Fluorescent dyes and their manufacture and use

Abstract

The present invention relates to a fluorescent dye and its preparation method and use, which has advantages such as sensitive and specific viscosity response and low background fluorescence, and can also be used as a fluorescence-activated emission probe for fluorescent labeling, quantification, or detection of proteins, enzymes, or nucleic acids.

Description

[Technical field]

[0001] The present invention relates to the technical field of fluorescent dyes, and more particularly to viscosity-responsive, low background fluorescence fluorescent dyes and their preparation and use. [Background technology]

[0002] The chromophores of fluorescent proteins are mainly imidazolinone dyes, which have the advantages of relatively good biocompatibility, good photostability, and adjustable fluorescent properties. In the study, the dyes of this system are a kind of molecular rotor, whose fluorescent properties change with changes in viscosity. After being excited by light irradiation, the molecular rotor in the free state releases excited state energy in a non-radiative form due to the intramolecular distortion in the excited state. It was found that when the molecule is in an environment with a relatively large viscosity or a relatively rigidity, the intramolecular distortion in the excited state is limited, and the excited state energy is mainly released in the form of radiative emission, showing the property of enhanced fluorescence. Therefore, molecular rotors are often used to detect changes in the microenvironment.

[0003] At present, the emission due to the restriction of the intramolecular distortion of molecular rotors is not only used for viscosity measurement, but is also widely applied to the construction of fluorescent sensors, protein labeling, nucleic acid labeling, etc. For example, after DCVJ binds to a protein such as BSA, the intramolecular distortion of the excited state of the molecular rotor is restricted, and the excited state energy is released in the form of radiative emission, showing fluorescence activation, which is used for the detection and quantification of target proteins. Dyes such as thiazole orange are used for the no-wash labeling and detection of DNA and RNA by generating fluorescence due to the restriction of molecular conformation after binding to DNA and RNA. DHBI was used as a target molecule, and an aptamer that can specifically bind to it was obtained by screening using SELEX, and a fluorescent aptamer was constructed, solving the problem of the lack of natural fluorescent RNA, making it possible to construct fluorescent RNA. Malachite green and other target molecules were used to obtain single-chain antibodies that can specifically bind to malachite green derivatives and activate fluorescence using phage display technology, which are used to label cell membrane proteins. Molecular rotors such as BODIPY are used in research into diseases such as Alzheimer's disease and Parkinson's disease by binding to amyloid proteins and tua proteins and emitting fluorescence.

[0004] However, the types of imidazolinone molecular rotors that are entirely derived from fluorescent protein chromophores are very limited, but by modifying them through organic synthesis methods, the spectral range of imidazolinones can be significantly expanded, and other properties such as photostability, oil-water partition coefficient, etc. can be effectively adjusted. However, at present, the molecular rotors obtained by this method generally have the disadvantage of high fluorescence background, and the detection signal-to-noise ratio is relatively low, making them difficult to apply to the detection and labeling of samples with small sample amounts, complex components, and relatively low substrate abundance. Therefore, it is necessary to develop imidazolinone molecular rotors with low background fluorescence, which can expand the use of this type of molecular rotor. Summary of the Invention

[0005] The object of the present invention is to provide a fluorescent dye that is viscosity-responsive and has low background fluorescence. The viscosity response of this type of molecular rotor is expressed in the range of 10 -5 The ratio of the fluorescence intensity in glycerol to that in methanol is greater than 10 in mol.

[0006] One aspect of the present invention is to provide a fluorescent dye of formula (I):

[0007] [ka]

[0008] During the ceremony: Ar is an arylene group or a heteroarylene group, each hydrogen atom in Ar may be independently replaced by a halogen atom, and D- is HO- or N(X 1 )(X 2 )- and X 1 , X 2 are each independently selected from hydrogen, an alkyl group, or a modified alkyl group; 1 , X 2 may be bonded to each other to form an aliphatic heterocycle together with the N atom, X 1 , X 2 may independently form an aliphatic heterocycle with Ar; Y is O or S; R 1 is hydrogen or an alkyl group, R 2 is a halogen atom, -OH or -CN, However, the above-mentioned "alkyl group" is C 1 -C 10 A straight or branched chain alkyl group, C 1 -C 6 may be a linear or branched alkyl group; 1 -C 4It may be a straight-chain or branched-chain alkyl group, and examples thereof include a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a t-butyl group, an s-butyl group, an n-pentyl group, a 1-methylbutyl group, a 2-methylbutyl group, a 3-methylbutyl group, an isoamyl group, a 1-ethylpropyl group, a neopentyl group, an n-hexyl group, a 1-methylpentyl group, a 2-methylpentyl group, a 3-methylpentyl group, an isohexyl group, and a 1,1-dimethylbutyl group. a 2,2-dimethylbutyl group, a 3,3-dimethylbutyl group, a 1,2-dimethylbutyl group, a 1,3-dimethylbutyl group, a 2,3-dimethylbutyl group, a 2-ethylbutyl group, a n-heptyl group, a 2-methylhexyl group, a 3-methylhexyl group, a 2,2-dimethylpentyl group, a 3,3-dimethylpentyl group, a 2,3-dimethylpentyl group, a 2,4-dimethylpentyl group, a 3-ethylpentyl group or a 2,2,3-trimethylbutyl group; The "modified alkyl group" is independently selected from the group consisting of C 1 -C 16 Any carbon atom of a straight or branched alkyl group may be a halogen atom, -OH, -CO-, -O-, -CN, -SO 3 a group substituted with one or more groups selected from H, a primary amino group, a secondary amino group, and a tertiary amino group, or the carbon-carbon single bonds may be independently replaced with a carbon-carbon double bond or a carbon-carbon triple bond; The substitution of a carbon atom means that the carbon atom, or a carbon atom together with a hydrogen atom thereon, is replaced with a corresponding group; The "halogen atoms" are each independently F, Cl, Br or I. The "aliphatic heterocycle" is a saturated or unsaturated 4- to 15-membered monocyclic or polycyclic aliphatic heterocycle having one or more heteroatoms selected from N, O, S, and Si in the ring. When the aliphatic heterocycle has an S atom, it is -S-, -SO-, or -SO 2 wherein the aliphatic heterocycle may be substituted with a halogen atom, an alkyl group, an aryl group or a modified alkyl group; The "arylene groups" are each independently a 5- to 13-membered (or may be 6- or 10-membered) monocyclic, bicyclic, fused bicyclic, or fused polycyclic arylene group, The "heteroarylene groups" each independently represent a 5- to 13-membered (or 6- or 10-membered) monocyclic, bicyclic, fused bicyclic, or fused polycyclic heteroarylene group having one or more heteroatoms selected from N, O, S, or Si in the ring; The "primary amino group" is R'NH 2 It is based on The "secondary amino group" is a R'NHR'' group, The "tertiary amino group" is a R'NR''R''' group, each R', R'', and R''' is independently a single bond, hydrogen, an alkyl group, or an alkylene group; The "alkylene group" is C 1 -C 10 is a straight or branched alkylene group of the formula C 1 -C 7 may be a linear or branched alkylene group, C 1 -C 5 may be a linear or branched alkylene group, Preferably, the "modified alkyl group" is -OH, -O-, -NH 2 , ethylene glycol unit (-(CH 2 CH 2 O) n -), -CN, -O-CO-, -NH-CO-, -SO 2 -O-, -SO-, Me 2 N-, Et 2 having one or more groups selected from N-, -CH=CH-, -C≡CH, F, Cl, Br, I, and a cyano group; Preferably, Ar is a structure selected from the following formulas (II-1) to (II-7):

[0009] [ka]

[0010] Preferably, the compound of formula (I) is selected from the following compounds:

[0011] [ka]

[0012] A second aspect of the present invention provides a method for producing the above-mentioned fluorescent dye, the method comprising a step of subjecting a compound of formula (a) and a compound of formula (b) to an aldol condensation reaction.

[0013] [ka]

[0014] In a third aspect, the present invention provides a use of the above-mentioned fluorescent dye for viscosity measurement, fluorescent labeling of proteins, fluorescent labeling of nucleic acids, quantification or detection of proteins, or quantification or detection of nucleic acids, which is not for a method for diagnosing a disease.

[0015] A fourth aspect of the present invention provides use of the above-mentioned fluorescent dye for producing a reagent for viscosity measurement, fluorescent labeling of protein, fluorescent labeling of nucleic acid, quantification or detection of protein, or quantification or detection of nucleic acid.

[0016] A fifth aspect of the present invention provides a fluorescence activated emission probe comprising the above fluorescent dye.

[0017] In a sixth aspect of the present invention, there is provided a use of the above-mentioned fluorescence activated generating probe for fluorescent labeling of a protein, fluorescent labeling of a nucleic acid, quantification or detection of a protein, or quantification or detection of a nucleic acid, which is not for a method for diagnosing a disease.

[0018] A seventh aspect of the present invention provides use of the above-mentioned fluorescence-activated generating probe for producing a reagent for fluorescent labeling of protein, fluorescent labeling of nucleic acid, quantification or detection of protein, or quantification or detection of nucleic acid.

[0019] The fluorescent dyes according to the invention can be used to measure the viscosity of a sample, for example suitable for measuring microscopic viscosity. According to specific embodiments of another aspect, the obtained fluorescent dyes can be specifically bound to corresponding antibodies, aptamers or amyloid proteins, etc., or can be bound to protein tags or enzymes via ligands or inhibitors, resulting in a series of fluorescence-activated generating probes, which are used for fluorescent labeling, quantification or monitoring of proteins, enzymes or nucleic acids. [Brief description of the drawings]

