Armored T cells

Abstract

This disclosure relates to compositions and methods for treating cancer using a population of cells having a disrupted A20 gene.

Description

[Technical Field]

[0001] This disclosure relates to methods, cells, and compositions for preparing cell populations and compositions for immunotherapy. In particular, this specification provides cell populations containing the disrupted TNF-alpha-inducible protein 3 (A20;TNFAIP3) gene, as well as methods for preparing and using such populations.

[0002] This application includes an electronically submitted sequence listing, which is incorporated herein by reference in its entirety. The sequence listing submitted herein is contained in an XML file titled "ARMCART(TNFA20)-100-US-PSP_Sequence-Listing.xml", created on 3 June 2024, and has a size of 3,658 bytes. [Background technology]

[0003] Genetically engineered immunotherapies have been transformative for patients with malignant diseases in recent years. Since 2017, the number of clinical trials investigating adoptive cell therapies such as CAR-T cells, NK and NKT cells, T cell receptor (TCR)-T cells, tumor-infiltrating lymphocytes (TILs), tumor-specific antigen-targeted T cells, CAR-NK cells and CAR-NKT cells, and other cell therapies has increased rapidly. While genetically engineered immunotherapies have a very high potential to be curative for patients, many factors limit the widespread development and administration of such therapies. Most immunotherapies are accompanied by various issues such as the quality of cell products, cytokine release syndrome and other toxicities, long manufacturing times, high costs, and limitations on the period during which these therapies can be genetically modified to enhance their efficacy and / or potency after administration to patients [1]. Clinical responses in the treatment of solid tumors are moderate, and improved genetically engineered immunotherapies are needed, particularly for solid tumors. This disclosure describes cell populations and methods to address this unmet need. [Overview of the project]

[0004] This specification provides a population of cells containing the disrupted TNF-alpha-inducible protein 3 (A20; TNFAIP3) gene, as well as methods for producing and using such a population. Such a population can influence the tumor microenvironment and provide many of the additional benefits described herein, enabling T cell survival in an immunosuppressive tumor microenvironment (TME). The inventors have found that A20 deficiency in CAR-T cells can result in prolonged activation, enhanced efficacy, enhanced NF-κB activation, and higher levels of IFNγ secretion compared to unarmored CAR-T cells. Furthermore, A20 deficiency in CAR-T cells has been found to delay the onset of dysfunction and maintain the ability of CAR-T cells to kill tumor cells for longer than unarmored cells.

[0005] In one embodiment, the disclosure provides a population of cells containing a disrupted TNF-alpha-inducible protein 3 (A20; TNFAIP3) gene. In some embodiments, the cell population further comprises nucleic acids containing isolated nucleotide sequences encoding a chimeric antigen receptor (CAR). In some embodiments, the cell population is an autologous cell population or an allogeneic cell population. In some embodiments, the cell population is a T cell population, a cytotoxic T lymphocyte (CTL) population, or a tumor-infiltrating lymphocyte population. In some embodiments, the cell population includes total T cells. In some embodiments, the cell population is CD8 + Includes T cells. In some embodiments, the cell population is CD4 + It includes T cells. In some embodiments, the cell population includes human primary immune cells.

[0006] In some embodiments, at least about 90%, at least about 95%, or at least about 99% of the cells in a population of cells do not express A20. In some embodiments, at least about 90%, at least about 95%, or at least about 99% of the cells in a population of cells express CAR.

[0007] In some embodiments, the cell population exhibits at least approximately 2-fold, at least approximately 2.5-fold, at least approximately 3-fold, at least approximately 4-fold, or at least approximately 5-fold enhanced activation of the NF-κB pathway. In some embodiments, the cell population exhibits antitumor activity. In some embodiments, the cell population exhibits enhanced antitumor activity.

[0008] In some embodiments, the present disclosure provides a pharmaceutical composition comprising a population of cells disclosed herein and a pharmaceutically acceptable carrier.

[0009] In some embodiments, the present disclosure provides a method for treating cancer in a subject requiring treatment for cancer, the method comprising administering a population of cells or a pharmaceutical composition disclosed herein to the subject.

[0010] In some embodiments, cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, gastric cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, or metastatic forms thereof.

[0011] In another embodiment, the Disclosure provides a method for treating cancer, comprising administering an effective dose to a subject in need of cancer treatment of a population of cells containing a disrupted TNF-alpha-inducible protein 3 (A20; TNFAIP3) gene and a chimeric antigen receptor (CAR). In some embodiments, the Method further comprises inhibiting tumor growth, inducing tumor regression, and / or extending survival of the subject. In some embodiments of the Method, the population of cells is an autologous cell population or an allogeneic cell population. In some embodiments, the population of cells is a T cell population, a cytotoxic T lymphocyte (CTL) population, or a tumor-infiltrating lymphocyte population. In some embodiments, the population of cells includes total T cells. In some embodiments, the population of cells is CD8 + Includes T cells. In some embodiments, the cell population is CD4 + It includes T cells. In some embodiments, the cell population includes human primary immune cells.

[0012] In some embodiments of this method, cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, gastric cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, or metastatic forms thereof. In some embodiments, the cell population exhibits enhanced antitumor activity.

[0013] In another aspect, the present disclosure provides a method for treating cancer, namely: (a) obtaining a population of cells from a donor; (b) genetically modifying the population of cells to disrupt the TNF-alpha-inducible protein 3 (A20; TNFAIP3) gene; (c) growing the population of genetically modified cells; and (d) administering the grown population of genetically modified cells to a patient.

[0014] In some embodiments of this method, A20 is destroyed by the Cas / CRISPR system. In some embodiments, the method further includes introducing a chimeric antigen receptor (CAR) into a population of cells.

[0015] In some embodiments, the method further includes inhibiting tumor growth, inducing tumor regression, and / or extending survival.

[0016] In some embodiments of this method, the cell population is an autologous cell population or an allogeneic cell population. In some embodiments, the cell population is a T cell population, a cytotoxic T lymphocyte (CTL) population, or a tumor-infiltrating lymphocyte population. In some embodiments, the cell population includes total T cells. In some embodiments, the cell population is CD8 + Includes T cells. In some embodiments, the cell population is CD4 + It includes T cells. In some embodiments, the cell population includes human primary immune cells.

[0017] In some embodiments of this method, cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, gastric cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, gastric cancer, testicular cancer, pharyngeal cancer, thyroid cancer, uterine cancer, or metastatic forms thereof. In some embodiments, the cell population exhibits enhanced antitumor activity.

[0018] In some embodiments, the Disclosure provides a method for treating a disease or condition in a subject requiring treatment of the disease or condition, comprising administering a population of cells or a pharmaceutical composition disclosed herein to the subject. In some embodiments, the disease or condition includes cancer. In some embodiments, cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, gastric cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, gastric cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, or metastatic forms thereof.

[0019] In some embodiments, the Disclosure provides the use of a population of cells or a pharmaceutical composition disclosed herein as a pharmaceutically acceptable treatment in subjects requiring treatment of a disease or condition. In some embodiments, the disease or condition includes cancer. In some embodiments, cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, gastric cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, gastric cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, or metastatic forms thereof.

[0020] In yet another embodiment, the disclosure provides the use of a population of cells containing a disrupted TNF-alpha-inducible protein 3 (A20; TNFAIP3) gene for the manufacture of a pharmaceutical for treating cancer in a patient. In some embodiments of use, the population of cells further comprises nucleic acids containing isolated nucleotide sequences encoding a chimeric antigen receptor (CAR).

[0021] In yet another aspect, the present disclosure provides a population of cells for treating cancer in a patient, the population of cells comprising cells having a disrupted TNF alpha-induced protein 3 (A20; TNFAIP3) gene. In some embodiments, the population of cells further comprises a nucleic acid comprising an isolated nucleotide sequence encoding a chimeric antigen receptor (CAR). BRIEF DESCRIPTION OF THE DRAWINGS

