Treatment of solid tumors using 5-HTR1B regulators

A novel HTR1B antagonist, Compound A, effectively treats solid tumors by demonstrating high activity and synergistic effects with standard chemotherapeutics, addressing the limitations of existing treatments.

JP2026521568APending Publication Date: 2026-06-30LEUKOS BIOTECH SL

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
LEUKOS BIOTECH SL
Filing Date
2024-06-14
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing treatments for solid tumors have limited effectiveness, and there is a need for more potent and selective compounds that modulate serotonin receptor 1B (5-HTR1B) to address this challenge.

Method used

Development of a novel HTR1B antagonist, referred to as Compound A, which demonstrates high activity against a variety of solid tumors, including synergistic effects with standard therapeutic products like paclitaxel and sorafenib.

Benefits of technology

Compound A effectively treats solid tumors, particularly breast and ovarian cancer, with significant antitumor activity and synergistic effects when combined with existing chemotherapeutics, enhancing treatment efficacy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026521568000001_ABST
    Figure 2026521568000001_ABST
Patent Text Reader

Abstract

This invention relates to novel, potent, and selective compounds that modulate serotonin receptor 1B (5-HTR1B), also known as 5-hydroxytryptamine receptor 1B (5-HT1B). These compounds are useful in the treatment of cancer, particularly solid tumors.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This invention relates to novel potent and selective compounds that modulate serotonin receptor 1B (5-HTR1B), also known as 5-hydroxytryptamine receptor 1B (5-HT1B) or simply HTR1B. These compounds are useful in the treatment of cancer, particularly solid tumors. [Background technology]

[0002] Serotonin (5-hydroxytryptamine, 5-HT) is a biological monoamine that acts as a neurotransmitter in the central nervous system (CNS), a local mediator in the gut, and a vasoactive agent in the blood. It is synthesized from the essential amino acid tryptophan via a two-step pathway. Most of the serotonin in the body is localized in the periphery (Non-Patent Literature 1). Serotonin is involved in various CNS functions, including brain development, circadian rhythms, thermoregulation, cognition, pain, appetite, sexual drive, fear, mood, violent behavior, motor function, and neuroendocrine function. Furthermore, serotonin is involved in many CNS and mental disorders: Parkinson's disease, depression, hallucinations, schizophrenia, bulimia, anxiety, addiction, and chronic stress. Therefore, the serotonergic system is a target for numerous psychoactive compounds, including antidepressants, antipsychotics, and hallucinogens (Non-Patent Literature 2).

[0003] Part of the broad range of effects that 5-HT mediates stems from the large number of 5-HT receptors, which are divided into seven families, all but one of which are members of the G protein-coupled receptor (GPCR) superfamily. The exception is the 5-HT3 receptor, a Cycloop ligand-gated ion channel.

[0004] In particular, the 5-HT receptor family consists of five distinct gene products: 5-HT1A, 5-HT1B, 5-HT1D, 5-HT1E, and 5-HT1F receptors. Each is encoded by a single intron-free reading frame and shares considerable sequence homology. All of these receptors bind to Gi / o and inhibit adenylyl cyclase, reducing cAMP levels, although further signaling mechanisms have been reported. Some of these receptors are well known as autoreceptors that regulate the excitability of serotonergic neurons and serotonin release, but they can also be expressed in non-serotonergic neurons and exert similar effects on other neurotransmitters.

[0005] In this invention, the 5-HT1B (also known as 5-HTR1B, and interchangeably referred to herein as 5-HTR1B) receptor is of particular interest. 5-HT1B is widely distributed in serotonergic and non-serotonergic neurons in the CNS. This autoreceptor has been found to reduce serotonin synthesis and release and enhance serotonin transporter-mediated reuptake. It also inhibits the release of a range of different neurotransmitters, depending on the type of neuron expressing it. Systemic administration of 5-HT1B receptor agonists induces certain behavioral effects, including increased spontaneous movement, altered brain reward mechanisms, and decreased aggression, while selective antagonists possess some degree of cognitive enhancement. The expression of the receptor in a diverse and potentially competing set of neurons influences its usefulness as a clinical target, although certain 5-HT1B / D receptor agonists are effective in treating migraines. 5-HTB receptor knockout mice have been widely studied and are characterized by increased aggression and, in most cases, a predisposition to addictive behavior, but with different phenotypes (Non-Patent Literature 3).

[0006] 5-HT is involved in the autocrine loop of growth factors that contribute to cell proliferation in aggressive tumors, but one study has shown that serotonin may also exert antitumor effects through the inhibition of angiogenesis. In silico screening was performed to search for small molecules that induce terminal differentiation, and apomorphine, an HTR1 / 2 antagonist, was identified. Studies were conducted in immunodeficient mice transplanted with human acute myeloid leukemia (AML) cells and left for 7 days until leukemia was established. The mice were then treated with apomorphine (5 mg / kg body weight) or methiotepine (0.1 mg / kg body weight) every two days for 14 days. Both HTR1 antagonists significantly reduced AML loading in the bone marrow (BM) compared to vehicle-treated mice. Similarly, the clonal function of transplanted AML cells was impaired in both treated mice, highlighting the effect of HTR inhibition on the self-renewal capacity of AML cells. The results indicate that AML cells express HTR1A and HTR1B, and that inhibition of these proteins induced terminal differentiation and cell death. Interestingly, leukemia stem cells (LSCs) are more sensitive to HTR1 antagonists than more mature AML blasts. Therefore, HTR1A and HTR1B may constitute interesting targets for AML treatment. This study demonstrates the involvement of HTR1 in cancer stem cells, and the results highlight the biological function of HTR1 in leukemia maintenance and suggest that HTR1 signaling is involved in AML blast survival and LSC functionality. (Non-patent Literature 4). [Prior art documents] [Patent Documents]

[0007] [Patent Document 1] International Publication No. 2022 / 074103 [Non-patent literature]

[0008] [Non-Patent Document 1] Sarrouilhe D. et al., Serotonin and Cancer: What Is the Link?, Current Molecular Medicine 2015, 15, 62-77 [Non-Patent Document 2] Marin P. et al., 5-HT Receptor-Associated Protein Networks: New Targets for Drug Discovery in Psychiatric Disorders?, Current Drug Targets, 2012,13, 28-52 [Non-Patent Document 3] Barnes NM et al., Neuronal 5-HT Receptors and SERT, Tocris Scientific Review Series, https: / / www.tocris.com / literature / scientific-reviews / 5-ht-receptors [Non-Patent Document 4] Etxabe, A. et al, Inhibition of serotonin receptor type 1 in acute myeloid leukemia impairs leukemia stem-cell functionality: A promising novel therapeutic target, Leukemia, 2017,1-15 [Overview of the Initiative] [Problems that the invention aims to solve]

[0009] However, as outlined above, the application of the antitumor effect of the HTR1B antagonist has so far been limited to hematological conditions (see also Patent Document 1). In fact, there have been conflicting reports regarding the actual presence of HTR1B in other cancers, particularly in solid tumors. At the same time, there remains a need to develop further treatments for other cancers, particularly solid tumors. [Means for solving the problem]

[0010] The present inventors address this need by providing a novel HTR1B antagonist, which is referred to as "Compound A" in this disclosure.

