Compositions and methods for treating and preventing neurodegenerative diseases and disorders

Abstract

The present invention relates to compositions and methods for promoting the removal of misfolded proteins and protein aggregates. These compositions and methods can be used to treat or prevent neurodegenerative diseases or disorders associated with misfolded proteins or protein aggregates. In various embodiments, the compositions and methods relate to activators of one or more TRIM proteins.

Description

[Technical Field]

[0001] Description of research and development funded by the federal government. This invention was made with government funding granted by the National Institutes of Health under TR001878 and CA243520. The government has certain rights to this invention.

[0002] Cross-reference of related applications This application claims priority to US No. 63 / 503,835, filed on 23 May 2023. The contents of that application are incorporated herein by reference.

[0003] Background of the Invention Neurodegenerative diseases are pathologically and genetically linked to protein misfolding and aggregation, followed by neuronal loss (F. Chiti, CM Dobson, Annu Rev Biochem 75, 333-366, 2006). These diseases—including Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS), Huntington's disease (HD), and spinocerebellar degeneration (SCA)—pose a significant threat to human health and well-being in modern society as the population ages. However, there are no effective treatments for any of these diseases.

[0004] The conversion of tau, a microtubule-associated protein, from its soluble monomeric state to its hyperphosphorylated fibrilic state is associated with many neurodegenerative diseases collectively known as tauopathies (VM Lee, M. Goedert, JQ Trojanowski, Annu Rev Neurosci 24, 1121-1159, 2001; MG Spillantini, M. Goedert, Lancet Neurol 12, 609-622, 2013; J. Gotz, G. Halliday, RM Nisbet, Annu Rev Pathol 14, 239-261, 2019). These diseases include Alzheimer's disease (AD), Pick's disease (PiD), frontotemporal dementia (FTD), chronic traumatic encephalopathy (CTE), corticobasal degeneration (CBD), frontotemporal dementia parkinsonism linked to chromosome 17 (FTDP-17), progressive supranuclear palsy (PSP), primary age-related tauopathy (PART), and argyrophilic granulopathy (AGD). Among these, Alzheimer's disease (AD) is the most common form of dementia (CL Masters et al., Nat Rev Dis Primers 1, 15056, 2015) (DS Knopman et al., Nat Rev Dis Primers 7, 33, 2021). The number of AD patients in the United States is currently estimated at 6 million, and is projected to reach approximately 13 million by 2050 (Alzheimers Dement, 2020). There are no treatments that can effectively prevent or slow the progression of Alzheimer's disease (AD) and other tauopathies, and the development of meaningful therapies is hindered, particularly by the limited knowledge of the PQC system in animal cells.

[0005] Therefore, there is a need in the art for improved compositions and methods for treating neurodegenerative diseases. The present invention satisfies this unmet need.

[0006] Summary of the Invention In some embodiments, the present invention relates to a composition for treating or preventing a disease or disorder related to aggregation of one or more proteins selected from the group consisting of tau, α-synuclein (α-Syn), superoxide dismutase 1 (SOD1), TAR DNA-binding protein 43 (TDP-43), FUsed in Sarcoma / Translocated in LipoSarcoma (FUS / TLS), ataxin 1, huntingtin (Htt), Aβ42, and heteroribonucleoprotein A1 (hnRNPA1), comprising an activator of the level or activity of one or more tripartite motif (TRIM) proteins, wherein one or more TRIM proteins are human TRIM10, TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM11, TRIM17, TRIM18, TRIM The present invention provides a composition in which the activator is one or more selected from the group consisting of 19, TRIM21, TRIM24, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM37, TRIM39, TRIM40, TRIM41, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM56, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, TRIM70, TRIM71, TRIM73, and TRIM77. In some embodiments, the activator is one or more selected from the group consisting of compounds, proteins, peptides, peptide mimes, antibodies, ribozymes, small molecule compounds, nucleic acids, vectors, antisense nucleic acids, siRNA, shRNA, and guide RNA.

[0007] In some embodiments, the disease or disorder is related to tau aggregation, and one or more TRIM proteins are selected from the group consisting of TRIM10, TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM11, TRIM12, TRIM17, TRIM18, TRIM19, TRIM21, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, and TRIM70.

[0008] In some embodiments, the disease or disorder is associated with α-Syn aggregation, and one or more TRIM proteins are selected from the group consisting of TRIM10, TRIM2, TRIM3, TRIM17, TRIM18, TRIM19, TRIM26, TRIM29, TRIM30, TRIM31, TRIM36, TRIM41, TRIM42, TRIM43, TRIM46, TRIM49, TRIM55, TRIM56, TRIM63, TRIM64, TRIM68, TRIM69, TRIM70, TRIM71, and TRIM73.

[0009] In some embodiments, the disease or disorder is associated with SOD1 aggregation, and one or more TRIM proteins are selected from the group consisting of TRIM10, TRIM11, TRIM24, TRIM36, and TRIM58.

[0010] In some embodiments, the disease or disorder is associated with TDP-43 aggregation, and one or more TRIM proteins are selected from the group consisting of TRIM10, TRIM11, TRIM17, TRIM36, TRIM37, TRIM40, TRIM49, and TRIM55.

[0011] In some embodiments, the disease or disorder is associated with the aggregation of FUS / TLS, ataxin 1, Htt, Aβ42, and hnRNPA1, and the one or more TRIM proteins are TRIM10.

[0012] In some embodiments, an activator of a TRIM protein is a peptide comprising the amino acid sequence of the TRIM protein or a functional variant thereof.

[0013] In some embodiments, an activator of a TRIM protein is a nucleic acid encoding the TRIM protein or a functional variant thereof.

[0014] In some embodiments, an activator of a TRIM protein is a vector comprising a nucleic acid encoding the TRIM protein or a functional variant thereof. In some embodiments, the vector is a virus. In some embodiments, the virus is an adeno-associated virus.

[0015] In some embodiments, the present invention provides a method for treating or preventing a neurodegenerative disease or disorder associated with the aggregation of one or more proteins selected from the group consisting of tau, α-Syn, SOD1, TDP-43, FUS / TLS, ataxin 1, Htt, Aβ42, and hnRNPA1, the method comprising administering to a subject the composition of the present invention.

[0016] In some embodiments, the neurodegenerative disease or disorder associated with tau is selected from the group consisting of Alzheimer's disease, frontotemporal lobar degeneration (FTLD-tau), progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), argyrophilic grain disease (AGD), frontotemporal dementia parkinsonism linked to chromosome 17 (FTDP-17), vacuolar tauopathy, Lytico-bodig disease, globular glial tauopathy (GGT), age-related tau astrogliopathy (ARTAG), Pick's disease, amyotrophic lateral sclerosis (ALS), primary age-related tauopathy (PART), senile dementia of the neurofibrillary tangle type (TOD), chronic traumatic encephalopathy (CTE), anti-IgLON5-related tauopathy, Guadeloupean parkinsonism, multisystem proteinopathy (MSP), neck tremor syndrome (NS), ganglioglioma, gangliocytoma, meningovascular angiomatosis, postencephalitic parkinsonism, subacute sclerosing panencephalitis (SSPE), lead encephalopathy, tuberous sclerosis, pantothenate kinase-associated neurodegeneration, and lipofuscinosis, and the activator of one or more TRIM proteins is one or more activators selected from the group consisting of TRIM10, TRIM11, and TRIM55.

[0017] In some embodiments, administering the composition is effective for one or more selected from the group consisting of a) reducing tau aggregates by at least about 60%, b) reducing the ratio of insoluble tau to soluble tau by at least about 50%, and c) reducing tau aggregates by about 90% 6 to 8 days after administration of the composition.

[0018] In some embodiments, the neurodegenerative disease or disorder associated with α-Syn is selected from the group consisting of Parkinson's disease (PD), Lewy body dementia (DLB), multiple system atrophy (MSA), Shy-Drager syndrome, striatonigral degeneration, olivopontocerebellar atrophy, Hallervorden-Spatz syndrome, REM sleep behavior disorder (RPD), and Alzheimer's disease with amygdala-restricted Lewy bodies (AD / ALB), and the activator of one or more TRIM proteins is one or more activators selected from the group consisting of TRIM10, TRIM36, TRIM55, and TRIM68.

[0019] In some embodiments, the neurodegenerative disease or disorder associated with SOD1 is selected from the group consisting of amyotrophic lateral sclerosis (ALS) and Parkinson's disease (PD), and the activator of one or more TRIM proteins is one or more activators selected from the group consisting of TRIM10, TRIM11, TRIM24, TRIM36 and TRIM58.

[0020] In some embodiments, TDP-43-related neurodegenerative diseases or disorders include frontotemporal dementia (FTD), frontotemporal lobar degeneration (FTLD-TDP), multiple system proteinosis (MSP), Perry's disease, facial-onset sensorimotor neuropathy (FOSMN), Alzheimer's disease (AD), cerebral age-related TDP-43 sclerosis (CARTS), limbic-dominant age-related TDP-43 encephalopathy (LATE), sporadic inclusion body myositis (sIBM), chronic traumatic encephalopathy (CTE), and primary lateral sclerosis (ALS). The group consists of PLS, progressive muscular atrophy (PMA), Guam-PDC, Guam-Amyotrophic lateral sclerosis (G-ALS), Parkinson's disease (PD), and Huntington's disease (HD), and one or more TRIM protein activators are selected from the group consisting of TRIM10, TRIM11, TRIM17, TRIM36, TRIM37, TRIM40, TRIM49, and TRIM55.

[0021] In some embodiments, the composition is administered into the cerebrospinal fluid (CSF) of the subject. In some embodiments, the composition is administered by intraventricular (ICV) infusion.

[0022] In some embodiments, the composition is administered to the subject before the onset of symptoms of the disease or disorder. In some embodiments, the composition is administered to the subject after the onset of symptoms of the disease or disorder.

[0023] In some embodiments, the method further includes administering one or more additional therapeutic agents. [Brief explanation of the drawing]

