RNA interference-inducing nucleic acids containing 8-oxoguanine, modified nucleic acids that bind to microRNAs containing 8-oxoguanine, and uses thereof

Abstract

In the present invention, at least one strand of the double strand of nucleic acid contains one or more 8-oxoguanines (o 8 and RNA interference-inducing nucleic acids containing 8-oxoguanine (oG) and 8-oxoguanine (oG) in the 1st to 9th nucleotides from the 5' end. 8 We have prepared modified nucleic acids that specifically bind to microRNAs modified with 8-oxoguanine (OG), and confirmed that when administered to cells or mice, they induce various pathophysiological phenomena. In addition, we have confirmed that oxidative stress induces the conversion of guanine (G) to 8-oxoguanine (OG) in the seed region of microRNAs. 8 The position where the G→T modification occurred was identified in the cDNA produced by reverse transcription of the microRNA in which oxidative modification to 8-oxoguanine had occurred, and the position where oxidative modification to 8-oxoguanine had occurred was confirmed.

Description

[Technical field]

[0001] The present invention relates to an RNA interference-inducing nucleic acid containing 8-oxoguanine, a modified nucleic acid that specifically binds to a microRNA containing 8-oxoguanine, and a pharmaceutical composition, a recombinant animal model, a drug screening method, a disease diagnosis method, and a method for regulating a pathophysiological phenomenon using the same. [Background technology]

[0002] When cells undergo pathophysiological changes, oxidative stress generally occurs, which generates reactive oxygen species (ROS). The generated reactive oxygen species have a high reactivity and modify various biological components, among which RNA is the most easily modified. In particular, the most frequently and easily oxidized RNA base is the guanine (G) base, which is oxidized to 8-oxoguanine (OG). 8 G).

[0003] Meanwhile, heart disease, including cancer, is one of the three leading causes of death among adults in the Republic of Korea. During the onset process, various pathological stresses cause changes in the size of heart tissue, inducing cardiac hypertrophy, which is characterized by an increase in the size of myocardial cells and an increase in the rate of protein synthesis. Cardiac hypertrophy gradually induces myocardial fibrosis and heart failure, and ultimately manifests as loss of cardiac function (or heart failure). In particular, in the case of heart failure, the mortality rate is extremely high at around 50%, so research is being conducted to ultimately prevent or develop a treatment for myocardial hypertrophy, and therefore it is necessary to construct a disease model for this purpose. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] Korean Patent No. 1481007 Summary of the Invention [Problem to be solved by the invention]

[0005] The present inventors have demonstrated that oxidative stress causes the guanine (G) base in the seed region of microRNA to be converted to 8-oxoguanine (8-oxoguanine). 8 G) undergoes oxidative modification, 8 It was confirmed that the target sequence was bound through the G:A configuration, and the position where the oxidative modification of 8-oxoguanine occurred was identified by identifying the position where the modification from G to T occurred in the cDNA produced by reverse transcription of the microRNA. Based on this, it was confirmed that guanine (G) was converted to 8-oxoguanine (o 8 G) and administering it to cells or mice, it was confirmed that various pathophysiological phenomena were induced, and the present invention was completed based on this.

[0006] Therefore, the present invention relates to at least one strand of a double strand of a nucleic acid that induces RNA interference, the single strand containing one or more 8-oxoguanines (8-oxoguanines; o-guanines) as the 1st to 9th nucleotides from the 5' end. 8 G).

[0007] In addition, in the present invention, 8-oxoguanine (o 8 G) position identification method.

[0008] In the present invention, one or more guanines (G) among the 1st to 9th nucleotides from the 5'-end are 8-oxoguanines (OG). 8 G), and a recombinant vector comprising a modified nucleic acid that specifically binds to a microRNA modified by said modified nucleic acid.

[0009] The present invention also provides a pharmaceutical composition for treating cardiac hypertrophy, which contains the modified nucleic acid or the recombinant vector, and a pharmaceutical composition for treating liver cancer or glioblastoma, which contains the RNA interference-inducing nucleic acid.

[0010] Other embodiments provide a pharmaceutical composition for preventing or treating cardiac hypertrophy, which comprises an antioxidant as an active ingredient, and a method for providing information for diagnosing cardiac hypertrophy.

[0011] Yet other embodiments provide a method for producing an animal model resistant to cardiac hypertrophy and an animal model resistant to cardiac hypertrophy.

[0012] Yet another embodiment provides a method for screening candidate substances for treating cardiac hypertrophy.

[0013] The technical problems that the present invention aims to solve are not limited to those mentioned above, and other problems not mentioned will be clearly understood by those having ordinary skill in the art to which the present invention pertains from the following description. [Means for solving the problem]

[0014] The present invention relates to a nucleic acid duplex comprising one or more 8-oxoguanines (8-oxoguanines; o-guanines) as the first to ninth nucleotides from the 5' end in at least one strand of the double strand of the nucleic acid. 8 G).

[0015] As one embodiment of the present invention, there is provided an interference-inducing nucleic acid, which is an RNA in which the 1st to 9th nucleotides from the 5' end contain a sequence of a microRNA.

[0016] In another embodiment of the invention, the microRNA may be one or more of the following Group 1 microRNAs: [Group 1] miR-1, miR-184, let-7f-5p, miR-1-3p, miR-122, let-7, miR-124.

[0017] In another embodiment of the present invention, the RNA interference-inducing nucleic acid is 8-oxoguanine (O 8 G) position 8 It is possible to recognize target sites where a G:A configuration occurs.

[0018] In another embodiment of the present invention, at least one strand of the double strand of the nucleic acid may comprise one or more of the polynucleotides in Group 2 below. [Group 2] A polynucleotide consisting of the base sequence of SEQ ID NO: 1 (5'p-Uo 8 GGAAUGUAAAGAAGUAUGUAU-3'); A polynucleotide consisting of the base sequence of SEQ ID NO: 2 (5'p-UGo 8 GAAUGUAAAGAAGUAUGUAU-3'); A polynucleotide consisting of the base sequence of SEQ ID NO: 3 (5'p-UGGAAUo 8 GUAAAGAAGUAUGUAU-3'); A polynucleotide consisting of the base sequence of SEQ ID NO: 65 (5'p-Uo 8 Go 8 GAGUGUGACAAUGGUGUUUG-3'); A polynucleotide consisting of the base sequence of SEQ ID NO:66 (5'p-UGAo 8 GUAGUAGGUUGUAUAGdTdT-3'); A polynucleotide consisting of the base sequence of SEQ ID NO: 67 (5'p-UAAo 8 GGCACGCGGUGAAUGCdTdT-3').

[0019] When the RNA interference-inducing nucleic acid according to the present invention is injected into cells or animals, it can induce myocardial hypertrophy, inhibition of liver cancer cell migration or apoptosis.

[0020] The present invention provides a composition comprising the aforementioned RNA interference-inducing nucleic acid and an antioxidant.

[0021] The present invention also provides a method for producing 8-oxoguanine (o 8G) A method for identifying the location of the device is provided. (a) extracting RNA from cells; (b) 8-oxoguanine (O) was isolated from the extracted RNA. 8 G) RNA containing anti-o 8 isolating by immunoprecipitation (IP) using antibody G; (c) the isolated 8-oxoguanine (o 8 G) reverse transcribing the RNA containing the 8-oxoguanine to prepare cDNA, and preparing and sequencing a sequencing library to identify the position of 8-oxoguanine; and (d) As a result of the sequencing, the position where guanine (G) is modified to thymine (T) is confirmed, and guanine (G) is converted to 8-oxoguanine (o 8 G) identifying the modified positions.

[0022] The present invention also relates to a method for preparing a nucleic acid sequence in which one or more guanines (G) among the 1st to 9th nucleotides from the 5'-end are 8-oxoguanines (o 8 G) a modified nucleic acid that specifically binds to a microRNA modified by The modified nucleic acid includes a polynucleotide complementary to six or more consecutive polynucleotides starting from any one of the second and third nucleotides from the 5' end of the modified microRNA; One or more 8-oxoguanine (o) nucleotides among the 1st to 9th nucleotides from the 5' end of the microRNA 8 The modified nucleic acid further comprises an adenine (A) nucleotide at the position that bonds with the target nucleic acid G.

[0023] In one embodiment of the present invention, the microRNA that specifically binds to the modified nucleic acid has one or more guanines (G) at the second, third, or seventh nucleotide from the 5' end that are 8-oxoguanine (OG). 8 G), The modified nucleic acid may include a polynucleotide complementary to six or more consecutive polynucleotides starting from any one of the second or third nucleotides from the 5' end of the microRNA, and may include an adenine (A) at a nucleotide position that binds to one or more 8-oxoguanines from the second, third or seventh nucleotides from the 5' end of the microRNA.

[0024] In one embodiment of the invention, the modified nucleic acid is 5'-ACAUUC A -3' (SEQ ID NO: 4), 5'-ACAUU A C-3' (SEQ ID NO: 5), or 5'-A A It may comprise the base sequence of AUUCC-3' (SEQ ID NO: 6).

[0025] The present invention also provides a recombinant vector comprising a gene encoding the above-mentioned modified nucleic acid.

[0026] The present invention also relates to a method for preparing a nucleic acid sequence in which one or more guanines (G) among the 1st to 9th nucleotides from the 5'-end are 8-oxoguanines (o 8 G) a modified nucleic acid that specifically binds to a microRNA modified by The modified nucleic acid includes a polynucleotide complementary to six or more consecutive polynucleotides starting from either the second or third 5' end of the microRNA, One or more 8-oxoguanine (o) residues among the 1st to 9th nucleotides from the 5' end of the microRNA are 8 A modified nucleic acid containing an adenine (A) at the nucleotide position that binds to G, or The present invention provides a pharmaceutical composition for treating cardiac hypertrophy, comprising a recombinant vector containing a gene encoding the modified nucleic acid.

[0027] In one embodiment of the present invention, the microRNA may be miR-1, miR-184, let-7f-5p or miR-1-3p.

[0028] In one embodiment of the present invention, the pharmaceutical composition for treating cardiac hypertrophy may further comprise an antioxidant.

[0029] The present invention also provides a nucleic acid double strand comprising one or more 8-oxoguanines (o guanines) as the first to ninth nucleotides from the 5' end in at least one strand of the double strand of the nucleic acid. 8 The present invention provides a pharmaceutical composition for treating liver cancer or glioblastoma, comprising an RNA interference-inducing nucleic acid comprising:

[0030] As one embodiment of the present invention, in the pharmaceutical composition for treating liver cancer, the microRNA may be miR-122.

[0031] In another embodiment of the present invention, in the pharmaceutical composition for treating glioblastoma, the microRNA may be let-7 or miR-124.

[0032] In another embodiment of the present invention, the pharmaceutical composition for treating liver cancer or glioblastoma may further comprise an antioxidant.

[0033] The present invention also provides a pharmaceutical composition for preventing or treating cardiac hypertrophy, comprising an antioxidant as an active ingredient, the antioxidant being an 8-oxoguanine (oG) nucleotide of one or more guanines (G) among the 1st to 9th nucleotides from the 5' end of RNA. 8 The present invention provides a pharmaceutical composition that inhibits the oxidative modification of .beta.-aminobutyric acid (A) to .beta.-aminobutyric acid (G).

[0034] In one embodiment of the present invention, the antioxidant may be N-acetylcysteine ​​(NAC) or butylated hydroxyanisole (BHA).

[0035] In other embodiments of the present invention, the RNA may be miR-1, miR-184, let-7f-5p or miR-1-3p.

[0036] The present invention also provides a method for the treatment of cardiomyopathy, comprising the steps of: (a) replacing one or more guanine (G) residues in a microRNA nucleotide sequence with 8-oxoguanine (OG); 8 G) checking whether the compound is modified; and At least one guanine (G) in the nucleotides of the microRNA is 8-oxoguanine (o 8 and classifying the patient as having cardiac hypertrophy if the patient is modified by any of the following:

[0037] In one embodiment of the present invention, the nucleotides may be the first to ninth nucleotides from the 5' end of the microRNA.

[0038] In other embodiments of the invention, the nucleotide may be the second, third or seventh nucleotide from the 5' end of the microRNA.

[0039] In yet another embodiment of the present invention, the microRNA may be miR-1, miR-184, let-7f-5p or miR-1-3p.

[0040] The present invention also provides a method for producing a recombinant vector comprising the steps of: (a) operably linking a gene encoding the modified nucleic acid to a promoter; (b) introducing the recombinant vector into a fertilized egg of an animal; and (c) A method for producing a non-human animal model resistant to cardiac hypertrophy, comprising the steps of implanting the fertilized egg into a surrogate mother and then developing the fertilized egg to obtain a transformed animal model, and a non-human animal model resistant to cardiac hypertrophy produced by the method.

[0041] The present invention also provides a method for treating cardiac hypertrophy in an animal model comprising the steps of: (a) treating cardiomyocytes of an animal model of cardiac hypertrophy with a candidate substance; (b) The 8-oxoguanine (oG) of the guanine (G) in the nucleotide of the microRNA expressed in the cardiomyocytes of the cardiac hypertrophy animal model is expressed. 8 G) analyzing the frequency of modification to; and (c) the 8-oxoguanine (o 8 G) is reduced as compared to when the candidate substance is not treated, selecting the candidate substance as a therapeutic agent for cardiac hypertrophy.

[0042] In one embodiment of the invention, the candidate substance may be an antioxidant.

[0043] In another embodiment of the present invention, the microRNA may be miR-1.

[0044] The present invention also provides a method for suppressing cardiac hypertrophy, which comprises the step of administering the modified nucleic acid to an individual.

[0045] The present invention also provides a method for suppressing liver cancer metastasis or treating glioblastoma, comprising the step of administering the RNA interference-inducing nucleic acid to an individual.

[0046] The present invention also provides a method for preventing or treating cardiac hypertrophy, which comprises the step of administering to an individual a composition containing an antioxidant as an active ingredient.

[0047] The present invention also provides use of the modified nucleic acid in suppressing cardiac hypertrophy.

[0048] The present invention also provides use of the RNA interference-inducing nucleic acid in suppressing liver cancer metastasis and in treating liver cancer or glioblastoma.

[0049] The present invention also provides use of a composition containing an antioxidant as an active ingredient in the prevention or treatment of cardiac hypertrophy.

[0050] The present invention also provides the use of an antioxidant for producing a medicament for treating cardiac hypertrophy. Effect of the Invention

[0051] The RNA interference-inducing nucleic acid according to the present invention and one or more guanines (G) among the 1st to 9th nucleotides from the 5'-end are 8-oxoguanines (8-oxoguanines). 8 G) Modified nucleic acids that specifically bind to modified microRNA nucleic acids can be used to regulate pathophysiological phenomena in cells or animals.

[0052] Specifically, it can be used for the diagnosis and development of therapeutic agents for cardiac hypertrophy, liver cancer, glioblastoma, and the like. [Brief description of the drawings]

