 114%). LCMS m / z[M+H] + : 137.0 Step 2: (Compound 23c) 23b (3.3g, 24.25 mmol), cesium carbonate (15.8g, 48.5 mmol), and 4-methoxybenzyl chloride (5.7g, 36.38 mmol) were added to N,N-dimethylformamide (24 mL). The mixture was stirred at 110°C for 16 hours under nitrogen gas protection. The reaction mixture was allowed to return to room temperature, silica gel was added, and the mixture was separated by column chromatography to obtain 23c (1.5g, yield: 24%). LCMS m / z[M+H] + : 257.2 Step 3: (Compound 23d) 23c (1.4g, 2.36 mmol) and palladium carbon (200 mg) were added to tetrahydrofuran (40 mL), the mixture was purged five times with hydrogen gas, and the mixture was stirred at room temperature for 16 hours under hydrogen gas protection. The reaction mixture was filtered, and the filtrate was concentrated to obtain 23d (700 mg, yield: 94%).
[0355] Step 4: (Compound 23e) Add 23d (125 mg, 0.92 mmol) and N,N-dimethylformamide (15 mg, 0.21 mmol) to dichloromethane (4 mL), then slowly add oxalyl chloride (0.35 g, 2.76 mmol), stir at room temperature for 16 hours under nitrogen gas protection, and concentrate the reaction mixture to obtain 23e (130 mg, yield: 92%), which is used directly in the next step.
[0356] Step 5: (Compound 23f) Add 23e (125 mg, 0.81 mmol) to dichloromethane (3 mL), cool to -78°C, then add 1.62 mL of hexane solution of 1 M diisobutylaluminum hydride, stir at -78°C for 2 hours under nitrogen gas protection, dilute the reaction mixture with 10 mL of dichloromethane, add silica gel, stir vigorously, then add 2 mL of methanol and 0.5 mL of acetic acid, return to room temperature, stir for 1 hour, concentrate, and separate by column chromatography to obtain 23f (35 mg, yield: 36%). LCMS m / z[M+H] + : 121.0 Step 6: (23g of compound) 21c (23.0 g, 77.20 mmol), N-methyl-4-(tri-n-butyltin)imidazole (25 g, 70.0 mmol), tetrakis(triphenylphosphine)palladium (2.0 g, 1.75 mmol), and cuprous iodide (0.7 g, 3.5 mmol) were added to 1,4-dioxane (220 mL). The mixture was purged three times with argon gas, heated to 80°C, and stirred for 26 hours. The reaction mixture was concentrated and separated by column chromatography to obtain 23 g (14 g, yield: 79%) of a brown solid. LCMS m / z[M+H] + : 252.1 Step 7: (Compound 23h) Dissolve 23 g (2.0 g, 7.93 mmol) in acetonitrile (20 mL), add 4-trifluoromethylphenylboronic acid (2.26 g, 11.89 mmol), triethylamine (0.8 g, 7.93 mmol), 2,6-dimethylpyridine (85 mg, 0.79 mmol), and copper acetate (140 mg, 0.79 mmol). After adding these, stir the reaction mixture in an air environment for 4 hours, concentrate it, and separate it by column chromatography to obtain a brown oily substance 23h (10 g, yield: 46%). LCMS m / z[M+H] + : 396.2 Step 8: (Compound 23) 23h (30 mg, 0.076 mmol) and 23f (11 mg, 0.091 mmol) were added to 1,4-dioxane (1 mL), followed by potassium phosphate (32 mg, 0.15 mmol), 4,5-bis(diphenylphosphin)-9,9-dimethylxanthene (8.8 mg, 0.015 mmol), and tris(dibenzylideneacetone)dipalladium (7 mg, 0.0076 mmol). The mixture was stirred at 110°C for 8 hours under nitrogen gas protection. Silica gel was added to the reaction mixture, and the mixture was separated by column chromatography to obtain 23 (30.5 mg, yield: 92%). LCMS m / z[M+H] + : 436.2 1 HNMR (400 MHz, DMSO-d6) δ 10.95 (s, 1H), 8.04 (dd, J = 11.9, 1.7 Hz, 1H), 7.88 (dd, J = 15.1, 1.3 Hz, 2H), 7.66 - 7.50 (m, 4H), 7.33 (d, J = 8.4 Hz, 2H), 4.07 - 3.83 (m, 4H), 3.75 (s, 3H), 2.38 (tt, J = 9.9, 5.0 Hz, 2H), 1.93 (q, J = 16.0 Hz, 2H). Example 24: (Compound 24)
[0357] [ka]
[0358] Step 1: (Compound 24a) Compound 7a (1000 mg, 4.48 mmol) was dissolved in THF (15 mL), purged three times with argon gas, cooled to 0°C, and sodium hydride (270 mg, 6.75 mmol) was slowly added. After addition, the mixture was stirred for 30 minutes, then added to bromomethylmethyl ether (672 mg, 5.38 mmol), stirred for 1 hour, and LC-MS confirmed that the reaction was complete. The reaction mixture was poured into ice water, extracted with ethyl acetate, the organic phase was washed with brine, dried over anhydrous sodium sulfate, and concentrated to obtain a brown oily liquid 24a (1100 mg, yield 91%).
[0359] Step 2: (Compound 24b) Compound 24a (1100 mg, 4.12 mmol), dimethylphosphine oxide (386 mg, 4.95 mmol), and potassium phosphate (1750 mg, 8.24 mmol) were dissolved in 1,4-dioxane (22 mL), and the mixture was substituted three times with argon gas. Pd2(dba)3 (377 mg, 0.41 mmol) and Xantphos (238 mg, 0.41 mmol) were added, and the reaction mixture was heated to 110°C and stirred for 18 hours. LC-MS confirmed complete reaction, the reaction mixture was cooled, poured into water, extracted with ethyl acetate, the organic phase was washed with brine, dried over anhydrous sodium sulfate, concentrated, and the crude product was purified by column chromatography to obtain a brown oily liquid 24b (800 mg, yield: 73%). LC-MS (ESI) m / z = 529.3 [2M+1] +.1H NMR (400 MHz, DMSO-d6) δ 8.35 (dt, J = 13.1, 1.0 Hz, 1H), 8.28 (dd, J = 8.6, 2.6 Hz, 1H), 7.82 (ddd, J = 9.9, 8.6, 1.5 Hz, 1H), 7.67 (d, J = 8.2 Hz, 1H), 7.52 (t, J = 8.0 Hz, 1H), 7.23 (dd, J = 7.7, 0.9 Hz, 1H), 5.45 (s, 2H), 3.46 (s, 3H), 1.74 (s, 3H), 1.71 (s, 3H). Step 3: (Compound 24c) Compound 24b (800 mg, 3.03 mmol) is dissolved in acetonitrile (20 mL), and NBS (600 mg, 3.37 mmol) is added while stirring. The reaction mixture is stirred at room temperature for 1 hour. LC-MS confirms that the starting materials have reacted completely. The reaction mixture is added to water, extracted with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain the crude product. The crude product is purified by column chromatography to obtain a yellow oily liquid 24c (935 mg, yield: 90%). LC-MS (ESI) m / z = 685.1 [2M+1] + .1H NMR (400 MHz, DMSO-d6) δ 8.54 (dt, J = 13.3, 0.9 Hz, 1H), 8.35 (dd, J = 8.6, 2.7 Hz, 1H), 7.95 - 7.92 (m, 1H), 7.89 (d, J = 8.4 Hz, 1H), 7.19 (d, J = 8.4 Hz, 1H), 5.46 (s, 2H), 3.45 (s, 3H), 1.76 (s, 3H), 1.73 (s, 3H). Step 4: (Compound 24d) Compound 24c (1200 mg, 3.5 mmol), methylboronic acid (420 mg, 7.02 mmol), potassium carbonate (1210 mg, 8.75 mmol), and Pd(dppf)Cl2 (256 mg, 0.35 mmol) were dissolved in 1,4-dioxane (25 mL) and water (2.5 mL). The reaction mixture was purged three times with argon gas and heated to 90°C, stirring for 5 hours. LC-MS confirmed that the starting materials had reacted completely. The reaction mixture was concentrated under reduced pressure to obtain the crude product. The crude product was purified by column chromatography to obtain a brown solid 24d (768 mg, yield: 79%). LC-MS(ESI) m / z = 557.3 [2M+1] + . Step 5: (Compound 24e) Compound 24d (1000 mg, 2.7 mmol) is dissolved in methanol (20 mL), and a solution of dioxane in hydrochloric acid (4 mL, 4 Mol / L in dioxane) is added at room temperature. The reaction mixture is stirred at room temperature for 1 hour. LC-MS confirms that the starting materials have reacted completely. The reaction mixture is concentrated under reduced pressure to obtain the crude product, which is then purified by column chromatography to obtain a yellow oily liquid 24e (500 mg, yield: 79%). LC-MS (ESI) m / z = 235.2 [M+H] + . Step 6: (Compound 24) Compound 24e (600 mg, 2.56 mmol), 4-trifluoromethyliodobenzene (836 mg, 3.07 mmol), potassium carbonate (425 mg, 3.08 mmol), 2-picolinic acid (32 mg, 0.26 mmol), and cuprous iodide (50 mg, 0.26 mmol) were dissolved in DMSO (10 mL). The reaction mixture was purged three times with nitrogen gas and heated to 120 °C, stirring for 14 hours. LC-MS confirmed that the starting materials had reacted completely. The reaction mixture was poured into water, extracted with ethyl acetate, the organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain the crude product. Purification by column chromatography and Prep-HPLC separation yielded yellow colloidal compound 24 (302 mg, yield: 31%). LC-MS (ESI) m / z = 379.2 [M + H] +.1H NMR (400 MHz, DMSO-d6) δ 8.52 - 8.47 (m, 1H), 8.02 (dd, J = 8.6, 2.7 Hz, 1H), 7.86 (td, J = 9.0, 8.5, 1.4 Hz, 1H), 7.71 (d, J = 8.6 Hz, 2H), 7.51 (dd, J = 7.7, 1.2 Hz, 1H), 7.30 (d, J = 7.7 Hz, 1H), 7.12 (d, J = 8.5 Hz, 2H), 2.74 (s, 3H), 1.76 (s, 3H), 1.72 (s, 3H). Example 25: (Compound 25)
[0360] [ka]
[0361] Step 1: (Compound 25a) Add 24b (11.1 g, 0.04 mmol) and 40 mL of 1,4-dioxane solution in 4 M HCl sequentially to a 100 mL necked flask and stir at room temperature for 4 hours until a solid precipitate forms. Filtration yields a white solid 25a (8.3 g, 79%).
[0362] Step 2: (Compound 25) In a 25 mL neck flask, 25a (70 mg, 0.32 mmol), 4-ethyliodobenzene (148 mg, 0.64 mmol), potassium carbonate (110 mg, 0.77 mmol), dimethyl sulfoxide (1.5 mL), picolinate hydrochloride (25 mg, 0.15 mmol), and cuprous iodide (18 mg, 0.096 mmol) were added in sequence. The mixture was purged five times with a nitrogen balloon and stirred at 120 °C for 16 hours under nitrogen gas protection. 20 mL of water was added, and the mixture was extracted twice with ethyl acetate (25 mL). The organic phases were combined, and the organic phases were washed once more with saturated brine (20 mL). The organic phases were dried over anhydrous sodium sulfate, concentrated, and column chromatography was performed to obtain product 25 (50 mg, yield: 56%). LC-MS (ESI) m / z = 325.1 [M+H] + 1H NMR (400 MHz, DMSO-d6) δ 8.45 (d, J = 13.0 Hz, 1H), 8.20 (dd, J = 8.6, 2.4 Hz, 1H), 7.85 (td, J = 8.7, 2.2 Hz, 2H), 7.55 (t, J = 7.9 Hz, 1H), 7.24 (d, J = 8.5 Hz, 2H), 7.04 (d, J = 7.6 Hz, 1H), 7.01 - 6.94 (m, 2H), 2.60 (q, J = 7.6 Hz, 2H), 1.73 (d, J = 13.3 Hz, 6H), 1.18 (t, J = 7.6 Hz, 3H). Example 26: (Compound 26)
[0363] [ka]
[0364] Step 1: (Compound 26b) In a 25 mL neck flask, sequentially add 26a (160 mg, 0.81 mmol), sodium iodide (360 mg, 2.43 mmol), n-butanol (1.5 mL), trans-N,N'-dimethylcyclohexane-1,2-diamine (23 mg, 0.16 mmol), and cuprous iodide (15.4 mg, 0.081 mmol). The mixture is purged five times with a nitrogen balloon and stirred at 120 °C for 16 hours under nitrogen gas protection. Add 20 mL of water, extract twice with ethyl acetate (25 mL), combine the organic phases, wash the organic phase once more with saturated brine (20 mL), dry the organic phase over anhydrous sodium sulfate, concentrate, and obtain product 26b (180 mg, yield: 91%) by column chromatography. Use directly in the next step.