[0011] [ka] Compound A That's what they say. This compound is effective in treating cancer, particularly solid tumors. The advantageous properties of the compound will be described in more detail below and in the examples. In particular, the inventors screened an NCI panel of cell lines of representative tumors (especially solid tumors such as those associated with lung cancer, kidney cancer, ovarian cancer, breast cancer, and colon cancer) and generated data using compound A. The disclosures and related examples of this application refer to SB224289 (SB9, Selkirk, JV, et al., British Journal of Pharmacology (1998) 125:202-208) and SB216641 (SB41, Price, GW, Naunyn Schiedebergs Arch. Parmacol. (1997) 356(3):312-320). SB224289 (SB9) and SB216641 (SB41) are known HTR1B receptor antagonists. Therefore, this experiment highlights that the claimed compound of the present invention not only provides a highly active compound, but surprisingly, is more active than other HTR1B antagonists. Compound A was shown to be the most active compound in a wide variety of tumors, particularly solid tumors. More specifically, the inventors have shown that compound A is also effective against spheroids of tumor cell lines derived from solid tumors. This highlights the possibility that the compound may prevent recurrence by treating tumor stem cells, which can be considered a surrogate model. A surprising observation is that HTR1B is indeed overexpressed when the spheroids are derived from 2D cultures. Furthermore, the inventors have surprisingly found that there is an unexpected synergistic effect between the HTR1B antagonist of the present invention and a standard therapeutic product used for treating solid tumors. The synergistic effect with compounds having different mechanisms of action such as paclitaxel or sorafenib was evaluated. Finally, the inventors have also shown the antitumor activity of Compound A in solid tumors, triple-negative breast cancer and ovarian cancer. As expected from in vitro data in triple-negative breast cancer, it was extremely effective even alone, and a strong in vivo synergistic effect with paclitaxel was also observed.

[0012] In a first aspect, the present invention provides a compound represented by Compound A or a pharmaceutically acceptable salt thereof for use in a method for treating cancer, of the following formula:

[0013]

Chemical formula

[0014] In a second aspect, the compound of the first aspect is provided in a composition together with at least one pharmaceutically acceptable excipient. In a further aspect, the composition is a pharmaceutical composition. In a third aspect, the cancer is a solid tumor. The present disclosure also provides a corresponding method for treating the human or animal body, the method comprising administering a therapeutically effective amount of said compound or a pharmaceutically acceptable salt thereof to a subject having a solid tumor. In a fourth aspect, the cancer is breast cancer, colon cancer, kidney cancer, lung cancer, ovarian cancer, prostate cancer or melanoma. In a fifth aspect, the cancer is preferably breast cancer or ovarian cancer.

[0015] In the sixth aspect, the method includes administering compound A or a pharmaceutically acceptable salt thereof at a dose of 30 mg / kg, more preferably 90 mg / kg, per administration in a 10 ml / kg solution. In the seventh aspect, the method comprises administering compound A or a pharmaceutically acceptable salt thereof once daily. In the eighth aspect, the method comprises administering compound A or a pharmaceutically acceptable salt thereof for at least 20 or 28 consecutive days, and optionally the administration for at least 28 consecutive days. In the ninth aspect, the method involves orally administering compound A or a pharmaceutically acceptable salt thereof, preferably, compound A is administered exclusively orally. In the tenth embodiment, any of the methods described above further includes administering paclitaxel or a pharmaceutically acceptable salt thereof. In the eleventh embodiment, any of the methods described above further includes administering sorafenib or a pharmaceutically acceptable salt thereof. In the twelfth embodiment, the method of the tenth or eleventh embodiment includes administering paclitaxel or a pharmaceutically acceptable salt thereof and / or sorafenib or a pharmaceutically acceptable salt thereof once weekly. In the 13th embodiment, any one of the 10th to 12th embodiments includes administering paclitaxel or a pharmaceutically acceptable salt thereof at a dose of 15 mg / kg per administration. In the 14th embodiment, any one of the 10th to 13th embodiments includes administering sorafenib or a pharmaceutically acceptable salt thereof at a dose of 15 mg / kg per single dose. In the 15th embodiment, any one of the methods of the 10th to 14th embodiments includes, preferably, administering subcutaneously, paclitaxel or a pharmaceutically acceptable salt thereof and / or sorafenib or a pharmaceutically acceptable salt thereof. [Brief explanation of the drawing]