[0053] [Figure 1a] Schematic representation of mice (n=7) receiving 75 mg / kg isoproterenol (ISO) intraperitoneally (IP) every 2 days for 29 days. [Figure 1b] FIG. 1 shows changes in mouse heart size due to ISO and NAC treatment. [Figure 1c] FIG. 11 shows the RNA oxidation effect of ROS generated by ISO treatment. [Figure 1d] FIG. 1 shows that o8G modification of microRNAs following PE or ISO treatment of rCMC cells was confirmed by co-immunofluorescence staining of Ago2 and o8G. [Figure 1e] FIG. 1 shows the results of immunofluorescence staining of o8G and Ago2 in H9c2 cells treated with PE or ISO. [Figure 1f] FIG. 1 shows a dot blot analysis using an o8G-specific antibody on H9c2 and rCMC cells. [Figure 1g] FIG. 1g shows the results of northwestern analysis of PE-treated H9c2 cells (upper panel of FIG. 1g) and ISO-treated mouse hearts (lower panel of FIG. 1g). [Figure 1h] FIG. 1 shows the results of a dot blot analysis using gel-extracted ∼20 nt miRNA from ISO-treated mouse hearts. [Figure 2a]A schematic diagram of the o8G sequencing method (o8G-miSeq) is shown. [Figure 2b] FIG. 1 shows the immunoprecipitation (IP) optimization process for o8G. [Figure 2c] FIG. 1 shows the amount of o8G obtained with the optimized IP process. [Figure 2d] G→T mutations in the cDNAs of oxidized miRNAs were confirmed indirectly by sequence-specific cleavage of restriction enzyme sites (top of Fig. 2d) and directly by sequencing (middle and bottom of Fig. 2d). [Figure 2e] FIG. 1 shows the o8G-miSeq results of oxidized miRNAs in H9c2 cells. [Figure 2f] FIG. 1 shows the results of Volcano plot analysis of H9c2 cells. [Figure 2g] FIG. 1 shows o8G-miSeq results of oxidized miRNAs in rCMC cells. [Figure 2h] Figure 1 shows the results of o8G-miSeq analysis of rCMC and H9c2 cells after exposure to serum deprivation. [Figure 2i] Same as above [Figure 2j] This figure shows the o8G-miSeq results of oxidized miRNAs in H2O2-treated H9c2 cells compared with the results of Wang JX, 2015 (Wang, JX et al. Oxidative Modification of miR-184 Enables It to Target Bcl-xL and Bcl-w. Mol Cell 59, 50-61). [Figure 3a] FIG. 1 shows the relative amount of o8G in miRNA oxidatively induced by PE treatment in rCMC cells. [Figure 3b] FIG. 1 shows the relative levels of oxidatively induced miR-1 by ISO treatment and the levels of miR-1 by o8G IP in mouse hearts. [Figure 3c]FIG. 1 shows the target silencing effect of the o8G:A base sequence of oxidized miR-1. [Figure 3d] Same as above [Figure 3e] FIG. 13 shows the results of analysis of AC16 treated with PE or H2O2 using a luciferase reporter carrying a miR-1 oxo site. [Figure 3f] FIG. 1 shows the results of flow cytometry analysis of dual fluorescent protein (dFP) reporter carrying the miR-1 7-oxo site with GFP in H9c2 cells. [Figure 3g] FIG. 1 shows the results of flow cytometry analysis of dual fluorescent protein (dFP) reporters with miR-1 seed sites by GFP in H9c2 cells. [Figure 3h] FIG. 1 shows miR-1 expression in AC16, H9c2, rCMC, and mouse heart. [Figure 3i] FIG. 1 shows the results of flow cytometry analysis of dual fluorescent protein (dFP) reporters with miR-1 7-oxo, 3-oxo, and 2-oxo sites by GFP in H9c2 cells. [Figure 3j] FIG. 1 shows the distribution of GFP size (log10(FSC)) and GFP value (log10(GFP)) in H9c2 cells, including miR-1 7-oxo sites. [Figure 3k] FIG. 1 shows the results of quantification of dFP reporter in H9c2 cells using flow cytometry. [Figure 3l] FIG. 13 demonstrates the activity of miR-1:7o8G (RFP:GFP-7oxo vs. RFP:GFP, NT) using dFP reporter analysis on H9c2 cells. [Figure 3m] FIG. 1 shows the results of dFP reporter analysis of H9c2 cells treated with NAC. [Figure 3n] FIG. 1 shows the results of flow cytometry analysis of dFP reporter carrying miR-1 7-oxo site by RFP in H9c2 cells. [Figure 3o] FIG. 1 shows the results of a dFP reporter analysis considering only the restricted cell population of H9c2 cells with the lowest reporter value (RFP) of 25%. [Figure 3p] FIG. 13 shows luciferase reporter assay results in H9c2 cells with miR-1 seed site in the presence of 2o8G, 3o8G, 7o8G, and miR-1. [Figure 4a] FIG. 11 confirms the effect of miR-1 expression in rCMC cells treated with PE or NAC. [Figure 4b] This figure shows the cell size of rCMC cells transduced with miR-1:o8G (miR-1:2o8G, miR-1:3o8G, miR-1:7o8G) or miR-1:2U, miR-1:3U, miR-1:7U according to one embodiment of the present invention. [Figure 4c] FIG. 1 shows microscopy results of H9c2 cells transduced with oxidized miR-1 (miR-1:2o8G, miR-1:3o8G, miR-1:7o8G) or miR-1:U (miR-1:2U, miR-1:3U, miR-1:7U) according to one embodiment of the present invention (scale bar: 50 μm). [Figure 4d] FIG. 1 is a graph confirming increased expression of the cardiac hypertrophy marker ANP by treatment with PE and NAC according to one embodiment of the present invention. [Figure 4e] FIG. 1 shows the size distribution of miR-1:7U-transduced H9c2 cells. [Figure 4f] FIG. 4F shows time lapse images of rCMC cells (upper part of FIG. 4F) and H9c2 cells (lower part of FIG. 4F) transduced with miR-1:7o8G or miR-1:7U according to one embodiment of the present invention. [Figure 4g] This figure shows the effect on cardiac hypertrophy in vivo when miR-1:7o8G according to one embodiment of the present invention was injected into mice via the tail vein (top row of Figure 4h) and the results of delivery to cardiac tissue confirmed by qPCR quantification (bottom row of Figure 4h). [Figure 4h]FIG. 1 shows a mouse heart delivered with miR-1:7o8G in vivo according to one embodiment of the present invention. [Figure 4i] FIG. 1 shows the results of immunostaining of the interventricular septum (IS) and the expression of cardiomyocytes and ANP when miR-1:7o8G according to one embodiment of the present invention was injected into mice. [Figure 5a] This figure shows the results of luciferase reporter assay for the target site, which can recognize when the o8G modification of miR-122 occurs at the second and third base, in hepatocellular carcinoma cells Huh7, compared with cells in which miR-122 was deleted from Huh7 (Huh7:miR-122 KO). [Figure 5b] FIG. 1 shows the results of confirming the presence of modified let-7 in glioma cells HS683, which can be recognized when the fourth base of let-7 is modified to o8G, using a luciferase reporter against the 4-oxo site. [Figure 5c] This figure shows the results of confirming the presence of modified miR-124, which can be recognized when the fourth base of miR-124 is modified to o8G, by removing fetal bovine serum from glioma cells HS683 to cause oxidative stress, using a luciferase reporter against the 4-oxo site. [Figure 5d] This figure shows the results of observing that when miR-122 was oxidatively modified by o8G introduced into Huh7 liver cancer cells, cell migration was changed, and that miR-122:2, 3o8G showed even more efficient effects when treated with antioxidants. [Figure 5e] FIG. 1 shows the results of confirming the apoptotic function in HS683 (glioma cells) into which let-7a:4o8G, in which the fourth base of let-7 has been modified to o8G, has been introduced. [Figure 5f] FIG. 1 shows the results of confirming the apoptotic function in HS683 (glioma cells) into which mir-124:4o8G, in which the fourth base of miR-124 has been modified to o8G, has been introduced. [Figure 6a]FIG. 1 shows the results of Ago HITS-CLIP derived from the left ventricle of a human cardiomyopathy patient's heart. [Figure 6b] This figure confirms the frequency of o8G:A binding in Ago-mRNA clusters. [Figure 6c] FIG. 6C shows the base sequences of anti-seed and anti-7oxo according to one embodiment of the present invention (top row of FIG. 6C), and the results of luciferase reporter analysis for these sequences (bottom row of FIG. 6C). [Figure 6d] FIG. 1 shows the miR-1 7oxo target suppression activity of anti-7oxo(9x) according to one embodiment. [Figure 6e] FIG. 1 is a graph confirming the cardiac hypertrophy suppression effect exhibited when anti-7oxo(4x) according to one embodiment is introduced into rCMC. [Figure 6f] FIG. 11 shows the cardiac hypertrophy suppression effect observed when anti-7oxo(4x) RNA or α-MHC 13x according to one embodiment was injected into ISO-treated mice. [Figure 6g] FIG. 6g shows the effect of administering anti-7oxo (α-MHC 13x) according to one embodiment on cardiomyocyte size (upper row of FIG. 6g) and on suppressing the miR-1:7o8G target (lower row of FIG. 6g). [Figure 6h] FIG. 14 confirms the effect of administration of anti-7oxo (4x or 13x) according to one embodiment on ROS elevation in the hearts of ISO-treated mice. [Figure 6i] FIG. 1 shows a recombinant vector designed to generate a transgenic mouse expressing anti-7oxo (α-MHC 13x) according to one embodiment. [Figure 6j] This figure confirms the expression of anti-7oxo (13x) in mice transformed with the recombinant vector of FIG. 5i. [Figure 6k] FIG. 1 shows the cardiac size of mice transgenic with anti-7oxo(13x) according to one embodiment. [Figure 6l]FIG. 14 confirms global repression of miR-1:7o8G targets in anti-7oxo(13x) transgenic mice according to one embodiment. [Figure 6m] FIG. 11 confirms the reduction in size of cardiomyocytes in the interventricular septum (IS) of mice transgenic with anti-7oxo(13x), according to one embodiment. [Figure 6n] FIG. 1 is a schematic diagram showing the site-specific oxidation of miR-1:7o8G induced by ROS and its process of inducing cardiac hypertrophy. [Figure 7a] FIG. 14 confirms successful induction of cardiac hypertrophy in an animal model of cardiac hypertrophy according to one embodiment for obtaining plasma samples. [Figure 7b] FIG. 6a is a diagram illustrating the experimental process after the plasma sample was obtained. [Figure 7c] FIG. 1 shows the results of measuring miRNA-1 in plasma samples from a cardiac hypertrophy group and a control group. [Figure 7d] FIG. 13 shows that oxidatively modified microRNA-1 (miR-1:o8G) was increased in cardiac hypertrophy as measured by o8G immunoprecipitation in plasma samples from cardiac hypertrophy and control groups. [Figure 8a] FIG. 1 shows immunostaining findings that treatment of H9c2 cells with an antioxidant (N-acetylcysteine, hereinafter referred to as NAC) reduced PE-induced cardiac hypertrophy. [Figure 8b] FIG. 1 shows mouse cardiac ultrasound results in response to ISO and NAC treatment. [Figure 8c] FIG. 1 shows the results of immunofluorescence staining of o8G in PE- and NAC-treated rCMC and H9c2 cells. [Figure 8d] FIG. 1 shows the results of suppressing cardiomyocyte hypertrophy in H9c2 cells, which had been treated with PE or ISO to induce cardiomyocyte hypertrophy, by treatment with BHA and an antioxidant for cell culture (Sigma-Aldrich). [Figure 8e]This figure confirms that when anti-miR-1-7oxo according to one embodiment for suppressing miR-1:7o8G was introduced into H9c2 cells in which cardiomyocyte hypertrophy was induced by PE treatment, cardiomyocyte hypertrophy was completely suppressed when treated with the antioxidant NAC. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0054] As used herein, the term "nucleotide" comprises a nitrogen-containing heterocyclic base, a sugar and one or more phosphate groups. These are the monomeric units of nucleic acid sequences.

[0055] In RNA, the sugar is ribose, and in DNA, it is deoxyribose, i.e., a sugar lacking the hydroxyl group present in ribose. The nitrogen-containing heterocyclic base may be a purine or pyrimidine base. Purine bases include adenine (A) and guanine (G), and modified derivatives or analogs thereof. Pyrimidine bases include cytosine (C), thymine (T), and uracil (U), and modified derivatives or analogs thereof. In the present invention, the sugar of the nucleotide is ribose, and the bases include adenine (A), guanine (G), cytosine (C), or uracil (U).

[0056] In the present invention, the term "target site" refers to a target base sequence that binds to the second to eighth base sequence based on the 5' end of a microRNA.

[0057] In the present invention, the term "seed region" refers to a base sequence between the 1st and 9th bases based on the 5' end of a microRNA.

[0058] In the present invention, the types of the "cells" include vertebrates, such as mammals including humans (humans, monkeys, mice, rats, hamsters, cows, etc.), birds (chickens, ostriches, etc.), amphibians (frogs, etc.), and fish, or invertebrates, such as insects (silkworms, moths, fruit flies, etc.), plants, and microorganisms such as yeast, and are preferably mammals including humans, but are not limited thereto.

[0059] In the present invention, "cardiac hypertrophy" refers to a state in which the heart weight increases and the ventricular wall thickens as a result of hypertrophy of myocardial fibers, and may be an early symptom of cardiac hypertrophy, heart failure, cardiac fibrosis, mitral regurgitation, aortic regurgitation, dilated cardiomyopathy, ischemic heart disease, ventricular septal defect, tricuspid regurgitation, pulmonary regurgitation, pulmonary artery hypertension, right ventricular myocardial infarction, cardiomyopathy affecting the right ventricle, atrial septal defect, atrial fibrillation, hypertrophic cardiomyopathy, or infiltrative cardiomyopathy, but is not limited to the type of the disease as long as it is a disease related to cardiac hypertrophy other than the above diseases.

[0060] As used herein, the term "recombinant" refers to a cell that replicates a heterologous nucleic acid, expresses said nucleic acid, or expresses a peptide, heterologous peptide, or protein encoded by a heterologous nucleic acid. Recombinant cells can express genes or gene segments not found in the native form of the cell, in either a sense or antisense fashion. Recombinant cells can also express genes found in the native state of the cell, but where the genes have been modified and reintroduced into the cell by artificial means.

[0061] In the present invention, the term "vector" refers to a DNA construct containing a DNA sequence operably linked to a suitable regulatory sequence capable of effecting expression of DNA in a suitable host. Suitable regulatory sequences include a promoter for effecting transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence for regulating the termination of transcription and translation. The vector of the present invention is not particularly limited as long as it is replicable in cells, and any vector known in the art may be used, for example, a plasmid, cosmid, phage particle, or virus vector.

[0062] In the present invention, the term "recombinant vector" can be used as an expression vector for a target polypeptide if it can express the target polypeptide with high efficiency in a suitable host cell when a gene encoding the target polypeptide to be expressed is operably linked to the recombinant vector and the recombinant vector can be expressed in the host cell. The host cell may be preferably a eukaryotic cell, and expression control sequences such as promoters, terminators, enhancers, etc., sequences for membrane targeting or secretion, etc., can be appropriately selected according to the type of host cell and various combinations can be made according to the purpose.

[0063] In the present invention, the term "promoter" refers to a DNA base sequence site to which a transcriptional regulator binds, and refers to a nucleic acid sequence that regulates gene expression and induces overexpression of a target gene. For example, the recombinant vector of the present invention may be operably linked to a promoter selected from the group consisting of an alpha MHC (αMHC) promoter, a beta MHC (βMHC) promoter, an Nkx2.5 promoter, a cardiac troponin T (TNNT2) promoter, a muscle creatine kinase (MCK) promoter, a human alpha skeletal actin (HAS) promoter, and a murine stem cell virus (MSCV) promoter to regulate cardiomyocyte-specific expression. According to one embodiment of the present invention, the recombinant vector may be operably linked to an alpha MHC (αMHC) promoter, but is not limited to the type of the promoter.

[0064] In the present invention, the term "cardiomyocyte-specific" refers to the characteristic of being not expressed or expressed at a low level in cells other than cardiomyocytes, but being expressed at a very high level in cardiomyocytes.

[0065] As used herein, the term "expression" refers to the process by which a polypeptide is produced from a structural gene, which process includes transcription of the gene into mRNA and the translation of such mRNA into the polypeptide.

[0066] As used herein, the term "transformation" refers to the change in the genetic properties of an organism by either directly introducing DNA in the form of a vector into a cell through physicochemical means or by infecting a host cell with a virus to express a foreign gene, i.e., by introducing a gene into a host cell and expressing it within the host cell.

[0067] In the present invention, an "antioxidant" is a substance that blocks the overproduction of active oxygen and plays a role in preventing oxidative stress in cells and tissues. The antioxidant neutralizes free radicals that cause harmful reactions in cells before they attack DNA or oxidize lipids. In addition, antioxidants are highly reactive and react with harmful substances in the body to prevent chain reactions caused by active oxygen and play a role in protecting cells.

[0068] In the present invention, "prevention" refers to any action that inhibits or delays the onset of a targeted pathophysiological phenomenon by administering a composition according to the present invention.

[0069] In the present invention, "treatment" refers to any action in which the symptoms of the targeted disease are ameliorated or beneficially altered by administration of a composition according to the invention.

[0070] MicroRNA (miRNA) is a small RNA consisting of about 21 bases, and functions to induce RNA interference, which suppresses gene expression in the post-transcriptional process of target genes. MicroRNA recognizes hundreds of target mRNAs mainly through the base sequence of the seed region (positions 1 to 8) located at the 5' end, and then arranges the bases to suppress the expression and regulate biological functions. Therefore, the seed region of microRNA contains guanine (G) to 8-oxoguanine (O). 8 G) modification occurs, which makes it possible 8 Through the G:A base sequence, it can inhibit new targets through base sequences with other mRNAs, thus regulating other pathophysiological functions.

[0071] In other words, oxidative modifications that occur in the seed region may be a mechanism for regulating target recognition by naturally occurring or pathologically occurring microRNAs, and based on this, it is possible to develop technology to artificially induce or suppress pathophysiological functions. 8-oxoguanine modifications that occur in RNA have long been known to occur frequently in degenerative diseases, mainly related to the aging process of the human body, and are also closely related to heart disease. Therefore, nucleic acids based on 8-oxoguanine modifications may be able to regulate a variety of diseases.

[0072] The present invention relates to a nucleic acid duplex comprising at least one 8-oxoguanine (8-oxoguanine; o-guanine) as the 1st to 9th nucleotides from the 5'-end in at least one strand of the double strand of the nucleic acid. 8 G).

[0073] At least one strand of the double strand of the nucleic acid may contain one or more 8-oxoguanines as the first to ninth nucleotides from the 5' end, and all of the double strands of the nucleic acid, i.e., all two single strands, may contain one or more 8-oxoguanines within the first to ninth nucleotides from the 5' end.

[0074] The RNA interference-inducing nucleic acid can be selected from the group consisting of microRNA, small interfering RNA (siRNA), short hairpin RNA (shRNA), DsiRNA, lsiRNA, ss-siRNA, piRNA, endo-siRNA, and asiRNA, but is not limited to the above types as long as it is a nucleic acid that induces RNA interference.

[0075] For example, the first to ninth nucleotides from the 5' end may include a microRNA sequence.

[0076] By way of example, the microRNA may be one or more of the following Group 1 microRNAs: [Group 1] miR-1, miR-184, let-7f-5p, miR-1-3p, miR-122, let-7, miR-124.

[0077] For example, the microRNA may be miR-1, miR-122, let-7 or miR-124.

[0078] As an example, the 8-oxoguanine (o 8 G) may be present at a position corresponding to the second, third, fourth, seventh, or a combination thereof from the 5' end of the microRNA.

[0079] In one example, the RNA interference-inducing nucleic acid has at least one strand of the double strand of nucleic acid that contains the 1st to 9th nucleotides from the 5' end of miR-1, and at least one of the 1st to 9th nucleotides is 8-oxoguanine (o 8 For example, the 8-oxoguanine (oG) may be substituted. 8 G) may be present at a position corresponding to the second, third, seventh or a combination thereof from the 5' end of the miR-1.

[0080] For example, the RNA interference-inducing nucleic acid has at least one strand of the double strand of nucleic acid that contains the 1st to 9th nucleotides from the 5' end of miR-122, and at least one of the 1st to 9th nucleotides is 8-oxoguanine (o 8 For example, the 8-oxoguanine (oG) may be substituted. 8 G) may be present at a position corresponding to the second, third or a combination thereof from the 5' end of the miR-122.

[0081] In one example, the RNA interference-inducing nucleic acid has at least one strand of the double strand of nucleic acid that contains nucleotides 1 to 9 from the 5' end of let-7 or miR-124, and at least one of the nucleotides is 8-oxoguanine (o 8 For example, the 8-oxoguanine (oG) may be substituted. 8G) may be present at a position corresponding to the 4th position from the 5' end of the let-7 or miR-124.

[0082] The RNA interference-inducing nucleic acid is 8-oxoguanine (o 8 G) position 8 The G:A configuration occurs to enable target site recognition.

[0083] In one example, the RNA interference-inducing nucleic acid may include one or more of the following Group 2 polynucleotides: [Group 2] A polynucleotide consisting of the base sequence of SEQ ID NO: 1 (5'p-Uo 8 GGAAUGUAAAGAAGUAUGUAU-3'); A polynucleotide consisting of the base sequence of SEQ ID NO: 2 (5'p-UGo 8 GAAUGUAAAGAAGUAUGUAU-3'); A polynucleotide consisting of the base sequence of SEQ ID NO: 3 (5'p-UGGAAUo 8 GUAAAGAAGUAUGUAU-3'); A polynucleotide consisting of the base sequence of SEQ ID NO: 65 (5'p-Uo 8 Go 8 GAGUGUGACAAUGGUGUUUG-3'); A polynucleotide consisting of the base sequence of SEQ ID NO:66 (5'p-UGAo 8 GUAGUAGGUUGUAUAGdTdT-3'); A polynucleotide consisting of the base sequence of SEQ ID NO: 67 (5'p-UAAo 8 GGCACGCGGUGAAUGCdTdT-3').