[0365] Step 2: (Compound 26c) In a 25 mL neck flask, 25a (70 mg, 0.32 mmol), 26b (160 mg, 0.64 mmol), potassium carbonate (110 mg, 0.77 mmol), dimethyl sulfoxide (1.5 mL), picolinate hydrochloride (25 mg, 0.15 mmol), and cuprous iodide (18 mg, 0.096 mmol) were added in sequence. The mixture was purged five times with a nitrogen balloon and stirred at 120 °C for 16 hours under nitrogen gas protection. 20 mL of water was added, and the mixture was extracted twice with ethyl acetate (25 mL). The organic phases were combined, and the organic phases were washed once more with saturated brine (20 mL). The organic phases were dried over anhydrous sodium sulfate, concentrated, and product 26 (72 mg, yield: 67%) was obtained by column chromatography. LC-MS (ESI) m / z = 337.1 [M+H] + . 1 H NMR (400 MHz, DMSO-d6) δ 8.47 - 8.39 (m, 1H), 8.19 (dd, J = 8.6, 2.6 Hz, 1H), 7.88 - 7.79 (m, 2H), 7.54 (t, J = 7.9 Hz, 1H), 7.15 - 7.08 (m, 2H), 7.02 (dd, J = 7.6, 0.9 Hz, 1H), 6.98 - 6.91 (m, 2H), 1.93 (tt, J = 8.3, 5.3 Hz, 1H), 1.73 (d, J = 13.3 Hz, 6H), 0.97 - 0.89 (m, 2H), 0.68 - 0.60 (m, 2H). Example 27: (Compound 27)
[0366] [ka]
[0367] In a 25 mL neck flask, 25a (70 mg, 0.32 mmol), 4-trifluoromethoxyiodobenzene (184 mg, 0.64 mmol), potassium carbonate (110 mg, 0.77 mmol), dimethyl sulfoxide (1.5 mL), picolinate hydrochloride (25 mg, 0.15 mmol), and cuprous iodide (18 mg, 0.096 mmol) were added in sequence. The mixture was purged five times with a nitrogen balloon and stirred at 120 °C for 16 hours under nitrogen gas protection. 20 mL of water was added, and the mixture was extracted twice with ethyl acetate (25 mL). The organic phases were combined, and the organic phases were washed once more with saturated brine (20 mL). The organic phases were dried over anhydrous sodium sulfate, concentrated, and column chromatography was performed to obtain product 27 (35 mg, yield: 34%). LC-MS (ESI) m / z = 381.1 [M+H] + . 1 H NMR (400 MHz, DMSO-d6) δ 8.48 (d, J = 13.0 Hz, 1H), 8.13 (dd, J = 8.6, 2.4 Hz, 1H), 7.94 (d, J = 8.3 Hz, 1H), 7.91 - 7.82 (m, 1H), 7.61 (t, J = 7.9 Hz, 1H), 7.40 (d, J = 8.7 Hz, 2H), 7.22 (d, J = 7.6 Hz, 1H), 7.18 - 7.10 (m, 2H), 1.73 (d, J = 13.3 Hz, 6H). Example 28: (Compound 28)
[0368] [ka]
[0369] In a 25 mL neck flask, 25a (70 mg, 0.32 mmol), 4-chloroiodobenzene (150 mg, 0.64 mmol), potassium carbonate (110 mg, 0.77 mmol), dimethyl sulfoxide (1.5 mL), picolinate hydrochloride (25 mg, 0.15 mmol), and cuprous iodide (18 mg, 0.096 mmol) were added in sequence. The mixture was purged five times with a nitrogen balloon and stirred at 120 °C for 16 hours under nitrogen gas protection. 20 mL of water was added, and the mixture was extracted twice with ethyl acetate (25 mL). The organic phases were combined, and the organic phases were washed once more with saturated brine (20 mL). The organic phases were dried over anhydrous sodium sulfate, concentrated, and obtained by column chromatography from product 28 (17 mg, yield: 16.2%). LC-MS(ESI) m / z = 331.0 [M+H]+. 1 H NMR (400 MHz, DMSO-d6) δ 8.47 (dd, J = 13.0, 1.3 Hz, 1H), 8.12 (dd, J = 8.6, 2.5 Hz, 1H), 7.92 (d, J = 8.3 Hz, 1H), 7.86 (ddd, J = 9.9, 8.6, 1.5 Hz, 1H), 7.60 (t, J = 7.9 Hz, 1H), 7.49-7.41 (m, 2H), 7.18 (dd, J = 7.6, 0.9 Hz, 1H), 7.10-7.03 (m, 2H), 1.73 (d, J = 13.3 Hz, 6H). Example 29: (Compound 29)
[0370] [ka]
[0371] Step 1: (Compound 29b) Compound 29a (500 mg, 2.11 mmol, synthesized by referring to part of Example 20 of Patent WO2013103738A1), 4-trifluoromethyliodobenzene (688 mg, 2.53 mmol), and potassium carbonate (584 mg, 4.23 mmol) were dissolved in DMSO (10 mL), substituted three times with argon gas, and CuI (81 mg, 0.43 mmol) and 2-pyridine carboxylate (104 mg, 0.84 mmol) were added. After adding these, the reaction mixture was heated to 120°C and stirred for 12 hours. The reaction was monitored by LC-MS to ensure that the starting materials had completely reacted. The reaction mixture was poured into water, extracted with ethyl acetate, the organic phase was washed once with brine, dried over anhydrous sodium sulfate, concentrated, and obtained by column chromatography as a colorless oily liquid 29b (360 mg, yield: 45%).
[0372] Step 2: (Compound 29) Compound 29b (200 mg, 0.52 mmol), dimethylphosphine oxide (61 mg, 0.78 mmol), and potassium phosphate (220 mg, 1.04 mmol) were dissolved in 1,4-dioxane (3 mL), and the mixture was substituted three times with argon gas. Pd2(dba)3 (48 mg, 0.05 mmol) and Xantphos (60 mg, 0.1 mmol) were added, and the reaction mixture was heated to 110°C and stirred for 14 hours. LC-MS confirmed that the reaction was complete. The reaction mixture was cooled, filtered over diatomaceous earth, washed twice with ethyl acetate, and the filtrate was concentrated. The crude product was purified by column chromatography to obtain the crude product, which was dissolved in a small amount of ethyl acetate and petroleum ether was added to precipitate crystals. After the solid had completely precipitated, the mixture was filtered and dried to obtain brown solid 29 (160 mg, yield: 80%). LCMS(ESI)m / z = 379.2 [M+H] + . 1H NMR (400 MHz, Methanol-d4) δ 8.41 - 8.33 (m, 1H), 8.09 (dd, J = 8.6, 2.8 Hz, 1H), 7.75 - 7.68 (m, 2H), 7.66 (s, 1H), 7.64 (s, 1H), 7.13 (dd, J = 4.7, 1.2 Hz, 2H), 7.10 (s, 1H), 2.51 (s, 3H), 1.87 (s, 3H), 1.84 (s, 3H). Example 30: (Compound 30)
[0373] [ka]
[0374] Step 1: (Compound 30b) 23 g (310 mg, 1.23 mmol) of compound 30a (397.43 mg, 1.97 mmol), triethylamine (124.23 mg, 1.23 mmol), and copper acetate (45.5 mg, 0.25 mmol) were added to 10 mL of 1,2-dichloroethane. The mixture was purged three times with oxygen gas, heated to 50°C under an oxygen gas atmosphere, and stirred for 8 hours. The reaction mixture was concentrated under reduced pressure, and the residue was purified by column chromatography to obtain yellow solid 30b (162 mg, yield: 32.29%). LCMS(ESI) m / z = 407.9 [M + H] + Step 2: (Compound 30) Compound 30b (110 mg, 0.27 mmol), dimethylphosphine oxide (52.61 mg, 0.67 mmol), cesium carbonate (131.63 mg, 0.41 mmol), Xantphos (62.49 mg, 0.11 mmol), and palladium acetate (12.07 mg, 0.05 mmol) were added to 1,4-dioxane (10 mL). The mixture was purged three times with nitrogen gas, heated to 110 °C under nitrogen gas protection, stirred overnight, the reaction mixture was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography to obtain a grayish-white solid 30 (50 mg, yield: 45.78%). LCMS(ESI) m / z = 406.1 [M + H] + .1 H NMR (400 MHz, DMSO-d6): δ 10.61 (s, 1H), 7.95-7.91 (m, 1H), 7.83 (s, 1H), 7.80 (d, J=0.8 Hz, 1H), 7.46-7.41 (m, 1H), 7.34-7.31 (m, 2H), 7.27-7.24 (m, 1H), 7.00-6.97 (m, 1H), 3.76 (s, 3H), 1.66 (s, 3H), 1.62 (s, 3H). Example 31: (Compound 31)
[0375] [ka]
[0376] Step 1: (Compound 31a) 23 g (100 mg, 0.40 mmol) of the compound, 4-iodophenylsulfate pentafluoride (261.83 mg, 0.79 mmol), chloro[(4,5-bis(diphenylphosphino)-9,9-dimethylxanthene)-2-(2-aminobiphenyl)]palladium(II) (35.22 mg, 0.04 mmol), and sodium tert-butoxide (76.8 mg, 0.80 mmol) were added to 1,4-dioxane (15 mL). The mixture was purged three times with nitrogen gas, heated to 110 °C under nitrogen gas protection, and stirred overnight. LC-MS confirmed that the starting materials had reacted completely. The reaction mixture was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography to obtain a brown solid 31a (160 mg, yield 89%). LC-MS (ESI) m / z = 455.9 [M + H] + Step 2: (Compound 31) Compound 31a (100 mg, 0.22 mmol), dimethylphosphine oxide (43.04 mg, 0.55 mmol), cesium carbonate (107.25 mg, 0.33 mmol), Xantphos (50.92 mg, 0.08 mmol), and palladium acetate (9.85 mg, 0.04 mmol) were added to 1,4-dioxane (10 mL). The mixture was purged three times with nitrogen gas, heated to 110 °C under nitrogen gas protection, stirred overnight, the reaction mixture was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography to obtain a white solid 31 (65 mg, yield 65.59%). LCMS(ESI) m / z = 452.1 [M + H] + . 1 H NMR (400 MHz, DMSO-d6): δ 10.76 (s, 1H), 8.03 (d, J=11.6 Hz, 1H), 7.85 (s, 1H), 7.78-7.34 (m, 3H), 7.54 (d, J=6.0 Hz, 2H), 7.25 (d, J=8.8 Hz, 2H), 3.74 (s, 3H), 1.69 (s, 3H), 1.65 (s, 3H). Example 32: (Compound 32)
[0377] [ka]
[0378] Step 1: (Compound 32a) 23 g (300 mg, 1.18 mmol) of the compound, 185 mg (1.18 mmol) of 4-chlorophenylboronic acid, 120 mg (1.18 mmol) of triethylamine, and 22 mg (0.12 mmol) of copper acetate were added to 20 mL of 1,2-dichloroethane. The mixture was purged three times with oxygen gas, and stirred at room temperature under an oxygen gas atmosphere for 8 hours. LC-MS confirmed that the starting materials had reacted completely. The reaction mixture was concentrated under reduced pressure, and the residue was purified by column chromatography to obtain yellow solid 32a (129 mg, yield 30.3%). LC-MS (ESI) m / z = 362.1 [M + H] + Step 2: (Compound 32) Compound 32a (129 mg, 0.35 mmol), dimethylphosphine oxide (56 mg, 0.71 mmol), cesium carbonate (117 mg, 0.35 mmol), Xantphos (83 mg, 0.14 mmol), and palladium acetate (16 mg, 0.07 mmol) were added to 1,4-dioxane (10 mL). The mixture was purged three times with nitrogen gas, heated to 110 °C under nitrogen gas protection, and stirred overnight. LC-MS confirmed that the starting materials had reacted completely. The reaction mixture was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography to obtain a white solid 32 (52 mg, yield 40.9%). LC-MS (ESI) m / z = 360.1 [M + H] + . 1 H NMR (400 MHz, DMSO-d6): δ 10.62 (s, 1H), 7.94-7.91 (m, 1H), 7.83 (d, J=0.8 Hz, 1H), 7.79 (d, J=1.2 Hz, 1H), 7.47-7.42 (m, 1H), 7.35-7.30 (m, 3H), 7.22-7.19 (m, 2H), 3.74 (s, 3H), 1.64 (s, 3H), 1.61 (s, 3H). Example 33: (Compound 34)
[0379] [ka]
[0380] Step 1: (Compound 34b) Compound 8a (1.0 g, 3.34 mmol), compound 34a (1.23 g, 3.34 mmol), and tetrakis(triphenylphosphine)palladium (0.37 g, 0.03 mmol) were added to 1,4-dioxane (40 mL). The mixture was purged three times with nitrogen gas, heated to 100 °C under nitrogen gas protection, and stirred overnight. LC-MS showed that some of the starting materials had not reacted completely. The reaction mixture was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography (PE / EA = 5:1~3:1) to obtain yellow solid 34b (250 mg, yield 30%). LC-MS (ESI) m / z = 252.0 [M + H]+ . Step 2: (Compound 34c) Compound 34b (250 mg, 1.0 mmol), 4-trifluoromethylphenylboronic acid (303.84 mg, 1.6 mmol), triethylamine (101.19 mg, 1.0 mmol), and copper acetate (18.2 mg, 0.1 mmol) were added to 1,2-dichloroethane (10 mL). The mixture was purged three times with oxygen gas, heated to 70°C under an oxygen gas atmosphere, and stirred for 16 hours. The reaction mixture was concentrated under reduced pressure, and the residue was purified by column chromatography to obtain yellow solid 34c (180 mg, yield 4.7%). LCMS(ESI) m / z = 394.0 [M + H] + . Step 3: (Compound 34) Compound 34c (100 mg, 0.25 mmol), dimethylphosphine oxide (49.5 mg, 0.63 mmol), cesium carbonate (121.87 mg, 0.38 mmol), Xantphos (57.86 mg, 0.1 mmol), and palladium acetate (11.2 mg, 0.05 mmol) were added to 1,4-dioxane (10 mL). The mixture was purged three times with nitrogen gas, heated to 110 °C under nitrogen gas protection, stirred overnight, the reaction mixture was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography to obtain a white solid 34 (45 mg, yield 45.35%). LCMS(ESI) m / z = 392.1 [M + H] + . 1 H NMR (400 MHz, DMSO-d6): δ 12.68 (s, 1H), 8.86-8.85 (m, 1H), 8.63-8.62 (s, 1H), 8.56-8.52 (s, 1H), 8.26 (d, J=8.0 Hz, 1H), 8.10-8.04 (m, 3H), 7.68 (d, J=8.4 Hz, 2H), 7.55-7.52 (m, 1H), 1.78 (s, 3H), 1.74 (s, 3H). Example 34: (Compound 35)