[0016] [Figure 1] This figure shows the NCI-60 human tumor cell line. [Figure 2] This figure shows the method of Example 1. [Figure 3] This figure shows the cell viability of breast cancer cell lines 48 hours after treatment with DMSO, SB224289 (5 μM), SB216641 (5 μM), and compound A (1 / 2.5 / 5 / 10 / 20 μM), as measured by flow cytometry 7-AAD elimination. Data are expressed as mean ± sem. [Figure 4] This figure shows the cell viability measured by flow cytometry 7-AAD elimination in colon cancer cell lines 48 hours after treatment with DMSO, SB224289 (5 μM), SB216641 (5 μM), and compound A (1 / 2.5 / 5 / 10 / 20 μM). Data are expressed as mean ± sem. [Figure 5] This figure shows the cell viability measured by flow cytometry 7-AAD elimination in renal cancer cell lines 48 hours after treatment with DMSO, SB224289 (5 μM), SB216641 (5 μM), and compound A (1 / 2.5 / 5 / 10 / 20 μM). Data are expressed as mean ± sem. [Figure 6] This figure shows the cell viability measured by flow cytometry 7-AAD elimination in lung cancer cell lines 48 hours after treatment with DMSO, SB224289 (5 μM), SB216641 (5 μM), and compound A (1 / 2.5 / 5 / 10 / 20 μM). Data are expressed as mean ± sem. [Figure 7] This figure shows the cell viability measured by flow cytometry 7-AAD elimination in melanoma cancer cell lines 48 hours after treatment with DMSO, SB224289 (5 μM), SB216641 (5 μM), and compound A (1 / 2.5 / 5 / 10 / 20 μM). Data are expressed as mean ± sem. [Figure 8]This figure shows the cell viability measured by flow cytometry 7-AAD elimination in ovarian cancer cell lines 48 hours after treatment with DMSO, SB224289 (5 μM), SB216641 (5 μM), and compound A (1 / 2.5 / 5 / 10 / 20 μM). Data are expressed as mean ± sem. [Figure 9] This figure shows the cell viability measured by flow cytometry 7-AAD elimination in prostate cancer cell lines 48 hours after treatment with DMSO, SB224289 (5 μM), SB216641 (5 μM), and compound A (1 / 2.5 / 5 / 10 / 20 μM). Data are expressed as mean ± sem. [Figure 10] This figure shows the cell viability of spheroids derived from the MCF-7 breast cancer cell line 72 hours after treatment with DMSO, SB224289 (1, 2.5, and 5 μM), SB216641 (1, 2.5, and 5 μM), compound A (1, 2.5, and 5 μM), and SWAY1001 (5 and 10 μM). Data are expressed as mean ± sem. [Figure 11] This figure shows the cell viability of spheroids derived from colon cancer cell lines 72 hours after treatment with DMSO, SB224289 (1, 2.5, and 5 μM), SB216641 (1, 2.5, and 5 μM), compound A (1, 2.5, and 5 μM), and SWAY1001 (5 and 10 μM). Data are expressed as mean ± sem. [Figure 12] This figure shows the cell viability of spheroids derived from the A549 lung cancer cell line 72 hours after treatment with DMSO, SB224289 (1, 2.5, and 5 μM), SB216641 (1, 2.5, and 5 μM), compound A (1, 2.5, and 5 μM), and SWAY1001 (5 and 10 μM). Data are expressed as mean ± sem. [Figure 13] This figure shows the cell viability of spheroids derived from melanoma cancer cell lines 72 hours after treatment with DMSO, SB224289 (1, 2.5, and 5 μM), SB216641 (1, 2.5, and 5 μM), compound A (1, 2.5, and 5 μM), and SWAY1001 (5 and 10 μM). Data are expressed as mean ± sem. [Figure 14] This figure shows the cell viability of spheroids derived from ovarian cancer cell lines 72 hours after treatment with DMSO, SB224289 (1, 2.5, and 5 μM), SB216641 (1, 2.5, and 5 μM), compound A (1, 2.5, and 5 μM), and SWAY1001 (5 and 10 μM). Data are expressed as mean ± sem. [Figure 15] This figure shows the cell viability of spheroids derived from prostate cancer cells 72 hours after treatment with DMSO, SB224289 (1, 2.5, and 5 μM), SB216641 (1, 2.5, and 5 μM), compound A (1, 2.5, and 5 μM), and SWAY1001 (5 and 10 μM). Data are expressed as mean ± sem. [Figure 16] This figure shows gene expression in 2D cultures and spheroids derived from the MCF-7 breast cancer cell line. Data are expressed as mean ± sem. [Figure 17] This figure shows gene expression in 2D cultures and spheroids derived from the MCF-7 breast cancer cell line 72 hours after treatment with DMSO or compound A (5 μM). Data are expressed as mean ± sem. [Figure 18] This figure shows the gene expression of 2D cultures and spheroids derived from the MDA-MB-231 breast cancer cell line 72 hours after treatment with DMSO or compound A (5 μM). Data are expressed as mean ± sem. [Figure 19] This figure shows the gene expression of 2D cultures and spheroids derived from the T47D breast cancer cell line 72 hours after treatment with DMSO or compound A (5 μM). Data are expressed as mean ± sem. [Figure 20] This figure shows the test design for Example 4. [Figure 21] This figure shows a xenograft study testing the efficacy of compound A in delaying subcutaneous SK-OV-3 tumor growth. The test substance was administered according to the schedule shown in Table 1 (note that the dose of compound A was 45 mg / kg from day 16 until the final decision). A) Relative tumor volume (%) relative to animal body weight. B) Body weight (g). [Figure 22]This figure shows the synergistic matrix and volume-based scoring of the EOBA method. [Figure 23] This figure shows the cell viability of BT-549, Hs578T, and MDA-MB-231 cell lines 48 hours after treatment with vehicle control or L compound A (indicated concentration range 2-15 μM) and / or sorafenib (indicated concentration range 2 / 10 μM), measured by flow cytometry for 7-AAD exclusion and Hoechst33342 dim staining. Synergistic analysis was performed. Brisk synergistic scores are shown. [Figure 24] This figure shows the cell viability of BT-549, Hs578T, and MDA-MB-231 cell lines 48 hours after treatment with a vehicle control or compound A (indicated concentration range 2–15 μM) and / or paclitaxel (indicated concentration range 0.01 / 0.05 μM), measured by flow cytometry for 7-AAD exclusion and Hoechst33342 dim staining. Synergistic analysis was performed. Brisk synergistic scores are shown. [Figure 25] This figure shows the cell viability of SK-OV-3 cell lines 48 hours after treatment with a vehicle control or compound A (indicated concentration range 2–15 μM) and / or paclitaxel (indicated concentration range 0.01 / 0.05 μM) or sorafenib (indicated concentration range 5–9 μM), measured by 7-AAD exclusion and flow cytometry with Hoechst33342 dim staining. Synergistic analysis was performed. Brisk synergistic scores are shown. [Figure 26] This figure shows the most synergistic scores from Figures 23-25. The Max Bliss synergistic score corresponds to the maximum percentage of effect that is not individually explained by the combined effects of both drugs (and therefore not explained on the basis of additiveity). The dotted line corresponds to the additive score. [Figure 27] This figure shows the test design for Example 6. [Figure 28] This figure shows a xenograft study testing the efficacy of a compound intended to delay subcutaneous MDA-MB-231 tumor growth. Compound A was administered according to the schedule described in Example 6. [Figure 29] This figure shows the weight changes corresponding to the test in Example 6, Figure 28. [Modes for carrying out the invention]

[0017] A brief explanation of arrays Sequence ID 1: Human CD24 Forward Sequence ID 2: Human CD24 Reverse Sequence ID 3: Human CD44 Forward Sequence ID 4: Human CD44 Reverse Sequence ID 5: Human OCT4 Forward Sequence ID 6: Human OCT4 Reverse Sequence ID 7: Human NANOG forward Sequence ID 8: Human NANOG Reverse Sequence ID 9: Human SOX2 Forward Sequence ID 10: Human SOX Reverse Sequence ID 11: Human HTR1B Forward Sequence ID 12: Human HTR1B Reverse Definitions and Abbreviations All terms used herein shall be understood in their ordinary sense as known in the art unless otherwise specified. Other, more specific definitions of any particular terms used in this application are set forth below and are intended to be applied uniformly throughout this specification and the claims unless a specific definition provides a broader definition. Throughout this specification and the claims, the term "including" and its variations are not intended to exclude other technical features, additives, ingredients, or steps. Furthermore, the term "including" encompasses the case of "consisting of." Further objects, advantages, and features of the present invention may become apparent to those skilled in the art by examining the description or may be acquired through the practice of the invention. Furthermore, the present invention encompasses all possible combinations of the specific aspects and embodiments described herein. In this specification and the appended claims, the singular forms "a," "an," and "the" (in the original text) refer to plural subjects unless the context clearly indicates otherwise. The term “about” used in relation to numerical values ​​throughout this specification and the claims indicates an acceptable precision interval that is well known to those skilled in the art. Generally, such precision interval is ±15%. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to whom this disclosure relates. See, for example, Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; Hinterst Press; Hinterst Press; Hinterst Press; Hinterst Press. See, for example, The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary of Biochemistry and Molecular Biology, Revised, 2000, Oxford University Press, which provide many common dictionaries of the terms used herein. Units, prefixes, and symbols are given in the form recognized by the International System of Units (SI). A numerical range includes the number that defines the range. The headings provided herein do not limit the various aspects or embodiments of this disclosure. The following abbreviations will be used throughout this specification. TIFF2026521568000004.tif198170 Serotonin receptor antagonist As used herein, the term "serotonin receptor" is also known as HTR, 5-hydroxytryptamine receptor, 5-HT receptor, or 5-HTR, and refers to a group of G protein-coupled receptors (GPCRs) and ligand-gated ion channels (LGICs), most of which are found in the central and peripheral nervous systems. A "serotonin receptor (HTR) antagonist" is a compound that binds to the 5-HT receptor but has virtually no function of activating the receptor itself. Antagonists can prevent or reduce the functional activation or occupancy of the receptor by the agonist, or, if an agonist is present, by the natural ligand. As used herein, the term "5-HT receptor antagonist" is intended to encompass both "neutral antagonists" and "inverse agonists." A "neutral antagonist" is a compound that blocks the action of an agonist but has no effect on endogenous or spontaneous receptor activity. An "inverse agonist" can either block the agonist's action at the receptor or reduce the constitutive activity of the receptor. The term "antagonist" also includes competitive antagonists, which are drugs that bind to the same site as the native ligand; non-competitive antagonists, which bind to a different site on the receptor than the native ligand; reversible antagonists, which bind to and unbind from the receptor at a rate determined by receptor-ligand dynamics; and irreversible antagonists, which bind permanently to the receptor by forming a covalent bond to the active site or by binding tightly to a dissociation rate of virtually zero.