[0022] [Figure 1-1] Efficient knockout (KO) of A20 in CAR-T cells using CRISPR. KO of the A20 gene by CRISPR Figures 1A-1B show efficient knockout (KO) of A20 in CAR-T cells using CRISPR. KO of the A20 gene by CRISPR was performed on the same day as CAR transduction. Western blot shows the expression of A20 protein after 7 days (Figure 1A) or 13 days (Figure 1B) of growth. These results indicate that A20 KO is efficient and stable. [Figure 1-2] Efficient knockout (KO) of A20 in CAR-T cells using CRISPR. KO of the A20 gene by CRISPR Figures 1A-1B show efficient knockout (KO) of A20 in CAR-T cells using CRISPR. KO of the A20 gene by CRISPR was performed on the same day as CAR transduction. Western blot shows the expression of A20 protein after 7 days (Figure 1A) or 13 days (Figure 1B) of growth. These results indicate that A20 KO is efficient and stable. [Figure 2-1] Proliferation rate and CD4 / CD8 ratio of unarmoured or A20-deficient CAR-T cells Figures 2A-2B show the proliferation rate (Figure 2A) and CD4 / CD8 ratio (Figure 2B) of unarmoured or A20-deficient CAR-T cells. The results indicate that the absence of A20 does not substantially affect the proliferation rate (Figure 2A) or CD4 / 8 ratio (Figure 2B) of CAR-T cells. [Figure 2-2]Figures 2A and 2B show the proliferation rate (Figure 2A) and CD4 / CD8 ratio (Figure 2B) of unarmored or A20-deficient CAR-T cells. The results indicate that the absence of A20 does not substantially affect the proliferation rate (Figure 2A) or CD4 / CD8 ratio (Figure 2B) of CAR-T cells. [Figure 3-1] A20 deficiency leads to enhanced NF-κB activation during CAR engagement. Figures 3A-3B show that A20 deficiency leads to enhanced NF-κB activation during CAR engagement. The data confirm that the absence of A20 leads to enhanced NF-κB activation in CAR-T cells. [Figure 3-2] A20 deficiency leads to enhanced NF-κB activation during CAR engagement. Figures 3A-3B show that A20 deficiency leads to enhanced NF-κB activation during CAR engagement. The data confirm that the absence of A20 leads to enhanced NF-κB activation in CAR-T cells. [Figure 4-1] A20 deficiency leads to enhanced NF-κB activation during CAR engagement. Figures 4A-4B show that A20 deficiency leads to enhanced NF-κB activation during CAR engagement. Non-armored or A20 KO CAR-T cells were left unstimulated or stimulated in GPC3-positive tumor cells for 1 or 6 days, and gene expression was analyzed by nanostring. Figure 4A - Volcano plot shows gene ratios in A20 KO cells compared to non-armored CAR-T cells. At all time points analyzed, more than 50% of the upregulated genes were NF-κB target genes. Figure 4B - Heatmap shows the top 20 NF-κB target genes upregulated in A20-deficient CAR-T cells after 6 days. The data confirm that A20 deficiency leads to enhanced NF-κBα activation in CAR-T cells. [Figure 4-2]A20 deficiency leads to enhanced NF-κB activation during CAR engagement. Figures 4A-4B show that A20 deficiency leads to enhanced NF-κB activation during CAR engagement. Non-armored or A20 KO CAR-T cells were left unstimulated or stimulated in GPC3-positive tumor cells for 1 or 6 days, and gene expression was analyzed by nanostring. Figure 4A - Volcano plot shows gene ratios in A20 KO cells compared to non-armored CAR-T cells. At all time points analyzed, more than 50% of the upregulated genes were NF-κB target genes. Figure 4B - Heatmap shows the top 20 NF-κB target genes upregulated in A20-deficient CAR-T cells after 6 days. The data confirm that A20 deficiency leads to enhanced NF-κBα activation in CAR-T cells. [Figure 5] Characterization of Target CAR-T Cell Lines Figure 5 shows the characterization of the target CAR-T cell lines. The cell lines shown were stained for GPC3 expression and analyzed by flow cytometry. Receptor density was calculated using bang beads. [Figure 6] A20 deficiency results in higher levels of IFNγ secretion at all antigen densities. Figure 6 shows that A20 deficiency results in higher levels of IFNγ secretion at all antigen densities. Non-armored or A20 KO CAR-T cells were incubated with tumor cells expressing low, medium / low, or high levels of GPC3 at an E:T ratio of 0.3:1. After 24 hours, the supernatant was collected and IFNγ secretion was evaluated by MSD. [Figure 7] A20 deficiency does not result in increased target cell killing in an acute single-challenge assay. Figure 7 shows that A20 deficiency does not result in increased target cell killing in an acute single-challenge assay. Unarmored or A20 KO CAR-T cells were incubated with tumor cells expressing low, medium / low, or high levels of GPC3 at an E:T ratio of 0.3:1, and cell lysis was assessed by xCELLigence. [Figure 8-1] A20-deficient CAR-T cells show increased and prolonged upregulation of activation markers. Figures 8A and 8B show that A20-deficient CAR-T cells show increased and prolonged upregulation of activation markers. Unarmored or A20 KO CAR-T cells were incubated with tumor cells expressing low (Figure 8A) or high (Figure 8B) levels of GPC3. CD25 and CD69 expression was analyzed by flow cytometry targeting CAR+ cells at 1 or 6 days. When the dot plot was gated in the CD4+ population, similar results were obtained for CD8+ CAR-T cells. A20 deficiency results in a rapid increase in the expression of NF-κB-dependent activation markers CD25 and CD69 on day 1 (D1). At 6 days of incubation, A20 KO cells show higher expression of CD25 and CD69 despite complete killing of target cells. Thus, the absence of A20 results in prolonged CAR-T cell activation. [Figure 8-2] A20-deficient CAR-T cells show increased and prolonged upregulation of activation markers. Figures 8A and 8B show that A20-deficient CAR-T cells show increased and prolonged upregulation of activation markers. Unarmored or A20 KO CAR-T cells were incubated with tumor cells expressing low (Figure 8A) or high (Figure 8B) levels of GPC3. CD25 and CD69 expression was analyzed by flow cytometry targeting CAR+ cells at 1 or 6 days. When the dot plot was gated in the CD4+ population, similar results were obtained for CD8+ CAR-T cells. A20 deficiency results in a rapid increase in the expression of NF-κB-dependent activation markers CD25 and CD69 on day 1 (D1). At 6 days of incubation, A20 KO cells show higher expression of CD25 and CD69 despite complete killing of target cells. Thus, the absence of A20 results in prolonged CAR-T cell activation. [Figure 9-1]A20-deficient CAR-T cells exhibit a similar differentiation pattern compared to unarmored CAR-T cells. Figures 9A–9C show that A20-deficient CAR-T cells exhibit a similar differentiation pattern compared to unarmored CAR-T cells. Unarmored or A20 KO CAR-T cells were incubated with tumor cells expressing low (Figure 9A) or high (Figure 9B) levels of GPC3. After 1 or 6 days, the expression of differentiation markers CD62L and CD45RO was analyzed by flow cytometry targeting CAR+ cells. When the dot plot was gated in the CD4+ population, similar results were obtained for CD8+ CAR-T cells. These data indicate that A20 deficiency does not result in increased differentiation before or after antigen encounter. This is particularly relevant because increased and prolonged expression of activation markers can lead to increased differentiation and therefore decreased stem cell characteristics and persistence. Figure 9C shows that A20 knockout CAR-T cells exhibit similar expression of stem cell genes and exhaustion genes compared to non-armored CAR-T cells. Non-armored or A20 knockout CAR-T cells were incubated with tumor cells expressing high levels of GPC3. After 6 days, gene expression shown was analyzed by nanostring. These data demonstrate that A20 deficiency does not result in increased differentiation antigen encounters, supporting the findings in Figures 9A and 9B. [Figure 9-2]A20-deficient CAR-T cells exhibit a similar differentiation pattern compared to unarmored CAR-T cells. Figures 9A–9C show that A20-deficient CAR-T cells exhibit a similar differentiation pattern compared to unarmored CAR-T cells. Unarmored or A20 KO CAR-T cells were incubated with tumor cells expressing low (Figure 9A) or high (Figure 9B) levels of GPC3. After 1 or 6 days, the expression of differentiation markers CD62L and CD45RO was analyzed by flow cytometry targeting CAR+ cells. When the dot plot was gated in the CD4+ population, similar results were obtained for CD8+ CAR-T cells. These data indicate that A20 deficiency does not result in increased differentiation before or after antigen encounter. This is particularly relevant because increased and prolonged expression of activation markers can lead to increased differentiation and therefore decreased stem cell characteristics and persistence. Figure 9C shows that A20 knockout CAR-T cells exhibit similar expression of stem cell genes and exhaustion genes compared to non-armored CAR-T cells. Non-armored or A20 knockout CAR-T cells were incubated with tumor cells expressing high levels of GPC3. After 6 days, gene expression shown was analyzed by nanostring. These data demonstrate that A20 deficiency does not result in increased differentiation antigen encounters, supporting the findings in Figures 9A and 9B. [Figure 9-3]A20-deficient CAR-T cells exhibit a similar differentiation pattern compared to unarmored CAR-T cells. Figures 9A–9C show that A20-deficient CAR-T cells exhibit a similar differentiation pattern compared to unarmored CAR-T cells. Unarmored or A20 KO CAR-T cells were incubated with tumor cells expressing low (Figure 9A) or high (Figure 9B) levels of GPC3. After 1 or 6 days, the expression of differentiation markers CD62L and CD45RO was analyzed by flow cytometry targeting CAR+ cells. When the dot plot was gated in the CD4+ population, similar results were obtained for CD8+ CAR-T cells. These data indicate that A20 deficiency does not result in increased differentiation before or after antigen encounter. This is particularly relevant because increased and prolonged expression of activation markers can lead to increased differentiation and therefore decreased stem cell characteristics and persistence. Figure 9C shows that A20 knockout CAR-T cells exhibit similar expression of stem cell genes and exhaustion genes compared to non-armored CAR-T cells. Non-armored or A20 knockout CAR-T cells were incubated with tumor cells expressing high levels of GPC3. After 6 days, gene expression shown was analyzed by nanostring. These data demonstrate that A20 deficiency does not result in increased differentiation antigen encounters, supporting the findings in Figures 9A and 9B. [Figure 10-1]A20 deficiency delays T cell dysfunction in serial killing assays against GPC3-expressing cells. Figures 10A–10C show that A20 deficiency delays T cell dysfunction in serial killing assays against GPC3 high (Figure 10A), medium / low (Figure 10B), and low (Figure 10C) expression cells. Unarmored or A20-deficient CAR-T cells were incubated with target cells expressing different levels of GPC3 as effectors: target ratio 0.3:1 (high GPC3) or 2:1 (medium / low GPC3 and low GPC3). After 2–3 days, cell counts were assessed by flow cytometry, and fresh tumor cells were added to the culture to maintain the initial E:T ratio. During the first round of the assay, unarmored and A20 KO CAR-T cells killed all tumor cells regardless of antigen density. However, after several rounds, the efficacy of CAR-T cells decreased as the cells became dysfunctional. A20 deficiency delays the onset of dysfunction, allowing CAR-T receptors to maintain their ability to kill tumor cells for longer than non-armored cells. This is especially true when target cells express very low levels of GPC3. [Figure 10-2]A20 deficiency delays T cell dysfunction in serial killing assays against GPC3-expressing cells. Figures 10A–10C show that A20 deficiency delays T cell dysfunction in serial killing assays against GPC3 high (Figure 10A), medium / low (Figure 10B), and low (Figure 10C) expression cells. Unarmored or A20-deficient CAR-T cells were incubated with target cells expressing different levels of GPC3 as effectors: target ratio 0.3:1 (high GPC3) or 2:1 (medium / low GPC3 and low GPC3). After 2–3 days, cell counts were assessed by flow cytometry, and fresh tumor cells were added to the culture to maintain the initial E:T ratio. During the first round of the assay, unarmored and A20 KO CAR-T cells killed all tumor cells regardless of antigen density. However, after several rounds, the efficacy of CAR-T cells decreased as the cells became dysfunctional. A20 deficiency delays the onset of dysfunction, allowing CAR-T receptors to maintain their ability to kill tumor cells for longer than non-armored cells. This is especially true when target cells express very low levels of GPC3. [Figure 10-3]A20 deficiency delays T cell dysfunction in serial killing assays against GPC3-expressing cells. Figures 10A–10C show that A20 deficiency delays T cell dysfunction in serial killing assays against GPC3 high (Figure 10A), medium / low (Figure 10B), and low (Figure 10C) expression cells. Unarmored or A20-deficient CAR-T cells were incubated with target cells expressing different levels of GPC3 as effectors: target ratio 0.3:1 (high GPC3) or 2:1 (medium / low GPC3 and low GPC3). After 2–3 days, cell counts were assessed by flow cytometry, and fresh tumor cells were added to the culture to maintain the initial E:T ratio. During the first round of the assay, unarmored and A20 KO CAR-T cells killed all tumor cells regardless of antigen density. However, after several rounds, the efficacy of CAR-T cells decreased as the cells became dysfunctional. A20 deficiency delays the onset of dysfunction, allowing CAR-T receptors to maintain their ability to kill tumor cells for longer than non-armored cells. This is especially true when target cells express very low levels of GPC3. [Figure 11-1] Enhanced tumor control in serial killing assays does not correlate with enhanced proliferation. Figures 11A–11C demonstrate that enhanced tumor control in serial killing assays does not correlate with enhanced proliferation. GPC3-expressing cells—high (Figure 11A), medium / low (Figure 11B), and low (Figure 11C)—were treated as shown in Figure 10. Proliferation rates were calculated based on the number of CAR+ cells counted after each round of killing. The data show that A20 KO cells did not proliferate further compared to non-armored cells, and therefore the enhanced tumor control was a result of enhanced intrinsic effector capacity. [Figure 11-2]Enhanced tumor control in serial killing assays does not correlate with enhanced proliferation. Figures 11A–11C demonstrate that enhanced tumor control in serial killing assays does not correlate with enhanced proliferation. GPC3-expressing cells—high (Figure 11A), medium / low (Figure 11B), and low (Figure 11C)—were treated as shown in Figure 10. Proliferation rates were calculated based on the number of CAR+ cells counted after each round of killing. The data show that A20 KO cells did not proliferate further compared to non-armored cells, and therefore the enhanced tumor control was a result of enhanced intrinsic effector capacity. [Figure 11-3] Enhanced tumor control in serial killing assays does not correlate with enhanced proliferation. Figures 11A–11C demonstrate that enhanced tumor control in serial killing assays does not correlate with enhanced proliferation. GPC3-expressing cells—high (Figure 11A), medium / low (Figure 11B), and low (Figure 11C)—were treated as shown in Figure 10. Proliferation rates were calculated based on the number of CAR+ cells counted after each round of killing. The data show that A20 KO cells did not proliferate further compared to non-armored cells, and therefore the enhanced tumor control was a result of enhanced intrinsic effector capacity. [Figure 12-1] A20 deficiency delays the reduction in effector cytokine production in serial killing assays against high-GPC3-expressing cells. Figures 12A–12C show that A20 deficiency delays the reduction in effector cytokine production in serial killing assays against high-GPC3-expressing cells. Unarmored or A20-deficient CAR-T cells were incubated with target cells expressing high levels of GPC3 as effectors: target ratio 0.3:1 (high GPC3) or 2:1 (medium / low GPC3 and low GPC3). Serial killing assays were performed as described above (Figure 10). IFNγ (Figure 12A), IL2 (Figure 12B), and TNFα (Figure 12C) in the supernatant were analyzed after 3, 5, or 6 rounds of serial killing. A20 KO CAR-T cells produced more effector cytokines and demonstrated enhanced activation compared to unarmored CAR-T cells, even after multiple rounds of stimulation. [Figure 12-2]A20 deficiency delays the reduction in effector cytokine production in serial killing assays against high-GPC3-expressing cells. Figures 12A–12C show that A20 deficiency delays the reduction in effector cytokine production in serial killing assays against high-GPC3-expressing cells. Unarmored or A20-deficient CAR-T cells were incubated with target cells expressing high levels of GPC3 as effectors: target ratio 0.3:1 (high GPC3) or 2:1 (medium / low GPC3 and low GPC3). Serial killing assays were performed as described above (Figure 10). IFNγ (Figure 12A), IL2 (Figure 12B), and TNFα (Figure 12C) in the supernatant were analyzed after 3, 5, or 6 rounds of serial killing. A20 KO CAR-T cells produced more effector cytokines and demonstrated enhanced activation compared to unarmored CAR-T cells, even after multiple rounds of stimulation. [Figure 12-3] A20 deficiency delays the reduction in effector cytokine production in serial killing assays against high-GPC3-expressing cells. Figures 12A–12C show that A20 deficiency delays the reduction in effector cytokine production in serial killing assays against high-GPC3-expressing cells. Unarmored or A20-deficient CAR-T cells were incubated with target cells expressing high levels of GPC3 as effectors: target ratio 0.3:1 (high GPC3) or 2:1 (medium / low GPC3 and low GPC3). Serial killing assays were performed as described above (Figure 10). IFNγ (Figure 12A), IL2 (Figure 12B), and TNFα (Figure 12C) in the supernatant were analyzed after 3, 5, or 6 rounds of serial killing. A20 KO CAR-T cells produced more effector cytokines and demonstrated enhanced activation compared to unarmored CAR-T cells, even after multiple rounds of stimulation. [Figure 13-1]Absence of A20 enhances the efficacy of CAR-T cells against high-GPC3-expressing tumors. Figures 13A–13D show that absence of A20 enhances the efficacy of CAR-T cells against high-GPC3-expressing tumors. Hep3B was subcutaneously transplanted into the flanks of NSG mice. When the tumor volume reached 200 mm3, untransduced T cells (UT) or CAR-T cells were intravenously injected at doses of 0.5e6 or 2e6 cells / mouse. Tumor volume was measured every two weeks. Figure 13A – Graph shows the tumor volume of individual mice in studies injected with 0.5e6 CAR-T cells or UTs. UT cells were unable to control tumor growth. Mice injected with unarmored CAR-T cells experienced partial tumor control, and only 3 out of 9 mice were able to maintain a tumor volume below 500 mm3 over the long term. In contrast, six of the nine mice injected with A20 KO CAR-T cells were able to maintain a tumor volume of less than 500 mm³ for approximately 10 days. Mice injected with 2e6 CAR-T cells generally experienced deeper and more persistent tumor control compared to mice injected with lower doses of cells (Figure 13B). Non-armored CAR-T cells induced complete regression (CR) in three of seven mice (42%), while A20 KO CAR-T cells induced CR in seven of eight mice (87%) (Figure 13B). Four A20 KO injected mice already had CR at day 17 post-injection (D17) compared to the only mouse injected with non-armored CAR-T cells. A20 KO CAR-T cells were able to mediate long-term tumor control, as reflected by a statistically significant difference in survival (Figure 13D) (Figure 13C). These data demonstrate that A20 KO CAR-T cells have superior efficacy against high-GPC3-expressing tumors compared to non-armored CAR-T cells. [Figure 13-2]Absence of A20 enhances the efficacy of CAR-T cells against high-GPC3-expressing tumors. Figures 13A–13D show that absence of A20 enhances the efficacy of CAR-T cells against high-GPC3-expressing tumors. Hep3B was subcutaneously transplanted into the flanks of NSG mice. When the tumor volume reached 200 mm3, untransduced T cells (UT) or CAR-T cells were intravenously injected at doses of 0.5e6 or 2e6 cells / mouse. Tumor volume was measured every two weeks. Figure 13A – Graph shows the tumor volume of individual mice in studies injected with 0.5e6 CAR-T cells or UTs. UT cells were unable to control tumor growth. Mice injected with unarmored CAR-T cells experienced partial tumor control, and only 3 out of 9 mice were able to maintain a tumor volume below 500 mm3 over the long term. In contrast, six of the nine mice injected with A20 KO CAR-T cells were able to maintain a tumor volume of less than 500 mm³ for approximately 10 days. Mice injected with 2e6 CAR-T cells generally experienced deeper and more persistent tumor control compared to mice injected with lower doses of cells (Figure 