[0381] [ka]
[0382] Step 1: (Compound 35a) Compound 8b (300 mg, 1.18 mmol), compound 30a (238 mg, 1.18 mmol), triethylamine (120 mg, 1.18 mmol), and copper acetate (22 mg, 0.12 mmol) were added to 1,2-dichloroethane (20 mL). The mixture was purged three times with oxygen gas, stirred at room temperature under an oxygen gas atmosphere for 8 hours, concentrated under reduced pressure, and the residue was purified by column chromatography to obtain yellow solid 35a (185 mg, yield 38.5%). LCMS(ESI) m / z = 409.1 [M + H] + . Step 2: (Compound 35) Compound 35a (143 mg, 0.35 mmol), dimethylphosphine oxide (56 mg, 0.71 mmol), cesium carbonate (117 mg, 0.35 mmol), Xantphos (83 mg, 0.14 mmol), and palladium acetate (16 mg, 0.07 mmol) were added to 1,4-dioxane (10 mL). The mixture was purged three times with nitrogen gas, heated to 110 °C under nitrogen gas protection, stirred overnight, the reaction mixture was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography to obtain a white solid 35 (92.5 mg, yield 65.1%). LC-MS (ESI) m / z = 407.1 [M + H] + . 1 H NMR (400 MHz, DMSO-d6): δ 12.00 (s, 1H), 8.39-8.36 (m, 1H), 8.22-8.19 (m, 1H), 8.15(d, J=2.4 Hz, 1H), 8.01 (d, J=1.2 Hz, 1H), 7.93 (d, J=0.8 Hz, 1H), 7.35-7.25 (m, 2H), 3.78 (s, 3 H), 1.71 (s, 3 H), 1.67 (s, 3 H). Example 35: (Compound 36)
[0383] [ka]
[0384] Step 1: (Compound 36a) Compound 8b (225 mg, 0.89 mmol), 4-chlorophenylboronic acid (223 mg, 1.42 mmol), triethylamine (90 mg, 0.89 mmol), and copper acetate (16 mg, 0.09 mmol) were added to 1,2-dichloroethane (40 mL). The mixture was purged three times with oxygen gas, stirred at room temperature under an oxygen gas atmosphere for 8 hours, and LC-MS confirmed that the starting materials had reacted completely. The reaction mixture was concentrated under reduced pressure, and the residue was purified by column chromatography to obtain yellow solid 36a (180 mg, yield 55.5%). LC-MS (ESI) m / z = 363.0 [M + H] + . Step 2: (Compound 36) Compound 36a (100 mg, 0.27 mmol), dimethylphosphine oxide (43 mg, 0.55 mmol), cesium carbonate (90 mg, 0.27 mmol), Xantphos (64 mg, 0.11 mmol), and palladium acetate (11 mg, 0.05 mmol) were added to 1,4-dioxane (5 mL). The mixture was purged three times with nitrogen gas, heated to 110 °C under nitrogen gas protection, and stirred overnight. LC-MS confirmed that the starting materials had reacted completely. The reaction mixture was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography to obtain a white solid 36 (48 mg, yield 48.4%). LC-MS (ESI) m / z = 361.0 [M + H] + . 1 H NMR (400 MHz, DMSO-d6): δ 11.97 (s, 1H), 8.38-8.36 (m, 1H), 8.21-8.18 (m, 1H), 8.00 (d, J=1.2 Hz, 1H), 7.94 (d, J=0.8 Hz, 1H), 7.82-7.80 (m, 2H), 7.37-7.35 (m, 2H), 3.78 (s, 3H), 1.70 (s, 3H), 1.67 (s, 3H). Example 36: (Compound 37)
[0385] [ka]
[0386] Step 1: (Compound 37b) Compound 37a (4.0 g, 12.6 mmol) is dissolved in 1,4-dioxane (40 mL), and dimethylphosphine oxide (1.5 g, 18.9 mmol), 4,5-bisdiphenylphosphin-9,9-dimethylxanthene (1.5 g, 2.52 mmol), triethylamine (3.8 g, 37.8 mmol), and tris(dibenzylideneacetone)dipalladium (2.3 g, 2.52 mmol) are added. The mixture is then stirred at 50°C for 16 hours under nitrogen gas protection. TLC indicates that the reaction is complete, the reaction mixture is cooled to room temperature, filtered, the filtrate is diluted with water (100 mL), and extracted with an ethyl acetate mixture containing 10% methanol (100 mL x 6). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and desolvated under reduced pressure. The residue was purified by silica gel column chromatography to obtain 6 g of crude product. Compound 37b (1 g, yellow solid, yield 29.64%) was obtained by reverse-phase fractionation. MS (ESI): m / z = 267.8 [M+1] + Step 2: (Compound 37c) Compound 37b (500 mg, 1.86 mmol) is dissolved in dimethyl sulfoxide (10 mL), and sulfur pentafluoride (4-aminophenyl) (490 mg, 2.23 mmol) and cesium carbonate (1.2 g, 3.72 mmol) are added. The mixture is then stirred at 100°C for 16 hours under nitrogen gas protection. TLC indicates completion of the reaction, and the mixture is diluted with water (100 mL) and extracted with ethyl acetate (50 mL x 3). The combined organic phase is washed with saturated brine (50 mL x 2), dried over anhydrous sodium sulfate, filtered, desolvated under reduced pressure, and the residue is purified by silica gel column chromatography to obtain compound 37c (450 mg, yellow oily, yield 53.55%). MS (ESI): m / z = 450.9 [M+1] + Step 3: (Compound 37) Compound 37c (50 mg, 0.11 mmol) is dissolved in 1,4-dioxane (2 mL), and N-methyl-4-(tri-n-butyltin)imidazole (41 mg, 0.11 mmol), cuprous iodide (3 mg, 0.02 mmol), and tetrakistriphenylphosphine palladium (12.8 mg, 0.01 mmol) are added. The mixture is then stirred at 80°C for 16 hours under nitrogen gas protection. TLC indicates completion of the reaction. The reaction mixture is cooled to room temperature, diluted with water (10 mL), and extracted with ethyl acetate (8 mL x 3). The organic phases are combined, washed with saturated brine (5 mL x 2), desolvated under reduced pressure, and the residue is separated by prep-TLC to obtain 37 (5 mg, green solid). MS (ESI): m / z = 452.9 [M+1] + . 1 H NMR (400 MHz, Chloroform-d) δ(ppm) 11.96 (s, 1H), 8.29 (d, J = 5.5 Hz, 1H), 8.24 - 8.16 (m, 1H), 7.89 (d, J = 8.7 Hz, 2H), 7.68 (d, J = 8.8 Hz, 2H), 7.57 (s, 1H), 7.46 (s, 1H), 3.80 (s, 3H), 1.79 (s, 3H), 1.76 (s, 3H). Example 37: (Compound 38)
[0387] [ka]
[0388] Compound 37c (100 mg, 0.22 mmol) is dissolved in 1,4-dioxane (5 mL), compound 21b (146 mg, 0.22 mmol, 60%), cuprous iodide (6 mg, 0.03 mmol), and tetrakistriphenylphosphine palladium (25.6 mg, 0.02 mmol) are added, and the mixture is stirred at 80°C for 16 hours under nitrogen gas protection. TLC indicates completion of the reaction, the reaction mixture is cooled to room temperature, diluted with water (15 mL), and extracted with ethyl acetate (10 mL x 3). The combined organic phase is washed with saturated brine (8 mL x 2), desolvated under reduced pressure, and the residue is separated by prep-TLC to obtain the crude product (100 mg). The crude compound is further purified by HPLC to obtain compound 38 (20 mg, off-white solid). MS (ESI): m / z = 479.1 [M+1] + . 1 H NMR (300 MHz, DMSO-d6) δ(ppm) 12.42 (s, 1H), 8.50 - 8.35 (m, 1H), 8.24 (d, J = 11.1 Hz, 1H), 8.07 - 7.91 (m, 3H), 7.83 (d, J = 8.9 Hz, 2H), 4.09 (t, J = 7.2 Hz, 2H), 2.94 (t, J = 7.4 Hz, 2H), 2.59 (t, J = 7.5 Hz, 2H), 1.73 (s, 3H) 1.68 (s, 3H). Example 38: (Compound 39)
[0389] [ka]
[0390] Step 1: (Compound 39a) Compound 22a (182 mg, 0.64 mmol), 4-chlorophenylboronic acid (164 mg, 1.04 mmol), triethylamine (68 mg, 0.64 mmol), and copper acetate (24 mg, 0.02 mmol) were added to 1,2-dichloroethane (10 mL). The mixture was purged three times with oxygen gas, stirred at room temperature under an oxygen gas atmosphere for 8 hours, and LC-MS confirmed that the starting materials had reacted completely. The reaction mixture was concentrated under reduced pressure, and the residue was purified by column chromatography to obtain yellow solid 39a (130 mg, yield 51.1%). LC-MS (ESI) m / z = 389.1 [M + H] + Step 2: (Compound 39) Compound 39a (130 mg, 0.33 mmol), dimethylphosphine oxide (53 mg, 0.67 mmol), cesium carbonate (109 mg, 0.33 mmol), Xantphos (78 mg, 0.13 mmol), and palladium acetate (15 mg, 0.06 mmol) were added to 1,4-dioxane (15 mL). The mixture was purged three times with nitrogen gas, heated to 110 °C under nitrogen gas protection, and stirred overnight. LC-MS confirmed that the starting materials had reacted completely. The reaction mixture was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography to obtain brown solid 39 (80 mg, yield 62.0%). LC-MS (ESI) m / z = 387.0 [M + H] + . 1 H NMR (400 MHz, DMSO-d6): δ 12.04 (s, 1H), 7.35 (d, J=4.4 Hz, 1H), 8.18-8.15 (m, 1H), 7.94 (s, 1H), 7.81 (d, J=8.8 Hz, 2H), 7.36 (d, J=8.4 Hz, 2H), 4.10-4.06 (m, 2H), 2.94-2.90 (m, 2H), 2.60-2.56 (m, 2H), 1.70 (s, 3H), 1.66 (s, 3H). Example 39: (Compound 40)
[0391] [ka]
[0392] Step 1: (Compound 40a) Compound 22a (182 mg, 0.64 mmol), compound 30a (210.1 mg, 1.04 mmol), triethylamine (68 mg, 0.64 mmol), and copper acetate (24 mg, 0.02 mmol) were added to 1,2-dichloroethane (10 mL). The mixture was purged three times with oxygen gas, stirred at room temperature under an oxygen gas atmosphere for 8 hours, concentrated under reduced pressure, and the residue was purified by column chromatography to obtain yellow solid 40a (130 mg, yield 46.9%). LCMS(ESI) m / z = 435.1 [M + H] + Step 2: (Compound 40) Compound 40a (130 mg, 0.33 mmol), dimethylphosphine oxide (53 mg, 0.67 mmol), cesium carbonate (109 mg, 0.33 mmol), Xantphos (78 mg, 0.13 mmol), and palladium acetate (15 mg, 0.06 mmol) were added to 1,4-dioxane (15 mL). The mixture was purged three times with nitrogen gas, heated to 110 °C under nitrogen gas protection, stirred overnight, the reaction mixture was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography to obtain brown solid 40 (65 mg, yield 45.8%). LCMS(ESI) m / z = 433.1 [M + H] + . 1 H NMR (400 MHz, DMSO-d6): δ 12.09 (s, 1H), 8.37-8.35 (m, 1H), 8.19-8.16 (m, 2H), 7.94(s, 1H), 7.34 (d, J=8.8 Hz, 1H), 7.26-7.23 (m, 1H), 4.10-4.06 (m, 2H), 2.94-2.90 (m, 2H), 2.60-2.56 (m, 2H), 1.70 (s, 3H), 1.67 (s, 3H). Example 40: (Compound 41)
[0393] [ka]
[0394] Step 1: (Compound 41b) Compound 41a (1 g, 3.14 mmol), dimethylphosphine oxide (245 mg, 3.14 mmol), cesium carbonate (2 g, 6.28 mmol), palladium acetate (78 g, 0.35 mmol), and XantPHos (382 g, 0.66 mmol) were added to a 5 mL solution of DMF. The mixture was purged three times with argon gas, and the temperature was raised to 100 °C and stirred for 16 hours. LC-MS confirmed the completion of the reaction. Water (50 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate (20 mL x 3). The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated to obtain a brown oily product 41b (0.3 g, yield: 51%).