[0018] As used herein, the terms "HTR1," "type 1 HTR," "type 1 5-HT receptor," "type 1 5-HTR," "5-HT1 receptor," or "5-HTR1" refer to a subfamily of 5-HT receptors that bind to the endogenous neurotransmitter serotonin (5-hydroxytryptamine, 5-HT). The 5-HT1 receptor subfamily consists of five Gi / Go-bound G protein-coupled receptors (GPCRs), including HTR1A, HTR1B, HTR1D, HTR1E, and HTR1F. These receptors mediate inhibitory neurotransmission by reducing cellular levels of cAMP. The UniProt deposit number for the complete protein sequence of the human type 1A 5-HT receptor is P08908 (November 30, 2016). The UniProt deposit number for the complete protein sequence of the human type 1B 5-HT receptor is P28222 (November 30, 2016). The UniProt deposit number for the complete protein sequence of the human type 1D 5-HT receptor is P28221 (November 2, 2016). The UniProt deposit number for the complete protein sequence of the human type 1E 5-HT receptor is P28566 (November 2, 2016). The UniProt deposit number for the complete protein sequence of the human type 1F 5-HT receptor is P30939 (November 2, 2016). Those skilled in the art know of methods for determining the affinity of a particular molecule to type 1 HTR, and for determining whether the particular molecule is an antagonist of the receptor. Particularly suitable assays are radioligand binding assays for determining binding affinity and functional studies of second messenger recruitment. For example, the HTR affinity of a molecule is determined by Millan et al. (Millan et al. J Pharmacol Exp Ther. 2002;303(2):791-804) (radioligand binding assay). Assays for evaluating whether a compound is a type 1 HTR antagonist include determining the Gi activation state and measuring cAMP production and adenylyl cyclase activation (Nichols DE and Nichols CE Chem Rev, 2008;108(5):1614-41). Type 1 HTR activity can be measured by a decrease in cAMP levels (Williams C. Nat Rev Drug Discovery, 2004;3(2):125-35) and an increase in phospho-Akt levels (Suni MA. and Maino VC. Methods Mol Biol 2011;717:155-69).

[0019] The compound of the present invention The present invention is essentially based on the following formula:

[0020] [ka] (Compound A) The present invention provides a compound represented by the following: This compound is an HTR1B antagonist. In this disclosure, the compound of the above formula may be referred to as "compound" or "compound A".

[0021] Polymorphic crystal forms, solvates, hydrates The individual crystalline forms of the compound of the present invention (compound A) may exist as polymorphs, and these are intended to be included in the present invention. Furthermore, the compounds of the present invention may form solvates with water (i.e., hydrates) or common organic solvents, and such solvates are also intended to be included within the scope of the present invention. The compounds of the present invention may also be obtained in the form of their salts, hydrates, or other solvents used for crystallization. Given the close relationship between the free compounds of the present invention and the compounds in the form of their salts, hydrates, or solvates, whenever a compound is referred to in this context, the corresponding salts, solvates, or polymorphs are also intended, provided that such are possible or appropriate in those circumstances.

[0022] Tautomers As used herein, the term "tautomerism" refers to the transfer of protons between adjacent single and double bonds. The tautomerization process is reversible. The compounds described herein may undergo any possible tautomerization within the range of the compound's physical properties.

[0023] Pharmaceutically acceptable salts As used herein, the term "pharmaceutically acceptable" encompasses both human and veterinary use. For example, the term "pharmaceutically acceptable" includes compounds that are veterinary-acceptable or compounds that are acceptable in human medicine and healthcare. The compounds of the present invention and their physiologically functional derivatives, as salts, hydrates, and solvates, suitable for pharmaceutical use, have pharmaceutically acceptable counterions or associated solvents. However, salts, hydrates, and solvates with pharmaceutically unacceptable counterions or associated solvents are within the scope of the present invention, for example, for use as intermediates in the preparation of other compounds and their pharmaceutically acceptable salts, hydrates, and solvates. Suitable salts according to the present invention include those formed using either organic or inorganic acids or bases.

[0024] Pharmaceutically acceptable acid addition salts include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, citric acid, tartaric acid, phosphoric acid, lactic acid, pyruvic acid, acetic acid, trifluoroacetic acid, triphenylacetic acid, sulfamic acid, sulfanilic acid, succinic acid, oxalic acid, fumaric acid, maleic acid, malic acid, mandelic acid, glutamic acid, aspartic acid, oxaloacetic acid, methanesulfonic acid, ethanesulfonic acid, arylsulfonic acid (e.g., p-toluenesulfonic acid, benzenesulfonic acid, naphthalenesulfonic acid or naphthalenedisulfonic acid), salicylic acid, glutaric acid, gluconic acid, tricarbaryl acid, cinnamic acid, substituted cinnamic acid (e.g., including 4-methyl and 4-methoxycinnamic acid), Examples include those formed from phenyl, methyl, methoxy, or halo-substituted cinnamic acid, ascorbic acid, oleic acid, naphthoic acid, hydroxynaphthoic acid (e.g., 1- or 3-hydroxy-2-naphthoic acid), naphthaleneacrylic acid (e.g., naphthalene-acrylic acid), benzoic acid, 4-methoxybenzoic acid, 2- or 4-hydroxybenzoic acid, 4-chlorobenzoic acid, 4-phenylbenzoic acid, benzeneacrylic acid (e.g., 1,4-benzenediacrylic acid), isethionic acid, perchloric acid, propionic acid, glycolic acid, hydroxyethanesulfonic acid, pamoic acid, cyclohexanesulfamic acid, salicylic acid, saccharic acid, and trifluoroacetic acid. Pharmaceutically acceptable base salts include alkali metal salts such as ammonium salts, sodium and potassium salts, alkaline earth metal salts such as calcium and magnesium salts, and salts with organic bases such as dicyclohexylamine and N-methyl-D-glucamine. All pharmaceutically acceptable acid addition salt forms of the compounds of the present invention are intended to be included within the scope of the present invention.

[0025] Preparation of compounds The preparation of the class of compounds to which the compounds of the present invention belong is described in detail in prior publications. For example, the synthetic route is outlined in Bennett-Palomino Laria et al. (International Publication No. 2022 / 074109). The well-known synthesis pathway from the starting materials involves the following coupling reaction.

[0026] [ka] Pharmaceutical composition The pharmaceutical composition according to the present invention comprises the above-mentioned compound (compound A) and pharmaceutically acceptable excipients (as further described below). The pharmaceutical composition according to the present invention may include pharmaceutically acceptable salts, tautomers, polymorphic crystalline forms, solvates, or hydrates of the compound of the present invention (compound A). As used herein, the term “pharmaceutical composition” is intended to encompass products containing the claimed compound in a therapeutically effective amount. More specifically, as used herein, “pharmaceutical composition” means a preparation that is capable of enabling the biological activity of the active ingredient (i.e., the claimed HTR1B antagonist, and optionally, further active compounds such as paclitaxel and / or sorafenib) and is physiologically acceptable, i.e., free from further ingredients that are unacceptably toxic to the subject to which the composition is administered. The composition may be sterile. In particular, the term “pharmaceutically acceptable” means that, when used in animals, more specifically in humans, it is approved by a state or federal regulatory authority or is included in the United States Pharmacopeia or other generally recognized pharmacopoeias. Appropriate amounts of the compounds of the present invention as defined above can be formulated with pharmaceutically acceptable excipients and / or carriers to obtain pharmaceutical compositions for use in medicine, in particular for the prevention and / or treatment of cancer, more specifically for the prevention and / or treatment of solid tumors. A pharmaceutical composition containing the compound of the present invention as defined above may exist in any pharmaceutical administration form (e.g., in the form of a lyophilized powder, slurry, aqueous solution, lotion, or suspension) that is considered suitable for selected routes of administration, including but not limited to systemic (e.g., intravenous, subcutaneous, intramuscular injection), intradermal, intraperitoneal, intranasal, epidural, topical, and oral routes, and therefore contains pharmaceutically acceptable excipients necessary for the formulation of the desired method of administration. The routes of administration are further described below.