[0024] The following detailed description of embodiments of the present invention will be better understood when read in conjunction with the attached drawings. It should be understood that the present invention is not limited to the exact configuration and means of the embodiments shown in the drawings. [Figure 1]Figure 1, including Figures 1A to 1I, shows representative results of TRIM protein screening. Figure 1A shows representative Western blot images of various TRIM proteins in HEK293T cells transfected with GFP-tau P301L and a control vector (-) or a vector for the indicated TRIM. Cells were lysed in NP-40 buffer and separated into soluble supernatant (SN) and insoluble precipitate (PE) fractions by sedimentation. These fractions (top two rows) and whole cell lysates (WCL, bottom two rows) were analyzed. Expected full-length TRIM bands are indicated by arrows. TRIM proteins with significantly reduced insoluble GFP-tau P301L species are enclosed in boxes. Figure 1B, similar to Figure 1A, shows representative Western blot images of various TRIM proteins in HEK293T cells. Figure 1C shows the relative ratio of GFP-tau P301L(PE) / HSP90 in HEK293T cells for the specified TRIM proteins shown in Figures 1A and 1B. Figure 1D shows a representative Western blot of SH-SY5Y cells expressing TRIM proteins with significantly reduced insoluble GFP-tau P301L, as shown in Figures 1A and 1B. Figure 1E shows the relative ratio of GFP-tau P301L(PE) in SH-SY5Y cells in the presence of the TRIM proteins shown in Figure 1D. Figure 1F shows a representative Western blot of TRIM expression in the indicated TRIM knockout HEK293T cells transfected with GFP-tau P301L. Figure 1G shows the relative ratio of GFP-tau P301L(PE) / HSP90 for the TRIM proteins shown in Figure 1F. Figure 1H shows a representative Western blot of TRIM expression in the indicated TRIM knockdown N2a cells transfected with GFP-tau P301L. Figure 1I shows the relative ratio of GFP-tau P301L(PE) / HSP90 of the TRIM protein shown in Figure 1H. For Figures 1C, 1E, 1G, and 1I, data are mean ± SD. n=3;*, p<0.05;**, p<0.01;***, p<0.001; unpaired Student's t-test. [Figure 2]Figure 2, including Figures 2A–2J, shows representative results of TRIM11 downregulation in the brains of sporadic Alzheimer's disease (AD). Figure 2A shows a representative table summarizing the demographic data of the controls and AD subjects used in this study. Figure 2B shows representative images of Western blots of frontal cortical gray matter from 14 controls and 23 AD individuals. Figure 2C shows the relative levels of TRIM10 and TRIM55 shown in Figure 2B. Figure 2D shows the relative levels of TRIM11 shown in Figure 2B. To compare between blots, #1 control and #1 AD samples were used for each blot. The p-Tau species was modified with residues S202 and T205 (reactive to AT8); Ser262; T231 (reactive to AT180) and S396 and S404 (reactive to PHF-1). Figure 2E shows representative IHC images of TRIM11 and AT8-responsive p-tau in the prefrontal cortex (scale bar, 50 μm). Figure 2F shows representative quantitative results of the TRIM11 and AT8 signals shown in Figure 2E (mean ± SD, n=4). Figure 2G shows representative images of TRIM11 and NeuN staining in the prefrontal cortex of control and AD samples (scale bar, 10 μm). Figure 2H shows quantitative results of the TRIM11 signal shown in Figure 2G, normalized to the number of neurons (mean ± SD, n=4). Individual neurons are indicated by white arrows. Figure 2I shows a representative negative correlation between TRIM11 expression and the levels of various p-tau species between AD tissue and control tissue. Figure 2J shows a representative negative correlation between TRIM11 expression and the levels of various p-tau species among AD tissues only. For Figures 2E and 2H, data are presented as mean ± SD. n=4;*, p<0.05;ns, no significant difference; Student's t-test without pairings. Figures 2I and 2J show the r and p values ​​of the Pearson correlation coefficient. [Figure 3]Figure 3, including Figures 3A to 3M, shows representative results of TRIM11 targeting tau for proteasome degradation. Figure 3A shows representative Western blot images of tau or tau P301L expressed in HEK293T cells as TRIM11 levels increase. Cells were lysed in sarcosyl-containing buffer and analyzed by Western blotting. Figure 3B shows representative Western blot images of a CHX chase assay of GFP-tau-P301L turnover in HEK293T cells in the presence and absence of TRIM11. To better compare the half-lives of GFP-tau-P301L under various conditions, the blot on the left and the corresponding blot on the right were exposed at different times so that equivalent band intensity was achieved at time 0. The relative ratio of GFP-tau p301L / actin is shown in Figure 13A. Figure 3C shows representative Western blots of QBI293 / tau P301L-GFP cells that stably express mCherry or mCherry+TRIM11, cultured in doxycycline (Dox)-containing medium to induce tau P301L-GFP expression, and then in Dox-free medium. The time-course turnover of existing tauP301L-GFP after Dox removal was analyzed by Western blotting. The quantitative results are shown in Figure 13B. Figure 3D shows representative blots of GFP-tau expressed alone or with Flag-TRIM11 in HEK293T cells, and treated or untreated with okadaic acid (OA, 100 nM). To equalize the levels of GFP-tau, the amount of GFP-tau plasmid was increased during co-expression with TRIM11 (Figure 13E). The quantitative results are shown in Figures 13F to 13I. Figure 3E shows representative images of BiFC assays for TRIM11-VN and tau-VC expressed in HEK293T cells (scale bar: 100 μm). The quantitative results of the BiFC signal are shown in Figure 14D. Figure 3F shows representative images of Western blots from co-IP assays of the interaction between Flag-TRIM11 and GFP-tau in HEK293T cells treated with or not treated with OA (100 nM).Figure 3G shows representative images of Western blots obtained when GST or GST-TRIM11 immobilized on beads was incubated with 6×His-GFP-tau or 6×His-GFP-tau P301L. Pull-down and input samples were analyzed by Western blotting and / or Coomassie blue staining. Figure 3H shows representative images demonstrating the localization of endogenous TRIM11 and tau in SH-SY5Y cells treated with or untreated with OA (100 nM) (scale bar, 10 μm). Figure 3I shows the quantitative results of colocalization analyzed from Figure 3H using Manders colocalization coefficients (n=6). Individual TRIM11 and tau images are shown in Figure 15A. Figure 3J shows representative images of the PLA assay of endogenous TRIM11-tau interaction in SH-SY5Y cells treated with or untreated with OA (100 nM) (scale bar: 10 μm). Figure 3K shows the quantitative results of the PLA signal from Figure 3J (n=10). Individual PLA and DAPI images are shown in Figure 15D. Figure 3L shows representative images of Western blots incubated with purified recombinant Flag-TRIM11 or Flag-TRIM112EA with GST-tau P301L, SUMO E1, E2, and 6×His-SUMO2 in or without ATP, as shown. This reaction mixture was denatured and the SUMOylation of GST-tau P301L was analyzed by IP (d-IP). Figure 3M shows representative images of Western blots demonstrating the levels of GFP-tau-P301L in HEK293T cells in the presence of TRIM11 or TRIM112EA with increasing amounts. For Figures 3I and 3K, data are presented as mean ± SD. ***, p<0.001; unpaired Student's t-test. [Figure 4]Figure 4, including Figures 4A to 4P, shows representative results of testing TRIM11 as both a molecular chaperone for tau and a disaggregase that enhances its solubility. Figure 4A shows a representative Western blot image demonstrating that TRIM11 enhances the solubility of tau in cells. HEK293T cells were transfected with varying amounts of GFP-tau plasmid so that the levels were equivalent in the presence or absence of TRIM11. The cells were treated with MG132 (10 μM) or NH4Cl (20 μM) as shown. Figure 4B shows representative images of HEK293T cells transfected with tau-VN, tau-VC, and TRIM11 as shown (scale bar: 100 μm). Figure 4C shows relative fluorescence signals (top panel) and protein expression (bottom panel), similar to those shown in Figure 4B. Figure 4D shows representative images of HEK293 / RD(LM)-YFP cells transfected with an empty vector (EV) or TRIM11, and treated or not treated with tau PFF. Intracellular tau inclusions were analyzed by IF (scale bar, 100 μm). Figure 4E shows the quantitative results of the tau inclusions shown in Figure 4D (n=12). Figure 4F shows representative images of QBI293 / tau P301L-GFP cells that stably express mCherry or mCherry+TRIM11, are treated with Dox to induce tau P301L expression, and are incubated with or without tau PFF. Intracellular tau inclusions were analyzed by IF (scale bar, 50 μm). Figure 4G shows the quantitative results of the tau inclusions shown in Figure 4F (n=8-10). Figure 4H shows representative images of Western blots of insoluble tau species. Figure 4I shows typical tau amyloid fibrils formed when tau protein (10 μM) was incubated with heparin (30 μM) in the presence of GST (1 μM) or GST-TRIM11 (0.25, 0.5, or 1 μM) and tested by ThT binding. Figure 4J shows typical Western blot images demonstrating tau amyloid fibril formation detected by sedimentation, similar to Figure 4I.Figure 4K shows a representative image of tau amyloid fibril formation detected by electron microscopy, similar to Figure 4I (scale bar, 500 nm). Figure 4L shows a representative formation of tau amyloid fibril when Tau P301L protein was incubated with buffer, GST (1 μM) or GST-TRIM11 (0.25, 0.5, or 1 μM) and tested by ThT binding. Figure 4M shows a representative image of a Western blot demonstrating the generation of high molecular weight tau species, as shown in Figure 4L. Figure 4N shows representative results of reformed tau PFF (1 μM) treated with GST or GST-TRIM11 at the indicated concentrations, analyzed by the ThT binding method (n=3). Figure 4O shows a representative image of a Western blot result in which reformed tau PFF treated in the same manner as in Figure 4N was detected by sedimentation. Figure 4P shows a representative image (scale bar, 200 nm) of a reformed tau PFF processed in the same manner as in Figure 4N, as detected by electron microscopy. For Figures 4C, 4E, 4G, and 4N, the data are presented as mean ± SD. **, p<0.01; ***, p<0.001; Student's t-test without pairs. [Figure 5]Figure 5, including Figures 5A to 5U, shows representative results of testing TRIM11 for the maintenance of neuronal integrity and connectivity. Figure 5A shows a representative image demonstrating the localization of endogenous TRIM11 and tau in wild-type cortical neurons (scale bar, 10 μm). Colocalization quantification results are shown in Figure 19A. Figure 5B shows representative images of PS19 cortical neurons transduction with control or TRIM11 ASO #5, with tau aggregates detected by AT8 (scale bar, 10 μm). Cells were treated with myc-K18 / P301L PFF. Figure 5C shows representative quantification results of intracellular tau aggregates shown in Figure 5B (n=4). Figure 5D shows representative images of PS19 cortical neurons transduction with AAV9-GFP or AAV9-TRIM11, with tau aggregates detected by AT8 (scale bar, 50 μm). Cells were treated with myc-K18 / P301L PFF. Figure 5E shows representative quantitative results of intracellular tau aggregates shown in Figure 5D (n=3). Figure 5F shows representative images of wild-type cortical neurons treated with control or TRIM11 ASO #5, and SYP expression was analyzed (scale bar, 10 μm). Figure 5G shows the quantitative results of SYP-reactive spots shown in Figure 5F (n=3). Figure 5H shows representative images of wild-type cortical neurons treated with control or TRIM11 ASO #5, and PSD95 expression was analyzed (scale bar, 10 μm). Figure 5I shows the quantitative results of PSD95-reactive spots shown in Figure 5H (n=3). Figure 5J shows representative images of wild-type cortical neurons treated with control or TRIM11 ASO #5, and NFL and MAP2 expression was analyzed (scale bar, 10 μm). Figure 5K shows the quantitative results of the relative intensity of NFL shown in Figure 5J (n=3). Figure 5L shows the quantitative results of the dendritic length shown in Figure 5J (n=3). Individual images are shown in Figure 12C. Figure 5M shows the representative survival rate of wild-type cortical neurons treated for 14 days with control ASO or the indicated TRIM11 ASO (n=3). Figure 5N shows representative images of wild-type cortical neurons transductioned with AAV9-GFP or AAV9-TRIM11 (the latter with HA tag) and stained with antibodies against SYP and HA (scale bar, 10 μm).Figure 5O shows the quantitative results of SYP spots shown in Figure 5N (n=3). Figure 5P shows representative images of wild-type cortical neurons stained with antibodies against PSD95 and HA, similar to Figure 5N (scale bar, 10 μm). Figure 5Q shows the quantitative results of PSD95 spots shown in Figure 5P (n=3). Figure 5R shows representative images of wild-type cortical neurons transductioned with AAV9-GFP or AAV9-TRIM11 and probed with antibodies against NFL and MAP2 (scale bar, 10 μm). Figure 5S shows the quantitative results of the relative intensity of NFL normalized to the number of neurons (n=3). Figure 5T shows the quantitative results of the relative intensity of MAP2 normalized to the number of neurons (n=3). Figure 5U shows representative survival rates of wild-type cortical neurons transductioned with AAV9-GFP or AAV9-TRIM11 and treated or not treated with tau PFF (n=3). For Figures 5C, 5E, 5G, 5I, 5K-5M, 5O, 5Q, and 5S-5U, the data are presented as mean ± SD. *, p<0.05; **, p<0.01; ***, p<0.005; ns, no significant difference; unpaired Student's t-test. [Figure 6]Figure 6, including Figures 6A to 6O, shows representative results from a study testing TRIM11 protection against tau pathology and cognitive / behavioral impairment in PS19 mice. Figure 6A shows a schematic diagram of the study on the effects of TRIM11 in PS19 mice. To distinguish it from endogenous mouse TRIM11, human TRIM11 was tagged with HA in AAV9 and detected with an anti-HA antibody. Figure 6B shows representative images demonstrating that TRIM11 reduces tau pathology in the hippocampus of PS19 mice. The brains of PS19 mice injected with AAV9-GFP or AAV9-TRIM11 were stained with AT8. Representative images of the hippocampus and CA1 region (left; scale bar: 0.2 mm) and the relative intensity of AT8 (right; n=6 mice) are shown. Additional images are presented in Figure 21A. Figure 6C shows representative images of Western blot analysis of total tau and p-tau species in the hippocampus of mice injected with AAV9-GFP or AAV9-TRIM11. Each line represents one mouse. Quantitative results are shown in Figures 21B to 21D. Figure 6D shows a representative image demonstrating that TRIM11 reduces astroglial proliferation. Brains of age-matched wild-type mice or PS19 mice injected with AAV9-GFP or AAV9-TRIM11 were stained with anti-GFAP antibody. Representative images of the hippocampus are shown (scale bar, 0.2 mm). Figure 6E shows the quantitative results of the GFAP immunoreactive area in Figure 6D (n=5 WT mice or 6 GFP or TRIM11 injected mice). Figure 6F shows a representative image demonstrating that TRIM11 reduces microglial proliferation. Brains of age-matched wild-type mice or PS19 mice injected with AAV9-GFP or AAV9-TRIM11 were stained with anti-Iba1 antibody (scale bar: 0.2 mm). Figure 6G shows the quantitative results of the Iba1 immunoreactive area in Figure 6F (n=5 WT mice or 6 GFP / TRIM11 injected mice). Additional images are shown in Figures 21E and 21F. Figure 6H shows a representative image demonstrating that dendritic degeneration is rescued by TRIM11. Brains of wild-type mice or PS19 mice injected with AAV9-GFP or AAV9-TRIM11 were stained with an antibody that detects MAP2. Images of the hippocampus are shown (scale bar: 0.2 mm).Figure 6I shows the quantitative results of MAP2 immunoreactivity in Figure 6H (n=4 WT mice, 6 GFP-AAV mice, or 7 AAV-TRIM11 PS19 mice). Figure 6J shows representative images demonstrating that axonal degeneration is rescued by TRIM11. Brains of wild-type mice or PS19 mice injected with AAV9-GFP or AAV9-TRIM11 were stained with an antibody that detects NFL (scale bar: 0.2 mm). Figure 6K shows the quantitative results of NFL immunoreactivity from Figure 6J (n=4 WT mice, 6 GFP-AAV mice, or 7 AAV-TRIM11 PS19 mice). Additional images are shown in Figures 21G and 21H. Figure 21L shows representative images demonstrating that neuronal loss is prevented by TRIM11. The brains of wild-type mice or PS19 mice injected with AAV9-GFP or AAV9-TRIM11 were stained with an antibody that detects NeuN. Representative images of the hippocampus are shown (scale bar: 0.2 mm). Figure 6M shows the quantitative results of NeuN immunoreactivity from Figure 6L (n=3 mice). Additional images are shown in Figure 21I. Figure 6N shows representative results demonstrating that AAV9-TRIM11 injected mice show improved preference for new objects (n=6 WT mice or GFP mice or 7 TRIM11 mice). Figure 6O shows representative results demonstrating improved gripping ability with TRIM11 (n=4 WT mice, 5 GFP mice or 6 TRIM11 mice). For Figures 6B (left), 6E, 6G, 6I, 6K and 6M-6O, data are presented as mean ± SD. *, p<0.05; **, p<0.01; ***, p<0.005; ns, no significant difference; Independent Student's t-test. [Figure 7]Figure 7, including Figures 7A to 7J, shows representative results from a study testing TRIM11 protection against PFF-induced tau pathology and cognitive and behavioral disorders in PS19 mice. Figure 7A shows a schematic diagram of a study on the effects of TRIM11 in PFF-injected PS19 (PS19-PFF) mice. Figure 7B shows representative results demonstrating that TRIM11 reduces tau pathology. The brains of PS19 mice injected with AAV9-GFP or AAV9-TRIM11 along with tau PFF were stained with AT8. Representative images of the hippocampus and CA1 region (left; scale bar: 0.2 mm) and relative intensity of AT8 (right; n=6 mice) are shown. Additional images are shown in Figure 22A. Figure 7C shows representative images of Western blot analysis of total tau and p-tau species in the hippocampus of mice injected with AAV9-GFP or AAV9-TRIM11 along with PFF. Each line represents one mouse. Quantitative results are shown in Figures 22B to 22D. Figure 7D shows representative results demonstrating that TRIM11 reduces astroglial proliferation. Brains of PS19 mice injected with AAV9-GFP or AAV9-TRIM11 along with PFF were stained with anti-GFAP antibody. Representative images of the hippocampus in the GFAP immunoreactive region (left; scale bar, 0.2 mm) and quantitative results (right, n=5 WT mice or 6 GFP- or TRIM11 injected PS19 mice) are shown. Figure 7E shows representative results demonstrating that TRIM11 reduces microglial proliferation. Brains of PS19 mice were processed in the same manner as in Figure 7D and stained with anti-Iba1 antibody. Representative images of the hippocampus (left; scale bar, 0.2 mm) and quantitative results of the Iba1 immunoreactive region (right, n=5 WT mice or 6 GFP- or TRIM11 injected PS19 mice) are shown. Additional images are shown in Figures 22E and 22F. Figure 7F shows representative results demonstrating that TRIM11 maintains the ability of mice to recognize new objects. The data represent the preference rate for new objects (n=9 WT mice or TRIM11 mice or 7 GFP mice).Figure 7G shows representative results demonstrating increased alternating behavior in the Y-maze test in AAV9-TRIM11 injected mice compared to AAV9-GFP injected mice (n=9 WT mice or TRIM11 mice or 10 GFP mice). Figure 7H shows representative open-field tracking plots demonstrating increased migration distance in AAV9-TRIM11 injected mice compared to AAV9-GFP injected mice. Figure 7I shows the quantitative results of the migration distance shown in Figure 7H (n=9 WT mice or GFP mice or 10 TRIM11 mice). Figure 7J shows representative results demonstrating reduced freezing time in AAV9-TRIM11 injected mice compared to AAV9-GFP injected mice (n=9 WT mice or GFP mice or 10 TRIM11 mice). For Figures 7B (right), 7D (right), 7E (right), 7F, 7G, 7I, and 7J, the data are presented as mean ± SD. *, p<0.05; **, p<0.01; ***, p<0.005; ns, no significant difference; unpaired Student's t-test. [Figure 8]Figure 8, including Figures 8A to 8Q, shows representative results from a study testing the improvement of tau pathology and cognitive impairment in 3×Tg-AD mice by TRIM11. Figure 8A shows a schematic diagram of bilateral intrahippocampal injection in 3×Tg-AD mice. Figure 8B shows representative results demonstrating a reduction in tau aggregates in the hippocampus of 3×Tg-AD mice by intraparenchymal injection of AAV9-TRIM11 according to Figure 8A. Representative images of the hippocampus (left; scale bar, 0.2 mm) and quantitative results of tau aggregates (right; n=6 mice) are shown. Figure 8C shows representative images of Western blot analysis of total tau and p-tau species in the hippocampus treated similarly to Figure 8A. Each line represents one mouse. Quantitative results are presented in Figures 23B to 23D. Figure 8D shows representative results demonstrating reduced astroglial proliferation in mice treated similarly to Figure 8A by TRIM11. Figure 23E shows representative images of the GFAP immunoreactive region (left; scale bar, 0.2 mm) and quantitative results (right; n=5-6 mice). Additional images are shown in Figure 23E. Figure 8E shows representative results demonstrating that microglial proliferation is reduced in mice treated with TRIM11 in the same manner as in Figure 8A. Figure 23F shows representative images of the Iba1 immunoreactive region (left; scale bar, 0.2 mm) and quantitative results (right, n=5-6 mice). Additional images are shown in Figure 23F. Figure 8F shows representative results demonstrating that the time spent on new objects increased in mice treated with TRIM11 in the same manner as in Figure 8A (n=9 GFP mice or 13 TRIM11 mice). Figure 8G shows representative results demonstrating that mice treated with TRIM11 in the same manner as in Figure 8A showed increased correct alternation behavior in the Y-maze test (n=9 GFP mice or 14 TRIM11 mice). Figure 8H shows representative results demonstrating increased movement distance in the open field test in mice treated with TRIM11, similar to Figure 8A (n=14 GFP mice or 17 TRIM11 mice). Figure 8I shows representative results demonstrating reduced freezing time in the open field test in mice treated with TRIM11, similar to Figure 8A (n=14 GFP mice or 17 TRIM11 mice).Figure 8J shows a schematic diagram of unilateral ICV injection in 3×Tg-AD mice. Figure 8K shows representative results demonstrating a reduction in tau aggregates in the hippocampus of 3×Tg-AD mice by ICV injection of AAV9-TRIM11 according to Figure 8J. Representative images of the hippocampus (left; scale bar, 0.2 mm) and quantitative results of tau aggregates (right; n=6 mice) are shown. Figure 8L shows representative images of Western blot analysis of total tau and p-tau species in the hippocampus treated similarly to Figure 8J. Each line represents one mouse. Quantitative results are shown in Figures 24A to 24C. Figure 8M shows representative results demonstrating that astroglial proliferation is reduced by TRIM11 in mice treated similarly to Figure 8J. Quantitative results of the GFAP immunoreactive area are shown (n=5-6 mice). Additional images are shown in Figure 24D. Figure 8N shows representative results demonstrating that microglial proliferation is reduced in mice treated with TRIM11 in the same manner as in Figure 8J. Quantitative results for the Iba1 immunoreactive region are shown (n-5 to 6 mice). Additional images are shown in Figure 24E. Figure 8O shows representative results demonstrating that the time spent on new objects increased in mice treated with TRIM11 in the same manner as in Figure 8J (n=6 GFP mice or 8 TRIM11 mice). Figure 8P shows representative results demonstrating that mice treated with TRIM11 in the same manner as in Figure 8J showed increased correct alternation behavior in the Y-maze test (n=7 mice). Figure 8Q shows representative results demonstrating that the distance traveled in the open-field test increased in mice treated with TRIM11 in the same manner as in Figure 8J (n=7 mice). For Figures 8B (right side), 8D (right side), 8E (right side), 8F-8I, 8K (right side), and 8M-8Q, the data are presented as mean ± SD. *, p<0.05; **, p<0.01; ***, p<0.001; ns, no significant difference; independent Student's t-test. [Figure 9]Figure 9 shows a schematic diagram of the structure of TRIM proteins. Except for TRIM12 and TRIM30, which are derived from mice, all TRIMs are human proteins. TRIM53 (pseudogene) and TRIM57 (same as TRIM59) are not listed. ARF, ADP-ribosylation factor-like; B, B-box; BR, bromodomain; CC, coiled-coil; COS, C-terminal subgroup 1 signature; FN3, fibronectin type 3; FIL, filamin-type immunoglobulin; MATH, meprin and tumor necrosis factor receptor-related factor homology; MID, midline; N-terminus, amino-terminus; PHD, plant homeodomain; PRY, SPRY-related domain; R, ring finger; SPRY, SPIa and ryanodine receptor domain; TM, transmembrane. Missing domains are indicated in parentheses. The scale is not accurate. [Figure 10]Figure 10, including Figures 10A to 10H, shows representative results of forced expression of TRIM10, TRIM11, and TRIM55. Figure 10A shows a representative relative ratio of GFP-tau P301L(SN) / HSP90 in SH-SY5Y cells in the presence of the indicated TRIM proteins. This relates to Figures 1D and 1E. Figure 10B shows a representative image of Western blot analysis of GFP-tau P301L transfected with a control vector or the indicated TRIM in N2a cells. Cells were lysed in NP40-containing buffer and separated into a soluble supernatant (SN) fraction and an insoluble pellet (PE) fraction by sedimentation. Figure 10C shows the relative ratio of tau / HSP90 in the PE fraction and SN fraction from Figure 10B. Figure 10D shows a representative image of Western blot analysis of N2 cells processed similarly to Figure 10B using sarcosyl buffer instead of NP40 buffer. Figure 10E shows the relative ratio of tau / HSP20 in the PE and SN fractions from Figure 10D. Figure 10F shows the representative relative levels of GFP-tau P301L mRNA in HEK293T cells in the presence of the indicated TRIM protein. Figure 10G shows the representative relative levels of GFP-tau P301L mRNA in SH-SY5Y cells in the presence of the indicated TRIM protein. Figure 10H shows the representative relative levels of GFP-tau P301L mRNA in N2a cells in the presence of the indicated TRIM protein. For Figures 10A, 10C, and 10E-10H, data are mean ± SEM. n=3;*, p<0.05;**, p<0.01;***: p<0.001; ns, no significant difference; unpaired Student's t-test. [Figure 11]Figure 11, including Figures 11A to 11H, shows representative results of TRIM10, TRIM11, or TRIM55 knockout and knockdown. Figure 11A shows the representative relative ratio of GFP-tau P301L in the supernatant (SN) of the shown TRIM knockout HEK293T cells. Figure 11B shows the representative relative ratio of GFP-tau P301L mRNA in the shown TRIM knockout HEK293T cells. Figure 11C shows representative images of Western blots of N2a cells transfected with GFP-tau P301L and pretreated with control or TRIM10-siRNA. Cells were lysed in NP-40-containing buffer. Figure 11D shows representative images of Western blots of N2a cells prepared similarly to Figure 11C, using TRIM11-siRNA instead of TRIM10-siRNA. Figure 11E shows a representative image of a Western blot of N2a cells prepared in the same manner as in Figure 11C, using TRIM36-siRNA instead of TRIM10-siRNA. Figure 11F shows a representative image of a Western blot of N2a cells prepared in the same manner as in Figure 11C, using TRIM55-siRNA instead of TRIM10-siRNA. Figure 11G shows the relative ratio of GFP-tau P301L / HSP90 in the pellet (PE) fraction and supernatant (SN) fraction shown in Figures 11C-11F. Figure 11H shows the relative levels of GFP-tau P301L mRNA shown in Figures 11C-11F. For Figures 11A, 11B, 11G, and 11H, data are mean ± SEM. n=3;*, p<0.05;**, p<0.01;ns, no significant difference; unpaired Student's t-test. [Figure 12]Figure 12, including Figures 12A to 12G, shows representative effects of TRIM11 downregulation in sporadic AD brains. Figure 12A shows representative relative ratios of AT8, pSer262, AT180, and PHF-1 tau species to GAPDH in control and AD brain tissue. Figure 12B shows representative images of high-MV tau species Western blots in the prefrontal cortical gray matter from AD and control individuals. #1 control and #1 AD samples were used for each blot to compare between blots. Figure 12C shows representative results of qRT-PCR analysis of MAPT and TRIM mRNA levels in the prefrontal cortex of control and AD individuals. Figure 12D shows representative images of anti-TRIM11 staining and DAPI in the prefrontal cortex of control and AD samples (scale bar, 10 μm). Figure 12E shows quantitative results of TRIM11 signaling normalized to the total neuronal count shown in Figure 12D. Figure 12F shows representative relative levels of TRIM11 mRNA (†) and protein (*) in individual control and AD samples. Figure 12G shows representative correlation analysis between TRIM11 expression and tau AT8 and AT180 species among AD samples. Pearson correlation coefficients (r and p values) are shown. For Figures 12A, 12B, and 12E, data are mean ± SEM. n=3;*, p<0.05;**, p<0.01;ns, no significant difference; unpaired Student's t-test. [Figure 13]Figure 13, including Figures 13A to 13M, shows representative results from tests that TRIM11 targets tau for degradation. Figure 13A shows the relative ratio of insoluble GFP-tau P301L / actin for the experiment shown in Figure 3B. Figure 13B shows the relative levels of PHF-1 for the experiment shown in Figure 3C. Figure 13C shows representative images of Western blots of GFP-tau P301L expressed in control and TRIM11 knockout HEK293T cells. Cells were treated with CHX for the indicated period. Figure 13D shows the relative ratio of GFP-tau P301L / actin shown in Figure 13C. Figure 13E shows representative images of GFP-tau expressed alone or with Flag-TRIM11 in okadaic acid (OA, 100 nM)-treated or untreated HEK293T cells (scale bar, 100 μm). To achieve comparable levels of GFP-tau, more GFP-tau plasmids were expressed with TRIM11. Figure 13F shows representative quantitative results of total tau relative to actin in cell pellets (PE), supernatant (SN), or whole cell lysate (WCL) treated in the same manner as in Figure 13E. Figure 13G shows representative quantitative results of p-tau species (AT8 and Ser-396) relative to actin in cell pellets (PE) treated in the same manner as in Figure 13E. Figure 13H shows representative quantitative results of p-tau species (AT8 and Ser-396) relative to actin in cell supernatant (SN) treated in the same manner as in Figure 13E. Figure 13I shows representative quantitative results of p-tau species (AT8 and Ser-396) relative to total tau in cell supernatant (SN) treated in the same manner as in Figure 13E. Figure 13J shows representative Western blot images of GFP-tau expressed alone or with TRIM11 in HEK293T cells. Cells were treated with CHX for the duration indicated and then lysed. Figure 13K shows the relative ratio of GFP-tau / actin quantified from Figure 13J. Figure 13L shows representative images of Western blots of GFP-tau expressed in control and TRIM11 knockout cells treated with CHX for the duration indicated and then lysed. Figure 13M shows the relative ratio of GFP-tau / actin quantified from Figure 13L.For Figures 13C, 13J, and 13L, in order to better compare the half-lives of GFP-tau under various conditions, the left blot and its corresponding right blot were exposed for different times so that similar band intensities were obtained at time 0. For Figures 13A, 13B, 13D, 13F-13I, 13K, and 13M, the data are mean ± SEM. n=3;*, p<0.05;**, p<0.01;***, p<0.001;ns, no significant difference; unpaired Student's t-test. [Figure 14]Figure 14, including Figures 14A to 14I, shows representative results demonstrating that TRIM11 interacts with tau and SUMOylates tau to promote its degradation. Figure 14A shows representative images of Western blots of HEK293T cells expressing GFP-tauP301L with increased TRIM11 levels. Cells were treated with MG132 (including c-Myc as a control) or NH4Cl (including p62 and LC3 as controls). Figure 14B shows representative images of Western blots of HEK293T cells expressing GFP-tau, similar to Figure 14A. Figure 14C shows schematic diagrams of BiFC assays for TRIM11-tau interaction (left and center) and tau-tau interaction (right). VN173 and VC155 contain amino acids 1-172 and 155-238 of Venus, respectively. Figure 14D shows representative quantitative results of the BiFC assay for TRIM11-VN and tau-VC expressed in HEK293T cells. This is related to Figure 3E. Figure 14E shows representative images of the BiFC signal in HEK293T cells expressing Tau-VN and TRIM-VC (scale bar, 100 μm). Figure 14F shows the quantitative results of the BiFC signal from Figure 14E. Figure 14G shows representative images of Western blots of HEK293T cells transfected with TRIM11 along with GFP-tau and GFP-tauP301L, demonstrating that TRIM11 interacts with tau, preferably the mutant or phosphorylated form. Cell lysates were immunoprecipitated with anti-FLAG antibody. Immunoprecipitates and WCL were analyzed. Figure 14H shows representative Western blot images of HEK293T cells transfected with TRIM11 along with GFP-tau and GFP-tau AT8, similar to Figure 14G. Figure 14I shows representative SDS-PAGE gels stained with coumarcine blue, containing recombinant GST-TRIM11, GFP-tau-6×His, and GFP-tau P301L-6×His proteins purified from E. coli, as well as Flag-TRIM11 and Flag-TRIM112EA proteins purified from HEK293T cells. BSA was used as a protein standard.For Figures 14D and 14F, the data are presented as mean ± standard deviation. n=10. [Figure 15]Figure 15, including Figures 15A to 15J, shows representative results demonstrating the co-localization and interaction of endogenous TRIM11 and tau in N2a cells and SH-SY5Y cells. Figure 15A shows representative immunofluorescence images of endogenous TRIM11 and tau in SH-SY5Y cells treated with or untreated with OA (100 nM) (scale bar, 10 μm). It relates to Figures 3H and 3I. Figure 15B shows representative immunofluorescence images of endogenous TRIM11 and tau in N2a cells treated with or untreated with OA (100 nM) (scale bar: 5 μm). Figure 15C shows quantitative results of co-localization from Figures 15A and 15B analyzed by Manders co-localization coefficient (n=6). Figure 15D shows a representative image of the interaction between endogenous TRIM11 and tau in SH-SY5Y cells treated with or not treated with OA (100 nM), tested with PLA (scale bar, 10 μm). Related to Figures 3J and 3K. Figure 15E shows a representative image of the interaction between endogenous TRIM11 and tau in N2a cells treated with or not treated with OA (100 nM), tested with PLA (scale bar, 10 μm). Figure 15F shows the quantitative results of the PLA signal from Figure 15E (n=10). Figure 15G shows representative results for SH-SY5Y cells treated with or not treated with OA (100 nM). TRIM11 and p-tau levels were analyzed by Western blotting to quantify TRIM11 against HSP90. Figure 15H shows the results of quantification of TRIM11 mRNA from cells treated in the same manner as in Figure 15G by qRT-PCR. Figure 15I shows representative results for N2a cells treated with and untreated with OA (100 nM). TRIM11 protein and p-tau levels were analyzed by Western blotting to quantify TRIM11 relative to HSP90. Figure 15J shows the results of quantification of TRIM11 mRNA from cells treated in the same manner as in Figure 15I by qRT-PCR. For Figures 15G to 15J, n=3. For Figure 15, and for Figures 15C, 15D, and 15G to 15J, the data are mean ± SEM.*, p<0.05; **, p<0.01; ***, p<0.001; ns, no significant difference; Student's t-test without pairings. [Figure 16] Figure 16, including Figures 16A and 16B, shows representative images demonstrating that TRIM11 promotes SUMOylation of tau in intracellular and cell-free systems. Figure 16A shows a representative Western blot image of HEK293T cells transfected with TRIM11, GFP-tau, and GFP-tau P301L, as shown, demonstrating that TRIM11 promotes SUMOylation of GFP-tau and GFP-tau P301L in cells. Cells were treated with MG132 and lysed in SDS-containing buffer. After dilution with SDS-free buffer, cell lysates were immunoprecipitated with an anti-GFP antibody (d-IP). Immunoprecipitates and inputs were analyzed for tau and total SUMOylation and protein expression. Figure 16B shows representative Western blot images of purified recombinant Flag-TRIM11 incubated with GST-tau or GST-tau P301L in the presence or absence of ATP, as shown, along with SUMO E1, E2, and 6×His-SUMO2. The SUMOylation of GFP-tau and GFP-tau P301L was analyzed by d-IP of this reaction mixture. [Figure 17]Figure 17, including Figures 17A to 17J, shows representative results demonstrating that TRIM11 improves the solubility of tau in cells. Figure 17A shows representative Western blot images of HEK293T cells expressing GFP-tau in the presence or absence of Flag-TRIM11. Figure 17B shows the quantitative results of the ratio of insoluble to soluble GFP-tau from Figure 17A. Figure 17C shows representative fluorescence images of cells from the experiment shown in Figure 4A (scale bar, 100 μm). Figure 17D shows representative Western blot images of HEK293T cells transfected with GFP or GFP-tau P301 alone or with Flag-TRIM11 or Flag-TRIM112EA, demonstrating that TRIM11 prevents tau P301L aggregation in cells. Figure 17E shows representative fluorescence images of HEK293T cells transfected with tau-VN or tau-VC pretreated with control or TRIM11 siRNA (scale bar, 100 μm). Figure 17F shows the quantitative results of relative fluorescence signal (top panel) and protein expression (bottom panel) in the cells from Figure 17E. Figure 17G shows representative fluorescence images of HEK293T cells or TRIM11 knockout HEK293T cells transfected individually or simultaneously with tau-VN and tau-VC (scale bar, 100 μm). Figure 17H ​​shows the quantitative results of relative fluorescence signal (top panel) and protein expression (bottom panel) in the cells from Figure 17G. Figure 17I shows representative Western blot images of HEK293 / RD(P301L / V337M)-YFP cells transfected with an empty vector (-) or TRIM11 and treated or not treated with tau PFF. Figure 17J shows the relative ratios of tau(SN) / tau(WCL) and tau(SN) / tau(WCL) quantified from Figure 17I. It relates to Figures 4D and 4E. For Figures 17B, 17F, 17H, and 17J, the data are presented as mean ± SD. n=3;*, p<0.05;**, p<0.01;ns, no significant difference; unpaired Student's t-test. [Figure 18]Figure 18, including Figures 18A to 18E, shows representative results demonstrating that TRIM11 is both a molecular chaperone and a disaggregase for tau. Figure 18A shows representative results of tau amyloid fibril formation by ThT binding, demonstrating that spontaneous tau aggregation is inhibited by TRIM11. Purified GST-tau (20 μM) was incubated with heparin (30 μM) for 24 hours in the absence of GST or GST-TRIM11 or in the presence of these concentrations. Figure 18B shows a representative Western blot image of tau amyloid fibril formation by sedimentation. Figure 18C shows a representative electron microscope image demonstrating the inhibition of tau amyloid fibril formation by TRIM11 (scale bar, 500 nm). Figure 18D shows a representative Western blot image demonstrating the dissolution of already formed tau aggregates by GST-TRIM11. PFFs formed with GST-tau (1 μM) were treated with GST or GST-TRIM11 at the indicated concentrations and obtained by sedimentation. Figure 18E shows a representative electron microscope image demonstrating that already formed tau aggregates are dissolved by TRIM11 (scale bar, 500 nm). [Figure 19]Figure 19, including Figures 19A to 19M, shows representative results demonstrating that TRIM11 interacts with tau in neurons, suppressing their aggregation. Figure 19A shows representative colocalization of endogenous TRIM11 and tau in cortical neurons obtained from wild-type (WT) mice, with Pearson correlation coefficients analyzed. This is related to Figure 5A. Figure 19B shows representative images of PLA of endogenous TRIM11-tau interaction in WT cortical neurons treated with or untreated with OA (100 nM) (scale bar, 10 μm). Figure 19C shows quantitative results of PLA signaling from Figure 19B (n=10). Figure 19D shows representative Western blot analysis (top panel) and quantitative results of TRIM11 levels (bottom panel; n=3) in WT cortical neurons treated with or untreated with OA (100 nM). Figure 19E shows representative images of WT cortical neurons treated with or untreated with SCR CTRL-FAR RED for 3 days and stained with MAP (scale bar, 20 μm). Figure 19F shows representative Western blot images of WT cortical neurons treated with AUMInc-scrctrl or AUMSiI-TRIM11-1 / 2 / 3 / 4 / 5 for 3 days. Cells were lysed in RIPA buffer. Figure 19G shows representative images of cortical neurons obtained from PS19 mice, either as control or transduction with TRIM11 #5 ASO and treated with PFF generated from myc-K18 / P301L. Tau aggregates were detected with MC1 (scale bar, 10 μm). Figure 19H shows the quantitative results of MC1 intensity from Figure 19G (n=8). Figure 19I shows representative images of PS19 cortical neurons transduction with AAV9-GFP or AAV9-TRIM11 and stained with DAPI, p-tau, GFP, and TRIM11 (scale bar, 50 μm). Related to Figure 4D. Figure 19J shows representative images of PS19 cortical neurons transduction with AAV9-GFP or AAV9-TRIM11 and treated with myc-K18 / P301L PFF. Cells were treated with myc-K18 / P301L PFF, and tau aggregates were detected with MC1 antibody.Cells were stained with DAPI, p-tau, GFP, and TRIM11 (HA-tagged, detected with anti-HA antibody) (scale bar, 50 μm). Figure 19K shows the quantitative results of the MC1 signal from Figure 19J (n=9). Figure 19L shows representative images of PS19 hippocampal neurons transductioned with AAV9-GFP or AAV9-TRIM11 vector and treated with myc-K18 / P301L PFF. Tau aggregates were detected with AT8 (scale bar, 100 μm). Figure 19M shows representative images of PS19 hippocampal neurons detected with MC1, similar to Figure 19M (scale bar, 100 μm). For Figures 19A, 19C, 19D, 19H, and 19K, data are presented as mean ± SEM. *, p<0.05; **, p<0.01; ns, no significant difference; unpaired Student's t-test. [Figure 20] Figure 20, including Figures 20A to 20C, shows representative results demonstrating that TRIM11 maintains neuronal integrity and connectivity. Figure 20A shows representative images of WT cortical neurons treated with control or TRIM11 ASO #5, with SYP and PSD95 expression analyzed (scale bar: 5 μm). Figure 20B shows the colocalization of SYP-reactive and PSD95-reactive spots from Figure 20A (mean ± SEM, n=6). Figure 20C shows representative images of NFL and MAP2 staining in WT cortical neurons treated with control or TRIM11 ASO #5 (scale bar, 10 μm). Related to Figures 5J to 5L. For Figure 20B, **, p<0.01; unpaired Student's t-test. [Figure 21]Figure 21, including Figures 21A to 21I, shows representative results demonstrating that TRIM11 reduces tau pathology and neuroinflammation in PS19 mice. Figure 21A shows representative images of the CA1 and DG regions of the brain of PS19 mice injected with AAV-GFP or AAV9-TRIM11 and stained with AT8 (scale bar, 0.2 mm). Related to Figure 6B. Figure 21B shows the quantitative results of the Western blot shown in Figure 6C, normalized to a loading control, demonstrating that TRIM11 strongly reduces p-tau species in the SN and PE fractions of hippocampal lysate (AT8 in PE approximately 81%, PHF1 in PE approximately 98%, AT8 in SN approximately 52%, PHF1 in SN approximately 89%). Figure 21C shows the quantitative results of the Western blots shown in Figure 6C, normalized to the total tau in the corresponding fractions, demonstrating a strong reduction in p-tau species in the SN and PE fractions of hippocampal lysate by TRIM11 (approximately 59% AT8 in PE, approximately 83% PHF1 in PE, approximately 56% AT8 in SN, and approximately 92% PHF1 in SN). Figure 21D shows the quantitative results of the Western blots shown in Figure 6C, normalized to a loading control. Figure 21E shows representative images of the hippocampal and CA3 regions of the brains of PS19 mice injected with AAV9-GFP or AAV9-TRIM11 and stained with an antibody against GFAP, as well as representative images of these regions in age-matched wild-type littermates. Figure 21F shows representative images of the hippocampal and CA3 regions of the brains of PS19 mice processed similarly to Figure 21E and stained with an antibody against Iba1. Related to Figures 6D-6G. Figure 21G shows representative images of the hippocampus of PS19 mice and wild-type mice injected with AAV9-GFP or AAV9-TRIM11 and probed with an antibody against MAP2 (G). Figure 21H shows representative images of the hippocampus of PS19 mice processed similarly to Figure 21G and probed with an antibody against NFL. Related to Figures 6H-6K. Figure 21I shows representative images of the brains of PS19 mice and wild-type mice injected with AAV9-GFP or AAV9-TRIM11 and stained with an antibody detecting NeuN. Related to Figures 6L and 6M.For Figures 21A and 21E-21I, the scale bar is 0.2 mm. For Figures 21B-21D, the data are presented as mean ± SD. n=3;*, p<0.05;**, p<0.01;***, p<0.001;ns, no significant difference; Student's t-test without pairings. [Figure 22]Figure 22, including Figures 22A to 22F, shows representative results demonstrating that TRIM11 improves PFF-induced tau pathology and neuroinflammation in PS19 mice. Figure 22A shows representative images of the CA1 and DG regions of the brain of PS19 mice injected with tau K18 PFF along with AAV-GFP or AAV9-TRIM11 and stained with AT8. This relates to Figure 7B. Figure 22B shows the quantitative results of the Western blot shown in Figure 7C, normalized for sample loading, demonstrating a strong reduction of p-tau species in the SN and PE fractions of hippocampal lysate by TRIM11 (AT8 approximately 86% in PE, PHF1 approximately 76% in PE, AT8 approximately 100% in SN, PHF1 approximately 89% in SN). Figure 22C shows the quantitative results of the Western blots shown in Figure 7C, normalized to the total tau in the corresponding fractions, demonstrating that TRIM11 strongly reduced p-tau species in the SN and PE fractions of hippocampal lysate (AT8 approximately 74% in PE, PHF1 approximately 57% in PE, AT8 approximately 100% in SN, and PHF1 approximately 93% in SN). Figure 22D shows the quantitative results of the Western blots shown in Figure 7C, normalized to sample loading, demonstrating that TRIM11 reduced total tau in the insoluble fraction (approximately 45%), increased total tau in the soluble fraction (approximately 38%), while total tau in WCL was hardly affected. Figure 22E shows representative images of the hippocampal and CA3 regions of the brains of PS19 mice injected with tau K18 PFF along with AAV9-GFP or AAV9-TRIM11 and stained with an antibody against GFAP. Figure 22F shows representative images of the hippocampal and CA3 regions of the brain of PS19 mice, processed similarly to Figure 22E and stained with an antibody against Iba1. It relates to Figures 7D and 7E. For Figures 22A, 22E, and 22F, the scale bar is 0.2 mm. For Figures 22A to 22D, data are presented as mean ± SD. n=5;*, p<0.05;**, p<0.01;***, p<0.001;ns, no significant difference; unpaired Student's t-test. [Figure 23]Figure 23, including Figures 23A to 23F, shows representative results demonstrating that delivery of AAV9-TRIM11 by intraparenchymal (IP) injection improves tau pathology and neuroinflammation in 3×Tg-AD mice. Figure 23A shows representative images of the CA1 region of the brain of 12-month-old uninjected 3×Tg-AD mice and 13-month-old AAV-GFP or AAV9-TRIM11-injected 3×Tg-AD mice, stained with AT8. Related to Figure 7B. Figure 23B shows quantitative results of Western blots shown in Figure 8C, normalized for sample loading, demonstrating a strong reduction (approximately 70-90%) of p-tau species in the SN and PE fractions of hippocampal lysate by TRIM11. Figure 23C shows the quantitative results of the Western blots shown in Figure 8C, normalized to total tau in the corresponding fractions, demonstrating a strong reduction of p-tau species in the SN and PE fractions of hippocampal lysate by TRIM11. Figure 23D shows the quantitative results of the Western blots in Figure 8C, normalized to sample loading, demonstrating a strong reduction of total tau in PE (approximately 45%) and a moderate reduction of total tau in SN and WCL (approximately 20% in both) by TRIM11. Figure 23E shows representative images of the CA3 and DG regions of the brains of 3×Tg-AD mice injected with tau K18 PFF along with AAV9-GFP or AAV9-TRIM11 and stained with an antibody against GFAP. Figure 23F shows representative images of the CA3 and DG regions of the brains of 3×Tg-AD mice processed similarly to Figure 23E and stained with an antibody against iBl1. Related to Figures 8D and 8E. For Figures 23A, 23E, and 23F, the scale bar is 0.2 mm. For Figures 23B to 23C, the data are presented as mean ± SD. n=5;*, p<0.05;ns, no significant difference; independent Student's t-test. [Figure 24]Figure 24, including Figures 24A to 24E, shows representative results demonstrating that delivery of AAV9-TRIM11 by ICV injection improves tau pathology and neuroinflammation in 3×Tg-AD mice. Figure 24A shows the quantitative results of the Western blot shown in Figure 8L, normalized to sample loading, demonstrating that TRIM11 reduced the p-tau species in the SN and PE fractions of hippocampal lysate by approximately 80-93%. Figure 24B shows the quantitative results of the Western blot shown in Figure 8L, normalized to loading, demonstrating that TRIM11 reduced total tau in the insoluble fraction (approximately 80%) and WCL (approximately 65%), and moderately reduced total tau in the soluble fraction (approximately 43%). Figure 24C shows the quantitative results of the Western blots shown in Figure 8L, normalized to the total tau in each fraction, demonstrating that TRIM11 strongly reduced SN p-tau (approximately 68-80%), while PE p-tau was only minimally or moderately reduced (approximately 45-0%). Figure 24D shows representative images of the hippocampus and CA1, CA3, and DG regions of the brains of 3×Tg-AD mice injected with tau K18 PFF along with AAV9-GFP or AAV9-TRIM11 and stained with an antibody against GFAP. Figure 24E shows representative images of the hippocampus and CA1, CA3, and DG regions of the brains of 3×Tg-AD mice processed similarly to Figure 24D and stained with an antibody against IBa1. Related to Figures 8M and 8N. For Figures 24D and 24E, the scale bar is 0.2 mm. For Figures 24A-24C, data are presented as mean ± SD. n=6;*, p<0.05;**, p<0.01;***, p<0.001;ns, no significant difference; Student's t-test without pairings. [Figure 25]Figure 25, including Figures 25A to 25C, shows representative results demonstrating that the TRIM protein affects tau protein levels. Figure 25A shows a schematic diagram of the BiFC assay for tau auto-assembly. VN173 and VC155 contain amino acids 1-172 and 155-238 of Venus, respectively. Figure 25B shows representative images (top panel) and quantitative results (bottom panel) of the BiFC signal in HEK293T cells expressing tau-VN and tau-VC individually or together. Figure 25C shows representative Western blot images of HEK293T cells co-expressing Tau-VN and tau-VC with the indicated TRIM protein. The TRIM protein that reduced the level of the BiFC signal is enclosed in a box. [Figure 26] Figure 26 shows representative images of HEK293T cells co-expressing tau-VN and tau-VC with the indicated TRIM protein, demonstrating that the TRIM protein influences tau self-assembly. This is related to Figure 25C. [Figure 27] Figure 27 shows representative quantitative results of BiFC fluorescence in HEK293T cells expressing tau-VN and tau-VC together with the indicated TRIM protein, demonstrating that the TRIM protein influences tau self-assembly. TRIM proteins with reduced fluorescence signal are shown in red. Related to Figures 1C and 2. Data are mean ± SD. n=3;***, p<0.005; unpaired Student's t-test. [Figure 28] Figure 28 shows representative Western blot images of HEK293T cells expressing GFP-α-Syn-A53T and the indicated TRIM protein, demonstrating that the TRIM protein affects α-Syn A53T aggregation. TRIM proteins with reduced α-Syn A53T levels are labeled in red. Expected full-length TRIM bands are indicated by red arrows. [Figure 29]Figure 29, including Figures 29A to 29C, shows representative effects of TRIM proteins on α-Syn self-assembly. Figure 29A shows a schematic diagram of a BiFC assay based on Venus, an improved version of yellow fluorescent protein (YFP) for α-Syn self-assembly. Figure 29B shows representative images (top panel) and quantitative results of the BiFC signal (bottom panel) of HEK293T cells expressing V1S and SV2 individually or together. Figure 29C shows representative images of Western blots from HEK293T cells co-expressing V1S and SV2 and the indicated TRIM proteins. TRIM proteins that reduced the BiFC signal are labeled in red. Expected full-length TRIM bands are indicated by red arrows. [Figure 30] Figure 30 shows representative fluorescence images of tHEK293T cells co-expressing V1S and SV2 with the indicated TRIM proteins, demonstrating that the TRIM proteins influence α-Syn self-assembly. This is related to Figure 29C. [Figure 31] Figure 31 shows representative quantitative results of BiFC fluorescence signals in HEK293T cells co-expressing V1S and SV2 with the indicated TRIM proteins, demonstrating that TRIM proteins influence α-Syn self-assembly. Data are mean ± SD. n=3. Related to Figures 29C and 30. [Figure 32] Figure 32 shows representative images of Western blots of HEK293T cells transfected with SOD1 G93A-GFP and a control vector (-) or the indicated TRIM protein, lysed in NP-40-containing buffer, and separated into soluble supernatant (SN) and insoluble pellet (PE) fractions by sedimentation, demonstrating that the TRIM protein affects SOD1. Expected full-length TRIM bands are indicated by green arrows. TRIM proteins that significantly reduced the insoluble SOD1 G93A-GFP species are labeled in red. [Figure 33]Figure 33, including Figures 33A to 33F, shows representative results of testing TRIM11 targeting pathogenic SOD1 for proteasome degradation. Figure 33A shows representative Western blot images of HEK293T cells transfected with an empty vector (EV), TRIM11, or TRIM112EA and expressing SOD1 G93A-GFP, demonstrating that TRIM11 reduces SOD1 G93A levels. Figure 33B shows representative Western blot images of HEK293T cells transfected with SOD1 G93A-GFP and EV or TRIM11 and treated for the period indicated by CHX, demonstrating that TRIM11 promotes the degradation of SOD1 G93A-GFP. Figure 33C shows representative Western blot images of NSC-34 cells expressing WT-hSOD-GFP or G93A-hSOD-GFP, which were treated with 1 μg Dox for 24 hours to induce SOD1 expression, and then transdulated with an empty vector (EV) or FLAG-TRIM11 to increase the amount, and 0.5 μg mCherry-N1 as a control for transfection efficiency. Cells were treated with the proteasome inhibitor MG132 (10 μM) for 8 hours or the lysosomal inhibitor leupeptin (10 mM) + NH4Cl (20 mM) (L+N) for 16 hours. Proteasome inhibition and lysosomal inhibition were confirmed, respectively, using c-Myc and p62. The data are representative of three independent experiments. Figure 33D shows representative Western blot images of Neuro-2A cells treated with 100 μM H2O2 for 48 hours, transiently transfected with FLAG-TRIM11 to increase EV or volume, and subsequently subjected to fractional analysis to demonstrate endogenous SOD1. 0.5 μg mCherry-N1 was co-transfected with the FLAG vector as an indicator for equivalent transfection.Figure 33E shows representative Western blot images of NSC-34 cells expressing WT-hSOD-GFP or G93A-hSOD-GFP, which were treated with 1 μg Dox for 24 hours to induce SOD1 expression and transiently transfected with 2 μg EV or FLAG-TRIM11 + 0.5 μg mCherry-N1. The cells were then cultured in Dox-free medium for the indicated time, followed by Western blot analysis of the SN fraction, PE fraction, and whole cell lysate (WCL). Figure 33F shows representative Western blot images of NSC-34 cells expressing WT-hSOD-GFP and G93A-hSOD-GFP, which were treated with Dox and transfected with EV or FLAG-TRIM11 (2 μg each) to induce SOD1 expression. Forty hours after transfection, cells were lysed in RIPA buffer, followed by repeated sedimentation using anti-FLAG(M2) beads or anti-GFP conjugate agarose beads. The input represents 10% of the RIPA lysis. To demonstrate binding specificity, NSC-34 stable cells expressing TRIM11 that were not attracted by Dox were used as a control (lane 1). The data are representative of three independent experiments. [Figure 34]Figure 34, including Figures 34A to 34J, shows representative results from a study testing the improvement of pathology and neuroinflammation in SOD1-G93A mice by TRIM11. Figure 34A shows a schematic diagram of this study. Figure 34B shows representative images of the cortex and spinal cord of control mice and mice injected with AAV9-GFP or AAV9-TRIM11, demonstrating that TRIM11 reduced SOD1-G93A staining in the cortex and spinal cord. Figure 34C shows the quantitative results of SOD1 G93A staining in the cortex of Figure 34B (n=15 mice in each group). Figure 34D shows the quantitative results of SOD1 G93A staining in the spinal cord of Figure 34B (n=7 for WT, n=8 for GFP, and n=10 for TRIM11). Figure 34E shows representative images of the cortex and spinal cord of control SOD1-G93A mice and SOD1-G03A mice injected with AAV9-GFP or AAV9-TRIM11, stained with a GFAP-specific antibody, demonstrating that TRIM11 reduces astroglial proliferation in SOD1-G93A mice. Figure 34F shows the quantitative results of GFAP immunoreactivity in the cortex of Figure 34E (n=13 for WT, n=15 for GFP and TRIM11). Figure 34G shows the quantitative results of GFAP immunoreactivity in the spinal cord of Figure 34E (n=7 WT, 8 GFP or 10 TRIM11). Figure 34H shows representative images of the cortex and spinal cord of mice treated similarly to Figure 34E and stained with an Iba1-specific antibody, demonstrating that TRIM11 reduces microglial proliferation in SOD1 G93A mice. Figure 34I shows the quantitative results of Iba1 immunoreactivity in the cortex of Figure 34H. Figure 34J shows the quantitative results of Iba1 immunoreactivity in the spinal cord of Figure 34H. For Figures 34I and 34J, n=7 WT mice, 8 GFP mice, or 10 TRIM11 mice. For Figures 34B, 34E, and 34H, the scale bar is 0.2 mm. For Figures 34C, 34F, and 34I, 6-7 cortical visual fields were analyzed for each mouse. For Figures 34D, 34G, and 34J, 3-4 spinal visual fields were analyzed for each mouse. For Figures 34C, 34D, 34F, 34G, 34I, and 34J, the data are presented as mean ± SD.**, p<0.01; ***, p<0.005; ****, p<0.001; Independent Student's t-test. [Figure 35] Figure 35, including Figures 35A and 35B, shows representative results from a study testing the reduction of protein aggregation, neuroinflammation, and apoptosis in SOD1 G93A mice by TRIM11. Figure 35A shows representative Western blot images of the cortex of non-transgenic (Ntg) mice and hSOD1 G93A transgenic mice injected with AAV9-GFP or AAV9-TRIM11-HA and fractionated into NP-40 soluble (SN) and 2% SDS soluble (PE) components. Figure 35B shows representative Western blot images of the spinal cord from the mice in Figure 35A. GFP and HA indicate successful intraventricular (ICV) injection of AAV into the central and peripheral nervous systems. GFAP and Iba1 were used as markers for astrocytes and microglia, respectively. Cleavage caspase 3 (C-CASP3) is a marker of apoptosis. Arrows indicate SOD1 monomers and dimers. SE: Short exposure; LE: Long exposure. The data are representative of two independent experiments. [Figure 36]Figure 36, including Figures 36A to 36E, shows representative results from a study testing the remedy of behavioral abnormalities in SOD1 G93A mice by TRIM11. Figure 36A shows representative quantitative results of movement distance in AAV9-GFP injected mice and AAV9-TRIM11 injected mice (n=27 for GFP, n=29 for TRIM11). Figure 36B shows representative quantitative results of movement time in AAV9-GFP injected mice and AAV9-TRIM11 injected mice (n=22 for GFP, n=21 for TRIM11). Figure 36C shows representative improvements in motor ability in AAV9-TRIM11 injected mice compared to AAV9-GFP injected mice, as indicated by the increased latency to fall during wire suspension (n=21). Figure 36D shows a typical improvement in motor function in AAV9-TRIM11-injected mice compared to AAV9-GFP-injected mice, as indicated by the increase in latency to fall in a rotorod accelerated from 4 to 40 RPM (n=22 for GFP and n=21 for TRIM11). Figure 36E shows a typical correlation between TRIM11 expression levels and motor function improvement in the rotorod test. For Figures 36A to 36D, data are presented as mean ± SD. *, p<0.05; **, p<0.01; ***, p<0.005; Student's t-test without pairs. [Figure 37]Figure 37, including Figures 37A to 37C, shows representative results of a systematic analysis of the effects of TRIM on TDP43. Figure 37A shows representative images of Western blots of HEK293T cells transfected with TDP43-Q331K-GFP and a control vector (-) or the indicated TRIM protein. Figure 37B shows representative images of Western blots of HEK293T cells transfected with TDP43-Q331K-GFP and a control vector (-) or the indicated TRIM protein. Cells were lysed in NP-40-containing buffer, separated into soluble supernatant (SN) and insoluble pellet (PE) fractions by sedimentation, and analyzed by Western blotting. In Figures 37A and 37B, the expected full-length TRIM band is indicated by a blue arrow. TRIM proteins with significantly reduced insoluble TDP43-Q331K-GFP species are labeled in red. Figure 37C shows representative Western blot images of SH-SY5Y cells stably expressing GFP-TDP-43 5FL or GFP-TDP-43 Q331K transduction with a control lentiviral vector (-) or a lentiviral vector expressing TRIM11. It demonstrates that TRIM11 reduces the level of insoluble TDP43 mutants, but not the level of soluble TDP43 mutants. Cells were lysed in NP-40-containing buffer and separated into soluble supernatant (SN) and insoluble fractions by sedimentation. The insoluble pellet was lysed in SDS-containing buffer. The SDS-insoluble pellet (SR) was analyzed by dot blotting. WCL, whole cell lysate. [Figure 38]Figure 38, including Figures 38A to 38J, shows representative results from a study testing the improvement of protein aggregation and neuroinflammation in a TDP-43-ALS mouse model by TRIM11. Figure 38A shows a schematic diagram of this study. Figure 38B shows representative images of the cortex and spinal cord of control Tar4 / 4 mice and Tar4 / 4 mice injected with AAV9-GFP or AAV9-TRIM11, demonstrating that TRIM11 reduced TDP-43 levels in the cortex and spinal cord. Figure 38C shows the quantitative results of TDP-43 staining in the cortex of Figure 28B (n=9 for WT, n=13 for GFP and TRIM11). Figure 38D shows the quantitative results of TDP-43 staining in the spinal cord of Figure 38B (n=5 for WT, n=13 for GFP and TRIM11). Figure 38E shows representative images of the cortex and spinal cord of control Tar4 / 4 mice and Tar4 / 4 mice injected with AAV9-GFP or AAV9-TRIM11, stained with an antibody specific to GFAP, demonstrating that TRIM11 reduced astroglial proliferation in Tar4 / 4 mice. Figure 38F shows the quantitative results of GFAP immunoreactivity in the cortex of Figure 38E (n=5 WT mice, 6 GFP mice, or 10 TRIM11 mice). Figure 38G shows the quantitative results of GFAP immunoreactivity in the spinal cord of Figure 38E (n=4 for WT mice or n=6 for GFP and TRIM11 mice). Figure 38H shows representative images of the cortex and spinal cord of mice treated similarly to Figure 38E and stained with an antibody specific to Iba1, demonstrating that TRIM11 reduced microglial proliferation. Figure 38I shows the quantitative results of Iba1 immunoreactivity in the cortex (n=5 for WT, n=6 for GFP, or n=8 for TRIM11). Figure 38J shows the quantitative results of Iba1 immunoreactivity in the spinal cord (n=5 for WT and GFP, or n=7 for TRIM11). For Figures 38B, 38E, and 38H, the scale bar is 0.2 mm. For Figures 38C, 38D, 38F, 38G, 38I, and 38J, the data are presented as mean ± SD. *, p<0.05; **, p<0.01; ***, p<0.005; ****, p<0.001; Independent Student's t-test. [Figure 39] Figure 39 shows representative results from a study testing the reduction of TDP-43 aggregation and apoptosis in a TDP-43-ALS mouse model using TRIM11. Whole brain lysates from non-transgenic (Ntg) mice and ALS disease mice (TAR4 / 4) injected with AAV9-GFP or AAV9-TRIM-HA were fractionated into NP-40 soluble (SN) and 2% SDS soluble (PE) components. GFP and HA indicate successful intraventricular (ICV) injection of AAV into the brain. GFAP and Iba1 were used as markers for astrocytes and microglia, respectively. Both cleavage-type PARP and cleavage-type caspase 3 (C-CASP3) are markers of apoptosis. Arrows indicate full-length, 35kDa, or 25kDa forms of TDP-43. The 25kDa fragment is associated with TDP-43 protein aggregation loading. GAPDH and lamin A / C were selected as markers for the cytoplasmic and nuclear fractions, respectively. SE: short exposure; LE: long exposure. The data are representative of two independent experiments. [Figure 40]Figure 40, including Figures 40A to 40P, shows representative results from tests demonstrating the reduction in levels of various misfolding proteins by TRIM10. Figure 40A shows representative Western blot images of HEK293T cells transfected for 36 hours with GFP-tagged tau or tau P301L along with an increased amount of Flag-TRIM10. Figure 40B shows representative Western blot images of HEK293T cells transfected for 36 hours with GFP-tagged α-Syn-A53T along with an increased amount of Flag-TRIM10. Figure 40C shows representative Western blot images of HEK293T cells transfected for 36 hours with GFP-tagged SOD1 along with an increased amount of Flag-TRIM10. Figure 40D shows representative Western blot images of HEK293T cells transfected for 36 hours with GFP-tagged TDP-40, TDP-43 M337V, or TDP-43 Q331K along with an increased dose of Flag-TRIM10. Figure 40E shows representative Western blot images of HEK293T cells transfected for 36 hours with GFP-tagged FUS along with an increased dose of Flag-TRIM10. Figure 40F shows representative Western blot images of HEK293T cells transfected for 36 hours with GFP-tagged Atxn1 82Q along with an increased dose of Flag-TRIM10. Figure 40G shows representative Western blot images of control cells (left) or TRIM10 knockdown (right) HEK293T cells transfected for 36 hours with Flag-TRIM10 and GFP-Atxn1 82Q or 30Q. Figure 40H shows representative Western blot images of TRIM10 knockdown HEK293T cells transfected with GFP-Atxn1 82Q for 36 hours or not transfected. Figure 40I shows representative Western blot images of HEK293T cells transfected with GFP-tagged Htt-72Q with increased amounts of Flag-TRIM10 for 36 hours.Figure 40J shows the quantitative results of tau mRNA from cells, processed in the same manner as in Figure 40A and measured by RT-PCR. Figure 40K shows the quantitative results of α-Syn-A53T mRNA from cells, processed in the same manner as in Figure 40B and measured by RT-PCR. Figure 40L shows the quantitative results of SOD1 mRNA from cells, processed in the same manner as in Figure 40C and measured by RT-PCR. Figure 40M shows the quantitative results of TDP-43 mRNA from cells, processed in the same manner as in Figure 40D and measured by RT-PCR. Figure 40N shows the quantitative results of FUS mRNA from cells, processed in the same manner as in Figure 40E and measured by RT-PCR. Figure 40O shows the quantitative results of Htt 72Q mRNA from cells, processed in the same manner as in Figure 40G and measured by RT-PCR. Figure 40P shows the quantitative results of attaxin mRNA from cells, processed in the same manner as in Figure 40H and measured by RT-PCR. For Figures 40J to 40P, data are presented as mean ± SD. n=3; ns, no significant difference; unpaired Student's t-test. WCL, whole cell lysate; PE, pellet fraction; SN, soluble supernatant fraction. [Figure 41]Figure 41, including Figures 41A to 41K, shows representative results from tests demonstrating that TRIM10 promotes proteasomal degradation of misfolding proteins. Figure 41A shows representative Western blot images of HEK293T cells expressing GFP-Atxn1 82Q with increased amounts of TRIM10. Cells were treated with 10 μM MG132 for 6 hours and / or with NH4Cl and leupeptin (LN) (p62 and LC3 as controls). Figure 41B shows representative Western blot images of HEK293T cells transfected with GFP-tagged tau or tau P301L for 36 hours and treated with MG132 for 6 hours, in or without Flag-TRIM10. Figure 41C shows representative Western blot images of HEK293T cells transfected with GFP-tagged α-Syn-A53T for 36 hours and treated with MG132 for 6 hours, in or without Flag-TRIM10. Figure 41D shows representative Western blot images of HEK293T cells transfected with GFP-tagged SOD1 or SOD1 G93A for 36 hours and treated with MG132 for 6 hours, in or without Flag-TRIM10. Figure 41E shows representative Western blot images of HEK293T cells transfected with GFP-tagged TDP-43, TDP-43 M337V, or TDP-43 Q331K for 36 hours and treated with MG132 for 6 hours, in or without Flag-TRIM10. Figure 41F shows representative Western blot images of HEK293T cells transfected with GFP-tagged FUS for 36 hours and treated with MG132 for 6 hours, in or without Flag-TRIM10. Figure 41G shows representative Western blot images of HEK293T cells transfected with GFP-tagged Htt-72Q for 36 hours and treated with MG132 for 6 hours, in or without Flag-TRIM10.Figure 41H shows representative Western blot images of the cycloheximide (CHX) chase assay for GFP-Atxn1 82Q turnover in HEK293T cells in the presence or absence of Flag-TRIM10. Figure 41I shows the quantitative results of the relative ratio of GFP-Atxn1 82Q / actin analyzed by Image J. Data are presented as mean ± SD. ***P<0.001. Figure 41J shows representative confocal images of HEK293T cells expressing GFP-Atxn1 82Q and mCherry-TRIM10, treated with 10 μM MG132 for 6 hours, fixed, and stained with Hoechst. Figure 41K shows representative quantitative results of the percentage of cells with TRIM10 accumulation in the nucleus from Figure 41J. [Figure 42]Figure 42, including Figures 42A to 42I, shows representative results of testing TRIM10 as a molecular chaperone for various client proteins. Figure 42A shows representative results of the ThT binding assay of α-Syn monomer fibrillation (70 μM) in the presence or absence of GST or Flat-TRIM10 at the indicated concentrations. Quantitative results are shown on the left, and Western blots are shown on the right. Figure 42B shows representative electron microscope images of α-Syn monomer fibrillation (70 μM) in the presence of GST or 0.5 μM Flag-TRIM10 (scale bar, 500 nm). Figure 42C shows representative results of the ThT binding assay of α-Syn (70 μM) fibrillation in the presence or absence of GST, Flag-TRIM10, or Hsp70 / Hsp40-Hsp104 (0.5 μM each). The ATP regeneration system was made to contain heat shock proteins, but not TRIM10 (all subsequent experiments using heat shock proteins also contained ATP and the ATP regeneration system, but experiments using TRIM10 did not). Figure 42D shows representative results of Western blots for fibrillation of α-Syn (70 μM) in the presence of GST and TRIM10 (50-500 nM), dot blots for pellets (PE) and SDS-insoluble (SR) aggregates, total α-Syn, and disuxcinimimidylsverate (DSS) cross-linking (for soluble oligomers). Figure 42E shows representative images of Western blots for HEK293T cells transfected with Flag-TRIM10 and GFP-α-Syn-A53T for 36 hours. Figure 42F shows representative Western blots of fibrillation of Aβ42 monomer (10 μM) in the presence or absence of TRIM10 (50-200 nM). Figure 42G shows representative results of ThT binding assays of Aβ42 monomer (10 μM) in the presence or absence of TRIM10 (50-200 nM). Figure 42H shows representative viability of SH-SY5Y cells treated with Aβ42 and pre-incubated or not pre-incubated with TRIM10. Figure 42I shows representative images of Western blots of Flag-TRIM10 (0.5 μM) mediated suppression of Atxn1 82Q aggregation.The relative amounts of Atxn1 82Q in each fraction are shown. For Figures 42A, 42C, and 42H, the data are mean ± SD. n=3;*, p<0.05;**, p<0.01; Independent Student's t-test. [Figure 43]Figure 43, including Figures 43A to 43H, shows representative results of testing TRIM10 as a disaggregase for various client proteins. Figure 43A shows representative results of a ThT binding assay of α-Syn PFF (0.5 μM) treated with GST, Flag-TRIM10 (increasing concentration), or HSP. Figure 43B shows representative Western blot images of α-Syn PFF (0.5 μM) treated with GST, Flag-TRIM10 (0.1, 0.2, and 0.5 μM), or HSP. Figure 43C shows representative dot blot images of α-Syn fibrils (0.5 μM) treated with GST (0.2 μM), Flag-TRIM10 at the indicated concentrations, or HSP, demonstrating that α-Syn is dissolved by TRIM10. Figure 43D shows representative electron microscope images of α-Syn PFF (0.5 μM) fibril dissociation after treatment with GST or 0.5 μM Flag-TRIM10 (scale bar, 500 nm). Figure 43E shows representative dot blot images of α-Syn fibrils (0.5 μM) treated with GST (0.2 μM), Flag-TRIM10 (0.5 μM), HSP, or TRIM10 and HSP, demonstrating that α-Syn is dissolved by TRIM10. Soluble α-Syn relative to total α-Syn was quantified (n=3). Figure 43F shows representative Western blot and dot blot images of Aβ42 fibrils incubated with GST, TRIM10 (50~500 μM), or DAXX (400 nM). Figure 43G shows representative results of the ThT binding assay of Aβ42 fibrils incubated with GST, TRIM10 (50-500 nM), or DAXX (400 nM). Figure 43H shows representative images of Western blots and dot blots of 50 nM Atxn1 82Q aggregates already formed, incubated for 3 hours with GST or Flag-TRIM10 (0, 200 nM, and 500 nM, respectively). For Figures 43A and 43G, data are presented as mean ± SD. n=4;**, p<0.01;***, p<0.001; unpaired Student's t-test. [Figure 44]Figure 44, including Figures 44A to 44E, shows representative experimental results for TRIMs that can prevent DP-43 aggregation. GFP-TDP-43NLRm was transfected into HeLa cells alone (-) or with the indicated TRIMs. Cells were treated with sodium arsenite (Ars) (+) or untreated (-) and stained with anti-HA antibody (for TRIM) and Hoechst 33342 (for DNA). Figure 44A shows representative immunofluorescence images of cells with cytoplasmic GFP-TDP-43NLRm aggregates in the presence or absence of TRIM10, TRIM11, TRIM17, and TRIM55. Figures 44B, 44C, 44D, and 44E show quantitative results of cells with cytoplasmic GFP-TDP-43NLRm aggregation in the presence or absence of TRIM10, TRIM11, TRIM17, and TRIM55, respectively. Data are mean ± SD. n=3 (scale bar, 10 μm). **P<0.01, ***P<0.001, independent Student's t-test. [Figure 45]Figure 45, including Figures 45A to 45G, shows representative experimental results demonstrating the downregulation of TRIM11 and TRIM10 in FTLD-TDP brains. Figure 45A shows representative immunoblots of prefrontal cortical gray matter from 11 control individuals and 11 FTLD-TDP individuals. Figure 45B shows the quantitative results of the relative ratio of TRIM11 / actin. Figure 45C shows representative IHC images of TRIM11 and pS409 / 410 TDP-43 in the prefrontal cortex (scale bar, 160 mm). Figure 45D shows a graph illustrating the negative correlation between TRIM11 levels and pS409 / 410 TDP-43 levels in FTLD-TDP tissue and control tissue. The r and p values ​​of the Pearson correlation coefficient are shown. Figure 45E shows representative immunoblots of frontal cortical gray matter from 11 control individuals and 11 FTLD-TDP individuals. Figure 45F shows the quantification results of the relative ratio of TRIM10 / GAPDH protein. Figure 45G shows the quantification results of the relative levels of mRNA. #1 control sample and #1 and #7 FTLP-TDP samples were used in both blots, and these blots were used for comparison. **P<0.01, ***P<0.001; ns, no significant difference; unpaired Student's t-test. [Figure 46]Figure 46, including Figures 46A to 46G, shows representative experimental results demonstrating the roles of endogenous TRIM11 and TRIM10 in the regulation of TDP-43. Figures 46A, 46B, and 46C show representative immunofluorescence images, pS409 / 410 intensity quantification results, and representative immunoblots of cortical neurons treated with control or TRIM11 ASO, respectively. Figure 46D shows representative immunofluorescence images of endogenous TDP-43 in control cells and TRIM10 KO HeLa cells treated with control or TRIM10 ASO (scale bar, 10 μm). Figure 46E shows quantification results of cells showing mislocalization of TDP-43 in HeLa cells (***P<0.001, unpaired Student's t-test). Figure 46F shows representative immunofluorescence images of endogenous TDP-43 in control and TRIM10 KO mouse primary cortical neurons treated with control or TRIM10 ASO (scale bar, 10 μm). Figure 46G shows quantitative results of cells showing mislocalization of TDP-43 in primary neurons (***P<0.001, unpaired Student's t-test). [Figure 47] Figure 47, including Figures 47A to 47D, shows representative experimental results demonstrating that TRIM10 is a molecular chaperone and disaggregase for TDP-43. Figure 47A shows a representative electron microscope image from the experiment, and Figure 47B shows a representative Western blot from a precipitation assay when MBP-TDP-43 (5 μM) was treated with TEV and incubated for 24 hours in or without TRIM10 (0.25 or 0.5 μM). Figure 47C shows a representative electron microscope image from the experiment, and Figure 47D shows a representative Western blot from a precipitation assay when TDP-43 proficientibilities (5 μM monomer concentration) were incubated with or without TRIM10 (0.25 or 0.5 μM). SN, supernatant; PE, SDS-soluble pellet; SR, SDS-insoluble pellet (detected by dot blot). Scale bar, 500 nm. Kapβ2 (2.5 and / or 5 μM), which does not act on TDP-43, was used as a negative control. [Figure 48]Figure 48, including Figures 48A to 48Q, shows representative experimental results demonstrating that TRIM10 maintains the nuclear localization of FUS. Figure 48A shows representative immunofluorescence images of HeLa cells transfected with EGFP-FUS + empty vector (EV), TRIM10-FLAG-HA, or Kapβ2-FLAG-HA, and treated with 0.5 mM sodium arsenite for 90 minutes (+Ars) or untreated (-Ars). Cells were stained with anti-HA, G3BP1, and Hoechst 33342 (scale bar, 10 μm). Figure 48B shows the quantitative results of the percentage of cells with GFP-FUS in the SG. Figure 48C shows representative Western blots from experiments in which HeLa cells were transfected with EGFP-FUS and empty vector or TRIM10 for 24 hours, and then treated with 0.5 mM sodium arsenite for 90 minutes. Cytoplasmic and nuclear fractions were separated and Western blotting was performed. Lamin A / C and GAPDH were used as loading controls for the nuclear and cytoplasmic fractions, respectively. Figure 48D shows representative immunofluorescence images of HeLa cells transfected with mCherry-N1 or mCherry-N1-TRIM10 and treated with 0.5 mM sodium arsenite for 90 minutes (+Ars) or untreated (-Ars). Cells were stained with anti-G3BP1, FUS, and Hoechst 33342 (scale bar, 10 μm). Figure 48E shows the quantitative results of the percentage of cells with FUS in the SG. Figure 48F shows representative immunofluorescence images of WT spinal neurons transfected with an empty vector or TRIM10 for 24 hours. Cells were treated with arsenite (0.5 mM) for an additional hour or left untreated, and stained with anti-HA antibody, FUS antibody, MAP2 antibody, and Hoechst 33342 (scale bar: 10 μm). Figure 48G shows the quantitative results of cells with FUS in the cytoplasm. Figure 48H shows a representative immunofluorescence image showing that GFP-FUS SG association is promoted by TRIM10 knockout. GFP-FUS was transfected into control or TRIM10 knockout HeLa cells for 24 hours.Cells were treated with arsenite (0.5 mM) for an additional 30 minutes or left untreated, and stained with anti-G3BP1 antibody and Hoechst 33342 (scale bar, 10 μm). Figure 48I shows the quantification results for cells with FUS in the SG. Figure 48J shows a representative immunofluorescence image demonstrating that TRIM10 knockout promotes SG association of endogenous FUS. Control and TRIM10 knockdown HeLa cells were stained with anti-FUS antibody and Hoechst 33342 (scale bar, 10 μm). Figure 48K shows the quantification results for the percentage of cells with FUS in the cytoplasm. Figure 48L shows a representative immunofluorescence image (scale bar, 10 μm) of WT cortical neurons transduction with control or TRIM10 #1 ASO for 3 days and stained with anti-FUS antibody, MAP2 antibody, and Hoechst 33342. Figure 48M shows the quantification results for cells with FUS in the cytoplasm. Figure 48N shows a representative immunofluorescence image of HeLa cells transfected with EGFP-FUS (G156E) along with TRIM10. Cells were treated with 0.5 mM sodium arsenite for 90 minutes (+Ars) or untreated (-Ars), stained with anti-HA antibody, anti-G3BP1 antibody, and Hoechst 33342, and analyzed by confocal microscopy (scale bar, 10 μm). Figure 48O shows the quantitative results of the percentage of cells with FUS G156E in the SG in the presence or absence of TRIM10. Figure 48P shows a representative immunofluorescence image of wild-type spinal cord neurons transfected for 24 hours with EGFP-FUS (R521H) and either an empty vector or TRIM10. Cells were further treated with arsenite (0.5 mM) for 1 hour or untreated, and stained with anti-HA antibody, MAP2 antibody, and Hoechst 33342 (scale bar, 10 μm). Figure 48Q shows the quantitative results for cells with FUS inclusions in the cytoplasm. The data shown are mean ± SD [n=3, for Figures 48B, 48E, 48G, 48I, 48M, 48O, and 48Q, cells with more than 20 cells were counted, and for Figure 48K, cells with more than 60 cells were counted]. *P<0.05, **P<0.01, ***P<0.001, Independent Student's t-test. [Figure 49]Figure 49, including Figures 49A to 49D, shows representative experimental results demonstrating that TRIM10 prevents and reverses hnRNPA1 SG association. Figure 49A shows representative immunofluorescence images from confocal microscopy observations of HeLa cells transfected with GFP-hnRNPA1 alone or with TRIM10 for 24 hours. Cells were treated with 0.5 mM sodium arsenite for 90 minutes (+Ars) or untreated (-Ars) and stained with anti-HA antibody, anti-TIA1 antibody, and Hoechst 33342 (scale bar, 10 μm). Figure 49B shows the quantitative results of the percentage of cells with hnRNPA1 in the SG. Figure 49C shows representative immunofluorescence images of endogenous hnRNPA1 in WT cortical neurons transduction with control or TRIM10 ASO (scale bar, 10 μm). Figure 49D shows the quantitative results of Figure 49C. The data shown are mean ± SD and represent three independent experiments. More than 25 cells were counted in each experiment. ***P<0.001, independent Student's t-test. [Figure 50]Figure 50, including Figures 50A to 50K, shows representative experimental results demonstrating that TRIM10 is a molecular chaperone and disaggregase for prion-like RBPs. Figure 50A shows a representative Western blot from a precipitation assay, and Figure 50B shows a representative EM image (scale bar, 500 nm) from an experiment in which GST-FUS (5 μM) was treated with TEV and incubated for 24 hours in the presence or absence of TRIM10 (0.5 μM). Figure 50C shows a representative Western blot from a precipitation assay, and Figure 50D shows a representative EM image from an experiment in which GST-hnRNPA1 (5 μM) was treated with TEV and incubated for 24 hours in the presence or absence of 0.5 or 5 μM TRIM10 or Kapβ2 (Figure 50C) or 0.5 μM TRIM10 or 5 μM Kapβ2 (Figure 50D). Figure 50E shows a representative Western blot from a precipitation assay in an experiment in which FUS-EGFP proficientifibrillar (5 μM monomer concentration) was incubated with the indicated concentrations of TRIM10 or Kapβ2, and Figure 50F shows a representative EM image from the same experiment (scale bar, 500 nm). The arrows indicate the proficientifibular FUS aggregates formed during PSC cleavage. Figure 50G shows a representative Western blot from a precipitation assay in an experiment in which hnRNPA1 proficientifibrillar (5 μM monomer concentration) was incubated with buffer, 0.5 or 5 μM TRIM10 or Kapβ2 (Figure 50G), or 0.5 μM TRIM10 or 5 μM Kapβ2 (Figure 50H), and Figure 50H shows a representative EM image from the same experiment (scale bar, 500 nm). Figure 50I shows a representative image of a FUS hydrogel (480 μM monomer concentration) treated with buffer, TRIM10 (20 μM), or Kapβ2 (54 μM), and Figure 50J shows a representative EM analysis of the same. Figure 50K shows a representative image from an experiment in which an hnRNPA1 hydrogel (3.3 mM monomer concentration) was treated with buffer, TRIM10 (20 μM), or Kapβ2 (270 μM). Solubility was evaluated by EM. Molar ratio of TRIM10:hnRNPA1 = 1:83, molar ratio of Kapβ2:hnRNPA1 = 1:6. Scale bar, 500 nm. [Figures 51-53]Figures 51-53 show representative immunofluorescence images from a systematic analysis of the effects of TRIM on TDP-43 aggregation. GFP-TDP-43NLRm was transfected into HeLa cells alone or with the indicated TRIMs. Cells were treated with sodium arsenite (Ars) and stained with anti-HA antibody (for TRIM) and Hoechst 33342 (for DNA). Representative images are shown (scale bar, 10 μm). [Figure 54-56] Figures 54–56 show representative confocal microscopy images of a systematic analysis of the effects of TRIM on the erroneous localization of FUS to the cytoplasm and SG association. HeLa cells were transfected with TRIM protein labeled GFP-FUS for 36 hours. The cells were treated with 0.5 mM sodium arsenite (Ars) for 90 minutes, fixed, and stained with anti-HA antibody, anti-TIA1 antibody, and Hoechst 33342 (scale bar: 10 μm). [Figure 57]Figure 57, including Figures 57A to 57K, shows representative experimental results demonstrating that TRIM10 maintains the nuclear localization of wild-type FUS. Figures 57A to 57C show representative results from experiments in which HeLa cells were transfected with HA-TRIM10 for 24 hours or not, and cells were treated with 0.5 mM sodium arsenite for 90 minutes (+Ars) or not (-Ars). Cells were fixed and stained with anti-HA antibody, anti-G3BP1 antibody, and Hoechst 33342. Figure 57A shows a representative Western blot showing the expression of the indicated proteins. Figure 57B shows a representative cell image (scale bar, 10 μm). Figure 57C shows the quantitative results of the mean fluorescence intensity of SG. Figures 57D and 57E show representative results from experiments in which cortical neurons obtained from wild-type mice were transfected with an empty vector or TRIM10 for 24 hours. Cells were treated with arsenite (0.5 mM) for an additional hour or left untreated, and stained with anti-HA, FUS, and MAP2 antibodies, as well as Hoechst 33342. Figure 57D shows a representative cell image (scale bar, 10 μm). Figure 57E shows the quantitative results for cells with FUS in the cytoplasm. Figure 57F shows a representative Western blot showing protein levels in Ctr and TRIM10 knockout cell lines. Figures 57G to 57I show representative results from experiments in which control cells or TRIM10 knockout HeLa cells were treated with 0.5 mM sodium arsenite for 60 minutes or left untreated, and stained with anti-G3BP1 antibody and Hoechst 33342. Figure 57G shows a representative Western blot showing TRIM10 knockdown efficiency and G3BP1 expression. Figure 57H shows a representative cell image (scale bar, 10 μm). Figure 57I shows the quantitative results of the mean fluorescence intensity of SG. Figure 57J shows representative fluorescence images of primary cortical neurons treated with or not treated with SCR CTRL-FAR RED for 3 days (scale bar: 10 μm). Figure 57K shows representative Western blots of primary cortical neurons incubated with AUMInc-scrctrl or AUMSiI-TRIM10-1 / 3 for 3 days. Cells were lysed in RIPA buffer.The data shown are mean ± SD [n=3, for Figures 57C and 57I, 25 or more cells and 20 or more SGs were counted, respectively, and for Figure 57E, more than 20 cells were counted]. *P<0.05. ns, no significant difference, unpaired Student's t-test. [Figure 58] Figure 58, including Figures 58A to 58C, shows representative experimental results demonstrating that TRIM10 maintains the nuclear localization of FUS mutants. Figure 58A shows representative immunofluorescence images of wild-type spinal cord neurons transfected with EGFP-FUS(R521H) for 24 hours with either an empty vector or TRIM10. Cells were further treated with arsenite (0.5 mM) for 1 hour or left untreated, and stained with anti-HA antibody, G3BP1 antibody, MAP2 antibody, and Hoechst 33342. Figure 58B shows representative immunofluorescence images of wild-type cortical neurons transfected with EGFP-FUS(R521H) for 24 hours with either an empty vector or TRIM10. Cells were further treated with arsenite (0.5 mM) for 1 hour or left untreated, and stained with anti-HA antibody, G3BP1 antibody, MAP2 antibody, and Hoechst 33342 (scale bar, 10 μm). Figure 58C shows the quantitative results for cells with FUS inclusions in the cytoplasm. The data shown are mean ± SD [n=3, each with 20 or more cells]. *P<0.05, **P<0.01, unpaired Student's t-test. [Figure 59]Figure 59, including Figures 59A to 59K, shows representative experimental results demonstrating that TRIM10 prevents SG association of hnRNPA1. Figure 59A shows representative immunofluorescence images of HeLa cells transfected for 24 hours with GFP-hnRNPA1 alone or with TRIM10. Cells were treated with 0.5 mM sodium arsenite for 90 minutes (+Ars) or untreated (-Ars), stained with anti-HA antibody and anti-TIA1 antibody, as well as Hoechst 33342, and analyzed by confocal microscopy (scale bar, 10 μm). Figure 59A is related to Figure 45L. Figure 59B shows representative Western blots of cytoplasmic and nuclear fractions isolated from HeLa cells transfected for 24 hours with EGFP-hnRNPA1 and an empty vector or TRIM10, and further treated with 0.5 mM sodium arsenite for 90 minutes. Lamin A / C and GAPDH were used as loading controls for the nuclear and cytoplasmic fractions, respectively. Figure 59C shows representative Western blots of protein expression from HeLa cells transfected for 24 hours with GFP-hnRNPA1 alone or with TRIM10. Cells were treated with 0.5 mM sodium arsenite for 90 minutes (+Ars) or untreated (-Ars). Figure 59D shows representative immunofluorescence images of HeLa cells transfected with GFP-hnRNPA1 for 24 hours and then transfected with the indicated TRIM10. After 24 hours, cells were treated with 0.5 mM sodium arsenite for 90 minutes (+Ars) or untreated (-Ars), then fixed, stained with anti-TIA1 antibody and Hoechst 33342, and observed under a confocal microscope (scale bar, 10 μm). Figure 59E shows the quantitative results of the percentage of cells with hnRNPA1 in the SG. Figure 59F shows a typical Western blot of protein expression analysis. Figure 59G shows a typical Western blot of HeLa cells transfected with an empty vector or TRIM10 for 24 hours and further treated with 0.5 mM sodium arsenite for 90 minutes. Whole cell lysates, as well as cytoplasmic and nuclear fractions, were analyzed by Western blotting. Lamin A / C and GAPDH were used as controls for the nuclear and cytoplasmic fractions, respectively.Figure 59H shows representative immunofluorescence images (scale bar, 10 μm) of control or TRIM10 knockdown HeLa cells transfected with GFP-hnRNPA1 for 36 hours, then fixed and stained with anti-G3BP1 antibody and Hoechst 33342 for confocal microscopy observation. Figure 59I shows the quantitative results of the percentage of cells with hnRNPA1 in the cytoplasm. Figure 59J shows representative immunofluorescence images (scale bar, 10 μm) of endogenous hnRNPA1 in control or TRIM10 knockdown HeLa cells. Figure 59K shows the quantitative results of the percentage of cells with hnRNPA1 in the cytoplasm. The data shown are mean ± SD [n=3. For Figures 59F, 59I, and 59K, cells with more than 20 cells were counted]. ***P<0.001, unpaired Student's t-test. [Figure 60] Figure 60, including Figures 60A and 60B, shows a schematic of the expression construct and analysis of the purified protein. Figure 60A shows a schematic diagram of the recombinant protein used in this study. Human FUS and hnRNPA1 were N-terminally fused with glutathione S-transferase (GST). The GST was cleaved from the fusion using TEV to initiate protein aggregation. Figure 60B shows a representative Western blot image of recombinant TRIM10 protein expressed in HEK293T cells (human TRIM10 tagged with both HA and Flag epitopes at the C-terminus). FUS and hnRNPA1 proteins expressed in E. coli were purified and analyzed by SDS-PAGE and coumarcine blue staining. BSA was used as a protein standard.