13B). Non-armored CAR-T cells induced complete regression (CR) in three of seven mice (42%), while A20 KO CAR-T cells induced CR in seven of eight mice (87%) (Figure 13B). Four A20 KO injected mice already had CR at day 17 post-injection (D17) compared to the only mouse injected with non-armored CAR-T cells. A20 KO CAR-T cells were able to mediate long-term tumor control, as reflected by a statistically significant difference in survival (Figure 13D) (Figure 13C). These data demonstrate that A20 KO CAR-T cells have superior efficacy against high-GPC3-expressing tumors compared to non-armored CAR-T cells. [Figure 13-3]Absence of A20 enhances the efficacy of CAR-T cells against high-GPC3-expressing tumors. Figures 13A–13D show that absence of A20 enhances the efficacy of CAR-T cells against high-GPC3-expressing tumors. Hep3B was subcutaneously transplanted into the flanks of NSG mice. When the tumor volume reached 200 mm3, untransduced T cells (UT) or CAR-T cells were intravenously injected at doses of 0.5e6 or 2e6 cells / mouse. Tumor volume was measured every two weeks. Figure 13A – Graph shows the tumor volume of individual mice in studies injected with 0.5e6 CAR-T cells or UTs. UT cells were unable to control tumor growth. Mice injected with unarmored CAR-T cells experienced partial tumor control, and only 3 out of 9 mice were able to maintain a tumor volume below 500 mm3 over the long term. In contrast, six of the nine mice injected with A20 KO CAR-T cells were able to maintain a tumor volume of less than 500 mm³ for approximately 10 days. Mice injected with 2e6 CAR-T cells generally experienced deeper and more persistent tumor control compared to mice injected with lower doses of cells (Figure 13B). Non-armored CAR-T cells induced complete regression (CR) in three of seven mice (42%), while A20 KO CAR-T cells induced CR in seven of eight mice (87%) (Figure 13B). Four A20 KO injected mice already had CR at day 17 post-injection (D17) compared to the only mouse injected with non-armored CAR-T cells. A20 KO CAR-T cells were able to mediate long-term tumor control, as reflected by a statistically significant difference in survival (Figure 13D) (Figure 13C). These data demonstrate that A20 KO CAR-T cells have superior efficacy against high-GPC3-expressing tumors compared to non-armored CAR-T cells. [Figure 13-4]Absence of A20 enhances the efficacy of CAR-T cells against high-GPC3-expressing tumors. Figures 13A–13D show that absence of A20 enhances the efficacy of CAR-T cells against high-GPC3-expressing tumors. Hep3B was subcutaneously transplanted into the flanks of NSG mice. When the tumor volume reached 200 mm3, untransduced T cells (UT) or CAR-T cells were intravenously injected at doses of 0.5e6 or 2e6 cells / mouse. Tumor volume was measured every two weeks. Figure 13A – Graph shows the tumor volume of individual mice in studies injected with 0.5e6 CAR-T cells or UTs. UT cells were unable to control tumor growth. Mice injected with unarmored CAR-T cells experienced partial tumor control, and only 3 out of 9 mice were able to maintain a tumor volume below 500 mm3 over the long term. In contrast, six of the nine mice injected with A20 KO CAR-T cells were able to maintain a tumor volume of less than 500 mm³ for approximately 10 days. Mice injected with 2e6 CAR-T cells generally experienced deeper and more persistent tumor control compared to mice injected with lower doses of cells (Figure 13B). Non-armored CAR-T cells induced complete regression (CR) in three of seven mice (42%), while A20 KO CAR-T cells induced CR in seven of eight mice (87%) (Figure 13B). Four A20 KO injected mice already had CR at day 17 post-injection (D17) compared to the only mouse injected with non-armored CAR-T cells. A20 KO CAR-T cells were able to mediate long-term tumor control, as reflected by a statistically significant difference in survival (Figure 13D) (Figure 13C). These data demonstrate that A20 KO CAR-T cells have superior efficacy against high-GPC3-expressing tumors compared to non-armored CAR-T cells. [Figure 14]A20 KO CAR-T cells produce more IFNy in vivo. Figure 14 shows that A20 KO CAR-T cells produce more IFNγ in vivo. Mice treated as shown in Figure 12 were collected from the serum 7 days after T cell infusion, and serum IFNγ was analyzed. Higher levels of IFNγ were present in the serum of A20 KO mice, consistent with in vitro findings (Figure 6) demonstrating that the absence of A20 leads to enhanced CAR-T cell activation in vivo. [Figure 15-1] Absence of A20 enhances the efficacy of CAR-T cells against medium / low GPC3-expressing tumors. Figures 15A–15C show that absence of A20 enhances the efficacy of CAR-T cells against medium / low GPC3-expressing tumors. PLC / PRF / 5 was subcutaneously transplanted into the flanks of NSG mice. When the tumor volume reached 200 mm3, untransduced T cells (UT) or CAR-T cells were intravenously injected at doses of 0.5e6 or 2e6 cells / mouse. Tumor volume was measured every other week. Figure 15A – Injection of low-dose CAR-T cells (0.5e6 cells / mouse) can partially control tumor growth. A20 KO CAR-T cells provide a slightly longer control. Figure 15B. 2e6 non-armored CAR-T cells induced delayed tumor growth, while the same dose of A20 KO CAR-T cells induced complete response (CR) in all treated mice, prolonged tumor control, and increased survival (Figure 15C). These data demonstrate that A20 KO CAR-T cells have superior efficacy against medium / low GPC3-expressing tumors compared to non-armored CAR-T cells. [Figure 15-2]Absence of A20 enhances the efficacy of CAR-T cells against medium / low GPC3-expressing tumors. Figures 15A–15C show that absence of A20 enhances the efficacy of CAR-T cells against medium / low GPC3-expressing tumors. PLC / PRF / 5 was subcutaneously transplanted into the flanks of NSG mice. When the tumor volume reached 200 mm3, untransduced T cells (UT) or CAR-T cells were intravenously injected at doses of 0.5e6 or 2e6 cells / mouse. Tumor volume was measured every other week. Figure 15A – Injection of low-dose CAR-T cells (0.5e6 cells / mouse) can partially control tumor growth. A20 KO CAR-T cells provide a slightly longer control. Figure 15B. 2e6 non-armored CAR-T cells induced delayed tumor growth, while the same dose of A20 KO CAR-T cells induced complete response (CR) in all treated mice, prolonged tumor control, and increased survival (Figure 15C). These data demonstrate that A20 KO CAR-T cells have superior efficacy against medium / low GPC3-expressing tumors compared to non-armored CAR-T cells. [Figure 15-3] Absence of A20 enhances the efficacy of CAR-T cells against medium / low GPC3-expressing tumors. Figures 15A–15C show that absence of A20 enhances the efficacy of CAR-T cells against medium / low GPC3-expressing tumors. PLC / PRF / 5 was subcutaneously transplanted into the flanks of NSG mice. When the tumor volume reached 200 mm3, untransduced T cells (UT) or CAR-T cells were intravenously injected at doses of 0.5e6 or 2e6 cells / mouse. Tumor volume was measured every other week. Figure 15A – Injection of low-dose CAR-T cells (0.5e6 cells / mouse) can partially control tumor growth. A20 KO CAR-T cells provide a slightly longer control. Figure 15B. 2e6 non-armored CAR-T cells induced delayed tumor growth, while the same dose of A20 KO CAR-T cells induced complete response (CR) in all treated mice, prolonged tumor control, and increased survival (Figure 15C). These data demonstrate that A20 KO CAR-T cells have superior efficacy against medium / low GPC3-expressing tumors compared to non-armored CAR-T cells. [Figure 16-1] The absence of A20 enhances the efficacy of CAR-T cells without affecting cell number. Figures 16A–16C show that the absence of A20 enhances the efficacy of CAR-T cells without affecting cell number. PLC / PRF / 5 was subcutaneously transplanted into the flank of NSG mice. When the tumor volume reached 200 mm3, untransduced T cells (UT) or luciferase-expressing CAR-T cells were intravenously injected at a dose of 2e6 cells / mouse. Tumor volume (Figure 16A) and bioluminescence (BLI) (Figures 16B and 16C) were evaluated every two weeks. These data demonstrate that the absence of A20 enhances the efficacy of CAR-T cells without affecting proliferation. [Figure 16-2] The absence of A20 enhances the efficacy of CAR-T cells without affecting cell number. Figures 16A–16C show that the absence of A20 enhances the efficacy of CAR-T cells without affecting cell number. PLC / PRF / 5 was subcutaneously transplanted into the flank of NSG mice. When the tumor volume reached 200 mm3, untransduced T cells (UT) or luciferase-expressing CAR-T cells were intravenously injected at a dose of 2e6 cells / mouse. Tumor volume (Figure 16A) and bioluminescence (BLI) (Figures 16B and 16C) were evaluated every two weeks. These data demonstrate that the absence of A20 enhances the efficacy of CAR-T cells without affecting proliferation. [Figure 16-3] The absence of A20 enhances the efficacy of CAR-T cells without affecting cell number. Figures 16A–16C show that the absence of A20 enhances the efficacy of CAR-T cells without affecting cell number. PLC / PRF / 5 was subcutaneously transplanted into the flank of NSG mice. When the tumor volume reached 200 mm3, untransduced T cells (UT) or luciferase-expressing CAR-T cells were intravenously injected at a dose of 2e6 cells / mouse. Tumor volume (Figure 16A) and bioluminescence (BLI) (Figures 16B and 16C) were evaluated every two weeks. These data demonstrate that the absence of A20 enhances the efficacy of CAR-T cells without affecting proliferation. [Figure 17] A20 KO CAR-T cells retain a higher capacity to produce IFN upon tumor recurrence. Figure 17 shows that A20 KO CAR-T cells retain a higher capacity to produce IFN upon tumor recurrence. Tumors were collected from non-armored or A20 KO-injected mice when the tumor volume reached approximately 300 mm3 at the time of recurrence. Tumors were homogenized, cell suspensions were plated, and stimulated overnight with PMA (10 ng / mL) and ionomycin (500 ng / mL). Supernatants were collected and IFNγ was analyzed by MSD. The frequency and number of T cells per sample were determined by analyzing the cell fraction by flow cytometry before stimulation. Secreted IFNγ was normalized by the number of T cells / well. The data show that A20 KO CAR-T cells isolated from recurrent tumors have a higher intrinsic activation capacity compared to non-armored CAR-T cells, consistent with in vitro data. [Figure 18] Absence of A20 enhances the efficacy of CAR-T cells against low-GPC3-expressing tumors. Figure 18 shows that absence of A20 enhances the efficacy of CAR-T cells against low-GPC3-expressing tumors. PLC / PRF / 5 was subcutaneously transplanted into the flanks of NSG mice. When the tumor volume reached 200 mm3, untransduced T cells (UT) or CAR-T cells were intravenously injected at doses of 0.5e6 or 2e6 cells / mouse. Tumor volume was measured every two weeks. Left panel: Injection of low-dose CAR-T cells (0.5e6 cells / mouse) can slightly delay tumor growth. A20 KO CAR-T cells achieve increased tumor control. Similar benefits are shown in the right panel with a dose of 2e6 CAR+ / mouse. These data demonstrate that A20 KO CAR-T cells have superior efficacy against low-GPC3-expressing tumors compared to non-armored CAR-T cells. [Figure 19]A20 KO CAR-T cells produce more IFNγ in vivo in GPC3 low tumors. Figure 19 shows that A20 KO CAR-T cells produce more IFNγ in vivo in GPC3 low tumors. Mice treated as shown in Figure 17 were sacrificed 7 days after T cell infusion, and IFNγ was analyzed by intracellular staining in tumor-infiltrating CAR-T cells. Tumor-infiltrating A20 KO CAR-T cells expressed higher levels of IFNγ, consistent with in vitro findings (Figure 6) demonstrating that A20 deficiency leads to enhanced CAR-T cell activation in vivo. [Figure 20] A20 KO HER2 CAR-T cells produce more IFNγ during incubation with HER2+ target cells. Figure 20 shows that A20 KO HER2 CAR-T cells produce more IFNγ during incubation with HER2+ target cells. This result indicates that the absence of A20 independently has a similar effect on CARs expressed by the cells. Therefore, A20 knockout is a protective strategy that can be applied across multiple projects. [Figure 21] Characterization of Target HER2 CAR-T Cell Lines Figure 21 shows the characterization of target CAR-T cell lines. The cell lines shown were stained for HER2 expression and analyzed by flow cytometry. [Figure 22-1] Efficient A20 Knockout in HER2 CAR-T Cells Using CRISPR Figures 22A-22B show efficient A20 knockout in HER2 CAR-T cells using CRISPR. CRISPR-mediated knockout of the A20 gene was performed on the same day as CAR transduction. Western blotting shows A20 protein expression after 10 days of proliferation (Figure 22A). Relative A20 protein expression was quantified by densitometry (Figure 22B). A20 expression was normalized relative to β-actin expression. These results demonstrate that A20 knockout is efficient and stable. [Figure 22-2]Efficient A20 Knockout in HER2 CAR-T Cells Using CRISPR Figures 22A-22B show efficient A20 knockout in HER2 CAR-T cells using CRISPR. CRISPR-mediated knockout of the A20 gene was performed on the same day as CAR transduction. Western blotting shows A20 protein expression after 10 days of proliferation (Figure 22A). Relative A20 protein expression was quantified by densitometry (Figure 22B). A20 expression was normalized relative to β-actin expression. These results demonstrate that A20 knockout is efficient and stable. [Figure 23-1] Growth Rate (and CD4 / CD8 Ratio) of Untransduced (UT), Unarmored, and A20-Deficient HER2 CAR-T Cells Figures 23A-23B show the growth rate (Figure 23A) and CD4 / CD8 ratio (Figure 23B) of untransduced (UT), unarmored, and A20-deficient HER2 CAR-T cells. The proportions of CD4 and CD8 in UT cells are gated in the CD45+ population, while the proportions of CD4 and CD8 in unarmored and A20KO CAR-T cells are gated in CAR+ cells. The results indicate that the absence of A20 does not substantially affect the growth rate (Figure 23A) or CD4 / 8 ratio (Figure 23B) of CAR-T cells. [Figure 23-2] Growth Rate (and CD4 / CD8 Ratio) of Untransduced (UT), Unarmored, and A20-Deficient HER2 CAR-T Cells Figures 23A-23B show the growth rate (Figure 23A) and CD4 / CD8 ratio (Figure 23B) of untransduced (UT), unarmored, and A20-deficient HER2 CAR-T cells. The proportions of CD4 and CD8 in UT cells are gated in the CD45+ population, while the proportions of CD4 and CD8 in unarmored and A20KO CAR-T cells are gated in CAR+ cells. The results indicate that the absence of A20 does not substantially affect the growth rate (Figure 23A) or CD4 / 8 ratio (Figure 23B) of CAR-T cells. [Figure 24]A20 deficiency does not result in increased target cell killing in rapid single-challenge assays. Figure 24 shows that A20 deficiency does not result in increased target cell killing in rapid single-challenge assays. UT, unarmored, or A20KO HER2 CAR-T cells were incubated with JIMT1 tumor cells in a 1:1 E:T ratio, and cell lysis was assessed by xCELLigence. [Figure 25] A20-deficient CAR-T cells show increased and prolonged upregulation of activation markers. Figure 25 shows that A20-deficient CAR-T cells show increased and prolonged upregulation of activation markers. Unarmored or A20KO HER2 CAR-T cells were incubated with JIMT1 tumor cells. CD25 and CD70 expression was analyzed by flow cytometry targeting CAR+ cells at 1 or 4 days. A20 deficiency results in a rapid increase in the expression of the activation marker CD70 at D1. Four days after incubation, A20KO cells show higher expression of CD25 and CD70 despite complete killing of target cells. Thus, the absence of A20 results in prolonged CAR-T cell activation. [Figure 26-1] A20-deficient CAR-T cells exhibit a similar differentiation pattern compared to non-armored CAR-T cells. Figures 26A-26B show that A20-deficient CAR-T cells exhibit a similar differentiation pattern compared to non-armored CAR-T cells. Non-armored or A20KO HER2 CAR-T cells were incubated with JIMT1 (Figure 26A) tumor cells or MDA-MB-231 (Figure 26B) tumor cells. After 1 or 4 days, the expression of differentiation markers CD62L and CD45RO was analyzed by flow cytometry targeting CAR+ cells. This is particularly relevant because increased and prolonged expression of activation markers can lead to increased differentiation. These data indicate that A20 deficiency does not result in increased differentiation before or after antigen encounter. [Figure 26-2]A20-deficient CAR-T cells exhibit a similar differentiation pattern compared to non-armored CAR-T cells. Figures 26A-26B show that A20-deficient CAR-T cells exhibit a similar differentiation pattern compared to non-armored CAR-T cells. Non-armored or A20KO HER2 CAR-T cells were incubated with JIMT1 (Figure 26A) tumor cells or MDA-MB-231 (Figure 26B) tumor cells. After 1 or 4 days, the expression of differentiation markers CD62L and CD45RO was analyzed by flow cytometry targeting CAR+ cells. This is particularly relevant because increased and prolonged expression of activation markers can lead to increased differentiation. These data indicate that A20 deficiency does not result in increased differentiation before or after antigen encounter. [Figure 27-1] A20 deficiency delays HER2 CAR-T dysfunction in vitro. Figures 27A–27C show that A20 deficiency delays HER2 CAR-T dysfunction in vitro. Figure 27A: A20 deficiency delays the onset of dysfunction and allows CAR-T cells to maintain their ability to kill tumor cells longer than unarmored cells. This assay also showed that A20 KO HER2 CAR-T cells achieved more antigen-mediated proliferation than their unarmored counterparts, suggesting a CAR-specific A20 KO protective effect (Figure 27B). Figure 27C: A20 deficiency delays the decline in effector cytokine production after multiple retries. [Figure 27-2] A20 deficiency delays HER2 CAR-T dysfunction in vitro. Figures 27A–27C show that A20 deficiency delays HER2 CAR-T dysfunction in vitro. Figure 27A: A20 deficiency delays the onset of dysfunction and allows CAR-T cells to maintain their ability to kill tumor cells longer than unarmored cells. This assay also showed that A20 KO HER2 CAR-T cells achieved more antigen-mediated proliferation than their unarmored counterparts, suggesting a CAR-specific A20 KO protective effect (Figure 27B). Figure 27C: A20 deficiency delays the decline in effector cytokine production after multiple retries. [Figure 27-3] A20 deficiency delays HER2 CAR-T dysfunction in vitro. Figures 27A–27C show that A20 deficiency delays HER2 CAR-T dysfunction in vitro. Figure 27A: A20 deficiency delays the onset of dysfunction and allows CAR-T cells to maintain their ability to kill tumor cells longer than unarmored cells. This assay also showed that A20 KO HER2 CAR-T cells achieved more antigen-mediated proliferation than their unarmored counterparts, suggesting a CAR-specific A20 KO protective effect (Figure 27B). Figure 27C: A20 deficiency delays the decline in effector cytokine production after multiple retries. [Figure 28] Successful A20 KO in Universal Effector T Cells (UECs) Figure 28 shows the successful A20 KO in Universal Effector T Cells (UECs). UECs were generated by performing CAR-KI at the B2m locus of CD8 cells in which the Trex module gene was knocked out, as described in International Publication No. 2023 / 025862(A1). [Figure 29] Rapid killing function of A20 KO or non-armored Her2-UEC Figure 29 shows the rapid killing function of A20 KO or non-armored Her2-UEC tested in an xCelligence killing assay using JIMT-1 target cells. [Figure 30] Evaluation of activation markers CD25 and CD69 by flow cytometry in unarmored and A20 KO Her2-UEC cells. Figure 30 shows the evaluation of activation markers CD25 and CD69 by flow cytometry in unarmored and A20 KO Her2-UEC cells after 3 days of co-culture in a resting state or with JIMT-1 target cells at an E:T ratio of 1:1. [Figure 31]Expression of the activation marker CD70 measured by flow cytometry in either unarmored or A20 KO Her2-UEC co-cultures with JIMT-1 target cells. Figure 31 shows the expression of the activation marker CD70 measured by flow cytometry for up to 3 days at an E:T ratio of 1:1 in either unarmored or A20 KO Her2-UEC co-cultures with JIMT-1 target cells. A20 KO UECs expressed CD70 at higher levels than unarmored UECs, suggesting a higher activation state. MFI = median fluorescence intensity. [Figure 32] IFNγ Production by Her2 UECs Co-cultured with Her2-Expressing Target Cells Figure 32 shows IFNγ production by Her2 UECs co-cultured with Her2-Expressing Target Cells. Effector cells were co-cultured with either JIMT-1 target cells or MDA-MB-231 target cells in an E:T ratio of 1:1, and the supernatant was analyzed after overnight incubation. IFNγ was quantified using the ELLA assay (Bio-techne). This figure shows that A20 KO UECs produce more IFNγ than their unarmored counterparts. Furthermore, this data indicates that A20 KO does not induce nonspecific release of IFNγ, as cytokines were not detected in the absence of target cells. [Modes for carrying out the invention]