[0084] When the above-mentioned RNA interference-inducing nucleic acid is injected into cells or animals, it can regulate various pathophysiological phenomena, such as inducing myocardial hypertrophy, inhibition of liver cancer cell migration, or apoptosis.

[0085] As an example, the miR-1 gene includes nucleotides 1 to 9 from the 5' end of the miR-1 gene, and one or more of these nucleotides are 8-oxoguanine (OG). 8 G) The substituted RNA interference-inducing nucleic acid is capable of inducing myocardial hypertrophy when injected into cells or animals.

[0086] As an example, the miR-122 includes nucleotides 1 to 9 from the 5' end, and one or more of these nucleotides are 8-oxoguanine (G). 8 G) When the substituted RNA interference-inducing nucleic acid is injected into hepatoma cells, it can induce inhibition of hepatoma cell migration.

[0087] As an example, the nucleotide sequence includes nucleotides 1 to 9 from the 5' end of let-7 or miR-124, and one or more of these nucleotides are 8-oxoguanine (OG). 8 G) The substituted RNA interference-inducing nucleic acid is capable of inducing apoptosis when injected into glioma cells.

[0088] The present invention provides a composition comprising the aforementioned RNA interference-inducing nucleic acid and an antioxidant.

[0089] The antioxidant prevents further oxidation of the RNA interference-inducing nucleic acid, i.e., guanine (G) to 8-oxoguanine (O). 8 G) to prevent further oxidation, so that the RNA interference-inducing nucleic acid can more effectively regulate pathophysiological phenomena. The antioxidant can be any antioxidant commonly used in the art.

[0090] The present invention also provides a method for producing 8-oxoguanine (8-oxoguanine; o 8 G) A method for identifying the location of the device is provided. (a) extracting RNA from cells; (b) 8-oxoguanine (O) was isolated from the extracted RNA. 8 G) RNA containing anti-o 8 isolating by immunoprecipitation (IP) using antibody G; (c) the isolated 8-oxoguanine (o 8 RNA containing 8-oxoguanine (OG) was reverse transcribed to produce cDNA. 8 G) preparing and sequencing a sequencing library to determine the position; and (d) As a result of the sequencing, the position where guanine (G) is modified to thymine (T) is confirmed, and guanine (G) is converted to 8-oxoguanine (o 8 G) identifying the modified positions.

[0091] The 8-oxoguanine (o 8 The method for identifying the position of guanine (G) is to reverse transcribe RNA to produce cDNA and sequence it to identify guanine (G) as 8-oxoguanine (oG) more accurately than existing position identification methods. 8 G) can be identified.

[0092] The present invention also relates to a method for preparing a nucleic acid sequence in which one or more guanines (G) among the 1st to 9th nucleotides from the 5'-end are 8-oxoguanines (o 8 G) A modified nucleic acid that specifically binds to a microRNA modified by

[0093] The modified nucleic acid includes a polynucleotide complementary to six or more, for example, six, seven, or eight consecutive polynucleotides starting from either the second or third nucleotide from the 5' end of the modified microRNA;

[0094] At least one 8-oxoguanine (o ) is selected from the 1st to 9th nucleotides from the 5' end of the modified microRNA. 8 The nucleotide at the position that bonds with G may contain adenine (A).

[0095] In one example, the modified nucleic acid is a nucleic acid in which one or more guanines (G) at the second, third or seventh nucleotide from the 5' end are 8-oxoguanine (o 8G) can specifically bind to modified microRNA.

[0096] The modified nucleic acid includes a polynucleotide complementary to six or more consecutive polynucleotides starting from either the second or third nucleotide from the 5' end of the modified microRNA;

[0097] The modified microRNA has one or more 8-oxoguanines (o 8 The nucleotide at the position that bonds with G) can contain adenine (A).

[0098] In one example, the modified nucleic acid is 5'-ACAUUC A -3',5'-ACAUU A C-3', 5'-A A It may include one or more base sequences of AUUCC-3', but is not limited thereto.

[0099] The present invention also provides a recombinant vector comprising a gene encoding the above-mentioned modified nucleic acid.

[0100] The recombinant vector may contain DNA, and the DNA may contain a polynucleotide complementary to the polynucleotide of the modified nucleic acid for suppressing cardiac hypertrophy of the present invention. For example, the vector may contain a thymine (T) base when the base of the modified nucleic acid for suppressing cardiac hypertrophy is adenine (A), a cytosine (C) base when the base of the modified nucleic acid for suppressing cardiac hypertrophy is guanine (G), a guanine (G) base when the base of the modified nucleic acid for suppressing cardiac hypertrophy is cytosine (C), or an adenine (A) base when the base of the modified nucleic acid for suppressing cardiac hypertrophy is uracil (U).

[0101] The present invention also provides a pharmaceutical composition for treating cardiac hypertrophy, comprising the above-mentioned modified nucleic acid or the above-mentioned recombinant vector.

[0102] In one example, the pharmaceutical composition for treating cardiac hypertrophy is a pharmaceutical composition for treating cardiac hypertrophy, in which one or more guanines (G) among the 1st to 9th nucleotides from the 5' end are 8-oxoguanines (O 8 G) may include a modified nucleic acid that specifically binds to the modified microRNA.

[0103] The modified microRNA to which the modified nucleic acid specifically binds may be any one of miR-1, miR-184, let-7f-5p, or miR-1-3p that has been modified.

[0104] The modified microRNA may be, for example, miR-1 modified, for example, the guanine (G) at the second, third, seventh position or a combination thereof from the 5' end of miR-1 modified.

[0105] For example, the pharmaceutical composition for treating cardiac hypertrophy may further include an antioxidant, which may be any antioxidant commonly used in the art, including, but not limited to, NAC, BAH, or antioxidant for cell culture (A1345; Sigma-Aldrich).

[0106] The present invention can also provide a pharmaceutical composition for treating liver cancer or glioblastoma, comprising the above-mentioned RNA interference-inducing nucleic acid.

[0107] For example, the pharmaceutical composition for treating liver cancer comprises at least one strand of the double strand of nucleic acid comprising nucleotides 1 to 9 from the 5' end of miR-122, at least one of which is 8-oxoguanine (OG). 8 G).

[0108] For example, the RNA interference-inducing nucleic acid is such that the guanine (G) at the second, third, or a combination thereof from the 5' end of the first to ninth nucleotides from the 5' end of miR-122 is 8-oxoguanine (o8 The invention may include a single strand containing a base sequence substituted with .

[0109] In one example, the pharmaceutical composition for treating glioblastoma comprises at least one strand of a double strand of a nucleic acid comprising nucleotides 1 to 9 from the 5' end of let-7 or miR-124, at least one of which is 8-oxoguanine (OG). 8 G).

[0110] For example, the RNA interference-inducing nucleic acid is a nucleic acid in which the guanine (G) at the fourth position from the 5' end of the first to ninth nucleotides from the 5' end of let-7 or miR-124 is replaced with 8-oxoguanine (o 8 The invention may include a single strand containing a base sequence substituted with .

[0111] For example, the pharmaceutical composition for treating liver cancer may further include an antioxidant in addition to the RNA interference-inducing nucleic acid, and the pharmaceutical composition for treating glioblastoma may also further include an antioxidant in addition to the RNA interference-inducing nucleic acid. The antioxidant refers to a commonly used antioxidant, for example, NAC, BAH, or antioxidant for cell culture (A1345; Sigma-Aldrich), but is not limited thereto.

[0112] The pharmaceutical composition for treating liver cancer or glioblastoma further contains an antioxidant, thereby preventing additional oxidation of other guanines (G) by intracellular reactive oxygen species in the RNA interference-inducing nucleic acid, thereby maximizing its function.

[0113] The pharmaceutical composition according to the present invention can be formulated into various forms by a conventional method and used, for example, into oral dosage forms such as powder, granules, tablets, capsules, suspensions, emulsions, syrups, etc., and into external skin preparations such as creams, gels, patches, sprays, ointments, plasters, lotions, liniments, pastes, or cataplasms, suppositories, and sterile injections.

[0114] The pharmaceutical composition according to the present invention may further comprise suitable carriers, excipients and diluents that are commonly used in the manufacture of pharmaceutical compositions. At this time, the carriers, excipients and diluents contained in the composition include lactose, dextrose, sucrose, oligosaccharides, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations are prepared by mixing the extract with at least one or more excipients, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate talc are also used. Liquid preparations for oral administration include suspensions, oral liquids, emulsions, syrups, etc., and can contain various excipients such as wetting agents, sweeteners, flavorings, preservatives, etc. in addition to water and liquid paraffin, which are commonly used simple diluents. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspensions include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin, etc. can be used.

[0115] The pharmaceutical composition of the present invention can be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally or topically) depending on the intended method, and the dosage varies depending on the condition and weight of the patient, the degree of the disease, the drug form, the administration route and time, but can be appropriately selected by those skilled in the art.

[0116] The pharmaceutical composition of the present invention is administered in a pharma- ceutical effective amount. In the present invention, the term "pharma-ceutical effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to any medical treatment, and the effective dose level can be determined based on factors including the type and severity of the patient's disease, the activity of the drug, sensitivity to the drug, administration time, administration route and excretion rate, duration of treatment, co-administered drugs, and other factors well known in the medical field. The pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. It is important to administer an amount that can obtain the maximum effect with the minimum amount without side effects, taking into consideration all of the above factors, and this can be easily determined by one skilled in the art. The administration may be once a day or in several divided doses.

[0117] The present invention also provides a pharmaceutical composition for preventing or treating cardiac hypertrophy, comprising an antioxidant as an active ingredient, the antioxidant being an 8-oxoguanine (OG) analogue of one or more guanines (G) among the 1st to 9th nucleotides based on the 5' end of microRNA. 8 The present invention provides a pharmaceutical composition that inhibits the oxidative modification of erythritol phosphate (G).

[0118] In the present invention, the antioxidant is a guanine (G) base that is 8-oxoguanine (o 8G), and other antioxidants such as N-acetylcysteine ​​(NAC), butylated hydroxyanisole (BHA), ascorbic acid (Vitamin C), glutathione, urate, bilirubin, vitamin E, carotenoids, ubiquinol (Co-Q10), flavonoids, and antioxidant enzymes such as superoxide dismutase (SOD), catalase, glutathione peroxidase (GSH-PX), glutathione reductase, and glutathione transferase (G). The antioxidant may be one or more selected from the group consisting of SOD mimetics (CuDIOS), ebselen, lazaroids (21-aminosteroids), captodative olefins, α-lipoic acid and dihydrolipoic acid (DHLA), 5-HTP (hydroxytryptophan), DHEA (dehydroepiandrosterone), amino acids, herbal antioxidants, and minerals, and according to one embodiment of the present invention, may be N-acetylcysteine ​​(NAC) or butylated hydroxyanisole (BHA), but is not limited to the type of antioxidant.

[0119] By way of example, the microRNA may be miR-1, miR-184, let-7f-5p or miR-1-3p.

[0120] The present invention also relates to a method for the preparation of a microRNA isolated from an animal's cardiomyocytes, the method comprising: 8 G) checking whether the compound is modified; and At least one guanine (G) in the nucleotides of the microRNA is 8-oxoguanine (o 8 G), classifying the patient as having cardiac hypertrophy. A method for providing information for diagnosing cardiac hypertrophy is provided.

[0121] In the present invention, "diagnosis" means to confirm the presence or characteristics of a pathological condition. For the purposes of the present invention, diagnosis is to confirm the presence or absence of cardiac hypertrophy.

[0122] As an example, the nucleotides may be the first to ninth nucleotides from the 5' end of the microRNA.

[0123] By way of example, the nucleotide may be the second, third or seventh nucleotide from the 5' end of the microRNA.

[0124] By way of example, the microRNA may be miR-1, miR-184, let-7f-5p or miR-1-3p.

[0125] The present invention also provides a method for producing a recombinant vector comprising the steps of: (a) operably linking a gene encoding the modified nucleic acid for suppressing cardiac hypertrophy to a promoter; (b) introducing the recombinant vector into a fertilized egg of an animal; and (c) providing a method for producing a non-human cardiac hypertrophy-resistant animal model, the method including a step of implanting the fertilized egg into a surrogate mother and then developing the fertilized egg to obtain a transformed animal model; and providing a non-human cardiac hypertrophy-resistant animal model produced by the method.

[0126] By way of example, the microRNA may be miR-1, miR-184, let-7f-5p or miR-1-3p, for example miR-1.

[0127] For example, the animal can be a non-human primate, mouse, dog, cat, rabbit, horse, or cow.

[0128] According to one embodiment of the present invention, the animal may be a mouse, but there is no particular limitation on the type of animal as long as it is a mammal other than a human.

[0129] In the present invention, the method of introducing DNA in the form of a vector into cells is not particularly limited, and may be, for example, nucleofection, transient transfection, cell fusion, liposome-mediated transfection, polybrene-mediated transfection, transduction using calcium phosphate (Graham, FL et al., Virology, 52:456 (1973)), DEAE-dextran transduction, microinjection transduction (Capecchi, MR, Cell, 22:479 (1980)), cationic lipid transduction (Wong, TK et al., Gene, 10:87 (1980)), electroporation (Neumann E et al., EMBO J, 1:841 (1982)), transduction or transfection as described in the literature (Basic methods in molecular biology, Davis et al., 1986 and Molecular This can be carried out by methods well known to those skilled in the art to which the present invention pertains, such as those described in "Genetic Analysis of Chromosome 13C and 13D Cloning: A Laboratory Manual, Davis et al., 1986."

[0130] The present invention also relates to a method for treating cardiac hypertrophy in an animal model comprising the steps of: (a) treating cardiomyocytes of an animal model of cardiac hypertrophy with a candidate substance; (b) Among the nucleotides of the microRNA expressed in the cardiomyocytes of the cardiac hypertrophy animal model, guanine (G) is 8-oxoguanine (o 8 G) analyzing the frequency of modification; and (c) The amount of 8-oxoguanine (o) in the absence of treatment with the candidate substance is increased. 8 G) is decreased, the candidate substance is selected as a therapeutic agent for cardiac hypertrophy.

[0131] In the present invention, the candidate substance is a compound that is capable of binding to the polynucleotide in cardiomyocytes of an animal model of cardiac hypertrophy. 8 It refers to an unknown substance used in screening to examine whether it affects the binding frequency with a G:A configuration target site, and includes, but is not limited to, chemicals, proteins, (poly)nucleotides, antisense RNA, siRNA (small interference RNA), or natural product extracts.

[0132] In the present invention, the candidate substance may be, but is not limited to, an antioxidant.

[0133] The present invention also provides a method for suppressing cardiac hypertrophy, which comprises the step of administering the modified nucleic acid to an individual.

[0134] The present invention also provides a method for suppressing liver cancer metastasis or treating glioblastoma, which comprises the step of administering the RNA interference-inducing nucleic acid to an individual.

[0135] The present invention also provides a method for preventing or treating cardiac hypertrophy, which comprises the step of administering to an individual a composition containing an antioxidant as an active ingredient.

[0136] In the present invention, the term "individual" refers to a subject in need of administration of a composition comprising a modified nucleic acid for suppressing cardiac hypertrophy, or an RNA interference-inducing nucleic acid for treating liver cancer or glioblastoma, or an antioxidant, and more specifically refers to mammals such as humans or non-human primates, mice, dogs, cats, horses, and cows.

[0137] In the present invention, "administration" means providing a composition comprising a modified nucleic acid for suppressing cardiac hypertrophy of the present invention, or an RNA interference-inducing nucleic acid for treating liver cancer or glioblastoma, or an antioxidant to an individual by any suitable method.

[0138] The present invention also provides use of the modified nucleic acid in suppressing cardiac hypertrophy.

[0139] The present invention also provides use of the RAN interference-inducing nucleic acid in inhibiting liver cancer metastasis and in treating liver cancer or glioblastoma.

[0140] The present invention also provides use of a composition containing an antioxidant as an active ingredient in the prevention or treatment of cardiac hypertrophy.

[0141] In the following, preferred examples are presented to aid in understanding the present invention. However, the following examples are merely provided to facilitate understanding of the present invention, and the contents of the present invention are not limited to the following examples. EXAMPLES

[0142] Example 1. Cell culture, drug treatment and transduction 1.Cell culture Rat cardiomyoblast cell line H9c2 (H9c2(2-1), ATCC CRL-1446; H9c2, Korea Cell Line Bank), human ventricular cardiomyocyte cell line AC16 (provided by J. Han, H.-W. Lee, and W. J. Park), and human cervical adenocarcinoma cell line HeLa (ATCC CCL-2) were grown in Dulbecco's modified Eagle's medium (DMEM; Hyclone) supplemented with 10% fetal bovine serum (FBS; Gibco), 100 U / ml penicillin, and 100 μg / ml streptomycin (Welgene) at 37°C and 5% CO2.

[0143] For consistency of results, several different batches of H9c2 maintained in two different facilities (ATCC and Korea Cell Line Bank) were used, and AC16 was obtained from each of the different batches derived from one provided by Dr. M. M. Davidson (scc109, Millipore).

[0144] Primary cultures of neonatal rat cardiomyocytes (rCMCs) were prepared using the Neomyt kit (nc-6031; Cellutron) according to the manufacturer's protocol as previously described in Seok, HY et al. Circ Res 114, 1585-1595. and Huang, Z Pet et al. Circ Res 112, 1234-1243.

[0145] That is, ventricular tissues from Sprague Dawley rat hearts were collected on postnatal day (P1), washed, cut into 3–4 mm pieces, and stirred in a 50-ml flask at 37°C. Cells derived from the ventricular pieces were completely isolated by repeated enzymatic reactions (solution provided by the Neomyt kit). Undigested tissue was removed from the resulting supernatant using a strainer, and then the cells were plated for 2 h to remove non-cardiomyocytes that readily adhere. Finally, non-adherent rCMCs were collected and resuspended in 10% FBS (Gibco), 5% horse serum (HS; Welgene), 2% L-glutamine (Welgene), 0.1 mM 5-bromo-2'-deoxyuridine (Sigma-Aldrich), 100 U ml -1 of penicillin, and 100 μg ml -1 The cells were maintained on SureCoat (sc-9035; Cellutron) culture plates with a 4:1 mixture of DMEM:M199 (Welgene) supplemented with 100 mg of streptomycin (Welgene).