[0025] Detailed explanation This invention relates to the discovery of the roles of molecular chaperones, disaggregases, and TRIM proteins as discriminants of proteins to be degraded, which play a role in the pathology of various neurodegenerative disorders.

[0026] In one embodiment, the present invention provides compositions and methods for treating or preventing neurodegenerative diseases or disorders. In some embodiments, neurodegenerative diseases or disorders are associated with misfolded proteins or protein aggregates. Therefore, in certain embodiments, the present invention can be used to remove intracellular or extracellular misfolded proteins, protein aggregates, or protein inclusions.

[0027] In some embodiments, the present invention provides compositions and methods for treating disorders associated with misfolded proteins or protein aggregates. For example, in certain embodiments, the compositions and methods are used to treat diseases and disorders associated with misfolded proteins and / or protein aggregates of proteins related to amyloid-beta, alpha-synuclein, tau, prions, SOD1, TDP-43, FUS, p53, p53 mutants, or polyglutamine repeats, such as huntingtin and ataxin.

[0028] In certain embodiments, the present invention provides compositions and methods for treating or preventing neurodegenerative disorders in subjects requiring treatment or prevention of such disorders. In some embodiments, the present invention provides compositions and methods for treating or preventing neurodegenerative disorders that are polyglutamine (polyQ) disorders. In this case, the CAG codon repeat encodes a protein having a polyglutamine chain, which may result in misfolded protein aggregates. Exemplary polyQ disorders include, but are not limited to, spinocerebellar degeneration (SCA) type 1 (SCA1), SCA2, SCA3, SCA6, SCA7, SCA17, Huntington's disease, and dentatorubral-pallidolar atrophy (DRPLA).