[0027] Pharmacologically acceptable excipients The term "excipient" refers to a vehicle, diluent, or adjuvant administered together with the active ingredient. Such pharmaceutical excipients may be sterile liquids such as water and oil, and may be of petroleum, animal, plant, or synthetic origin, such as peanut oil, soybean oil, mineral oil, or sesame oil. Water or saline solution and aqueous dextrose and glycerol solutions for injection are particularly used as vehicles. Suitable pharmaceutical vehicles are listed in "Remington's Pharmaceutical Sciences" by EW Martin, 21st Edition, 2005; or "Handbook of Pharmaceutical Excipients," Rowe CR; Paul JS; Maian EQ, 6th Edition. Suitable pharmaceutically acceptable vehicles include, for example, water, saline solutions, alcohol, vegetable oil, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, surfactants, silicic acid, viscous paraffin, fragrance oils, monoglycerides and diglycerides of fatty acids, petroetals (fatty acid esters), hydroxymethylcellulose, and polyvinylpyrrolidone.

[0028] Medical use In one embodiment, the present invention relates to a method for treating cancer, and the following formula is used:

[0029] [ka] (Compound A) The present invention provides a compound represented as compound A, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition. Alternatively, the present invention relates to the use of the compounds of the present invention, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions for the preparation of pharmaceuticals for the prevention and / or treatment of cancer. Alternatively, the present invention relates to a method for the prevention and / or treatment of cancer, comprising administering the compounds of the present invention, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions thereof, to a subject for which it is necessary.

[0030] In other embodiments, the present invention relates to the following formula for use in a method for treating solid tumors:

[0031] [ka] (Compound A) The present invention provides a compound represented as compound A, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition. Alternatively, the present invention relates to the use of the compounds of the present invention or pharmaceutically acceptable salts thereof or pharmaceutical compositions for the preparation of pharmaceuticals for the prevention and / or treatment of solid tumors. Alternatively, the present invention relates to a method for the prevention and / or treatment of solid tumors, comprising administering the compounds of the present invention or pharmaceutically acceptable salts thereof or pharmaceutical compositions to a subject for which it is necessary. As used herein, the terms “to treat,” “to cure,” or “to treat” preferably mean reducing the likelihood of a particular disease or disorder, reducing the occurrence of a particular disease or disorder, and / or reducing the severity of a particular disease or disorder, to the extent that the subject no longer suffers discomfort and / or functional changes resulting therefrom. For example, “to treat” may mean the function of a therapy (i.e., the HTR1B antagonist of the present invention) that, when administered to a subject, prevents the occurrence of a particular disease or disorder, and / or cures or alleviates the symptoms, signs, or causes of a particular disease. "To treat" also means to alleviate or reduce at least one clinical symptom, and / or inhibit or delay the progression of a condition, and / or prevent or delay the onset of a disease or illness. Accordingly, the terms "to treat," "to treat," or "treatment" (or grammatically equivalent terms) refer to prophylactic and therapeutic treatment regimens. In particular, as used herein, "treatment" refers to the administration of the compounds of the present invention or pharmaceutically acceptable salts thereof or pharmaceutical compositions to subjects suffering from solid tumors, including administration in the early or initial stages of the disease, the purpose of which is to prevent or slow (mitigate) undesirable physiological changes or impairments. This disclosure generally provides methods and compositions that provide therapeutic benefits or desired clinical outcomes. Therapeutic benefits are not necessarily the cure of a particular disease or disorder, but rather, most typically, include outcomes such as reduction or increased survival of a disease or disorder, elimination of a disease or disorder, reduction or alleviation of symptoms associated with a disease or disorder, prevention or alleviation of secondary diseases, disorders or conditions arising from the onset of a primary disease or disorder, reduction in the severity of the disease, stabilization (i.e., non-exacerbating) of the disease, delay or slowing of disease progression, improvement or mitigation of a disease condition, and remission (partial or total), which may be either detectable or undetectable and / or preventive of the disease or disorder. Treatment also means extended survival compared to survival expected without treatment.

[0032] As used herein, the terms “prevention,” “prevention,” or “prevention” relate to the administration of the compounds of the present invention, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions to subjects who have not been diagnosed with cancer or particularly solid tumors at the time of administration, but who are normally expected to develop the disease or be at increased risk of developing the disease. Prevention is intended to avoid the appearance of the disease. Prevention may be complete (e.g., the disease is not present at all). Prevention may also be partial, for example, such that the incidence of the disease in the subject is reduced compared to what would have occurred if the combination or composition of the present invention had not been administered. Prevention also means reduced susceptibility to clinical symptoms.

[0033] The terms “subject,” “individual,” “animal,” or “patient” include any subject, particularly mammalian subjects, for which diagnosis, prognosis, or treatment is desired. Mammalian subjects include humans, livestock, farm animals, and zoo animals or pets, such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, and cows. In some embodiments of the present invention, the subject is a mammal. In some embodiments of the present invention, the subject is a human, particularly a human of any race and sex. In one embodiment, the subject is untreated. An untreated subject is one that has not received therapy, such as an antineoplastic agent. In another embodiment, the subject has received therapy and / or one or more doses of the therapeutic agent.

[0034] Combined use The compounds of the present invention, or their pharmaceutically acceptable salts or pharmaceutical compositions, may be used in combination with other therapeutic agents. Further therapeutic agents are, but are not particularly limited, therapeutic agents for the specific cancer being treated, and preferably chemotherapeutic agents for the treatment of solid tumors. Particularly preferred is combination therapy with paclitaxel and / or sorafenib. Paclitaxel (CAS number: 33069-62-4) is a type of chemotherapy drug called a taxane. It blocks cell proliferation by stopping mitosis (cell division). Taxanes inhibit microtubules (cellular structures that assist in chromosome movement during mitosis).

[0035] [ka] Sorafenib (CAS number: 284461-73-0) is a kinase inhibitor approved for the treatment of primary renal cell carcinoma (advanced renal cell carcinoma), advanced primary liver cancer (hepatocellular carcinoma), FLT3-ITD-positive AML, and radioactive iodine-resistant advanced thyroid cancer.

[0036] [ka] Paclitaxel and sorafenib are both well-known FDA-approved chemotherapeutic agents for the treatment of cancer, particularly solid tumors. They can be used in combination with the compounds of the present invention or their pharmaceutically acceptable salts or pharmaceutical compositions at doses, schedules, and administration regimens known to those skilled in the art. The combination of paclitaxel and / or sorafenib with the compounds of the present invention or their pharmaceutically acceptable salts or pharmaceutical compositions is particularly preferred for the treatment of breast cancer, ovarian cancer, kidney cancer, liver cancer and non-small cell lung cancer.

[0037] solid tumors In one embodiment of the present invention, the compound of the present invention is used in a method for treating solid tumors. A solid tumor is an abnormal mass of tissue that does not usually contain a cyst or fluid-filled area. Solid tumors can be benign or malignant. They are named after the type of cells that form them. Examples of solid tumors include sarcomas, carcinomas, and lymphomas. Leukemia (a type of blood cancer) generally does not form solid tumors. Examples of solid tumors include carcinomas, sarcomas, germ cell tumors, and blastomas. Carcinomas are cancers that originate from epithelial cells, and because epithelial tissue is the most abundant tissue in the body, they account for 80% to 90% of all cancer cases. This group includes many of the most common cancers, particularly in the elderly, and includes lung cancer, colorectal cancer, pancreatic cancer, laryngeal cancer, tongue cancer, prostate cancer, breast cancer, ovarian cancer, liver cancer, head and neck cancer, esophageal cancer, kidney cancer, endometrial cancer, gallbladder cancer, bladder cancer, and stomach cancer. There are two types of carcinoma: adenocarcinoma and squamous cell carcinoma. Adenocarcinomas originate in organs or glands, while squamous cell carcinomas originate in squamous epithelium. Adenocarcinomas can affect mucous membranes and initially appear as thickened, plaque-like white mucosa. These are rapidly spreading cancers.