[0146] 2. Drug Treatment To induce adrenergic hypertrophy, rCMC, H9c2 or AC16 were routinely treated with 200 μM phenylephrine (PE) or 10 μM isoproterenol (ISO) unless otherwise indicated, and examined 48 h after treatment. In some cases, serum deprivation was used as a precondition for myocardial hypertrophy, so the same medium was replaced with one without FBS and HS 24 h before treatment. When treated with antioxidants, 2 mM N-acetylcysteine ​​(NAC) was applied during treatment with PE or ISO.

[0147] 3. Transduction Generally, transfection or cotransfection of dual-miRNA-carrying vectors into H9c2, AC16, rCMC, or HeLa cells was performed using Lipofectamine 2000 or 3000 (Invitrogen), whereas transfection of miRNA or miRNA inhibitors (50 nM) was performed using RNAiMAX (Invitrogen) or Lipofectamine 3000 (Invitrogen) according to the general protocol provided by the manufacturer. To achieve maximum efficiency, accurate cell numbers were counted using a Countess II Automated Cell Counter (Invitrogen) and aliquoted into plates before transfection.

[0148] Example 2. Measurement of ROS and cell size For quantitative measurement of cellular ROS levels, a flow cytometry method based on ROS fluorescent dye and dihydroethidium (DHE) was performed using a Muse Cell Analyzer (Milipore) with a Muse Oxidative Stress Kit (Milipore). 6Cells were plated at a density of 100 cells / 6-well plate. After treatment, cells were harvested from 10 min to 48 h and were fixed, stained, and measured repeatedly according to the manufacturer's protocol (n=3). For analysis, the same number of cells (n=10,000) were quantified for both ROS levels and cell size. Cell size was measured as FSC (forward-scattered light) according to the manufacturer's protocol (log 10 (FSC), y axis; hypertrophy, cell size >3).

[0149] CM-H2DCFDA (Invitrogen) was used to measure the amount of ROS in cardiac tissue lysates. Protein was quantified using the Qubit Protein Assay Kit (Invitrogen) for homogenates of lysates prepared in 1x RIPA lysis buffer (DyneBio) supplemented with protease inhibitors (cOmplete, Mini, EDTA-free; Roche) and 2.5 mM deferoxamine mesylate (DFOM; Sigma-Aldrich). 100 μg of lysate was incubated with 2 μM CM-H2DCFDA for 30 min at 37 °C in the dark. Fluorescence signals were detected by a Qubit 2.0 Fluorometer (Invitrogen).

[0150] DHE (Invitrogen) was used to visualize cellular ROS levels. First, H9c2 cells were serum-starved for 24 h and treated with 100 μM PE for the indicated times. Then, harvested cells were washed with serum-free DMEM and incubated with 10 μM DHE for 10 min at 37°C in the dark, after which the cells were washed again with serum-free DMEM. ROS images were obtained using an inverted fluorescence microscope (Leica DMi8).

[0151] Example 3. Immunofluorescence staining H9c2 or rCMCs were fixed with 4% paraformaldehyde (PFA; Biosesang) for 15 min at room temperature. After washing twice with PBS (Biosesang) containing 0.1% NP-40 (Sigma-Aldrich), the samples were incubated with 5% bovine serum albumin (BSA; Bovogen) for 1 h at room temperature. They were then washed twice and incubated with primary antibodies under the following conditions: 0.1% NP-40 and 3% BSA, MF20 (1:1000, Developmental hybridoma), o 8 G (15A3, 1:1000, QED Bioscience) and Ago2 (ab5072, 1:200, Abcam) in PBS at 4°C overnight. DAPI (1.5μg / ml, Vector lab) was used for nuclear staining. Due to the heterogeneity of cell fate in H9c2 cardiomyoblasts (even though all H9c2 cells are in the same lineage as cardiomyocytes), MF20 was used to stain cardiomyocytes. For RNase treatment, 10μg / ml RNaseA (Invitrogen) was used for 15 min at room temperature before incubation with the primary antibody, and Alexa Fluor 488 donkey anti-mouse IgG (1:1000, Abcam) and Alexa Fluor 594 donkey anti-rabbit IgG (1:1000, Abcam) were used as secondary antibodies in PBS with 0.1% NP-40 for 1 h at room temperature. Stained cells were examined under an inverted fluorescence microscope (Leica DMi8), analyzed with Leica Application Suite (LAS), and quantified with ImageJ (≥100 cells, https: / / imagej.nih.gov / ).

[0152] Example 4. Measurement of cell size Cell size was quantified from cultures or tissue sections using the “Measure” function of ImageJ 1.51s software (https: / / imagej.nih.gov / ). All images were scaled to 35.56 × 26.67 inches for consistent comparison across different images. 2 The image was then converted to a size of 2560 × 1962 pixels, which corresponds to the area of ​​the cell in inches.2 (71.9 pixels / inch) and used in the following analysis.

[0153] Example 5. RNA synthesis and modification RNA with diverse modifications was produced using the custom synthesis and modification services of TriLink Biotechnologies (USA), Integrated DNA Technologies (USA), ST Pharm (Korea) and Bioneer (Korea), and its quality was monitored and confirmed through mass spectrometry.

[0154] 8-oxoguanine in ribonucleotides (o 8 G) was introduced into miR-1 (5'p-UGGAAUGUAAAGAAGUAUGUAU-3'; SEQ ID NO: 7) at the indicated position: miR-1:7o 8 G, 5′p-UGGAAUo 8 GUAAAGAAGUAUGUAU-3' (SEQ ID NO: 3); miR-1:2o 8 G, 5′p-Uo 8 GGAAUGUAAAGAAGUAUGUAU-3' (SEQ ID NO: 1); miR-1:3o 8 G, 5′p-UGo 8 GAAUGUAAAGAAGUAUGUAU-3' (sequence number 2).

[0155] Duplexes of miR-1 containing the oxidized derivative were generated in vitro by annealing to a synthetic miR-1 passenger strand (5'p-ACAUACUUCUUUAUAUGCCCAUA-3' (SEQ ID NO: 8) and, once transfer was confirmed, fluorescein isothiocyanate (FITC) was attached to the 5' end under the following conditions: 90°C for 2 min, 30°C for 1 h, and 4°C for 5 min.

[0156] In addition, 8-oxoguanine (o 8 G) miR-122(5'pU G GAGUGUGACAAUGGUGUUUG-3'; SEQ ID NO:68), let-7 (5'-pUGAG UAGUAGGUUGUAUAGdTdT-3'; SEQ ID NO: 69) and miR-124 (5'-pUAA G miR-122: 2, 3o 8 G, 5′p-Uo 8 Go 8 GAGUGUGACAAUGGUGUUUG-3' (SEQ ID NO: 65); let-7: 4o 8 G:5'p-UGAo 8 GUAGUAGGUUGUAUAGdTdT-3' (SEQ ID NO: 66); miR-124: 4o 8 G, 5'-pUAAo 8 GGCACGCGGUGAAUGCdTdT-3' (sequence number 67).

[0157] Duplexes of miR-122, let-7 and miR-124, including their oxidized derivatives, were constructed in a similar manner to the miR-1 duplex.

[0158] miR-1 containing G→U substitutions at the indicated positions was also synthesized (miR-1: 2GU, 5'pU U GAAUGUAAAGAAGUAUGUAU-3' (SEQ ID NO: 9); miR-1: 3GU, 5'p-UG U AAUGUAAAGAAGUAUGUAU-3' (SEQ ID NO: 10); miR-1: 7GU, 5'p-UGGAAU UThe miR-1 miRNA was duplexed with the passenger strand of miR-1, UAAAGAAGUAUGUAU-3' (SEQ ID NO: 11). As a control miRNA, a non-targeting miRNA (NT) 5'-UCACAACCUCCUAGAAAGAGUA-3' (SEQ ID NO: 12) derived from cel-miR-67 (a C. elegans-specific miRNA provided by D. Dharmacon as a negative control) was synthesized as an siRNA and used as a duplex (guide strand: 5'p-UCACAACCUCCUAGAAAGAGUAdTdT-3' (SEQ ID NO: 13), passenger strand: 5'p-UACUCUUUCUAGGAGGUUGUGAdTdT-3' (SEQ ID NO: 14), where 'dT' represents thymidine deoxynucleotide). To eliminate seed-mediated off-target effects, NTs were additionally modified to contain dSpacer (abasic deoxynucleotide; φ) at position 6 or 2'-O-methyl at positions 1 and 2 on both the guide and passenger strands as previously reported.

[0159] o 8 To confirm the G-induced G→T mutation, RT-PCR was performed 8 39-oxo-R(o) generates a potential EcoR1 site through a G:A base bond 8 G;5'-CCUGGUCCCAGACUAAA GAAUo 8 GC UUGACAGUUAUCUCGUAUGCCGUCUUCUCGAGGUAGCGGAACCGUGAGCUUUGAAGU-3'; SEQ ID NO: 15), and its control, 39R (G; 5'-CCUGGUCCCAGACUAAA GAAUGC UUGACAGUUAUCUCGUAUGCCGUCUUCUCGAGGUAGCGGAACCGUGAGCUUUGAAGU-3'; SEQ ID NO: 16) was synthesized as a spike-in control. 8 G spike-in (5'pU o 8 Go 8 GAAUGUAAAGAAGUAUGUAU-3'; SEQ ID NO: 17), G spike-in (5'p-UGGAAUGUAAAGAAGUAUGUAU-3'; SEQ ID NO: 18), and miRNA:o 8 G spike-in (5'p-UAAG o 8 G CACGCGGUGAAUGCCAA-3'; SEQ ID NO: 19) was synthesized.

[0160] Competitive miR-1 and miR-1:7o 8 For G inhibitors, anti-seed (2x: 5'-dTdTφ ACAUUCC Aφ ACAUUCC AφdTdT-3' (5'-ACAUUCC-3' is the miR-1 seed site; SEQ ID NO: 20)), anti-7oxo (2x: 5'-dTdTφ AAAUUCC Aφ AAAUUCC AφdTdT-3', 4x:5'- dTAAAUUCCAAAUUCC AG AAAUUCC AC AAAUUCC AdT-3', 9x:5'-dNdNφ AAAUUCC Aφ AAAUUCC Aφ AAAUUCC Aφ AAAUUCC Aφ AAAUUCC Aφ AAAUUCC Aφ AAAUUCC Aφ AAAUUCC Aφ AAAUUCC AφdNdN-3'; 'dN' denotes dioxynucleotides, A, T, C or G (5'-AAAUUCC-3' is miR-1 7-oxo site; SEQ ID NO: 6), control (anti-NT; 2x: 5'-dTdTφ GGUUGUG Aφ GGUUGUG AφdTdT-3', 4x:5'-dT GGUUGUGGGUUGUG AG GGUUGUG AC GGUUGUG AdT-3', 9x:5'-dNdNφ GGUUGUG Aφ GGUUGUG Aφ GGUUGUG Aφ GGUUGUG Aφ GGUUGUG Aφ GGUUGUG Aφ GGUUGUG Aφ GGUUGUG Aφ GGUUGUGAφdNdN-3' (5'-GGUUGUG-3' is the control NT site; SEQ ID NO: 21) was synthesized. "dT" or "dN" was intentionally attached to both the 5' and 3' ends of the inhibitor to contribute to RNA stability. To prevent off-target effects due to the predicted sequence of the junction, an abasic deoxynucleotide (φ) was introduced at the junction of the target site of anti-seed (2x) or anti-7oxo (2x) to confirm that there was no difference in the phenotype of the inhibitor without the abasic deoxynucleotide. The underlined sequences in the above sequence indicate the corresponding target inhibition site.

[0161] Example 6. RNA extraction To purify RNA by size, the miRNeasy Mini Kit (Qiagen) was used to separate small (<200nt) and large (>200nt) RNA fractions according to the protocol provided by the manufacturer. For cardiac tissue samples, a Minilys Personal Homogenizer (Bertin) or a glass homogenizer was used in the presence of 700 μl of Qiazol Lysis Reagent (Qiagen), supplemented with 2.5 mM DFOM (Sigma-Aldrich) to prevent in vitro oxidation as previously reported. For total RNA purification, only Qiazol Lysis Reagent with 2.5 mM DFOM was used after the addition of 20% chloroform (Merck), followed by RNA precipitation with isopropyl alcohol and treatment with RQ1 RNase free DNase (30 min at 37°C; solution stopped by heat inactivation, 10 min at 65°C; Promega). For accurate quantification of RNA, a spectrophotometer (Denovix) and Qubit fluorimetry (Invitrogen) were used.

[0162] To purify miRNA, gel extraction of approximately 20 nt from total RNA was performed. Total RNA denatured with gel loading buffer II (2 min at 90°C; Ambion) was separated by 15% urea-PAGE gel together with a labeled approximately 20 nt miRNA marker (synthesized miR-1), and its size was cross-confirmed with a 14–30 ssRNA ladder marker (Takara). After staining with SYBR Gold, approximately 20 nt of the size was excised from the gel and incubated with gel extraction buffer (0.5 M ammonium acetate, 10 mM magnesium acetate, 0.1% SDS, 1 mM EDTA, pH 8.0) at 65°C overnight in a thermomixer (Thriller, Peqlab), and further purified with Oligo Clean & Concentrator kit (Zymo).

[0163] Example 7. ELISA 8 Quantification of G o 8 Colorimetric detection and quantification of G were performed using the OxiSelect Oxidative RNA Damage ELISA kit (Cell Biolabs) according to the manufacturer's protocol. To prepare samples, purified small or large RNA (0.4–5 μg) was treated with Nuclease P1 (Wako) for 1 h at 37°C, extracted through ethanol precipitation, and incubated with anti-o 8 Binding of G antibodies 8 The antibody was added to compete with the G / BSA conjugate, and then reacted with the HRP-conjugated secondary antibody provided in the kit for detection. The absorbance of the sample was measured using a spectrophotometer (450 nm, GloMax-Multi Detection System; Promega). 8 The concentration of G was determined beforehand. 8 The amount was estimated by comparison with a standard curve and expressed as a relative amount.

[0164] Example 8. Drug treatment All experimental procedures were approved by the Korea University Laboratory Animal Management Committee and were performed in compliance with the Animal Care and Use Guide. To induce adrenergic cardiac hypertrophy, ISO (75 mg / kg) was administered via intraperitoneal injection (IP) to 8- to 12-week-old male C57BL / 6J mice (Koatech) every 2 days for a total of 29 days. As a mock-injected control group (Mock), an identical volume of PBS was used, and 100 mg / kg of NAC was administered to investigate the antioxidant effect. Mice were divided into various groups according to the injected drug (n=4 in each group, sample size selected based on the minimum number used in a previous study (Lee, HSet al. Nature communications 6, 10154)): Mock, ISO, ISO+NAC, and NAC. Twenty-nine days after the first injection, the heart tissues of each mouse were harvested, and the heart weight (HW), body weight (BW) and tibia length (TL) were measured, and HW / BW or HW / TL were used to normalize the heart size. All samples were subjected to ROS measurement, CLEAR-CLIP and RNA extraction, followed by o 8 The samples were stored at -80°C until analysis by ELISA, dot blot, Northwestern, IP and qPCR for G. For paraquat (Sigma-Aldrich) treatment, 10 mg / kg paraquat was administered to mice by IP for a total of 4 weeks. RNA was then extracted and used for ELISA. For RNA-Seq, ISO was injected IP three times on days 1, 3 and 5, mice (n=3) were killed 1 week later and the same volume of PBS was injected for controls. All samples were stored at -80°C until used for RNA-Seq library construction and qPCR analysis.

[0165] Example 9. Cardiac Ultrasound Cardiac ultrasound was monitored and recorded under the control of the Animal Imaging Core Facility at Samsung Medical Center. Specifically, mice were first exposed to 2-5% isoflurane to anesthetize and then maintained at 1% isoflurane during approximately 5 min of cardiac ultrasound recording (Visual Sonics Vevo 2100 Imaging System). 2-D short-axis tracing under M-mode was applied to fix the papillary region of the mouse as an individual recording location. Heart rate, left ventricular (LV) diameter, and LV end-diastolic and end-systolic chamber diameters, including diastolic and systolic wall thickness, were measured.

[0166] Example 10. Dot blot and northwestern blot analysis For dot blots, size-sorted RNA (80–300 ng) or gel-purified miRNA (50 ng) was blotted onto Zeta-Probe blotting membranes (Bio-Rad) and crosslinked using an optimal setting (120 mJ / cm) in a Spectrolinker XL-1000 (Spectroline). 2 For Northwestern blots, total RNA was denatured in Gel Loading Buffer II (2 min at 90°C; Ambion), separated on a 15% Novex TBE-urea gel (Invitrogen) with a 22 nt miRNA size marker (synthesized miR-1), transferred to a Zeta-Probe blotting membrane, and cross-linked by UV (120 mJ / cm 2 The membrane was crosslinked with a Spectrolinker XL-1000. The membrane was blocked with 1xTBST (Biosesang) with 5% BSA for 1 hour at room temperature and then incubated with anti-o in 1xTBST for 1 hour at room temperature. 8G antibody (15A3, 1:2000; QED Bioscience). Then, HRP-conjugated goat anti-mouse IgG (1:5000, Pierce) in TBST was used for 1 hour at room temperature, and then reacted with ECL (SuperSignal West Pico PLUS, Pierce) for detection. When using a fluorophore-conjugated secondary antibody (Alexa Fluor 680 goat anti-mouse IgG, 1:15000 in 1xTBST, Invitrogen), Blocker FL Fluorescent Blocking Buffer (ThermoFisher) was used for blocking and anti-o 8 Both incubations with antibodies against G were used. Fluorescence signals were directly quantified by an iBright FL100 imaging system (Invitrogen) and calculated as relative intensity to the total amount of RNA represented by spots stained with SYBR Gold (1:10000, Invitrogen).

[0167] Example 11.o 8 Optimization of immunoprecipitation (IP) anti-o 8 G antibody (15A3, QED Bioscience) 8 To optimize the immunoprecipitation (IP) conditions for G, two o 8 A synthetic 20-nt long RNA containing G bases. 8 G spike in (5'p-Uo 8 Go 8 GAAUGUAAAGAAGUAUGUAU-3') 8 The antibody was compared to a G spike-in with no G (5'p-UGGAAUGUAAAGAAGUAUGUAU-3'). 8 To prepare beads with G antibodies attached, 2.5 μg of anti-O 8 Anti-oG antibody (15A3, QED Bioscience) was incubated with 25 μl of Dynabeads Protein G (Invitrogen) and 200 μl of PBS for 1 h at room temperature. 8To prevent non-specific interactions of the G antibody, the addition of 250 μg deoxyguanosine (dG, Sigma-Aldrich) was tested during bead preparation. For washing and purification, Dynabeads Protein G were separated using a DynaMag-2 magnet (Invitrogen). After washing the beads three times with PBS, the other conditions of IP buffer were o 8 G spike-in vs. G spike-in (10 pg or 100 pg, in the presence of 300 ng of small RNA) were confirmed in: PBS containing 0.04% NP-40; low detergent, PBS containing 0.004% NP-40; high detergent, PXL (PBS, 0.1% SDS, 0.5% deoxycholate, 0.5% NP-40). As a reference, all IP steps were performed in the presence of 2.5 mM DFOM and 40 U of recombinant RNase inhibitor (Takara) at 4°C for 2 h.