[0029] Exemplary neurodegenerative diseases associated with misfolded proteins or protein aggregates include SCA1, SCA2, SCA3, SCA6, SCA7, SCA17, Huntington's disease, dentatorubral-pallidolar atrophy (DRPLA), Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), transmissible spongiform encephalopathy (prion disease), Lewy body dementia (DLB), multiple system atrophy (MSA), frontotemporal lobar degeneration (FTLD), AL amyloidosis, AA amyloidosis, familial Mediterranean fever, senile systemic amyloidosis, and familial amyloidosis. Polyneuropathy, Icelandic hereditary cerebral amyloid angiopathy, hereditary cerebral hemorrhage with amyloidosis, pituitary prolactinoma, frontotemporal lobar degeneration (FTLD-tau), progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), argyrophilic granulopathy (AGD), frontotemporal dementia parkinsonism linked to chromosome 17 (FTDP-17), vacuolar tauopathy, Lytico-Bodig disease, glial tauopathy (GGT), age-related tau astrocyte disease (ARTAG), Pick's disease, primary age-related tauopathy (PART), Neurofibrillary tangle dementia (TOD), chronic traumatic encephalopathy (CTE), anti-IgLON5-related tauopathy, Guadeloupe parkinsonism, nodding syndrome (NS), ganglioglioma, gangliocytoma, meningeal hemangioma, post-encephalitis parkinsonism, subacute sclerosing panencephalitis (SSPE), lead encephalopathy, tuberous sclerosis, pantothenate kinase-related neurodegeneration, lipofuscinosis, Shy-Drager syndrome, striatonigral degeneration, olivopontocerebellar atrophy, Haller-Folden-Spats syndrome, REM sleep behavior disorder (RPD), Alzheimer's disease with restricted amygdala-Lewy bodies This includes, but is not limited to, Heimer's disease (AD / ALB), frontotemporal lobar degeneration (FTLD-TDP), multiple system proteinosis (MSP), Perry's disease, facial-onset sensorimotor neuropathy (FOSMN), cerebral age-related TDP-43 sclerosis (CARTS), limbic-dominant age-related TDP-43 encephalopathy (LATE), sporadic inclusion body myositis (sIBM), chronic traumatic encephalopathy (CTE), primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), Guam-PDC, and Guam-ALS.

[0030] In one embodiment, the present invention provides compositions and methods for improving the expression, activity, or both of the expression and activity of one or more TRIM proteins. In a particular embodiment, the composition comprises nucleic acid molecules, expression vectors, proteins, peptides, small molecule compounds, etc., that improve the expression, activity, or both of the expression and activity of one or more TRIM proteins.

[0031] definition Unless otherwise specified, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which the present invention pertains. Any methods and materials similar or equivalent to those described herein may be used in carrying out or testing the present invention, but preferred methods and materials are described.

[0032] As used herein, the following terms have the meanings set forth in this section.

[0033] In this specification, the articles "a" and "an" are used to refer to one or more (i.e., at least one) grammatical objects of the article. For example, "an element" means one or more elements.

[0034] As used herein, "about" when referring to measurable values, such as quantities or time periods, means that the variation suitable for carrying out the disclosed method includes a variation of ±20%, ±10%, ±5%, ±1%, or ±0.1% from the specified value.

[0035] When used in reference to organisms, tissues, cells, or components thereof, the term “abnormal” means that an organism, tissue, cell, or component thereof differs from an organism, tissue, cell, or component thereof that exhibits each “normal” (expected) characteristic in at least one observable or detectable characteristic (e.g., age, treatment, time of day, etc.). A characteristic that is normal or expected for one cell or tissue species may be abnormal for a different cell or tissue species.

[0036] As used herein, “cell therapy” refers to the administration of living cells as a treatment for the treatment or prevention of one or more diseases or disorders. Cells may be unprocessed or processed, for example, genetically modified to overexpress a therapeutic protein of interest. Cells used in cell therapy may be heterologous, allogeneic, syngeneic, or autologous.

[0037] "Disease" is a state of animal health in which the animal's health continuously deteriorates if it is unable to maintain homeostasis and the disease does not improve.

[0038] In contrast, a “disorder” in animals is one in which the animal can maintain homeostasis, but the animal’s health is less desirable than it would be without the disorder. Without treatment, the disorder does not necessarily worsen the animal’s health.

[0039] A disease or disability is “relieved” if the severity of the signs or symptoms of the disease or disability, the frequency of experiencing such signs or symptoms, or both are reduced.

[0040] The “effective dose” or “therapeutically effective dose” of a compound is the amount of the compound sufficient to provide a beneficial effect to the subject to which it is administered. The “effective dose” of a delivery medium is the amount sufficient to effectively bind to the compound or to deliver the compound.

[0041] As used herein, “Information Materials” include publications, recording media, diagrams, or any other medium of expression that can be used to communicate the usefulness of the kit-type compounds, compositions, vectors, or delivery systems of the present invention in providing relief for the various diseases or disorders referred to herein. Optionally or alternatively, the Information Materials may describe one or more methods for providing relief for diseases or disorders in mammalian cells or tissues. The Information Materials for the kit of the present invention may, for example, be attached to or transported together with the container containing the specified compounds, compositions, vectors, or delivery systems of the present invention. Alternatively, the Information Materials may be transported separately from the container, with the intention that the recipient use the Information Materials in conjunction with the compounds.

[0042] The terms “patient,” “subject,” and “individual” are used interchangeably herein and refer to any animal or its cells (whether in vitro or in vivo) suitable for the methods described herein. In certain non-limiting embodiments, patient, subject, or individual is human.

[0043] A "therapeutic" treatment is a treatment administered to a person exhibiting signs or symptoms of a disease or disorder, with the aim of reducing or eliminating those signs or symptoms.

[0044] As used herein, “treating a disease or disorder” means reducing the severity and / or frequency of signs or symptoms of a disease or disorder experienced by a patient.

[0045] As used herein, the term “biological sample” is intended to include any sample containing cells, tissues, or bodily fluids in which nucleic acid or polypeptide expression is present or detectable. Liquid samples are referred to herein as “bodily fluids.” Biological samples can be obtained from patients by various techniques, including, for example, obtaining bodily fluids by scratching or swab collection of the area of ​​interest or by using a needle. Methods for collecting various bodily samples are well known in the art.

[0046] As used herein, “immunoassay” refers to any binding assay that detects and quantifies a target molecule using an antibody capable of specifically binding to that target molecule.

[0047] As used herein with respect to antibodies, the term "specifically binding" means an antibody that recognizes a particular antigen but substantially does not recognize or bind to other molecules in the sample. Furthermore, for example, an antibody that specifically binds to an antigen from one species may also bind to antigens from one or more species. However, such interspecies reactivity itself does not alter the classification of antibody specificity. Another example is an antibody that specifically binds to an antigen may also bind to different allele forms of that antigen. However, such cross-reactivity itself does not alter the classification of antibody specificity.

[0048] In some cases, the terms "specific binding" or "specifically binding" may be used to mean that, in relation to an interaction between an antibody, protein, or peptide and a second chemical species, that interaction is determined by the presence of a specific structure (e.g., an antigenic determinant or epitope) on that chemical species. For example, an antibody recognizes and binds to a specific protein structure, rather than a general protein. If an antibody is specific to epitope "A", then in a reaction involving labeled "A" and the antibody, the presence of a molecule containing epitope A (or free, unlabeled A) will reduce the amount of labeled A bound to the antibody.

[0049] The "coding region" of a gene consists of nucleotide residues in the coding chain of that gene and nucleotides in the non-coding chain of that gene that are homologous or complementary to the coding region of the mRNA molecule produced by the transcription of that gene.

[0050] The "coding region" of an mRNA molecule consists of nucleotide residues of the mRNA molecule that pair with the anticodon region of the transfer RNA molecule or encode a stop codon during the translation process of the mRNA molecule. Therefore, the coding region may contain nucleotide residues that include codons of amino acid residues not present in the mature protein encoded by the mRNA molecule (for example, amino acid residues in the protein transport signal sequence).

[0051] As used herein to refer to nucleic acids, “complementary” refers to the broad concept of sequence complementarity between regions of two nucleic acid chains or between two regions of the same nucleic acid chain. It is known that an adenine residue in a first nucleic acid region can form a specific hydrogen bond ("base pairing") with a residue in a second nucleic acid region antiparallel to the first region if that residue is thymine or uracil. Similarly, it is known that a cytosine residue in a first nucleic acid chain can base pair with a residue in a second nucleic acid chain antiparallel to the first chain if that residue is guanine. When a first region of a nucleic acid is complementary to a second region of the same or a different nucleic acid, if the two regions are arranged antiparallel, at least one nucleotide residue in the first region can base pair with a residue in the second region. Preferably, the first region includes a first portion, and the second region includes a second portion. As a result, when the first and second parts are arranged antiparallel, at least about 50%, preferably at least about 75%, at least about 90%, or at least about 95% of the nucleotide residues in the first part are base-pairable with the nucleotide residues in the second part. More preferably, all of the nucleotide residues in the first part are base-pairable with the nucleotide residues in the second part.

[0052] "Isolated" means that something has been altered or removed from its natural state. For example, nucleic acids or peptides that naturally exist in the normal environment of a living animal are not "isolated," but the same nucleic acids or peptides that have been partially or completely separated from coexisting substances in that natural environment are "isolated." Isolated nucleic acids or proteins may exist in a substantially purified form or in a non-natural environment, such as in a host cell.

[0053] "Isolated nucleic acid" refers to a nucleic acid segment or fragment separated from its adjacent sequences in its natural state, i.e., a DNA fragment typically extracted from sequences adjacent to that fragment within the natural genome. The term also applies to nucleic acids substantially purified from other components that coexist with nucleic acids in nature, i.e., RNA or DNA or proteins that coexist within cells in nature. Therefore, the term includes recombinant DNA, for example, vectors, autonomously replicating plasmids or viruses, or recombinant DNA incorporated into the genomic DNA of prokaryotes or eukaryotes, or existing as a distinct molecule independent of other sequences (i.e., cDNA or genomic or cDNA fragments produced by PCR or restriction enzyme digestion). The term also includes recombinant DNA that is part of a hybrid gene encoding additional polypeptide sequences.

[0054] In the context of this invention, the following abbreviations for commonly existing nucleic acid bases are used: "A" refers to adenosine, "C" refers to cytosine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.

[0055] As used herein, the term “polynucleotide” is defined as a chain of nucleotides. Furthermore, nucleic acids are polymers of nucleotides. For this reason, as used herein, nucleic acids and polynucleotides are interchangeable. Those skilled in the art will have general knowledge that nucleic acids are polynucleotides and can be hydrolyzed to monomeric “nucleotides.” Monomeric nucleotides may be hydrolyzed to nucleosides. As used herein, polynucleotides include, but are not limited to, all nucleic acid sequences obtained by any means available in the art (including, but not limited to, recombinant means, i.e., cloning of nucleic acid sequences from recombinant libraries or cell genomes using conventional cloning techniques and PCR, etc.) and synthetic means.

[0056] As used herein, the terms “peptide,” “polypeptide,” and “protein” are interchangeable and refer to compounds composed of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that may constitute a protein or peptide sequence. A polypeptide includes any peptide or protein containing two or more amino acids linked to each other by peptide bonds. As used herein, this term refers to both single-chain (commonly called, in the art, for example, peptides, oligopeptides, and oligomers) and long-chain (commonly called, in the art, proteins, of which there are many types). A “polypeptide” includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins, etc. Polypeptides include native peptides, recombinant peptides, synthetic peptides, or combinations thereof.

[0057] As used herein, "conjugated" refers to a covalent bond between one molecule and another molecule.

[0058] As used herein, "mutant" refers to a nucleic acid sequence or peptide sequence that differs in sequence from the reference nucleic acid sequence or peptide sequence, respectively, but retains the essential biological properties of the reference molecule. Sequence changes in nucleic acid mutants may not alter the amino acid sequence of the peptide encoded by the reference nucleic acid, or they may result in amino acid substitutions, additions, deletions, fusions, and cleavages. Sequence changes in peptide mutants are typically limited or conserved, such that the sequence of the reference peptide and the sequence of the mutant are very similar overall and identical in many regions. Mutants and reference peptides may differ in amino acid sequence due to one or more substitutions, additions, or deletions in any combination. Mutants of nucleic acids or peptides may occur spontaneously, such as allele mutants, or they may be mutants whose spontaneous occurrence is unknown. Non-spontaneous nucleic acid and peptide mutants can be generated by mutagenesis or direct synthesis.

[0059] As used herein, “activator of one or more TRIM proteins” is a compound that enhances the expression, activity, or biological function of a TRIM protein compared to the expression, activity, or biological function of a TRIM protein in the absence of an activator.

[0060] Scope: Throughout this disclosure, various aspects of the invention may be presented in scope form. It should be understood that scope form is for convenience and brevity only and should not be interpreted as an inflexible limitation on the scope of the invention. Therefore, a scope description should be considered to have all specifically disclosed possible sub-scopes within that scope, as well as individual numerical values. For example, a scope description, e.g., 1–6, should be considered to have specifically disclosed sub-scopes, e.g., 1–3, 1–4, 1–5, 2–4, 2–6, 3–6, etc., as well as individual numbers within that scope, e.g., 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the scope.

[0061] explanation In one embodiment, the present invention provides compositions and methods for treating or preventing neurodegenerative diseases or disorders. In some embodiments, the neurodegenerative diseases or disorders are associated with misfolded proteins or protein aggregates. For example, the present invention provides compositions and methods for improving the recognition and removal of misfolded proteins. In certain embodiments, the present invention assists in protein folding. In certain embodiments, the present invention provides dissociation and refolding of protein aggregates or inclusions. For this reason, the present invention can be used both intracellularly and extracellularly to treat or prevent misfolded proteins, protein aggregates, or protein inclusions.

[0062] This invention relates to the discovery of the roles of molecular chaperones, disaggregases, and TRIM proteins as discriminants of proteins to be degraded, which play a role in the pathology of various neurodegenerative disorders.

[0063] composition In various embodiments, the present invention includes compositions for improving the level or activity of TRIM proteins. Accordingly, in some embodiments, the composition includes an activator for the expression or activity of one or more TRIM proteins. In some embodiments, the activator improves the expression or activity of one or more TRIM proteins. In some embodiments, the composition of the present invention improves the level of one or more TRIM proteins, the amount of mRNA encoding one or more TRIM proteins, the activity of one or more TRIM proteins, or a combination thereof. The one or more TRIM proteins include any member of the TRIM protein family, including mammalian and non-mammalian members. In a specific embodiment, the composition is: Human TRIM1, TRIM2, TRIM3, TRIM4, TRIM5, TRIM6, TRIM7, TRIM8, TRIM9, TRIM10, TRIM11, TRIM13, TRIM14, TRIM15, TRIM16, TRIM17, TRIM18, TRIM19, TRIM20, TRIM21, TRIM22, TRIM23, TRIM24, TRIM25, TRIM26, TRIM27, TRIM28, TRIM29, TRIM30, TRIM31, TRIM32, TRIM33, TRIM34, TRIM35, TRIM36, TRIM37, TRIM38, TRIM39, TRIM40, TRIM It includes one or more activators selected from the group consisting of IM41, TRIM42, TRIM43, TRIM44, TRIM45, TRIM46, TRIM47, TRIM48, TRIM49, TRIM50, TRIM51, TRIM52, TRIM54, TRIM55, TRIM56, TRIM58, TRIM59, TRIM60, TRIM61, TRIM62, TRIM63, TRIM64, TRIM65, TRIM66, TRIM67, TRIM68, TRIM69, TRIM70, TRIM71, TRIM72, TRIM73, TRIM74, TRIM76 and TRIM77, as well as mouse TRIM12 and TRIM30.In some embodiments, the composition includes one or more activators selected from the group consisting of human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM21, TRIM24, TRIM26, TRIM29, TRIM31, TRIM34, TRIM36, TRIM37, TRIM46, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, and TRIM70, as well as mouse TRIM12 and TRIM30. In some embodiments, the composition includes one or more activators selected from the group consisting of human TRIM10, TRIM11, TRIM24, TRIM36, TRIM37, TRIM40, TRIM49, TRIM55, TRIM58, and TRIM68. In some embodiments, the composition includes one or more activators selected from the group consisting of human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM12, TRIM17, TRIM18, TRIM19, TRIM21, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, and TRIM70. In some embodiments, the composition includes one or more activators selected from the group consisting of human TRIM10, TRIM11, and TRIM55.In some embodiments, the composition includes one or more activators selected from the group consisting of human TRIM2, TRIM3, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM26, TRIM29, TRIM30, TRIM31, TRIM36, TRIM41, TRIM42, TRIM43, TRIM46, TRIM49, TRIM55, TRIM56, TRIM63, TRIM64, TRIM68, TRIM69, TRIM70, TRIM71, and TRIM73. In some embodiments, the composition includes one or more activators selected from the group consisting of human TRIM10, TRIM11, TRIM36, TRIM55, and TRIM68. In some embodiments, the composition includes one or more activators selected from the group consisting of human TRIM10, TRIM11, TRIM24, TRIM36, and TRIM58. In some embodiments, the composition includes one or more activators selected from the group consisting of human TRIM10, TRIM11, TRIM17, TRIM36, TRIM37, TRIM40, TRIM49, and TRIM55. In some embodiments, the composition includes an activator of human TRIM10. In some embodiments, the composition includes an activator of human TRIM11.

[0064] The activation of a gene or gene product can be evaluated using a wide range of methods, including those disclosed herein and those known or to be developed in the art. That is, a routineer will understand, based on the disclosures provided herein, that improving the level or activity of a gene or gene product can be easily evaluated using methods that evaluate the level of nucleic acid encoding the gene product (e.g., mRNA), the level of polypeptide gene product present in a biological sample, the activity of polypeptide gene product present in a biological sample, or combinations thereof.

[0065] The activator compositions and methods of the present invention for improving the level or activity of a gene or gene product include, but should not be construed as, compounds, proteins, peptides, peptide mimes, antibodies, ribozymes, small molecule compounds, nucleic acids, vectors, antisense nucleic acid molecules (e.g., siRNA, miRNA, etc.), or combinations thereof. Those skilled in the art will readily understand, based on the disclosures provided herein, that the activator compositions encompass compounds that improve the level or activity of a gene or gene product. Furthermore, the activator compositions encompass chemically modified compounds and derivatives, as is well known to those skilled in the chemical art.

[0066] In some embodiments, the activator composition of the present invention is an agonist that enhances the expression, activity, or biological function of a gene or gene product. For example, in certain embodiments, the activator of the present invention is an agonist of one or more TRIM proteins.

[0067] Furthermore, those skilled in the art will understand that, with the methods exemplified herein, the activators may include activators that may be identified in the future, as can be identified by well-known standards in the field of pharmacology, such as the physiological consequences of the modulation of genes and gene products, as described in detail herein and / or are known in the art. Accordingly, the present invention is not limited in any way to the specific activator compositions exemplified or disclosed herein. Rather, the present invention encompasses useful activator compositions that are known in the art and will be understood by those skilled in the art as they may be discovered in the future.

[0068] Further methods for identifying and producing activator compositions are well known to those skilled in the art. Alternatively, activators can be chemically synthesized. Furthermore, those skilled in the art will understand that activator compositions can be obtained using recombinant organisms based on the teachings provided herein. Compositions and methods for chemically synthesizing activators and obtaining activators from natural sources are well known in the art and described in the technical literature.

[0069] Those skilled in the art will understand that activators can be administered as small molecule compounds, polypeptides, peptides, antibodies, nucleic acid constructs encoding proteins, antisense nucleic acids, nucleic acid constructs encoding antisense nucleic acids, or combinations thereof. Numerous vectors and other compositions and methods for administering proteins or nucleic acid constructs encoding proteins to cells or tissues are well known. Accordingly, the present invention includes peptides or nucleic acids encoding peptides that are activators of genes or gene products. For example, the present invention includes peptides or nucleic acids encoding peptides that include one or more TRIM proteins, one or more functional TRIM peptides, or combinations thereof (Sambrook et al., 2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York; Ausubel et al., 1997, Current Protocols in Molecular Biology, John Wiley & Sons, New York).

[0070] In some embodiments, the activator of the present invention results in an improvement in the expression of at least one TRIM protein, including transcription, translation, or both. In some embodiments, the activator of the present invention results in an improvement in the activity of at least one TRIM protein (e.g., inhibition of USP14). Therefore, improving the level or activity of at least one TRIM protein includes, but is not limited to, increasing the amount of at least one TRIM protein, or improving the transcription, translation, or both of the nucleic acid encoding at least one TRIM protein. It also includes improving any activity of the TRIM polypeptide.

[0071] Those skilled in the art will understand that reducing the amount or activity of a molecule that reduces the amount or activity of the TRIM protein may help to increase the amount or activity of the TRIM protein. Any inhibitor of the negative regulator of the TRIM protein is included in the present invention. In non-limiting examples, antisense is described as a form that inhibits the regulator of a proteasome or proteasome subunit in order to increase the amount or activity of the proteasome or proteasome subunit. An antisense oligonucleotide is a DNA or RNA molecule complementary to a portion of an mRNA molecule. When an antisense oligonucleotide is present in a cell, it hybridizes with the existing mRNA molecule, thereby inhibiting its translation into a gene product. Inhibiting gene expression using antisense oligonucleotides is well known in the art (Marcus-Sekura, 1988, Anal. Biochem. 172:289). Similarly, methods for expressing antisense oligonucleotides in cells are also well known (Inoue, US No. 5,190,931). The present invention involves the use of antisense oligonucleotides to reduce the amount of molecules that reduce the amount or activity of TRIM proteins, thereby improving the amount or activity of TRIM proteins. Antisense oligonucleotides synthesized by methods well known to those skilled in the art and supplied to cells are assumed in the present invention. For example, antisense oligonucleotides can be synthesized with a length of about 10 to about 100, more preferably about 15 to about 50 nucleotides. The synthesis of nucleic acid molecules is well known in the art, and similarly, the synthesis of modified antisense oligonucleotides to improve bioactivity compared to unmodified antisense oligonucleotides is also well known (Tullis, 1991, US Patent No. 5,023,243).

[0072] Similarly, gene expression may be inhibited by affecting the transcription of a gene through hybridization of an antisense molecule with the gene's promoter or other regulatory element. Methods for identifying promoters or other regulatory elements that interact with a target gene are well known in the art and include methods such as the yeast two-hybrid system (Bartel and Fields, eds., In: The Yeast Two Hybrid System, Oxford University Press, Cary, NC).

[0073] Alternatively, inhibition of genes expressing proteins that reduce the level or activity of TRIM protein can be achieved by using siRNA, shRNA, antisense oligonucleotides, or ribozymes. Given the nucleotide sequences of such molecules and the disclosures and references incorporated herein, those skilled in the art can synthesize antisense oligonucleotides or ribozymes without excessive trial and error.

[0074] peptide In some embodiments, the activator of the present invention comprises an active TRIM polypeptide or a fragment thereof. In some embodiments, the peptide of the composition comprises the amino acid sequence of one or more TRIM proteins. In some embodiments, the peptide of the composition comprises human TRIM1, TRIM2, TRIM3, TRIM4, TRIM5, TRIM6, TRIM7, TRIM8, TRIM9, TRIM10, TRIM11, TRIM13, TRIM14, TRIM15, TRIM16, TRIM17, TRIM18, TRIM19, TRIM20, TRIM21, TRIM22, TRIM23, TRIM24, TRIM25, TRIM26, TRIM27, TRIM28, TRIM29, TRIM30, TRIM31, TRIM32, TRIM33, TRIM34, TRIM35, TRIM36, TRIM37, TRIM38, TRIM39, TRIM40, TRIM41, T The peptides include RIM42, TRIM43, TRIM44, TRIM45, TRIM46, TRIM47, TRIM48, TRIM49, TRIM50, TRIM51, TRIM52, TRIM54, TRIM55, TRIM56, TRIM58, TRIM59, TRIM60, TRIM61, TRIM62, TRIM63, TRIM64, TRIM65, TRIM66, TRIM67, TRIM68, TRIM69, TRIM70, TRIM71, TRIM72, TRIM73, TRIM74, TRIM76, and TRIM77; and one or more amino acid sequences selected from the group consisting of mouse TRIM12 and TRIM30 peptides and their functional variants.In some embodiments, the peptides of the composition include one or more amino acid sequences selected from the group consisting of human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM21, TRIM24, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM37, TRIM46, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, and TRIM70; mouse TRIM12 and TRIM30 peptides and their functional variants. In some embodiments, the peptide of the composition comprises one or more amino acid sequences selected from the group consisting of human TRIM10, TRIM11, TRIM24, TRIM36, TRIM37, TRIM40, TRIM49, TRIM55, TRIM58, and TRIM68 peptides and their functional variants. In some embodiments, the peptide of the composition comprises one or more amino acid sequences selected from the group consisting of human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM12, TRIM17, TRIM18, TRIM19, TRIM21, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, and TRIM70 peptides and their functional variants. In some embodiments, the peptide of the composition comprises one or more amino acid sequences selected from the group consisting of human TRIM10, TRIM11, and TRIM55 peptides and their functional variants.In some embodiments, the peptide of the composition comprises one or more amino acid sequences selected from the group consisting of human TRIM2, TRIM3, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM26, TRIM29, TRIM30, TRIM31, TRIM36, TRIM41, TRIM42, TRIM43, TRIM46, TRIM49, TRIM55, TRIM56, TRIM63, TRIM64, TRIM68, TRIM69, TRIM70, TRIM71, and TRIM73 peptides and their functional variants. In some embodiments, the peptide of the composition comprises one or more amino acid sequences selected from the group consisting of human TRIM10, TRIM11, TRIM36, TRIM55, and TRIM68 peptides and their functional variants. In some embodiments, the peptide of the composition comprises one or more amino acid sequences selected from the group consisting of human TRIM10, TRIM11, TRIM24, TRIM36, and TRIM58 peptides and their functional variants. In some embodiments, the peptide of the composition comprises one or more amino acid sequences selected from the group consisting of human TRIM10, TRIM11, TRIM17, TRIM36, TRIM37, TRIM40, TRIM49, and TRIM55 peptides and their functional variants. In some embodiments, the peptide of the composition comprises the amino acid sequence of human TRIM10 peptide or its functional variant. In some embodiments, the peptide of the composition comprises the amino acid sequence of human TRIM11 peptide or its functional variant.

[0075] In some embodiments, the composition comprises one or more TRIM proteins. For example, in some embodiments, the composition comprises the amino acid sequences of one or more TRIM proteins provided by the accession numbers in Table 1.

[0076] Furthermore, the present invention should also be interpreted as including any form of peptide having substantially homology to the peptides disclosed herein. A “substantially homologous” peptide is one whose amino acid sequence is at least about 50%, at least about 70%, at least about 80%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to that of the peptides disclosed herein.

[0077] In some embodiments, the compositions of the present invention include peptides, peptide fragments, peptide homologs, variants, derivatives, or salts described herein. For example, in certain embodiments, the compositions include peptides comprising one or more TRIM proteins, one or more TRIM protein fragments, one or more TRIM protein homologs, one or more TRIM protein variants, one or more TRIM protein derivatives, or one or more TRIM protein salts.

[0078] In certain embodiments, the peptide includes a target domain, thereby targeting the peptide to a desired location. For example, in certain embodiments, the target domain binds to a target cell, protein, or protein aggregate, thereby delivering the therapeutic peptide to a desired location. For example, in some embodiments, the target domain is directed to bind to a protein or protein aggregate associated with a disease or disorder. Such proteins or protein aggregates include, but are not limited to, proteins and protein aggregates associated with amyloid-beta, alpha-synuclein, tau, prions, SOD1, TDP-43, FUS, p53 mutants, and polyglutamine repeats, such as huntingtin and ataxin proteins.

[0079] In certain embodiments, the target domain includes peptides, nucleic acids, small molecules, etc., that have the ability to bind to target cells, proteins, or protein aggregates. In some embodiments, the target domain includes antibodies or antibody fragments that bind to target cells, proteins, or protein aggregates.

[0080] The peptides of the present invention can be produced using chemical methods. For example, the peptides can be synthesized using solid-phase technology (Roberge JY et al (1995) Science 269: 202-204), cleaved from a resin, and purified by preparative high-performance liquid chromatography. Automated synthesis can be achieved, for example, using an ABI 431 A peptide synthesizer (Perkin Elmer) according to instructions provided by the manufacturer.

[0081] Alternatively, peptides can be produced by recombinant means or by cleavage from longer polypeptides. The composition of the peptides can be confirmed by amino acid analysis or sequencing.

[0082] Variants of the peptide of the present invention may be (i) variants in which one or more amino acid residues are substituted with conserved or unconserved amino acid residues (preferably conserved amino acid residues), and such substituted amino acid residues may or may not be encoded by the genetic code; (ii) variants in which one or more modified amino acid residues, for example, residues modified by substituent attachment; (iii) variants in which the peptide is an alternative splicing variant of the peptide of the present invention; (iv) a fragment of the peptide and / or (v) a variant in which the peptide is fused with another peptide, for example, a leader sequence or secretion sequence or a sequence used for purification (e.g., a His tag) or a sequence used for detection (e.g., an Sv5 epitope tag). The fragments include peptides produced by protein cleavage (including multi-site proteolysis) of the original sequence. Variants may be post-translationally modified or chemically modified. Such variants are considered to be within the scope of those skilled in the art from the teachings herein.

[0083] The peptides of the present invention may be post-translationally modified. For example, post-translational modifications within the scope of the present invention include signal peptide cleavage, glycosylation, acetylation, isoprenylation, proteolysis, myristoylation, protein folding, and proteolytic treatment. Some modifications or treatment events require the introduction of additional biological mechanisms. For example, treatment events, such as signal peptide cleavage and core glycosylation, are tested by adding canine microsomal membrane or Xenopus egg extract (US No. 6,103,489) to a standard translation reaction.

[0084] The peptides of the present invention may contain unnatural amino acids formed by post-translational modification or by introducing unnatural amino acids during translation. Various approaches are available for introducing unnatural amino acids during protein translation. As an example, special tRNAs, such as suppressor tRNAs, which have suppressor properties, have been used in the process of site-directed unnatural amino acid substitution (SNAAR). In SNAAR, a specific codon is required on the mRNA, and the suppressor tRNA acts to target the unnatural amino acid to the specific site during protein synthesis (described in WO 90 / 05785). However, the suppressor tRNA must not be recognizable by aminoacyl-tRNA synthase present in the protein translation system. In certain cases, unnatural amino acids can be formed after aminoacylation of the tRNA molecule using chemical reactions that specifically modify the natural amino acid and do not significantly alter the functional activity of the aminoacylated tRNA. These reactions are called post-aminoacylation modifications. For example, tRNA corresponding to lysine (tRNA LYS The epsilon-amino group of lysine linked to ) may be modified with an amine-specific photoaffinity label.

[0085] The peptide of the present invention can be conjugated with other molecules, such as proteins, to prepare a fusion protein. This can be achieved, for example, by synthesizing an N-terminal or C-terminal fusion protein. However, the resulting fusion protein must retain the functionality of the peptide of the present invention.

[0086] Cyclic derivatives of the peptides of the present invention are also part of the present invention. Cyclization may allow the peptide to adopt a stereochemistry more favorable to association with other molecules. Cyclization can be achieved using techniques known in the art. For example, a disulfide bond can be formed between two appropriately spaced components having free sulfhydryl groups, or an amide bond can be formed between an amino group of one component and a carboxyl group of the other. Cyclization can also be achieved using azobenzene-containing amino acids, as described in Ulysse, L., et al., J. Am. Chem. Soc. 1995, 117, 8466-8467. The components forming the bond may be amino acid side chains, non-amino acid components, or a combination of both. In embodiments of the present invention, the cyclic peptide may contain a beta-turn at an appropriate position. The beta-turn can be introduced into the peptide of the present invention by adding a Pro-Gly amino acid at an appropriate position.

[0087] In some cases, it is desirable to produce cyclic peptides that are more flexible than the cyclic peptides containing the peptide bonds described above. More flexible peptides can be prepared by introducing cysteine ​​at the right and left positions of the peptide and forming a disulfide bridge between the two cysteine. The two cysteine ​​are positioned so that the beta-sheet and turn do not deform. As a result of the shorter length of the disulfide bond and the fewer hydrogen bonds in the beta-sheet region, the peptide becomes more flexible. The relative flexibility of the cyclic peptide can be determined by molecular dynamics simulations.

[0088] The peptide of the present invention can be converted into a pharmaceutical salt by reacting it with an inorganic acid, such as hydrochloric acid, sulfuric acid, hydrobromic acid, phosphoric acid, etc., or with an organic acid, such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, succinic acid, malic acid, tartaric acid, citric acid, benzoic acid, salicylic acid, benzenesulfonic acid, and toluenesulfonic acid.

[0089] Furthermore, the peptides of the present invention may also have modifications. Modifications (usually without changing the primary structure) include chemical derivatization of the polypeptide in vivo or in vitro, such as acetylation or carboxylation. Modifications also include glycosylation, such as modifications performed by altering the glycosylation pattern of the polypeptide during the synthesis and processing of the polypeptide or in a further processing step, such as modifications performed by exposing the polypeptide to an enzyme that affects glycosylation, such as a mammalian glycosylation enzyme or deglycosylase. Sequences having phosphorylated amino acid residues, such as phosphotyrosine, phosphoserine, or phosphothreonine, are also included.

[0090] The invention also includes peptides that have been modified using conventional molecular biological techniques, resulting in improved resistance to proteolysis, optimized solubility, or greater suitability as therapeutic agents. Such variants include those containing residues other than naturally occurring L-amino acids, such as D-amino acids or non-natural synthetic amino acids. The peptides of the present invention can be further conjugated with non-amino acid moieties useful for their therapeutic applications. Particularly useful are moieties that improve the stability, biological half-life, water solubility, and / or immunological properties of the peptide. A non-limiting example of such a moiety is polyethylene glycol (PEG).

[0091] Covalently bonding biologically active compounds to water-soluble polymers is one way to alter and control the in vivo distribution, pharmacokinetics, and often toxicity of these compounds (Duncan et al., 1984, Adv. Polym. Sci. 57:53-101). To achieve these effects, many water-soluble polymers have been used, such as poly(sialic acid), dextran, poly(N-(2-hydroxypropyl)methacrylamide) (PHPMA), poly(N-vinylpyrrolidone) (PVP), poly(vinyl alcohol) (PVA), poly(ethylene glycol-copropylene glycol), poly(N-acryloylmorpholine (PAcM), and poly(ethylene glycol)) (PEG) (Powell, 1980, Polyethylene glycol. In RL Davidson (Ed.) Handbook of Water Soluble Gums and Resins. McGraw-Hill, New York, chapter 18). PEG has very low toxicity (Pang, 1993, J. Am. Coll. Toxicol. 12: 429-456), excellent solubility in aqueous solutions (Powell, as above), and low immunogenicity and antigenicity (Dreborg et al., 1990, Crit. Rev. Ther. Drug Carrier). It possesses the ideal set of characteristics (Symst. 6: 315-365).PEG conjugates or "PEGylated" protein therapeutics, which contain single-chain or multi-chain polyethylene glycol in the protein, are documented in the scientific literature (Clark et al., 1996, J. Biol. Chem. 271: 21969-21977; Hershfield, 1997, Biochemistry and immunology of poly(ethylene glycol)-modified adenosine deaminase (PEG-ADA). In JM Harris and S. Zalipsky (Eds) Poly(ethylene glycol): Chemistry and Biological Applications. American Chemical Society, Washington, DC, pp. 145-154; Olson et al., 1997, Preparation and characterization of poly(ethylene glycol)ylated human growth hormone antagonist. In JM Harris and S. Zalipsky (Eds) Poly(ethylene glycol): Chemistry and Biological Applications. American Chemical Society, Washington, DC, pp. 170-181).