[0038] Sarcomas are cancers that arise from connective tissue, including muscle, bone, cartilage, and fat. Examples of sarcomas include osteosarcoma (bone), chondrosarcoma (cartilage), leiomyosarcoma (smooth muscle), rhabdomyosarcoma (skeletal muscle), mesosarcoma or mesothelioma (membrane lining of body cavities), fibrosarcoma (fibrous tissue), angiosarcoma or hemangioendothelioma (blood vessels), liposarcoma (fat or adipose tissue), glioma or astrocytoma (neurogenic connective tissue of the brain), myxosarcoma (primitive embryonic connective tissue), and mesenchymal or mixed mesodermal tumors (mixed connective tissue type). Germ cell tumors are germ cell tumors of pluripotent origin (seminomas and undifferentiated germ cell tumors, respectively) that most frequently occur in the testes or ovaries. Blastoma is a type of cancer that originates from immature progenitor cells or embryonic tissue. Blastoma is more common in children than in the elderly. Examples of blastomas include hepatoblastoma, medulloblastoma, nephroblastoma, pancreaticblastoma, premembranous pulmonary blastoma, retinoblastoma, and glioblastoma multiforme.

[0039] Cancers of particular interest for the medical use of this invention are solid tumors: breast cancer, colon cancer, kidney cancer, lung cancer, ovarian cancer, prostate cancer, or melanoma. Breast cancer or ovarian cancer are most preferred.

[0040] Administration The compounds of the present invention, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions may be administered as liquid solutions, suspensions, emulsions, gels, polymers, or sustained-release formulations. The compounds of the present invention, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions may be formulated together with conventional binders and carriers, as is known in the art. The formulations may include standard carriers, such as pharmaceutical-grade mannitol, lactose, starch, magnesium stearate, sodium sugar, cellulose, magnesium carbonate, and other inert carriers with well-established functionality in pharmaceutical manufacturing. Various delivery systems are known, including encapsulation in liposomes, microparticles, microcapsules, etc., and can be used to administer the compound of the present invention or a pharmaceutically acceptable salt thereof or pharmaceutical composition. In the context of the present invention, oral administration of the compound of the present invention or a pharmaceutically acceptable salt thereof or a pharmaceutical composition is particularly preferred.

[0041] Solid dosage forms for oral administration include conventional capsules, sustained-release capsules, conventional tablets, sustained-release tablets, chewable tablets, sublingual tablets, effervescent tablets, pills, suspensions, powders, granules, and gels. In these solid dosage forms, the active compound may be mixed with at least one inactive excipient, such as sucrose, lactose, or starch. These dosage forms may also include further substances other than the usual inactive diluents, such as lubricants like magnesium stearate. In the case of capsules, tablets, effervescent tablets, and pills, the dosage form may contain a buffer. Tablets and pills may be prepared using enteric coating. Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs containing inactive diluents such as water, which are commonly used in the industry. These compositions may also contain wetting agents, emulsifiers, and suspensions, as well as adjuvants such as sweeteners, flavoring agents, and fragrances. In some embodiments, a further therapeutic agent (preferably paclitaxel and / or sorafenib) used in combination with the compound of the present invention or a pharmaceutically acceptable salt thereof or pharmaceutical composition is administered intravenously or subcutaneously.

[0042] Dosage and schedule The appropriate dose of the active ingredient in the combination therapy or pharmaceutical composition will depend on the type of cancer being treated, the severity and course of the disease, whether the composition is administered for preventive or therapeutic purposes, previous treatments, the patient's medical history and response to the compound, and the discretion of the attending physician. The amount of the compound of the present invention, or a pharmaceutically acceptable salt thereof, or pharmaceutical composition is administered to the patient in an appropriate amount, either in a single dose or over a series of treatments. Depending on the type and severity of the disease, an appropriate dose level is generally about 0.01 to 500 mg per kg of the patient's body weight per day, which can be administered in one or more doses. A particularly preferred dose of the compound of the present invention or its pharmaceutically acceptable salt is 30 mg / kg per single dose, and more preferably 90 mg / kg. In one embodiment, the compound of the present invention, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof, is administered daily in an appropriate dose. In a further embodiment, the administration is continued for at least 20 days, more preferably 28 days. In a further embodiment, sorafenib or paclitaxel is administered at a dose of 15 mg / kg. In the case of concurrent administration of sorafenib and / or paclitaxel, the preferred dose of the compound or a pharmaceutically acceptable salt thereof is 30 mg / kg. In a further aspect of the present invention, sorafenib and / or paclitaxel are administered weekly.

[0043] Examples The present invention will be further illustrated by the following examples. These examples are provided for illustrative purposes only and are not intended to limit the scope of the present invention. [Examples]

[0044] Efficacy of compound A treatment in NCI-60 human tumor cell lines Test objectives The purpose of this study is to preclinically evaluate the in vitro efficacy of compound A, the test compound, in NCI-60 human tumor cell lines (Figure 1). The NCI-60 cancer cell line panel is a group of 60 human cancer cell lines used by the National Cancer Institute (NCI) for screening compounds to detect potential anti-cancer activity. Test design Thirty-seven different NCI-60 human tumor cell lines were treated with compound A for 48 hours, and cell viability was analyzed compared to control cells treated with DMSO, SB224289 (short SB9), SB216641 (short SB41), and untreated cells. SB9 and SB41 were used at 5 μM for all cell types. Compound A was used at 1, 2.5, 5, 10, and 20 μM. Table 1

[0045] [Table 1] Materials and methods Total 4 x 10 4 Cells / ml were cultured for 24 hours in complete medium (RPMI 1640 + 10% HI-FBS) in a 96-well plate, and all drugs were added at the indicated concentrations. After 48 hours, cell viability was measured by 7-aminoactinomycin D (7-AAD) (eBioscience, San Diego, CA, USA) exclusion and flow cytometry with Hoechst33342 (Sigma-Aldrich) positive staining, and cell counts were obtained by volume using a FACSCanto II cytometer (Becton Dickinson, Franklin Lakes, NJ, USA) (Figure 2).

[0046] conclusion Compound A reduced the viability of analyzed cell lines derived from the NCI-60 cancer cell line panel. Lower viability correlated with higher concentrations of compound A. The results are shown in Figures 3-9. Table 2: Summary of IC50 values ​​for compounds A, SB9, and SB41

[0047] [Table 2] [Examples]

[0048] Efficacy of treatment with compound A in spheroids derived from the NCI-60 human tumor cell line. Test objectives : The purpose of this study is to preclinically evaluate the in vitro efficacy of compound A, the test compound, in 3D cultured NCI-60 human tumor cell lines. Three-dimensional (3D) systems mimic key tissue factors in a far more representative way than two-dimensional (2D) monolayers, and are advantageous for maintaining stem cell properties. Test design According to the published protocol of Friedrich et al. Nat Protocol 2009, ten different NCI-60 human tumor cell lines were cultured in three dimensions as spheroids, treated with compound A for 72 hours, and their cell viability was analyzed compared to cells treated with DMSO, SB224289, SB216641, SWAY1001, and vehicle. For all cell types, SB9, SB41, and compound A were used at concentrations of 1, 2.5, and 5 μM. SWAY1001 was used at concentrations of 5 and 10 μM. Table 2: Test design for Example 2

[0049] [Table 3] Materials and methods For each cell line, 5000 cells were transferred per well into agarose-coated microtiter plates. After 96 hours of incubation, spheroids were treated and incubated for a further 72 hours. Cell viability was then assessed by acid phosphatase assay (APH). 100 μL of 3D culture was mixed with 100 μL of APH assay buffer (0.1 M sodium acetate; 0.1% Triton X-100; 2 mg / mL PNPP) and incubated at 37°C for 90 minutes. After incubation, 10 μL of 1N NaOH was added to each well, and absorbance at 405 nm was measured using a microplate reader.