[0023] This disclosure relates to methods, cells, and compositions for preparing cell populations and compositions for immunotherapy. In particular, this specification provides cell populations containing the disrupted TNF-alpha-inducible protein 3 (A20;TNFAIP3) gene, as well as methods for preparing and using such populations.

[0024] When used in accordance with this disclosure, all technical and scientific terms shall be understood to have the same meaning as that commonly understood by those skilled in the art, unless otherwise indicated. The following references provide common definitions of many of the terms used in this disclosure: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). When used herein, the following terms shall have the meanings set forth below unless otherwise specified.

[0025] Unless otherwise required by context, singular terms shall include the plural form, and plural terms shall include the singular form.

[0026] As used herein, the terms “comprise” and “include,” and their variations (e.g., “comprises,” “comprising,” “includes,” and “including”) are understood to include the described component, feature, element, or process, or group of components, features, elements, or processes, but not to exclude any other component, feature, element, or process, or group of components, features, elements, or processes. The terms “comprising,” “consisting essentially of,” and “consisting of” may be substituted for any of the other two terms while retaining their usual meanings.

[0027] As used herein, the singular forms "a," "an," and "the" refer to multiple objects unless the context clearly indicates otherwise.

[0028] Where used herein, ranges and quantities may be expressed as "approximately" a specific value or range. The term "approximately" also includes exact quantities. For example, "approximately 5%" means "approximately 5%" and also "5%". The term "approximately" may also refer to ±10% of a given value or range of values. Thus, approximately 5% also means, for example, 4.5% to 5.5%. Unless otherwise evident from the context, all numerical values ​​provided herein are modified by the term "approximately".

[0029] The percentages disclosed herein may vary by ±10, 20, or 30% from the disclosed values ​​and may fall within the intended scope of disclosure.

[0030] Unless otherwise indicated, or unless it is obvious from the context and the understanding of those skilled in the art, values ​​expressed herein as ranges may, unless the context clearly indicates otherwise, be assumed to be any specific value or subrange within the ranges described in the different embodiments of this disclosure, up to one-tenth of the lower limit of the range.

[0031] As used herein, the terms “or” and “and / or” may be used in combination with each other or exclusively to describe multiple components. For example, “x, y, and / or z” may refer to “x” alone, “y” alone, “z” alone, “x, y, and z,” “(x and y) or z,” “x or (y and z),” or “x or y or z.”

[0032] In one embodiment, the disclosure provides a population of cells containing a disrupted TNF-alpha-inducible protein 3 (A20 or TNFAIP3) gene. TNF-alpha-inducible protein 3 may also be referred to as TNFAIP3;A20;AISBL;AIFBL1;OTUD7C; or TNFA1P2. The TNFAIP3 gene (NCBI reference sequence: NM_006290.4) encodes a ubiquitin editing enzyme (NCBI reference sequence: NP_006281.1) that has a crucial function in negatively modulating inflammation and immune responses by inhibiting pro-inflammatory molecules. TNFAIP3(A20) is a cytoplasmic zinc finger protein that inhibits nuclear factor kappa-B (NF-κB) activity and tumor necrosis factor (TNF)-mediated programmed cell death. Disruption of the TNFAIP3(A20) gene in CAR T cells may improve T cell survival, efficacy, and persistence in the immunosuppressive tumor microenvironment (TME).

[0033] In some embodiments, cell populations containing disruption of the TNFAIP3(A20) gene exhibit enhanced NF-κB pathway activation. In some embodiments, cell populations containing disruption of the TNFAIP3(A20) gene exhibit at least approximately 2-fold, at least approximately 2.5-fold, at least approximately 3-fold, at least approximately 4-fold, or at least approximately 5-fold enhanced NF-κB pathway activation, as quantified using an NF-κB reporter assay (see, for example, Example 2).

[0034] In some embodiments, a population of cells containing disruption of the TNFAIP3(A20) gene exhibits antitumor activity and / or enhanced antitumor activity when compared to a population of A20-expressing cells quantified, for example, by the number of complete responses (CRs) achieved (see, e.g., Example 5) or TGI (see, e.g., Examples 6 and 7).

[0035] In certain embodiments, the TNFAIP3(A20) gene can be knocked out (KO) or its expression can be effectively eliminated by any preferred method or technique known in the art. In some embodiments, the TNFAIP3(A20) gene can be knocked out or its expression can be effectively eliminated using a CRISPR / Cas system, a transcription activator-like effector nuclease (TALEN), a zinc finger, a site-specific nuclease, a meganuclease, a neutralizing antibody, a small molecule inhibitor, or a chemoinhibitor that blocks a downstream signaling pathway. In some embodiments, TNFAIP3(A20) can be knocked out or its expression can be effectively eliminated using a CRISPR / Cas system containing the sequence of SEQ ID NO: 1 (CUUUGUAUUUGAGCAAUAUG), SEQ ID NO: 2 (AACCAUGCACCGAUACACAC), and / or SEQ ID NO: 3 (UGGAUGAUCUCCCGAAACUG). In some embodiments, the expression of the TNFAIP3(A20) gene can be effectively eliminated using antisense techniques, for example, by using antisense oligonucleotides (ASOs), microRNAs, shRNAs, siRNAs, or RNAi.

[0036] In some embodiments, disruption of the A20(TNFAIP3) gene may result in reduced gene expression of approximately 75% to 100% (i.e., 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100%). In some embodiments, disruption of the A20(TNFAIP3) gene may result in a decrease of approximately 75% to 100% (i.e., 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100%) in A20 protein levels. In certain embodiments, at least about 90%, at least about 95%, or at least about 99% of cells in a population of cells do not express A20. TNFAIP3 gene expression and / or TNFAIP3 protein levels can be measured by any suitable method or technique known in the art, e.g., in situ hybridization techniques, RNase protection assays, Northern blotting, reverse transcription (RT)-PCR, Western blotting, or sequencing.