[0092] The peptide of the present invention can be synthesized by conventional methods. For example, the peptide of the present invention can be synthesized by chemical synthesis using solid-phase peptide synthesis. These methods utilize either solid-phase synthesis or solution-phase synthesis (for example, regarding solid-phase synthesis techniques, see JM Stewart, and JD Young, Solid Phase Peptide Synthesis, 2 ndSee Ed., Pierce Chemical Co., Rockford Ill. (1984) and G. Barany and RB Merrifield, The Peptides: Analysis, Synthesis, Biology editors E. Gross and J. Meienhofer Vol. 2 Academic Press, New York, 1980, pp. 3-254. For classical liquid synthesis, see M Bodansky, Principles of Peptide Synthesis, Springer-Verlag, Berlin 1984 and E. Gross and J. Meienhofer, Eds., The Peptides: Analysis, Synthesis, Biology, suprs, Vol 1.

[0093] Peptides can be chemically synthesized by Merrifield solid-phase peptide synthesis. This method is typically used to produce peptides up to approximately 60-70 residues in length, and in some cases, it can be used to produce peptides up to approximately 100 amino acids in length. Larger peptides can also be synthetically produced by fragment condensation or native chemical ligation (Dawson et al., 2000, Ann. Rev. Biochem. 69:923-960). The advantage of using synthetic peptide pathways is the ability to produce large quantities of peptides with relatively high purity, i.e., purity sufficient for research, diagnostic, or therapeutic purposes, even for peptides that are rarely found in nature.

[0094] Solid-phase peptide synthesis is described in Stewart et al. in Solid Phase Peptide Synthesis, 2nd Edition, 1984, Pierce Chemical Company, Rockford, Ill. and Bodanszky and Bodanszky in The Practice of Peptide Synthesis, 1984, Springer-Verlag, New York. First, a well-protected amino acid residue is attached via its carboxyl group to a derivatized, insoluble polymer support, such as a cross-linked polystyrene or polyamide resin. "Well-protected" means that protecting groups are present on both the alpha-amino group of the amino acid and any side-chain functional groups. The side-chain protecting groups are generally stable to the solvents, reagents, and reaction conditions used throughout the synthesis and can be removed under conditions that will not affect the final peptide product. Stepwise synthesis of oligopeptides is carried out by removing the N-protecting group from the first amino acid and coupling the carboxyl end of the next amino acid in the desired peptide sequence to it. This amino acid is also well-protected. The carboxyl group of the introduced amino acid can be activated to react with the N-terminus of the support-bound amino acid by forming an active group, such as a carbodiimide, a symmetric acid anhydride, or an "active ester" group, such as a hydroxybenzotriazole or pentafluorophenyl ester.

[0095] Examples of solid-phase peptide synthesis methods include the BOC method, which utilizes tert-butyloxycarbonyl as an alpha-amino protecting group, and the FMOC method, which utilizes 9-fluorenylmethyloxycarbonyl to protect the alpha-amino of an amino acid residue. Both of these methods are well known to those skilled in the art.

[0096] Furthermore, the inclusion of N- and / or C-blocking groups can be achieved using protocols conventionally used in solid-phase peptide synthesis. To inclusion of a C-terminal blocking group, for example, the synthesis of the desired peptide is typically carried out using a support resin that has been chemically modified as the solid phase so that a peptide with the desired C-terminal blocking group can be obtained by cleavage from the resin. To provide a peptide with a primary amino-blocking group at the C-terminus, for example, the synthesis is carried out using a p-methylbenzhydrylamine (MBHA) resin so that the desired C-terminal amidated peptide is released by hydrofluoric acid treatment upon completion of peptide synthesis. Similarly, the inclusion of an N-methylamine blocking group at the C-terminus is achieved using an N-methylaminoethyl derivatized DVB resin, in which case the peptide with the N-methylamidated C-terminus is released by HF treatment. Protection of the C-terminus by esterification can also be achieved using conventional methods. This requires using a resin / blocking group combination that allows the side-chain peptide to be released from the resin and then reacted with the desired alcohol to form an ester functional group. For this purpose, FMOC protecting groups can be used in combination with a DVB resin derivatized with methoxyalkoxybenzyl alcohol or an equivalent linker, and cleavage from the support is carried out with TFA in dichloromethane. Subsequently, esterification of the appropriately activated carboxyl functional group with, for example, DCC can be carried out by the addition of the desired alcohol, followed by deprotection and isolation of the esterified peptide product.

[0097] The peptides of the present invention can be prepared by standard chemical or biological means of peptide synthesis. Biological methods include, but are not limited to, expressing nucleic acids encoding the peptide in host cells or in vitro translation systems.

[0098] The nucleic acid sequence encoding the peptide of the present invention is included in the present invention. In some embodiments, the present invention includes a nucleic acid sequence encoding the amino acid sequence of one or more TRIM proteins.

[0099] Therefore, subclones of the nucleic acid sequence encoding the peptide of the present invention can be produced using conventional molecular genetic operations for subcloning gene fragments. These operations are described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Laboratory, Cold Springs Harbor, New York (2012) and Ausubel et al. (ed.), Current Protocols in Molecular Biology, John Wiley & Sons (New York, NY) (1999 and preceding editions). Each of these publications is incorporated herein by reference in its entirety. The subclones are then expressed in vitro or in vivo in bacterial cells to produce smaller proteins or polypeptides whose specific activities can be tested.

[0100] When combined with specific formulations, such peptides can become effective intracellular agents. Alternatively, to enhance the efficacy of such peptides, one or more peptides of the present invention can be provided as "transcytotic" fusion peptides, for example, with a second peptide that facilitates the uptake of the peptide by cells. For example, in some embodiments, the peptide may include a cell penetration domain, such as a cell penetration peptide (CPP), which allows the peptide to enter the cell. In some embodiments, the CPP is obtained from HIV Tat.

[0101] To illustrate, one or more peptides of the present invention can be provided as part of a fusion polypeptide with the entire N-terminal domain of the HIV protein Tat or a fragment thereof, for example, residues 1-72 of Tat or a smaller fragment thereof that can promote transcytosis. In some embodiments, the peptide comprises the protein transduction domain of HIV Tat. In other embodiments, one or more peptides can be provided as a fusion polypeptide with the entire Antennapedia III protein or a portion thereof. Other cell penetration domains that mediate peptide uptake are known in the art and are similarly applicable for use with the fusion peptides of the present invention.

[0102] nucleic acid In some embodiments, the composition of the present invention comprises one or more isolated nucleic acids. For example, in some embodiments, one or more isolated nucleic acids encode one or more TRIM proteins. In some embodiments, one or more isolated nucleic acids encode human TRIM1, TRIM2, TRIM3, TRIM4, TRIM5, TRIM6, TRIM7, TRIM8, TRIM9, TRIM10, TRIM11, TRIM13, TRIM14, TRIM15, TRIM16, TRIM17, TRIM18, TRIM19, TRIM20, TRIM21, TRIM22, TRIM23, TRIM24, TRIM25, TRIM26, TRIM27, TRIM28, TRIM29, TRIM31, TRIM32, TRIM33, TRIM34, TRIM35, TRIM36, TRIM37, TRIM38, TRIM39, TRIM40, TRIM41, TRIM4 2. Encodes one or more amino acid sequences selected from the group consisting of TRIM43, TRIM44, TRIM45, TRIM46, TRIM47, TRIM48, TRIM49, TRIM50, TRIM51, TRIM52, TRIM54, TRIM55, TRIM56, TRIM58, TRIM59, TRIM60, TRIM61, TRIM62, TRIM63, TRIM64, TRIM65, TRIM66, TRIM67, TRIM68, TRIM69, TRIM70, TRIM71, TRIM72, TRIM73, TRIM74, TRIM76 and TRIM77 peptides; mouse TRIM12 and TRIM30 peptides and their functional variants.In some embodiments, one or more isolated nucleic acids encode one or more amino acid sequences selected from the group consisting of human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM21, TRIM24, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM37, TRIM46, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, and TRIM70 peptides; mouse TRIM12 and TRIM30 peptides and their functional variants. In some embodiments, one or more isolated nucleic acids encode one or more amino acid sequences selected from the group consisting of human TRIM10, TRIM11, TRIM24, TRIM36, TRIM37, TRIM40, TRIM49, TRIM55, TRIM58, and TRIM68 peptides and their functional variants. In some embodiments, one or more isolated nucleic acids encode one or more amino acid sequences selected from the group consisting of human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM12, TRIM17, TRIM18, TRIM19, TRIM21, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, and TRIM70 peptides and their functional variants. In some embodiments, one or more isolated nucleic acids encode one or more amino acid sequences selected from the group consisting of human TRIM10, TRIM11, and TRIM55 peptides and their functional variants.In some embodiments, one or more isolated nucleic acids encode one or more amino acid sequences selected from the group consisting of human TRIM2, TRIM3, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM26, TRIM29, TRIM30, TRIM31, TRIM36, TRIM41, TRIM42, TRIM43, TRIM46, TRIM49, TRIM55, TRIM56, TRIM63, TRIM64, TRIM68, TRIM69, TRIM70, TRIM71, and TRIM73 peptides and their functional variants. In some embodiments, one or more isolated nucleic acids encode one or more amino acid sequences selected from the group consisting of human TRIM10, TRIM11, TRIM36, TRIM55, and TRIM68 peptides and their functional variants. In some embodiments, one or more isolated nucleic acids encode one or more amino acid sequences selected from the group consisting of human TRIM10, TRIM11, TRIM24, TRIM36, and TRIM58 peptides and their functional variants. In some embodiments, one or more isolated nucleic acids encode one or more amino acid sequences selected from the group consisting of human TRIM10, TRIM11, TRIM17, TRIM36, TRIM37, TRIM40, TRIM49, and TRIM55 peptides and their functional variants. In some embodiments, one or more isolated nucleic acids encode an amino acid sequence of human TRIM10 peptide or its functional variant. In some embodiments, the peptide in the composition contains an amino acid sequence of human TRIM11 peptide or its functional variant.

[0103] In some embodiments, the isolated nucleic acid contains a nucleotide sequence encoding the amino acid sequence of one or more TRIM proteins provided by the accession numbers in Table 1.

[0104] Furthermore, the present invention includes isolated nucleic acids comprising nucleotide sequences having substantial homology to the nucleotide sequences encoding the peptides disclosed herein. A “substantially homologous” nucleic acid sequence is at least about 50%, at least about 70%, at least about 80%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, and at least about 99% identical to the nucleotide sequence of the isolated nucleic acid encoding the peptides of the present invention.

[0105] Therefore, the present invention includes expression vectors and methods for introducing foreign DNA into cells and simultaneously expressing the foreign DNA within the cells, such as those described in Sambrook et al (2012, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and Ausubel et al (1997, Current Protocols in Molecular Biology, John Wiley & Sons, New York).

[0106] Desired nucleic acids encoding one or more TRIM proteins can be cloned into numerous types of vectors. However, the present invention should not be construed as being limited to any particular vector. Rather, the present invention should be construed as encompassing a broad range of vectors readily available and / or well known in the art. For example, desired polynucleotides of the present invention can be cloned into vectors including (but not limited to) plasmids, phagemids, phage derivatives, animal viruses, and cosmids. Of particular interest are expression vectors, replication vectors, and transgene vectors.

[0107] In specific embodiments, the expression vector is selected from the group consisting of viral vectors, bacterial vectors, and mammalian cell vectors. Numerous expression vector systems exist that contain at least some or all of the compositions considered above. Prokaryotic and / or eukaryotic vector-based systems can be used in the present invention to produce polynucleotides or their corresponding polypeptides. Many such systems are commercially available and widely accessible.

[0108] Furthermore, expression vectors may be supplied to cells in the form of viral vectors. Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (2012) and Ausubel et al. (1997), as well as in other virology and molecular biology manuals. Useful viruses as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, and lentiviruses. Generally, a suitable vector contains a replication origin that functions in at least one organism, a promoter sequence, a convenient restriction endonuclease site, and one or more selection markers (see, for example, WO 01 / 96584; 01 / 29058 and US 6,326,193).

[0109] Numerous virus-based systems have been developed for gene delivery into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. Selected genes can be inserted into vectors and packaged into retroviral particles using techniques known in the art. Recombinant viruses can then be isolated and delivered to target cells either in vivo or ex vivo. Numerous retroviral systems are known in the art. Adenovirus vectors are used in some embodiments. Numerous adenovirus vectors are known in the art. Lentiviral vectors are used in some embodiments.

[0110] For example, vectors derived from retroviruses, such as lentiviruses, are suitable tools for achieving long-term gene transfer. These vectors allow for the long-term, stable integration of transgenes and their transmission to progenitor cells. Lentiviral vectors have the additional advantage of being able to transduce non-proliferating cells, such as hepatocytes, compared to vectors derived from oncoretroviruses, such as mouse leukemia virus. They also have the additional advantage of low immunogenicity. In a preferred embodiment, the composition includes a vector derived from adeno-associated virus (AAV). Adeno-associated virus (AAV) vectors are powerful gene delivery tools for treating various disorders. AAV vectors possess numerous features ideally suited for gene therapy, including lack of pathogenicity, minimal immunogenicity, and the ability to stably and efficiently transduce post-mitotic cells. The expression of specific genes contained within an AAV vector can be specifically targeted to one or more cell types by selecting an appropriate combination of AAV serotype, promoter, and delivery method.

[0111] In some embodiments, the coding sequence is contained within the AAV vector. More than 30 natural AAV serotypes are available. Many natural variants exist in AAV capsids, which allows for the identification and use of AAVs with properties particularly suited to skeletal muscle. AAV viruses can be manipulated using conventional molecular biological techniques, which allows for the optimization of these particles for cell-specific delivery of nucleic acid sequences, minimization of immunogenicity, adjustment of stability and particle lifetime, efficient degradation, and precise delivery to the nucleus.

[0112] Therefore, the expression of one or more TRIM proteins can be achieved by delivering recombinant AAVs or artificial AAVs containing one or more coding sequences. The use of AAVs is a common method of exogenous DNA delivery because it is relatively low-toxicity, provides efficient gene delivery, and can be easily optimized for specific purposes. Exemplary AAV serotypes include, but are not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9.

[0113] Desirable AAV fragments for incorporation into vectors include cap proteins containing vp1, vp2, vp3 and hypervariable regions, rep proteins containing rep78, rep68, rep52, and rep40, and sequences encoding these proteins. These fragments can be readily utilized in various vector systems and host cells. Such fragments can be used alone, in combination with other AAV serotype sequences or fragments, or in combination with elements from other AAV or non-AAV viral sequences. As used herein, artificial AAV serotypes include, but are not limited to, AAVs having non-natural capsid proteins. Such artificial capsids can be generated by any suitable technique using selected AAV sequences (e.g., fragments of the vp1 capsid protein) in combination with heterologous sequences that can be obtained from different selected AAV serotypes, discontinuous portions of the same AAV serotype, non-AAV viral sources, or non-viral sources. Artificial AAV serotypes may, but are not limited to, chimeric AAV capsids, recombinant AAV capsids, or "humanized" AAV capsids. Therefore, exemplary AAVs or artificial AAVs suitable for the expression of one or more TRIM proteins include AAV2 / 8 (see US No. 7,282,199), AAV2 / 5 (available from the National Institutes of Health), AAV2 / 9 (WO No. 2005 / 033321), AAV2 / 6 (US No. 6,156,303), and AA Vrh8 (WO No. 2003 / 042397), among others.

[0114] To express a desired polynucleotide, at least one module in each promoter functions to position the RNA synthesis start site. The most well-known example of this is the TATA box, but in some promoters that lack a TATA box, such as the promoter for the mammalian terminal deoxynucleotidyltransferase gene and the promoter for the SV40 gene, a separate element covering the start site itself helps to fix the start position.

[0115] Additional promoter elements, or enhancers, regulate the frequency of transcription initiation. These are typically located 30–110 bp upstream of the initiation site, although in recent years, many promoters have been shown to contain functional elements downstream of the initiation site. The spacing between promoter elements is often flexible, and as a result, promoter function is preserved even if elements are inverted or move relative to each other. In the thymidine kinase (TK) promoter, the spacing between promoter elements can be widened to 50 bp, beyond which activity begins to decrease. It has been shown that, in some promoters, individual elements can function to activate transcription, either cooperatively or independently.

[0116] Promoters may inherently be associated with a gene or polynucleotide sequence, and can be obtained by isolating a 5' non-coding sequence located upstream of the coding segment and / or exon. Such promoters are sometimes called “endogenous.” Similarly, enhancers may inherently be associated with a polynucleotide sequence, located either downstream or upstream of that sequence. Alternatively, certain advantages may be obtained by placing the coding polynucleotide segment under the control of a recombinant or heterologous promoter. These promoters refer to promoters that, in their inherent environment, are not typically associated with a polynucleotide sequence. Similarly, recombinant or heterologous enhancers refer to enhancers that, in their inherent environment, are not typically associated with a polynucleotide sequence. Such promoters or enhancers may include promoters or enhancers of other genes, as well as promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cell, and promoters or enhancers that are not “native,” i.e., those containing different elements of different transcriptional regulatory regions and / or mutations that alter expression. In addition to the synthetic production of promoter and enhancer nucleic acid sequences, sequences can also be produced using nucleic acid amplification techniques, including recombinant cloning and / or PCR (US Patent Nos. 4,683,202 and 5,928,906), in relation to the compositions disclosed herein (US Patent Nos. 4,683,202 and 5,928,906). Furthermore, it is conceivable that regulatory sequences directing the transcription and / or expression of sequences in non-nuclear organelles, such as mitochondria and chloroplasts, may also be utilized.

[0117] Naturally, it will be important to utilize promoters and / or enhancers that effectively direct the expression of DNA fragments in the selected cell types, organelles, and organisms for expression. Those skilled in the field of molecular biology are generally familiar with the methods of using combinations of promoters, enhancers, and cell types for protein expression. See, for example, Sambrook et al. (2012). The promoters used are constitutive, tissue-specific, attractive, and / or useful under conditions suitable for high-level expression of the introduced DNA fragment, which may be advantageous, for example, for the large-scale production of recombinant proteins and / or peptides. Promoters may be heterogeneous or endogenous.

[0118] To evaluate the expression of a desired polynucleotide, the expression vector introduced into cells may contain either or both a selection marker gene and / or a reporter gene to facilitate the identification and selection of expressing cells from a cell population intended for transfection or infection with a viral vector. In other embodiments, the selection marker may be held on a separate DNA fragment and used in co-transfection techniques. Both the selection marker and the reporter gene may be able to be expressed in host cells by being adjacent to a suitable regulatory sequence. Useful selection markers are known in the art and include, for example, antibiotic resistance genes, such as neo.

[0119] Reporter genes are used to identify potentially transfected cells and to evaluate the functionality of regulatory sequences. Reporter genes encoding readily assayable proteins are well known in the art. Generally, a reporter gene is a gene that encodes a protein that is not present in or expressed by the recipient organism or tissue, and whose expression manifests from several readily detectable characteristics, such as enzymatic activity. Reporter gene expression is assayed at an appropriate time after the DNA has been introduced into recipient cells.

[0120] Suitable reporter genes may include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase, or green fluorescent protein genes (see, e.g., Ui-Tei et al., 2000 FEBS Lett. 479:79-82). Suitable expression systems are well known and can be prepared using well-known techniques or are commercially available. Internal deletion constructs can be generated using intrinsic internal restriction sites or by partial digestion of non-intrinsic restriction sites. The constructs can then be transfected into cells exhibiting high levels of siRNA polynucleotide and / or polypeptide expression. Generally, constructs with minimal 5' flanking regions exhibiting the highest level of reporter gene expression are identified as promoters. Such promoter regions can be ligated to reporter genes and used to evaluate agonists for their ability to modulate promoter-driven transcription.

[0121] In the context of expression vectors, the vector can be readily introduced into host cells, such as mammalian, bacterial, yeast, or insect cells, by any method available in the art. For example, the expression vector can be introduced into host cells by physical, chemical, or biological means.

[0122] Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle guns, microinjection, and electroporation. Methods for producing cells containing vectors and / or exogenous nucleic acids are well known in the art. See, for example, Sambrook et al. (2012, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and Ausubel et al. (1997, Current Protocols in Molecular Biology, John Wiley & Sons, New York).

[0123] Biological methods for introducing target polynucleotides into host cells include the use of DNA and RNA vectors. Viral vectors, particularly retroviral vectors, are the most widely used method for inserting genes into mammalian cells, such as human cells. Other viral vectors can be obtained from lentiviruses, poxviruses, herpes simplex virus type 1, adenoviruses, and adeno-associated viruses, among others. See, for example, US Nos. 5,350,674 and 5,585,362.

[0124] Chemical means for introducing polynucleotides into host cells include colloidal dispersion systems, such as polymer complexes, nanocapsules, microspheres, beads, and lipid-based systems including water-in-oil emulsions, micelles, mixed micelles, and liposomes. A preferred colloidal system for use as a delivery medium in vitro and in vivo is liposomes (i.e., artificial membrane vesicles). The preparation and use of such systems are well known in the art.

[0125] Regardless of the method used to introduce exogenous nucleic acids into host cells, various assays can be performed to confirm the presence of recombinant DNA sequences within the host cells. Such assays include, for example, “molecular biological” assays well known to those skilled in the art, such as Southern blotting and Northern blotting, RT-PCR and PCR; “biochemical” assays (ELISA and Western blotting) for detecting the presence or absence of specific peptides, for example, by immunological means; or assays described herein for identifying agents that fall within the scope of the present invention.

[0126] Desired polynucleotides can be introduced into cells in vitro or in vivo using any DNA vector or delivery medium. When nonviral delivery systems are used, liposomes are preferred delivery mediums. Accordingly, the delivery systems and protocols mentioned above can be found in Gene Targeting Protocols, 2nd ed., pp 1-35 (2002) and Gene Transfer and Expression Protocols, Vol. 7, Murray ed., pp 81-89 (1991).

[0127] "Liposomes" is a general term encompassing various monolayer and multilayer lipid media formed by the formation of encapsulated lipid bilayers or aggregates. Liposomes can be characterized as having a vesicle structure with a phospholipid bilayer membrane and an internal aqueous medium. Multilayer liposomes have multiple lipid layers separated by an aqueous medium. These spontaneously form when phospholipids are suspended in an excess aqueous solution. The lipid components undergo self-rearrangement before forming a closed structure, trapping water and dissolved solutes between the lipid bilayers. On the other hand, the present invention also includes compositions having structures in solution that differ from the usual vesicle structure. For example, lipids may exist in micelle structures or simply as heterogeneous aggregates of lipid molecules. Lipofectamine-nucleic acid complexes are also conceivable.

[0128] In some embodiments, the composition of the present invention comprises in vitro transcription (IVT) RNA encoding one or more components of one or more TRIM proteins. In some embodiments, the IVT RNA can be introduced into cells as a form of transient transfection. The RNA is produced by in vitro transcription using a synthetically generated plasmid DNA template. The target DNA from any source can be directly converted into an in vitro mRNA synthesis template by PCR using appropriate primers and RNA polymerase. The DNA source may be, for example, genomic DNA, plasmid DNA, phage DNA, cDNA, synthetic DNA sequence, or any other suitable DNA source. The desired template for in vitro transcription is one or more TRIM proteins or TRIM protein fragments.

[0129] In some embodiments, the DNA used in PCR contains an open reading frame. The DNA may be a native DNA sequence from the genome of an organism. In some embodiments, the DNA is the full length or a portion of the gene of interest. This gene may contain a portion or all of the 5' and / or 3' untranslated region (UTR). This gene may contain exons and introns. In some embodiments, the DNA used in PCR is a human gene. In another embodiment, the DNA used in PCR is a human gene containing the 5' and 3' UTRs. This DNA may, alternatively, be an artificial DNA sequence not normally expressed in a natural organism. An exemplary artificial DNA sequence contains portions of genes ligated together to form an open reading frame encoding a fusion protein. The portions of DNA ligated together may come from a single organism or from two or more organisms.

[0130] In some embodiments, the compositions of the present invention include modified nucleic acids encoding one or more TRIM proteins described herein. For example, in some embodiments, the composition includes nucleoside-modified RNA. In some embodiments, the composition includes nucleoside-modified mRNA. Nucleoside-modified mRNA has certain advantages over unmodified mRNA, including, for example, improved stability, lower immunogenicity, and improved translation efficiency. Nucleoside-modified mRNA useful for the present invention is further described in US Patent No. 8,278,036, which is incorporated herein by reference in its entirety.

[0131] modified cells The present invention includes a composition comprising cells comprising one or more TRIM proteins, nucleic acids encoding one or more TRIM proteins, or a combination thereof. In some embodiments, the cells are genetically modified to express the proteins and / or nucleic acids of the present invention. In certain embodiments, the genetically modified cells are self to the subject treated with the composition of the present invention. Alternatively, the cells may be homogeneous, syngeneic, or heterogeneous to the subject. In certain embodiments, the cells are capable of secreting or releasing the expressed proteins into the extracellular space to deliver the peptides to one or more other cells.

[0132] Genetically modified cells can be modified in vivo or ex vivo using standard techniques in the art. Genetic modification of cells can be performed using expression vectors or isolated naked nucleic acid constructs.

[0133] In some embodiments, the cells are obtained ex vivo and modified using isolated nucleic acids encoding one or more proteins described herein. In some embodiments, the cells are obtained from a subject, genetically modified to express proteins and / or nucleic acids, and then re-administered to the subject. In certain embodiments, the cells are grown ex vivo or in vitro to produce a cell population, where at least a portion of this population is administered to a subject in need.

[0134] In some embodiments, the cells are genetically modified to stably express the protein. In other embodiments, the cells are genetically modified to transiently express the protein.

[0135] Treatment method Furthermore, the present invention also provides methods for treating diseases or disorders related to protein misfolds, protein aggregates, or combinations thereof.

[0136] In some embodiments, the method involves administering a composition comprising one or more TRIM protein activators to a subject. In some embodiments, the subject has a disease or disorder related to protein misfolding or protein aggregates. In some embodiments, the subject has a disease and disorder related to amyloid-beta, alpha-synuclein, tau, prions, SOD1, TDP-43, FUS, p53, p53 mutants, or proteins related to polyglutamine repeats, such as huntingtin and ataxin, with misfolded proteins and / or protein aggregates.

[0137] In various embodiments, the diseases and disorders treatable by the method of the present invention include SCA1, SCA2, SCA3, SCA6, SCA7, SCA17, Huntington's disease, dentatorubral-pallidolar atrophy (DRPLA), Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), transmissible spongiform encephalopathy (prion disease), Lewy body dementia (DLB), multiple system atrophy (MSA), frontotemporal lobar degeneration (FTLD), AL amyloidosis, AA amyloidosis, familial Mediterranean fever, senile systemic amyloidosis, and familial polyneuropathy. Disorders, Icelandic hereditary cerebral amyloid angiopathy, hereditary cerebral hemorrhage with amyloidosis, pituitary prolactinoma, frontotemporal lobar degeneration (FTLD-tau), progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), argyrophilic granulopathy (AGD), frontotemporal dementia parkinsonism linked to chromosome 17 (FTDP-17), vacuolar tauopathy, Lytico-Bodig disease, glial tauopathy (GGT), age-related tau astrocyte disease (ARTAG), Pick's disease, primary age-related tauopathy (PART), neurofibrillary tauopathy Transcatheter dementia (TOD), chronic traumatic encephalopathy (CTE), anti-IgLON5-related tauopathy, Guadeloupe parkinsonism, nodding syndrome (NS), ganglioglioma, gangliocytoma, meningeal hemangioma, post-encephalitis parkinsonism, subacute sclerosing panencephalitis (SSPE), lead encephalopathy, tuberous sclerosis, pantothenate kinase-associated neurodegeneration, lipofuscinosis, Shy-Drager syndrome, striatonigral degeneration, olivopontocerebellar atrophy, Haller-Folden-Spats syndrome, REM sleep behavior disorder (RPD), Alzheimer's disease with restricted amygdala-bound Lewy bodies. This includes, but is not limited to, Mer's disease (AD / ALB), frontotemporal lobar degeneration (FTLD-TDP), multiple system proteinosis (MSP), Perry's disease, facial-onset sensorimotor neuropathy (FOSMN), cerebral age-related TDP-43 sclerosis (CARTS), limbic-dominant age-related TDP-43 encephalopathy (LATE), sporadic inclusion body myositis (sIBM), chronic traumatic encephalopathy (CTE), primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), Guam-island Parkinson's dementia complex (G-PDC), and Guam-island amyotrophic lateral sclerosis (G-ALS).

[0138] Those skilled in the art will understand, given this disclosure including the methods detailed herein, that the present invention is not limited to the treatment of established diseases associated with protein misfolds or protein aggregates. In particular, the disease or disorder does not need to have manifested to a stage that causes adverse effects on the subject, and in fact, it does not need to be detectable in the subject before the treatment is administered. That is, there does not need to be a significant sign or symptom of the disease or disorder before the present invention may provide a benefit. Accordingly, the present invention includes a method for preventing diseases or disorders associated with protein misfolds or protein aggregates, in that the disease or disorder can be prevented by administering an activator composition, as previously discussed elsewhere herein, to a subject before the onset of the disease or disorder.

[0139] Those skilled in the art will understand, given the disclosures herein, that the prevention of diseases associated with protein misfolds or protein aggregates includes administering activators to the target as a preventive measure against the onset or progression of diseases associated with protein misfolds or protein aggregates. As discussed more fully elsewhere herein, methods for improving the level or activity of a gene or gene product include not only improving the level and activity of polypeptide gene products, but also a broad range of techniques for increasing the expression of nucleic acids, including transcription, translation, or both.

[0140] Furthermore, as disclosed elsewhere in this specification, those skilled in the art will understand, given the teachings provided herein, that the present invention encompasses methods for treating or preventing a wide range of diseases associated with protein misfolds or protein aggregates, by modulating the level or activity of a gene or gene product. Various methods for assessing whether a disease is associated with protein misfolds or protein aggregates are known in the art. Furthermore, the present invention encompasses the treatment or prevention of such diseases that may be discovered in the future.

[0141] In one embodiment, the method includes the use of one or more TRIM proteins to stabilize the misfolded protein. In certain embodiments, functional stabilization of the misfolded protein with one or more TRIM proteins described herein can treat or prevent diseases or disorders associated with the misfolded protein.

[0142] In another embodiment, the method includes the use of one or more TRIM proteins to reduce the level of protein aggregates. In some embodiments, the level of protein aggregates is reduced by degrading the protein aggregates. In some embodiments, at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, or about 90% of the protein aggregates are degraded relative to the level of protein aggregates before administration of the composition. In some embodiments, the method is effective in reducing the level of protein aggregates by about 10% to about 90%. In some embodiments, the method is effective in reducing the level of protein aggregates by about 30% to about 90%. In some embodiments, the method is effective in reducing the level of protein aggregates by about 50% to about 90%. In some embodiments, the method is effective in reducing the level of protein aggregates by about 10%, about 15%, about 20%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%.

[0143] In some embodiments, the method reduces the level of protein aggregates by solubilizing them. In some embodiments, the ratio of insoluble protein to soluble protein is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%. In some embodiments, the method is effective in reducing the ratio of insoluble protein to soluble protein by about 10% to about 90%. In some embodiments, the method is effective in reducing the ratio of insoluble protein to soluble protein by about 30% to about 90%. In some embodiments, the method is effective in reducing the ratio of insoluble protein to soluble protein by about 50% to about 90%. In some embodiments, the method is effective in reducing the ratio of insoluble protein to soluble protein by about 10%, about 15%, about 20%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%.

[0144] In some embodiments, the level of protein aggregates is reduced after at least about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, or about 2 weeks. In some embodiments, the method is effective for reducing the level of protein aggregates over a longer period of time. In some embodiments, the level of protein aggregates is reduced after at least about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, or about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 26 weeks, about 39 weeks, about 1 year, or about 2 years.

[0145] The present invention encompasses the administration of activators of genes or gene products. Those skilled in the art will understand, based on the disclosures provided herein, how to formulate a suitable activator composition and how to administer the composition to a target. The present invention is not limited to any particular administration method or treatment plan.

[0146] In some embodiments, the method includes administering an effective amount of a composition that enhances the expression or activity of one or more TRIM proteins to a subject in need of such enhancement.

[0147] For example, in some embodiments, the method includes administering an effective amount of a composition that enhances the expression or activity of one or more TRIM proteins to a subject in need of such enhancement.

[0148] In a particular embodiment, the TRIM proteins are human TRIM1, TRIM2, TRIM3, TRIM4, TRIM5, TRIM6, TRIM7, TRIM8, TRIM9, TRIM10, TRIM11, TRIM13, TRIM14, TRIM15, TRIM16, TRIM17, TRIM18, TRIM19, TRIM20, TRIM21, TRIM22, TRIM23, TRIM24, TRIM25, TRIM26, TRIM27, TRIM28, TRIM29, TRIM31, TRIM32, TRIM33, TRIM34, TRIM35, TRIM36, TRIM37, TRIM38, TRIM39, TRIM40 It is one or more selected from the group consisting of TRIM41, TRIM42, TRIM43, TRIM44, TRIM45, TRIM46, TRIM47, TRIM48, TRIM49, TRIM50, TRIM51, TRIM52, TRIM54, TRIM55, TRIM56, TRIM58, TRIM59, TRIM60, TRIM61, TRIM62, TRIM63, TRIM64, TRIM65, TRIM66, TRIM67, TRIM68, TRIM69, TRIM70, TRIM71, TRIM72, TRIM73, TRIM74, TRIM76 and TRIM77, as well as mouse TRIM12 and TRIM30. In some embodiments, the TRIM protein is one or more selected from the group consisting of human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM21, TRIM24, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM37, TRIM46, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, and TRIM70, as well as mouse TRIM12 and TRIM30. In some embodiments, the TRIM protein is one or more selected from the group consisting of human TRIM10, TRIM11, TRIM24, TRIM36, TRIM37, TRIM40, TRIM49, TRIM55, TRIM58, and TRIM68.In some embodiments, the TRIM protein is one or more selected from the group consisting of human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM12, TRIM17, TRIM18, TRIM19, TRIM21, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, and TRIM70. In some embodiments, the TRIM protein is one or more selected from the group consisting of human TRIM10, TRIM11, and TRIM55. In some embodiments, the TRIM protein is one or more selected from the group consisting of human TRIM2, TRIM3, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM26, TRIM29, TRIM30, TRIM31, TRIM36, TRIM41, TRIM42, TRIM43, TRIM46, TRIM49, TRIM55, TRIM56, TRIM63, TRIM64, TRIM68, TRIM69, TRIM70, TRIM71, and TRIM73. In some embodiments, the TRIM protein is one or more selected from the group consisting of human TRIM10, TRIM11, TRIM36, TRIM55, and TRIM68. In some embodiments, the TRIM protein is one or more selected from the group consisting of human TRIM10, TRIM11, TRIM24, TRIM36, and TRIM58. In some embodiments, the TRIM protein is one or more selected from the group consisting of human TRIM10, TRIM11, TRIM17, TRIM36, TRIM37, TRIM40, TRIM49, and TRIM55. In some embodiments, the TRIM protein is human TRIM10. In some embodiments, the TRIM protein is human TRIM11.