[0168] Other conditions of wash buffer were also tested: high detergent, IP buffer (2 times) → PXL (4 times) → PBS (2 times); salt addition, PBS supplemented with 100 mM NaCl (3 times) → PBS (5 times); series of washes with high salt, TE (15 mM Tris-HCl pH 7.5, 5 mM EDTA) → TE with high detergent (1% Triton X-100, 1% deoxycholate, 0.1% SDS, and 2.5 mM EGTA) and high salt (1 M NaCl) → TE with high detergent and salt (120 mM NaCl) → wash buffer (50 mM Tris-HCl pH 7.5, 1 mM MgCl, 150 mM NaCl, 0.05% NP-40); series of washes with extreme salt, TE → TE with high detergent and high salt → TE with high detergent and extreme salt (2M NaCl) → TE with high detergent and salt → wash buffer. RNA in beads was purified with 700 μl of Qiazol Lysis Reagent supplemented with 2.5 mM DFOM and 20% chloroform, followed by RNA Clean & Concentrator-5 kit (Zymo). As the spike-in control was 22 nt in size, o 8The amounts of G spike-in and G spike-in were measured by quantitative RT-PCR (qPCR) for miRNAs, and their relative ratios were used to estimate the signal:noise in the IP step.

[0169] Example 12. Quantitative RT-PCR (qRT-PCR) for miRNA To quantify miRNA, miRNA qPCR method or TaqMan MicroRNA analysis method (Applied Biosystems) was used. Specifically, 1 μg of small RNA purified by miRNeasy Mini Kit (Qiagen) or IP-purified RNA was polyadenylated in a total volume of 10 μl using poly(A) polymerase (Ambion). The polyadenylated RNA was then reverse transcribed using SuperScript III reverse transcriptase (Invitrogen) with 2 μM oligo(dT) adapter primer (5'-GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3'; SEQ ID NO: 22). qPCR reactions were performed in SYBR Green PCR Master Mix (Applied Biosystems) with forward (sequence identical to the target miRNA) and reverse primers (5'-GCGAGCACAGAATTAATACGACTCAC-3'; SEQ ID NO: 23) under the following cycling conditions: 95°C for 5 min; 45 cycles of 95°C for 15 s, 55°C for 15 s, and 72°C for 20 s; and 72°C for 5 min. 8 G or G spike-in (forward: 5'-TGGAATGTAAAGAAGTATGTAT-3' (SEQ ID NO: 24), reverse: 5'-GCGAGCACAGAATTAATACGACTCAC-3' (SEQ ID NO: 25)) or miRNA: 8Except for the use of a G spike-in (forward: 5'-TAAGGCACGCGGTGAATGCCAA-3' (SEQ ID NO: 26), reverse: 5'-GCGAGCACAGAATTAATACGACTCAC-3' (SEQ ID NO: 27)), measurements were generally taken as reference controls (control, forward: 5'-CGCTTCGGCAGCACATATAC-3' (SEQ ID NO: 28), reverse: 5'-TTCACGAATTTGCGTGTCAT-3' (SEQ ID NO: 29)).

[0170] When using TaqMan MicroRNA Assay, the protocol provided by the manufacturer was followed: 100 ng of small RNA was reverse transcribed using a MicroRNA Reverse Transcription Kit (Applied Biosystems) with a specific RT probe that recognizes each miRNA sequence. With the RT product, qPCR reactions were performed using specific qPCR primers and TaqMan Universal PCR Master Mix (No AmpErase UNG; Invitrogen). RT probes and qPCR primers used to detect specific miRNAs were provided by the kit, including: miR-1b and hsa-miR-1 in rCMC (ID:002222); miR-1-3p and rno-miR-1 in rCMC (ID:002064); miR-184 and has-miR-184 in rCMC (ID:000485); let-7f and hsa-let-7f in rCMC (ID:000382); miR-1 and hsa-miR-1 in H9c2 (ID:00222); AC16, rCMC, and mouse heart, U6 and U6 snRNA (ID:001973); 8 G or G spike-in, hsa-miR-1 (ID:002222); miRNA:o 8 G spike-in, mmu-miR-124a (ID:001182); NT, cel-miR-67-3p (ID:000224). All qPCR analyses were performed by Rotor-Gene Q (Qiagen) with technical replicates (n=3) and parallel reactions without reverse transcriptase (negative control).

[0171] Example 13. RT-PCR 8 Analysis of G→T conversion o 8 Since G can pair with A, the GAAUo in the synthesized 39-oxo-R 8 The efficacy of inducing a G to T transversion based on a GC to GAATTC (EcoRI site) change was investigated. The oDNA was synthesized by SuperScript III reverse transcriptase (Invitrogen) with a RT primer (5'-ACTTCAAAGCTCACGGTTCCGCTACCTCGAGAAGACGGCATACGA-3' (SEQ ID NO: 30), Bioneer). 8 Reverse transcription was performed for G control (39-oxo-R) and G control (39R). cDNA was amplified with Ex Taq (Takara) with primers (forward: 5'-CCTGGTCCCAGACTAAAGAAT-3' (SEQ ID NO: 31), reverse: 5'-ACTTCAAAGCTCACGGTTCCG-3' (SEQ ID NO: 32); Bioneer) in a PCR reaction (98°C for 10 s; 30 cycles of 98°C for 10 s, 40°C for 30 s, 72°C for 20 s; and 72°C for 10 min). After purification with Oligo Clean & Concentrator kit (Zymo), RT-PCR products were digested with EcoRI (NEB) and separated on a 12% PAGE gel in TBE.

[0172] In RT-PCR 8 The G-induced G→T transversion was also directly confirmed by sequencing. After each ligation step, a 22-nt synthetic RNA (5'p-UGGAAUo 8 400 ng of o 8 A sequencing library was constructed for G. In particular, the unique read value due to the degenerate barcode (four random nucleotides) in the 5' adapter was calculated. 8By analyzing the nucleotide frequency at the G position, confounding biases in PCR amplification can be eliminated.

[0173] Example 14. o 8 G -miSeq o in RT-PCR 8 G IP conditions and 8 Based on the optimization of G-induced G→T transition, oxidized miRNA and its o 8 Sequencing methods to identify the position of G (o 8 A 12.5 μg anti-oG miSeq was developed. The 12.5 μg anti-oG miSeq was incubated with 125 μl Dynabeads Protein G (Invitrogen) in PBS (total volume 500 μl) supplemented with 1.2 mg deoxyguanosine (Sigma) for 1 h at room temperature. 8 Magnetic beads with attached antibodies were prepared by incubating with Protein G antibody (15A3, QED Bioscience). For washing and purification, Dynabeads Protein G were separated using a DynaMag-2 magnet (Invitrogen). After two washes with PBS, 7–10 μg of small RNA sample purified with miRNeasy Mini Kit (Qiagen) was mixed with beads prepared in 200 μl of PXL containing 2.5 mM DFOM (Sigma) and 40 U of recombinant RNase inhibitor (Takara). After 2 hours of alternating incubation at 4°C, a series of washes with very high salt were performed: TE (15 mM Tris-HCl pH 7.5, 5 mM EDTA); TE containing high detergent (1% Triton X-100, 1% deoxycholate, 0.1% SDS, and 2.5 mM EGTA) and high salt (1 M NaCl); TE containing high detergent and very high salt (2 M NaCl); TE containing high detergent and salt (120 mM NaCl); wash buffer (50 mM Tris-HCl pH 7.5, 1 mM MgCl, 150 mM NaCl, 0.05% NP-40). The purified oxidized small RNA on the beads was either directly or further processed after extraction.

[0174] When working with intact beads, the RNA from the beads was washed twice with PNK buffer (50 mM Tris-Cl pH 7.4, 10 mM MgCl2, 0.5% NP-40) and incubated for 2 min at 70°C with 8 μl of T4 RNA ligase 2 cleavage KQ (NEB) in 80 μl of T4 RNA ligase buffer (NEB) supplemented with 1 mg / ml BSA and 40 U of recombinant RNase inhibitor (Takara), followed by ligation with 0.25 μM of the prepared 3' adapter (5'-(rApp)T(PMe)GGAATTCTCGGGTGCCAAGG(ddC)-3' (SEQ ID NO: 34); rApp: adenylic acid, PMe: methylphosphonic acid, ddC: dideoxycytosine; Trilink) on ice. After 1 h incubation at 28° C. in a thermomixer (Thriller, Peqlab), the beads were washed once with PXL (2.5 mM DFOM) and twice with PNK buffer. For 5′ adapter ligation, after 2 min incubation at 70° C., 0.25 μM of 5′ adapter (5′-GUUCAGAGUUCUACAGUCCGACGAUCNNNN(2′-methoxy-C)-3′ (SEQ ID NO: 35); Trilink) prepared on ice was incubated with RNA on the beads in a total of 80 μl T4 RNA ligase buffer composed of 8 μl T4 RNA ligase (Thermo), 1 mg / ml BSA and 40 U recombinant RNase inhibitor for 1 h at 28° C. in a thermomixer (Thriller, Peqlab). After sequential washing with PXL (2.5 mM DFOM) and 1x First Strand Buffer (Invitrogen), the RNA on the beads was reverse transcribed as follows: 1 μl SuperScript III Reverse Transcriptase (Invitrogen), 0.72 μM RT primer (5'-GCCTTGGCACCCGAGAATTCCA-3'; SEQ ID NO: 36), 375 μM dNTPs, 7.25 mM DTT and 4 U recombinant RNase inhibitor in a total of 40 μl 1x First Strand Buffer; incubation for 1 h at 55°C in a thermal mixer (Thriller, Peqlab). The resulting cDNA was further amplified by PCR to construct a sequencing library.

[0175] At the same time, the cDNA sequencing library was also generated using input small RNA (0.4–1 μg; small RNA-Seq) or 8 GIP was performed from the beads purified with 700 μl of Qiazol Lysis Reagent supplemented with 2.5 mM DFOM and 20% chloroform, followed by extraction of RNA (concentrated with Clean & Concentrator-5 kit). First, 0.25 μM 3' adapter (prepared on ice after incubation at 70°C for 2 min) was ligated using 1 μl of T4 RNA ligase 2 cleavage KQ (NEB) in 13 μl of total T4 RNA ligase buffer supplemented with 20% PEG 8000 and 20 U of recombinant RNase inhibitor, incubated at 28°C for 60 min, and then inactivated at 65°C for 20 min. Then, 13 μl of T4 RNA ligase buffer containing 0.25 μM 5' adapter, 2 μl of T4 RNA ligase (ThermoFisher), 40 U of recombinant RNase inhibitor, and 1 mg / ml BSA were added to ligate the 5' adapter, which was incubated at 28 °C for 60 min and inactivated at 65 °C for 20 min. The ligated total RNA sample was denatured at 70 °C for 2 min with 1 μl of 10 μM RT primer, placed on ice for 1 min, and reverse transcribed as follows: 1 μl of SuperScript III reverse transcriptase (Invitrogen), 375 μM dNTPs, 7.25 mM DTT, and 4 U of recombinant RNase inhibitor in a total of 40 μl of 1x first strand buffer; incubation at 55 °C for 1 h and 70 °C for 15 min. The generated cDNA was further amplified by PCR to produce a sequencing library.

[0176] The produced cDNA was further treated to include Truseq index adapter sequences (Illumina). First, cDNA was amplified by PCR using Q5 high accuracy 2x master mix (NEB) with 100 nM of universal forward primer (5'-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA-3'; SEQ ID NO: 37) and 100 nM of RT primer: 98°C for 30 s; 5 cycles of 98°C for 10 s, 60°C for 30 s, and 72°C for 15 s; and 72°C for 10 min. After purifying the primary PCR product using QIAquick PCR Purification Kit (Qiagen), a portion of the eluate was used to perform qPCR (Rotor-Gene Q; Qiagen) with Q5 high accuracy 2x master mix supplemented with SYBR Geen I (1:10000, Invitrogen) to determine the number of cycles required to reach the linear range of amplification. A secondary PCR was performed on the remaining purified primary PCR products using Q5 high accuracy 2x master mix with the determined optimal cycle number to generate multiplexed barcodes (universal forward primer at 250 nM, barcode primer: 5'-CAAGCAGAAGACGGCATACGAGAT-6mer barcode-GTGACTGGAGTTCCTTGGCACCCGAGAATTCCA-3'; SEQ ID NO: 38). PCR products containing inserts of expected size of approximately 20 nt were further purified using 15% urea-PAGE gel extraction (see Example 6) or Pippin Prep (Sage Science) with 3% agarose gel cassettes and quantified using Qubit RNA HS assay kit (Invitrogen) and Fragment Analyzer (Advanced analytical) with crosscheck. Finally, the produced library was sequenced as 50 single-end reads by a HiSeq 2500 system (Illumina) and demultiplexed using CASAVA (Illumina).

[0177] Example 15. Bioinformatics and statistical data analysis For bioinformatics analysis, we mainly used Python scripts (http: / / clip.korea.ac.kr / oxog / ) and UCSC Genome Browser (http: / / genome.ucsc.edu / ). RNA-Seq analysis was performed using Tuxedo Suite; TopHat2 (http: / / ccb.jhu.edu / software / tophat), Cufflinks and Cuffdiff (http: / / cole-trapnell-lab.github.io / cufflinks / ). Mapping of sequencing reads to miRNAs was performed using Bowtie (http: / / bowtie-bio.sourceforge.net). Peak analysis of CLIP data was processed by CLIPick (http: / / clip.korea.ac.kr / clipick / ). GO analysis was performed using DAVID (http: / / david.abcc.ncifcrf.gov / ) with base parameters and visualized with REVIGO (http: / / revigo.irb.hr / ) unless otherwise indicated. Functional tin reinforcement was analyzed using GSEA (http: / / software.broadinstitute.org / gsea / ).

[0178] Standard laboratory practice randomization procedures were used for cell line groups and mice of the same age and sex. Experimenters were blinded to batches during experiments and outcome evaluation. All statistical tests, including Kolmogorov-Smirnov test (KS test), t-test (unpaired two-sided test), and Fisher's exact test (relative to total mapped miR-1 reads value), were performed using Scipy (http: / / www.scipy.org / ) or Excel (two-sided test). Values ​​show mean ± sd unless otherwise stated. Statistical significance was essentially set at P = 0.05, and variances were similar between groups.

[0179] Example 16.o8 G-miSeq data analysis Demultiplexed sequencing reads (FASTQ files) were aligned using Bowtie allowing two mismatches (Bowtie--norc-l7-n2-af), and the reduced sequencing reads were indexed (using bowtie-build indexer with base parameters) and mapped with the mature miRNA sequences of the same species in miRBase (http: / / www.mirbase.org / ). The results were further parsed by filtering reads with mismatch errors, resulting in a quality score below 20. The number of reads per miRNA was normalized to the total reads (reads per million total reads; RPM) and expressed as log2 values ​​(e.g., log2(input) and log2(o 8 G IP)) was used. In particular, 8 G enrichment correlates with the RPM of input small RNA-Seq (input; miRNA frequency). 8 G IP Sequencing (o 8 GIP) were estimated by measuring the RPM and calculated as log2 ratios, and significance (-log 10 The results are shown as p-values ​​(p-values, t-test). 8 To investigate GIP bias, the G-content (number of Gs) and o 8 The number of miRNAs classified by G enrichment (bin size = 1) was visualized through heat map analysis (Treeview, http: / / rana.lbl.gov / EisenSoftware.htm). 8 To analyze G enrichment, the relative 8 G enrichment values ​​between PE treatment and mock (no treatment) 8The percentage of mismatches occurring at each position of the miRNA sequence was calculated relative to the total match frequency, considering only the mismatches with the highest quality score in base calling; mismatches (%). Notably, seed sequences from miR-1:2U and miR-1:3U do not overlap with other mammalian miRNAs (n=17,948; miRBase, http: / / www.mirbase.org / ), except for the species-specific miRNAs mdo-miR-12320-3p and mmu-miR-7216-3p (<80 sequencing reads), which show very low and negligible expression.

[0180] Example 17. Oxidized miRNA o 8 G Quantification by IP and qPCR rCMCs (n = 3) were treated with 100 μM PE for 48 h or with ISO (75 mg kg -1 After inducing cardiac hypertrophy in mice by chronic injection (n=3) of 10 pg miRNA:o, small RNA was extracted using the miRNeasy Mini Kit (Qiagen). As a cross-validation, the same amount of small RNA (2 μg, PE-treated vs. untreated) was then extracted from 10 pg miRNA:o infusions, which were accurately measured by both a spectrophotometer (Denovix) and Qubit fluorimetric assay (Invitrogen). 8 In the presence of spike-in controls 8 RNA was extracted from the beads using Qiazol Lysis Reagent and RNA Clean & Concentrator-5 kit (Zymo), and then analyzed by TaqMan MicroRNA Assay kit (Applied Biosystems). 8 The amount of specific miRNAs in the GIP was evaluated. For reference, all steps before reverse transcription were performed in the presence of 2.5 mM DFOM to prevent oxidation of RNA in vitro. To normalize the variation from the IP step, 8 miRNA:o in GIP 8 The amount of G spike-in was measured by qPCR to determine the relative abundance of specific miRNAs.8 It was used as the denominator for quantifying the G value. 8 Relative levels were estimated by measuring U6 snRNA by GIP and used for normalization to confirm oxidative enrichment of specific miRNAs.

[0181] Example 18. Construction of luciferase reporters To measure miRNA-mediated gene silencing activity, we used psiCheck-2 (Promega) or pmirGLO vectors (Promega). In particular, for the miR-1 oxo site, the target site was flanked and repeated (n=5) and inserted into the 3'UTR of Renilla luciferase (hRLuc) in psiCheck-2 to increase the detection sensitivity.