[0037] 5.1 Cells A population of cells containing the disrupted A20 gene may include various cell types, such as lymphocytes. Specific types of cells that can be used include T cells, natural killer (NK) cells, natural killer T (NKT) cells, invariant natural killer T (iNKT) cells, alpha-beta T cells, gamma-delta T cells, virus-specific T (VST) cells, cytotoxic T lymphocytes (CTLs), tumor-infiltrating lymphocytes, and regulatory T cells (Tregs). In some embodiments, the cells are autologous. In certain embodiments, the cells are allogeneic. In other embodiments, the cells may originate from a genetically similar but not identical donor (allogeneic).

[0038] In some embodiments, the cell population may also include proliferated and / or manipulated T cells. In some embodiments, the cell population may include total T cells, CD4-positive T cells, CD8-positive T cells, regulatory T cells, gamma-delta T cells, mucosa-associated invariant T (MAIT) T cells, natural killer (NK) cells, or natural killer T (NKT) cells. T cells are broadly classified into cells that express CD4 on their surface (also called CD4-positive cells) and cells that express CD8 on their surface (also called CD8-positive cells). T cells suitable for use according to the methods provided herein are mononuclear lymphocytes derived from human donor bone marrow (BM), peripheral blood (PB), or cord blood (CB). These cells could be collected directly from BM, PB, or CB, or after recruitment or stimulation by administering growth factors and / or cytokines, such as granulocyte colony-stimulating factor (G-CSF) or granulocyte-macrophage colony-stimulating factor (GM-CSF), to allogeneic or autologous donors. Those skilled in the art will understand that there are many established protocols for isolating peripheral blood mononuclear cells (PBMCs) from peripheral blood. Isolation of PBMCs can be assisted by density gradient separation protocols that typically use density gradient centrifugation techniques using Ficoll®-Hypaque or Histopaque® to separate lymphocytes from other elements in the blood. Preferably, PBMC isolation is performed under sterile conditions. Negative selection kits can also be used for PBMC isolation. Alternatively, cell elution methods may be used to isolate mononuclear cell populations. In some embodiments, the cell population is human cells. In certain embodiments, the cell population is human primary immune cells.

[0039] In some embodiments, the cell compositions and methods of this disclosure further include a population of cells containing a genetically engineered antigen receptor or chimeric antigen receptor. Chimeric antigen receptors (CARs), also known as chimeric T cell receptors, artificial T cell receptors, and chimeric immune receptors, are engineered receptors that transfer specificity to immune effector cells. In some embodiments, at least about 90%, at least about 95%, or at least about 99% of the cells in a population of cells express CARs. Generally, a chimeric antigen receptor is a transmembrane protein having a target-antigen binding domain fused to a signaling end domain via a spacer and a transmembrane domain. When a CAR binds to its target antigen, an activation signal is transmitted to T cells. In one embodiment, a polynucleotide encoding a chimeric antigen receptor is introduced into a population of cells having a disrupted A20 gene. In one embodiment, a nucleic acid vector encoding a chimeric antigen receptor or a genetically engineered receptor is introduced into a population of cells so that T cells express the chimeric antigen receptor. In some embodiments, CARs bind to glypican 3 (GPC3), human epidermal growth factor receptor 2 (HER2); also known as Erb-B2 receptor tyrosine kinase 2 (ERBB2), or CD19. In specific embodiments, CARs for use in immunotherapy can bind to any target.

[0040] 5.2 CAR Structure Design The CAR constructs of this disclosure may have several components, many of which can be selected based on the desired or improved function of the resulting CAR construct. In addition to the antigen-binding domain, the CAR construct may have a spacer domain, a hinge domain, a signal peptide domain, a transmembrane domain, and one or more costimulatory domains. The selection of a particular component rather than another (i.e., selecting a specific costimulatory domain from one receptor rather than costimulatory domains from different receptors) may affect the clinical efficacy and safety profile.

[0041] 5.2.1 Antigen-binding domain The antigen-binding domains envisioned herein may comprise an antibody or one or more antigen-binding fragments thereof. In one embodiment, the CAR construct targets GPC3. In one embodiment, the CAR construct targets HER2. In one embodiment, the CAR construct targets CD19. In one embodiment, the CAR construct targets any molecule useful in immunotherapy. In certain embodiments, the antigen-binding domain comprises single-chain variable fragments (scFv) containing light and heavy chain variable regions from one or more antibodies specific to GPC3, HER2, or CD19, which are either directly linked together or linked together via a flexible linker (e.g., a G4S repeat having one, two, or three or more repeats).

[0042] 5.2.2 Spacer Domain CAR constructs may have spacer domains to provide steric flexibility to facilitate binding to target antigens on target cells. The optimal length of the spacer domain may depend on the proximity of the binding epitope to the target cell surface. For example, proximal epitopes may require longer spacers, while distal epitopes may require shorter spacers. In addition to facilitating CAR binding to target antigens, achieving the optimal distance between CAR cells and cancer cells may also help sterically occlude large inhibitory molecules from the immunological synapses formed between CAR cells and target cancer cells. CARs may have long, medium, or short spacers. Long spacers may include the CH2CH3 domain (approximately 220 amino acids) of immunoglobulin G1 (IgG1) or IgG4 (either naturally occurring or with common therapeutic antibody modifications such as the S228P mutation), although the CH3 region can itself be used to construct intermediate spacers (approximately 120 amino acids). Shorter spacers may originate from segments (<60 amino acids) of CD28, CD8α, CD3, or CD4. Short spacers may also originate from hinge regions of the IgG molecule. These hinge regions may originate from any IgG isotype and may or may not contain mutations common to therapeutic antibodies, such as the S228P mutation mentioned above.

[0043] 5.2.3 Hinged Domain CARs may also possess hinge domains. Flexible hinge domains are short peptide fragments that provide conformational freedom to facilitate binding to target antigens on tumor cells. They can be used alone or in combination with spacer sequences. The terms “hinge” and “spacer” are often used interchangeably, and for example, an IgG4 sequence can be considered both a “hinge” and a “spacer” sequence (i.e., a hinge / spacer sequence).

[0044] 5.2.4 Signal Peptides The CAR construct may further include a sequence containing a signal peptide. The signal peptide functions to prompt the cell to translocate the CAR to the cell membrane. Examples include IgG1 heavy chain signal polypeptide, Ig kappa or lambda light chain signal peptide, granulocyte-macrophage colony-stimulating factor receptor 2 (GM-CSFR2 or CSFR2) signal peptide, CD8a signal polypeptide, or CD33 signal peptide.

[0045] Transmembrane domain: CAR constructs may further include sequences containing a transmembrane domain. The transmembrane domain may include a hydrophobic α-helix spanning the cell membrane. While the properties of the transmembrane domain have not been studied as extensively as other aspects of CAR constructs, they may potentially influence CAR expression and association with endogenous membrane proteins. The transmembrane domain may originate from, for example, CD4, CD8α, or CD28.

[0046] 5.2.5 Co-stimulatory Domain CAR constructs may further contain one or more sequences that form a co-stimulatory domain. A co-stimulatory domain is a domain capable of enhancing or modulating the response of immune effector cells. Co-stimulatory domains may include sequences from one or more of the following: CD3 zeta (or CD3z), CD28, 4-1BB, OX-40, ICOS, CD27, GITR, CD2, IL-2Rβ, and MyD88 / CD40. The selection of the co-stimulatory domain affects the phenotypic and metabolic signature of CAR cells. For example, CD28 co-stimulation results in a potent but short-lived effector-like phenotype with high levels of cytolytic ability, interleukin-2 (IL-2) secretion, and glycolysis. In contrast, T cells modified with CARs containing the 4-1BB co-stimulatory domain tend to proliferate in vivo, persist longer, have increased oxidative metabolism, are less prone to exhaustion, and have an increased ability to generate central memory T cells.

[0047] 5.3 Treatment Methods In some embodiments, the cell populations described herein are used in methods for treating cancer in subjects requiring treatment for cancer. In some embodiments, cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, gastric cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, gastric cancer, testicular cancer, pharyngeal cancer, thyroid cancer, uterine cancer, or metastatic forms thereof. However, the cancers listed herein are not intended to be limiting.

[0048] As used herein, the terms “treatment” or “to treat” refer to both therapeutic procedures and preventive or protective measures. Subjects requiring treatment include subjects with cancer, subjects prone to cancer, or subjects for whom cancer should be prevented. In some embodiments, the methods, compositions, and combinations disclosed herein may be used for the treatment of cancer. In other embodiments, subjects requiring treatment include subjects with tumors, subjects prone to tumors, or subjects for whom tumors should be prevented. In certain embodiments, the methods, compositions, and combinations disclosed herein may be used for the treatment of tumors. In certain embodiments, the methods, compositions, and combinations disclosed herein may be used for the treatment of solid tumors. In other embodiments, the treatment of a tumor includes inhibiting tumor growth, promoting tumor reduction, or both inhibiting tumor growth and promoting tumor reduction.

[0049] In some embodiments, the cell populations provided herein may be administered as a pharmaceutical composition containing a therapeutically effective amount of the cell population as a therapeutic agent (i.e., for therapeutic use).

[0050] In some embodiments, the cell populations provided herein are CAR-modified cells, such as CAR T cells, which may be administered alone or as a pharmaceutical composition with diluents and / or cytokines or other components related to the cell population. Briefly, the pharmaceutical compositions of this disclosure may include, for example, CAR T cells containing the disrupted A20 gene described herein, together with one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients. Such compositions may include buffers, such as neutral buffered saline; sulfates; carbohydrates such as glucose, mannose, sucrose, or dextran, mannitol; amino acids such as proteins, polypeptides, or glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. The pharmaceutical compositions of this disclosure may be adapted for therapeutic (or prophylactic) use.

[0051] As used herein, the terms “pharmaceutical composition” or “therapeutic composition” refer to a compound or composition that, when appropriately administered to a subject, can induce a desired therapeutic effect. In some embodiments, the present disclosure provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a population of cells of the present disclosure.

[0052] As used herein, the terms “pharmaceutically acceptable carrier” or “physiologically acceptable carrier” refer to one or more formulation materials suitable for achieving or enhancing the delivery of one or more populations of cells of this disclosure.

[0053] The term "subject" is intended to include humans and non-human animals, particularly mammals. In certain embodiments, the subject is a human patient.

[0054] As used herein, the terms “administer” or “to administer” refer to providing, contacting, and / or delivering one or more compounds by any suitable route to achieve a desired effect. Any acceptable route of administration, e.g., intravenous (e.g., intravenous infusion), parenteral, or subcutaneous, is intended. Administrations may include, but are not limited to, oral, sublingual, parenteral (e.g., intravenous, subcutaneous, intradermal, intramuscular, intra-articular, intra-arterial, intra-bursal, intrasternal, intrathecal, intrafocal, or intracranial injection), percutaneous, topical, buccal, rectal, vaginal, nasal, ocular, inhalation, and implantation.

[0055] The number of cells in the population administered per dose, the number of doses, and the frequency of administration depend on various parameters, including the patient's age, weight, clinical assessment, tumor type, tumor load, and / or the attending physician's judgment. The number of cells can vary considerably from patient to patient, based on the initial number of cells obtained and how quickly the modified cells grow in the laboratory.

[0056] In certain embodiments, the therapeutic methods disclosed herein may also include one or more therapeutic components, such as anticancer antibodies and / or chemotherapy components. For example, a therapeutic regimen may further include additional therapeutic agents (e.g., chemotherapy and / or biologics). Examples of such additional therapeutic agents include, but are not limited to, cisplatin / gemcitabine or methotrexate, vinblastine, Adriamycin® (doxorubicin), cisplatin (MVAC), carboplatin-based regimens, or monotherapy taxanes or gemcitabine, temozolomide, or dacarbazine, vinflunin, docetaxel, paclitaxel, nab-paclitaxel, vemurafenib, erlotinib, afatinib, cetuximab, bevacizumab, erlotinib, gefitinib, and / or pemetrexed. Further examples include drugs that target the DNA damage repair system, such as poly(ADP-ribose) polymerase 1 (PARP1) inhibitors, as well as therapeutic agents that inhibit WEE1 protein kinase activity, ATR protein kinase activity, ATM protein kinase activity, Aurora B protein kinase activity, and DNA-PK activity.Additional treatment options may also include, but are not limited to, the following: 1) Combination regimens such as: AD (doxorubicin, dacarbazine); AIM (doxorubicin, ifosfamide, mesna); MAID (mesna, doxorubicin, ifosfamide, dacarbazine); ifosfamide, epirubicin, mesna; gemcitabine and docetaxel; gemcitabine and vinorelbine; gemcitabine and dacarbazine; doxorubicin and olaratumab; methotrexate t and vinblastine; tamoxifen and sulindac; vincristine, dactinomycin, cyclophosphamide; vincristine, doxorubicin, cyclophosphamide; vincristine, doxorubicin, ifosfamide and cyclophosphamide including etoposide; vincristine, doxorubicin, ifosfamide; cyclophosphamide topotecan; or ifosfamide, doxorubicin; and / or 2) monotherapy such as: cisplatin or other Metal compounds, 5-FU / capecitabine (Xeloda®), cetuximab (Erbitux®), semiprimab (Libtayo®), pembrolizumab (MK-3475), panitumumab (Vectibix®), dacomitinib (PF-00299804), gefitinib (ZD1839, Iressa), doxorubicin, ifosfamide, epirubicin, gemcitabine, dacarbazine, temozolomide, vinorubicin N, eribulin, trabectedin, pazopanib, imatinib, sunitinib, regorafenib, sorafenib, nilotinib, dasatinib, interferon, toremifene, methotrexate, irinotecan, topotecan, paclitaxel, nab-paclitaxel (Abraxane), docetaxel, bevacizumab, temozolomide, sirolimus (Rapamune®), everolimus, temsirolimus, crizotinib, ceritinib, or palbociclib.Examples of additional immunotherapies include, for example, MEDI-0680, durvalumab (Imfinzi®; MEDI-4736), pembrolizumab (Keytruda®), nivolumab (Opdivo®), cemiplimab (Libtayo®), atezolizumab (Tecentriq®), and avelumab (Bavencio®). CTLA-4 inhibitors (e.g., tremelimumab (Imjudo®; ipilimumab (Yervoy®)) are another class of drugs that can boost the immune response. In some cases, cytokine therapies (e.g., interferon-alpha and interleukin-2) can be used to boost the immune system. Examples of interferon and interleukin-based therapies can include, but are not limited to, Aldesleukin (Proleukin®), Interferon alpha-2b (INTRON®), and pegylated interferon alpha-2b (Sylvatron®; PEG-INTRON®; PEGASYS).