[0050] conclusion Compound A reduced tumor spheroid volume in a dose-response manner, but its antineoplastic effect was significantly higher than that of SB224289 or SB214461 (Figures 10-15). [Examples]

[0051] Gene expression profiles of spheroids derived from breast NCI-60 human tumor cell line after treatment with compound A. Test objectives The purpose of this study is to preclinically evaluate the in vitro efficacy of compound A, the test compound, in 3D cultured NCI-60 human tumor cell lines. Three-dimensional (3D) systems mimic key tissue factors in a far more representative way than two-dimensional (2D) monolayers, and are advantageous for maintaining stem cell properties. Test design Three distinct representative breast cancer cell lines from the NCI-60 human tumor panel were cultured in three dimensions as spheroids and treated with compound A or DMSO for 72 hours, after which gene expression was analyzed. Table 3: Cells used in Example 3

[0052] [Table 4] Materials and methods For each cell line, 5000 cells were transferred per well in an agarose-coated microtiter plate. After 96 hours of incubation, spheroids were treated and incubated for a further 72 hours. RNA was isolated using the Total RNA Purification Kit (Norgen Biotek, Thorold, ON, Canada) according to the manufacturer's instructions, and reverse transcriptase-PCR was performed using the qScript cDNA Synthesis Kit (Quanta Biosciences, Beverly, MA, USA). Quantitative PCR was performed using the Step One Plus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) with Power SYBR Green PCR mastermix (Applied Biosystems) and specific primers for the following genes, according to the manufacturer's instructions. Human CD24 Fw:CTCCTACCCACGCAGATTTATTC Human CD24 Rv:AGAGTGAGACCACGAAGAGAC Human CD44 Fw:CTGCCGCTTTGCAGGTGTA Human CD44 Rv:CATTGTGGGCAAGGTGCTATT Human OCT4 Fw:GTGGAGGAAGCTGACAACAA Human OCT4 Rv:ATTCTCCAGGTTGCCTCTCA Human NANOG Fw:CCCCAGCCTTTACTCTTCCTA Human NANOG Rv: CCAGGTTGAATTGTTCCAGGTC Human SOX2 Fw:GAGCTTTGCAGGAAGTTTGC Human SOX2 Rv:GCAAGAAGCCTCTCCTTGAA Human HTR1B Fw:GGGTTCCTCAAGCCAACTTATC Human HTR1B Rv:GCCAATAGCATAACCAGCAGT conclusion Expression of stem cell genes in spheroids is higher than in monolayer cultures derived from induced breast cancer cell lines. Expression of the HTR1B gene in spheroids is also higher than in monolayer cultures derived from induced breast cancer cell lines. Expression of stem cell genes and HTR1B in spheroids decreases after treatment with compound A (Figures 16-19). [Examples]

[0053] Efficacy of compound A in an ovarian cancer xenograft model Test objectives: The purpose of this study is to preclinically evaluate the in vivo efficacy of compound A, the test compound, in an ovarian cancer xenograft model. Test design SK-OV-3 cells (human ovarian cancer) were introduced into 30 athymoid-Foxn 1 nu mice (female) at approximately 120 mm 3 After the detection of the tumor, the patient was administered daily with either the vehicle or compound A (oral gastric tube feeding) for 20 consecutive days (Figure 20). The number of test substances administered and the number of samples for each test group are shown in the experimental design table below.

[0054] [Table 5] *Study deviation: From day 16 to day 20, the dose was 45 mg / kg at 10 ml / kg due to weight loss. Materials and methods Species: House mouse Strain:Hsd:Athymic-Foxn 1 nu Age: 6-7 weeks old (estimated age at the time of vaccination) Sex: Female Total number: 30 mice (20 mice plus 10 additional mice to account for tumor engraftment rate) Test compound: The test compound, compound A, was received as a dry powder. Final formulation: 5% NMP, 5% sorbitol, 10% PEG, 80% NaCl, 0.9%. Each mouse was given 0.1 ml of SK-OV-3 (1 × 10⁻¹⁴⁻¹ 7 Tumors were induced by subcutaneous injection of ) into the flank region. The tumor volume was approximately 120 mm². 3 When the tumor reached 120 mm, treatment was initiated according to the experimental plan in Table 1. 3 Twenty animals were selected for the SK-OV-3 tracking xenotransplantation experiment and randomly assigned to groups 1 and 2. After cell inoculation, the tumors were monitored twice a week. Primary tumor size was determined using caliper measurements.

[0055] conclusion Treatment with compound A reduced tumor growth in the ovarian cancer xenograft mouse model. No weight loss of more than 20% in the animals was observed during the study (Figure 21). [Examples]

[0056] Efficacy of combination therapy with compound A and paclitaxel / sorafenib in ovarian cancer cell lines and breast cancer cell lines Test objectives The purpose of this study is to preclinically evaluate the in vitro efficacy of compound A, the test compound, when used in combination with sorafenib and paclitaxel in BT-549, Hs578T, MDA-MB-231 (breast cancer cell lines), and SK-OV-3 (ovarian cancer cell line). Test design Three different breast cancer cell lines, BT-549, Hs578T, and MDA-MB-231, and the SK-OV-3 ovarian cancer cell line were treated with compound A / sorafenib / paclitaxel for 48 hours, and cell viability was analyzed by flow cytometry compared to vehicle-treated cells. Materials and methods 4 x 10 per 1 ml 4 Individual cancer cells were cultured in complete medium (RPMI 1640 + 10% HI-FBS) and treated with a predetermined concentration of therapy. After 48 hours, cell viability was measured by 7-aminoactinomycin D (7-AAD) (eBioscience, San Diego, CA, USA) elimination and Hoechst 33342 (Sigma-Aldrich) positive staining by flow cytometry. Cell count was determined by volume using a FACSCanto II cytometer (Becton Dickinson, Franklin Lakes, NJ, USA). Synergistic effect studies were conducted at http: / / synergyfinder.org / .