[0395] Step 2: (Compound 41d) Compound 41b (300 mg, 2.64 mmol), compound 41c (0.36 g, 2.64 mmol), and cesium carbonate (1.7 g, 5.28 mmol) were added to DMSO (3 mL) solution, bubbled with argon gas for 1 minute, and heated to 100°C and stirred for 16 hours. LC-MS confirmed the completion of the reaction, the reaction mixture was concentrated, and purified by column chromatography to obtain an off-white solid product 41d (0.5 g, purity: 78%). LC-MS (ESI) m / z = 367.1 [M+H] + Step 3: (Compound 41) Compound 41d (150 mg, 0.45 mmol), N-methyl-4-(tri-n-butyltin)imidazole (330 mg, 0.90 mmol), tetrakistriphenylphosphine palladium (52 mg, 0.045 mmol), and triethylamine (140 mg, 1.35 mmol) were added to a 2 mL solution of DMF. LC-MS was used to indicate completion of the reaction. The reaction mixture was removed under vacuum, and column chromatography yielded a white solid product 41 (130 mg, yield: 86%, purity: 100%). LC-MS (ESI) m / z = 369.2 [M+H] + . 1H NMR (400 MHz, DMSO-d6) δ 9.34 (d, J = 7.2 Hz, 1H), 8.24 (dd, J = 6.1, 2.1 Hz, 1H), 7.99 (dd, J = 10.9, 2.1 Hz, 1H), 7.85 (dd, J = 10.8, 1.3 Hz, 2H), 4.24 (d, J = 9.0 Hz, 1H), 3.76 (s, 3H), 2.13 - 1.95 (m, 8H), 1.67 (s, 3H), 1.64 (s, 3H). Examples of effectiveness experiments The structure of comparative compound B1 is,
[0396] [ka]
[0397] The structure of comparative compound B2 is,
[0398] [ka]
[0399] Comparative compounds B1 and B2 are obtained by referencing the synthetic route in patent WO2020214734A1. The structure of comparative compound B3 (VT103) is,
[0400] [ka]
[0401] It is CAS number: 2290608-13-6 and is obtained by referencing the synthesis route in patent WO2019040380A1. The structure of comparative compound B4 (MRK-A) is,
[0402] [ka]
[0403] Its CAS number is 2821763-12-4, and it was purchased from Jiangsu Aikang Biomedical Research and Development Co., Ltd., with batch number AK23-1338803-1-1.
[0404] Example of an effectiveness experiment 1: YAP-TEAD reporter gene The YAP-TEAD reporter gene assay is performed as follows: First, the 8xGTIIC promoter sequence (GAGCTCTTACGCGTGCTAGCCCGGCCAGTGCCAAGTTGAGACACATTCCACACATTCCACTGCAAGCTTGAGACACATTCCACACATTCC ACTGCAAGCTTGGCCAGTGCCAAGTTGAGACACATTCCACACATTCCACTGCAAGCTTGAGACACATTCCACACATTCCACTGCAAGCTT CTAGAGATCTGCAGGTCGAGGTCGACGGTATCGATAAGCTTGGGGGTGGGCGCCGGGGGGACCTTAAAGCCTCTGCCCCCCAAGGAGCCC A TK promoter (AAATGAGTCTTCGGACCTCGCGGGGGCCGCTTAAGCGGTGGTTAGGGTTTGTCTGACGCGGGGGGAGGGGGAAGGAACGAAACACTCTCA) was constructed on the pGL4.20 (luc2-Puro) plasmid, and a TK promoter (AAATGAGTCTTCGGACCTCGCGGGGGCCGCTTAAGCGGTGGTTAGGGTTTGTCTGACGCGGGGGGAGGGGGAAGGAACGAAACACTCTCA) was constructed that is unrelated to the hippo pathway. TTCGGAGGCGGCTCGGGGTTTGGTCTTGGTGGCCACGGGCACGCAGAAGAGCGCCGCGATCCTCTTAAGCACCCCCCCGCCCTCCGTGGA GGCGGGGGTTTGGTCGGCGGGTGGTAACTGGCGGGCCGCTGACTCGGGCGGGTCGCGCGCCCAGAGTGTGACCTTTTCGGTCTGCTCGC AGACCCCCGGGCGGCGCCGCCGCGGCGGCGACGGGCTCGCTGGGTCCTAGGCTCCATGGGGACCGTATACGTGGACAGGCTCTGGAGCAT CCGCACGACTGCGGTGATATTACCGGAGACCTTCTGCGGGACGAGCCGGGTCACGCGGCTGACGCGGAGCGTCCGTTGGGCGACAAACAC CAGGACGGGGCACAGGTACACTATCTTGTCACCCGGAGGCGCGAGGGACTGCAGGAGCTTCAGGGAGTGGCGCAGCTGCTTCATCCCCGT GGCCCGTTGCTCGCGTTTGCTGGCGGTGTCCCCGGAAGAAATATATTTGCATGTCTTTAGTTCTATGATGACACAAACCCCGCCCAGCGT CTTGTCATTGGCGAATTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCCAGGTCCACTTCGCATATTAAGGTGACGCGTGTGGCCTC GAACACCGAGCGACCCTGCAGCGACCCGCTTAA) is constructed on the pGL4.78(hRlucCP / Hygro) plasmid to construct 293T stable transfection cells capable of stably and continuously responding to the transcriptional activity of the YAP-TEAD transcription complex. After selecting and identifying individual clones, the clones are grown and maintained in DMEM, 10% fetal bovine serum, penicillin-streptomycin solution, 1 μg / mL puromycin, and 150 μg / mL hygromycin culture medium. To perform reporter gene assays using the compound awaiting measurement, good quality cells in the above growth state are harvested and seeded in a 384-well plate at a cell density of 3000 cells per well, with the wells sealed with an appropriate amount of PBS at 90 μL per well to prevent evaporation of water at the well edges. The drug is administered the day after cell seeding. Compounds with different concentration gradients are added to each well, with three overlapping wells set for each concentration point. The compound concentration is initially 5 μM and diluted seven times with a 5-fold gradient. A corresponding DMSO-negative controlled group is also set up. 24 hours after drug treatment, the assay reagents are prepared by thawing the Dual-Lumi® firefly luciferase assay reagent and Dual-Lumi® sea urchin luciferase assay buffer and allowing them to reach room temperature. The Dual-Lumi® sea urchin luciferase assay substrate (100X) is placed on an ice bath or icebox for use. An appropriate amount of Dual-Lumi® sea urchin luciferase assay activator is prepared according to the amount of 100 μL of Dual-Lumi® sea urchin luciferase assay activator required to assay each sample. Mix an appropriate amount of sea urchin luciferase assay substrate (100X) and Dual-Lumi® sea urchin luciferase assay buffer in a ratio of 1:100 to prepare the Dual-Lumi® sea urchin luciferase assay activator. Remove the cell culture plate and allow it to equilibrate at room temperature for 10 minutes (it is generally undesirable to exceed 30 minutes).Next, 100 μL of Dual-Lumi® firefly luciferase assay reagent (25 μL per well in a 384-well plate) is added to each well of a 96-well plate and mixed uniformly. After incubating at room temperature (approximately 25°C) for 10 minutes to stabilize the luminescence signal, chemiluminescence detection is performed using a multifunctional microplate reader with chemiluminescence detection capabilities. Subsequently, detection of sea urchin luciferase is started. First, 100 μL of Dual-Lumi® sea urchin luciferase assay activator (25 μL per well in a 384-well plate) is added to each well of a 6-well plate and mixed uniformly. Next, the luminescence signal is stabilized by incubating at room temperature (approximately 25°C) for 10 minutes. Finally, chemiluminescence detection is performed using a multifunctional microplate reader with chemiluminescence detection capabilities. The obtained data were analyzed using GraphPad Prism 7.0 software to create an S-type dose-survival curve using a nonlinear regression model, and IC50 was calculated. 50 The values are calculated. The test results are shown in Table 1.
[0405] [Table 1]
[0406] Effect Experiment Example 2: Inhibition of Cell Proliferation NCI-H2052 (NF2 mutant), NCI-H226 (NF2 mutant), NCI-H2452 (NF2 wide-type), NCI-H28 (NF2 wide-type), and MSTO-211H (NF2 wide-type) cells were collected and cultured in RPMI1640 complete medium.
[0407] The normally proliferating cells described above are digested with pancreatin cell digestant, centrifuged, counted, and seeded in a 96-well plate at a density of 1000 cells per well. 24 hours after seeding, the cells are administered by adding 10 μL of inhibitor at different concentration gradients to each well, setting up three overlapping wells for each concentration point, with a 20 μM initial concentration, and then diluting it eight times backward at a 4-fold gradient, and further establishing a corresponding 1 / 1000 DMSO-negative control group. 72 hours after drug treatment, the cell culture plates awaiting measurement are removed from the incubator, the culture medium from the 96-well plate is aspirated, 190 μL of RPMI 1640 complete medium is re-added, and the cells are cultured again for 72 hours. The 96-well plate is removed and equilibrated at room temperature for 10 minutes. The medium from the 96-well plate is aspirated and added to CellTiter-Lumi® luminescent cell viability detection solution (mixed 1:1 with the culture medium), shaken for 2 minutes, and then allowed to react at room temperature for 10 minutes. 150 μL of liquid is aspirated from a transparent 96-well plate and transferred to a 96-well white plate, and chemiluminescence readings are performed. After subtracting the background value from the values in each well, the cell viability is calculated. Viability (%) = (Sample / Vehicle-1) × 100. Sample is the chemiluminescence of the drug-treated group, and Vehicle is the absorbance of the DMSO control group. An S-type dose-viability curve is created using a nonlinear regression model with GraphPad Prism 7.0 software, and IC is also calculated. 50 Value or GI 50 The calculation is performed. The test results are shown in Table 2.
[0408] [Table 2]
[0409] Efficacy Experiment Example 3: Stability Test of Liver Microsomes We will evaluate the Phase 1 metabolic stability of the test compound in CD-1 mice, Sprague-Dawley rats, and human liver microsomes.