[0149] Methods using TRIM proteins, nucleic acids encoding TRIM proteins, and combinations thereof for preventing or treating protein misfolding and aggregation are disclosed in WO 2016 / 196328. That publication is incorporated herein by reference in its entirety.

[0150] In some embodiments, the method includes improving the expression or activity of one or more TRIM proteins in at least one neuronal cell of interest. For example, in certain embodiments, the method includes improving the expression or activity of one or more TRIM proteins in at least one neuron, glial cell, astrocyte, oligodendrocyte, Purkinje cell, pyramidal cell, etc.

[0151] In some embodiments, the method involves contacting the target nerve tissue with a composition that enhances the expression or activity of one or more components of one or more TRIM proteins in an effective amount. For example, in certain embodiments, the method involves contacting the target neurons, glial cells, astrocytes, oligodendrocytes, Purkinje cells, pyramidal cells, etc., with a composition that enhances the expression or activity of one or more TRIM proteins in an effective amount. In some embodiments, nerve cells are affected by protein misfolds, protein aggregates, or a combination thereof.

[0152] Those skilled in the art will understand that the activators of the present invention can be administered alone or in any combination. Furthermore, the activators of the present invention can be administered alone or in any combination, in terms of timing, meaning they can be administered simultaneously or sequentially. Those skilled in the art will understand, based on the disclosures provided herein, that the activator compositions of the present invention can be used to prevent or treat diseases or disorders associated with misfolded proteins or protein aggregates, and that preventive or therapeutic results can be obtained by using the activator compositions alone or in any combination with other activators.

[0153] In various embodiments, any of the activators of the present invention described herein may be administered alone or in combination with other activators of other molecules associated with diseases related to protein misfolding or protein aggregates. In various embodiments, any of the activators of the present invention described herein may be administered alone or in combination with other therapeutic or prophylactic agents that can be used to treat or prevent diseases related to protein misfolding or protein aggregates. Exemplary therapeutic agents that can be used in combination with the activators of the present invention include, but are not limited to, anti-amyloid-beta antibodies and anti-tau antibodies.

[0154] gene therapy By contacting cells in a target area with a nucleic acid composition encoding a protein that enhances the expression or activity of one or more TRIM proteins, the onset of one or more symptoms of a disease or disorder associated with protein misfolding or protein aggregates can be inhibited or delayed.

[0155] In some embodiments, the nucleic acid composition of the present invention encodes one or more peptides. For example, in some embodiments, the nucleic acid composition can encode a peptide containing the amino acid sequences of one or more TRIM proteins. In some embodiments, the nucleic acid composition encodes human TRIM1, TRIM2, TRIM3, TRIM4, TRIM5, TRIM6, TRIM7, TRIM8, TRIM9, TRIM10, TRIM11, TRIM13, TRIM14, TRIM15, TRIM16, TRIM17, TRIM18, TRIM19, TRIM20, TRIM21, TRIM22, TRIM23, TRIM24, TRIM25, TRIM26, TRIM27, TRIM28, TRIM29, TRIM30, TRIM31, TRIM32, TRIM33, TRIM34, TRIM35, TRIM36, TRIM37, TRIM38, TRIM39, TRIM40, TRIM It encodes one or more TRIM proteins selected from the group consisting of 41, TRIM42, TRIM43, TRIM44, TRIM45, TRIM46, TRIM47, TRIM48, TRIM49, TRIM50, TRIM51, TRIM52, TRIM54, TRIM55, TRIM56, TRIM58, TRIM59, TRIM60, TRIM61, TRIM62, TRIM63, TRIM64, TRIM65, TRIM66, TRIM67, TRIM68, TRIM69, TRIM70, TRIM71, TRIM72, TRIM73, TRIM74, TRIM76, and TRIM77, as well as mouse TRIM12 and TRIM30. In some embodiments, the nucleic acid composition encodes one or more TRIM proteins selected from the group consisting of human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM21, TRIM24, TRIM26, TRIM29, TRIM31, TRIM34, TRIM36, TRIM37, TRIM46, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, and TRIM70, as well as mouse TRIM12 and TRIM30.In some embodiments, the nucleic acid composition encodes one or more TRIM proteins selected from the group consisting of human TRIM10, TRIM11, TRIM24, TRIM36, TRIM37, TRIM40, TRIM49, TRIM55, TRIM58, and TRIM68. In some embodiments, the nucleic acid composition encodes one or more TRIM proteins selected from the group consisting of human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM12, TRIM17, TRIM18, TRIM19, TRIM21, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, and TRIM70. In some embodiments, the nucleic acid composition encodes one or more TRIM proteins selected from the group consisting of human TRIM10, TRIM11, and TRIM55. In some embodiments, the nucleic acid composition encodes one or more TRIM proteins selected from the group consisting of human TRIM2, TRIM3, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM26, TRIM29, TRIM30, TRIM31, TRIM36, TRIM41, TRIM42, TRIM43, TRIM46, TRIM49, TRIM55, TRIM56, TRIM63, TRIM64, TRIM68, TRIM69, TRIM70, TRIM71, and TRIM73. In some embodiments, the nucleic acid composition encodes one or more TRIM proteins selected from the group consisting of human TRIM10, TRIM11, TRIM36, TRIM55, and TRIM68. In some embodiments, the nucleic acid composition encodes one or more TRIM proteins selected from the group consisting of human TRIM10, TRIM11, TRIM24, TRIM36, and TRIM58.In some embodiments, the nucleic acid composition encodes one or more TRIM proteins selected from the group consisting of human TRIM10, TRIM11, TRIM17, TRIM36, TRIM37, TRIM40, TRIM49, and TRIM55. In some embodiments, the nucleic acid composition encodes human TRIM10. In some embodiments, the nucleic acid composition encodes human TRIM11.

[0156] In some embodiments, the nucleic acid composition encoding one or more TRIM proteins comprises one or more sequences of one or more accession numbers listed in Table 1.

[0157] Furthermore, the present invention also provides a method for supplying proteins to cells having normal or mutant genes associated with reduced or insufficient activity of one or more TRIM proteins. By supplying proteins to cells having mutant genes, it should be possible to enable the recipient cells to function normally. A nucleic acid in a peptide-encoding vector can be introduced into a cell such that the nucleic acid remains outside the chromosome. In such a situation, the nucleic acid will be expressed by the cell from an extrachromosomal location. It is more preferable that the nucleic acid or a portion thereof is introduced into the cell in a manner such as being integrated into the cell's genome or being recombined with endogenous mutant genes present in the cell. Vectors for introducing and maintaining genes outside the chromosome by both recombination and integration are known in the art, and any suitable vector can be used. Methods for introducing DNA into cells, such as electroporation, calcium phosphate coprecipitation, and viral transduction, are known in the art, and the choice of method is within the discretion of the practitioner.

[0158] As generally discussed above, even in individuals whose wild-type genes are expressed at "normal" levels but whose gene products are insufficiently functional, nucleic acids can be used in gene therapy, where applicable, to improve the level or activity of the peptides of the present invention.

[0159] "Gene therapy" includes both conventional gene therapies that achieve a sustained effect with a single treatment and the administration of gene therapy agents that deliver therapeutically effective DNA or mRNA once or repeatedly. Oligonucleotides can be modified to improve their uptake, for example, by substituting a negatively charged phosphodiester group with an uncharged group. One or more TRIM proteins of the present invention can be delivered locally or systemically to, for example, nerve cells or tissues using gene therapy (for example, by a vector that selectively targets a particular tissue type, such as a tissue-specific adeno-associated virus vector). In some embodiments, primary cells taken from an individual can be transfected ex ivo with a nucleic acid encoding any of the peptides of the present invention, and then the transfected cells can be returned to the individual's body.

[0160] Gene therapy is well known in the art. See, for example, WO 96 / 07321, which discloses the use of gene therapy to generate intracellular antibodies. Gene therapy has also been successfully demonstrated in human patients. See, for example, Baumgartner et al., Circulation 97: 12, 1114-1123 (1998), Fatham, CG, "A gene therapy approach to treatment of autoimmune diseases," Immun. Res. 18:15-26 (2007), and US No. 7,378089. Both publications are incorporated herein by reference. See also Bainbridge JWB et al. "Effect of gene therapy on visual function in Leber's congenital Amaurosis". N Engl J Med 358:2231-2239, 2008 and Maguire AM et al. "Safety and efficacy of gene transfer for Leber's Congenital Amaurosis". N Engl J Med 358:2240-8, 2008.

[0161] There are two main approaches to introducing nucleic acids encoding peptides or proteins (sometimes contained in vectors) into a patient's cells: in vivo and ex vivo. For in vivo delivery, in certain situations, the nucleic acid is injected directly into the patient, and sometimes into the site where the protein is most needed. For ex vivo procedures, the patient's cells are collected, the nucleic acid is introduced into these isolated cells, and the modified cells are either administered directly to the patient or implanted into the patient, for example, encapsulated in a porous membrane (see, e.g., US Nos. 4,892,538 and 5,283,187). Various techniques exist for introducing nucleic acids into living cells. These techniques vary depending on whether the nucleic acid is introduced into cells cultured in vitro or into the cells of the intended host in vivo. Suitable techniques for introducing nucleic acids into mammalian cells in vitro include the use of liposomes, electroporation, microinjection, cell fusion, DEAE-dextran, and calcium phosphate precipitation. The vectors commonly used for ex vivo delivery of genes are retroviral vectors and lentiviral vectors.

[0162] Gene therapy will be carried out according to generally accepted methods, as described, for example, in Friedman et al., 1991, Cell 66:799-806 or Culver, 1996, Bone Marrow Transplant 3:S6-9; Culver, 1996, Mol. Med. Today 2:234-236. In some embodiments, cells from the patient will first be analyzed using diagnostic methods known in the art to confirm the expression or activity of one or more TRIM proteins. A viral or plasmid vector containing a copy of the gene or its functional equivalent, ligated to an expression regulatory element and capable of replicating in cells, is prepared. This vector may be capable of replicating in cells. Alternatively, the vector may be replication-deficient and replicated in helper cells for use in gene therapy. Suitable vectors are publicly known and disclosed, for example, in US No. 5,252,479, WO No. 93 / 07282, and US No. 5,691,198; US No. 5,747,469; US No. 5,436,146, and US No. 5,753,500. The vector is then injected into the patient. If the transfected gene is not permanently integrated into the genome of each target cell, the procedure may need to be repeated periodically.

[0163] Gene transfer systems known in the art may be useful in carrying out the gene therapy of the present invention. This includes viral and nonviral transfer methods. Numerous viruses have been used as gene transfer vectors or as the basis for repair gene transfer vectors. These viruses include papovavirus (e.g., SV40, Madzak et al., 1992, J. Gen. Virol. 73:1533-1536), adenovirus (Berkner, 1992; Curr. Topics Microbiol. Immunol. 158:39-66), vaccinia virus (Moss, 1992, Current Opin. Biotechnol. 3:518-522; Moss, 1996, PNAS 93:11341-11348), adeno-associated virus (Russell and Hirata, 1998, Mol. Genetics 18:325-330), herpesviruses including HSV and EBV (Fink et al., 1996, Ann. Rev. Neurosci. 19:265-287), and lentivirus (Naldini). This includes retroviruses from birds (Petropoulos et al., 1992, J. Virol. 66:3391-3397), Sindbis virus and Semryki Forest virus (Berglund et al., 1993, Biotechnol. 11:916-920), as well as retroviruses from birds (Petropoulos et al., 1992, J. Virol. 66:3391-3397), retroviruses from mice (Miller, 1992, Hum. Gene Ther. 3:619-624), and retroviruses from humans (Shimada et al., 1991; Helseth et al., 1990; Page et al., 1990; Buchschacher and Panganiban, 1992, J. Virol. 66:2731-2739). Most human gene therapy protocols are based on detoxified mouse retroviruses, but adenoviruses and adeno-associated viruses are also used.

[0164] Nonviral gene transfer methods known in the art include chemical techniques, e.g., calcium phosphate coprecipitation; mechanical techniques, e.g., microinjection; liposome-mediated membrane fusion transfer; and direct DNA uptake and receptor-mediated DNA transfer (Curiel et al., 1992, Am. J. Respir. Cell. Mol. Biol 6:247-252). Viral-mediated gene transfer can be combined with direct in vitro gene transfer using liposome delivery, thereby enabling the induction of viral vectors into tumor cells and not into surrounding non-dividing cells. Subsequently, injection of producing cells will provide a sustained source of vector particles. This technique has been approved for use in humans with inoperable brain tumors.

[0165] In a combined biological and physical gene delivery approach, plasmid DNA of arbitrary size is combined with a polylysine conjugate antibody specific to the adenovirus hexone protein, and the resulting complex is attached to an adenovirus vector. This trimolecular complex is then used to infect cells. The adenovirus vector enables efficient binding, internal translocation, and degradation of endosomes before the bound DNA is damaged. For other techniques for adenovirus-based vector delivery, see US Nos. 5,691,198; 5,747,469; 5,436,146 and 5,753,500.

[0166] Liposome / DNA complexes have been shown to be capable of mediating direct gene transfer in vivo. While the gene transfer process is nonspecific with standard liposome preparations, localized in vivo uptake and expression in tumor lesions have been reported, for example, after direct in situ administration.

[0167] In the context of gene therapy, an expression vector means a construct containing a sequence sufficient to express the polynucleotide cloned therein. In a viral expression vector, this construct contains a viral sequence sufficient to support the packaging of the construct. If the polynucleotide encodes a protein, expression will produce that protein. If the polynucleotide encodes an antisense polynucleotide or ribozyme, expression will produce an antisense polynucleotide or ribozyme. Therefore, in this context, expression does not require the synthesis of a protein product. In addition to the polynucleotide cloned in the expression vector, the vector also contains a promoter that functions in eukaryotic cells. The cloned polynucleotide sequence is under the control of this promoter. Appropriate eukaryotic promoters include those described above. The expression vector may also contain sequences such as selection markers and other sequences described herein.

[0168] In certain embodiments, the method involves the use of gene transfer techniques that directly target isolated nucleic acids to nerve tissue. Receptor-mediated gene transfer is achieved, for example, by conjugation of nucleic acid molecules (usually in the form of covalently closed supercoil plasmids) to protein ligands via polylysine. The ligands are selected based on the presence of corresponding ligand receptors on the cell surface of the target cell / tissue type. These ligand-DNA conjugates can, if necessary, be injected directly into the bloodstream and directed towards the target tissue where receptor binding and internal migration of the DNA-protein complex occur. To overcome the problem of DNA disruption within cells, co-infection with adenoviruses that disrupt endosomal function can be included.

[0169] Therefore, the therapeutic and preventive methods of the present invention encompass the use of pharmaceutical compositions comprising the activators or combinations thereof described herein in order to carry out the methods of the present invention. Pharmaceutical compositions useful for carrying out the present invention can be administered to be delivered in doses of ng / kg / day to 100 mg / kg / day. In some embodiments, the present invention envisions the administration of doses in which the concentration of the compound of the present invention is 1 μM to 10 μM in mammals.

[0170] Typically, the dose that can be administered to mammals, preferably humans, in the method of the present invention ranges from 0.5 μg to about 50 mg per kilogram of body weight of the mammal, however, the exact dose administered will vary depending on many arbitrary factors, including (but not limited to) the type of mammal being treated, the type of disease condition, the age of the mammal, and the route of administration. Preferably, the dose of the compound will vary from about 1 μg to about 10 mg per kilogram of body weight of the mammal. More preferably, the dose will vary from about 3 μg to about 1 mg per kilogram of body weight of the mammal.

[0171] The compound can be administered to mammals several times a day, or at a less frequent frequency, for example, once a day, once a week, once every two weeks, once a month, or even less frequently, for example, once every few months or once a year or less. The frequency of administration will be readily apparent to those skilled in the art and will depend on a number of factors, such as the type and severity of the disease being treated, the type and age of the mammal, etc. (but not limited to these).

[0172] In some embodiments, the present invention includes a method comprising administering a combination of activators described herein. In certain embodiments, the method has an additive effect, where the overall effect of administering the combination of activators is approximately equal to the sum of the effects of administering each individual activator. In other embodiments, the method has a synergistic effect, where the overall effect of administering the combination of activators is greater than the sum of the effects of administering each individual activator.

[0173] The method involves administering a combination of activators in any appropriate ratio. For example, in some embodiments, the method involves administering two individual activators in a 1:1 ratio. In other embodiments, the method involves administering three individual activators in a 1:1:1 ratio. However, the method is not limited in any particular ratio; rather, any ratio that has been shown to be effective is included.

[0174] The disclosed nucleic acids can be administered in combination with a carrier or lipid to increase intracellular uptake. For example, oligonucleotides can be administered in combination with cationic lipids. Examples of cationic lipids include, but are not limited to, lipofectin, DOTMA, DOPE, and DOTAP. Publication WO 0071096 is specifically incorporated by reference and describes various formulations that can be effectively used in gene therapy, such as DOTAP: cholesterol or cholesterol derivative formulations. Other disclosures also explore various lipid or liposomal formulations and methods of administration, including nanoparticles. These include, but are not limited to, US 20030203865, 20020150626, 20030032615, and 20040048787. These publications are specifically incorporated by reference to the extent that they disclose formulations of nucleic acids and other relevant aspects of the administration and delivery of nucleic acids. Furthermore, methods used to form particles are disclosed in US Patents Nos. 5,844,107, 5,877,302, 6,008,336, 6,077,835, 5,972,901, 6,200,801 and 5,972,900, which are incorporated by reference with respect to these embodiments.

[0175] Furthermore, nucleic acids can be administered in combination with cationic amines, such as poly(L-lysine). Nucleic acids can also be conjugated to chemical moieties, such as transferrin and cholesteryl. In addition, oligonucleotides can be targeted to specific organelles by linking specific chemical groups to them.

[0176] Expression vectors can be delivered to target cells for the treatment or prevention of disease or disorder. Nucleic acid molecules are delivered to target cells in a form that allows them to be taken up and expressed advantageously so that therapeutically effective levels can be achieved.

[0177] The methods for delivering nucleic acid molecules to cells according to this disclosure include using delivery systems, such as liposomes, polymers, microspheres, gene therapy vectors, and naked DNA vectors.

[0178] The term “vector” is used to refer to a carrier nucleic acid molecule that can be inserted into a cell capable of replicating a nucleic acid sequence in order to introduce that sequence. A nucleic acid sequence may be “exogenous,” meaning that it is foreign to the cell into which the vector is introduced, or that the sequence is homologous to an intracellular sequence, but its nucleic acid sequence is located in a position not normally found within the host cell nucleic acid. Vectors include plasmids, cosmids, viruses (bacteriophages, animal viruses, and plant viruses), and artificial chromosomes (e.g., BACs and YACs). Those skilled in the art will have sufficient ability to construct vectors using standard recombinant techniques. These techniques are described in Sambrook et al., 2012 and Ausubel et al., 2003. Both of these publications are incorporated herein by reference. Transduction virus (e.g., retroviruses, adenoviruses, lentiviruses, and adeno-associated viruses) vectors can be used in somatic gene therapy. This is particularly due to its high infection efficiency and stable integration and expression (see, for example, Cayouette et al., Human Gene Therapy 8:423-430, 1997; Kido et al, Current Eye Research 15:833-844, 1996; Bloomer et al, Journal of Virology 71:6641-6649, 1997; Naldini et al, Science 272:263-267, 1996 and Miyoshi et al, Proc. Natl. Acad. Sci. USA 94: 10319, 1997). For example, the nucleotide sequence can be cloned into a retroviral vector, and expression can be driven by its endogenous promoter, the long terminal repeat of the retrovirus, or a promoter specific to the target cell type.Other viral vectors that can be used include, for example, vaccinia virus, bovine papillomavirus, or herpesvirus, such as Epstein-Barr virus (e.g., the vectors of Miller, Human Gene Therapy 15-14, 1990; Friedman, Science 244: 1275-1281, 1989; Eglitis et al, BioTechniques 6:608-614, 1988; Tolstoshev et al, Current Opinion in Biotechnology 1:55-61, 1990; Sharp, The Lancet 337: 1277-1278, 1991; Cornetta et al, Nucleic Acid Research and Molecular Biology 36:31 1-322, 1987; Anderson, Science 226:401-409, 1984; Moen, Blood Cells) (See also 17:407-416, 1991; Miller et al, Biotechnology 7:980-990, 1989; Le Gal La Salle et al, Science 259:988-990, 1993 and Johnson, Chest 107:77S-83S, 1995). Retroviral vectors, in particular, are well-developed and used in clinical practice (Rosenberg et al, N. Engl. J. Med 323:370, 1990; Anderson et al, US No. 5,399,346).

[0179] Other methods suitable for nucleic acid delivery that result in the expression of the compositions of this disclosure are considered to substantially include any methods described herein or known to those skilled in the art that can introduce nucleic acids (e.g., DNA including viral and nonviral vectors) into organelles, cells, tissues or organisms.

[0180] The administration of nucleic acid or peptide inhibitors of the present invention can be achieved using gene therapy. Gene therapy is based on inserting therapeutic genes into cells using ex vivo or in vivo techniques. Vectors and methods suitable for in vitro or in vivo gene therapy have been reported and are known to those skilled in the art. For example, see Giordano, Nature Medicine 2 (1996), 534-539; Schaper, Circ. Res 79 (1996), 911-919; Anderson, Science 256 (1992), 808-813; Isner, Lancet 348 (1996), 370-374; Muhlhauser, Circ. Res 77 (1995), 1077-1086; Wang, Nature Medicine 2 (1996), 714-716; WO No. 94 / 29469; WO No. 97 / 00957 or Schaper, Current Opinion in Biotechnology 7 (1996), 635-640 and the references cited therein. The polynucleotides encoding the polypeptides of the present invention may be designed for direct insertion into cells or for insertion via liposomes or viral vectors (e.g., adenovirus vectors or retrovirus vectors). Preferably, the cells are germline cells, embryonic cells, or egg cells, or cells derived therefrom, and more preferably, the cells are core cells. Suitable gene distribution systems that can be used according to the present invention may include liposomes, receptor-mediated distribution systems, naked DNs, and viral vectors, such as herpesviruses, retroviruses, adenoviruses, and adeno-associated viruses. Distribution of nucleic acids to specific sites in the body for gene therapy can also be achieved, for example, by using the gene gun distribution system described by Williams (Proc. Natl. Acad. Sci. USA, 88 (1991), 2726-2729).Standard methods for transfecting cells with recombinant DNA are well known to those skilled in the art of molecular biology; see, for example, WO 94 / 29469. See also the above. Gene therapy can be performed by directly administering the recombinant DNA molecule or vector of the present invention to a patient, or by ex vivo transfecting cells with the polynucleotide or vector of the present invention and administering the transfected cells to the patient.

[0181] Furthermore, gene transfer can also be achieved using nonviral means involving in vitro transfection. Such methods include the use of calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Liposomes may also be beneficial for delivering DNA into cells. Expression for use in polynucleotide therapeutic methods can be induced by any suitable promoter (e.g., human cytomegalovirus (CMV), monkey virus 40 (SV40), or metallothionein promoter) and regulated by any suitable mammalian regulatory element. For example, nucleic acid expression can be induced using enhancers known to preferentially induce gene expression in specific cell types, as needed. Enhancers used may include, but are not limited to, those characterized as tissue-specific or cell-specific enhancers. For any particular subject, a specific dosing plan should be adjusted over time according to the individual needs and the professional judgment of the person administering or supervising the administration of the composition.

[0182] Pharmaceutical compositions and preparations Furthermore, the present invention also encompasses the use of a pharmaceutical composition or salt thereof of the present invention for carrying out the method of the present invention. Such a pharmaceutical composition may consist of at least one activator composition or salt thereof of the present invention in a form suitable for administration to a subject, or the pharmaceutical composition may include at least one activator composition or salt thereof of the present invention, one or more pharmaceutically acceptable carriers, one or more additional components, or several combinations thereof. The compounds or conjugates of the present invention may be present in the pharmaceutical composition in the form of a physiologically acceptable salt, for example, in combination with a physiologically acceptable cation or anion, as is well known in the art.

[0183] In some embodiments, a pharmaceutical composition useful for carrying out the method of the present invention can be administered to deliver a dose between 1 ng / kg / day and 100 mg / kg / day. In other embodiments, a pharmaceutical composition useful for carrying out the present invention can be administered to deliver a dose between 1 ng / kg / day and 500 mg / kg / day.

[0184] The relative amounts of the active ingredient, pharmaceutically acceptable carrier, and optional additional components in the pharmaceutical composition of the present invention will vary depending on their identity, size, and the condition of the target being treated, as well as the route through which the composition is administered. For example, the composition may contain 0.1% to 100% (w / w) of the active ingredient.

[0185] Pharmaceutical compositions useful for the methods of the present invention can be appropriately developed for oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, buccal, ophthalmic, or other routes of administration. Compositions useful for the methods of the present invention can be directly administered to the skin, vagina, or any other tissue of mammals. Other conceivable formulations include liposomal preparations, resealed red blood cells containing active ingredients, and immunological-based formulations. The route of administration will be readily apparent to those skilled in the art and will depend on any number of factors, including the type and severity of the disease being treated, the type and age of the animal or human subject being treated, and so on.

[0186] Formulations of the pharmaceutical compositions described herein can be prepared by any method known or to be developed in the field of pharmacology. Generally, such preparation methods include the steps of associating the active ingredient with a carrier or one or more other auxiliary components, and then, if necessary or desirable, forming or packaging the product into desired single-dose units or multi-dose units.

[0187] As used herein, “unit dose” refers to a specific amount of a pharmaceutical composition containing a predetermined amount of active ingredient. The amount of active ingredient is generally equal to the dose of active ingredient that would be administered to the subject, or a convenient fraction of such a dose, for example, half or one-third of such a dose. The unit dose form may be for once-daily administration or multiple-daily administration (e.g., about 1 to 4 times or more per day). When multiple-daily administration is used, the unit dose form may be the same or different for each administration.

[0188] The descriptions of pharmaceutical compositions provided herein primarily concern pharmaceutical compositions suitable for ethical administration to humans; however, those skilled in the art will understand that such compositions are generally suitable for administration to all types of animals. Modifications to make pharmaceutical compositions suitable for administration to humans suitable for administration to various animals are well understood, and a veterinary pharmacologist of ordinary skill can design and perform such modifications as needed, through ordinary trial and error. The intended recipients of the pharmaceutical compositions of the present invention include, but are not limited to, humans and other primates, and mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, and dogs.

[0189] In some embodiments, the compositions of the present invention are formulated using one or more pharmaceutically acceptable excipients or carriers. In some embodiments, the pharmaceutical compositions of the present invention comprise a therapeutically effective amount of the compound or conjugate of the present invention and a pharmaceutically acceptable carrier. Useful pharmaceutically acceptable carriers include, but are not limited to, glycerol, water, saline, ethanol, and other pharmaceutically acceptable salt solutions, such as phosphates and organic salts. Examples of these and other pharmaceutically acceptable carriers are described in Remington's Pharmaceutical Sciences (1991, Mack Publication Co., New Jersey).

[0190] The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils. Appropriate fluidity can be maintained, for example, by coating, e.g., the use of lecithin, and in the case of dispersions, by maintaining the required particle size and by the use of surfactants. Prevention of microbial activity can be achieved by various antimicrobial and antifungal agents, e.g., parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In many cases, it would be preferable to include isotonic agents, e.g., sugars, sodium chloride, or polyhydric alcohols, e.g., mannitol and sorbitol, in the composition. Sustained absorption of the injectable composition can be achieved by including absorption-delaying agents, e.g., aluminum monostearate or gelatin, in the composition. In some embodiments, the pharmaceutically acceptable carrier is not DMSO alone.

[0191] The formulation can be used in mixtures with conventional excipients, i.e., pharmaceutically acceptable organic or inorganic carrier substances suitable for oral, vaginal, parenteral, nasal, intravenous, subcutaneous, enteral, or any other suitable method of administration known in the art. The pharmaceutical preparation may be sterile and, if necessary, may be mixed with adjuvants, such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts affecting osmotic pressure, buffers, colorants, flavorings, and / or aromatic substances. It may also be mixed with other activators, such as other analgesics, if necessary.

[0192] As used herein, “additional components” include, but are not limited to, one or more of the following: excipients; surfactants; dispersants; inert diluents; granulators and disintegrants; binders; lubricants; sweeteners; flavorings; colorants; preservatives; physiologically degradable compositions, e.g., gelatin; aqueous media and solvents; oily media and solvents; suspending agents; dispersants or wetting agents; emulsifiers, lubricants; buffers; salts; thickeners; fillers; emulsifiers; antioxidants; antibiotics; antifungal agents; stabilizers; and pharmaceutically acceptable polymers or hydrophobic materials. Other “additional components” that may be included in the pharmaceutical compositions of the present invention are well known in the art and are described, for example, in Genaro, ed. (1985, Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA). That document is incorporated herein by reference.

[0193] The compositions of the present invention may contain about 0.005% to 2.0% of a preservative based on the total weight of the composition. The preservative is used to prevent deterioration when exposed to contaminants in the environment. Examples of preservatives useful in the present invention include, but are not limited to, those selected from the group consisting of benzyl alcohol, sorbic acid, parabens, imidourea, and combinations thereof. Particularly preferred preservatives are combinations of about 0.5% to 2.0% benzyl alcohol and 0.05% to 0.5% sorbic acid.

[0194] The composition preferably contains antioxidants and chelating agents that inhibit the degradation of the compound. Preferred antioxidants for some compounds are BHT, BHA, alpha-tocopherol, and ascorbic acid, with a preferred range of about 0.01% to 0.3%, more preferably 0.03% to 0.1% by weight of BHT, relative to the total weight of the composition. Preferably, the chelating agent is present in an amount of 0.01% to 0.5% by weight, relative to the total weight of the composition. Particularly preferred chelating agents include EDTA salts (e.g., disodium EDTA) and citric acid, with a weight range of about 0.01% to 0.20%, more preferably 0.02% to 0.10% by weight, relative to the total weight of the composition. The chelating agent is useful for chelating metal ions in the composition that may adversely affect the shelf life of the formulation. BHT and disodium edetate are particularly preferred antioxidants and chelating agents for certain compounds, respectively, but as will be known to those skilled in the art, they can be substituted with other suitable and equivalent antioxidants and chelating agents.

[0195] Liquid suspensions can be prepared using conventional methods for suspending active ingredients in aqueous or oily media. Aqueous media include, for example, water and isotonic saline. Oily media include, for example, almond oil, oily esters, ethyl alcohol, vegetable oils such as peanut oil, olive oil, sesame oil or coconut oil, fractionated vegetable oils and mineral oils, such as liquid paraffin. Liquid suspensions may further contain one or more additional components, including (but not limited to) suspending agents, dispersants or wetting agents, emulsifiers, lubricants, preservatives, buffers, salts, flavorings, colorings and sweeteners. Oily suspensions may further contain thickeners. Known suspending agents include, but are not limited to, sorbitol syrup, hydrogenated edible oils and fats, sodium alginate, polyvinylpyrrolidone, tragacanth gum, acacia gum and cellulose derivatives such as sodium carboxymethylcellulose, methylcellulose and hydroxypropylmethylcellulose. Known dispersants or wetting agents include, but are not limited to, natural phospholipids, such as lecithin, alkylene oxides and fatty acids, long-chain aliphatic alcohols, partial esters obtained from fatty acids and hexitol, or condensation products of partial esters obtained from fatty acids and hexitol anhydrides (e.g., polyoxyethylene stearate, heptadecaethyleneoxycetanol, polyoxyethylene sorbitol monooleate, and polyoxyethylene sorbitan monooleate, respectively). Known emulsifiers include, but are not limited to, lecithin and acacia. Known preservatives include, but are not limited to, methyl, ethyl, or n-propyl-p-hydroxybenzoate, ascorbic acid, and sorbic acid. Known sweeteners include, for example, glycerol, propylene glycol, sorbitol, sucrose, and saccharin. Known thickeners for oily suspensions include, for example, beeswax, hard paraffin, and cetyl alcohol.

[0196] Liquid formulations of active ingredients in aqueous or oily solvents can be prepared in substantially the same manner as liquid suspensions, the main difference being that the active ingredient is dissolved rather than suspended in the solvent. As used herein, "oily" liquids contain carbon-containing liquid molecules and exhibit lower polarity than water. Liquid formulations of the pharmaceutical compositions of the present invention may contain the components described with respect to liquid suspensions, and it is understood that the suspending agent will not necessarily facilitate the dissolution of the active ingredient in the solvent. Aqueous solvents include, for example, water and isotonic saline. Oily media include, for example, almond oil, oily esters, ethyl alcohol, vegetable oils such as peanut oil, olive oil, sesame oil, or coconut oil, fractionated vegetable oils, and mineral oils such as liquid paraffin.

[0197] Powder and granular formulations of the pharmaceutical preparations of the present invention can be prepared using known methods. Such formulations can be administered directly to a target, and can be used, for example, to form tablets, fill capsules, or prepare aqueous or oily suspensions or liquids by adding an aqueous or oily medium thereto. Each of these formulations may further contain one or more of the following: dispersants or wetting agents, suspending agents, and preservatives. Additional excipients, such as fillers and sweeteners, flavorings, or colorings, may also be included in these formulations.

[0198] Furthermore, the pharmaceutical compositions of the present invention may be prepared, packaged, or sold in the form of water-in-oil emulsions or oil-in-water emulsions. The oil phase may be a vegetable oil, such as olive oil or peanut oil, a mineral oil, such as liquid paraffin, or a combination thereof. Such compositions may further contain one or more emulsifiers, such as natural gums, such as acacia gum or tragacanth gum, natural phospholipids, such as soy lecithin or lecithin phospholipids, esters or partial esters obtained from a combination of fatty acids and hexitol anhydride, such as sorbitan monooleate, and condensation products of such partial esters with ethylene oxide, such as polyoxyethylene sorbitan monooleate. These emulsions may also contain additional components, such as sweeteners or flavorings.

[0199] Methods for impregnating or coating materials with chemical compositions are known in the art and include, but are not limited to, methods for depositing or bonding chemical compositions to a surface, methods for incorporating chemical compositions onto the surface of a material (i.e., a physiologically degradable material) during the synthesis of a material, and methods for absorbing aqueous or oily solutions or suspensions into an absorbent material (with or without subsequent drying).