[0057] conclusion The combination of compound A with sorafenib or paclitaxel produced a synergistic effect against breast cancer cells (BT-549, Hs578T, MDA-MB-231) and SK-OV-3 ovarian cancer cells (Figures 22-26). [Examples]

[0058] Efficacy evaluation of compound A in the treatment of subcutaneous MDA-MB-231 xenograft models (NOD / SCID) Test objectives: The objective of this study was to preclinically evaluate the in vivo efficacy of compound A in the treatment of a subcutaneous MDA-MB-231 cancer xenograft model in NOD / SCID mice. Compound A was tested alone and in combination with paclitaxel using various dosing regimens and associated compound A concentrations. Laboratory animals and IACUC review The IACUC study protocol was approved on September 17, 2021 (IACUC Protocol 410075). Sixty NOD / SCID mice (15-18 weeks old, female) were obtained from Harlan Laboratories (Envigo, Inc.) and forced acclimation for one week according to IACUC guidelines. All animal procedures and maintenance were carried out according to facility guidelines. Mice were housed in the Altogen Labs animal facility, carcasses were frozen, and disposed of at the end of the study according to facility guidelines. Test design The number of test substances administered and the number of animals in each study group are shown in the experimental design table below. Table 4: Experimental plan for Example 6

[0059] [Table 6] A total of 35 tumor-bearing animals (MDA-MB-231) were prepared for the experiment. Tumor inoculation was performed on September 30, 2021 (day 0). Tumor volume ranged from 50 to 150 mm. 3 Treatment was initiated on October 5, 2021 (day 5), when the condition was reached. Tumor size (volume) was measured twice a week using electronic calipers. Research endpoints 2,000 mm 3 The point at which the first BWL exceeds 20% is either the tumor volume or 45 days after xenografting (according to Altogen Labs IACUC). Materials and equipment animal: Species: House mouse Strand: NOD / SCID immunodeficient mouse Age: 16-18 weeks (estimated age at the time of vaccination) Sex: Female Total number: 60 mice (35 mice plus an additional 25 mice to account for tumor survival rate) Animal supplier: Harlan Laboratories (Envigo, Inc) The animals were housed in individual ventilated cages (3-4 mice per cage) under the following conditions. Temperature: 22~25°C Humidity: 40~60% Light cycle: 12-hour light period and 12-hour dark period Irradiated sterilized IVC cage Bed material: Bed material of irradiated corn cob Diet: Immunodeficient mouse diet, irradiated sterilized dry granules Water: Sterilized water autoclaved before use Cage identification label: By Altogen Labs IACUC Animal identification: By Altogen Labs IACUC Test article: Compound A was received as a dry powder in good condition. Final formulation: 5% NMP, 5% Solutol HS-5, 10% PEG-400 and 80% 1×PBS (physiological saline). Experimental method Cell culture MDA-MB-231 tumor cells were maintained in vitro as monolayer cultures in Leibovitz's L-15 medium (ATCC) supplemented with 0.01 mg / ml insulin, 12% fetal bovine serum, sodium pyruvate (1 mM), and 10 nM estrogen; there was no gas exchange with the atmosphere. Tumor cells were passaged regularly twice a week by trypsin-EDTA treatment (0.05% trypsin-EDTA). Cells in the exponential growth phase were harvested and counted for tumor inoculation. 6 million MDA-MB-231 cells were generated. Cells were grown under sterile conditions. MDA-MB-231 cells were analyzed by Guava PCA flow cytometry for cell number and cell viability (99%) before xenografting. Tumor inoculation MDA-MB-231 cells (in 〈1×10 6 ) in 0.1 ml of 1×PBS mixed with Matrigel (1:1) were subcutaneously inoculated into the flank region of each mouse to generate tumors (50% Matrigel protocol according to Altogen Labs SOP 6.012). Xenografting was performed on September 30, 2021 (designated as day 0). Tumor volume was 50~l50 mm 3Treatment was initiated when the tumor reached a certain size (October 5, 2021). For the MDA-MB-231 follow-up xenograft experiment, the tumor was 50-150 mm. 3 Thirty-five animals were selected and randomly assigned to groups 1 through 5. The number of animals administered the test substance in each study group and the experimental design table are shown. Group assignment Before grouping and treatment, the weight of all animals was measured and the tumor volume was confirmed using electronic calipers (50-150 mm). 3 Since tumor volume can affect the efficacy of any given treatment, mice were assigned to groups using a randomized block design as follows: First, the experimental animals were divided into uniform blocks based on tumor volume. Second, within each block, the experimental animals were randomized to different groups. By using a randomized block design to assign the experimental animals, the inventors ensured that each animal had the same probability of being assigned to any given treatment group, that is, systematic error was reliably minimized. Observation and data collection After tumor cell inoculation, animals were checked daily for morbidity and mortality. At routine monitoring points, animals were checked for any adverse effects of tumor growth and treatment on normal behavior (e.g., mobility, visual assessment of food and water consumption, weight gain / loss, eye / hair tangles, and any other abnormal effects). Deaths and observed clinical signs were recorded according to Altogen Labs IACUC. Tumor volume was measured two-dimensionally every 3-4 days using an electronic caliper, and the volume data was expressed in mm using the formula: V = 0.5 a × b² (where a and b are the major and minor diameters of the tumor, respectively). 3 This is represented as follows. Medication and tumor volume measurement procedures were performed in a Laminar Flow Cabinet in accordance with Altogen Labs IACUC regulations. statistics Summary statistics, the mean, and the standard error of the mean (SEM) are provided for tumor volume in each group at each time point. Statistical analysis of differences in tumor volume between groups and drug interaction analysis were performed on data obtained after the final dose. result No animal deaths were observed during the study. No clinical signs or behavioral phenotypes were observed in the study (daily cage observations were conducted for adverse effects). No animals with >20% BWL were observed during the study period. No weight loss was observed in animals with BWL >20% in the study. The study design overview, tumor volume, and body weight results are shown in Figures 27-29.

[0060] References

[0061] [Table 7]

Claims

1. The following formula is used in methods for treating cancer: 【Chemistry 1】 (Compound A) A compound represented as compound A, or a pharmaceutically acceptable salt thereof.

2. A compound according to claim 1 or a pharmaceutically acceptable salt thereof, provided in a composition together with at least one pharmaceutically acceptable excipient.

3. The compound according to claim 1 or 2, or a pharmaceutically acceptable salt thereof, wherein the cancer is a solid tumor.

4. The compound according to any one of claims 1 to 3 or a pharmaceutically acceptable salt thereof, wherein the cancer is breast cancer, colon cancer, kidney cancer, lung cancer, ovarian cancer, prostate cancer, or melanoma.

5. The compound according to claim 4 or a pharmaceutically acceptable salt thereof, wherein the cancer is breast cancer or ovarian cancer.

6. The method comprises administering compound A or a pharmaceutically acceptable salt thereof at a dose of 30 mg / kg or 90 mg / kg per administration in a 10 ml / kg environment, according to any one of claims 1 to 5.

7. The method comprises administering compound A or a pharmaceutically acceptable salt thereof once daily, according to any one of claims 1 to 6.

8. The method comprises administering compound A or a pharmaceutically acceptable salt thereof for at least 20 or 28 consecutive days, according to any one of claims 1 to 7.

9. The compound or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 8, wherein the method comprises administering compound A or a pharmaceutically acceptable salt thereof orally or by oral administration alone.

10. The method comprises administering paclitaxel or a pharmaceutically acceptable salt thereof, wherein the compound or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 9.

11. The method comprises administering sorafenib or a pharmaceutically acceptable salt thereof, wherein the compound or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 10.

12. The compound or pharmaceutically acceptable salt thereof according to claim 10 or 11, wherein the method comprises administering paclitaxel or a pharmaceutically acceptable salt thereof and / or sorafenib or a pharmaceutically acceptable salt thereof once weekly.

13. The method comprises administering paclitaxel or a pharmaceutically acceptable salt thereof at a dose of 15 mg / kg per single administration, wherein the compound or a pharmaceutically acceptable salt thereof according to any one of claims 10 to 12.

14. The method comprises administering sorafenib or a pharmaceutically acceptable salt thereof at a dose of 15 mg / kg per single dose, wherein the compound or a pharmaceutically acceptable salt thereof according to any one of claims 10 to 13.

15. A compound or a pharmaceutically acceptable salt thereof according to any one of claims 10 to 14, wherein the method comprises administering paclitaxel or a pharmaceutically acceptable salt thereof and / or sorafenib or a pharmaceutically acceptable salt thereof subcutaneously, intravenously, or entirely subcutaneously.