[0020] [Figure 1] FIG. 2 is a graph showing the fluorescence emission intensity of molecular rotor IV-1 (1×10−5 M) under different viscosity conditions. [Diagram 2] FIG. 2 is a graph showing the fluorescence emission intensity of molecular rotor IV-2 (1×10−5 M) under different viscosity conditions. [Diagram 3] FIG. 2 is a graph showing the fluorescence emission intensity of molecular rotor IV-3 (1×10−5 M) under different viscosity conditions. [Figure 4] FIG. 2 is a graph showing the fluorescence emission intensity of molecular rotor IV-4 (1×10−5 M) under different viscosity conditions. [Diagram 5] FIG. 2 is a graph showing the fluorescence emission intensity of molecular rotor IV-5 (1×10−5 M) under different viscosity conditions. [Figure 6] FIG. 2 is a graph showing the fluorescence emission intensity of molecular rotor IV-6 (1×10−5 M) under different viscosity conditions. [Figure 7] FIG. 2 is a graph showing the fluorescence emission intensity of molecular rotor IV-17 (1×10−5 M) under different viscosity conditions. [Figure 8] FIG. 2 is a graph showing the fluorescence emission intensity of molecular rotor IV-18 (1×10−5 M) under different viscosity conditions. [Figure 9] FIG. 2 is a graph showing the fluorescence emission intensity of molecular rotor IV-19 (1×10−5 M) under different viscosity conditions. [Figure 10] FIG. 2 is a graph showing the fluorescence emission intensity of molecular rotor IV-20 (1×10−5 M) under different viscosity conditions. [Figure 11]FIG. 2 is a graph showing the fluorescence emission intensity of molecular rotor IV-21 (1×10−5 M) under different viscosity conditions. [Figure 12] FIG. 2 is a graph showing the fluorescence emission intensity of molecular rotor IV-22 (1×10−5 M) under different viscosity conditions. [Figure 13] This is a comparison of the fluorescence background in PBS of molecular rotors IV-39, IV-40, and IV-44 and IV-1, IV-2, IV-3, IV-4, IV-5, IV-6, IV-7, and IV-8 (1 x 10-6 M). [Figure 14] This is a comparison of the fluorescence background of molecular rotors IV-41, IV-43, and IV-17, IV-18, IV-19, IV-20, IV-21, and IV-22 (1 x 10-6 M) in PBS. [Figure 15] FIG. 1 is a comparison of the fluorescence background of molecular rotors IV-42 and IV-36 (1×10 −6 M) in PBS. [Figure 16] FIG. 1 is a comparison of the fluorescence background of molecular rotors IV-45, IV-46, and IV-3 (1×10−6 M) in PBS. [Figure 17] FIG. 1 is a comparison of the fluorescence background of molecular rotors IV-47, IV-48, and IV-20 (1×10−6 M) in PBS. [Figure 18] FIG. 1 is a comparison of the fluorescence background of molecular rotors IV-49, IV-50, and IV-5 (1×10−6 M) in PBS. [Figure 19] FIG. 1 is a comparison of the fluorescence background of molecular rotors IV-51 and IV-1 (1×10 −6 M) in PBS. [Figure 20] Molecular rotors IV-1, IV-2, IV-3, IV-4, IV-5, IV-6, IV-17, IV-18, IV-19, IV-20, IV-21, and IV-22 were used to label intracellular RNA aptamers, among which A is the cell expressing the target RNA aptamer and B is the cell not expressing the target RNA aptamer. [Figure 21] FIG. 1 is a detection flow chart for labeling mRNA with molecular rotors IV-21 and IV-41. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0021] Example 1: Compound IV-1

[0022] [ka]

[0023] Compound 1 (0.504 g, 2 mmol) and p-cyanobenzaldehyde (0.626 g, 5 mmol) were placed in a 250 ml round flask, and 100 ml of tetrahydrofuran was added to dissolve the compound. Under Ar protection, anhydrous zinc chloride (0.545 g, 4 mmol) was added, and the system was heated to reflux in an oil bath at 80°C. The reaction was measured by TLC. After the reaction was completed, the solvent was removed in vacuum, and the residue was separated by column chromatography to obtain the desired product (0.292 g, 40%). 1 H NMR (400MHz, DMSO-d 6 ) δ 11.07(s,1H),8.10(d,J=8.5Hz,2H),8.06(dd,J=7.8,2.1Hz,2H),8.03(s,1H),7.9 4(d,J=8.3Hz,2H),7.44(d,J=15.9Hz,1H),7.03(s,1H),3.29(s,3H).MS(ESI):m / z Calcd.For C 20 H 13 F 2 N 3 O 2 365.0976;found 364.0902,[MH] - .

[0024] Example 2: Compound IV-2

[0025] [ka]

[0026] The procedure for the synthesis of compound IV-1 was followed (0.475 g, 65%). 1 H NMR (400MHz, DMSO-d6 ) δ 11.04(s,1H),8.49(d,J=1.9Hz,1H),8.21(dt,J=8.0,1.4Hz,1H),8.10-8.02(m,2H),8.00(s,1H),7.88(dt ,J=7.7,1.4Hz,1H),7.67(t,J=7.8Hz,1H),7.43(d,J=16.0Hz,1H),7.01(s,1H),3.29(s,3H).MS(ESI):m / z Calcd.For C 20 H 13 F 2 N 3 O 2 365.0976;found 364.0903,[MH] - .

[0027] Example 3: Compound IV-3

[0028]

change

[0029] The synthesis method of compound IV-1 is as follows: 0.221g, 31%. 1 H NMR (400 MHz, DMSO-d 6 ) δ 10.94(s,1H),10.11(s,1H),8.07-8.01(m,2H),7.95(d,J=15.7Hz,1H),7.74(d,J=8.7Hz ,2H),7.01(d,J=15.7Hz,1H),6.90(s,1H),6.87-6.83(m,2H),3.26(s,3H).MS(ESI):m / z Calcd.For C 19 H 14 F 2 N 2 O 3 356.0972;found 355.0901,[MH] - .

[0030] Example 4: Compound IV-4

[0031]

change

[0032] Synthesized according to the procedure for Compound IV-1 (0.207 g, 29%). 1 H NMR (400 MHz, DMSO-d 6 ) δ 9.70 (s, 1H), 8.05 (d, J = 8.9 Hz, 2H), 7.98 - 7.89 (m, 1H), 7.30 (t, J = 6.2 Hz, 1H), 7.26 (d, J = 8.9 Hz, 1H), 7.15 (d, J = 15.8 Hz, 1H), 6.97 (s, 1H), 6.87 (d, J = 7.5 Hz, 1H), 3.27 (s, 3H). MS (ESI): m / z Calcd. For C 19 H 14 F 2 N 2 O 3 356.0972; found 355.0900, [M - H] - 。

[0033] Example 5: Compound IV-5

[0034]

Chemical Structure

[0035] Synthesized according to the procedure for Compound IV-1 (0.186 g, 26%). 1 H NMR (400 MHz, DMSO-d 6 ) δ 8.16 (d, J = 8.5 Hz, 2H), 7.99 - 7.86 (m, 3H), 7.31 (t, J = 8.9 Hz, 2H), 7.18 (d, J = 15.9 Hz, 1H), 6.95 (s, 1H), 6.83 - 6.72 (m, 2H), 3.59 (t, J = 5.9 Hz, 2H), 3.51 (t, J = 5.9 Hz, 2H), 3.27 (s, 3H), 3.05 (s, 3H). MS (ESI): m / z Calcd. For C 19 H 13 F 3 N 2 O 2 358.0929; found 357.0856, [M - H] - 。

[0036] Example 6: Compound IV-6

[0037]

Chem.

[0038] The synthesis procedure of Compound IV-1 was followed (0.222 g, 31%). 1 1H NMR (400 MHz, DMSO-d 6 ) δ 11.02 (s, 1H), 8.09 - 8.03 (m, 2H), 8.01 (d, J = 15.8 Hz, 1H), 7.85 (dt, J = 10.6, 2.1 Hz, 1H), 7.72 (d, J = 7.8 Hz, 1H), 7.51 (td, J = 8.0, 6.1 Hz, 1H), 7.34 (d, J = 15.9 Hz, 1H), 7.28 (td, J = 8.7, 2.7 Hz, 1H), 7.00 (s, 1H), 3.28 (s, 3H). MS (ESI): m / z Calcd. For C 19 1H 13 F 3 N 2 O 2 358.0929; found 357.0857, [M - H] -

[0039] Example 7: Compound 2

[0040]

Chem.

[0041] Compound IV-5 (0.716 g, 2.0 mmol), t-butyldimethylchlorosilane (0.450 g, 3.0 mmol), and imidazole (0.204 g, 3.0 mmol) were placed in a 100 ml round flask, and 50 ml of dry dimethylformamide was added to dissolve the compound. The mixture was stirred at room temperature under Ar protection conditions and measured by TLC. After the reaction was completed, the system was poured into 150 ml of water and extracted three times with dichloromethane. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the solvent was removed under reduced pressure. The residue was separated by column chromatography to obtain compound 2 (0.927 g, 98%). 1 H NMR (400MHz, DMSO-d 6 ) δ 8.16(d,J=8.5Hz,2H),7.99-7.86(m,3H),7.31(t,J=8.9Hz,2H),7.18(d,J=15.9Hz,1H),6.95(s,1H),6.83-6.72(m ,2H),3.59(t,J=5.9Hz,2H),3.51(t,J=5.9Hz,2H),3.27(s,3H),3.05(s,3H),1.50(s,9H),0.2(s,6H).MS(ESI):m / z Calcd.For C 25 H 28 F 3 N 2 O 2 Si 473.2; found 473.2, [M+H] + .

[0042] Compound IV-7

[0043] [ka]

[0044] Compound 2 (0.473g, 1mmol) and Lawesson's reagent (0.808g, 2mmol) were placed in a 250ml three-neck flask, dissolved in 100ml of toluene, added with 2 drops of aniline, heated under reflux in an oil bath under Ar protection, and measured by TLC. After the reaction was completed, the solvent was removed under reduced pressure, and the residue was dissolved in 50ml of dichloromethane, added with tetrabutylammonium fluoride (0.313g, 1.2mmol), stirred at room temperature under Ar protection, and measured by TLC. After the reaction was completed, the solvent was removed under reduced pressure, and the residue was separated by column chromatography to obtain compound IV-7 (0.209g, 56%). 1 H NMR (400MHz, DMSO-d 6 ) δ 8.17(d,J=8.5Hz,2H),7.98-7.86(m,3H),7.31(t,J=8.9Hz,2H),7.18(d,J=15.9Hz,1H),6.95(s,1H),6 .83-6.72(m,2H),3.59(t,J=5.9Hz,2H),3.51(t,J=5.9Hz,2H),3.27(s,3H),3.05(s,3H).MS(ESI):m / z Calcd.For C 19 H 13 F 3 N 2 NaOS 397.0598;found 397.0597,[M+Na] + .

[0045] Example 8: compound 3

[0046] [ka]

[0047] The procedure for the synthesis of compound 2 was followed (0.932 g, 99%). 1 H NMR (400MHz, DMSO-d 6) δ 8.10 (d, J = 8.5 Hz, 2H), 8.06 (dd, J = 7.8, 2.1 Hz, 2H), 8.03 (s, 1H), 7.94 (d, J = 8.3 Hz, 2H), 7.44 (d, J = 15.9 Hz, 1H), 7.03 (s, 1H), 3.29 (s, 3H), 1.51 (s, 9H), 0.29 (s, 9H). MS(ESI): m / z Calcd. For C 26 H 28 F 2 N 3 O 2 Si 480.2; found 480.2, [M + H] + 。

[0048] Compound IV-8

[0049]

Chem.