[0182] For such vector construction, synthetic double-stranded oligonucleotides (Macrogen) containing various miR-1 oxo sites were cloned into the psiCheck-2 plasmid via the XhoI and NotI sites as indicated: miR-1-seed site, forward: 5′-TCGAGA CATTCC A CATTCC A CATTCC A CATTCC A CATTCC GC-3' (SEQ ID NO:39), reverse: 5'-GGCCGC GGAATG T GGAATG T GGAATG T GGAATG T GGAATG TC-3' (SEQ ID NO: 40); miR-1-2 oxo site, forward: 5'-TCGAGA CATTCA A CATTCA A CATTCA A CATTCA A CATTCA GC-3' (SEQ ID NO: 41), reverse: 5'-GGCCGC TGAATG T TGAATG T TGAATG T TGAATG T TGAATG TC-3' (SEQ ID NO: 42); miR-1-3 oxo site, forward: 5'-TCGAGA CATTAC A CATTAC A CATTAC A CATTAC A CATTACGC-3' (SEQ ID NO: 43), reverse: 5'-GGCCGC GTAATG T GTAATG T GTAATG T GTAATG T GTAATG TC-3' (SEQ ID NO: 44); miR-1-7 oxo site, forward: 5'-TCGAGA AATTC A AATTC A AATTC A AATTC A AATTC GC-3' (SEQ ID NO: 45), reverse: 5'-GGCCGC GGAATT T GGAATT T GGAATT T GGAATT T GGAATT TC-3' (SEQ ID NO: 46); miR-1 control site, forward: 5'-TCGAGA CTTTCC A CTTTCC A CTTTCC A CTTTCC A CTTTCC GC-3' (SEQ ID NO: 47), reverse: 5'-GGCCGC GGGAAAG T GGGAAAG T GGGAAAG T GGGAAAG T GGGAAAG Importantly, a miR-1 control site was constructed that had a mismatch at position 6 (pivot) of the miR-1 seed site by having the same base, where a damaged pivot has been reported to abolish seed-mediated target repression, and was therefore used as a negative control.

[0183] In the same manner as above, miR-122, let-7, and miR-124 were added to the seed sites. 8 When generating the G modification, the recognizable sequence is extended to the 8th complementary sequence based on the 5' end. 8 The G modification site was replaced with A. 8To sensitively confirm the 7-oxo site in G target mRNA, the psiCheck-2 vector was modified and subcloned to contain two or three repeats of the target site. First, the firefly gene (hluc+) containing the predicted offset 7-oxo site (3:8) was replaced via ApaI and XbaI sites with a different firefly gene (Luc2) that lacks the 7-oxo site and is located in the pmirGLO vector (Promega).

[0184] Example 19. Luciferase reporter assay Various luciferase reporter vectors (pmirGLO, psiCheck-2 or modified plasmids thereof containing the desired sites) and / or synthetic double-stranded miRNAs (50-75 nM, as specified) were transduced into H9c2, rCMC and AC16. 24 hours after transduction, the activity of expressed luciferase was measured in general. For drug treatment, cells were treated with the indicated concentrations of PE, H2O2 and / or NAC for the indicated times, treatment was started 24 hours after transduction, and post-treatment was obtained. Relative activity (Renilla luciferase activity normalized to firefly luciferase) was measured using the Dual-Luciferase Reporter Analysis System (Promega) together with the GloMax-Multi Detection System (Promega) in replicates (n=6) according to the manufacturer's protocol. To evaluate the efficiency of miRNA-mediated repression, different concentrations of miRNAs (0-100 nM) were transduced into HeLa. Then, we used Scipy (scipy.optimize.curve_fit) to perform nonlinear least squares fitting to the sigmoid function to obtain the IC. 50 If the least squares fit is not possible, the regression line is used to calculate the approximate IC 50 was calculated.

[0185] Example 20. Preparation of dual fluorescent reporters A dual fluorescent protein (dFP) reporter vector was constructed based on psiCheck-2 (Promega), replacing the luciferase gene with a fluorescent protein gene. The eGFP gene was amplified in pUlta (Addgene; provided by Malcolm Moore) and replaced hRLuc via the NheI and XhoI sites: forward primer: 5'-TAGGCTAGC CACCATGGTGAGCAAGGGCGA -3' (SEQ ID NO: 49), reverse primer: 5'-GGGCTCGAG CGATCGCCTAGAATTACTTGTACAGCTCGTCCATGC -3' (SEQ ID NO: 50). The TurboRFP gene was amplified in pTRIPZ (Thermo Scientific) and inserted into the ApaI and XbaI sites (forward primer: 5'-GAAGGGCCC TATGAGCGAGCTGATCAAAGGAG -3' (SEQ ID NO: 51), reverse primer: 5'-GACTCTAGA ATTATTATCTGTGCCCCAGTTTGCTAG hluc+ was replaced via the -3' (SEQ ID NO: 52) and further treated to remove the remaining 33 bp of hluc+ sequence due to the PCR-mediated deletion (forward primer: 5'-GTACTGTTGGTAAAGCCACCATGAGCGAGCTGATCA-3' (SEQ ID NO: 53), reverse primer: 5'-TCCTTGATCAGCTCGCTCATGGTGGCTTTACCAACA-3' (SEQ ID NO: 54)), and then the non-deleted backbone plasmid was removed (DpnI treatment). All PCR reactions were performed using PfuUltra High-Fidelity DNA polymerase (Agilent Technologies) according to the manufacturer's protocol. In addition, a converted dFP vector (p.UTA.3.0 Empty provided by Jens Gruber; Addgene plasmid #82447) was used, which is derived from the psiCheck-2 vector, in which acGFP replaced hluc+ and RFP replaced hRLuc, as if the reporter and control fluorescent genes were exchanged with dFP. Finally, the miR-1 seed site, 7-oxo site, 2-oxo site and 3-oxo site were inserted into dFP or the converted dFP vector (p.UTA.3.0) by the same subcloning method used for psiCheck-2.

[0186] Example 21. Single-cell reporter analysis using a flow cytometer Fluorescent protein reporter vectors were used to measure miRNA-mediated gene suppression at the single-cell level using a flow cytometer. First, dFPs (RFP:GFP sites) or converted dFPs (GFP:RFP sites) containing miR-1 seeds, 7-oxo, 3-oxo or 2-oxo sites were transduced into H9c2, and cells were harvested 24 hours after transduction. As a positive control, cognate miRNAs (50 nM) for each target site were cotransduced. To confirm that suppression of miR-1 oxo sites is mediated by endogenous miR-1, 50 nM of a miR-1 specific inhibitor obtained from miRIDIAN microRNA hairpin inhibitor (Dharmacon) was also cotransduced. In the case of cotransduction, the same amount of NT was used as a control. For drug treatment, 200 μM PE (serum-starved H9c2) or 2 mM NAC were treated for 24 hours starting from the time of transduction. Cells were harvested in PBS (Biosesang) with 4% BSA (Bovogen) and 5 mM EDTA (Sigma) and analyzed by flow cytometer.

[0187] For dFP (RFP:GFP site) transduced H9c2, we initially used a BD Accuri C6 Plus (BD Biosciences) operated in 4-blue configuration (equipped with only blue laser equipment, excitation wavelength: 488 nm; standard filters, GFP: 533 / 30, RFP: 670LP). After gating on live single cells (based on FSC and SSC), cells without reporter expression were further removed based on the basal level of autofluorescence estimated by psi-Check2 transduced cells. Then, scatter plots of GFP vs. RFP signals (n=10,000 cells) were analyzed. H9c2 cell size was estimated by FSC value. To test the effect of PE treatment on oxidized miR-1-mediated repression, cellular distribution by GFP intensity (log2(GFP)) or relative GFP ratio (log2(GFP / RFP)) was shown by comparing PE-treated vs. untreated and further statistical analysis was performed by cumulative fraction analysis (KS test, performed using Scipy, scypy.stats.ks_2samp).

[0188] To increase the detection sensitivity for both dFP (RFP:GFP moiety) and converted dFP (GFP:RFP moiety), an Attune NxT flow cytometer equipped with blue (488 nm) and yellow (561 nm) lasers was then used to achieve full excitation of both GFP and RFP. For the analysis, ranges of GFP and RFP signals were initially selected from scatter plot analysis to determine similar ranges of vector expression (log 1 relative to dFP). 10 (RFP) and log for converted dFP 10 (GFP) estimated by the GFP-GFP assay; similarly, the reporter values ​​derived from the input (log log 10 (GFP) and log for converted dFP 10(RFP)) were averaged and quantified as a relative ratio. Ultimately, relative fold changes were calculated by normalizing the relative ratios to values ​​derived from the same reporter without the site (e.g., the average of the dFP and RFP values ​​in each bin was displayed as the no site control value). To narrow the analysis range to only include the lowest 25% reporter expression, the relative fold changes were recalculated using only cells with the lowest 25% reporter values ​​in each vector expression bin.

[0189] Example 22. miR-1:o 8 Induction of cardiac cell hypertrophy using G NT-6φ, miR-1, miR-1:7o 8 G, miR-1:2o 8 G, miR-1:3o 8 G, miR-1:7U, miR-1:2U, and miR-1:3U were transfected into H9c2 or rCMC cells by RNAiMax or Lipofectamine 3000 (Invitrogen) according to the manufacturer's protocol, and images were taken using an inverted microscope (Leica DMi8) and analyzed with ImageJ (≥100 cells, https: / / imagej.nih.gov / ). To generate time series images, miR-1:7o 8 After transduction of G or miR-1:7U, Lumascope 400 (Etaluma) was used at 20-min intervals between 0 and 50 h.

[0190] Example 23. Administration of miRNA to mice We performed in vivo delivery of miRNA to mice. Specifically, double-stranded miRNA (5 mg kg -1 ) was administered to 12-week-old male C57BL / 6 mice (Koatech) by intravenous injection (IV) using in vivo jetPEI (N / P ratio = 5; Polyplus) according to the manufacturer's protocol. 8 Two sets of experiments were designed by distributing mice into two groups according to the following: G, NT vs. miR-1:7U; n = 4. 8G (4 mg kg -1 ) or miR-1:7U (4mg kg -1 ) is injected, NT (1 mg kg -1 ) was also injected to confirm delivery to the mouse heart. 8 G or miR-1:7U duplexes were generated by using miR-1 passenger strands containing FITC at the 5' end to confirm delivery to cardiac tissue. Injections were performed twice on days 1 and 2, and mice were sacrificed on day 7. Heart tissues were collected for each cardiac measurement: HW, BW and TL. Sectioned heart tissues were used immediately for RNA extraction (small and large RNA; miRNeasy Mini Kit, Qiagen) and the amount of NT delivered was investigated by qPCR (see detailed methods for qPCR for miRNA section) followed by RNA-Seq and qPCR analysis. Parts of sectioned hearts were also prepared as tissue sections on slides for immunohistochemistry analysis.

[0191] Example 24. Quantitative RT-PCR for mRNA Total RNA was isolated using the RNeasy Mini Kit (Qiagen) through on-column DNA digestion with RNase-Free DNase Set (Qiagen). Reverse transcription was performed with SuperScript III reverse transcriptase (Invitrogen) and oligo(dT) primers. qPCR analysis was performed with SYBR Green PCR Master Mix (Applied Biosystems). All reactions were performed in triplicate with a standard two-step cycling protocol, and relative quantification was calculated by the ΔCT method using ACTB and GAPDH as controls.

[0192] Example 25. Immunohistochemistry of cardiac tissue Dissected mouse heart tissues were fixed (4% paraformaldehyde, overnight at 4°C), preserved (70% ethanol), embedded in paraffin, cut (transverse sections, serial sections; 5 μm width), and stained with hematoxylin and eosin (H&E). Paraffin-embedded section preparation, H&E staining, and Masson's trichrome staining were performed by the Cardiovascular Product Evaluation Center (Yonsei University College of Medicine, Korea) or the Pathology Core Facility (Seoul National University College of Medicine, Korea) through a service subscription. Immunofluorescence staining was then performed on the prepared slides. After deparaffinization with Histo-Clear (National Diagnostics), the sections were hydrolyzed with serially diluted ethanol and stored in PBS. Antigens were retrieved using the BD Retrievagen Antigen Retrieval Systems (BD Biosciences) according to the manufacturer's protocol. Then, target staining areas defined by PAP pen (Sigma) were immunostained as indicated, blocking solution (PBS containing 10% normal goat serum and 1% BSA) for 1 h at room temperature; MF20 antibody (1:200, Developmental hybridoma) in blocking solution, overnight at 4°C; Alexa Fluor 488 donkey anti-mouse IgG (1:1000, Abcam) in blocking solution, 1 h at room temperature. Alex Fluor 594 WGA (50 μg / ml; Invitrogen) and DAPI (1.5 μg / ml; Vector lab) were applied to visualize cell membranes and nuclei, respectively. Stained tissues were observed under an inverted fluorescent microscope (Leica DMi8; 20x or 40x magnification), analyzed with Leica Application Suite (LAS), and quantified with ImageJ (≥100 cells, https: / / imagej.nih.gov / ).

[0193] Example 26. Generation of transgenic mice To produce cardiomyocyte-specific transgenic mice (TG), anti-7oxo (α-MHC 13x) plasmid was digested using BamHI to isolate the transformation cassette. The gel-purified transformation cassette was injected into the nucleus of mouse zygotes produced from superovulated C57BL / 6 female mice (induced by PMSG and HCG) after mating. The mouse embryos (fertilized single-cell zygotes) were then implanted into pseudopregnant female mice (Korea Bio Co. Ltd, Seoul, Korea). After delivery, all anti-7oxo TG(+) mice were confirmed by PCR analysis of genomic DNA (purified from the ends) using a primer set corresponding to hGH poly(A) (forward: 5'-CCACCAGCCTTGTCCTAATAAA-3' (SEQ ID NO: 55), reverse: 5'-CAGCTTGGTTCCCAATAGA-3' (SEQ ID NO: 56)). For anti-7oxoTG, four independent founder lines (F0; #44, #65, #68, and #69) were established and studied. All mice were provided with food and water ad libitum and maintained on a 12:12-h light:dark cycle.

[0194] Example 27. RNA-Seq library construction and analysis RNA-Seq libraries were generated from total or large RNA using the adaptor ligation-based method or the strand displacement termination / ligation method. For the adaptor ligation-based method, 100 ng of total RNA (purified with miRNeasy Mini Kit; Qiagen) was applied to the TruSeq Stranded mRNA Library Prep Kit (Illumina) using NeoPrep (Illumina) according to the manufacturer's protocol; sample designations: H9C2-NT-N1, H9C2-miR-1-2o 8 G-N1, H9C2-miR-1-3o 8G-N1. TruSeq Stranded mRNA Libraries were constructed, sequenced, and demultiplexed by Omega Bioservices (Norcross, GA, USA); sample names: H9C2-NT-O1, H9C2-NT-O2, H9C2-miR-1-7o 8 G-O1, H9C2-miR-1-7o 8 G-O2.

[0195] The remaining samples were processed using the strand displacement termination / ligation method as follows: polyadenylated mRNA was ligated from 1.5 μg of large RNA (>200 nt, extracted by RNeasy or miRNeasy Mini Kit; Qiagen) to 10 μl of Dynabead Oligo(dT) 25 (Invitrogen) according to the protocol provided by the manufacturer. Then, 10 ng of the purified mRNA was used to prepare an RNA-Seq library using the SENSE Total RNA-Seq Library Kit (Lexogen) according to the manufacturer's instructions. After the libraries were generated, they were amplified by PCR with the lowest optimal cycle. PCR was performed to compare the results of different cycles or by the same method as in Example 14 above. 8The quality of the amplified libraries was determined by performing qPCR as described in the G-miSeq method. The quality of the amplified libraries was confirmed by using Fragment Analyzer (Advanced analytical) for size distribution and quantity. If necessary, urea-PAGE gel extraction or Pippin Prep (Sage Science) was additionally used for size selection. Finally, the prepared multiplexed libraries were accurately quantified using Qubit RNA HS Analysis Kit (Thermo Fisher) and Fragment Analyzer and applied to be sequenced by HiSeq2500 system (Illumina) as 50 single-end reads. Samples named H9C2-control, H9C2-anti-7oxo, mHT-ISO-control, mHT-ISO-anti-7oxo, mHT-ISO-anti-7oxo-TG(-) and mHT-ISO-anti-7oxo-TG(+) were used to sequence, using MiniSeq system (Illumina). To maintain consistency with the results of the HiSeq2500 system, only SE50 information was used for the MiniSeq system.

[0196] Demultiplexed sequence analysis reads (CASAVA; acquired using Illumina) were aligned to the mouse genome (mm9) or rat genome (rn5) using TopHat2 (tophat2 -a 4 -g 1 --b2-sensitive -r 100 --mate-std-dev=50 --library-type fr-firststrand) with the RefSeq gene annotations. If the strand-displacement termination / ligation method was used to produce the sequencing libraries, the first 9 nucleotides from the start of the reads were trimmed against TopHat2 according to the manufacturer's instructions. Transcription levels were quantified using Cufflinks (cufflinks -Nb) and differential transcription profiles were analyzed with Cuffdiff (Cuffdiff --FDR=0.1 -b -N --min-alignment-count=10 -library-norm-method=geometric) with the mapping results of groups with identical experimental conditions. Only valid status values ​​were selected and used in addition to fold changes and statistical significance (p-values). When replicates were derived from two different library construction methods (adapter ligation-based and strand displacement termination / ligation methods), cufflinks were used only for libraries of the same type, and then median RPKM and p-values ​​(t-test, two-tailed) were calculated from all replicates.

[0197] Example 28. Cumulative fraction analysis To test for the tendency of a given miRNA or miRNA inhibitor to inhibit or derepress a putative target transcript, the cumulative fraction of fold change (log2 ratio) was analyzed. 8 G targets were selected as transcripts containing a miR-1 oxo site in the 3′UTR (defined by RefSeq downloaded from the UCSC genome browser), where miR-1:o 8 All hexamers (o 8 G:O instead of C 8The miR-1 seed site and oxo site were routinely examined unless otherwise indicated. "No site" indicates transcripts that do not contain the miR-1 seed site and oxo site in the mRNA sequence. "Control site" indicates transcripts that contain the miR-1 control site in the 3'UTR and oxo site. 8 G-binding nucleotides were replaced with G, as used in previous studies as negative controls. K-S tests were performed using Scipy (scypy.stats.ks_2samp) on total mRNA or control sites. Fold changes and significance (-log 10 Volcano plots were analyzed by calculating p-values ​​(p-values), from which cutoffs were used to select differentially expressed genes (DEGs).