[0410] Experimental system: The animal and human liver microsomes used in this test system were purchased from Xenotech, Corning, or other quality suppliers and stored in a refrigerator below -60°C before use. Information on the animal and human liver microsomes used is as follows:
[0411] [Table 3]
[0412] A brief introduction to the experiment: The sample and control compound are incubated with animal and human liver microsomes, respectively, at 37±1°C for a specified time, with a maximum incubation time of 60 minutes. At the specified time, the sample is removed and the reaction is stopped with acetonitrile or other organic solvent containing an internal standard. After centrifugation, the resulting supernatant is measured by liquid chromatography-tandem mass spectrometry (LC-MS / MS).
[0413] Experimental method: 1. Preparation of buffer solution Dissolve 73.21 g of potassium dihydrogen phosphate trihydrate and 10.78 g of potassium dihydrogen phosphate in 4000 mL of ultrapure water. Adjust the pH of the solution to between 7.40 ± 0.10 with 10% phosphoric acid or 1 M potassium hydroxide, and make the final concentration 100 mM.
[0414] 2. Preparation of the working fluid After preparing the sample powder into a stock solution of the specified concentration with DMSO or other organic solvents, it is further diluted with a suitable organic solvent.
[0415] The control compounds, testosterone, diclofenac, and propafenone, were prepared as 10 mM stock solutions with DMSO, and then further diluted with a suitable organic solvent.
[0416] 3. Preparation of liver microsome solution Dilute each species of microsome in 2x working solution with 100 mM potassium phosphate buffer. The final concentration of microsomes in the reaction system is 0.5 mg / mL.
[0417] 4. Preparation of a reduced nicotinamide adenine dinucleotide phosphate (NADPH) regeneration system Weigh appropriate amounts of nicotinamide adenine phosphate dinucleotide (NADP) and isocitrate (ISO) powder, dissolve them in magnesium chloride solution, and shake to mix uniformly. Add appropriate amounts of isocitrate dehydrogenase (IDH) and gently invert the mixture to mix uniformly. The final concentrations in the reaction system are 1 mM NADP, 1 mM magnesium chloride, 6 mM ISO, and 1 unit / mL IDH, respectively.
[0418] 5. Preparation of stop solution Prepare a stop solution using acetonitrile or other organic solvent containing an internal standard (tolbutamide or other suitable compound). Store the prepared stop solution in a refrigerator at 2–8°C.
[0419] 6. Incubation Process Incubation is completed in 96-well plates. Eight incubation plates are prepared, named T0, T5, T15, T30, T45, T60, Blank60, and NCF60, respectively. The reaction time points corresponding to the first six plates are 0, 5, 15, 30, 45, and 60 minutes, respectively. No sample or control compound is added to the Blank60 plate, and sampling is performed after 60 minutes of incubation. In the NCF60 plate, potassium phosphate buffer is incubated for 60 minutes instead of the NADPH regeneration solution. All condition samples are in three parallel pairs.
[0420] After mixing microsomes with the sample or control compound, incubator plates Blank60, T5, T15, T30, T45, and T60 (excluding T0 and NCF60) are pre-incubated in a 37°C water bath for approximately 10 minutes. Incubator plate T0 is first given stop solution, followed by NADPH regeneration system working solution. Incubator plate NCF60 is then initiated by adding 98 μL of potassium phosphate buffer to each sample well. After pre-incubation of incubator plates Blank60, T5, T15, T30, T45, and T60 is complete, the reaction is initiated by adding 98 μL of NADPH regeneration system working solution to each sample well. The reaction temperature is 37±1°C, the final reaction volume is 200 μL, and the reaction system contains 0.5 mg / mL of microsomes, 1.0 μM of substrate, 1 mM of NADP, 6 mM of ISO, and 1 unit / mL of IDH.
[0421] The reaction is terminated by adding a cold stop solution containing an internal standard to the reaction plate at 5, 15, 30, 45, and 60 minutes, respectively.
[0422] After completion, all reaction plates are uniformly shaken and centrifuged at 4°C and 3220×g for 20 minutes. The supernatant is diluted to a specific ratio and then analyzed by LC-MS / MS.
[0423] Sample analysis Liquid chromatography-tandem mass spectrometry (LC-MS / MS) is used for sample analysis, without standard curves or quality control samples. Semi-quantitative measurements are performed using the ratio of the analyte peak area to the internal standard peak area. Retention times of the analyte and internal standard, chromatogram acquisition, and chromatogram integration are processed using the software Analyst (Sciex, Framingham, Massachusetts, USA).
[0424] The coefficient of variation (CV) of the internal standard peak area in each matrix within each analysis batch should be within 20%.
[0425] Data Analysis The extracorporeal elimination rate constant ke of a compound is determined by converting the ratio of the compound's peak area to the internal standard substance peak area in the following equation into a residual rate.
[0426]
number
[0427] CL int(mic) =0.693 / T 1 / 2 / Microsomal protein content (microsomal concentration during incubation in mg / mL) CL int(liver) =CL int(mic) × Protein content of microsomes in the liver (mg / g) × Ratio of liver weight to body weight A sufficient well-stir model, intrinsic liver clearance, and liver clearance can be converted using the following formula.
[0428] CL (liver) =(CL int(liver) ×Q h ) / (CL int(liver) +Q h ) The parameters in the formula are shown in Table 3.
[0429] [Table 4]
[0430] The test results are shown in Table 4.
[0431] [Table 5]
[0432] Effect Experiment Example 4: hERG HEK293 cells were cultured in DMEM medium containing 10% fetal bovine serum and 0.8 mg / mL of G418 at a culture temperature of 37°C and a CO2 concentration of 5%. After digesting the cells with TrypLE® Express, they were centrifuged to obtain a cell density of 2 × 10⁶. 6 After adjusting to cells / mL, gently mix the cells in a room-temperature equilibrium shaker for 15-20 minutes and subject them to patch-clamp testing using the instrument. Replace the culture medium of the prepared cells with extracellular fluid. Aspirate intracellular and extracellular fluids from the liquid pool and add them to the intracellular fluid pool, cell pool, and test pool on the QPlate tip, respectively. For whole-cell patch-clamp testing, record the voltage stimulation of the whole-cell hERG potassium current, and collect and store the test data with Qpatch. Start with a compound at 30 μM, dilute 3-fold, and set up 6 concentration points, with each drug concentration set to be administered twice for at least 5 minutes. The current detected by each cell in the compound-free extracellular fluid is independently detected twice using at least 2 cells at each concentration as a self-control group. All electrophysiological tests are performed at room temperature.
[0433] Data analysis first involves standardizing the current acting on each drug concentration and the blank control current.
[0434]
number
[0435] ), next, the inhibition rate corresponding to each drug concentration
[0436]
number
[0437] Calculate the following: Calculate the mean and standard error for each concentration, and calculate the half-inhibitory concentration of each compound.
[0438]
number
[0439] The dose-dependent effect is nonlinearly fitted using the above equation, where Y represents the inhibition rate, C represents the concentration of the test substance, and IC 50 is the half-percentage inhibitory concentration, and HillSlope represents the Hill coefficient. Curve fitting and IC 50 The calculation is performed using Graphpad software.
[0440] Effect Experiment Example 5: Cytochrome oxidase P450 Inhibition 1) Preparation of buffer solution: Mix 9.5 mL of stock solution A (100 mM K-Buffer) with 40.5 mL of stock solution B, adjust the total volume to 500 mL with ultrapure water, and titrate the buffer to pH 7.4 with KOH or H3PO4.
[0441] Raw material A (1M potassium dihydrogen phosphate): 136.5g potassium dihydrogen phosphate in 1L of water Stock solution B (1M potassium dihydrogen phosphate): 174.2g potassium dihydrogen phosphate in 1L of water 2) Preparation of the test substance The test substance powder is prepared into a stock solution of a certain concentration using DMSO or other organic solvents, and then further diluted with a suitable organic solvent.
[0442] 3) In vitro incubation The in vitro incubation system for liver microsomes used in CYP450 enzyme metabolic phenotyping studies involves adding redox coenzymes to fabricated liver microsomes, followed by enzyme-specific selective inhibitors, and performing biochemical reactions under conditions that simulate physiological temperature and environment.
[0443] 4) Detection of prototype drugs or metabolites LC-MS / MS was used to measure the concentration of the prototype drug or its metabolites in the incubation fluid. The test results are shown in Table 5.
[0444] [Table 6]
[0445] Efficacy Experiment Example 6: Mouse Pharmacokinetic Study The compounds of the present invention were administered to Balb / c mice by single intravenous injection and oral gastric administration, respectively, and mouse plasma was collected at each time point. The drug concentrations of the compounds awaiting measurement in BALB / C plasma tissue were detected by LC-MS / MS analysis, and pharmacokinetic analysis was then performed.
[0446] 1. Preparation of the administered formulation (low dose) Preparation steps for oral and intravenous formulation solvents: Preparation of a 25% sulfobutyl β-cyclodextrin solution with 3% dimethyl sulfoxide and 5% polyethylene glycol-15 hydroxystearate: Transfer an appropriate volume of 25% sulfobutyl β-cyclodextrin solution of the compound to a concentration of 1 mg / mL, add 3% sulfobutyl β-cyclodextrin solution by total volume, vortex, shake, sonicate, add the remaining 25% sulfobutyl β-cyclodextrin (sterile) by volume, and prepare a solution or suspension of the final concentration.
[0447] For intravenous injection formulations, they are used directly in animal experiments without filtration. IV preparation vials are placed in an infrared sterilization cabinet for disinfection one day prior to administration.
[0448] 2. Administration Intravenous injection: Tail vein administration is used. After inserting the needle, slowly withdraw the syringe. If blood returns, it indicates that the needle has entered the vein, and the drug solution can be injected.
[0449] Intragastric administration: Select the appropriate type of gastric tube and syringe, insert the gastric tube into the esophagus from the base of the tongue until it approaches the cardia of the stomach, then push the drug preparation in and inject it, withdraw the gastric tube, and if using disposable plastic gastric tubes, use one for each group.
[0450] 3. Collection and processing of blood samples At each time point, 60 μL of whole blood is collected from the submandibular vein or tail vein (except for group IV). The blood is placed in a pre-cooled anticoagulant blood collection tube containing EDTA-K2 (1 μL, 15% EDTA-K2 solution), placed on wet ice, and centrifugation (3000 g, 4°C, 10 minutes) is completed within 1 hour. Immediately after centrifugation, the plasma is collected, transferred to an EP tube, and stored in an environment of -90 to -60°C.
[0451] 4. Sample detection Drug concentration detection: Drug concentration is measured using HPLC or LCMS / MS.
[0452] Plasma concentration detection: In this experiment, compounds in plasma will be detected using the already developed LC-MS / MS method.
[0453] 5. Data Analysis A non-compartment model was employed, and blood drug concentration-time data were analyzed using Phoenix®WinNonlin® (Version 8.2, Pharsight, Mountain View, CA). The dosages of the compounds in Table 6 were IV: 2 mg / kg and PO: 10 mg / kg, and the test results are shown in Table 6.
[0454] [Table 7]
[0455] As can be seen from the table above, the compounds of the present invention have high oral exposure levels and good bioavailability.
[0456] Pharmacokinetic studies of high-dose (100 mpk or 200 mpk) compounds in mice: Oral formulation solvent: Preparation steps for a 10% hydroxypropyl β-cyclodextrin solution in 5% dimethyl sulfoxide and 15% polyethylene glycol-15 hydroxystearate: Weigh an appropriate amount of compound, calculate the total volume of the solution based on the dose (e.g., dose is 200 mg / kg, fixed dose volume for mice is 10 mL / kg, concentration is 20 mg / mL), add 5% DMSO and vortex, add 15% HS15 and vortex, and finally add 10% cyclodextrin aqueous solution and vortex to prepare a solution or suspension of the final concentration. The remaining steps refer to the mouse pharmacokinetic procedures at a dose of 10 mpk. The test results are shown in Table 7.
[0457] [Table 8]
[0458] As can be seen from the table above, the compounds of the present invention still have very high oral exposure levels even at high doses (100 mpk or 200 mpk), and the exposure level depends linearly with the dose, compared to the PO results for 10 mpk in Table 6.
[0459] Efficacy Experiment Example 7: Pharmacokinetic Study in Rats This experiment will examine the pharmacokinetic behavior of the compound in SD rats after intravenous (IV) and intragastric (PO) administration. The preparation of the dosage formulation will be based on low-dose pharmacokinetic studies in mice.