[0050] Synthesized according to the procedure of Compound IV-7 (0.332 g, 49%). 1 1H NMR (400 MHz, DMSO-d 6 ) δ 11.00 (s, 1H), 8.11 (d, J = 8.5 Hz, 2H), 8.07 (dd, J = 7.8, 2.1 Hz, 2H), 8.04 (s, 1H), 7.94 (d, J = 8.3 Hz, 2H), 7.44 (d, J = 15.9 Hz, 1H), 7.03 (s, 1H), 3.29 (s, 3H). HMS(ESI): m / z Calcd. For C 20 H 13 F 2 N 3 NaOS 404.0645; found 404.0646, [M + Na] + 。

[0051] Example 9: Compound 5

[0052]

Chem.

[0053] 3-Fluoro-4-hydroxy-benzaldehyde (0.560g, 4.0mmol) was placed in a 100ml round flask, dissolved in 40ml of anhydrous ethanol, added with 10g of anhydrous sodium sulfate and 5ml of 33% aqueous methylamine solution, stirred at room temperature for 24h under Ar protection, filtered, removed the organic solvent under pressure, dissolved the residue in 10ml of anhydrous ethanol, added compound 4 (0.790g, 5.0mmol), stirred at room temperature overnight under Ar protection, filtered the next day, and rinsed with cold ethanol three times to obtain compound 5 (0.796g, 85%). 1 H NMR (400MHz, DMSO-d 6 ) δ 10.52(s,1H),8.19(m,1H),7.76(m,1H),6.99(t,J=8.8Hz,1H),6.89(s,1H),3.09(s,3H),2.34(s,3H).MS(ESI):m / z Calcd.For C 12 H 10 FN 2 O 2 234.2;found 234.2,[MH] - .

[0054] Compound IV-9

[0055] [ka]

[0056] The procedure for the synthesis of compound IV-1 was followed (0.239 g, 21%). 1 H NMR (400MHz, DMSO-d 6 ) δ 10.52(s,1H),8.11(d,J=8.5Hz,2H),8.07(d,J=7.8Hz,2H),7.84(d,J=8.0Hz,1H),7.67(d,J=8.4H z,1H),7.32(m,1H),6.99(t,J=8.8Hz,1H),6.89(s,1H),6.78(m,1H),2.34(s,3H).HR-MS(ESI):m / z Calcd.For C 20 H 13 FN 3 O 2346.0997; found 346.0998, [M-H] - 。

[0057] Example 10: Compound 6

[0058]

Chem.

[0059] Synthesized according to the synthetic procedure of Compound 5 (0.812 g, 91%). 1 H NMR (400 MHz, CD 3 OD) δ 7.28 (s, 1H), 7.19 (d, J = 8.0 Hz, 2H), 3.59 (t, J = 5.6 Hz, 3H), 3.12 (s, 3H), 1.23 (q, J = 5.6 Hz, 3H). MS (ESI): m / z Calcd. For C 13 H 11 ClFN 2 O 2 281.0; found 281.0, [M-H] - 。 Compound IV-10

[0060]

Chem.

[0061] Synthesized according to the synthetic procedure of Compound IV-1 (0.239 g, 21%). 1 H NMR (400 MHz, CD 3 OD) δ 7.84 (s, 2H), 7.28 (s, 1H), 7.19 (d, J = 8.0 Hz, 2H), 3.12 (s, 3H), 1.23 (q, J = 5.6 Hz, 3H). HR-MS (ESI): m / z Calcd. For C 21 H 14 ClFN 3 O 2 395.0837; found 394.0764, [M-H] - 。

[0062] Example 11: Compound 7

[0063]

Chem.

[0064] According to the synthesis procedure of Compound 5 (0.812 g, 91%). 1 H NMR (400 MHz, CD 3 OD) δ 7.28 (s, 1H), 7.19 (d, J = 8.0 Hz, 2H), 3.81 (s, 3H), 3.12 (s, 3H), 3.12 (s, 3H), 1.58 (m, 1H), 1.11 (d, 6H). MS (ESI): m / z Calcd. For C 15 H 15 BrFN 2 O 2 353.0; found 3.0, [M - H] - 。

[0065] Compound IV - 11

[0066]

Chem.

[0067] According to the synthesis procedure of Compound IV - 1 (0.209 g, 22%). 1 H NMR (400 MHz, CD 3 OD) δ 8.15 (d, J = 8.8 Hz, 2H), 7.95 (d, J = 15.7 Hz, 1H), 7.74 (d, J = 8.7 Hz, 2H), 7.28 (s, 1H), 7.19 (d, J = 8.0 Hz, 2H), 7.01 (d, J = 15.7 Hz, 1H), 6.87 - 6.83 (m, 2H), 3.12 (s, 3H), 1.58 (m, 1H), 1.11 (d, 6H). HR - MS (ESI): m / z Calcd. For C 23 H 19 BrFN 3 O 2 467.0645; found 466.0572, [M - H] - 。

[0068] Example 12: Compound 8

[0069]

Chem.

[0070] Synthesized according to the procedure for Compound 5 (0.812 g, 91%). 1 H NMR (400 MHz, CD3OD) δ 10.52 (s, 1H), 7.76 (d, J = 8.5 Hz, 2H), 6.95 (s, 1H), 3.79 (t, J = 5.2 Hz, 2H), 3.35 (s, 3H), 2.39 (t, J = 4.8 Hz, 2H), 1.40 (m, 2H), 1.20 (t, J = 4.8 Hz, 3H). MS (ESI): m / z Calcd. For C 14 H 214 FIN 2 O 2 388.0; found 388.0, [M-H] - 。

[0071] Compound IV-12

[0072]

Chem.

[0073] Synthesized according to the procedure for Compound IV-1 (0.156 g, 18%). 1 H NMR (400 MHz, CD 3 OD) δ 10.52 (s, 1H), 7.98 - 7.86 (m, 3H), 7.76 (d, J = 8.5 Hz, 2H), 7.31 (t, J = 8.9 Hz, 2H), 7.18 (d, J = 15.9 Hz, 1H), 6.95 (s, 1H), 3.79 (t, J = 5.2 Hz, 2H), 3.35 (s, 3H), 2.39 (t, J = 4.8 Hz, 2H), 1.40 (m, 2H), 1.20 (t, J = 4.8 Hz, 3H). HR-MS (ESI): m / z Calcd. For C 21 H 17 ClFIN 2 O 2 510.0007; found 408.9936, [M-H] - 。

[0074] Example 13: Compound 9

[0075]

Chem.

[0076] Synthesized according to the procedure for Compound 5 (0.732 g, 93%). 1 H NMR (400 MHz, CD 3 OD) δ 10.52 (s, 1H), 7.76 (d, J = 8.5 Hz, 2H), 6.95 (s, 1H), 3.10 (s, 3H), 2.39 (s, 3H). MS (ESI): m / z Calcd. For C 12 H 10 Cl 2 N 2 O 3 284.0; found 283.0, [M - H] - 。

[0077] Compound IV - 13

[0078]

Chem.

[0079] Synthesized according to the procedure for Compound IV - 1 (0.156 g, 18%). 1 H NMR (400 MHz, CD 3 OD) δ 10.52 (s, 1H), 8.07 - 8.01 (m, 2H), 7.95 (d, J = 15.7 Hz, 1H), 7.76 (d, J = 8.5 Hz, 2H), 7.01 (d, J = 15.7 Hz, 1H), 6.95 (s, 1H), 6.87 - 6.83 (m, 2H), 3.10 (s, 3H), 2.39 (s, 3H). HR - MS (ESI): m / z Calcd. For C 19 H 13 BrCl 2 N 2 O 2 449.9537; found 448.9455, [M - H] - 。

[0080] Example 14: Compound 10

[0081] [Chemical formula]

[0082] Synthesized according to the procedure for Compound 5 (0.732 g, 93%). 1 H NMR (400 MHz, DMSO-d 6 ) δ 10.52 (s, 1H), 8.19 (m, 1H), 7.76 (m, 1H), 6.99 (t, J = 8.8 Hz, 1H), 6.89 (s, 1H), 3.01 (q, J = 4.8 Hz, 2H), 2.34 (s, 3H), 1.21 (t, J = 4.8 Hz, 3H). MS (ESI): m / z Calcd. For C 13 H 13 ClN 2 O 2 264.1; found 263.1, [M-H] - .

[0083] Compound IV-13

[0084] [Chemical formula]

[0085] Synthesized according to the procedure for Compound IV-1 (0.156 g, 18%). 1 H NMR (400 MHz, DMSO-d 6 ) δ 10.52 (s, 1H), 8.19 (m, 1H), 8.07 - 8.01 (m, 2H), 7.95 (d, J = 15.7 Hz, 1H), 7.76 (m, 1H), 7.01 (d, J = 15.7 Hz, 1H), 6.99 (t, J = 8.8 Hz, 1H), 6.89 (s, 1H), 6.87 - 6.83 (m, 2H), 3.01 (q, J = 4.8 Hz, 2H), 2.34 (s, 3H), 1.21 (t, J = 4.8 Hz, 3H). HR-MS (ESI): m / z Calcd. For C 21 H 13 ClIN2 O 2 486.9716; found 486.9715, [M-H] - 。

[0086] Example 15: Compound 11

[0087]

Chem.

[0088] Synthesized according to the procedure for Compound 5 (0.732 g, 93%). 1 H NMR (400 MHz, CD 3 OD) δ 10.52 (s, 1H), 8.19 (m, 1H), 7.76 (m, 1H), 6.99 (t, J = 8.8 Hz, 1H), 6.89 (s, 1H), 3.05 (s, 3H), 2.34 (s, 3H). MS (ESI): m / z Calcd. For C 12 H 11 BrN 2 O 2 294.0; found 293.0, [M-H] - 。

[0089] Compound IV-15

[0090]

Chem.

[0091] Synthesized according to the procedure for Compound IV-1 (0.156 g, 18%). 1 H NMR (400 MHz, CD3OD) δ 10.52 (s, 1H), 8.19 (m, 1H), 7.95 (d, J = 15.7 Hz, 1H), 7.76 (m, 1H), 7.49 (m, 1H), 7.40 - 7.22 (m, 3H), 7.01 (d, J = 15.7 Hz, 1H), 6.99 (t, J = 8.8 Hz, 1H), 6.89 (s, 1H), 3.05 (s, 2H), 2.34 (s, 3H). HR-MS (ESI): m / z Calcd. For C 19 H 14 BrClN2 O 2 415.9927; found 414.9854, [M-H] - 。

[0092] Example 16: Compound 9

[0093]

Chem.

[0094] Synthesized according to the procedure of Compound 5 (0.732 g, 93%). 1 H NMR (400 MHz, CD 3 OD) δ 10.52 (s, 1H), 7.76 (d, J = 8.5 Hz, 2H), 6.95 (s, 1H), 2.39 (s, 3H). MS (ESI): m / z Calcd. For C 11 H 8 Cl 2 N 2 O 2 270.0; found 271.0, [M+H][M+H] - 。

[0095] Compound IV-16

[0096]

Chem.