[0057] In some embodiments, the present disclosure provides a method for treating cancer, comprising: (a) obtaining a population of cells from a donor; (b) genetically modifying the population of cells to disrupt the TNF alpha-induced protein 3 (A20; TNFAIP3) gene; (c) expanding the population of genetically modified cells; and (d) administering the expanded population of genetically modified cells to a patient.

[0058] In certain embodiments, the population of genetically modified cells undergoes at least about 50-fold expansion, at least about 500-fold expansion, at least about 5000-fold expansion, at least about 250,000-fold expansion, at least about 500,000-fold expansion, at least about 10 6 -fold expansion, at least about 10 7 -fold expansion, at least about 108-fold expansion, at least about 10 9 -fold expansion, or at least about 10 10They undergo double proliferation. In certain embodiments, the proliferated population of cells is resistant to replication senescence. Furthermore, these cells do not become functionally exhausted after prolonged proliferation and can be directed to perform cytotoxic functions through engagement of their TCRs by T cell engager antibodies, through engagement of chimeric antigen receptors (CARs), or through native or transgenic TCRs.

[0059] In some embodiments, the cell population is cultured in a culture medium that contains supportive cytokines but does not contain primary immune cell stimulants. In certain embodiments, primary immune cells proliferate during culture in the absence of feeder cells or during stimulation via CD3 and / or their antigen receptors. The ability of the disclosed method to generate immune cells in the absence of extensive T cell restimulation or feeder cells advantageously eliminates the problems of scaling up the method and producing a dysfunctional population of immune cells.

[0060] In some embodiments, the methods disclosed herein provide a population of proliferating cells (including human CD8+ T cells, human CD4+ T cells, or human natural killer T cells) having a disrupted A20 gene that has the ability to proliferate for a considerable period of time in the absence of restimulation via the T cell receptor (TCR) and proliferates millions of times during long-term culture. In certain embodiments, the cell population is cultured for at least 5 days, at least 10 days, at least 15 days, at least 20 days, at least 30 days, at least 40 days, at least 50 days, at least 60 days, at least 70 days, at least 80 days, at least 90 days, at least 100 days, at least 150 days, at least 200 days, at least 300 days, or at least 400 days.

[0061] 6 Embodiments: The following clauses define embodiments of this disclosure.

[0062] Embodiment 1) A population of cells containing the disrupted TNF-alpha-inducible protein 3 (A20; TNFAIP3) gene.

[0063] Embodiment 2) A population of cells according to Embodiment 1, further comprising nucleic acids containing isolated nucleotide sequences encoding chimeric antigen receptors (CARs).

[0064] Embodiment 3) The cell population according to Embodiment 1 or Embodiment 2, wherein the cell population is an autologous cell population or an allogeneic cell population.

[0065] Embodiment 4) The cell population according to any one of Embodiments 1 to 3, wherein the cell population is a T cell population, a cytotoxic T lymphocyte (CTL) population, or a tumor-infiltrating lymphocyte population.

[0066] Embodiment 5) The cell population is the cell population according to any one of Embodiments 1 to 4, wherein the cell population includes total T cells.

[0067] Embodiment 6) The cell population is the cell population according to any one of Embodiments 1 to 5, wherein the cell population includes CD8+ T cells.

[0068] Embodiment 7) The cell population is the cell population according to any one of Embodiments 1 to 5, wherein the cell population includes CD4+ T cells.

[0069] Embodiment 8) The cell population is the cell population according to any one of Embodiments 1 to 7, wherein the cell population includes human primary immune cells.

[0070] Embodiment 9) A population of cells according to any one of Embodiments 1 to 8, wherein at least about 90%, at least about 95%, or at least about 99% of the cells in the population of cells do not express A20.

[0071] Embodiment 10) A population of cells according to any one of Embodiments 1 to 9, wherein at least about 90%, at least about 95%, or at least about 99% of the cells in the population of cells express CAR.

[0072] Embodiment 11) A population of cells according to any one of Embodiments 1 to 10, wherein the activation of the NF-κB pathway is enhanced by at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 4 times, or at least about 5 times.

[0073] Embodiment 12) A population of cells according to any one of Embodiments 1 to 11, wherein the population of cells exhibits antitumor activity.

[0074] Embodiment 13) A population of cells according to any one of Embodiments 1 to 12, wherein the population of cells exhibits enhanced antitumor activity.

[0075] Embodiment 14) A pharmaceutical composition comprising a population of cells described in any one of Embodiments 1 to 13 and a pharmaceutically acceptable carrier.

[0076] Embodiment 15) A method for treating cancer in a subject requiring cancer treatment, comprising administering to a population of cells described in any one of Embodiments 1 to 13 or a pharmaceutical composition described in Embodiment 14.

[0077] Embodiment 16) The method according to Embodiment 15, wherein the cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, gastric cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, gastric cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, or a metastatic form thereof.

[0078] Embodiment 17) The method according to Embodiment 15 or Embodiment 16, further comprising inhibiting the growth of the target tumor, inducing tumor regression, and / or extending survival.

[0079] Embodiment 18) A method for treating cancer, (a) Obtaining a population of cells from a donor, (b) Genetically modifying a population of cells to disrupt the TNF-alpha-inducible protein 3 (A20;TNFAIP3) gene, (c) Proliferating a population of genetically modified cells, (d) Administering a population of proliferated genetically modified cells to a patient, Methods that include...

[0080] Embodiment 19) The method according to Embodiment 18, wherein A20 is destroyed by a Cas / CRISPR system.

[0081] Embodiment 20) The method according to Embodiment 18 or Embodiment 19, further comprising introducing a chimeric antigen receptor (CAR) into a population of cells.

[0082] Embodiment 21) The method according to any one of Embodiments 18 to 20, wherein the cell population is an autologous cell population or an allogeneic cell population.

[0083] Embodiment 22) The method according to any one of Embodiments 18 to 21, wherein the cell population is a T cell population, a cytotoxic T lymphocyte (CTL) population, or a tumor-infiltrating lymphocyte population.

[0084] Embodiment 23) The method according to any one of Embodiments 18 to 22, wherein the cell population includes total T cells.

[0085] Embodiment 24) The method according to any one of Embodiments 18 to 23, wherein the cell population includes CD8+ T cells.

[0086] Embodiment 25) The method according to any one of Embodiments 18 to 24, wherein the cell population includes CD4+ T cells.

[0087] Embodiment 26) The method according to any one of Embodiments 18 to 25, wherein the cell population includes human primary immune cells.

[0088] Embodiment 27) The method according to any one of Embodiments 18 to 26, wherein the population of cells exhibits enhanced antitumor activity.

[0089] Embodiment 28) Use of a population of cells according to any one of Embodiments 1 to 13 or a pharmaceutical composition according to Embodiment 14 for the manufacture of a pharmaceutical for the treatment of a disease or condition.

[0090] Embodiment 29) The use described in Embodiment 28, wherein the disease or condition is cancer.

[0091] Embodiment 30) The use described in Embodiment 29, wherein the cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, gastric cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, gastric cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, or a metastatic form thereof.

[0092] Embodiment 31) A population of cells according to any one of Embodiments 1 to 13 or a pharmaceutical composition according to Embodiment 14, for use as a pharmaceutical.

[0093] Embodiment 32) A population of cells according to any one of Embodiments 1 to 13 or a pharmaceutical composition according to Embodiment 14 for use in the treatment of cancer.

[0094] Embodiment 33) A population of cells for use as described in Embodiment 32, wherein cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, gastric cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, gastric cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, or a metastatic form thereof. 7 Examples

[0095] It should be understood that certain aspects of this specification are not limited to the specific embodiments presented and may vary. It should also be understood that the terms used herein are for the purpose of describing only specific embodiments and are not intended to be limiting unless specifically defined herein. Furthermore, certain embodiments disclosed herein can be combined with other embodiments disclosed herein without limitation as will be recognized by those skilled in the art. The following examples illustrate specific embodiments of this disclosure and various uses thereof. They are provided for illustrative purposes only and should not be construed as limiting the scope of this disclosure.

[0096] The embodiments described herein can be implemented without any one or more elements or limitations not specifically disclosed herein. The terms and expressions used are for illustrative purposes only, not limitation, and in the use of such terms and expressions, it is not intended to exclude equivalents of the shown and described features or parts thereof, but it is recognized that various modifications are possible within the scope of the claimed embodiments. Accordingly, although this specification is specifically disclosed by embodiments, any features, modifications and variations of the concepts disclosed herein may be used by those skilled in the art, and it should be understood that such modifications and variations are considered to be within the scope of these embodiments as defined by the description and appended claims. While some aspects of this disclosure may be identified as particularly advantageous herein, this disclosure is intended not to be limited to these particular aspects of this disclosure.

[0097] Any claim or description containing “or” between one or more members of a group is considered satisfied unless otherwise indicated or is evident from the context, if one, two or more, or all of the group members are present in, used in, or related to a given product or process. This disclosure includes embodiments in which exactly one member of the group is present in, used in, or otherwise related to a given product or process. This disclosure includes embodiments in which two or more, or all of the group members are present in, used in, or related to a given product or process.

[0098] Furthermore, this disclosure encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, and descriptive terms from one or more of the enumerated claims are introduced into another claim. For example, any claim dependent on another claim may be modified to include one or more limitations found in any other claim dependent on the same basic claim. Where elements are presented as a list, for example in Markush group format, each subgroup of the elements is also disclosed, and any element(s) may be removed from the group.

[0099] In general, where the Disclosure or aspects thereof are referred to as containing certain elements and / or features, it should be understood that certain embodiments of the Disclosure or aspects thereof consist of or are essentially such elements and / or features. For simplicity, these embodiments are not specifically described herein.

[0100] 7.1 Example 1. Efficient CRISPR knockout of A20 in CAR-T cells. To determine whether efficient knockout of A20 can be achieved in CAR-T cells, the inventors performed Western blotting of the A20 protein on A20 CRISPR knockout cells at different time points. CRISPR-mediated knockout of the A20 gene was performed on the same day as CAR transduction. During transduction, cells were cultured in IL-2-containing medium and maintained at a concentration of 200,000–500,000 / cell / mL. Cell concentration and viability were measured every 2–3 days, and cells were diluted in the medium to achieve a standardized concentration of 200,000–500,000 / cell / mL. To evaluate A20 expression, cells were lysed, and protein content was analyzed by Western blotting after 7 days (Figure 1A) or 13 days (Figure 1B) of proliferation. A20 expression disappeared on days 7 and 13.

[0101] Considering the broad effects of A20 in regulating the NF-κB signaling pathway, we investigated whether knockout of this gene affects in vitro proliferation or the CD4 / CD8 ratio of CAR-T cells. Incremental growth rate changes were calculated by dividing each new concentration measurement by the previously standardized concentration. Cumulative growth rate changes were calculated by multiplying all incremental growth rate changes. The graphs represent the cumulative growth rate of each construct. Knockout of the A20 gene had virtually no effect on the growth rate (Figure 2A) and CD4 / CD8 ratio (Figure 2B) of unarmored or A20-deficient CAR-T cells.

[0102] 7.2 Example 2. A20 deficiency leads to enhanced NF-κB activation upon CAR engagement. A20 is a key negative regulator of the NF-κB pathway, which is activated upon T cell receptor (TCR) engagement ([2]). It remains unclear whether A20 negatively modulates NF-κB, which signals downstream CAR engagement. To resolve this question, we performed a reporter assay using Jurkat cells transfected with a luciferase-expressing NF-κB-responsive construct. These NF-κB luciferase reporter Jurkat cells were either untransduced, lacked a CAR, or expressed either a GPC3 (Figure 3A)CAR or a CD19 (Figure 3B)CAR, and were either sufficiently A20-rich or knocked out. Untransduced cells did not show NF-κB activation when unstimulated or stimulated with the GPC3-expressing cell line PLC / PRF / 5. Cells expressing the GPC3 CAR showed slightly elevated luciferase signaling at baseline due to persistent 4-1BB signaling, which, as expected, increased 3.6-fold upon stimulation with GPC3+ cells. NF-κB activation levels in unstimulated A20 KO CAR-T cells were 2.6-fold higher than in unstimulated non-armored CAR-T cells and were induced 2.3-fold more strongly during incubation with PLC / PRF / 5 compared to stimulated non-armored CAR-T cells (Figure 3A). A similar pattern was observed when cells expressing the CD19 CAR were stimulated with the CD19+ cell line NALM6. The data confirm that the absence of A20 leads to enhanced NF-κBα activation in CAR-T cells.