[0460] On the day of administration, the actual body weight of the rats will be weighed, and the administration volume will be calculated. Three rats will be assigned to each group, and for each compound, two groups will be tested: one group will receive a single intravenous dose, and the other group will receive a single intragastric dose. Whole blood samples will be collected at predetermined time points (0.25, 0.5, 1, 2, 4, 8, and 24 hours after administration) using the jugular vein sampling method. Immediately after blood sample collection, the samples will be transferred to commercially available sample tubes tagged with K2-EDTA (0.85-1.15 mg), and then the plasma will be collected by centrifugation (3200 × g, 4°C, 10 minutes). The plasma will be transferred to a pre-cooled centrifuge tube, rapidly frozen in dry ice, and then stored in an ultra-low temperature refrigerator at -60°C or below until LC-MS / MS analysis is performed.
[0461] Plasma concentrations are measured using LC-MS / MS. Plasma drug concentration data for compounds are processed using a non-compartmental model with WinNonlin Version 6.3 (Pharsight, Mountain View, CA) pharmacokinetic software. Relevant pharmacokinetic parameters are calculated using a linear logarithmic trapezoidal model. The dosages for the compounds in Table 8 were IV: 2 mg / kg and PO: 10 mg / kg, and the test results are shown in Table 8.
[0462] [Table 9]
[0463] The dosages of the compounds in the table above are IV: 2 mg / kg and PO: 10 mg / kg. As is clear from the results, the compounds of the present invention have high oral exposure and good bioavailability.
[0464] Efficacy Experiment Example 8: Pharmacodynamic Test Healthy female nude mice (BALB / cnu / nu) aged 6-8 weeks are used and reared in an SPF environment in accordance with animal ethics guidelines. A good growth rate is achieved through trypsin digestion. 7H226 cells are obtained, then washed with phosphate-buffered saline (PBS), and subsequently resuspended in PBS containing 50% Matrigel (BD Biosciences).
[0465] Next, the drug is subcutaneously injected into the dorsolateral region of the mouse, and the tumor volume is measured once every three days thereafter. If the tumor volume is approximately 150-200 mm³ 3 In this case, mice are randomly assigned to different treatment groups, and one of the compounds described in the present invention is prepared accordingly and then administered in an appropriate dose. Finally, the tumor growth status of nude mice is analyzed after 4 to 6 weeks according to the tumor growth status. The test results are shown in Table 9.
[0466] [Table 10]
[0467] .
[0468] Healthy female nude mice (BALB / cnu / nu) aged 6-8 weeks were used and reared in an SPF environment in accordance with animal ethics guidelines. 5M MSTO-211H cells in good growth condition were obtained by trypsin digestion, then washed with phosphate-buffered saline (PBS), and subsequently resuspended in PBS containing 50% Matrigel (BD Biosciences).
[0469] Next, the drug is subcutaneously injected into the dorsolateral region of the mouse, and the tumor volume is measured once every three days thereafter. If the tumor volume is approximately 150-200 mm³ 3 In this case, mice are randomly assigned to different treatment groups, and one of the compounds described in the present invention is prepared accordingly and then administered in an appropriate dose. Finally, the tumor growth status of nude mice is analyzed after 4 to 6 weeks according to the tumor growth status. The test results are shown in Table 10.
[0470] [Table 11]
[0471] .
[0472] Effect Experiment Example 9: Test of Saturation Solubility of Samples in FaSSIF Solution 1. Experimental Procedure 1.1 Preparation of FaSSIF solution Preparation of buffer solution (pH 6.5): Weigh approximately 0.21 g of sodium hydroxide, approximately 2.24 g of sodium dihydrogen phosphate dihydrate, and 3.09 g of sodium chloride. Dissolve them in 500 mL of water, then adjust the pH to 6.5 with 1 N sodium hydroxide or 1 N hydrochloric acid.
[0473] Weigh 112 mg of FaSSIF solid into a 50 mL volumetric flask, dissolve it in the above buffer solution, dilute to the marked level, shake uniformly, and let stand at room temperature for at least 2 hours.
[0474] 1.2 Sample Preparation Sample: Take approximately 1 mg of the sample, add 1 mL of FaSSIF solution, stir overnight at room temperature, centrifuge, and collect the supernatant for sampling analysis.
[0475] Control solution: Approximately 1.5 mg of the sample is accurately weighed into a 50 mL volumetric flask, dissolved in DMF, diluted to the marked level, and then uniformly mixed to obtain the control solution.
[0476] 1.3 Preparation of the mobile phase Mobile phase A: Obtained by accurately weighing 1000 mL of purified water, adding 1 mL of formic acid, mixing uniformly, and degassing with ultrasound.
[0477] Mobile phase B: Acetonitrile.
[0478] 1.4 Chromatography conditions (Table 11)
[0479] [Table 12]
[0480] 2.Results The principal component peak of the control sample and the peak in the sample corresponding to its retention time were integrated, and the concentration in the FaSSIF solution was calculated using the external standard method. The test results are shown in Table 12.
[0481] [Table 13]
[0482] .
Claims
1. A compound represented by formula I, a pharmaceutically acceptable salt thereof, an ester thereof, a stereoisomer thereof, a tautomer thereof, a crystalline polymorph thereof, a solvate thereof, a metabolite thereof, an isotopic derivative thereof, or a prodrug thereof, 【Chemistry 1】 During the ceremony, R 1 and R 2 C 1 ~C 6 alkyl group, C 3 ~C 6 Cycloalkyl groups or C 6 ~C 10 It is an aryl group, Alternatively, R 1 , R 2 forms, together with the atoms connecting thereto, a 3- to 12-membered heterocycloalkyl group, or a 3- to 12-membered heterocycloalkyl group substituted with one or more R 1-1 , wherein in the 3- to 12-membered heterocycloalkyl group, in addition to the connecting P atom, further contains 0, 1, 2 or 3 heteroatoms selected from N, O and S, one, two or three heteroatoms of one, two or three kinds, R 1-1 C 1 ~C 6 It is an alkyl group, Ring B is C 3 ~C 12 A saturated or unsaturated carbon ring, "a 5- to 16-membered saturated or unsaturated heterocycle in which one, two, or three heteroatoms are selected from N, O, and S, and the number of heteroatoms is 1, 2, 3, 4, or 5," Ring B is either monocyclic or polycyclic. If ring B is monocyclic, it is an aromatic ring. If ring B is polycyclic, 【Chemistry 2】 The ring connected to it is an aromatic ring, and the remaining rings are saturated or unsaturated rings. m1 is either 0 or 1. R 3 "A 5-12 member saturated or unsaturated heterocyclyl group having one, two, or three heteroatoms selected from N, O, and S," and one or more R 3-1 A 5-12 member saturated or unsaturated heterocyclyl group having one, two, or three heteroatoms selected from N, O, and S, substituted with C 6 ~C 10 An aryl group or one or more R groups 3-5 C replaced by 6 ~C 10 It is an aryl group, R 3-1 and R 3-5 These are independently H, deuterium, halogen, and C 1 ~C 6 alkyl group, C 1 ~C 6 Alkoxy group, CN, one or more R 3-2 C replaced by 1 ~C 6 Alkyl group, one or more R 3-3 C replaced by 1 ~C 6 Alkoxy group, "a 3- to 12-membered heterocycloalkyl group having one, two, or three heteroatoms selected from N, O, and S", "a 5- to 12-membered heteroaryl group having one, two, or three heteroatoms selected from N, O, and S", C(=O)NR c R d , C 3 ~C 6 Cycloalkyl group, one or more R 3-4 C replaced by 3 ~C 6 It is a cycloalkyl group, R 3-2 and R 3-3 These are independently deuterium, halogen, OH, CN, and C. 1 ~C 6 Alkoxy group, "a 3-12 membered heterocycloalkyl group having one, two, or three heteroatoms selected from N, O, and S", C(=O)NR c R d or NR b C(=O)R a And, R 3-4 These are independently CN and C(=O)NR c R d or C (=O) OR a And, m2 is 0, 1, 2, or 3. R 4 These are independently oxo (=O), CN, halogen, and C 1 ~C 6 alkyl group, C 1 ~C 6 Haloalkyl group, C 1 ~C 6 Alkoxy group or C 1 ~C 6 It is a haloalkoxy group, L is a single bond, -CR L1 R L2 -, -O-, -S-, -NR L3 -, -NR L3 CR L1 R L2 -, -CR L4 =CR L5 - 【Transformation 3】 And, R L1 , R L2 and R L3 H and C are independent of each other. 1 ~C 6 Alkyl or C 3 ~C 6 It is a cycloalkyl group, R L4 and R L5 H or C 1 ~C 6 It is an alkyl group, L 1 and L 2 Independently, -CH 2 -, -O-, -S-, or -NH- Ring A is C 3 ~C 12 A saturated or unsaturated carbon ring, "a 5- to 12-membered saturated or unsaturated heterocycle in which one, two, or three heteroatoms are selected from N, O, and S," m3 is 0, 1, 2, or 3. R 5 is independently SF 5 , halogen, C 1 to C 6 alkyl group, one or more R 5-1 substituted C 1 to C 6 alkyl group, SR 5-2 , OR 5-3 , CN, S(=O) 2 R 5-4 , C(=O)R 5-5 , S(=O) 2 NR d R 5-6 , NR d R 5-6 , C 3 to C 6 cycloalkyl group, or one or more R 5-7 substituted C 3 to C 6 cycloalkyl group, and R 5-1 These are independently a hydroxyl group, CN, or halogen. R 5-2 , R 5-3 , R 5-4 , R 5-6 H and C are independent of each other. 1 ~C 6 Haloalkyl group, C 1 ~C 6 alkyl group, C 3 ~C 6 Cycloalkyl groups, or one or more R groups 5-8 C replaced by 3 ~C 6 It is a cycloalkyl group, R 5-5 C 1 ~C 6 Haloalkyl groups, H, C 1 ~C 6 alkyl group, C 1 ~C 6 Alkoxy group, C 1 ~C 6 Haloalkoxy group, C 3 ~C 6 Cycloalkyl groups, or one or more R groups 5-8 C replaced by 3 ~C 6 Cycloalkyl groups, NR d R 5-6 And, R 5-7 and R 5-8 These are, independently, halogen or C 1 ~C 6 It is a haloalkyl group, R a , R b , R c and R d H or C 1 ~C 6 It is an alkyl group. Compounds represented by formula I, pharmaceutically acceptable salts thereof, esters thereof, stereoisomers thereof, tautomers thereof, crystalline polymorphs thereof, solvates thereof, metabolites thereof, isotopic derivatives thereof, or prodrugs thereof.