[0097] Synthesized according to the procedure of Compound IV-1 (0.156 g, 18%). 1 H NMR (400 MHz, CD 3 OD) δ 10.52 (s, 1H), 8.07 - 8.01 (m, 2H), 7.95 (d, J = 15.7 Hz, 1H), 7.76 (d, J = 8.5 Hz, 2H), 7.01 (d, J = 15.7 Hz, 1H), 6.95 (s, 1H), 6.87 - 6.83 (m, 2H), 2.39 (s, 3H). HR-MS (ESI): m / z Calcd. For C 18 H 11 BrCl 2 N 2 O 2435.9381; found 436.9459, [M+H][M+H] - 。

[0098] Example 17: Compound IV-17

[0099]

Chem.

[0100] Prepared according to the synthetic procedure of Compound IV-1 (0.286 g, 28%). 1 H-NMR (400 MHz, DMSO-d 6 ): δ8.15 (d, J = 8.6 Hz, 2H), 7.82 (d, J = 15.8 Hz, 1H), 7.31 - 7.22 (m, 2H), 7.21 - 7.17 (m, 1H), 7.10 (d, J = 15.8 Hz, 1H), 6.94 (s, 1H), 6.88 - 6.73 (m, 3H), 3.59 (t, J = 5.8 Hz, 2H), 3.51 (t, J = 6.0 Hz, 2H), 3.26 (s, 3H), 3.05 (s, 3H). HR-MS (ESI): m / z Calcd. For C 22 H 24 N 3 O 3 378.1818; found 378.1819, [M+H] + 。

[0101] Example 18: Compound IV-18

[0102]

Chem.

[0103] Prepared according to the synthetic procedure of Compound IV-1 (0.486 g, 60%). 1 H-NMR (400 MHz, DMSO-d 6): δ8.43(d,J=1.8Hz,1H),8.16(t,J=8.5Hz,3H),7.93(d,J=15.9Hz,1H),7.85(dt,J=7.8,1.4Hz,1H),7.66(t,J=7.8Hz,1H),7.40(d,J =15.9Hz,1H),6.98(s,1H),6.86-6.71(m,2H),3.60(t,J=5.9Hz,2H),3.52(t,J=5.9Hz,2H),3.28(s,3H),3.06(s,3H).HR-MS(ESI):m / z Calcd.For C 23 H 23 N 4 O 2 387.1821; found 387.1822, [M+H] + .

[0104] Example 19: Compound IV-19

[0105]

change

[0106] The synthesis method of compound IV-1 is as follows: 0.286g, 38%. 1 H-NMR (400 MHz, DMSO-d 6 ): δ8.17(d,J=8.6Hz,2H),7.91(d,J=15.8Hz,1H),7.79(dt,J=10.6,2.1Hz,1H),7.66(d,J=7.8Hz,1H),7.50(td,J=8.0,6.2Hz,1H),7. 34-7.20(m,2H),6.97(s,1H),6.84-6.73(m,2H),3.59(t,J=5.9Hz,2H),3.52(t,J=5.9Hz,2H),3.27(s,3H),3.06(s,3H).MS(ESI):m / z Calcd.For C 22 H 23 N 3 O 3 F 380.1774;found 380.1775,[M+H] + .

[0107] Example 20: Compound IV-20

[0108]

Chem.

[0109] Prepared according to the synthesis procedure of Compound IV-1 (0.222 g, 30%). 1 H NMR (400 MHz, DMSO-d 6 ): δ 8.14 (d, J = 8.5 Hz, 2H), 7.84 (d, J = 15.7 Hz, 1H), 7.68 (d, J = 8.4 Hz, 2H), 6.97 (d, J = 15.8 Hz, 1H), 6.88 (s, 1H), 6.84 (d, J = 8.5 Hz, 2H), 6.79 (d, J = 8.8 Hz, 2H), 3.59 (q, J = 5.4 Hz, 2H), 3.51 (t, J = 5.9 Hz, 2H), 3.24 (s, 3H), 3.05 (s, 3H). MS (ESI): m / z Calcd. For C 22 H 24 N 3 O 3 378.1818; found 378.1819, [M + H] + .

[0110] Example 21: Compound IV-21

[0111]

Chem.

[0112] Prepared according to the synthesis procedure of Compound IV-1 (0.352 g, 56%). 1 H-NMR (400 MHz, DMSO-d 6 ): δ 8.18 (d, J = 8.5 Hz, 2H), 8.08 - 8.02 (m, 2H), 7.98 - 7.90 (m, 3H), 7.40 (d, J = 15.9 Hz, 1H), 7.00 (s, 1H), 6.86 - 6.72 (m, 2H), 3.60 (t, J = 5.9 Hz, 2H), 3.52 (t, J = 5.6 Hz, 2H), 3.28 (s, 3H), 3.06 (s, 3H). MS (ESI): m / z Calcd. For C 23 H23 N 4 O 2 387.1821; found 387.1820, [M+H] + 。

[0113] Example 22: Compound IV-22

[0114]

化

[0115] Synthesized according to the procedure of Compound IV-1 (0.252 g, 32%). 1 H-NMR (400 MHz, DMSO-d 6 ): δ8.16 (d, J = 8.5 Hz, 2H), 7.93 (t, J = 4.4 Hz, 2H), 7.90 (d, J = 6.1 Hz, 1H), 7.31 (t, J = 8.9 Hz, 2H), 7.18 (d, J = 15.9 Hz, 1H), 6.95 (s, 1H), 6.83 - 6.72 (m, 2H), 3.59 (t, J = 5.9 Hz, 2H), 3.51 (t, J = 5.9 Hz, 2H), 3.27 (s, 3H), 3.05 (s, 3H). MS (ESI): m / z Calcd. For C 22 H 23 FN 3 O 2 380.1774; found 380.1775, [M+H] + 。

[0116] Example 23: Compound 13

[0117]

化

[0118] Synthesized according to the procedure of Compound IV-1 (0.252 g, 32%). 1 H-NMR (400 MHz, DMSO-d 6):δ8.43(d,J=1.8Hz,1H),8.16(t,J=8.5Hz,3H),7.93(d,J=15.9Hz,1H),7.85(dt,J=7.8,1.4Hz,1H),7.66(t,J=7.8Hz,1H),7.40(d, J=15.9Hz,1H),6.98(s,1H),6.86-6.71(m,2H),3.60(t,J=5.9Hz,2H),3.52(t,J=5.9Hz,2H),3.28(s,3H),3.06(s,3H).MS(ESI):m / z Calcd.For C 23 H 23 N 4 O 2 387.2;found 387.2,[M+H] + .

[0119] compound 14

[0120] [ka]

[0121] Compound 13 (0.774 g, 2.0 mmol) and potassium carbonate (0.276 g, 2.0 mmol) were placed in a 250 ml round flask, dissolved in 100 ml of acetonitrile, and 2 ml of allyl bromide was added under Ar protection conditions. The mixture was heated to reflux in an oil bath and measured by TLC. After the reaction was completed, the mixture was filtered and the solvent was removed under reduced pressure. The residue was separated by column chromatography to obtain compound 18 (0.673 g, 79%). 1 H-NMR (400MHz, DMSO-d 6 ):δ8.43(d,J=1.8Hz,1H),8.16(t,J=8.5Hz,3H),7.93(d,J=15.9Hz,1H),7.85(dt,J=7.8,1.4Hz,1H),7.66(t,J=7.8Hz,1H),7.40(d,J=15. 9Hz,1H),6.98(s,1H),6.86-6.71(m,2H),3.81(s,2H),3.60(t,J=5.9Hz,2H),3.52(t,J=5.9Hz,2H),3.41(s,3H),3.06(s,3H).MS(ESI):m / z Calcd.For C 26 H27 N 4 O 2 427.2; found 427.2, [M+H] + 。

[0122] Compound IV-14

[0123]

Chem.

[0124] Synthesized according to the procedure for compound IV-7 (0.152 g, 72%). 1 H-NMR (400 MHz, DMSO-d 6 ): δ 8.43 (d, J = 1.8 Hz, 1H), 8.16 (t, J = 8.5 Hz, 3H), 7.93 (d, J = 15.9 Hz, 1H), 7.85 (dt, J = 7.8, 1.4 Hz, 1H), 7.66 (t, J = 7.8 Hz, 1H), 7.40 (d, J = 15.9 Hz, 1H), 6.98 (s, 1H), 6.86 - 6.71 (m, 2H), 3.81 (s, 2H), 3.60 (t, J = 5.9 Hz, 2H), 3.52 (t, J = 5.9 Hz, 2H), 3.41 (s, 3H), 3.06 (s, 3H). MS (ESI): m / z Calcd. For C 26 H 27 N 4 OS 443.1906; found 443.1905, [M+H] + 。

[0125] Example 24: Compound 15

[0126]

Chem.

[0127] Synthesized according to the procedure for compound 5 (0.692 g, 82%). 1 H NMR (400 MHz, CD 3OD) δ = 8.02 (d, J = 2.4 Hz, 1H), 7.44 (dd, J = 8.7 Hz, J = 2.4 Hz, 1H), 7.09 (s, 1H), 6.51 (d, J = 8.7 Hz, 1H), 3.56 (t, JHH = 7.6 Hz, 2H), 3.08 (s, 6H), 1.66 (m, 2H), 2.38 (s, 3H), 0.95 (t, J = 7.6 Hz, 3H). MS(ESI): m / z Calcd. For C 15 H 21 N 4 O 273.2; found 273.2, [M + H] + 。

[0128] Compound 16

[0129]

Chem.

[0130] Synthesized according to the procedure for Compound IV - 1 (0.452 g, 34%). 1 H NMR (400 MHz, CD 3 OD) δ = 8.02 (d, J = 2.4 Hz, 1H), 7.95 (m, 2H), 7.68 - 7.50 (m, 1H), 7.44 (dd, J = 8.7 Hz, J = 2.4 Hz, 1H), 7.34 - 7.06 (m, 2H), 7.09 (s, 1H), 7.00 (d, J = 15.7 Hz, 1H), 6.51 (d, J = 8.7 Hz, 1H), 3.56 (t, JHH = 7.6 Hz, 2H), 3.08 (s, 6H), 1.66 (m, 2H), 2.38 (s, 3H), 0.95 (t, J = 7.6 Hz, 3H). MS(ESI): m / z Calcd. For C 22 H 24 FN 4 O 379.2; found 379.2, [M + H] + 。

[0131] Compound IV - 24

[0132]

Chem.