[0198] Example 29. Ago HITS-CLIP Data Analysis Ago HITS-CLIP results from left ventricular tissues of cardiomyopathy patients were retrieved from the GEO database (GSE83410). Reads containing miRNA sequences were confirmed by 'reverse' mapping from Bowtie (alignment of mature miRNA sequences against sample reads) with a tolerance of two mismatches, and positional mismatches of miRNA reads were analyzed against miR-1. For enrichment analysis of miR-1 oxo sites, Ago2 binding clusters provided by a previous study (Spengler, RM et al., Nucleic Acids Res 44, 7120-7131) were analyzed in comparison with miR-1 seed sites mediated by G:U bonds. The seed site of miR-124, a brain-specific miRNA, was used as a negative control since it is not present in cardiac tissue. The non-nucleating bulge site of miR-1 was also used as a negative control.

[0199] To confirm miR-1 7-oxo sites in cardiomyopathy patients, the raw sequencing data of Ago HITS-CLIP were processed by CLIPIck. Specifically, FASTQ files were first filtered based on quality scores (fastq_filter.pl -f mean:0-24:20) and collapsed (fastq2collapse.pl). The preprocessed read values ​​were then aligned to the human genome (hg19) using the NovoAlign program (http: / / www.novocraft.com) with identical mediation variables. After selecting read values ​​with annotated transcripts (RefSeq), the aligned Ago CLIP read values ​​were generated into BED or BAM files using BedTools and SAMtools (http: / / samtools.sourceforge.net / ) and used for peak analysis of expression profiles sourced from human heart (derived from RNA-Seq Atlas, http: / / medicalgenomics.org / rna_seq_atlas). The UCSC genome browser (http: / / genome.ucsc.edu / ) was applied to visualize the peaks, all edited reads, and putative miR-1 7-oxo sites (hexamers at positions 2–8).

[0200] Example 30. CLEAR-CLIP Mouse heart tissue (approximately 150 mg) dissected from ISO-treated or PBS-treated mice was pulverized and subjected to UV irradiation (400 mj / cm 23 times; Spectrolinker XL-1000) to induce covalent cross-linking of in vivo RNA-protein complexes. Treated Ago-associated fragment mRNAs obtained by treatment with 50 μU / μl RNAse A (affymetrix) for 5 min at 37°C were immunoprecipitated with 10 μg of two different anti-Ago antibodies (2A8; Diagenode, 2E12; Abnova) attached to 60 mg Dynabeads Protein A (Invitrogen). Ligation to generate miRNA-target mRNA chimeras was performed by treatment with 0.625 U / μl T4 RNA ligase 1 (NEB) overnight at 16°C and enhanced by further treatment with 1 U / μl T4 RNA ligase 1 (NEB) in the presence of 3% DMSO (Sigma) and 18% PEG8000 (Sigma) for 75 min at 25°C. The isotope-labeled RNA-protein complexes were size-separated by running NuPAGE 10% Bis-Tris Gels (Invitrogen), transferred to nitrocellulose membranes (BA85; Whatman), excised, treated with 4 mg / ml proteinase K (Roche) and 7 M urea (Sigma), and extracted with acid phenol:chloroform:IAA (125:24:1; Invitrogen) and RNA Clean & Concentrator-5 kit (Zymo). The purified RNA was applied to adaptor ligation and RT-PCR to generate libraries for high-throughput sequencing by using the small RNA-Seq Library Prep kit (Lexogen), and finally sequenced on a HiSeq2500 system (Illumina).

[0201] After the sequencing reads were preprocessed and mapped, and adapter sequences were removed, potential chimeric reads containing miRNA sequences were confirmed by 'reverse' mapping, where the mature miRNA sequences were aligned backwards to the sample library using Bowtie. The remaining sequences were then mapped to the mouse genome (mm9), and only those that overlapped with combined exons from both 2A8 and 2E12 antibodies were additionally selected, ultimately focusing only on miR-1 containing chimeric reads. In investigating miR-1 seeds and oxo sites, the upstream (5', -) and downstream (3', +) were extended from the mapped chimeric reads comparing the enrichment results between ISO-injected and non-injected mouse hearts (- / +0, - / +25, - / +50, - / +100).

[0202] Example 31. Cardiomyocyte-specific miR-1:7o 8 Construction of G inhibitors miR-1:7o in cardiomyocytes 8 To specifically suppress G, we constructed a competitive inhibitor containing multiple miR-1 7-oxo target sites based on the pJG / ALPHA MHC plasmid carrying a cardiomyocyte-specific α-MHC promoter. Thirteen miR-1 7-oxo sites (5'-A A Synthetic duplex oligos (Macrogen) containing either the NT target site (5'-AUUCC-3'; SEQ ID NO: 6) or the control NT target site (5'-GGUUGUG-3'; SEQ ID NO: 21) were cloned into the pJG / ALPHA MHC vector via the SalI and HindIII sites as per the manufacturer's instructions. Anti-7oxo, α-MHC 13x, forward: 5'-TCGAC AAATTCC AA AAATTCC AT AAATTCC AG AAATTCC AC AAATTCC AA AAATTCC AC AAATTCC AT AAATTCC AG AAATTCC AA AAATTCC AT AAATTCC AG AAATTCC AC AAATTCC AA-3' (SEQ ID NO:57), reverse: 5'-AGCTTT GGAATTT GT GGAATTT CT GGAATTT AT GGAATTT TT GGAATTT CT GGAATTT AT GGAATTT GT GGAATTT TT GGAATTT GT GGAATTT CT GGAATTT AT GGAATTT TT GGAATTT G-3' (SEQ ID NO:58); control, anti-NT, forward: 5'-TCGAC GGTTGTG AA GGTTGTG AT GGTTGTG AG GGTTGTG AC GGTTGTG AA GGTTGTG AC GGTTGTG AT GGTTGTG AG GGTTGTG AA GGTTGTG AT GGTTGTG AG GGTTGTG AC GGTTGTG AA-3' (SEQ ID NO:59), reverse: 5'-AGCTTT CACAACC GT CACAACC CT CACAACC AT CACAACC TT CACAACC CT CACAACC AT CACAACC GT CACAACC TT CACAACC GT CACAACC CT CACAACC AT CACAACC TT CACAACC G-3' (SEQ ID NO: 60). Of note, the control vector (anti-NT) was an identical plasmid to that used for anti-7oxo (α-MHC 13x) except that it contained a binding site for the non-targeting siRNA (NT) derived from cel-miR-67 (C. elegans-). The pJG / ALPHA MHC vector was provided to Dr. Da-Zhi Wang by Jeffrey Robbins (Addgene plasmid #55594). Other competitive miRNA inhibitors were synthesized from RNA (see RNA synthesis methods).

[0203] Example 32. Administration of miRNA inhibitors to ISO-treated mice Competitive miR-1:7o 8To investigate whether the G inhibitor (anti-7-oxo) could attenuate ISO-induced cardiac hypertrophy in vivo, ISO (75 mg kg -1 ) was first administered by intraperitoneal injection (IP) to 8- to 12-week-old male C57BL / 6J mice (Korea Bio Co.LTD), with the same volume of PBS used as a control (n=5 for each set). Eight hours later, the mice were intravenously injected with anti-7oxo or control (anti-NT) using in vivo jetPEI (Polyplus) in the amount and ratio specified by the manufacturer's protocol; anti-7oxo (α-MHC 13x) or control (anti-NT 13x), 1.9 mg kg -1 , N / P ratio = 8; anti-7oxo (4x) or control (anti-NT 4x), 5 mg kg -1 , N / P ratio=5. Sequential injections were performed three times on days 1, 2 and 5, and on day 7, all mice were sacrificed and their hearts were examined. The delivery rate of anti-7oxo(α-MHC 13x) to cardiac tissue was measured by performing RT-qPCR of anti-7oxo transcripts containing hGH poly(A) (forward: 5'-TAAATTCCAAATTCCAGAAATTCCACAAATTCCAT-3' (SEQ ID NO: 61), reverse: 5'-CCAGCTTGGTTCCCAATAGA-3' (SEQ ID NO: 62)). To confirm that anti-7oxo(4x) was delivered to mouse heart, a poly(A) tail-based miRNA qPCR method (see Methods for quantitative PCR for miRNA) was performed with anti-7oxo(4x) (forward, 5'-TAAATTCCAAATTCCAGAAATTCCACAAATTCCAT-3'; SEQ ID NO: 63) specific primers.

[0204] Example 33. miR-1:o in ISO over time 8 Quantification of G To investigate the change in the amount of oxidized miR-1 in a time course ISO experiment, 75 mg kg -1Mice were administered ISO by IP injection, and the injected mice were sacrificed on days 1, 5, and 7 from the treatment time point (n=4 for each time point). The same volume of PBS was further injected, and the mice were sacrificed immediately to serve as day 0 samples (n=4). After dissection of the heart, small RNA was extracted using the miRNeasy Mini Kit (Qiagen). miR-1:o 8 To quantify G, 8 Quantification of oxidized miRNA by GIP and qPCR” as described in Methods. 8 GIP and subsequent miR-1 qPCR were performed with minor modifications as follows: 3 μg of anti-o in 150 μl of PXL for bead preparation; 8 G antibody (15A3, QED Bioscience), 30 μl of Dynabeads Protein G (Invitrogen), and 300 μg of deoxyguanosine (dG, Sigma-Aldrich) were used; for IP incubation, 2 μg of small RNA sample and 1 pg of oG antibody were used in 250 μl of PXL containing 2.5 mM DFOM and 40 U of recombinant RNase inhibitor (Takara). 8 dG RNA spike-in (miR-124-3p:4o 8 dG:5'p-UAAG o 8 dG CACGCGGUGAAUGCC-3'; sequence number 64) was used.

[0205] Example 34. Sequence conservation analysis of miR-1 target sites within the 3'UTR When counting sequence motifs conserved in 3'UTRs, PhastCons results for mammals were obtained from the UCSC genome browser (http: / / genome.ucsc.edu) and used only if the score was ≥ 0.9, and the conservation ratio (number of conserved motifs / total motifs; %) was calculated. Conservation ratios in all 3'UTRs (defined by RefSeq) were calculated for the seed site of the miRNA family conserved against four different sites in miR-1 (seed, 2-oxo, 3-oxo and 7-oxo sites) (n=103, hexamers in positions 2-8). Of these, sequences are conserved in most mammals (but generally not beyond placental mammals; http: / / www.targetscan.org). As a background control, conservation of all hexamers (n=4098) was also calculated. The resulting distributions were expressed as cumulative fractions and population proportions.

[0206] Example 35. Data Availability o 8 All raw sequencing data from G-miSeq (SRP189806, SRP189807, SRP189808, SRP226125), RNA-Seq (SRP189813, SRP189117, SRP189812, SRP189811, SRP189809, SRP213998, SRP214400, SRP228274) and CLEAR-CLIP (SRP189810) were deposited in the Sequence Read Archives. 8 All FASTQ files containing the sequencing data of G IP are also provided on the project website (http: / / clip.korea.ac.kr / oxog / ).

[0207] Example 36. miR-1:o in plasma of an animal model of cardiac hypertrophy 8 Measurement of G Cardiac hypertrophy was induced in mice by ISO injection in the same manner as described in Example 8 (FIG. 6a). Then, 700 μl of blood was collected from three mice in the PBS-treated control group and three mice in the experimental group treated with an excess of ISO, and the blood was precipitated by centrifugation at 4°C and 1000×g for 5 minutes to separate the plasma. Small RNA was extracted from 350 μl of plasma per group using Qiagen's miRNeasy Serum / Plasma Kit, and the measurement of miR-1 in the extracted small RNA was performed by qPCR as described in Example 12, and was quantified by correcting for the amount of U6. In addition, 100 ng of small RNA isolated from the plasma was subjected to antibody precipitation (IP) as described in Example 11. 8 G-modified RNA was specifically isolated and miR-1 was quantified by qPCR. 8 Quantification of G-modified miR-1 was performed using the DNA form of 8 G was synthesized, 1pg of miR-124-3p:4o 8 dG(UAAG o 8 dG CACGCGGUGAAUGCC-3'; SEQ ID NO: 64) 8 In addition to immunoprecipitation experiments using G antibody, measurements were performed using qPCR and correction was performed.

[0208] Experimental Example 1. Oxidation of miRNA in ROS-dependent cardiac hypertrophy H9c2 rat cardiomyocyte cell line was treated with an α-adrenergic receptor (AR) agonist (phenylephrine; PE) to confirm pathophysiological hypertrophy stimulation by PE treatment and ROS generation and miRNA oxidation. Analysis by flow cytometry (10,000 cells, n=3) using an ROS fluorescent dye (DHE) confirmed that ROS was increased in cells after PE treatment, and notably, 93% of the hypertrophied cells that developed after treatment with PE showed a 1.8-fold increase in ROS generation after treatment. Serum deprivation, an established prerequisite for stimulating adrenergic hypertrophy, enhances the enlarged phenotype with high basal ROS levels.

[0209] Further extending to an in vivo mouse model, chronic administration of the β-AR agonist isoproterenol (ISO), shown in Figure 1a, induces cardiac hypertrophy (an increase of approximately 13%), as shown in Figure 1b, of which pathology was confirmed by cardiac ultrasound and ROS generation upon treatment with ISO.

[0210] Next, we investigated whether RNA was oxidized by ROS in the ISO-administered mouse model of cardiac hypertrophy.

[0211] RNA was separated by size (200 nucleotides) and the 8-oxoguanine (O) induced by ISO treatment was analyzed. 8 G) 8 The results were measured by ELISA using a G-specific antibody. As shown in Fig. 1c, the small RNA was approximately 3.1 times more abundant than the large RNA. 8 It was confirmed that G was produced, which was more rapid than the large RNA (1.8-fold) produced when the large RNA was subjected to oxidative stress induced by paraquat (PQ) treatment.

[0212] As shown in Fig. 1d, oxidation of small RNAs induces the silencing of small RNAs by the interaction of Argonaute2 (Ago2) and oRNA, which are key proteins in the RNA-induced silencing complex. 8 We further decomposed the expression of miRNAs based on their colocalization with G, and confirmed that they were quantified and increased in PE-treated rCMCs (approximately 8-fold), and also increased in PE- or ISO-treated H9c2 as shown in Figure 1e (o per plane). 8 G+, Ago2+; 100 cells, n=4; P=0.05).

[0213] Independently, o 8 Dot blot analysis using a G-specific antibody confirmed increased oxidation of small RNAs (<200 nt) from PE-treated H9c2 and rCMC in a redox-dependent manner, as shown in Figure 1f.

[0214] When confirming the oxidation of miRNA in PE-treated H9c2 and ISO-injected mouse hearts, the results of northwestern analysis of PE-treated H9c2 (upper panel of Fig. 1g) and ISO-injected mouse hearts (lower panel of Fig. 1g) and the dot blot analysis of gel-extracted miRNAs of approximately 20 nt each (Fig. 1h) showed that PE and ISO treatments, respectively, induced oxidative stress. 8 We confirmed that G originates from miRNA with a size of approximately 20 nt.

[0215] In summary, cardiac hypertrophy is redox-dependent, allowing the generation of ROS, which then acts on miRNAs. 8 Induces G modification.

[0216] Experimental example 2. Site-specific expression of cardiac miRNA 8 Sequencing of G Oxidized miRNAs and corresponding o 8 To confirm the position of G, 8 Optimizing immunoprecipitation (IP) of G. 8 by detecting G-induced G→T transversions 8 A new sequencing method for G 8 We developed a novel method for sequencing (G-miSeq), the schematic of which is shown in Figure 2a.

[0217] First, as shown in Figure 2b, we adopted the conditions used in CLIP. 8 The IP process for G was extensively improved, and as shown in Figure 2c, the optimized IP showed approximately 3000-fold synthesis o 8 The amount of G was shown. 8 Because G can pair with A, the efficacy of inducing G→T mutations in cDNA was improved to reach about 50–60%, which was demonstrated indirectly by sequence-specific cleavage of the acquired restriction enzyme sites (top row of Fig. 2d) and directly by sequencing (middle and bottom rows of Fig. 2d) as shown in Fig. 2d.

[0218] Next, as shown in Table 1 below, 8 G-miSeq was initially applied to H9c2 to quantify the basal expression of miR-1b ( 8 G enrichment, log2(IP / input)=7; normalized by miRNA-Seq) and confirmed as the most oxidized miRNA in relation to o 8 G enrichment, i.e., the number of reads normalized to the input read count for the miRNA 8 The log ratio of G IP was plotted according to miRNA frequency in the left panel of FIG. 2e, and the number of G in the sequence was shown as a heatmap density in the right panel of FIG. 2e.

[0219] [Table 1]

[0220] The IP was demonstrated to be specific, with no bias observed from the amount of miRNA and G content, and the significance (-log 10 As shown in Figure 2f, the P value of miR-1b was 8 G was significantly higher (P<0.01) and was found to be prominent in the seed regions (positions 2, 3, and 7) based on the G→T mutation rate. In addition, as shown in Figure 2g, the additional application to rCMC, as shown in Table 2 below, 8 G-miSeq identified positions (positions 2, 3, and 7) in the seed region. 8 The increase in G (upper panel of Fig. 2g) further demonstrated that miR-1b was preferentially oxidized by PE treatment (relative o 8 G enrichment, log2(PE / Mock) = 1.66; lower panel of Fig. 2g).

[0221] [Table 2]

[0222] Next, rCMCs were exposed to serum deprivation to exacerbate the hypertrophic phenotype of rCMCs, and then the o 8 PE treatment was performed for G-miSeq analysis. As a result, as shown in Figure 2h, the miR-1 sequence showed a 7-terminal alpha-G-T transversion rate, which was estimated by the G→T transversion rate. 8 G increased dramatically (miR-1:7o 8 G, ~2-fold increase). In addition to observing enhanced miR-1b oxidation as shown in Figure 2i and Table 4, a significant amount of o 8 G(log2(o 8 Significant oxidation was also observed for other miRNAs such as miR-184, let-7f-5p and miR-1-3p (P<0.01) along with G-IP)>10. In particular, miR-184 was confirmed to be identical to the previous H2O2 treatment results as shown in Figure 2j, while there was some mismatch in the cases of other miRNAs.

[0223] In general, 8 By using G-miSeq, we identified oxidized miR-1 and its specific oxidized domain during cardiac hypertrophy. 8 The position of G was detected accurately.