2. R 1 and R 2 C 1 ~C 6 alkyl group, C 3 ~C 6 Cycloalkyl groups or C 6 ~C 10 It is an aryl group, Alternatively, R 1 , R 2 These are 3- to 12-membered heterocycloalkyl groups, or one or more R atoms, along with the atoms linked to them. 1-1 A 3- to 12-membered heterocycloalkyl group is formed by substitution with, wherein the 3- to 12-membered heterocycloalkyl group further contains, in addition to the linked P atom, 0, 1, 2, or 3 heteroatoms selected from N, O, and S, of which one, two, or three types. R 1-1 C 1 ~C 6 It is an alkyl group, Ring B is C 3 ~C 12 A saturated or unsaturated carbon ring, "a 5- to 16-membered saturated or unsaturated heterocycle in which one, two, or three heteroatoms are selected from N, O, and S, and the number of heteroatoms is 1, 2, 3, 4, or 5," Ring B is either monocyclic or polycyclic. If ring B is monocyclic, it is an aromatic ring. If ring B is polycyclic, 【Chemistry 4】 The ring connected to it is an aromatic ring, and the remaining rings are saturated or unsaturated rings. m1 is either 0 or 1. R 3 "A 5-12 member saturated or unsaturated heterocyclyl group having one, two, or three heteroatoms selected from N, O, and S," and one or more R 3-1 A 5-12 member saturated or unsaturated heterocyclyl group having one, two, or three heteroatoms selected from N, O, and S, substituted with C 6 ~C 10 An aryl group or one or more R groups 3-5 C replaced by 6 ~C 10 It is an aryl group, R 3-1 and R 3-5 These are independently H, deuterium, halogen, and C 1 ~C 6 alkyl group, C 1 ~C 6 Alkoxy group, CN, one or more R 3-2 C replaced by 1 ~C 6 Alkyl group, one or more R 3-3 C replaced by 1 ~C 6 Alkoxy group, "a 3- to 12-membered heterocycloalkyl group having one, two, or three heteroatoms selected from N, O, and S", "a 5- to 12-membered heteroaryl group having one, two, or three heteroatoms selected from N, O, and S", C(=O)NR c R d , C 3 ~C 6 Cycloalkyl group, one or more R 3-4 C replaced by 3 ~C 6 It is a cycloalkyl group, R 3-2 and R 3-3 These are independently deuterium, halogen, OH, CN, and C. 1 ~C 6 Alkoxy group, "a 3-12 membered heterocycloalkyl group having one, two, or three heteroatoms selected from N, O, and S", C(=O)NR c R d or NR b C(=O)R a And, R 3-4 These are independently CN and C(=O)NR c R d or C (=O) OR a And, m2 is 0, 1, 2, or 3. R 4 These are independently oxo (=O), CN, halogen, and C 1 ~C 6 alkyl group, C 1 ~C 6 Haloalkyl group, C 1 ~C 6 Alkoxy group or C 1 ~C 6 It is a haloalkoxy group, L is a single bond, -CR L1 R L2 -, -O-, -S-, -NR L3 -, -NR L3 CR L1 R L2 -, -CR L4 =CR L5 - 【Transformation 5】 And, R L1 , R L2 and R L3 H and C are independent of each other. 1 ~C 6 Alkyl or C 3 ~C 6 It is a cycloalkyl group, R L4 and R L5 H or C 1 ~C 6 It is an alkyl group, L 1 and L 2 Independently, -CH 2 -, -O-, -S-, or -NH- Ring A is C 3 ~C 12 A saturated or unsaturated carbon ring, "a 5- to 12-membered saturated or unsaturated heterocycle in which one, two, or three heteroatoms are selected from N, O, and S," m3 is 0, 1, 2, or 3. R 5 Independently, science fiction 5 , halogen, C 1 ~C 6 Alkyl group, one or more R 5-1 C replaced by 1 ~C 6 Alkyl alkyl, SR 5-2 , OR 5-3 ,CN,S(=O) 2 R 5-4 , C(=O)R 5-5 , S (=O) 2 NR d R 5-6 , NR d R 5-6 , or one or more R 5-7 C replaced by 3 ~C 6 It is a cycloalkyl group, R 5-1 These are independently a hydroxyl group, CN, or halogen. R 5-2 , R 5-3 , R 5-4 , R 5-6 H and C are independent of each other. 1 ~C 6 Haloalkyl group, C 1 ~C 6 alkyl group, C 3 ~C 6 Cycloalkyl groups, or one or more R groups 5-8 C replaced by 3 ~C 6 It is a cycloalkyl group, R 5-5 C 1 ~C 6 Haloalkyl groups, H, C 1 ~C 6 alkyl group, C 1 ~C 6 Alkoxy group, C 1 ~C 6 Haloalkoxy group, C 3 ~C 6 Cycloalkyl groups, or one or more R groups 5-8 C replaced by 3 ~C 6 Cycloalkyl groups, NR d R 5-6 And, R 5-7 and R 5-8 These are, independently, halogen or C 1 ~C 6 It is a haloalkyl group, R a , R b , R c and R d H or C 1 ~C 6 It is an alkyl group. A compound represented by formula I as described in feature 1, a pharmaceutically acceptable salt thereof, an ester thereof, a stereoisomer thereof, a tautomer thereof, a crystalline polymorph thereof, a solvate thereof, a metabolite thereof, an isotopic derivative thereof, or a prodrug thereof.
3. The following conditions, (1) The "halogen" is independently fluorine, chlorine, bromine, or iodine. (2) The above “C 1 ~C 6 Each alkyl group is independently a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, or a tert-butyl group. (3) The above “C 1 ~C 6 Each "alkoxy group" is independently a methoxy group, an ethoxy group, an n-propoxy group, an isopropoxy group, an n-butoxy group, an isobutoxy group, or a tert-butoxy group. (4) The above “C 1 ~C 6 Each "haloalkyl group" is independently -CHF 2 ien-CH 2 F or -CF 3 Being (5) The above “C 1 ~C 6 Each "haloalkoxy group" is independently -OCHF 2 , -OCH 2 F or -OCF 3 Being (6) The above “C 3 ~C 6 "Cycloalkyl group" is independently a cyclopropyl group, a cyclobutyl group, a cyclopentyl group, or a cyclohexyl group. (7) The above “C 6 ~C 10 The "aryl group" is independently either a phenyl group or a naphthyl group. (8) The "3- to 12-membered heterocycloalkyl group having one, two, or three heteroatoms selected from N, O, and S" is independently defined as "a 5- to 6-membered heterocycloalkyl group having one or two heteroatoms selected from N and O, and having one or two heteroatoms," (9) The "5- to 12-membered heteroaryl group having one, two, or three heteroatoms selected from N, O, and S" is defined as "a 5- to 6-membered heteroaryl group having one, two, or three heteroatoms selected from N, O, and S," (10) In ring B, the above "C 3 ~C 12 "Saturated or unsaturated carbon rings" is C 6 ~C 10 An unsaturated carbon ring, preferably C 6 ~C 10 Being an aryl ring, (11) In ring B, the "heteroatoms are selected from N, O, and S, and the heteroatoms number 1, 2, 3, 4, or 5, and the heteroring is a 5- to 16-membered saturated or unsaturated heteroring" is defined as "heteroatoms are selected from N, O, and S, and the heteroatoms number 1, 2, 3, 4, or 5, and the heteroring is a 6- to 15-membered unsaturated heteroring," (12) R 3 Therefore, the aforementioned "heterocyclyl group having one, two, or three heteroatoms selected from N, O, and S, and a number of heteroatoms of one, two, or three, and being 5-12 membered saturated or unsaturated" is defined as "a heterocyclyl group having one, two, or three heteroatoms selected from N, O, and S, and a number of heteroatoms of one, two, or three, and being 5-10 membered unsaturated", (13) In ring A, the above "C 3 ~C 12 "Saturated or unsaturated carbon rings" is C 4 ~C 10 A saturated or unsaturated carbon ring, preferably C 6 ~C 10 Being an aryl ring, and (14) In ring A, the "5- to 12-membered saturated or unsaturated heterocycle having one, two, or three heteroatoms selected from N, O, and S" satisfies one or more of the following conditions: "a 5- to 6-membered heteroaryl ring having one, two, or three heteroatoms selected from N, O, and S, and having one, two, or three heteroatoms." A compound represented by formula I according to feature 1 or 2, a pharmaceutically acceptable salt thereof, an ester thereof, a stereoisomer thereof, a tautomer thereof, a crystalline polymorph thereof, a solvate thereof, a metabolite thereof, an isotopic derivative thereof, or a prodrug thereof.
4. The following conditions, (1) The "halogen" is independently either fluorine or chlorine. (2) The above “C 1 ~C 6 Each "alkyl group" is independently either a methyl group or an ethyl group. (3) The above “C 1 ~C 6 The "alkoxy group" is either a methoxy group or an ethoxy group, independently of each other. (4) The above “C 3 ~C 6 Each "cycloalkyl group" is independently either a cyclopropyl group or a cyclobutyl group. (5) The above “C 6 ~C 10 Each "aryl group" is independently a phenyl group. (6) In ring B, the above "C 3 ~C 12 A "saturated or unsaturated carbon ring" is a benzene ring, a naphthalene ring, or an indan ring. (7) In ring B, the "heteroatoms are selected from N, O, and S, and the heteroatoms are 1, 2, 3, 4, or 5 heteroatoms, and the number of heteroatoms is 1, 2, 3, 4, or 5, and the heteroring is a 5-16 member saturated or unsaturated heteroring" is a pyridine ring (for example, 【Transformation 6】 ), indole ring (for example, 【Transformation 7】 ), carbazole ring (for example, 【Transformation 8】 )、 【Chemistry 9】 Being (8) R 3 So, the aforementioned "heterocyclyl group having one, two, or three heteroatoms selected from N, O, and S, and having one, two, or three heteroatoms, and being a 5-12 member saturated or unsaturated heterocyclyl group" is an imidazolyl group (for example, 【Chemistry 10】 ), pyrazolyl group (for example, 【Chemistry 11】 )、 【Chemistry 12】 , pyridyl group (for example, 【Chemistry 13】 ) or pyrimidinyl group (for example, 【Chemistry 14】 ) (9) In ring A, the above "C 3 ~C 12 A "saturated or unsaturated carbon ring" is a cyclobutane ring (for example, 【Chemistry 15】 ), cyclohexane ring (for example, 【Chemistry 16】 ), spiro[3.3]heptane ring (for example, 【Chemistry 17】 ), benzene ring (for example, [Chemistry 18] ), naphthalene ring (for example, 【Chemistry 19】 ), being an indan ring or tetralin ring, and (10) In ring A, the "heterocyclyl having one, two, or three heteroatoms selected from N, O, and S, and having one, two, or three heteroatoms, and being a 5-12 member saturated or unsaturated heterocyclyl" is a pyridine ring (for example, 【Chemistry 20】 ) or thiophene ring (for example, 【Chemistry 21】 ) that satisfies one or more of the following conditions A compound represented by formula I according to feature 1 or 2, a pharmaceutically acceptable salt thereof, an ester thereof, a stereoisomer thereof, a tautomer thereof, a crystalline polymorph thereof, a solvate thereof, a metabolite thereof, an isotopic derivative thereof, or a prodrug thereof.
5. The following conditions, (1) R 3 So, the aforementioned "heterocyclyl group having one, two, or three heteroatoms selected from N, O, and S, and having one, two, or three heteroatoms, and being a 5-12 member saturated or unsaturated heterocyclyl group" is a pyrrolyl group (for example, 【Chemistry 22】 ), pyrazolyl group (for example, 【Chemistry 23】 )), imidazolyl group (for example, 【Chemistry 24】 ), triazolyl group (for example, 【Chemistry 25】 ), thiazolyl group (for example, 【Chemistry 26】 ), oxazolyl group (for example, 【Chemistry 27】 ), isoxazolyl group (for example, 【Chemistry 28】 ), pyridyl group (for example, 【Chemistry 29】 ), pyrimidinyl group (for example, 【Transformation 30】 ), pyrazinyl group (for example, 【Chemistry 31】 ), pyridadinyl group (for example, 【Chemistry 32】 )、 【Transformation 33】 Being, and (2) In ring A, the above "C 3 ~C 12 A "saturated or unsaturated carbon ring" is a cyclobutane ring (for example, 【Transformation 34】 ), cyclohexane ring (for example, 【Chemistry 35】 ), spiro[2.5]octane (for example, 【Transformation 36】 ), spiro[3.3]heptane ring (for example, 【Chemistry 37】 ), benzene ring (for example, 【Transformation 38】 ), naphthalene ring (for example, 【Chemistry 39】 ), satisfying one or more of the following: being an indan ring or a tetralin ring, A compound represented by formula I as described in feature 1, a pharmaceutically acceptable salt thereof, an ester thereof, a stereoisomer thereof, a tautomer thereof, a crystalline polymorph thereof, a solvate thereof, a metabolite thereof, an isotopic derivative thereof, or a prodrug thereof.
6. The following conditions, (1) R 1 and R 2 C 1 ~C 6 Being an alkyl group, (2) R 3 This refers to "a 5-12 member saturated or unsaturated heterocyclyl group having one, two, or three heteroatoms selected from N, O, and S," or one or more R 3-1 The substituted heterocyclyl group is a 5-12 member saturated or unsaturated group with one, two, or three heteroatoms selected from N, O, and S. (3) Note 3-1 C 1 ~C 6 Alkyl group, or one or more R 3-2 C replaced by 1 ~C 6 Being an alkyl group, (4) R 3-2 It is independently a halogen, (5) Caution 4 These are halogens and C 1 ~C 6 Alkyl or C 1 ~C 6 It is an alkoxy group. (6) Ring B is C 6 ~C 10 An unsaturated carbon ring, or "a 6-15 member unsaturated heterocycle in which one, two, or three heteroatoms are selected from N, O, and S, and the number of heteroatoms is 1, 2, 3, 4, or 5." (7) L is a single bond, -CR L1 R L2 -, -O-, -S-, or -NR L3 - Preferably, L is a single bond, -O-, -S- or -NR L3 - that is, (8) R L3 H is, (9) Ring A is C 6 ~C 10 An aryl ring or "a 5-6 membered heteroaryl ring in which one, two, or three heteroatoms are selected from N, O, and S," (10) m³ is 1. (11) R 5 These are halogens and C 1 ~C 6 Alkyl group, or one or more R 5-1 C replaced by 1 ~C 6 Being an alkyl group, (12) R 5-1 It satisfies one or more of the following conditions: being independently halogenated. A compound represented by formula I according to feature 1 or 2, a pharmaceutically acceptable salt thereof, an ester thereof, a stereoisomer thereof, a tautomer thereof, a crystalline polymorph thereof, a solvate thereof, a metabolite thereof, an isotopic derivative thereof, or a prodrug thereof.