[0133] Synthesis was carried out according to the procedure for Compound IV-7 (0.152 g, 72%). 1 H NMR (400 MHz, CD 3 OD) δ = 8.02 (d, J = 2.4 Hz, 1H), 7.95 (m, 2H), 7.68 - 7.50 (m, 1H), 7.44 (dd, J = 8.7 Hz, J = 2.4 Hz, 1H), 7.34 - 7.06 (m, 2H), 7.09 (s, 1H), 7.00 (d, J = 15.7 Hz, 1H), 6.51 (d, J = 8.7 Hz, 1H), 3.56 (t, JHH = 7.6 Hz, 2H), 3.08 (s, 6H), 1.66 (m, 2H), 2.38 (s, 3H), 0.95 (t, J = 7.6 Hz, 3H). HR-MS (ESI): m / z Calcd. For C 22 H 24 FN 4 S 395.1706; found 395.1705, [M + H] + 。

[0134] Example 25: Compound 17

[0135]

化

[0136] Synthesis was carried out according to the procedure for Compound 5 (0.892 g, 80%). 1 H NMR (400 MHz, CD 3 OD) δ 8.41 (d, J = 1.5 Hz, 1H), 7.97 (d, J = 1.5 Hz, 1H), 7.31 (s, 1H), 5.86 (s, 1H), 3.46 (t, J = 6.6 Hz, 4H), 3.15 (s, 3H), 2.32 (s, 3H), 1.61 (m, 4H), 1.32 (m, 12H), 0.89 (t, 6H). MS (ESI): m / z Calcd. For C 22 H 36 N 5 O 386.3; found 386.3, [M + H] + 。

[0137] Compound IV-25

[0138] [Chemistry]

[0139] Synthesis was carried out according to the procedure for Compound IV-1 (0.452 g, 34%). 1 H NMR (400 MHz, CD 3 OD) δ 8.41 (d, J = 1.5 Hz, 1H), 7.97 (d, J = 1.5 Hz, 1H), 7.85 (d, J = 15.7 Hz, 1H), 7.49 (m, 1H), 7.40 - 7.22 (m, 3H), 7.31 (s, 1H), 7.01 (d, J = 15.7 Hz, 1H), 5.86 (s, 1H), 3.46 (t, J = 6.6 Hz, 4H), 3.15 (s, 3H), 2.32 (s, 3H), 1.61 (m, 4H), 1.32 (m, 12H), 0.89 (t, 6H). MS (ESI): m / z Calcd. For C 29 H 39 ClN 5 O 508.2843; found 508.2842, [M + H] + .

[0140] Example 26: Compound 18

[0141]

化

[0142] Synthesis was carried out according to the procedure for Compound 5 (0.812 g, 81%). 1 H NMR (400 MHz, CDCl 3 ) δ 7.93 (s, 2H), 7.31 (s, 1H), 4.24 (t, J = 6.8 Hz, 2H), 3.44 (s, 3H), 2.82 (s, 2H), 2.43 (s, 3H). MS (ESI): m / z Calcd. For C 14 H 17 N 6 O 285.1; found 285.1, [M + H] + .

[0143] Compound IV-25

[0144]

Chem.

[0145] According to the synthesis procedure of Compound IV-1 (0.312 g, 26%). 1 1H NMR (400 MHz, CDCl 3 ) δ = 8.02 (d, J = 15.7 Hz, 1H), 7.93 (m, 3H), 7.68 - 7.50 (m, 1H), 7.31 (s, 1H), 7.24 - 7.06 (m, 2H), 7.01 (d, J = 15.7 Hz, 1H), 4.24 (t, J = 6.8 Hz, 2H), 3.44 (s, 3H), 2.82 (s, 2H), 2.43 (s, 3H). MS (ESI): m / z Calcd. For C 21 1 20 H 6 19N + O 499.0743; found 499.0742, [M + H]

[0146] Example 27: Compound 19

[0147]

Chem.

[0148] According to the synthesis procedure of Compound 5 (0.932 g, 85%). 1 1H NMR (400 MHz, CDCl 3 ) δ = 7.59 (s, 2H), 6.71 (s, 1H), 3.24 (t, J = 5.6 Hz, 4H), 3.06 (t, J = 8.4 Hz, 2H), 2.67 (t, J = 6.2 Hz, 4H), 2.29 (s, 3H), 1.86 - 1.82 (m, 4H), 1.46 (m, 2H), 1.21 (t, J = 8.4 Hz, 3H). MS (ESI): m / z Calcd. For C 20 1 25 H 3 16N + O 323.2; found 324.2, [M + H]

[0149] Compound IV-27

[0150]

Chem.

[0151] Synthesized according to the synthetic procedure of Compound 5 (0.932 g, 85%). 1 H NMR (400 MHz, CDCl 3 ) δ = 8.31 (dd, J = 8.3 Hz, J = 2.1 Hz, 1H), 8.16 (s, 1H), 7.94 (d, J = 8.3 Hz, 1H), 7.95 (d, J = 15.7 Hz, 1H), 7.59 (s, 2H), 7.01 (d, J = 15.7 Hz, 1H), 6.71 (s, 1H), 3.24 (t, J = 5.6 Hz, 4H), 3.06 (t, J = 8.4 Hz, 2H), 2.67 (t, J = 6.2 Hz, 4H), 2.29 (s, 3H), 1.86 - 1.82 (m, 4H), 1.46 (m, 2H), 1.21 (s, J = 8.4 Hz, 3H). MS (ESI): m / z Calcd. For C 28 H 28 N 4 O 2 436.2263; found 437.2340, [M + H] + 。

[0152] Example 28: Compound 20

[0153]

Chem.

[0154] Compound IV-21 (0.792 g, 2.0 mmol), p-toluenesulfonyl chloride (0.476 g, 2.5 mmol), and triethylamine (0.303 g, 3.0 mmol) were placed in a 250 ml round flask, dissolved in 100 ml dry dichloromethane, stirred at room temperature under Ar protection conditions, and measured by TLC. After the reaction was completed, the system was poured into 200 ml water and extracted three times with dichloromethane. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the solvent was removed under reduced pressure. The residue was separated by column chromatography to obtain compound 27 (0.822 g, 76%). 1 H-NMR (400MHz, DMSO-d 6 ):δ8.18(d,J=8.5Hz,2H),8.08-8.02(m,2H),7.98-7.90(m,3H),7.40(d,J=15.9Hz,1H),7.18(d,J=8.2Hz,2H),7.00(s,1H),6.86-6 .72(m,2H),6.47(d,J=8.2Hz,2H),4.06(t,J=6.1Hz,2H),3.49(t,J=6.1Hz,2H),3.28(s,3H),2.77(s,3H),2.31(s,3H).MS(ESI):m / z Calcd.For C 30 H 29 N 4 O 4 S 541.2; found 541.2, [M+H] + .

[0155] Compound IV-28

[0156] [ka]

[0157] Compound 20 (0.541 g, 1.0 mmol) and sodium sulfite (0.630 g, 5.0 mmol) were placed in a 100 ml round flask, 20 ml of anhydrous DMF was added, and the mixture was heated in an oil bath at 50°C for 24 hours under Ar protection conditions, and the reaction was measured by TLC. After the reaction was completed, the solvent was removed under reduced pressure, and the residue was separated by reverse phase chromatography to obtain the product (0.301 g, 60%). 1H-NMR (400MHz, DMSO-d 6 ):δ8.18(d,J=8.5Hz,2H),8.08-8.02(m,2H),7.98-7.90(m,3H),7.40(d,J=15.9Hz,1H),7.00(s,1H),6.86-6.72(m, 2H),3.85(m,4H),3.60(t,J=5.9Hz,2H),3.52(t,J=5.6Hz,2H),3.28(s,3H),3.16(m,4H),2.77(s,3H).MS(ESI):m / z Calcd.For C 23 H 21 N 4 O 4 S 499.1289;found 499.1288,[MH] - .

[0158] Example 29: Compound IV-29

[0159] [ka]

[0160] Compound IV-21 (0.386 g, 1.0 mmol), compound 31 (0.265 g, 1.2 mmol), EDCI (0.382 g, 2.0 mmol), and DMAP (0.183 g, 1.5 mmol) were placed in a 100 ml round flask, dissolved in 30 ml of anhydrous DMF, stirred at room temperature under Ar protection conditions, and measured by TLC. After the reaction was completed, the solvent was removed under reduced pressure, and the residue was separated by column chromatography to obtain the product (0.490 g, 83%). 1 H-NMR (400MHz, DMSO-d 6): δ8.18(d,J=8.5Hz,2H),8.08-8.02(m,2H),7.98-7.90(m,3H),7.40(d,J=15.9Hz,1H),7.00(s,1H),6.86-6.72(m,2H),4.17( s,2H),3.75(s,3H),3.6-3.7(m,10H),3.57(m,2H),3.52(t,J=5.6Hz,2H),3.38(s,3H),3.28(s,3H),3.06(s,3H).MS(ESI):m / z Calcd.For C 32 H 39 N 4 O 7 S 591.2819;found 591.2820,[M+H] + .

[0161] Example 30: Compound 22

[0162]

change

[0163] The synthesis method of compound 5 was smooth (0.612g, 87%). 1 H NMR (400 MHz, CDCl 3 ) δ 8.15(d,J=9.0Hz,2H),8.14(d,J=9.0Hz,2H),7.21(s,1H),4.23(s,2H),4.11(s,3H), 3.38(t,J=6.4Hz,2H),3.01(s,3H),2.92(t,J=6.4Hz,2H),2.41(s,3H).MS(ESI):m / z Calcd.For C 18 H 25 N 4 O 3 345.2;found 345.2,[M+H] + .

[0164] Compound IV-30

[0165]

change

[0166] Synthesized according to the procedure for Compound IV-1 (0.422 g, 36%). 1 H NMR (400 MHz, CDCl 3 ) δ 8.15 (d, J = 9.0 Hz, 2H), 8.14 (d, J = 9.0 Hz, 2H), 7.95 (d, J = 16.0 Hz, 1H), 7.82 (d, J = 8.4 Hz, 2H), 7.32 (d, J = 8.4 Hz, 2H), 7.21 (s, 1H), 7.01 (d, J = 16.0 Hz, 1H), 4.23 (s, 2H), 4.11 (s, 3H), 3.38 (t, J = 6.4 Hz, 2H), 3.01 (s, 3H), 2.92 (t, J = 6.4 Hz, 2H). MS (ESI): m / z Calcd. For C 25 H 28 BrN 4 O 3 511.1345; found 511.1344, [M + H] + 。

[0167] Example 31: Compound 23

[0168]

Chemical Structure

[0169] Synthesized according to the procedure for Compound 23 (0.912 g, 89%). 1 H-NMR (400 MHz, DMSO-d 6 ): δ 8.17 (d, J = 8.6 Hz, 2H), 7.91 (d, J = 15.8 Hz, 1H), 7.79 (dt, J = 10.6, 2.1 Hz, 1H), 7.66 (d, J = 7.8 Hz, 1H), 7.50 (td, J = 8.0, 6.2 Hz, 1H), 7.34 - 7.20 (m, 2H), 7.18 (d, J = 8.2 Hz, 2H), 6.97 (s, 1H), 6.84 - 6.73 (m, 2H), 6.47 (d, J = 8.2 Hz, 2H), 4.06 (t, J = 6.1 Hz, 2H), 3.49 (t, J = 6.1 Hz, 2H), 3.27 (s, 3H), 3.06 (s, 3H), 2.77 (s, 3H), 2.31 (s, 3H). MS (ESI): m / z Calcd. For C 29 H29 FN 3 O 4 S 534.2; found 534.2, [M+H] + .