[0103] To better characterize the biological effects of enhanced NF-κBα activation downstream of CAR, we performed gene expression arrays on unarmored or A20 KO armored CAR-T cells stimulated with or unstimulated target-expressing cells. As shown in Figures 4A–4, A20 deficiency results in enhanced NF-κB activation upon CAR engagement. Gene expression was analyzed by nanostrings on unarmored or A20 KO CAR-T cells, either left unstimulated or stimulated with GPC3-positive tumor cells for 1 or 6 days. Figure 4A - Volcano plot shows gene ratios in A20 KO compared to unarmored CAR-T cells. At all time points analyzed, more than 50% of the upregulated genes were NF-κB target genes. Figure 4B - Heatmap shows the top 20 upregulated NF-κB target genes in A20-deficient CAR-T cells after 6 days. The data confirm that A20 deficiency leads to NF-κBα activation, downstream classical TNF pathway enhancement, and downstream CAR-T cell enhancement.

[0104] 7.3 Example 3. A20-deficient CAR-T cells show increased and prolonged upregulation of activation markers. Tumor antigen expression and receptor density have been shown to modulate CAR-T effector function [3]. To evaluate whether A20 knockout affects the sensitivity of CAR-T cells to different levels of target expression, we co-cultured unarmored and armored CAR-T cells with cell lines expressing different levels of target. To quantify target expression, we stained the cell lines for GPC3 expression and calculated receptor density by flow cytometry using bang beads. Figure 5 shows GPC3 high expression (Hep3B), medium / low expression (PLC / PRF / 5), and low expression (PLC / PRF / 5). lowThe characteristics of target cell lines expressing ) are shown. Cell line SNU-182 is GPC3-negative and was used as a negative control (Figure 5). The inventors used these cell lines in downstream in vitro and in vivo assays to characterize A20 KO armored CAR-T cells.

[0105] CAR-T cell activation leads to the release of effector cytokines, among which IFNγ is one of the best characterized. To evaluate whether A20 knockout affects IFNγ release, unarmored or A20-KO CAR-T cells were incubated with tumor cells expressing low, medium / low, or high levels of GPC3 at an E:T ratio of 0.3:1. After 24 hours, the supernatant was collected and IFNγ secretion was assessed by MSD. Figure 6 shows that A20 deficiency results in approximately three-fold higher levels of IFNγ secretion at all antigen densities.

[0106] To evaluate the effect of A20 knockout on the cytotoxic capacity of CAR-T cells, unarmored or A20 knockout CAR-T cells were incubated with tumor cells expressing low, medium / low, or high levels of GPC3 at an E:T ratio of 0.3:1, and cell lysis was assessed by xCELLigence. Figure 7 shows that A20 deficiency does not result in increased target cell killing in a rapid single-challenge assay.

[0107] CAR engagement leads to upregulation of T cell activation markers and differentiation into effector phenotypes. To assess whether A20 knockout (KO) can affect T cell activation, unarmored or A20 KO CAR-T cells were incubated with tumor cells expressing low (Figure 8A) or high (Figure 8B) levels of GPC3. CD25 and CD69 expression was analyzed by flow cytometry targeting CAR+ cells at 1 or 6 days. Figures 8A–8B show that unstimulated A20 KO cells express similar levels of CD25 and CD69 compared to unarmored CAR-T cells. Activation markers were strongly upregulated at 1 day after incubation with low-GPC3 expression cells (Figure 8A) or high-GPC3 expression cells (Figure 8B), and downregulated at 6 days in unarmored cells. A20 deficiency results in a rapid increase in the expression of NF-κB-dependent activation markers CD25 and CD69 on day 1 (D1). This phenomenon was more pronounced in incubation with low-GPC3 target cells, with the frequency of A20 KO CD25 / CD69 double-positive (DP) cells being approximately 1.4 times higher compared to non-armored cells. Six days after incubation, non-armored cells almost completely downregulated CD25 and CD69, while A20 KO cells still showed higher expression (approximately 1.4 times) of CD25 and CD69 despite the complete killing of target cells. Incubation with high-GPC3 target cells also resulted in higher expression of CD25 and CD69, although this phenomenon was less pronounced due to the higher expression of the two markers in non-armored cells on day 6. Therefore, A20 deficiency results in prolonged CAR-T cell activation. When the dot plot was gated in the CD4+ population, similar results were obtained for CD8+ CAR-T cells.

[0108] 7.4 Example 4.A20 KO CAR-T cells show similar expression of stem cell genes and exhaustion genes compared to non-armored CAR-T cells. T cell activation leads to differentiation into effector phenotypes that can efficiently support cytokine secretion and target cell killing. However, more differentiated cells may undergo faster aging and dysfunction and may lack persistence. We investigated whether higher expression of activation markers is associated with a more differentiated phenotype in A20KO armored CAR-T cells. Unarmored or A20KO CAR-T cells were incubated with tumor cells expressing low levels (Figure 9A) or high levels (Figure 9B) of GPC3, as shown in Figure 8. After 1 or 6 days, the expression of differentiation markers CD62L and CD45RO was analyzed by flow cytometry targeting CAR+ cells to distinguish between naive (CD62Lhi CD45ROhi), central memory (CD62Lhi CD45ROhi), and effector memory (CD62LloCD45ROhi). When the dot plot was gated in the CD4+ population, similar results were obtained for CD8 CAR-T cells. Figures 9A–9C show that A20-deficient CAR-T cells exhibit a similar differentiation pattern compared to non-armored CAR-T cells. These data indicate that A20 deficiency does not result in increased differentiation before or after antigen encounter. This is particularly relevant because increased and prolonged expression of activation markers can lead to increased differentiation and, consequently, decreased stem cell characteristics and persistence. Figure 9C shows that A20 KO CAR-T cells exhibit similar expression of stem cell genes and exhaustion genes compared to non-armored CAR-T cells. Non-armored or A20 KO CAR-T cells were incubated with tumor cells at high levels of GPC3. After 6 days, gene expression shown was analyzed by nanostring. These data indicate that A20 deficiency does not result in increased differentiation antigen encounter, supporting the findings in Figures 9A and 9B.

[0109] 7.5 Example 5. The absence of A20 delays CAR-T dysfunction in vitro. The differentiation stage of T cells is closely related to their proliferative capacity, viability, and cytotoxic capacity. Sustained antigen stimulation of CAR-T cells in cancer induces terminal differentiation of CAR-T cells, leading to progressive dysfunction and T cell exhaustion. Classical features of exhaustion include low proliferative capacity, decreased secretion of effector cytokines, and reduced cytotoxic capacity [4]. To test the effect of A20 knockout on T cell dysfunction, we developed a serial killing assay that mimics the chronic antigen exposure that CAR-T cells would experience in TME by repeatedly stimulating CAR-T cells with antigen-expressing cells.

[0110] Unarmored or A20-deficient CAR-T cells were incubated with target cells expressing high (Figure 10A), medium / low (Figure 10B), and low (Figure 10C) levels of GPC3 as effectors: target ratio 0.3:1 (high GPC3) or 2:1 (medium / low GPC3 and low GPC3). After 2-3 days, cell counts were assessed by flow cytometry, and fresh tumor cells were added to the culture to maintain the initial E:T ratio. During the first round of the assay, unarmored and A20 KO CAR-T cells killed all tumor cells regardless of antigen density. However, after several rounds, as the cells became dysfunctional, the efficacy of the CAR-T cells decreased. A20 deficiency delayed the onset of dysfunction, allowing CAR-T cells to maintain their ability to kill tumor cells longer than unarmored cells. This is especially true when the target cells express very low levels of GPC3.

[0111] As shown in Figures 11A–11C, enhanced tumor control in the serial killing assay did not correlate with enhanced proliferation. GPC3-expressing cells—high (Figure 11A), medium / low (Figure 11B), and low (Figure 11C)—were treated as shown in Figure 10. Proliferation rates were calculated based on the number of CAR+ cells counted after each round of killing. The data show that A20 KO cells did not proliferate further compared to non-armored cells, and therefore the enhanced tumor control was a result of enhanced intrinsic effector capacity.

[0112] As shown in Figures 12A–12C, the absence of A20 delays the decrease in effector cytokine production in serial killing assays against high-GPC3-expressing cells. Unarmored or A20-deficient CAR-T cells were incubated with target cells expressing high levels of GPC3 as effectors: target ratio 0.3:1 (high GPC3) or 2:1 (medium / low GPC3 and low GPC3). Serial killing assays were performed as described above (Figure 10). IFNγ (Figure 12A), IL2 (Figure 12B), and TNFα (Figure 12C) in the supernatant were analyzed after 3, 5, or 6 rounds of serial killing. A20 KO CAR-T cells produced more effector cytokines and demonstrated enhanced activation compared to unarmored CAR-T cells, even after multiple rounds of stimulation.

[0113] 7.6 The absence of Example 6.A20 enhances the efficacy of CAR-T against high-GPC3-expressing tumors. To test the in vivo efficacy of A20 KO CAR-T cells, the inventors used a xenograft model employing the GPC3-overexpressing HCC cell line Hep3B as a target, and monitored the CAR-T cells' ability to regulate tumor growth and the release of IFNγ as a marker of effector function.

[0114] As shown in Figures 13A to 13D, Hep3B was subcutaneously transplanted into the flank of NSG mice. The tumor volume was 200 mm². 3 When tumor volume reached a certain level, untransduced T cells (UT) or CAR-T cells were intravenously injected at a dose of 0.5e6 or 2e6 cells / mouse. Tumor volume was measured every two weeks. Figure 13A shows the tumor volume of individual mice in studies injected with 0.5e6 CAR-T cells or UT cells. UT cells were unable to control tumor growth. Mice injected with unarmored CAR-T cells experienced partial tumor control and maintained a tumor volume of 500 mm over a long period. 3 Only 3 out of 9 mice were able to maintain a tumor volume of less than 500 mm³. In contrast, 6 out of 9 mice injected with A20 KO CAR-T cells maintained a tumor volume of less than 500 mm³ for approximately 10 days. 3The tumor could be maintained at less than 2e6 CAR-T cells. Mice injected with 2e6 CAR-T cells generally experienced deeper and more persistent tumor control compared to mice injected with lower doses of cells (Figure 13B). Non-armored CAR-T cells induced complete regression (CR) in 3 out of 7 mice (42%), while in contrast, A20 KO CAR-T cells induced CR in 7 out of 8 mice (87%) (Figure 13B). Four A20 KO injected mice were already in CR at D17 post-injection compared to the only mouse injected with non-armored CAR-T cells. A20 KO CAR-T cells were able to mediate long-term tumor control, as reflected by a statistically significant difference in survival (Figure 13D) (Figure 13C). These data demonstrate that A20 KO CAR-T cells have superior efficacy against high-GPC3-expressing tumors compared to non-armored CAR-T cells.

[0115] As shown in Figure 14, A20 KO CAR-T cells produce more IFNγ in vivo. Serum IFNγ was analyzed from mice treated as shown in Figure 12, seven days after T-cell infusion. Higher levels of IFNγ were present in the serum of A20 KO mice, consistent with in vitro findings (Figure 6) demonstrating that A20 deficiency leads to enhanced CAR-T cell activation in vivo.

[0116] 7.7 The absence of Example 7.A20 enhances the efficacy of CAR-T against tumors with moderate to low GPC3 expression. The data presented in Example 6 demonstrate that the absence of A20 enhances CAR-T activation in high-GPC3-expressing tumors. To investigate whether similar enhancements in in vivo efficacy are achieved in low / moderate target-expressing cells, we used a xenograft model utilizing PLC / PRF / 5 cells to monitor the effect of CAR-T cells on tumor growth, as well as their in vivo proliferation and IFNγ production.

[0117] As shown in Figures 15A to 15C, PLC / PRF / 5 was subcutaneously transplanted into the flank of NSG mice. The tumor volume was 200 mm². 3 When tumor volume reached a certain level, untransduced T cells (UTs) or CAR-T cells were intravenously injected at doses of 0.5e6 cells or 2e6 cells / mouse. Tumor volume was measured every two weeks. Figure 15A shows that injection of low-dose CAR-T cells (0.5e6 cells / mouse) can partially control tumor growth. A20 KO CAR-T cells provided a slightly longer control. As shown in Figure 15B, 2e6 non-armored CAR-T cells induced delayed tumor growth, while in contrast, the same dose of A20 KO CAR-T cells induced complete response (CR) in all treated mice, prolonged tumor control, and increased survival (Figure 15C). These data demonstrate that A20 KO CAR-T cells have superior efficacy against medium / low GPC3-expressing tumors compared to non-armored CAR-T cells.

[0118] The inventors investigated whether enhanced efficacy in vivo correlated with an increase in the number of CAR-T cells in tumors. To answer this question, the inventors injected non-armored or A20 KO CAR-T cells expressing luciferase under the control of a CAR promoter into PLC / PRF / 5 tumor-bearing mice and tracked cell distribution and proliferation. Luc+-A20 KO CAR-T cells were more effective than non-armored CAR-T cells (A), as shown in Figure 15B. The amount of BLI in the tumor, calculated as a digit change after injection day (D0), indicates that CAR-T cells underwent rapid proliferation followed by significant contraction correlated with a decrease in tumor volume, showing similar dynamics for both non-armored and A20 KO CAR-T cells. The digit change in BLI was not higher in A20 KO CAR-T cells compared to non-armored CAR-T cells, indicating a similar number of tumor-infiltrating cells. In contrast, tumor 1 mm 3The density of A20 KO CAR-T cells per unit area was significantly higher compared to non-armored CAR-T cells, consistent with the smaller tumor volume resulting from increased efficacy. Figures 16A–16C show that the absence of A20 enhances the efficacy of CAR-T cells without affecting cell number. PLC / PRF / 5 was subcutaneously transplanted into the flank of NSG mice. Tumor volume was 200 mm². 3 When tumor volume reached a certain level, non-transduced T cells (UTs) or luciferase-expressing CAR-T cells were intravenously injected at a dose of 2e6 cells / mouse. Tumor volume (Figure 16A) and bioluminescence (BLI) (Figures 16B and 16C) were assessed every two weeks. These data demonstrate that the absence of A20 enhances the efficacy of CAR-T cells without affecting proliferation.