7. R 5 C 3 ~C 6 It is a cycloalkyl group. A compound represented by formula I as described in feature 1, a pharmaceutically acceptable salt thereof, an ester thereof, a stereoisomer thereof, a tautomer thereof, a crystalline polymorph thereof, a solvate thereof, a metabolite thereof, an isotopic derivative thereof, or a prodrug thereof.
8. The following conditions, (1) R 1 and R 2 C 1 ~C 6 It is an alkyl group, or R 1 , R 2 These, together with the atoms linked to them, form a 3- to 12-membered heterocycloalkyl group, wherein the 3- to 12-membered heterocycloalkyl group further contains, in addition to the linked P atoms, 0, 1, 2, or 3 heteroatoms selected from N, O, and S, of one, two, or three types. (2) R 4 C 1 ~C 6 Being an alkyl group, (3) Caution 5 This is one or more R independently 5-1 C replaced by 1 ~C 6 Being an alkyl group, and (4) m2 is 0 or 1, satisfying one or more of the following conditions. A compound represented by formula I as described in feature 1, a pharmaceutically acceptable salt thereof, an ester thereof, a stereoisomer thereof, a tautomer thereof, a crystalline polymorph thereof, a solvate thereof, a metabolite thereof, an isotopic derivative thereof, or a prodrug thereof. 【Request Item 9】 【Chemistry 40】 teeth, 【Chemistry 41】 And, During the ceremony, 【Chemistry 42】 This indicates a single bond or a double bond. X 1 is S, -CR X1 =CR X1 -, -N = CR X1 - or -CR X1 = N-, X 2 CR X1 , N or S, X 3 C, CR X1 or N, X 4 CR X1 , N, -C(O)- or CR X1 R X2 And, X 5 N, NR X3 CR X1 CR X1 R X2 , -CR X1 =CR X1 -, -N = CR X1 -, -CR X1 = N-, -CR X1 R X2 -CR X1 R X2 -, -O-CR X1 R X2 -, -C(O)-N=, -C(O)-CR X1 = or -NR X3 -CR X1 R X2 - and X 6 CR X1 or N, X 7 CR X1 or N, X 8 CR X1 CR X1 R X2 , N, NR X3 , -C(O)-, O or S, X 9 は、CR X1 ,N,NR X3 、-CR X1 =CR X1 -、=CR X1 -CR X1 =、-CR X1 R X2 -、-CR X1 R X2 -CR X1 R X2 -、=N-CR X1 =、=CR X1 -N=、=CR X1 -NR X3 -、-NR X3 -CR X1 =、-NR X3 -N=、=N-NR X3 - X 10 CR X1 CR X1 R X2 , N, NR X3 , -C(O)-, O or S, X 11 is non-existent, O or S, X 12 CR X1 or N, X 16 is C or N, X 13 CR X1 or N, X 14 CR X4 or N, X 15 CR X1 or N, X 17 CR X1 or N, Each R X1 and R X2 H and C are independent of each other. 1 ~C 6 It is an alkyl group, halogen or CN, or R X1 , R X2 C 3 ~C 4 Forms a cycloalkyl group, Each R X3 H and C are independent of each other. 1 ~C 6 It is an alkyl group, halogen or CN, R X4 H is "a 5-12 member saturated or unsaturated heterocyclyl group having one, two, or three heteroatoms selected from N, O, and S", and one or more R X4-1 A 5-12 member saturated or unsaturated heterocyclyl group having one, two, or three heteroatoms selected from N, O, and S, substituted with C 6 ~C 10 An aryl group or one or more R groups X4-5 C replaced by 6 ~C 10 It is an aryl group, R X4-1 and R X4-5 These are independently H, deuterium, halogen, and C 1 ~C 6 Alkyl alkyl group, C 1 ~C 6 Alkoxy group, CN, one or more R X4-2 C replaced by 1 ~C 6 Alkyl group, one or more R X4-3 C replaced by 1 ~C 6 Alkoxy group, "a 3- to 12-membered heterocycloalkyl group having one, two, or three heteroatoms selected from N, O, and S", "a 5- to 12-membered heteroaryl group having one, two, or three heteroatoms selected from N, O, and S", C(=O)NR c R d , C 3 ~C 6 Cycloalkyl group, one or more R X4-4 C replaced by 3 ~C 6 It is a cycloalkyl group, R X4-2 and R X4-3 These are independently deuterium, halogen, OH, CN, and C. 1 ~C 6 Alkoxy group, "a 3-12 membered heterocycloalkyl group having one, two, or three heteroatoms selected from N, O, and S", C(=O)NR c R d or NR b C(=O)R a And, R X4-4 These are independently CN and C(=O)NR c R d or C (=O) OR a And, R a , R b , R c and R d H or C 1 ~C 6 It is an alkyl group. A compound represented by formula I according to feature 1 or 2, a pharmaceutically acceptable salt thereof, an ester thereof, a stereoisomer thereof, a tautomer thereof, a crystalline polymorph thereof, a solvate thereof, a metabolite thereof, an isotopic derivative thereof, or a prodrug thereof.
10. The following conditions, (1) 【Chemistry 43】 teeth 【Chemistry 44】 Preferably, 【Chemistry 45】 teeth, 【Chemistry 46】 Being (2) 【Chemistry 47】 teeth 【Chemistry 48】 【change】 Preferably, 【Chemistry 49】 teeth [Transformation 50] Being (3) 【Chemistry 51】 teeth 【Chemistry 52】 Being, and (4) R X4 teeth, 【Chemistry 53】 Satisfying one or more of the following conditions: The compound represented by formula I as described in feature 9, a pharmaceutically acceptable salt thereof, an ester thereof, a stereoisomer thereof, a tautomer thereof, a crystalline polymorph thereof, a solvate thereof, a metabolite thereof, an isotopic derivative thereof, or a prodrug thereof.
11. The following conditions, (1) 【Chemistry 54】 teeth 【Transformation 55】 Being, and (2) R X4 teeth, 【Transformation 56】 【change】 And preferably, R X4 teeth, 【Chemistry 57】 Satisfying one or more of the following conditions: The compound represented by formula I as described in feature 9, a pharmaceutically acceptable salt thereof, an ester thereof, a stereoisomer thereof, a tautomer thereof, a crystalline polymorph thereof, a solvate thereof, a metabolite thereof, an isotopic derivative thereof, or a prodrug thereof.
12. The following conditions, (1) Ring B is, 【Chemical Formula 58】 Being (2) Each R X1 It is independently H, (3) Caution X4 This refers to "a 5-12 member saturated or unsaturated heterocyclyl group having one, two, or three heteroatoms selected from N, O, and S," or one or more R X4-1 The substituted "heterocyclyl group having 1, 2, or 3 heteroatoms selected from N, O, and S, and having 1, 2, or 3 heteroatoms, and being a 5-12 member saturated or unsaturated heterocyclyl group", and (4) R X4-1 and R X4-5 H or C 1 ~C 6 Alkyl alkyl groups, for example, C 1 ~C 6 It satisfies one or more of the following conditions: being an alkyl group. The compound represented by formula I as described in feature 9, a pharmaceutically acceptable salt thereof, an ester thereof, a stereoisomer thereof, a tautomer thereof, a crystalline polymorph thereof, a solvate thereof, a metabolite thereof, an isotopic derivative thereof, or a prodrug thereof.
13. The following conditions, R X4 So, the aforementioned "heterocyclyl group having one, two, or three heteroatoms selected from N, O, and S, and a number of heteroatoms of one, two, or three, and being 5-12 membered saturated or unsaturated" is defined as "heterocyclyl group having one, two, or three heteroatoms selected from N, O, and S, and a number of heteroatoms of one, two, or three, and being 5-10 membered unsaturated," for example, a pyrrolyl group (for example, 【Chemistry 59】 ), pyrazolyl group (for example, 【Transformation 60】 ), imidazolyl group (for example, 【Chemistry 61】 ), triazolyl group (for example, 【Transformation 62】 ), thiazolyl group (for example, 【Transformation 63】 ), oxazolyl group (for example, 【Chemistry 64】 ), isoxazolyl group (for example, 【Transformation 65】 ), pyridyl group (for example, 【Chemical Formula 66】 ), pyrimidinyl group (for example, 【Transformation 67】 ), pyrazinyl group (for example, 【Transformation 68】 ), pyridadinyl group (for example, 【Transformation 69】 )、 【Transformation 70】 And, for example, an imidazolyl group (for example, 【Chemistry 71】 ), pyrazolyl group (for example, 【Chemistry 72】 )、 【Transformation 73】 , pyridyl group (for example, 【Chemistry 74】 ) or pyrimidinyl group (for example, 【Chemistry 75】 ) satisfying one or more of the following conditions The compound represented by formula I as described in feature 9, a pharmaceutically acceptable salt thereof, an ester thereof, a stereoisomer thereof, a tautomer thereof, a crystalline polymorph thereof, a solvate thereof, a metabolite thereof, an isotopic derivative thereof, or a prodrug thereof.
14. The following conditions, (1) 【Transformation 76】 teeth 【Chemical 77】 Being (2) 【Transformation 78】 teeth 【Transformation 79】 【change】 Being (3) L is a single bond, -O- or -NH-, and (4) 【Chemistry 80】 teeth 【Chemistry 81】 Satisfying one or more of the following conditions: A compound represented by formula I according to feature 1 or 2, a pharmaceutically acceptable salt thereof, an ester thereof, a stereoisomer thereof, a tautomer thereof, a crystalline polymorph thereof, a solvate thereof, a metabolite thereof, an isotopic derivative thereof, or a prodrug thereof.
15. The following conditions, (1) 【Chemistry 82】 teeth, 【Chemistry 83】 【change】 Being (2) L is a single bond, -CR L1 R L2 It must be -, -O-, -S-, or -NH-, and (3) 【Chemical 84】 teeth 【Chemical 85】 Satisfying one or more of the following conditions: A compound represented by formula I according to feature 1 or 2, a pharmaceutically acceptable salt thereof, an ester thereof, a stereoisomer thereof, a tautomer thereof, a crystalline polymorph thereof, a solvate thereof, a metabolite thereof, an isotopic derivative thereof, or a prodrug thereof.
16. The compound represented by formula I is the compound represented by the following formulas I-1, I-2, I-3, I-4, I-5, I-6, or I-7, 【Chemical 86】 In the formula, X 3 is C or N, X 4 CR X1 , N, -C(O)- or CR X1 R X2 And, X 5 is, -CR X1 =CR X1 -, -N = CR X1 -, -CR X1 = N-, -O-CR X1 R X2 - or - NR X3 -CR X1 R X2 - and X 8 CR X1 or N, X 10 CR X1 or N, R 1 , R 2 , L, ring A, R 5 The definitions of m3 are as defined in any one of claims 1 to 15, X 7 , X 13 , R X1 , R X2 , R X3 and R X4 The definition is as defined in any one of claims 9 to 15. A compound represented by formula I as described in any one of claims 1 to 15, a pharmaceutically acceptable salt thereof, an ester thereof, a stereoisomer thereof, a tautomer thereof, a crystalline polymorph thereof, a solvate thereof, a metabolite thereof, an isotopic derivative thereof, or a prodrug thereof.
17. The compound represented by formula I is one of the following compounds: 【Chemistry 87】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 A compound represented by formula I according to feature 1 or 2, a pharmaceutically acceptable salt thereof, an ester thereof, a stereoisomer thereof, a tautomer thereof, a crystalline polymorph thereof, a solvate thereof, a metabolite thereof, an isotopic derivative thereof, or a prodrug thereof.
18. A pharmaceutical composition, (1) Compounds represented by formula I as described in any one of claims 1 to 17, pharmaceutically acceptable salts thereof, esters thereof, stereoisomers thereof, tautomers thereof, crystalline polymorphs thereof, solvates thereof, metabolites thereof, isotopic derivatives thereof or prodrugs thereof, and (2) Contains pharmaceutically acceptable additives, A pharmaceutical composition characterized by the following features.
19. Use in the manufacture of a drug, the compound represented by formula I as described in any one of claims 1 to 17, a pharmaceutically acceptable salt thereof, an ester thereof, a stereoisomer thereof, a tautomer thereof, a crystalline polymorph thereof, a solvate thereof, a metabolite thereof, an isotopic derivative thereof, or a prodrug thereof, or the pharmaceutical composition as described in claim 18, wherein the drug is used for the treatment of diseases and conditions mediated by TEAD, such as cancer (e.g., solid tumors, leukemia, etc.), organ regeneration, wound healing, and fibrosis.