[0170] Compound IV-31

[0171] [ka]

[0172] Compound 23 (0.534g, 1.0mmol) was placed in a 100ml round flask, dissolved by adding 35ml DMF, carefully added NaN3 (0.195g, 3.0mmol), heated overnight in an oil bath at 50℃ under Ar protection, cooled to room temperature the next day, poured into 100ml water, extracted with DCM three times, combined organic phase, washed twice with saturated saline, combined organic phase, dried over anhydrous sodium sulfate, filtered, and removed the solvent under reduced pressure. The residue did not need to be purified and was used directly in the next reaction.

[0173] The residue was dissolved in 30 ml THF and 3 P (0.524 g, 2.0 mmol) and 2 ml of water were added, and the mixture was stirred overnight at room temperature under Ar protection. The next day, the solvent was removed under pressure, and the residue was separated by column chromatography to obtain the desired product (0.301 g, 79%). 1 H-NMR (400MHz, DMSO-d 6 ):δ8.17(d,J=8.6Hz,2H),7.91(d,J=15.8Hz,1H),7.79(dt,J=10.6,2.1Hz,1H),7.66(d,J=7.8Hz,1H),7.50(td,J=8.0,6.2Hz,1H),7. 34-7.20(m,2H),6.97(s,1H),6.84-6.73(m,2H),3.38(t,J=6.4Hz,2H),2.92(t,J=6.4Hz,2H),3.27(s,3H),3.06(s,3H).MS(ESI):m / z Calcd.For C 22 H 24 FN 4O 379.1934;found 379.1935,[M+H] + .

[0174] Example 32: Compound IV-32

[0175] [ka]

[0176] Compound 24 (0.534 g, 1.0 mmol) was placed in a 100 ml round flask, dissolved in 50 ml of ethanol, and then 33% dimethylamine solution was added. The mixture was heated to reflux in an oil bath at 90° C. under Ar protection conditions and measured by TLC. After the reaction was completed, the system was returned to room temperature, the solvent was removed under reduced pressure, and the residue was separated by column chromatography to obtain the desired product (0.276 g, 68%). 1 H-NMR (400MHz, DMSO-d 6 ):δ8.17(d,J=8.6Hz,2H),7.91(d,J=15.8Hz,1H),7.79(dt,J=10.6,2.1Hz,1H),7.66(d,J=7.8Hz,1H),7.50(td,J=8.0,6.2Hz,1H),7. 34-7.20(m,2H),6.97(s,1H),6.84-6.73(m,2H),3.47(t,J=7.6Hz,2H),2.96(s,3H),2.49(t,J=7.6Hz,2H),2.31(s,6H).MS(ESI):m / z Calcd.For C 24 H 28 FN 4 O 407.2247;found 407.2246,[M+H] + .

[0177] Example 33: compound 25

[0178] [ka]

[0179] Synthesis was carried out according to the procedure for Compound 5 (0.842 g, 89%). 1 H NMR (400 MHz, CDCl 3 ) δ = 7.97 (d, J = 8.6 Hz, 1H), 7.88 (s, 1H), 6.85 (s, 1H), 6.56 (d, J = 8.6 Hz, 1H), 5.40 (s, 1H), 3.07 (s, 3H), 2.84 (s, 3H), 2.31 (s, 3H), 1.94 (s, 3H), 1.32 (s, 6H). MS (ESI): m / z Calcd. For C 19 H 24 N 3 O 310.2; found 310.2, [M + H] + 。 Compound IV-33

[0180]

Chem.

[0181] Synthesis was carried out according to the procedure for Compound IV-1 (0.222 g, 21%). 1 H NMR (400 MHz, CDCl 3 ) δ = 7.97 (d, J = 8.6 Hz, 1H), 7.90 (d, J = 16.0 Hz, 1H), 7.88 (s, 1H), 7.87 (d, J = 4.0 Hz, 2H), 7.43 (d, J = 4.0 Hz, 2H), 7.01 (d, J = 16.0 Hz, 1H), 6.85 (s, 1H), 6.56 (d, J = 8.6 Hz, 1H), 5.40 (s, 1H), 3.07 (s, 3H), 2.84 (s, 3H), 1.94 (s, 3H), 1.32 (s, 6H). MS (ESI): m / z Calcd. For C 27 H 26 N 4 O 422.2107; found 423.2186, [M + H] + 。

[0182] Example 34: Compound 26

[0183]

Chem.

[0184] Synthesized according to the procedure for Compound 5 (0.732 g, 81%). 1 H NMR (400 MHz, CDCl 3 ) δ = 7.40 (dd, J = 8.32, 1.93 Hz, 1H), 7.29 (d, J = 1.89 Hz, 1H), 7.15 (s, 1H), 6.68 (d, J = 8.35 Hz, 1H), 4.23 - 4.31 (m, 2H), 3.40 - 3.49 (m, 2H), 3.21 (s, 3H), 3.03 (s, 3H), 2.42 (s, 3H). MS (ESI): m / z Calcd. For C 15 H 18 N 3 O 2 227.1; found 227.1, [M + H] + 。

[0185] Compound IV - 34

[0186]

Chem.

[0187] Synthesized according to the procedure for Compound IV - 1 (0.222 g, 21%). 1 H NMR (400 MHz, CDCl 3 ) δ = 7.95 (d, J = 16.0 Hz, 1H), 7.87 (d, J = 4.0 Hz, 2H), 7.43 (d, J = 4.0 Hz, 2H), 7.40 (dd, J = 8.32, 1.93 Hz, 1H), 7.29 (d, J = 1.89 Hz, 1H), 7.15 (s, 1H), 7.01 (d, J = 16.0 Hz, 1H), 6.68 (d, J = 8.35 Hz, 1H), 4.23 - 4.31 (m, 2H), 3.40 - 3.49 (m, 2H), 3.03 (s, 3H), 2.42 (s, 3H). MS (ESI): m / z Calcd. For C 22 H 20 FN 3 O 2 377.1540; found 378.1681, [M + H] + 。

[0188] Example 35: compound 28

[0189] [ka]

[0190] The procedure for the synthesis of compound IV-1 was followed (0.732 g, 39%). 1 H NMR (400 MHz, CDCl 3 ) δ 8.19(d,J=8.5Hz,2H),8.07(m,4H),8.04(s,1H),7.94(d,J=8.3Hz,2H),7.44(d,J=15.9Hz,1H),7.03(s,1H),3.29(s,3H)..MS(ESI):m / z Calcd.For C 20 H 15 N 4 O 3 359.1;found 359.1,[M+H] + .

[0191] Compound IV-35

[0192] [ka]

[0193] Compound 28 (0.718g, 2.0mmol) and stannous chloride (0.758g, 4.0mmol) were placed in a 250ml round flask, dissolved in 100ml of ethyl acetate, stirred at room temperature under Ar protection, and measured by TLC. After the reaction was completed, the system was poured into 150ml of water and extracted three times with ethyl acetate. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the solvent was removed under reduced pressure. The residue was separated and purified by column chromatography to obtain the desired product (0.586g, 89%). 1 H NMR (400 MHz, CDCl 3) δ 8.19 (d, J = 8.5 Hz, 2H), 7.97 (m, 4H), 8.04 (s, 1H), 7.94 (d, J = 8.3 Hz, 2H), 7.44 (d, J = 15.9 Hz, 1H), 7.03 (s, 1H), 3.29 (s, 3H). MS(ESI): m / z Calcd. For C 20 H 17 N 4 O 329.1402; found 329.1403, [M + H] + 。

[0194] Example 36: Compound 29

[0195]

Chem.

[0196] Synthesized according to the procedure for Compound 5 (0.756 g, 74%). 1 H NMR (400 MHz, CDCl 3 ) δ 8.15 (1H, s), 7.81 (2H, m), 7.65 (1H, d, J = 9.0 Hz), 7.16 (1H, dd, J = 9.0, J = 3.0 Hz), 6.95 (s, 1H), 6.88 (1H, d, J = 3.0 Hz), 3.60 (t, J = 5.9 Hz, 2H), 3.52 (t, J = 5.9 Hz, 2H), 3.28 (s, 3H), 3.06 (s, 3H). MS(ESI): m / z Calcd. For C 19 H 21 N 3 O 2 323.2; found 324.2, [M + H] + 。 Compound IV - 36

[0197]

Chem.

[0198] Synthesized according to the procedure for Compound IV - 1 (0.272 g, 24%). 1 H NMR (400 MHz, CDCl 3) δ 8.15(1H,s),7.81(2H,m),7.65(1H,d,J=9.0Hz),7.49(m,1H),7.40-7.22(m,3H),7.16(1H,dd,J=9.0,J=3.0Hz),6.9 5(s,1H),6.88(1H,d,J=3.0Hz),3.60(t,J=5.9Hz,2H),3.52(t,J=5.9Hz,2H),3.28(s,3H),3.06(s,3H).MS(ESI):m / z Calcd.For C 26 H 25 N 3 O 3 427.1896;found 428.1974,[M+H] + .

[0199] Example 37: Compound IV-37

[0200]

change

[0201] The synthesis method of compound 13 was smooth (0.322g, 79%). 1 H-NMR (400 MHz, DMSO-d 6 ): δ8.16(d,J=8.5Hz,2H),7.93(t,J=4.4Hz,2H),7.90(d,J=6.1Hz,1H),7.31(t,J=8.9Hz,2H),7.18(d,J=15.9Hz,1H),6.95( s,1H),6.83-6.72(m,2H),4.21(s,2H),3.59(t,J=5.9Hz,2H),3.51(t,J=5.9Hz,2H),3.27(s,3H),3.05(s,3H).MS(ESI):m / z Calcd.For C 25 H 25 FN 3 O 2 418.1931; found 418.1932, [M+H] + .