[0200] The administration plan may affect the composition of the effective dose. The therapeutic formulation can be administered to the patient either before or after the diagnosis of the disease. Furthermore, divided doses and stepped doses can be administered daily or sequentially, or these doses can be administered by continuous infusion or bolus injection. In addition, the dose of the therapeutic formulation can be increased or decreased proportionally depending on the urgency of the therapeutic or prophylactic situation.

[0201] The compositions of the present invention can be administered to subjects, preferably mammals, and more preferably humans, using known methods in doses and for durations effective in preventing or treating a disease. The effective amount of the therapeutic compound required to achieve a therapeutic effect may vary depending on factors such as the activity of the specific compound used; the timing of administration; the rate of excretion of the compound; the duration of treatment; other drugs, compounds, or substances used in combination with the compound; the state of the disease or disorder, the age, sex, weight, condition, overall health, and medical history of the subject being treated, and similar factors well known in the medical field. The administration plan can be adjusted to provide an optimal therapeutic response. For example, it can be administered in divided doses daily, or the dose can be proportionally reduced depending on the urgency of the treatment situation. A non-limiting example of the effective dose range of the therapeutic compound of the present invention is 1 to 5,000 mg per kg of body weight per day. Those skilled in the art will be able to study the relevant factors and make a determination regarding the effective amount of the therapeutic compound without excessive trial and error.

[0202] The compound may be administered several times a day, or at a low frequency, for example, once a day, once a week, once every two weeks, once a month, or even less frequently, for example, once every few months or once a year or less. In non-limiting examples, it is understood that the amount of the compound administered per day may be daily, every other day, every two days, every three days, every four days, or every five days. For example, in the case of every-other-day administration, a dose of 5 mg per day may be started on Monday, the next dose of 5 mg per day may be administered on Wednesday, and the following dose of 5 mg per day may be administered on Friday. The frequency of administration will be easily understood by those skilled in the art and will depend on any number of factors, such as the type and severity of the disease being treated, the type and age of the animal, etc. (but not limited to these).

[0203] The actual dose level of the active ingredient in the pharmaceutical composition of the present invention can be varied to obtain an amount of the active ingredient that is effective in achieving a desired therapeutic response for a specific subject, composition, and administration method, without causing toxicity to the subject.

[0204] A physician with ordinary skills in the art, such as an internist or veterinarian, can easily determine and prescribe the effective amount of the required pharmaceutical composition. For example, an internist or veterinarian can start the dose of the compound of the present invention used in the pharmaceutical composition at a level lower than the amount required to achieve the desired therapeutic effect, and gradually increase the dose until the desired effect is achieved.

[0205] In certain embodiments, it is particularly advantageous to formulate the compound into dosage units for ease of administration and dose uniformity. As used herein, a dosage unit refers to a physically separated unit suitable for single administration to the subject being treated, each unit containing a predetermined amount of the therapeutic compound calculated to produce the desired therapeutic effect in combination with the required pharmaceutical medium. The dosage unit of the present invention is determined and directly determined by (a) the inherent properties of the therapeutic compound and the specific therapeutic effect to be achieved, and (b) the constraints inherent in the field of compounding / formulating such therapeutic compounds for disease treatment in the subject.

[0206] In some embodiments, the compositions of the present invention are administered to subjects in a dosage range of once to five times or more per day. In other embodiments, the compositions of the present invention are administered to subjects in a dosage range including (but not limited to) once per day, every two days, every three days, once a week, and once every two weeks. Those skilled in the art will readily understand that the dosage frequency of the various combination compositions of the present invention will vary from subject to subject depending on many factors, including (but not limited to) age, the disease or disorder being treated, sex, and general condition, as well as other factors. For this reason, the present invention should not be construed as being limited to any particular dosage schedule, and the exact dose and composition to be administered to any subject will be determined by the attending physician, taking into account all other factors relating to the subject.

[0207] The compounds of the present invention for administration are available in doses of approximately 1 mg to 10,000 mg, 20 mg to 9,500 mg, 40 mg to 9,000 mg, 75 mg to 8,500 mg, 150 mg to 7,500 mg, 200 mg to 7,000 mg, 3,050 mg to 6,000 mg, 500 mg to 5,000 mg, 750 mg to 4,000 mg, and 1 mg to 3,000 mg. g may be in the range of approximately 10 mg to 2,500 mg, approximately 20 mg to 2,000 mg, approximately 25 mg to 1,500 mg, approximately 50 mg to 1,000 mg, approximately 75 mg to 900 mg, approximately 100 mg to 800 mg, approximately 250 mg to 750 mg, approximately 300 mg to 600 mg, approximately 400 mg to 500 mg, or any and all of these increments, either whole or partial.

[0208] In some embodiments, the dose of the compound of the present invention is about 1 mg to about 2,500 mg. In some embodiments, the dose of the compound of the present invention used in the compositions described herein is less than about 10,000 mg, or less than about 8,000 mg, or less than about 6,000 mg, or less than about 5,000 mg, or less than about 3,000 mg, or less than about 2,000 mg, or less than about 1,000 mg, or less than about 5,000 mg, or less than about 200 mg, or less than about 50 mg. Similarly, in some embodiments, the dose of the second compound described herein (i.e., the agent used to treat the same or a different disease treated by the composition of the present invention) is less than about 1,000 mg, less than about 800 mg, less than about 600 mg, less than about 500 mg, less than about 400 mg, less than about 300 mg, less than about 200 mg, less than about 100 mg, less than about 50 mg, less than about 40 mg, less than about 30 mg, less than about 25 mg, less than about 20 mg, less than about 15 mg, less than about 10 mg, less than about 5 mg, less than about 2 mg, less than about 1 mg, or less than 0.5 mg, as well as any whole or partial increments thereof.

[0209] In some embodiments, the present invention relates to a packaged pharmaceutical composition comprising a container holding a therapeutically effective amount of the compound or conjugate of the present invention, either alone or in combination with a second pharmaceutical agent, and instructions for using the compound or conjugate to treat, prevent or alleviate one or more symptoms of a disease in a subject.

[0210] The term “container” includes any container for holding a pharmaceutical composition. For example, in some embodiments, the container is packaging that contains the pharmaceutical composition. In other embodiments, the container is not packaging that contains the pharmaceutical composition; i.e., the container is a container, such as a box or vial, that contains the packaged or unpackaged pharmaceutical composition and instructions for use of the pharmaceutical composition. Furthermore, packaging techniques are well known in the art. Instructions for use of the pharmaceutical composition can be contained in packaging that contains the pharmaceutical composition, and in this way, the instructions can enhance the functional relevance of the instructions to the packaged product. On the other hand, it should be understood that the instructions may contain information about the compound’s ability to perform its intended function, for example, to treat or prevent a disease in a subject or to deliver a contrast agent or diagnostic agent to a subject.

[0211] Any of the compositions of the present invention can be administered via oral, nasal, rectal, parenteral, sublingual, transdermal, transmucosal (e.g., sublingual, tongue, (trans) buccal, (trans) urethral, ​​vagina (e.g., transvaginal and perivaginal), (trans) nasal and (trans) rectal), intravesical, intrapulmonary, intracerebral, epidural, intraventricular, intraduodenal, intragastric, intrathecal, subcutaneous, intramuscular, intradermal, intra-arterial, intravenous, intrabronchial, inhalation, and topical administration. In some embodiments, the composition can be administered into the cerebrospinal fluid of the subject.

[0212] Suitable compositions and dosage forms include, for example, tablets, capsules, caplets, pills, gel capsules, lozenges, dispersants, suspensions, liquids, syrups, granules, beads, transdermal patches, gels, powders, pellets, magma preparations, lozenges, creams, pastes, plasters, lotions, discs, suppositories, liquid sprays for nasal or oral administration, dry powders or aerosol preparations for inhalation, intravesical compositions and preparations, etc. It should be understood that the preparations and compositions that may be useful in the present invention are not limited to the specific preparations and compositions described herein.

[0213] Diagnostic methods The present invention provides a method for diagnosing subjects who have or are at risk of developing diseases or disorders associated with protein misfolds or protein aggregates. For example, in some embodiments, the method includes using the expression or activity level of one or more TRIM proteins as a diagnostic marker. In some embodiments, the method includes detecting the presence of gene mutations in nucleic acids encoding one or more TRIM proteins.

[0214] In some embodiments, the method is used to diagnose that a subject has a disease or disorder related to protein misfolding or protein aggregates. In some embodiments, the method is used to diagnose that a subject is at risk of developing a disease or disorder related to protein misfolding or protein aggregates.

[0215] In some embodiments, the method is used to evaluate the effectiveness of treatment for neurodegenerative diseases or disorders associated with protein misfolds or protein aggregates.

[0216] In some embodiments, the method includes collecting a biological sample from a subject. Exemplary samples include, but are not limited to, blood, urine, feces, sweat, bile, serum, plasma, tissue biopsy, etc. For example, in some embodiments, the sample includes at least one type of cell from nerve tissue. In some embodiments, the sample includes neurons, astrocytes, oligodendrocytes, Purkinje cells, pyramidal cells, etc.

[0217] Methods for detecting a decrease in the expression or activity of one or more TRIM proteins include any method of examining a gene or its product at either the nucleic acid or protein level. Such methods are well known in the art and include, but are not limited to, nucleic acid hybridization techniques, nucleic acid reverse transcription and nucleic acid amplification techniques, Western blotting, Northern blotting, Southern blotting, ELISA, immunoprecipitation, immunofluorescence, flow cytometry, and immunohistochemistry. In certain embodiments, for example, antibodies against specific proteins are used to detect disruption of gene transcription at the protein level. These antibodies can be used in a variety of methods, such as Western blotting, ELISA, immunoprecipitation, flow cytometry, or immunohistochemistry techniques.

[0218] Method for producing recombinant proteins In certain embodiments, the present invention provides a method for producing a target recombinant protein using one or more TRIM proteins. In the art, it is recognized that recombinant proteins may spontaneously misfold and aggregate, which can lead to a decrease in their functionality and usefulness. Therefore, one or more TRIM proteins can be used to dissociate protein aggregates of the target recombinant protein, thereby enabling the production and collection of the target functional recombinant protein. In some embodiments, one or more TRIM proteins are human TRIM1, TRIM2, TRIM3, TRIM4, TRIM5, TRIM6, TRIM7, TRIM8, TRIM9, TRIM10, TRIM11, TRIM13, TRIM14, TRIM15, TRIM16, TRIM17, TRIM18, TRIM19, TRIM20, TRIM21, TRIM22, TRIM23, TRIM24, TRIM25, TRIM26, TRIM27, TRIM28, TRIM29, TRIM30, TRIM31, TRIM32, TRIM33, TRIM34, TRIM35, TRIM36, TRIM37, TRIM38, TRIM39, It is one or more selected from the group consisting of TRIM40, TRIM41, TRIM42, TRIM43, TRIM44, TRIM45, TRIM46, TRIM47, TRIM48, TRIM49, TRIM50, TRIM51, TRIM52, TRIM54, TRIM55, TRIM56, TRIM58, TRIM59, TRIM60, TRIM61, TRIM62, TRIM63, TRIM64, TRIM65, TRIM66, TRIM67, TRIM68, TRIM69, TRIM70, TRIM71, TRIM72, TRIM73, TRIM74, TRIM76 and TRIM77, as well as mouse TRIM12 and TRIM30.In some embodiments, one or more TRIM proteins are selected from the group consisting of human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM21, TRIM24, TRIM26, TRIM29, TRIM31, TRIM34, TRIM36, TRIM37, TRIM46, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, and TRIM70, as well as mouse TRIM12 and TRIM30. In some embodiments, one or more TRIM proteins are selected from the group consisting of human TRIM10, TRIM11, TRIM24, TRIM36, TRIM37, TRIM40, TRIM49, TRIM55, TRIM58, and TRIM68. In some embodiments, one or more TRIM proteins are selected from the group consisting of human TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM10, TRIM11, TRIM12, TRIM17, TRIM18, TRIM19, TRIM21, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, and TRIM70. In some embodiments, one or more TRIM proteins are selected from the group consisting of human TRIM10, TRIM11, and TRIM55.In some embodiments, one or more TRIM proteins are selected from the group consisting of human TRIM2, TRIM3, TRIM10, TRIM11, TRIM17, TRIM18, TRIM19, TRIM26, TRIM29, TRIM30, TRIM31, TRIM36, TRIM41, TRIM42, TRIM43, TRIM46, TRIM49, TRIM55, TRIM56, TRIM63, TRIM64, TRIM68, TRIM69, TRIM70, TRIM71, and TRIM73. In some embodiments, one or more TRIM proteins are selected from the group consisting of human TRIM10, TRIM11, TRIM36, TRIM55, and TRIM68. In some embodiments, one or more TRIM proteins are selected from the group consisting of human TRIM10, TRIM11, TRIM24, TRIM36, and TRIM58. In some embodiments, one or more TRIM proteins are selected from the group consisting of TRIM10, TRIM11, TRIM17, TRIM36, TRIM37, TRIM40, TRIM49, and TRIM55. In some embodiments, the TRIM protein is human TRIM10. In some embodiments, the TRIM protein is human TRIM11.

[0219] In certain embodiments, the present invention provides a method for improving the production of a target recombinant protein using one or more TRIM proteins disclosed herein. In the art, it is recognized that proteins overexpressed in cell-based expression systems may undergo misfolding and aggregation at high concentrations, leading to premature cell death. Therefore, proteins capable of preventing or addressing protein misfolding, such as the TRIM proteins of this disclosure, can be used to prevent misfolding and cell death while improving the production of functional recombinant proteins.

[0220] In certain embodiments, the method involves administering one or more TRIM proteins, nucleic acid molecules encoding one or more TRIM proteins, or a combination thereof, to cells. In certain embodiments, the cells are modified to express the recombinant protein of interest. The cells may be from any expression system, including but not limited to yeast, bacterial, insect, or mammalian expression systems.

[0221] Methods for maintaining cells In some embodiments, the present invention includes a method for maintaining cells for use in cell therapy. Cells for use in cell therapy, such as cells engineered to overexpress therapeutic proteins, are known to be susceptible to protein misfolding and aggregation, which can lead to premature cell death. Therefore, the TRIM proteins of this disclosure can be used to prevent or address protein misfolding and aggregation to keep the cells healthy and usable. In some embodiments, the method includes administering to the cells one or more TRIM proteins, nucleic acid molecules encoding one or more TRIM proteins, or a combination thereof.

[0222] Experimental example The present invention will be described in more detail with reference to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to limit the invention unless otherwise specified. Therefore, the present invention should not be construed as being limited to the following examples, but rather as encompassing any and all modifications that become apparent as a result of the teachings provided herein.

[0223] Without further explanation, those skilled in the art will likely be able to manufacture, utilize, and carry out the claimed method of the present invention by using the foregoing description and the following examples. Therefore, the following examples should not be construed as limiting the remainder of the disclosure.

[0224] Example 1: TRIM11 provides protection from tauopathy, and TRIM11 is downregulated in Alzheimer's disease. Intracellular neurofibrillary tangles (NFTs), composed of hyperphosphorylated tau, are a common pathological feature in more than 20 heterogeneous dementias and motor disorders collectively known as tauopathies (VM Lee, M. Goedert, JQ Trojanowski, Annu Rev Neurosci 24, 1121-1159 (2001); MG Spillantini, M. Goedert, Lancet Neurol 12, 609-622 (2013); J. Gotz, G. Halliday, RM Nisbet, Annu Rev Pathol 14, 239-261 (2019)). Among these, various diseases, such as frontotemporal lobar degeneration (FTLD-tau), including progressive supranuclear palsy (PSP), corticobasal degeneration, and Pick's disease (PiD), are primary tauopathies that do not exhibit other major pathological abnormalities. Alzheimer's disease (AD), the most common cause of dementia, is a secondary tauopathy further characterized by the presence of extracellular amyloid-beta (Aβ) plaques (CL Masters et al., Nat Rev Dis Primers 1, 15056 (2015); DS Knopman et al., Nat Rev Dis Primers 7, 33 (2021)). In familial subsets of primary tauopathy, the MAPT gene, which codes for tau, is mutated (M. Hutton et al., Nature 393, 702-705 (1998); MG Spillantini et al., Proc Natl Acad Sci USA 95, 7737-7741 (1998); C. Dumanchin et al., Hum Mol Genet 7, 1825-1829 (1998)).In both primary tauopathy and Alzheimer's disease (AD), NFT accumulation correlates with cognitive decline and neurodegeneration (PV Arriagada, JH Growdon, ET Hedley-Whyte, BT Hyman, Neurology 42, 631-639 (1992); H. Ling et al., Neuropathol Appl Neurobiol 40, 149-163 (2014); N. Kouri et al., Brain 134, 3264-3275 (2011)). Furthermore, tau is required for Aβ-induced neurotoxicity (ED Roberson et al., Science 316, 750-754 (2007)). Therefore, tau misfolding and aggregation are likely major disease-causing events in AD and other tauopathy.

[0225] To maintain proteins in their functionally soluble form, organisms throughout the biological world have evolved protein quality control (PQC) systems (WE Balch, RI Morimoto, A. Dillin, JW Kelly, Science 319, 916-919 (2008); S. Wolff, JS Weissman, A. Dillin, Cell 157, 52-64 (2014); D. Balchin, M. Hayer-Hartl, FU Hartl, Science 353, aac4354 (2016)). These systems include degradation pathways that recycle defective proteins and excess normal proteins, molecular chaperones that prevent protein misfolding and aggregation, and disaggregases that dissolve existing protein accumulations. In tauopathy, the age-dependent conversion of tau from soluble monomers to fibrillary aggregates suggests a decline in the ability of the PQC system to protect against tau aggregation. Nevertheless, the identification and properties of these PQC systems remain unknown. This lack of knowledge is hindering the development of effective treatments.

[0226] Triangular motif (TRIM) proteins are defined by a TRIM / RBCC region consisting of a RING domain, one or two B-boxes, and a coiled-coil motif (Figure 9). These proteins are found only in metazoans and have rapidly increased in number during evolution, with humans comprising more than 70 members (S. Hatakeyama, Nat Rev Cancer 11, 792-804 (2011); K. Ozato, DM Shin, TH Chang, HC Morse, 3rd, Nat Rev Immunol 8, 849-860 (2008)). New evidence suggests that some TRIM proteins may be involved in multiple aspects of PQC (L. Guo et al., Mol Cell 55, 15-30 (2014); L. Chen et al., Cell Rep 18, 3143-3154 (2017); L. Chen, G. Zhu, EM Johns, X. Yang, Nat Commun 9, 1223 (2018); G. Zhu et al., Cell Rep 33, 108418 (2020)). On the other hand, other TRIMs may worsen protein aggregation (MW Rousseaux et al., Elife 5, (2016)). Furthermore, the cytoplasmic antibody receptor TRIM21 mediates the degradation of endogenous proteins that deliver antibody-coated viruses or specific antibodies that have entered the cytoplasm into the cell (DL Mallery et al., Antibodies mediate intracellular immunity through tripartite motif-containing 21 (TRIM21). Proc Natl Acad Sci USA 107, 19985-19990 (2010); A. Kondo et al., Nature 523, 431-436 (2015); D. Clift et al., Cell 171, 1692-1706 e1618 (2017); WA McEwan et al., Proc Natl Acad Sci USA 114, 574-579 (2017)).This study investigated the role of the TRIM system in the pathogenesis of tauopathies, its mechanism of action, and its usefulness in disease treatment.

[0227] The materials and methods used in the experiment are described below.

[0228] antibody Antibodies against the following proteins or epitopes were purchased from the indicated suppliers: TRIM10 (pAb, Abcam, Cat# ab151306), TRIM11 (pAb, Millipore, Cat# ABC926; pAb, Abcam, Cat# ab111694), TRIM55 (MURF2) (mAb, Abnova, Cat# H00084675-M02), GFP (mAb, Santa Cruz, Cat# sc-9996; pAb, GeneTex, Cat# GTX113617), HA (mAb, C29F4, Cell Signaling, Cat# 3724), GAPDH (Santa Cruz, Cat# sc-32233), β-actin (Sigma-Aldrich, Cat# A5441), FLAG (mAb, Cell signaling, Cat# 14793;mAb, M2, Sigma-Aldrich, Cat# F1804), Hsp90(Cell Signaling, Cat# 4874), Phosphorylated tau(Ser202 / Thr205)(mAb AT8, Thermo Fisher Scientific, Cat# MN1020), Phosphorylated tau(Thr231)(mAb AT180, Thermo Fisher Scientific, Cat# MN1040), phosphorylated tau(Ser262)(pAb, Invitrogen, Cat# OPA1-03142), phosphorylated tau(Ser396)(pAb, Thermo Fisher Scientific, Cat# 44-752G), tau(mAb tau5, Thermo Fisher Scientific, Cat# AHB0042), tau(pAb T22, Millipore, Cat# ABN454), p62(SQSTM1)(pAb, MBL, Cat# PM045), 6×His(pAb, Cell Signaling, Cat# 2365), mCherry(mAb, Santa Cruz, Cat# sc-390909), c-Myc(pAb, Santa Cruz, Cat# sc-40), LC3B (D11, XP, mAb, Cell Signaling, Cat# 3868), SUMO2 / 3 (pAb, Abcetpa, Cat# AP1224a) and FLAG M2 agarose beads (Sigma-Aldrich, Cat# A1205). PSD95 (mAb, Cell Signaling, Cat# 36233S). PSD95 (mAb, Cell Signaling, Cat# 3409S). Synaptophysin (mAb, Cell Signaling, Cat# 36406S). NeuN (mAb, Millipore, Cat# MAB377). MAP2 (pAb, Origene Technologies, Cat# TA309162). The antiphosphorylated tau mAbs PHF-1 (Ser396 / Ser404) and MC1 were kindly provided by Dr. Peter Davies.

[0229] reagent Mg 2+-ATP (Cat# A9187), FLAG peptide (Cat# F3290), ammonium chloride (Cat# 09718), benzonase (Cat# E1014), isopropyl-1-thio-D-galactopyranoside (IPTG) (Cat# I6758), complete protease inhibitor cocktail (Cat# 11697498001), reduced L-glutathione (Cat# G4251), cycloheximide (Cat# 66819), thioflavin T (Cat# T3516), imidazole (Cat# I5513), heparin (Cat# H3393), human Aβ42 peptide, Duolink® In Situ Red starter kit (Cat# DUO92101) and polyblen (Cat# We purchased TR-1003) from Sigma-Aldrich. We purchased Glutathione Superflow Agarose (Cat# 25236), High-Volume cDNA Reverse Transcription Kit (Cat# 4368814), Puromycin Dihydrochloride (Cat# A1113803), Lipofectamine 2000 (Cat# 6031), Lipofectamine RNAiMAX (Cat# 13778150), SYBR Green Master Mix (Cat# A25742), and SuperSignal® Western Blot Substrate Bundle (Cat# A45916) from Thermo Fisher Scientific. We purchased SUMO E1 (Cat# E-315), SUMO E2 (UbcH9) (Cat# E2-465), and 6×His-SUMO2 (Cat# UL-75) from Boston Biochem.Ni-NTA agarose (Cat# 30230) was purchased from QIAFEN, TRIzol reagent (Cat# 15596) and Hoechst 33342 (Cat# H3570) from Invitrogen, 4',6-diamidino-2-phenylindole (DAPI) (Cat# H-1200) from Vector Laboratories, MG132 (Cat# S2619) from Selleck Chemicals, polyethyleneimine (PEI) (linear, MW25000, Cat# 23966-1) from Polysciences, the phosphatase inhibitor PhosSTOP™ (Cat# 04906845001) from Roche, DPX mount medium (Cat# 13510) from Electron Microscopy Science, and the Bradford protein assay kit (Cat# I purchased product 5000205) from Bio-Rad Labs and the ABC (avidin-biotin complex) kit (Cat# PK6100) from Vector Laboratories.

[0230] plasmid For expression in mammalian cells, cDNAs (Table 1) were synthesized for 73 human TRIMs and 75 TRIMs, including mouse TRIM12 and TRIM30, and cloned into the pCDH-EF1-FHC vector (Addgene, #64874). FLAG tags and HA tags were fused to the C-terminus of each TRIM (Gene Universal, Newark, DE). Flag-tau and Flag-tau P301L were cloned into pcDNA3.1. Tau-VN173 and TRIM11-VN173 were cloned into pBiFC-VN173 (Addgene, plasmid #22010), and tau-VC155 and TRIM11-VC155 were cloned into pBiFC-VC155 (Addgene, plasmid #22011) (provided by Dr. Chang-Deng Hu). Tau-GFP, tau P301L-GFP, and tau AT8(S199E, S202E, T205E)-GFP were created in pEGFP-N1. EGFP was fused to the C-terminus of the tau protein. pRK5-EGFP-tau and pRK5-EGFP-tau P301L, in which EGFP was fused to the N-terminus of the tau protein, were provided by Dr. Karen Ashe (Addgene, plasmids #46904 and #46908, respectively). GFP-TRIM11 (in pEGFP-C1), Flag-TRIM11, Flag-TRIM11 2EA (in pcDNA3.1) (G. Zhu et al., Cell Rep 33, 108418 (2020)), mCherry and mCherry-TRIM11 (in pTRPE) (L. Chen et al., Cell Rep 18, 3143-3154 (2017)) have been previously reported.

[0231] For bacterial expression, GST-tau, GST-tau P301L, and GST-tau AT8 were created in pGEX-1ZT, a derivative of pGEX-1λT with additional cloning sites. GFP-tau and GFP-tau P301L were cloned into pET-28(+). GST-TRIM11 was cloned into pGEX-1ZT (Zhu, G. et al., 2020, Cell Reports, 33:108418).

[0232] siRNA, sgRNA, and antisense oligonucleotides siRNAs targeting mouse TRIM10 (Cat# sc-76733), mouse TRIM11 (Cat# sc-76735), mouse TRIM36 (Cat# sc-154647), mouse TRIM55 (Cat# sc-149718), and human TRIM11 (Cat# sc-76734) were purchased from Santa Cruz. A negative control siRNA, 5'-GGUUAAUCGCGUAUAAUACGCGUAU-3' (SEQ ID NO: 1), was prepared by IDT.

[0233] sgRNAs targeting human TRIM10, TRIM11, TRIM26, TRIM36, and TRIM55 were synthesized by Integrated DNA Technologies (Coralville, IA, USA). The target sequences were: TRIM10: 5'-GGCAGTTGACTTCATCTGCC-3' (SEQ ID NO: 2); TRIM11: 5'-GAGCCAGCGGCAGAACGTGC-3' (SEQ ID NO: 3); TRIM26: 5'-GCCGCTCAATGTTCTCCACC-3' (SEQ ID NO: 4); TRIM36: 5'-TACCATTAAGAATATCGAAA-3' (SEQ ID NO: 5); TRIM55: 5'-AACCCGTATTTGCCCACAAG (SEQ ID NO: 6).

[0234] The antisense oligonucleotides (ASOs) used in this study were designed and synthesized by AUM LifeTech (Philadelphia, PA, USA). The sequences are as follows: TRIM11-1, 5'-ATAAACAGCAGCGACCCATCC-3' (SEQ ID NO: 7); TRIM11-2, 5'-ACTTAGTGCTTTGGTGAGAGC-3' (SEQ ID NO: 8); TRIM11-3, 5'-ACTGTAGAATGAGAGATGGCC-3' (SEQ ID NO: 9); TRIM11-4, 5'-TAGAATGAGAGATGGCCAGCT-3' (SEQ ID NO: 10); TRIM11-5, 5'-ATTTGTTTCCGTAGGTGCTCC-3' (SEQ ID NO: 11); and scrambled control (SCR CTRL), 5'-CCTTCCCTGAAGGTTCCTCC-3' (SEQ ID NO: 12). SCR CTRL-Far Red was tagged with a far-red fluorescent dye that exhibits maximum excitation at 646 nm and maximum emission at 669 nm (+ / -5).

[0235] cell culture HEK293T cells and N2A cells were purchased from ATCC, and SH-SY5Y cells were purchased from Sigma. HEK293 cells expressing RD(LM)-YFP expressing tau repeat domains (RD; aa244~372 of the full-length tau 4R2N isoform) containing the aggregation-promoting mutations P301L and V337M were generated according to a published protocol (DW Sanders et al., Neuron 82, 1271-1288 (2014)). QBI293 / tau P301L-GFP cells have been previously reported (JL Guo et al., J Biol Chem 291, 13175-13193 (2016)). HEK293T, HEK293 / RD(LM)-YFP, and QBI293 / tau P301L-GFP cells were cultured in DMEM medium, SH-SY5Y cells in DMEM / F12 (1:1), and N2A cells in EMEM medium. All media contained penicillin / streptomycin and 10% FBS. Cells were maintained in a humidified incubator at 37°C and 5% CO2.

[0236] Primary neurons were prepared from the hippocampus or cerebral cortex of wild-type or PS19 mouse juveniles (P1). Tissue was collected, placed in ice-cold Hanks equilibrium salt solution containing 10 mM HEPES, cut into flakes, and digested with papain (1 mg / ml) at 37°C for 30 minutes. DMEM containing 10% thermoinactivated fetal bovine serum was added to terminate the digestion reaction. After grinding, cells were recovered by centrifugation at 1,000 × g and resuspended in neurobasal medium containing 2% B27, 1% penicillin / streptomycin, and 2 mM GlutaMAX.

[0237] TRIM knockout (KO) cells To knock out TRIM10, TRIM11, TRIM26, TRIM36, or TRIM55 in HEK293T cells, HEK293T cells were co-transfected with PEI in a 4:1:3 ratio with either a control plentiCRISPRv2 vector or plentiCRISPRv2 encoding the sgRNAs of TRIM10, TRIM11, TRIM26, TRIM36, or TRIM55, along with the packaging plasmids pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260). The culture medium was changed after 12 hours. The virus particles were collected 60 hours after transfection, centrifuged at 1,200 rpm for 5 minutes, filtered through a 0.45 μm sterile filter (Millipore), and concentrated overnight at 4°C in a 3:1 ratio using a Lenti-X® concentrator (Takara Bio, Cat# 631312), followed by centrifugation at 4500 × g for 1 hour at 4°C. HEK293T cells were then infected with the concentrated virus particles in a medium containing 8 μg / ml polyblen. Lentiviral transduction cells were selected with 2 μg / ml puromycin for 7 days.

[0238] mouse tau P301S(PS19) or B6;C3-Tg(Prnp-MAPT *P301S)PS19Vle / J) Heterozygous female breeder (strain #: 008169) and 3×Tg-AD or B6;129-Tg(APPSwe, tau P301L)1Lfa Psen1 tm1Mpm tm1Mpm The homozygous male breeder of / Mmjax (MMRRC strain #034830-JAX) was purchased from Jackson Laboratories. The PS19 colony was maintained by heterozygous mating pairs with C57Bl / 6J wild-type male mice, and heterozygous PS19 transgenic mice were used in this study. The 3×Tg-AD colony was maintained by heterozygous mating, and homozygous mice were included in this study. Genotypes were confirmed using PCR. Mice were housed in groups of 3 - 5 at a constant temperature of 23°C, with a 12-hour light / dark cycle, and allowed free access to food and water.

[0239] cDNA / siRNA transfection and lentiviral transduction cDNA plasmids were transfected into cultured cells using Lipofectamine 2000 (Invitrogen) or polyethyleneimine, and siRNA was transfected using Lipofectamine RNAiMAX. When both siRNA and cDNA were used, cells were first transfected with siRNA for 24 hours, and then transfected with cDNA plasmids for another 24 hours. QBI293 / tau P301L-GFP cells stably expressing mCherry or mCherry-TRIM11 were generated by lentiviral transduction using a third-generation lentiviral packaging system. HEK293T cells were transfected with mCherry or mCherry-TRIM11 plasmids along with helper plasmids Gag, Rev, and VSVG. Lentiviral vectors were obtained by centrifugation of the culture medium at 10,000 rpm for 18–20 hours and used to transduce QBI293 / tau P301L-GFP cells (JL Guo et al., J Biol Chem 291, 13175-13193 (2016)). Three days after viral transduction, mCherry-positive cells were selected using fluorescence-activated cell sorting (FACS) and grown in DMEM medium. These cells were further selected by two rounds of FACS and used in this study.

[0240] Screening of TRIM proteins against tau HEK293T cells that were approximately 80 - 90% confluent after 24 - hour culture in a 6 - well plate were transfected with 0.5 μg of pRK5 - GFP - tau P301L and 2 μg of the indicated pCDH - EF1 - FHC - TRIM - FLAG - HA plasmid using polyethyleneimine. The medium was changed after 12 hours. Cells were harvested 48 hours after transfection and lysed on ice for 30 minutes in 150 μl of ice - cold lysis buffer (50 mM Tris pH 8.8, 100 mM NaCl, 5 mM MgCl2, 0.5% NP - 40, 1 mM DTT, 250 IU / ml benzonase, 1 mM PMSF, and 1× complete protease inhibitor cocktail). The lysate was centrifuged at 13,000 rpm for 15 minutes at 4°C. The NP - 40 soluble supernatant was designated as the SN fraction. The NP - 40 insoluble pellet was washed once with 500 μl of pre - cooled PBS and resuspended on ice for 30 minutes in 50 μl of ice - cold pellet buffer (20 mM Tris pH 8.0, 15 mM MgCl2, 1 mM DTT, 250 IU / ml benzonase, 1 mM PMSF, and 1× complete protease inhibitor cocktail), and then 25 μl of 3× boiling buffer (6% SDS, 20 mM Tris pH 8.0, 150 mM DTT) was added. The samples were heated at 95°C for 5 - 10 minutes. The aggregated proteins in the pellet that could be solubilized by SDS were designated as the SDS - soluble pellet fraction (PE).

[0241] Both the SN and PE fractions were boiled in SDS sample buffer (final concentration: 62.5 mM Tris pH 6.8, 2% SDS, 10% glycerol, 100 mM DTT, 0.01% bromophenol blue), analyzed by SDS-PAGE, and then transferred to a nitrocellulose membrane. After blocking with 5% nonfat milk in tris-buffered saline (TBST) containing Tween, the membrane was incubated with anti-GFP, anti-HA, and anti-HSP90 antibodies, followed by incubation with an HRP-conjugated secondary antibody. Signals were detected using the Western blot substrate and substrate kit of the ECL detection system (Bio-Rad Chemidoc Touch Imaging System Chemiluminescence / Fluorescence Detection). Sample loading and exposure time for immunoblotting were controlled so that all bands in the Western blot were detected within the linear range.