[0119] As shown in Figure 17, A20 KO CAR-T cells maintain a higher capacity to produce IFN when tumor recurrence occurs. When the tumor volume is approximately 300 mm³ at the time of recurrence... 3 Tumors were collected from non-armored or A20 KO injected mice when the tumors reached a certain stage. The tumors were homogenized, the cell suspension was plated, and stimulated overnight with PMA (10 ng / mL) and ionomycin (500 ng / mL). The supernatant was collected and IFNγ was analyzed by MSD. The frequency and number of T cells per sample were determined by flow cytometry of the cell fraction before stimulation. Secreted IFNγ was normalized by the number of T cells / well. The data show that A20 KO CAR-T cells isolated from recurrent tumors have higher intrinsic activation potential compared to non-armored CAR-T cells, consistent with in vitro data.

[0120] 7.8 The absence of Example 8.A20 enhances the efficacy of CAR-T against low-GPC3-expressing tumors. Low expression of tumor-associated antigens as a result of tumor escape or heterogeneity is one of the main causes of cell therapy failure in solid tumors. We investigated whether A20 deficiency would result in enhanced in vivo efficacy against tumors expressing low levels of GPC3.

[0121] As shown in Figure 18, PLC / PRF / 5 expressing low levels of GPC3 was subcutaneously transplanted into the flank of NSG mice. The tumor volume was 200 mm². 3 When tumor volume reached a certain level, non-transduced T cells (UT) or CAR-T cells were intravenously injected at doses of 0.5e6 or 2e6 cells / mouse. Tumor volume was measured every two weeks. Left panel: Infusion of low-dose CAR-T cells (0.5e6 cells / mouse) can slightly delay tumor growth. A20 KO CAR-T cells achieve increased tumor control. Similar benefits are shown in the panel. Right panel: Dose of 2e6 CAR+ cells / mouse. These data indicate that A20 KO CAR-T cells have superior efficacy against low-GPC3-expressing tumors compared to non-armored CAR-T cells.

[0122] Figure 19 shows that A20 KO CAR-T cells produce more IFNγ in vivo in GPC3 low tumors. Mice treated as shown in Figure 17 were sacrificed 7 days after T cell infusion, and IFNγ was analyzed by intracellular staining in tumor-infiltrating CAR-T cells. Tumor-infiltrating A20 KO CAR-T cells expressed higher levels of IFNγ, consistent with in vitro findings (Figure 6) demonstrating that A20 deficiency leads to enhanced CAR-T cell activation in vivo.

[0123] 7.9 Knockout of Example 9.A20 results in enhanced IFNγ production in a CAR-independent manner. To characterize the effects of A20 deficiency on CAR-T cell effector function, the inventors used GPC3-CAR as a benchmark. To investigate whether A20 knockout yields similar phenotypes using different CARs, the inventors analyzed the production of the effector cytokine IFNγ in HER2 CAR-T cells that were either A20-sufficient or A20-knockingout.

[0124] HER2 CAR-T cells were generated using methods known in the art. The cell lines shown were stained for HER2 expression and analyzed by flow cytometry (Figure 21). CRISPR-mediated knockout of the A20 gene was performed on the same day as HER2 CAR transduction. A20 protein expression after 10 days of cell proliferation was evaluated using Western blotting (Figure 22A). Relative A20 protein expression was quantified by densitometry (Figure 22B). A20 expression was normalized relative to β-actin expression. These results indicate that A20 knockout was efficient and stable in HER2 CAR-T cells.

[0125] As shown in Figure 20, IFNγ is HER2 + Target cell lines were undetectable when incubated with UT T cells. In contrast, incubation of HER2-CART cells resulted in robust IFNγ production, which was approximately twice as high when CAR-T cells were A20 knockout (Figure 20) as observed by the inventors using GPC3 CAR-T cells (Figure 6). This result indicates that the absence of A20 independently has a similar effect on CAR expressed by cells. Therefore, A20 knockout is a protective strategy that can be applied across multiple projects.

[0126] The proportions of CD4 and CD8 in UT were gated in the CD45+ population, while the proportions of CD4 and CD8 in unarmored and A20KO CAR-T cells were gated in CAR+ cells. The absence of A20 had virtually no effect on the proliferation rate of CAR-T cells (Figure 23A) or the CD4 / 8 ratio (Figure 23B).

[0127] A20 deficiency also did not result in increased target cell killing in a rapid single-challenge assay (Figure 24). A20-deficient HER2 CAR-T cells showed increased and prolonged upregulation of activation markers (Figure 25). Unarmored or A20KO HER2 CAR-T cells were incubated with JIMT1 tumor cells. CD25 and CD70 expression was analyzed by flow cytometry targeting CAR+ cells at 1 or 4 days. A20 deficiency resulted in a rapid increase in the expression of the activation marker CD70 at D1. At 4 days of incubation, A20KO cells showed higher expression of CD25 and CD70 despite complete target cell killing. Thus, the absence of A20 resulted in prolonged CAR-T cell activation.

[0128] A20-deficient HER2 CAR-T cells showed a similar differentiation pattern compared to unarmored CAR-T cells. Unarmored or A20KO HER2 CAR-T cells were incubated with JIMT1 (Figure 26A) tumor cells or MDA-MB-231 (Figure 26B) tumor cells. At 1 or 4 days, the expression of differentiation markers CD62L and CD45RO was analyzed by flow cytometry targeting CAR+ cells. This is particularly relevant because increased and prolonged expression of activation markers can lead to increased differentiation. These data indicate that A20 deficiency did not result in increased differentiation before or after antigen encounter.

[0129] To test the effect of A20 knockout on HER2 CAR-T cell dysfunction, we developed a serial killing assay that mimics the chronic antigen exposure that CAR-T cells would experience in TME by repeatedly stimulating CAR-T cells with antigen-expressing cells. Unarmored or A20-deficient HER2 CAR-T cells were incubated with HER2-expressing target cells (MDA-MB-231). After 3–4 days, cell counts were assessed by flow cytometry, and fresh tumor cells were added to the culture to maintain the initial E:T ratio. During the first round of the assay, unarmored and A20-deficient CAR-T cells killed all tumor cells. However, after several rounds, as the cells became dysfunctional, the efficacy of the CAR-T cells decreased. As shown in Figure 27, A20 deficiency delayed the onset of dysfunction, and CAR-T cells maintained their ability to kill tumor cells longer than unarmored cells. This assay also showed that A20 KO HER2 CAR-T cells achieved greater antigen-mediated proliferation than their unarmored counterparts, suggesting a CAR-specific A20 KO protective effect (Figure 27B). Proliferation rates were calculated based on the number of CAR+ cells counted after each round of killing. As shown in Figure 27C, the absence of A20 delayed the decline in effector cytokine production after multiple retries. A20 KO HER2 CAR-T cells produced more IFNγ compared to unarmored CAR-T cells, even after multiple rounds of stimulation, confirming an enhanced activation state.

[0130] 7.10 Example 11: Absence of A20 enhances the efficiency of allogeneic CAR-T cells. Universal effect T cells (UECs) have been previously described (International Publication No. 2023 / 025862(A1)). To evaluate the effect of A20 knockout in cells suitable for allogeneic cell therapy, UECs expressing anti-Her2 CARs were stimulated overnight with plate-bound Her2 protein or PBS alone as a control. The following day, the cells were lysed and protein extracts were analyzed by Western blotting. A20 was upregulated in unarmored UECs after CAR stimulation, confirming successful A20 knockout at the protein level in armored UECs and the lack of A20 upregulation in stimulated cells (Figure 28).

[0131] The rapid killing ability of A20 KO or unarmored Her2-UECs was tested using an xCelligence killing assay with JIMT-1 target cells. A20 KO did not improve the rapid killing of tumor cells in UECs, similar to autologous CAR-T (Figure 7) (Figure 29). Activation markers CD25 and CD69 were evaluated by flow cytometry in unarmored and A20 KO Her2-UECs after 3 days of co-culture with JIMT-1 target cells in a resting state or with an E:T ratio of 1:1. A20 KO UECs maintained a more activated phenotype than their unarmored counterparts (Figure 30). Expression of the activation marker CD70 was measured by flow cytometry in either unarmored or A20 KO co-cultures of Her2-UECs for up to 3 days with an E:T ratio of 1:1 with JIMT-1 target cells. A20 KO UECs expressed CD70 at higher levels and showed a higher activation state than non-armored UECs (Figure 31). Effector cells were co-cultured with either JIMT-1 target cells or MDA-MB-231 target cells in an E:T ratio of 1:1, and the supernatant was analyzed after overnight incubation. IFNγ was quantified using the ELLA assay (Bio-techne). A20 KO UECs produced more IFNγ than their non-armored counterparts (Figure 32). Furthermore, this data indicates that A20 KO does not induce nonspecific release of IFNγ, as cytokines were not detected in the absence of target cells.

[0132] 8 References All patents and publications referenced herein are incorporated herein by reference to the same extent as each independent patent and publication is specifically and individually indicated as being incorporated by reference. No citation or specification of any reference in any section of this application should be construed as an acknowledgment that such reference is available as prior art to this disclosure. [1] RCLarson and MVMaus, Nat. Rev. Cancer 21, p. 145 (2021). [2] S. Paul and BCSchaefer, Trends Immunol. 34, 269 (2013). [3] AJ Walker et al., Mol.Ther.J.Am.Soc.Gene Ther.25, 2189 (2017). [4] G. Lopez-Cantillo et al., Front.Immunol.13, 878209 (2022).

Claims

1. A population of cells containing the disrupted TNF-alpha-inducible protein 3 (A20; TNFAIP3) gene.

2. A population of cells according to claim 1, further comprising nucleic acids containing isolated nucleotide sequences encoding chimeric antigen receptors (CARs).

3. The population of cells according to claim 1 or claim 2, wherein the population of cells is a population of the same cells or a population of allogeneic cells.

4. The population of cells according to any one of claims 1 to 3, wherein the population of cells is a T cell population, a cytotoxic T lymphocyte (CTL) population, or a tumor-infiltrating lymphocyte population.

5. The cell population according to any one of claims 1 to 4, wherein the cell population includes total T cells.

6. The cell population according to any one of claims 1 to 5, wherein the cell population includes CD8+ T cells.

7. The cell population according to any one of claims 1 to 5, wherein the cell population includes CD4+ T cells.

8. The cell population according to any one of claims 1 to 7, wherein the cell population includes human primary immune cells.

9. The cell population according to any one of claims 1 to 8, wherein at least about 90%, at least about 95%, or at least about 99% of the cells in the cell population do not express A20.

10. The cell population according to any one of claims 1 to 9, wherein at least about 90%, at least about 95%, or at least about 99% of the cells in the cell population express CAR.

11. The population of cells according to any one of claims 1 to 10, wherein the activation of the NF-κB pathway is enhanced by at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 4 times, or at least about 5 times.

12. The population of cells according to any one of claims 1 to 11, wherein the population of cells exhibits antitumor activity.

13. The population of cells according to any one of claims 1 to 12, wherein the population of cells exhibits enhanced antitumor activity.

14. A pharmaceutical composition comprising a population of cells according to any one of claims 1 to 13 and a pharmaceutically acceptable carrier.

15. A method for treating cancer in a subject requiring cancer treatment, comprising administering to the subject a population of cells according to any one of claims 1 to 13 or a pharmaceutical composition according to claim 14.

16. The method according to claim 15, wherein the cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, stomach cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, stomach cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, or a metastatic form thereof.

17. The method according to claim 15 or claim 16, further comprising inhibiting tumor growth, inducing tumor regression, and / or prolonging survival of the subject.

18. A method for treating cancer, a) Obtaining a population of cells from a donor, b) Genetically modifying the aforementioned cell population to disrupt the TNF alpha-inducible protein 3 (A20; TNFAIP3) gene, c) Proliferating the population of the genetically modified cells, d) Administering the aforementioned population of proliferated genetically modified cells to the patient, Methods that include...

19. The method according to claim 18, wherein A20 is destroyed by a Cas / CRISPR system.

20. The method according to claim 18 or claim 19, further comprising introducing a chimeric antigen receptor (CAR) into the population of cells.

21. The method according to any one of claims 18 to 20, wherein the population of cells is a population of autologous cells or a population of allogeneic cells.

22. The method according to any one of claims 18 to 21, wherein the population of cells is a T cell population, a cytotoxic T lymphocyte (CTL) population, or a tumor-infiltrating lymphocyte population.

23. The method according to any one of claims 18 to 22, wherein the population of cells includes total T cells.

24. The method according to any one of claims 18 to 23, wherein the population of cells includes CD8+ T cells.

25. The method according to any one of claims 18 to 24, wherein the population of cells includes CD4+ T cells.

26. The method according to any one of claims 18 to 25, wherein the population of cells includes human primary immune cells.

27. The method according to any one of claims 18 to 26, wherein the population of cells exhibits enhanced antitumor activity.

28. Use of a population of cells according to any one of claims 1 to 13 or a pharmaceutical composition according to claim 14 for the manufacture of a pharmaceutical for the treatment of a disease or condition.

29. The use according to claim 28, wherein the disease or condition is cancer.

30. The use according to claim 29, wherein the cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, stomach cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, stomach cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, or a metastatic form thereof.

31. A population of cells according to any one of claims 1 to 13 or a pharmaceutical composition according to claim 14, for use as a pharmaceutical.

32. A population of cells according to any one of claims 1 to 13 or a pharmaceutical composition according to claim 14, for use in the treatment of the aforementioned cancer.

33. The population of cells for use according to claim 32, wherein the cancer is bladder cancer, bone cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, gallbladder cancer, gastric cancer, head and neck cancer, kidney cancer, liver cancer, lung cancer, melanoma, mesothelioma, nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, small cell lung cancer, small intestine cancer, soft tissue sarcoma, gastric cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, or metastatic forms thereof.

Images