[0202] Example 38: Compound 30

[0203] [Chemistry]

[0204] Synthesized according to the procedure for Compound 5 (0.816 g, 89%). 1 H NMR (400 MHz, CDCl 3 ) δ 9.02 (d, 1H, J = 2.1 Hz), 8.59 (d, 1H, J = 2.1 Hz), 7.93 (d, 1H, J = 9.1 Hz), 7.34 (dd, 1H, J = 9.1, 2.5 Hz), 7.21 (s, 1H), 7.00 (d, 1H, J = 2.5 Hz), 3.11 (s, 6H), 3.06 (s, 3H). MS (ESI): m / z Calcd. For C1 7 H 18 N 4 O 294.1; found 295.1, [M + H] + .

[0205] Compound IV-38

[0206] [Chemistry]

[0207] Synthesized according to the procedure for Compound IV-1 (0.272 g, 24%). 1 H NMR (400 MHz, CDCl 3 ) δ = 9.02 (d, 1H, J = 2.1 Hz), 8.59 (d, 1H, J = 2.1 Hz), 7.95 (d, J = 16.0 Hz, 1H), 7.93 (d, 1H, J = 9.1 Hz), 7.49 (m, 1H), 7.40 - 7.22 (m, 3H), 7.34 (dd, 1H, J = 9.1, 2.5 Hz), 7.21 (s, 1H), 7.15 (d, J = 16.0 Hz, 1H), 7.00 (d, 1H, J = 2.5 Hz), 3.11 (s, 6H), 3.06 (s, 3H). MS (ESI): m / z Calcd. For C 25 H 21 N 5 O 407.1821; found 408.1825, [M + H] + .

[0208] Comparative Example 1: Compound IV-39

[0209]

Chem.

[0210] It was carried out according to the synthesis procedure of Compound IV-1 (0.275 g, 75%). 1 H NMR (400 MHz, DMSO-d 6 ) δ 11.00 (s, 1H), 8.08 - 8.04 (m, 2H), 8.02 (d, J = 15.9 Hz, 1H), 7.92 - 7.87 (m, 2H), 7.49 - 7.45 (m, 2H), 7.26 (d, J = 15.9 Hz, 1H), 6.98 (s, 1H), 3.29 (s, 3H). MS (ESI): m / z Calcd. For C 19 H 13 F 2 N 3 O 2 339.0951; found 339.0950, [M - H] - .

[0211] Comparative Example 2: Compound IV-40

[0212]

Chem.

[0213] It was carried out according to the synthesis procedure of Compound IV-1 (0.327 g, 55%). 1 H NMR (400 MHz, DMSO-d 6 ) δ 9.70 (s, 1H), 8.05 (d, J = 8.9 Hz, 2H), 7.98 - 7.89 (m, 1H), 7.30 (t, J = 6.2 Hz, 1H), 7.26 (d, J = 8.9 Hz, 1H), 7.15 (d, J = 15.8 Hz, 1H), 6.97 (s, 1H), 6.87 (d, J = 7.5 Hz, 1H), 3.27 (s, 3H). MS (ESI): m / z Calcd. For C 18 H 12 F 2 N3 O 2 340.0903; found 340.090, [M-H] - 。

[0214] Comparative Example 3: Compound IV-41

[0215]

Chem.

[0216] The synthesis procedure of Compound IV-1 was followed (0.342 g, 46%). 1 H-NMR (400 MHz, DMSO-d 6 ): δ = 8.21 (d, 2H, J = 8.8 Hz), 8.00 (d, 1H, J = 16 Hz), 7.85 (d, 2H, J = 8.0 Hz), 7.50 - 7.43 (m, 2H), 7.42 (d, J = 2.6 Hz, 1H), 7.24 (s, 1H), 7.01 (s, 1H), 6.92 (d, 2H, J = 8.8 Hz), 3.85 (t, 2H, J = 5.6 Hz), 3.60 (t, 2H, J = 5.6 Hz), 3.10 (s, 3H). MS (ESI): m / z Calcd. For C 22 H 24 N 3 O 2 362.1869; found 362.1868, [M+H] + 。

[0217] Comparative Example 4: Compound IV-42

[0218]

Chem.

[0219] The synthesis procedure of Compound IV-1 was followed (0.312 g, 43%). 1 H NMR (400 MHz, CDCl 3) δ = 8.15 (1H, s), 8.00 (d, 1H, J = 16 Hz), 7.85 (d, 2H, J = 8.0 Hz), 7.81 (2H, m), 7.65 (1H, d, J = 9.0 Hz), 7.20 (s, 1H), 7.50 - 7.43 (m, 3H), 7.42 (d, 1H, J = 16 Hz), 7.16 (1H, dd, J = 9.0, J = 3.0 Hz), 6.88 (1H, d, J = 3.0 Hz), 3.65 (t, J = 7.2 Hz, 2H), 3.45 (t, J = 7.2 Hz, 2H), 3.35 (s, 3H) 3.03 (s, 3H). MS(ESI): m / z Calcd. For C 26 H 26 N 3 O 2 412.2025; found 412.2026, [M + H] + 。

[0220] Comparative Example 5: Compound IV - 43

[0221]

Chem.

[0222] Synthesized according to the procedure of Compound IV - 1 (0.412 g, 46%). 1 H - NMR (400 MHz, DMSO - d 6 ): δ = 8.72 (s, 2H), 8.00 (d, 1H, J = 16 Hz), 7.50 - 7.43 (m, 2H), 7.42 (d, J = 2.6 Hz, 1H), 7.24 (s, 1H), 7.01 (s, 1H), 6.92 (d, 2H, J = 8.8 Hz), 3.75 (t, J = 6.8 Hz, 2H), 3.60 (t, 2H, J = 6.8 Hz), 3.05 (s, 3H). MS(ESI): m / z Calcd. For C 21 H 21 lN 6 O 373.1777; found 373.1778, [M + H] + 。

[0223] Comparative Example 6

[0224]

Chem.

[0225] Synthesized according to the synthesis procedure of Compound IV-1 (0.192 g, 33%). 1 H NMR (400 MHz, DMSO-d 6 ) δ 7.96 - 7.99 (m, 4H), 7.33 - 7.37 (m, 3H), 6.98 (s, 1H), 3.24 (s, 3H). MS (ESI): m / z Calcd. For C 19 H 12 F 4 N 2 O 2 376.0835; found 376.0830, [M - H] - .

[0226] Comparative Example 7

[0227]

Chemical Structure

[0228] Synthesized according to the synthesis procedure of Compound IV-1 (0.192 g, 33%). 1 H NMR (400 MHz, DMSO-d 6 ) δ 7.96 - 7.99 (m, 4H), 7.33 - 7.37 (m, 3H), 6.98 (s, 1H), 3.24 (s, 3H). MS (ESI): m / z Calcd. For C 19 H 12 F 4 N 2 O 2 376.0835; found 376.0830, [M - H] - .

[0229] Comparative Example 8

[0230]

Chemical Structure

[0231] Synthesized according to the synthesis procedure of Compound IV-1. 11H NMR (400 MHz, DMSO-d 6 ) δ ppm 10.70 (s, 1H), 8.35 (s, 2H), 8.15 (s, 2H), 7.82 (d, J = 15.8 Hz, 1H), 7.22 (d, J = 15.9 Hz, 1H), 6.95 (s, 1H), 3.27 (s, 3H); HRMS (ESI) m / z: 546.8647 found (calcd for C 19 H 12 Br 2 Cl 2 N 2 O 3 , [M + H] + 546.8644).

[0232] Comparative Example 9

[0233]

Chemical Structure

[0234] The synthesis procedure of Compound IV-1 was followed. 1 1H NMR (400 MHz, DMSO-d 6 ) δ ppm 10.38 (s, 1H), 8.18 (d, J = 2.0 Hz, 2H), 8.12 (s, 2H), 7.81 (d, J = 4.8 Hz, 1H), 7.18 (d, J = 4.8 Hz, 1H), 6.93 (s, 1H), 6.78 (d, J = 2.0 Hz, 2H), 3.25 (s, 3H), 3.04 (s, 6H); HRMS (ESI) m / z: 505.9855 found (calcd for C 21 H 19 Br 2 N 3 O 2 , [M + H] + 505.9896). Comparative Example 10

[0235]

Chemical Structure

[0236] The synthesis procedure of Compound IV-1 was followed. 11H NMR (400 MHz, DMSO-d 6 ) δ ppm 10.38 (s, 1H), 8.16 (d, J = 2.0 Hz, 2H), 8.11 (s, 2H), 7.80 (d, J = 4.8 Hz, 1H), 7.18 (d, J = 4.8 Hz, 1H), 6.91 (s, 1H), 6.74 (d, J = 2.0 Hz, 2H), 3.44 (d, J = 4.8 Hz, 2H), 3.25 (s, 3H), 1.14 (t, J = 4.8 Hz, 6H); HRMS (ESI) m / z: 534.0154 found (calcd for C 23 H 23 Br 2 N 3 O 2 , [M + H] + 534.0209).

[0237] Comparative Example 11

[0238]

Chemical Structure

[0239] Synthesized according to the procedure of Compound IV-1 (0.156 g, 18%). 1 1H NMR (400 MHz, CD 3 OD) δ 10.52 (s, 1H), 8.07 - 8.01 (m, 2H), 7.95 (d, J = 15.7 Hz, 1H), 7.76 (d, J = 8.5 Hz, 2H), 7.01 (d, J = 15.7 Hz, 1H), 6.95 (s, 1H), 6.87 - 6.83 (m, 2H), 4.12 (s, 3H), 3.62 (s, 3H), 1.50 (s, 9H). HR-MS (ESI): m / z Calcd. For C 24 H 21 F 3 N 2 O 4 457.5381; found 457.5380, [M - H] - .

[0240] Comparative Example 12

[0241]

Chemical Structure

[0242] It was synthesized according to the method disclosed in the literature (JACS, 2018, 140, 7381-7384.). 1 H NMR (400MHz, CD 3 OD) δ 8.17(d,J=8.3Hz,2H),7.79(d,J=15.6Hz,1H),7.55(d,J=8.8Hz,2H),6.84(s,1H),6.80(dd,J=9.9,2. 8Hz,2H),6.75(dd,J=8.8,5.6Hz,2H),6.66(d,J=15.6Hz,1H),4.82(s,2H),4.38(s,2H),3.59-3.43(m 8H),3.41-3.35(m,2H),3.20-3.13(m,2H),3.04(s,6H),2.12-1.17(m,18H).HR-MS(ESI):m / z Calcd.For C 37 H 44 ClF 3 N 4 O 6 732.2901;found 733.2980,[MH] - .