[0242] Real-time quantitative PCR (RT-qPCR) Total RNA was extracted using TRIzol according to the manufacturer's instructions. 1 μg of RNA was reverse transcribed using a High Capacity cDNA Reverse Transcription Kit. Gene expression was measured by SYBR Green-based RT-PCR using the ABI ViiA 7 PCR system (Applied Biosystems, Foster City, CA, USA). Each gene expression was normalized to GAPDH. The following primers were used (5'→3'): tau-F: GAGGCGGGAAGGTGCAGATAATTAATAA (SEQ ID NO: 13), tau-R: CTGGTTTATGATGGATGTTGCC (SEQ ID NO: 14); TRIM10-F: CTGCCCCATCTGTCAGGGTA (SEQ ID NO: 15), TRIM10-R: GGTATCTCACAGTAGCGGGTAA (SEQ ID NO: 16); TRIM11-F: TACTGGGAGGTGGAGGTTGGG (SEQ ID NO: 17), TRIM11-R: GGATCTCGGGAAAGATGAATAGCA (SEQ ID NO: 18); TRIM26-F: TGCACTACTACTGTGAG GACG (Sequence ID: 19), TRIM26-R:TCCTTAGGGTACTCAGGTGGT (Sequence ID: 20); TRIM36-F:GAGCTGTTTACCCACCCATTG (Sequence ID: 21), TRIM36-R:CTGATCCCACATCGTTGAATGA (Sequence ID: 22); TRIM55-F:TTGTCAGCACAACCTGTGTAG (Sequence ID: 23), TRIM55-R:CCCATGTCTATCCAAAACCACTT (Sequence ID: 24); GAPDH-F:GCTAAGGCTGTGGGCAAGG (Sequence ID: 25), GAPDH-R:GGAGGAGTGGGTGTCGCTG (Sequence ID: 26).

[0243] Protein extraction from human brain samples Autopsy human brain tissue was obtained from 23 cases with neuropathologically confirmed AD and 14 subjects with no history of dementia or other neurological disorders (Figure 2A and Table 2). Proteins were extracted from these human brain tissues as previously reported (GS Gibbons et al., Mol Neurodegener 15, 64 (2020)). Briefly, the gray matter of the frontal cortex was homogenized using a homogenizer in a high-salt sarcosyl-containing buffer (10 mM Tris-HCl pH 7.4, 800 mM NaCl, 1 mM EDTA, 2 mM DTT, protease inhibitor cocktail, 1 mM PMSF, PhosSTOP®, 0.1% sarcosyl, and 10% sucrose) at 9 volumes of buffer per gram of tissue. After 30 minutes on ice, the lysates were centrifuged at 10,000 g at 4°C for 10 minutes. The supernatant was collected, the protein concentration was measured using the Bradford assay (Bio-Rad Labs), boiled in SDS sample buffer, and then analyzed by SDS-PAGE.

[0244] Immunohistochemical (IHC) and immunofluorescence (IF) analysis of human brain tissue Human brain tissue was fixed with paraformaldehyde, embedded in paraffin, and 6 μm thick sections were cut. These sections were deparaffinized in xylene and rehydrated in ethanol (100-50%). For IHC staining, rabbit anti-TRIM11 antibody was diluted 1:500 in 3% goat serum in PBS, and after antigen retrieval at 4°C, it was applied overnight to the rehydrated tissue sections. After washing five times with PBS, the sections were incubated with biotin-conjugated secondary antibody and ligated to avidin by incubation with an ABC kit for 1 hour, followed by staining with DAB solution. For IF staining, rabbit anti-TRIM11 antibody, mouse anti-tau AT8 antibody, or mouse anti-NeuN antibody was diluted 1:500 in 3% goat serum in PBS and applied overnight at 4°C. After washing five times with PBS, the labeled proteins were visualized by incubation with Alexa Fluor 488-conjugate secondary antibodies and Alexa Fluor 555-conjugate secondary antibodies. The sections were then dehydrated, cleared with xylene, and mounted on slides using DPX mounting medium (Electron Microscopy Science). The samples were visualized using an inverted fluorescence microscope (Revolve, Echo Laboratories).

[0245] Protein purification GST, GST-TRIM11, GST-tau, 6×His-GFP-tau, and 6×His-GFP-tau P301L were purified from bacteria. BL21 DE3 cells (Thermo Fisher Scientific, Cat# C600003) containing the corresponding plasmids were incubated at 37°C. 600nmCells were grown to a volume of 0.6-0.8, and protein expression was induced with 0.5 mM IPTG at 19-20°C for 20 hours. The cells were harvested and resuspended in either a buffer containing 50 mM Tris-HCl pH 7.4, 500 mM NaCl, 200 mM KCl, and 10% glycerol (for GST protein), supplemented with a complete protease inhibitor cocktail, 1 mM phenylmethylsulfonyl fluoride, 1 mM DTT, and 1 mg / ml lysozyme, or a buffer containing 50 mM NaH2PO4 and 300 mM NaCl (for 6 × His-tau). The cells were lysed by sonication. The cell lysates were centrifuged at 4°C at 13,000 rpm for 30 minutes.

[0246] For the purification of GST protein, the supernatant was applied to a glutathione bead-packed column (QIAGEN, cat# 34694) and incubated at 4°C for 2 hours. The column was thoroughly washed with washing buffer (50 mM Tris-Cl pH 7.5 and 150 mM NaCl). The bound protein was eluted with elution buffer (50 mM Tris-Cl pH 7.5, 150 mM NaCl and 20 mM glutathione). Fractions were collected in 0.5 mL portions, and fractions containing GST or GST fusions were concentrated using a centrifugation filter (Millipore, cat#: UFC800308) and desalted. For the purification of 6×His-GFP-tau and 6×His-GFP-tau P301L, the supernatant was incubated with Ni-NTA agarose (QIAGEN) at 4°C for 2 hours. The beads were thoroughly washed with washing buffer (50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, pH 8.0). The fusion protein was eluted with elution buffer (50 mM NaH2PO4, 300 mM NaCl, 400 mM imidazole, pH 8.0), concentrated using a centrifuge filter, and desalted.

[0247] Flag-TRIM11 and Flag-TRIM11 2EAAs previously reported (76, 77), it was purified from HEK293T cells. Briefly, HEK293T cells transfected with the Flag-TRIM11 plasmid were lysed by sonication in IP lysis buffer (20 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.5% Triton X-100, 0.5% NP-40 and 10% glycerol). The supernatant was incubated with anti-Flag M2 affinity gel at 4 °C for 4 hours to overnight. The gel was sequentially washed with lysis buffer containing 0, 0.25, 0.5, 1, 0.5, 0.25 and 0 M KCl, and then washed with Tris buffer or sodium phosphate buffer. The recombinant protein was eluted with 3×FLAG peptide at 4 °C for 1 hour, concentrated with a centrifugal filter, and desalted.

[0248] Tau-441 was purified as previously reported (W. Li, V. M. Lee, Biochemistry 45, 15692-15701 (2006)). Tau-441 P301L (cat# T-1014-1) was purchased from rPeptide (Watkinsville, GA).

[0249] Cycloheximide chase assay HEK293T cells were cultured in 12-well plates for 24 hours and then transfected with the indicated plasmids. To analyze the half-life of GFP-tau or GFP-tau P301L, the cells were treated with cycloheximide (CHX) (50 μg / ml -1 ) for various periods 24 hours after transfection. After treatment, the cells were harvested and the SN fraction and PE fraction were extracted as described above.

[0250] BiFC assay HEK293T cells were seeded for 24 hours in a 6-well plate containing DMEM medium supplemented with 10% fetal bovine serum (FBS). This allowed the cells to grow to 80-90% confluence at the time of transfection. The cells were co-transfected with the indicated plasmid. After 12 hours, the cells were replaced with fresh medium and cultured for another 12 hours. Fluorescence was observed using a Revolve Microscope Demo (Echo Laboratories).

[0251] co-immunoprecipitation Co-immunoprecipitation assays were performed as previously reported (G. Zhu et al., Cell Rep 33, 108418 (2020)). Briefly, HEK293 cells transfected with the indicated expression plasmid were lysed on ice for 30 minutes in lysis buffer (50 mM Tris pH 7.4, 200 mM NaCl, 0.2% Triton, 1 mM DTT, 1 mM PMSF, and 1× complete protease inhibitor cocktail). Cell lysates were centrifuged, the supernatant was collected, and incubated overnight at 4°C with the indicated primary antibody. Protein A / G agarose beads were incubated with the immunocomplex for 4 hours. After thorough washing, the immunoprecipitation was resuspended in SDS sample buffer and boiled for 5 minutes. The immunoprecipitation and whole cell lysates were separated by SDS-PAGE and Western blotted.

[0252] Colocalization assay To assay the co-localization of endogenous TRIM11 and tau in SH-SY5Y, N2A, and cultured neurons, cells were fixed in PBS containing 4% paraformaldehyde and 4% sucrose at room temperature for 10 minutes. The cells were then permeabilized with 0.5% Triton X-100 for 5 minutes, blocked with 10% NGS in PBS for 30 minutes, and subsequently incubated overnight at 4°C with rabbit anti-TRIM11 antibody, mouse anti-tau antibody (for all cells), and chicken anti-MAP2 antibody (for neurons only). After washing the three cells with PBS, the labeled proteins were visualized by incubation at room temperature for 1 hour with Alexa Fluor 488-conjugate goat anti-rabbit secondary antibody, Alexa Fluor 555-conjugate goat anti-mouse secondary antibody, and Alexa Fluor 405-conjugate goat anti-chicken secondary antibody (for MAP2 staining). After washing the three samples with PBS, the coverslips were mounted on glass slides, and fluorescence images were acquired by confocal microscopy. To quantify the colocalization of endogenous TRIM11 and tau, SH-SY5Y cells, N2A cells, or neuronal dendrites of the same length were randomly selected, and colocalization was quantified using the Image J plugin JACoP.

[0253] Proximity ligation assay (PLA) The Duolink® In Situ Red starter kit from Sigma-Aldrich was used to assay the PLA fluorescence of endogenous TRIM11 and tau in SH-SY5Y, N2A, and cultured primary neurons. Cells were fixed in PBS containing 4% paraformaldehyde at room temperature for 10 minutes. After fixation, cells were washed with PBS, permeabilized with 0.5% Triton X-100 for 5 minutes, and blocked with Duolink® blocking solution at 37°C for 60 minutes. The cells were then incubated overnight at 4°C with rabbit anti-TRIM11 antibody and mouse anti-tau antibody. Secondary antibodies conjugated with oligonucleotides were added to this reaction and incubated at 37°C for 1 hour. Ligation and amplification were performed by incubation in ligation solution at 37°C for 30 minutes, followed by incubation in amplification buffer containing polymerase at 37°C for 100 minutes. The slides were mounted using a mounting medium containing DAPI, and fluorescence images were then captured by confocal microscopy. As a negative control, a proximity ligation assay was performed in the absence of one of the primary antibodies.

[0254] SUMOylation assay For the intracellular SUMOylation assay, HEK293T cells were transfected with the indicated plasmid for 48 hours and treated with the proteasome inhibitor MG132 (10 mM) for 6 hours. Cells were lysed in a lysis buffer supplemented with 2% SDS and 50 mM DTT (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.5% Triton, 1 mM DTT, 1 mM PMSF, and a 1× complete protease inhibitor cocktail). Cell lysates were boiled at 95°C for 10 minutes and diluted 10-fold with SDS-free lysis buffer. A portion of the cell lysates was saved. The remaining cell lysates were incubated overnight at 4°C with anti-GFP antibody and further incubated for 2 hours with protein A / G agarose beads (denatured immunoprecipitation, d-IP). The d-IP samples were thoroughly washed and analyzed together with the cell lysates by immunoblotting with the indicated antibody.

[0255] The in vitro SUMOylation assay was performed using purified GST-tau or GST-tau P301L (600 ng / 400 nM, respectively), SUMO E1 (125 nM), SUMO E2 (1 μM), Flag-TRIM11 (300 nM), His-SUMO2 (25 μM), and 10 mM Mg 2+ - The reaction was carried out at 37°C for 1.5 hours in 20 μl of ATP-containing reaction buffer (50 mM Tris pH 7.5 and 25 mM DTT). 20 μl of IP lysis buffer containing 2% SDS and 50 mM DTT was added to the reaction mixture, and the mixture was stopped by heating at 95°C for 10 minutes. A portion of the heat-denatured reaction mixture was saved. The remainder was diluted in 1.5 ml of IP lysis buffer without SDS. GST-tau or GST-tau P301L was immunoprecipitated with anti-GST beads (anti-GST d-IP). After thorough washing, the d-IP samples and reaction mixtures were analyzed by Western blotting using the indicated antibodies.

[0256] Prevention and dissociation of tau fibrils To prevent contamination, purified tau-441 (10 μM) was induced to form tau aggregates at 37°C for 24 hours in the presence of the indicated concentrations of GST or GST-TRIM11, using heparin (30 μM) or pre-formed tau fibrils (PFF, 0.2 μM) in reaction buffer (20 mM Tris-HCl pH 7.4, 100 mM NaCl, 1 mM EDTA, and 1 mM DTT). Tau fibril formation was analyzed by ThT binding as previously reported (DS Harischandra et al., Sci Signal 12, (2019)). Tau aggregates were also tested by a precipitation assay. After centrifugation at 4°C and 13,000 rpm for 30 minutes, the pellet fraction was analyzed by Western blotting to detect SDS-soluble (PE) amorphous aggregates, and by dot blotting to detect relatively large SDS-insoluble (SR) fibrillary aggregates (L. Guo et al., Mol Cell 55, 15-30 (2014); G. Zhu et al., Cell Rep 33, 108418 (2020); L. Huang et al., DAXX represents a new type of protein-folding enabler. Nature 597, 132-137 (2021)). For dissociation, pre-formed tau fibers (1 μM) were incubated at 37°C for 24–48 hours in the presence or absence of Flag-TRIM11 or GST-TRIM11 at the indicated concentrations in the reaction solution (50 mM HEPES pH 7.5, 50 mM KCl, 5 mM MgCl2, and 1 mM DTT). The reaction mixture was analyzed by ThT binding and precipitation assays as described above.

[0257] Negative staining electron microscopy observation A 5 μl volume of the sample was applied to a thin film carbon grid and glow discharged for 2 minutes using a Pelco Easyglow device. 5 μl of freshly prepared 2% uranyl acetate staining solution was applied and incubated with the sample on this grid for 2 minutes. Excess sample and staining solution were blotted off with Whatman filter paper. The staining process was repeated and the grid was dried until imaging. TEM micrographs were collected at 100 KeV using a Tecnai T12 TEM microscope. Images were recorded with a Gatan Oneview 4K×4K camera. Each image was collected by exposing the sample for 4 seconds, and a total of 100 dose-fractionated images were collected and made into a single micrograph. Data were collected at a focus depth of -1.5 to 2 micrometers and a magnification of 30K to 40K.

[0258] Prevention of PFF-induced aggregation of endogenous tau Protofibril transduction in HEK293T cells was performed as reported (D. W. Sanders et al., Neuron 82, 1271-1288 (2014)). Briefly, tau PFF was incubated with Lipofectamine-2000 in OptiMEM for 20 minutes and then added to the cells at a final concentration of 400 nM. After 18 hours, the cells were washed and the medium was replaced with fresh medium. For protofibril transduction into primary neurons, cells were grown for 4 days and tested with AAV or ASO for 3 days as previously reported (J. L. Guo, V. M. Lee, FEBS Lett 587, 717-723 (2013)). tau PFF was diluted in PBS, sonicated at 60 pulses, and added to neurons at 1.5 μg / well. Two weeks after PFF transduction, the transduced neurons were collected for immunocytochemistry. For long-term ASO-mediated TRIM11 knockdown, ASO transduction was performed again on neurons on day 14.

[0259] Production of rAAV9-TRIM11 and rAAV9-GFP vectors Human TRIM11 (with an HA tag at the C-terminus) and GFP were cloned into the plasmid pENN.AAV9.CB7.CI.WPRE.rBG. In this plasmid, their expression is driven by CB7, a chicken β-actin promoter containing a cytomegalovirus enhancer element. TRIM11 and GFP plasmid DNA were prepared using an endotoxin-free mega-prep kit (QIAGEN) and characterized by structural and sequence analysis.

[0260] AAV / ASO transduction and analysis of cultured primary neurons Primary neurons were grown for 4 days before AAV vector treatment. For neuronal transduction, rAAV9-GFP was administered in Neurobasal medium in 5 × 10⁶ doses. 10 Dilute to GC / ml and add rAAV9-TRIM11 in 1.9 × 10 11 The solution was diluted to GC / ml. To knock down TRIM11 in neurons, ASO was added to the culture medium at a final concentration of 10 μM, and the knockdown effect was analyzed by estam blotting after 3 days. For long-term TRIM11 knockdown in neurons, ASO was added at two time points, and intracellular uptake was monitored using a fluorescently labeled oligonucleotide.

[0261] Hippocampal and cortical neurons were washed with PBS and fixed in PBS containing 4% paraformaldehyde and 4% sucrose at room temperature for 10 minutes. After fixation, the cells were washed with PBS, permeabilized with 0.5% Triton X-100 for 5 minutes, and blocked with 10% NGS in PBS for 30 minutes. The cells were then incubated overnight at 4°C with primary antibodies against phosphorylated tau (AT8 and MC1; 1:2000), GFP (1:2000), HA (1:500), synaptophysin (1:500), PSD95 (1:300), NFL (1:500), and / or MAP2 (1:2000). After incubation with the primary antibody, the cells were washed and incubated with Alexa Fluor 488-conjugate secondary antibody, Alexa Fluor 555-conjugate secondary antibody, or Alexa Fluor 405-conjugate secondary antibody (Invitrogen, 1:1000) in the dark for 90 minutes. Hoechst 44432 (Invitrogen, 1:10000) was used as the nuclear stain, and then the coverslips were mounted on the slides and then the fluorescence images were acquired by confocal laser scanning microscopy. AT8, MC1, and NFL signals were normalized based on cell number. PSD95 and synaptophysin signals were normalized based on dendritic length. MAP2 staining was used to quantify dendritic length. For this purpose, single neurons were randomly selected, and the total dendritic length of each neuron was tracked and measured using the Image J plugin Neuron J. To measure cell viability, neurons treated with control, TRIM11 ASO, or transduction with AAV9-GFP or AAV9-TRIM11, and then treated with myc-K18 / P301L PFF for two weeks were analyzed using Cell Counting KIT-8 (Dojindo Laboratories, CK04) according to the manufacturer's instructions.

[0262] Stereotactic injection PS19 or 3×Tg-AD-AD mice of either sex were anesthetized with a ketamine / xylazine mixture (100 mg / kg ketamine, 10 mg / kg xylazine, ip) and fixed to a stereotactic frame (Angle II, Leica Biosystems). A 10 μl Hamilton syringe was used to inject the mixture into the designated coordinates. The following were injected into the mouse hippocampus (bregma, AP -2.5 mm, ML, +2.0 mm and DV, -1.8 mm) or lateral ventricle (bregma, AP -2.5 mm, ML, +2.0 mm and DV, -1.8 mm): (1) rAAV9-TRIM11 or rAAV9-GFP (5×10 13 (1) GC / ml, 5 μl) or (2) rAAV9-TRIM11 or rAAV9-GFP + K18 tau PFF (2 μg / μl, 2.5 μl) was injected. Specifically, rAAV9-GFP or rAAV9-TRIM11 was injected into the hippocampus of 10-week-old PS19 mice, and tau PFF and rAAV9-GFP or rAAV9-TRIM11 were injected into the hippocampus of 4-week-old PS19 mice. rAAV9-GFP or rAAV9-TRIM11 was injected into the hippocampus of 12-month-old 3×Tg-AD-AD mice, and rAAV9-GFP or rAAV9-TRIM11 was injected into the lateral ventricles of 9-month-old 3×Tg-AD-AD mice. All animals were given an analgesic (10 mg / kg bupivacaine) during surgery and monitored during and for 3 days post-surgery.

[0263] Western blot analysis of mouse brains PS19 mice injected with tau PFF and rAAV9-GFP or rAAV9-TRIM11 were euthanized at 12 weeks of age using carbon dioxide asphyxiation. The hippocampus of the injected PS19 mice was carefully dissected and stored at -80°C until use. The same procedure was performed on the remaining mouse models at the following time points: 10 months of age for PS19 mice injected with rAAV9; 13 months of age for 3×Tg-AD-AD mice injected with rAAV9 in the hippocampus; and 13.5 months of age for 3×Tg-AD-AD mice injected with rAAV9 in the lateral ventricle.

[0264] Hippocampus was dissolved on ice for 30 minutes in a lysis buffer (50 mM Tris pH 8.8, 100 mM NaCl, 5 mM MgCl2, 0.5% NP-40, 1 mM DTT, 250 IU / ml benzonase, 1 mM PMSF, and 1× complete protease inhibitor cocktail). The lysate was centrifuged at 4°C and 13,000 rpm for 15 minutes. The NP-40 soluble supernatant was collected as the SN fraction. The NP-40 insoluble pellet was washed with PBS and then resuspended on ice for 30 minutes in a pellet buffer (20 mM Tris pH 8.0, 15 mM MgCl2, 1 mM DTT, 250 IU / ml benzonase, 1 mM PMSF, and 1× complete protease inhibitor cocktail). The aggregated proteins in the pellet were boiled in a buffer containing 2% SDS. Clarified samples containing equal amounts of protein were separated on a 10% SDS-polyacrylamide gel and analyzed by Western blotting.

[0265] Immunohistochemical analysis of mouse brain Mice were perfused intracardiacly with PBS and 4% paraformaldehyde (PFA), then the brains were removed and fixed in PFA for 48 hours. They were thoroughly rinsed with PBS and then embedded in paraffin blocks, from which 7 μm thick sections were cut for histological analysis. The slides were baked at 60°C for 30 minutes, followed by deparaffinization with xylene (two washes for 5 minutes each), and rehydration using an ethanol gradient (1 min 100% EtOH, 1 min 95% EtOH, 1 min 70% EtOH, and 1 min 50% EtOH). Antigen retrieval was performed as previously reported (H. Kai et al., J Histochem Cytochem 60, 761-769 (2012)). Specifically, brain tissue sections were incubated at 90°C for 5 minutes in 10 mM EDTA (pH 3.0, pH 6.0, and pH 10.0) and 0.1 M sodium citrate (pH 3.0, pH 7.2, and pH 10.0), respectively. Proteolytic digestion of the tissue sections was performed at 37°C for 30 minutes using 1.0 μg / ml proteinase K and 100.0 μg / ml trypsin dissolved in 1.0 mM CaCl2 / 50 mM Tris buffer (pH 7.6). The sections were incubated in FA at room temperature for 5 minutes. After antigen retrieval, the sections were washed with tap water for at least 5 minutes, then washed with PBS, and permeabilized at room temperature for 1 hour in blocking buffer (PBS containing 10% goat serum, 2% BSA, 0.1% Triton X-100, and 0.05% Tween 20). The sections were incubated overnight at 4°C with an antibody against AT8 (1:200, Thermo Fisher Scientific, MN1020) and treated with DAB (3,3'-diaminobenzidine) staining as previously reported (R. Gordon et al., Nat Commun 7, 12932 (2016)). The sections were counterstained with hematoxylin, then dehydrated, clarified in xylene, and mounted on slides using DPX mounting medium (Electron Microscopy Science). The samples were visualized, and microscopic images of the sections were acquired using an inverted fluorescence microscope (Revolve, Echo Laboratories).

[0266] AT8, GFAP, and Iba1 staining were quantified using ImageJ. The hippocampal region was outlined and isolated, and the color was separated using "Color Deconvolution - H&E DAB". The threshold was automatically set, and the staining intensity was measured. For AT8 staining, the average staining intensity for GFP or TRIM11 injected groups (6 mice each) was calculated and presented as relative intensity. For GFAP and Iba1 staining, the percentage of the hippocampal area stained was calculated.

[0267] Object Recognition Test First, the mice were allowed to acclimate to an empty open-field maze (mentioned above) for 5 minutes. After 24 hours, the mice were placed in the center of a chamber containing two identical objects 5 cm away from the wall and allowed to explore these objects for 10 minutes. After 12 hours, the mice were placed in the center of the chamber containing the same two identical objects and allowed to explore for 10 minutes. After 6 hours, the mice were placed in the center of a chamber containing one familiar object and one new object and allowed to explore for 10 minutes. The mice were recorded and tracked using a video camera linked to automated tracking software (ANY-maze, SD Instruments). The discrimination index was calculated by subtracting the time spent exploring the new object from the time spent exploring the familiar object, and dividing the difference by the sum of the time spent exploring the familiar object and the time spent exploring the new object. The preference index was calculated by dividing the time spent searching for new objects by the sum of the time spent searching for new objects and the time spent searching for familiar objects, and then multiplying this quotient by 100 to obtain a percentage (LM Lueptow, J Vis Exp, (2017)).

[0268] Y-shaped maze test To measure hippocampus-dependent memory, mice were tested for spontaneous alternation behavior in a Y-maze (ANY-maze, SD Instruments). Mice were placed in the center of a three-armed Y-maze and tracked for 5 minutes. Spontaneous alternation behavior was scored as the ratio of alternations (entering an arm different from the previous two choices) to the total number of alternation opportunities, based on the following formula: % Spontaneous Alternation = Number of Spontaneous Alternations / (Total Number of Arm Entries - 2) × 100.

[0269] Wire suspension test To measure gripping force, mice were placed on a mesh wire, allowed to acclimate for 30 seconds, and then the mesh was inverted. The wire was suspended 15 cm above an empty, clean cage, and the latency to fall was measured. The maximum study time was 3 minutes. The average fall latency over three tests conducted over one day was analyzed.

[0270] Open field testing To analyze exploratory movement behavior, a multi-unit open-field maze (SD Instruments) made of white, high-density, non-porous plastic was used, consisting of four activity chambers, each measuring 50 cm (length) x 50 cm (width) x 38 cm (height). Mice were placed in the center of the chamber at the start of the experiment. After a 2-minute acclimatization period, the mice were monitored for 10 minutes using a video camera linked to automated tracking software (ANY-maze, SD Instruments) to track total distance traveled, total travel time, total freezing time, and time spent in each of the four designated activity chambers.

[0271] Software GraphPad Prism 7, ImageJ, ZEN lite: Carl Zeiss Microscopy.

[0272] statistical analysis Data are presented as mean ± standard deviation (SD) or mean ± standard error of the mean (SEM). Unless otherwise specified, a two-tailed Student's t-test was used to assess the statistical significance of the mean values ​​between two groups. * P<0.05;** P<0.01; *** P<0.001). Figures were created and statistical analysis was completed using PrismgraphPad 7.

[0273] Each experiment was performed at least three times or with at least three biological duplicates.

[0274] The experimental results are described below.

[0275] Effect of TRIM protein on tau aggregation To determine the effect of TRIM proteins on tau aggregation, two approaches were combined: (1) systematically analyzing all known human TRIMs for their ability to remove tau aggregates in cultured cells, and (2) comparing the expression of TRIMs exhibiting potent effects in human autopsy tissue from AD and control individuals. For systematic analysis, 75 TRIMs were individually cloned into mammalian expression vectors (Table 1). Each TRIM was introduced into HEK293T cells with GFP-tau P301L (M. Hutton et al., Nature 393, 702-705 (1998); C. Dumanchin et al., Hum Mol Genet 7, 1825-1829 (1998)), an enhanced green fluorescent protein fusion of the longest isoform of human tau (containing two inserts and four microtubule-binding repeats 2N4R at the N-terminus) with the P301L mutation associated with familial FTLD. When GFP-tau P301L was expressed alone, insoluble aggregates were generated on nonionic surfactants (Figures 1A-1C). When co-expressed with ...

Claims

1. A composition for treating or preventing diseases or disorders related to aggregation of one or more substances selected from the group consisting of tau, α-synuclein (α-Syn), superoxide dismutase 1 (SOD1), TAR DNA-binding protein 43 (TDP-43), fused in sarcoma / translocated in lipoSarcoma (FUS / TLS), ataxin 1, huntingtin (Htt), Aβ42, and heteroribonucleoprotein A1 (hnRNPA1), It contains an activator of the level or activity of one or more tripartite motif (TRIM) proteins, Here, one or more TRIM proteins include human TRIM10, TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM11, TRIM17, TRIM18, TRIM19, TRIM21, TRIM24, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM37, TRIM39, TRIM40, T It is one or more selected from the group consisting of RIM41, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM56, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, TRIM70, TRIM71, TRIM73, and TRIM77. composition.

2. The composition according to claim 1, wherein the activator is one or more selected from the group consisting of compounds, proteins, peptides, peptide mimes, antibodies, ribozymes, small molecule compounds, nucleic acids, vectors, antisense nucleic acids, siRNA, shRNA, and guide RNA.

3. The disease or disorder is related to the aggregation of tau, Here, one or more TRIM proteins are TRIM10, TRIM2, TRIM3, TRIM4, TRIM5, TRIM9, TRIM11, TRIM12, TRIM17, TRIM18, TRIM19, TRIM21, TRIM26, TRIM29, TRIM30, TRIM31, TRIM34, TRIM36, TRIM The composition according to claim 1, selected from the group consisting of 39, TRIM40, TRIM42, TRIM43, TRIM46, TRIM47, TRIM48, TRIM49, TRIM52, TRIM54, TRIM55, TRIM58, TRIM63, TRIM64, TRIM65, TRIM68, TRIM69, and TRIM70.

4. The disease or disorder is related to the aggregation of α-Syn, The composition according to claim 1, wherein one or more TRIM proteins are selected from the group consisting of TRIM10, TRIM2, TRIM3, TRIM17, TRIM18, TRIM19, TRIM26, TRIM29, TRIM30, TRIM31, TRIM36, TRIM41, TRIM42, TRIM43, TRIM46, TRIM49, TRIM55, TRIM56, TRIM63, TRIM64, TRIM68, TRIM69, TRIM70, TRIM71, and TRIM73.

5. The disease or disorder is related to the aggregation of SOD1, The composition according to claim 1, wherein one or more TRIM proteins are selected from the group consisting of TRIM10, TRIM11, TRIM24, TRIM36, and TRIM58.

6. The disease or disorder is related to the aggregation of TDP-43, The composition according to claim 1, wherein one or more TRIM proteins are selected from the group consisting of TRIM10, TRIM11, TRIM17, TRIM36, TRIM37, TRIM40, TRIM49, and TRIM55.

7. The disease or disorder is associated with the aggregation of FUS / TLS, ataxin 1, Htt, Aβ42, and hnRNPA1. The composition according to claim 1, wherein one or more TRIM proteins are TRIM10.

8. The composition according to any one of claims 3 to 7, wherein the activator of the TRIM protein is a peptide comprising the amino acid sequence of the TRIM protein or a functional variant thereof.

9. The composition according to any one of claims 3 to 7, wherein the activator of the TRIM protein is a nucleic acid encoding the TRIM protein or a functional variant thereof.

10. The composition according to any one of claims 3 to 7, wherein the TRIM protein activator is a vector containing a nucleic acid encoding the TRIM protein or a functional variant thereof.

11. The composition according to claim 10, wherein the vector is a virus.

12. The composition according to claim 11, wherein the virus is an adeno-associated virus.

13. A method for treating or preventing neurodegenerative diseases or disorders related to the aggregation of one or more proteins selected from the group consisting of tau, α-Syn, SOD1, TDP-43, FUS / TLS, ataxin 1, Htt, Aβ42, and hnRNPA1, The method involves administering the composition described in any one of claims 1 to 12 to a subject. method.

14. Neurodegenerative diseases or disorders associated with tau include Alzheimer's disease, frontotemporal lobar degeneration (FTLD-tau), progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), argyrophilic granulopathy (AGD), frontotemporal dementia parkinsonism linked to chromosome 17 (FTDP-17), vacuolar tauopathy, Lytico-bodig disease, glial tauopathy (GGT), age-related tau astroligatosis (ARTAG), Pick's disease, and amyotrophic lateral sclerosis (ALS). The group consists of primary age-related tauopathy (PART), neurofibrillary tangle-type senile dementia (TOD), chronic traumatic encephalopathy (CTE), anti-IgLON5-related tauopathy, Guadeloupe parkinsonism, multiple system proteinopathy (MSP), nodding syndrome (NS), ganglioglioma, gangliocytoma, meningeal hemangioma, post-encephalitis parkinsonism, subacute sclerosing panencephalitis (SSPE), lead encephalopathy, tuberous sclerosis, pantothenate kinase-related neurodegeneration, and lipofuscinosis. The method according to claim 13, wherein the activator of one or more TRIM proteins is one or more activators selected from the group consisting of TRIM10, TRIM11, and TRIM55.

15. Administering the composition a) Reduce the number of tau aggregates by at least about 60%. b) Reducing the ratio of insoluble tau to soluble tau by at least about 50%, and c) To reduce tau aggregates by approximately 90% within 6 to 8 days after administration of the composition. The method according to claim 14, which is effective for one or more selected from the group consisting of the following.

16. A group of neurodegenerative diseases or disorders related to α-synchn were selected from the following: Parkinson's disease (PD), Lewy body dementia (DLB), multiple system atrophy (MSA), Shy-Drager syndrome, striatonigral degeneration, olivopontocerebellar atrophy, Haller-Folden-Spats syndrome, REM sleep behavior disorder (RPD), and Alzheimer's disease with amygdala-restricted Lewy bodies (AD / ALB). The method according to claim 13, wherein the activator of one or more TRIM proteins is one or more activators selected from the group consisting of TRIM10, TRIM36, TRIM55, and TRIM68.

17. SOD1-related neurodegenerative diseases or disorders are selected from the group consisting of amyotrophic lateral sclerosis (ALS) and Parkinson's disease (PD). The method according to claim 13, wherein the activator of one or more TRIM proteins is one or more activators selected from the group consisting of TRIM10, TRIM11, TRIM24, TRIM36, and TRIM58.

18. Neurodegenerative diseases or disorders related to TDP-43 were selected from the group consisting of frontotemporal dementia (FTD), frontotemporal lobar degeneration (FTLD-TDP), multiple system proteinopathy (MSP), Perry's disease, facial-onset sensorimotor neuropathy (FOSMN), Alzheimer's disease (AD), cerebral age-related TDP-43 sclerosis (CARTS), limbic-dominant age-related TDP-43 encephalopathy (LATE), sporadic inclusion body myositis (sIBM), chronic traumatic encephalopathy (CTE), primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), Guam-PDC, Guam-ALS, Parkinson's disease (PD), and Huntington's disease (HD). The method according to claim 13, wherein the activator of one or more TRIM proteins is one or more activators selected from the group consisting of TRIM10, TRIM11, TRIM17, TRIM36, TRIM37, TRIM40, TRIM49, and TRIM55.

19. The method according to any one of claims 13 to 18, comprising administering the composition into the cerebrospinal fluid (CSF) of the subject.

20. The method according to claim 19, wherein the composition is administered by intraventricular (ICV) injection.

21. The method according to any one of claims 13 to 20, wherein the composition is administered to the subject before the onset of symptoms of the disease or disorder.

22. The method according to any one of claims 13 to 20, wherein the composition is administered to the subject after the onset of symptoms of the disease or disorder.

23. The method according to any one of claims 13 to 22, further comprising administering one or more additional therapeutic agents.

Images