[0243] Comparative Example 13

[0244] [ka]

[0245] It was synthesized according to the method disclosed in the literature (JACS, 2018, 140, 7381-7384.). 1 H NMR (400MHz, CD 3OD) δ 8.17(d,J=8.3Hz,2H),7.79(d,J=15.6Hz,1H),7.55(d,J=8.8Hz,2H),6.84(s,1H),6.80(dd,J=9.9,2. 8Hz,2H),6.75(dd,J=8.8,5.6Hz,2H),6.66(d,J=15.6Hz,1H),4.82(s,2H),4.38(s,2H),3.59-3.43(m 8H),3.41-3.35(m,2H),3.20-3.13(m,2H),3.04(s,6H),2.12-1.17(m,18H).HR-MS(ESI):m / z Calcd.For C 38 H 44 ClF 3 N 5 O 6 739.2948;found 740.3026,[M+H] - .

[0246] Test example 1: Each of the fluorescent dyes IV-1 to IV-38 (molecular rotors) prepared in Examples 1 to 38 was dissolved in dimethyl sulfoxide to a concentration of 1×10 -2 Each mother liquor was added to glycerin and methanol, respectively, and mixed uniformly to give a final concentration of 1 × 10 -5 The fluorescent dyes were then sequentially measured under the same conditions using the maximum excitation wavelength of each dye, and the results are shown in Table 1, which indicates that the fluorescent dyes of the present invention are sensitive to viscosity changes.

[0247] [Table 1]

[0248] Test example 2: Molecular rotors IV-1, IV-2, IV-3, IV-4, IV-5, IV-6, IV-17, IV-18, IV-19, IV-20, IV-21, and IV-22 were added to the diethylene glycol-glycerin mixture to a final concentration of 1 × 10 -5A solution of M was prepared and excited at 480 nm. The fluorescence emission spectra under different viscosity conditions are shown in Figures 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12. The fluorescence intensity of the molecular rotor at the same concentration under different viscosity conditions gradually increases, which shows that the fluorescence intensity of the molecular rotor increases with the increase in the environmental viscosity, proving that the molecular rotor is sensitive to viscosity response and is a kind of molecular rotor.

[0249] Test example 3: Molecular rotors IV-39, IV-40, IV-44 and IV-1, IV-2, IV-3, IV-4, IV-5, IV-6, IV-7, IV-8, IV-41, IV-43 and IV-17, IV-18, IV-19, IV-20, IV-21, IV-22, IV-42 and IV-36, IV-45, IV-46 and IV-3, IV-47, IV-48 and IV-20, IV-49, IV-50 and IV-5, and IV-51 and IV-1 were dissolved in DMSO and concentrated to 1 × 10 -3 Prepare the mother solution of M by adding each of the above mother solutions to PBS solution to obtain a final concentration of 1 x 10. -6 A solution of M was prepared, and each compound was excited using the maximum excitation wavelength, respectively, and the fluorescence intensity in PBS was measured. The strongest fluorescence of each set was set as 100 to normalize each sample, and the results are shown in Figures 13, 14, 15, 16, 17, 18, and 19, respectively. The results in Figures 13, 14, and 15 show that the molecular rotors having hydroxyl, cyano, fluorine, chlorine, bromine, and iodine atom substitutions in the aromatic ring on the electron-withdrawing group of the present invention have lower background fluorescence than the molecular rotors having no substitutions in the aromatic ring on the electron-withdrawing group. The results in Figures 16 and 17 show that the molecular rotors having a single substitution have lower background fluorescence than the molecular rotors having multiple substitutions in the aromatic ring on the electron-withdrawing group, which is believed to be because the multiple substitutions change the electron cloud distribution of the aromatic structure on the electron-withdrawing group, thereby improving the fluorescence background. The results in Figures 18 and 19 show that the molecular rotors having a single substitution have lower background fluorescence than the molecular rotors having multiple substitutions in the aromatic ring on the electron-withdrawing group. 1 The background fluorescence was lower when the site was a simple alkyl group, because R1 It is considered that the fluorescence background of the compound is improved by restricting the behavior of the double bond at the site that does not consume radiation energy, such as rotation, due to the relatively large volume of the compound or the weak interaction between a heteroatom (e.g., oxygen atom, nitrogen atom) on the modified alkyl group and an aromatic ring on the electron-withdrawing group.

[0250] Test example 4: Compounds IV-1, IV-2, IV-3, IV-4, IV-5, IV-6, IV-17, IV-18, IV-19, IV-20, IV-21, and IV-22 specifically bound to the RNA aptamer (UUGCCAUGUGUAUGUGGGAGGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGCCGGAAGAUUGUAAACACGCCGAAAGGCGGACACUUCCGGCGGCACUUCCGGCGGACCUUCCGGCGGACCUUCCUCCCACAUACUCUGAUGAUCCUUCGGGAUCAUUCAUGGCAA), and the compound fluorescence after binding was significantly activated, emitting bright fluorescence when excited by excitation light of an appropriate wavelength. The optical properties after binding are shown in Table 2. The compounds were also able to bind to the aptamer inside cells, and cells expressing the RNA aptamer had bright fluorescence, as shown in Figure 20A, while cells not expressing the RNA aptamer had no fluorescence, as shown in Figure 20B, demonstrating the use of this series of dyes to label nucleic acids.

[0251] [Table 2]

[0252] NOTE: Fluorescence quantum yields were measured using the relative method, with rhodamine 6G as the reference (QY = 0.94).

[0253] Test Example 5:

Claims

1. A fluorescent dye of formula (I), 【Chemistry 1】 During the ceremony, Ar is an arylene group or a heteroarylene group, and D- is HO- or N(X １ ) (X ２ )-, and X １ , X ２ are each independently selected from hydrogen, an alkyl group, or a modified alkyl group; １ , X ２ may be bonded to each other to form an aliphatic heterocycle together with the N atom; X １ , X ２ may independently form an aliphatic heterocycle with Ar; When D- is HO-, at least one hydrogen atom in Ar is independently replaced with a halogen atom; Y is O or S; R １ is hydrogen or an alkyl group, R ２ is a halogen atom, —OH or —CN, However, the "alkyl group" is C １ -C １０ is a linear or branched alkyl group, The "modified alkyl group" is C １ -C １６ Any carbon atom of the linear or branched alkyl group may be a halogen atom, —OH, —CO—, —O—, —CN, —SO ３ H, R'NH ２ , R'NHR'', R'NR''R''', or the carbon-carbon single bonds may be independently replaced by carbon-carbon double bonds or carbon-carbon triple bonds; Said “C １ -C １６ Any carbon atom of the linear or branched alkyl group may be a halogen atom, —OH, —CO—, —O—, —CN, —SO ３ H, R'NH ２ "substituted with one or more groups selected from R'NHR", R'NR"R'" means that a carbon atom, or a carbon atom together with a hydrogen atom thereon, is replaced with a corresponding group; The "halogen atoms" are each independently F, Cl, Br or I. The "aliphatic heterocycle" is a saturated or unsaturated 4- to 15-membered monocyclic or polycyclic aliphatic heterocycle having one or more heteroatoms selected from N, O, S, and Si in the ring. When the aliphatic heterocycle has an S atom, it is -S-, -SO-, or -SO ２ -, wherein the aliphatic heterocycle may be substituted with a halogen atom, an alkyl group, an aryl group or a modified alkyl group, The "arylene group" is a 5- to 13-membered monocyclic, bicyclic, fused bicyclic, or fused polycyclic arylene group, The "heteroarylene group" is a 5- to 13-membered monocyclic, bicyclic, fused bicyclic, or fused polycyclic heteroarylene group having one or more heteroatoms selected from N, O, S, or Si in the ring, Each R' is independently a single bond or an alkylene group; Each R″ is independently a single bond, an alkyl group, or an alkylene group; each R''' is independently a single bond, an alkyl group, or an alkylene group; The "alkylene group" is １ -C １０ A fluorescent dye, which is a linear or branched alkylene group.

2. The "alkyl group" includes a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a t-butyl group, an s-butyl group, an n-pentyl group, a 1-methylbutyl group, a 2-methylbutyl group, a 3-methylbutyl group, an isoamyl group, a 1-ethylpropyl group, a neopentyl group, an n-hexyl group, a 1-methylpentyl group, a 2-methylpentyl group, a 3-methylpentyl group, an isohexyl group, a 1,1-dimethylbutyl group, and a 2,2-dimethylbutyl group.

2. The fluorescent dye according to claim 1, characterized in that the aryl group is selected from the group consisting of aryl, aryl, aryl and aryl groups.

3. The "alkylene group" is １ -C ７ 2. The fluorescent dye according to claim 1, which is a linear or branched alkylene group.

4. The "alkylene group" is １ -C ５ 2. The fluorescent dye according to claim 1, which is a linear or branched alkylene group.

5. 2. The fluorescent dye according to claim 1, wherein the "arylene group" is a 6- or 10-membered monocyclic, bicyclic, fused bicyclic, or fused polycyclic arylene group.

6. The fluorescent dye according to claim 1, characterized in that the "heteroarylene group" is a 6- or 10-membered monocyclic, bicyclic, fused bicyclic, or fused polycyclic heteroarylene group having one or more heteroatoms selected from N, O, S, or Si in the ring.

7. The "modified alkyl group" is -OH, -O-, -NH ２ , -CN, -O-CO-, -NH-CO-, -SO ２ -O-, -SO-, Me ２ N-, Et ２ 2. The fluorescent dye according to claim 1, which has one or more groups selected from the group consisting of N-, -CH=CH-, -C≡CH, F, Cl, Br, I and a cyano group.

8. The fluorescent dye according to any one of claims 1 to 7, wherein Ar has a structure selected from the following formulas (II-1) to (II-7). 【Chemistry 2】

9. 2. The fluorescent dye according to claim 1, wherein the compound represented by formula (I) is selected from the following compounds: 【Chemistry 3】

10. A method for producing the fluorescent dye according to any one of claims 1 to 9, comprising a step of carrying out an aldol condensation reaction between a compound of formula (a) and a compound of formula (b). 【Chemistry 4】

11. 10. A use of the fluorescent dye according to any one of claims 1 to 9 for viscosity measurement, fluorescent labeling of proteins, fluorescent labeling of nucleic acids, quantification or detection of proteins, or quantification or detection of nucleic acids, which is not for a method for diagnosing a disease.

12. 10. Use of the fluorescent dye according to any one of claims 1 to 9 for producing a reagent for viscosity measurement, fluorescent labeling of protein, fluorescent labeling of nucleic acid, quantification or detection of protein, or quantification or detection of nucleic acid.

13. A fluorescence activated emission probe comprising the fluorescent dye according to any one of claims 1 to 9.

14. 14. A use of the fluorescence activated generating probe according to claim 13 for fluorescent labeling of a protein, fluorescent labeling of a nucleic acid, quantification or detection of a protein, or quantification or detection of a nucleic acid, which is not for a method of diagnosing a disease.

15. Use of the fluorescence-activated generating probe according to claim 13 for producing a reagent for fluorescent labeling of protein, fluorescent labeling of nucleic acid, quantification or detection of protein, or quantification or detection of nucleic acid.

Images