[0224] [Table 3]

[0225] [Table 4]

[0226] Experimental Example 3. Oxidized miR-1 8 Targeted silencing effect by G:A base pair As confirmed in Experimental Example 2, the oxidized miRNAs (miR-1b, miR-1-3p, miR-184, and let-7f) were oxidized by PE treatment as shown in FIG. 3a. 8 GIP(miRNA:o 8G) We observed significant increases in these levels and validated these in rCMCs (P<0.05, t-test). Among them, miR-1 showed the most dramatic increase (~2.5-5 fold), which was also confirmed in ISO-treated hypertrophied mouse hearts despite its downregulation after ISO treatment as shown in Figure 3b.

[0227] Centered on miR-1, the seed region was identified as 8 G positions (positions 2, 3, and 7) of miR-1 (miR-1:2o 8 G, miR-1:3o 8 G and miR-1:7o 8 G) is o 8 We investigated whether the corresponding new target sites (2-oxo, 3-oxo and 7-oxo sites) could be recognized through G:A base linkage, and the results are shown in FIG. 3c.

[0228] By performing luciferase reporter analysis, the synthesized miR-1:2o 8 G, miR-1:3o 8 G and miR-1:7o 8 We confirmed that G was able to silence targets that had oxo sites (2-oxo, 3-oxo, and 7-oxo sites) that could be recognized by the G;A base sequence upon oxidative modification, and these targets were not suppressed by miR-1.

[0229] Indeed, as shown in Fig. 3d, all of these luciferase reporters containing miR-1 oxo sites were repressed in PE-treated rCMCs but were activated in the presence of the antioxidant NAC, indicating that endogenous miR-1:o produced by adrenergic stimulation of rCMCs was sufficient to alter target recognition and induce silencing. 8 Indicates the level of G.

[0230] Moreover, consistent results were observed in AC16 immediately after PE or H2O2 treatment, as shown in Fig. 3e.

[0231] Next, to exclude synthetic effects from cell population heterogeneity, we performed flow cytometry with dual fluorescent protein (dFP) reporters as shown in Figure 3f: green fluorescent protein gene (GFP) with miRNA targeting sites and red fluorescent protein gene (RFP) without miRNA targeting sites. The dFP reporter showed a cumulative fraction analysis of relative activity (P = 1.56 × 10) in hypertrophic H9c2. -5 , Kolmogorov-Smirnov test (KS test, GFP / RFP).

[0232] Despite the low expression levels of endogenous miR-1 (possibly due to the fate heterogeneity of cardiomyoblast cell lines shown in Fig. 3h), miR-1:o expression was observed at the individual H9c2 cell level, as shown in Fig. 3g. 8 G-dependent repression could be detected. All miR-1 oxo sites (7oxo, 3oxo and 2oxo sites) of the dFP reporter were 8 miR-1:o observed by G-miSeq (Fig. 2f) 8 The G positions (positions 2, 3, and 7) matched miR-1:o 8 Endogenously repressed with sensitivity to detect repression mediated by basal levels of G ( Fig. 3<em>i ) was confirmed by transduction of miR-1 inhibitors or the cognate miR-1 mutant.

[0233] Moreover, the dFP reporter detected significant PE-dependent repression of the miR-1 7-oxo site in hypertrophic H9c2 as shown in FIG. 3j.

[0234] In addition, the increased sensitivity from the complete excitation of the two fluorescent proteins resulted in a significant increase in the sensitivity of the miR-1:7o reporter, as shown in Fig. 3l by comparing the values ​​with those of the no site dFP reporter (RFP:GFP, NT) as shown in Fig. 3k. 8The analysis was probed by verifying the repression of miR-1 by endogenous levels in G (RFP:GFP-7oxo vs. RFP:GFP, NT) and its activation by NAC treatment shown in Fig. 3m (RFP:GFP-7oxo, mock vs. NAC).

[0235] Importantly, such relative suppression, calculated by averaging reporter fluorescence (GFP-7oxo) with control fluorescence (RFP) in a similar range of cells, was striking at the lowest 25% of reporter fluorescence (GFP-7oxo) and at high levels of miR-1:7o. 8 As shown in Figure 3n, the dFP reporter, in which the reporter and the control fluorescent protein were interchanged, was significantly suppressed by miR-1:7o 8 We sensitively detected the repression of miR-1 7-oxo site by endogenous levels of G and the PE-dependent increase in repression.

[0236] Moreover, as shown in Figure 3o, when using the converted dFP reporter and considering only the restricted cell population with the lowest reporter value (RFP) of 25%, PE-induced repression of the miR-1 7-oxo site was observed to be more substantial, and the observation of reporter activity (RFP) restored by introducing a miR-1 inhibitor further confirmed that PE-dependent repression of the miR-1 7-oxo site is mediated by miR-1. In particular, as shown in Figure 3p, oxidized miR-1 (2o 8 G, 3o 8 G and 7o 8 G) was less potent than unoxidized miR-1, but 8 The seed site could be suppressed with a luciferase reporter due to the maintained activity of the G:C base bond. miR-1:7o 8 G is derived from adrenergic cardiac hypertrophy 8 It was observed to silence the target mRNA through G:A base binding.

[0237] Experimental Example 4.miR-1:o 8 Confirmation of cardiac hypertrophy induction in G Although miR-1 has been reported to play a negative role in hypertrophy, PE treatment reduced the miR-1-induced atrophy of rCMCs, as shown in Fig. 4a by microscopic observation and cell size quantification of rCMC cells. 2 , n = 100) were quantified using ImageJ.

[0238] miR-1:o in Experimental Example 2 8 Discovery of G and synthetic miR-1:2o sustained redox-dependent PE-induced hypertrophy 8 G, miR-1:3o 8 G or miR-1:7o 8 By introducing G, we observed that it further induced rCMC hypertrophy substantially more than PE treatment, as shown in FIG. 4b.

[0239] Such an effect is 8 The results were similar when synthetic miR-1 with G substituted by U (miR-1:2U, miR-1:3U, and miR-1:7U) was introduced, which suppressed the hypertrophy phenomenon. 8 It can be seen that this depends on the G:A base bond.

[0240] Similar effects were also observed in H9c2 as shown in FIG. 4c.

[0241] Specifically, as shown in the qPCR results in Figure 4d, miR-1:7o 8 Hypertrophy induced by G or miR-1:7U significantly increased the expression of atrial natriuretic peptide (ANP), a known cardiac hypertrophy marker, as observed with PE treatment. These results were further confirmed by flow cytometry and time-lapse images of rCMC (upper row of Fig. 4f) and H9c2 (lower row of Fig. 4f) shown in Fig. 4e.

[0242] In addition, miR-1:7o 8 We tested the effect of miR-1:7oG on cardiac hypertrophy in vivo. 8G was injected as a polyethyleneimine (PEI) complex with a non-targeted control (NT) through the tail vein (upper panel of Fig. 4g), and delivery to cardiac tissue was verified by quantitative PCR (qPCR) (lower panel of Fig. 4g). As a result, at least ~10% of cardiac size was significantly increased (P=0.001, n=3) as shown in Fig. 4h, and the size of cardiomyocytes was quantified by immunostaining the interventricular septum (IS) of H&E-stained cardiac tissue as shown in Fig. 4i. As a result, ~19% of cardiac cell size was decreased and ANP expression was significantly upregulated. WGA (wheat germ agglutinin) was used to stain cell boundaries, MF20 was used to stain cardiomyocytes, and DAPI was used to stain nuclei (Fig. 4j).

[0243] To summarize the above experimental results, miR-1, especially miR-1:7o 8 The site-specific oxidation of G is 8 G:A base binding is sufficient to induce cardiac hypertrophy in vivo.

[0244] Experimental Example 5. Discovery of oxidized miR-122, let-7, and miR-124 and their gain-of-function In addition to myocardial hypertrophy, the 5' to 8th bases of various microRNAs are also known to be involved in other diseases in which oxidative stress occurs. 8 The presence or absence of G modification was confirmed.

[0245] First, among tumors known to have increased reactive oxygen species, the Huh7 hepatoma cell line was derived from hepatocytes in which miR-122 was specifically and highly expressed. In the Huh7 hepatoma cell line, the second (2oxo), third (3oxo), or both the second and third guanines of miR-122 were oxo. 8 We created luciferase reporters to confirm whether miR-122 was modified with 2-oxo or 3-oxo. 8The psi-check2 (Promega) vector was used to create five target sites that can be recognized by binding in a G:A configuration, and then transfected into Huh7 and measured. In addition, to prove that the suppression of the site is directly due to miR-122, a cell line (Huh7:miR-122 KO) in which the miR-122 gene was deleted by gene correction using CRISPR / Cas9 in Huh7 was created using miRNA CRISPR knockout kits (Canopy Bioscience) and experimented together under the same conditions.

[0246] The results of the above experiment are shown in FIG. 5a.

[0247] As a result of the experiment, not only was the seed site (seed: 5'-ACACUCCA-3') target recognized by existing miR-122 suppressed, but also the second o 8 G modification site (2oxo: 5'-ACACUC A A-3'), 3rd o 8 G modification site (3-oxo: 5'-ACACU A CA-3'), No. 2 and No. 3 are simultaneously 8 G modified sites (2oxo, 3oxo: 5'-ACACU AA A-3') was inhibited.

[0248] In addition, Huh7:miR-122 KO resulted in the 3rd o 8 G modification site (3oxo), 2 and 3 are simultaneously o 8 We observed that the repression of G-modified sites (2oxo, 3oxo) was abolished, demonstrating that the repression was due to modification of miR-122.

[0249] 4th place against let-7 8 G site (4-oxo: 5'-CUAC AWe constructed a luciferase reporter for let-7 (seed: 5'-CUACCUCA-3') in the same manner as before and used it to measure the activity of glioblastoma cells, HS683. We confirmed that the level of inhibition was less than that of the let-7 seed site (seed: 5'-CUACCUCA-3'), but was significantly suppressed compared to the control group (P<0.01). The results are shown in Figure 5b.

[0250] In addition, it also showed the same activity against miR-124, which is known to be highly expressed in neurons and glioblastoma cells. 8 To examine whether G modification was generated in the seed region, we 8 G-modified target site (4-oxo: 5'-GUGC A Luciferase reporter experiments were also performed for UUA-3') in glioblastoma HS683 cells, and the results are shown in Figure 5c.

[0251] As a result of the experiment, the seed site of miR-124 (seed: 5'-GUGCCUUA-3') was suppressed, but the suppression of the 4-oxo site was not observed. It is known that when tumor cells lack nutrients and blood supply, oxidative stress increases and intracellular oxidation increases. Therefore, the suppression of miR-124 expressed in HS683 cells was suppressed. 8 To examine whether the G modification is increased under these conditions, we performed experiments in which serum was removed from the cell culture medium and found that the 4-oxo site of miR-124 was significantly (P<0.01) suppressed.

[0252] Based on the above experimental results, in hepatoma cells, miR-122 at positions 2, 3, or both 2 and 3 were 8 The fact that let-7 is modified with G and that the 4th base of let-7 is O in glioblastoma 8 miR-124 is modified by a G at the 4th base when subjected to oxidative stress, which can occur in tumor cells, such as serum deprivation in the incubation medium. 8 We confirmed that G modifications occur and that they are capable of suppressing the expression of newly recognized target genes.

[0253] In order for hepatoma cells to metastasize, they must have the ability to migrate, and it is known that the expression of miR-122 inhibits hepatoma cell migration. In the hepatoma cell line Huh7, miR-122 was found to be involved in the second and third loci of the tumor. 8 G modification (miR-122:2, 3o 8 G) We observed that oxidized miR-122 was oxidized to investigate whether it affects the migration ability of hepatoma cells. 8 G(5'pU o 8 Go 8 The RNA sequence of the miR-122-5p-GAGUUGUGACAAUGGUGUUUG-3' (sequence number 65) was synthesized by Trilink's RNA synthesis service, and then duplexed with the passenger strand (has-miR-122-5p), which was then transfected into Huh7 for a wound-healing assay.

[0254] As a result of the experiment, as shown in Figure 5d, the miR-122:2, 3o 8 We confirmed that when G was introduced into cells, the migration ability of Huh7 was significantly inhibited.

[0255] Thus, miR-122:2, 3o 8 G may be somewhat reduced in function due to the additional oxidation of other guanines by intracellular reactive oxygen species (see Figure 8e). Therefore, when the same wound healing assay was performed with cell culture antioxidants (Sigma-Aldrich antioxidant supplement), miR-122:2, 3o 8 It was confirmed that G exhibited even greater inhibition of hepatoma cell migration. 8 The biological effect of G-modified microRNA can be maximized by treating the cells with antioxidants.

[0256] In addition, we confirmed that 8The G-modified microRNA let-7:4o 8 To investigate the function of G, we synthesized it in siRNA form (let-7:4o 8 G: 5'-pUGA o 8 G UAGUAGGUUGUAUAGdTdT-3', SEQ ID NO: 66) in a duplex form was introduced into HS683 cells, and apoptosis was measured using an Attune NxT flow cytometer and an eBioscience Annexin V-FITC Apoptosis Detection Kit (Invitrogen).

[0257] As a result of the experiment, as shown in FIG. 5e, it was confirmed that apoptosis of HS683 was significantly increased.

[0258] The same experiment was performed with miR-124:4o 8 G siRNA synthetic form (5'p-UAA o 8 G GCACGCGGUGAAUGCdTdT-3', SEQ ID NO: 67) and observed that apoptosis was induced, as shown in FIG. 5f.

[0259] Referring to the experimental results of Experimental Examples 1 to 5, the o that occurs in the seed region (up to the 8th base based on the 5' end) of various microRNAs 8 It has been found that G modifications can exhibit a variety of pathophysiological functions when synthesized and introduced into cells.

[0260] Experimental example 6. miR-1:7o in cardiomyopathy 8 G and its loss of function We investigated the oxidation of miR-1 by analyzing Ago HITS-CLIP results obtained from the left ventricle of human cardiomyopathy patient hearts (n = 6, see Tables 5-7).

[0261] [Table 5]

[0262] [Table 6]

[0263] [Table 7]

[0264] As a result, as shown in Fig. 6a, the same pattern of G→T mutations (positions 2, 3, and 7) was detected in Ago-associated miR-1, albeit at a low ratio (Fig. 6a, left panel), and clustered together with a patient group (1, 2, 4, and 5) that mainly had the highest frequency at position 7, along with other minor positions (positions 2, 3, and 12; n=4); another one (3 and 6) had the highest frequency exclusively at position 2 (n=2) (Fig. 6a, right panel). In the normalized Ago-mRNA clusters, no significant differences were observed through positions 2, 3, or 7. 8 Oxidized miR-1 target sites represented by G:A linkages were observed more significantly than expected (P<0.01, chi-square test) as shown in Figure 6b, accounting for an average of ∼18% over G:U linkages (∼10%) and control sites (∼7%).

[0265] miR-1:7o 8 To additionally address the physiological relevance of G, we assessed loss of function. Adopting a concept from miRNA sponges, which are competitive inhibitors synthesized as RNA to carry tandem repeats of seed-mediated target sites, we investigated the function of miR-1 (anti-seed) and miR-1:7o (Fig. 6c). 8 G(anti-7oxo) was prepared (Figure 6c, top panel) and tested for these specific inhibitions (Figure 6c, bottom panel).

[0266] The inhibitory activity of Anti-7oxo(9x) was confirmed to globally inhibit miR-1 7oxo targets in serum-starved H9c2 cells by performing RNA-Seq (see Table 8) as shown in FIG. 6d.

[0267] [Table 8]

[0268] We then observed that anti-7oxo(4x) was introduced into rCMCs and attenuated PE-induced hypertrophy, as shown in Figure 6e. We also observed that anti-7oxo(4x) and α-MHC 13x, both of which were injected into ISO-treated mice as synthetic anti-7oxo(4x) RNA or as a cardiomyocyte-specific expression vector containing 13 targeting sites (α-MHC 13x), potently antagonized adrenergic cardiac hypertrophy, as shown in Figure 6f, and that the degree of delivery of anti-7oxo(α-MHC 13x) correlated with their inhibitory activity.

[0269] Administration of anti-7oxo (α-MHC 13x) maintained cardiomyocyte size as shown in Fig. 6g (top panel of Fig. 6g), and miR-1:7oxo 8 G targeting was globally suppressed (see the bottom panel of Fig. 6g and Table 9), but had no effect on ROS elevation in ISO-treated mouse hearts as shown in Fig. 6h.

[0270] [Table 9]

[0271] Additionally, as shown in Figure 6i, transgenic mice expressing anti-7oxo (α-MHC 13x) were generated (TG), and its expression was confirmed (RNA-Seq) as shown in Table 10 and Figure 6j.

[0272] [Table 10]

[0273] As a result, as shown in Fig. 6k, there was no basal difference in cardiac size (upper panel of Fig. 6k), but ISO-induced cardiac hypertrophy was significantly prevented in all three different TG models (lower panel of Fig. 6k), and miR-1:7o was significantly inhibited in all three different TG models (lower panel of Fig. 6k) as shown in Fig. 6l. 8 The overall suppression of G targets was observed, as shown in Fig. 6m. ISO vs. TG(-) ISO ) cardiomyocyte size was also reduced at IS in the presence of IS.

[0274] Taken together, miR-1, especially miR-1:7o 8 We have demonstrated that the site-specific oxidation of G may initiate and alter target interactions in cardiomyopathic patients, playing an endogenous driver role in cardiac hypertrophy and disease. In this regard, the ROS-induced miR-1:7o 8 A schematic diagram of the site-specific oxidation of G and its process of inducing cardiac hypertrophy is shown in Figure 6n.

[0275] Experimental Example 7. miR-1:o in plasma of an animal model of cardiac hypertrophy 8 G increase confirmed The upregulation of miR-1 in cardiac tissue from models of cardiac hypertrophy and patients with myocardial hypertrophy 8 After observing the increase in G modification, we examined whether this could be detected quantitatively to diagnose cardiac hypertrophy by quantitatively analyzing miR-1 levels in the blood of mice with induced cardiac hypertrophy. 8 First, we confirmed whether cardiac hypertrophy was induced in mice by ISO treatment. Figure 7a shows representative photographs of the hearts of mice with cardiac hypertrophy induced by ISO, with three mice per group. The hearts of the ISO-treated experimental group increased in size by an average of about 30% (36% H / B vs. 32% H / T) compared to the control group. The details are shown in Table 11. In addition, miR-1:o 8 To determine whether G was measured and enriched in cardiac hypertrophy, plasma samples were isolated and analyzed using miR-1:oG assays. 8 G was quantified (n=3).

[0276] [Table 11]

[0277] Next, blood plasma was separated from each animal model, small RNA was extracted, and the amount of miR-1 in the isolated small RNA was measured while simultaneously measuring the amount of miR-1 in the blood plasma. 8 G modified amount 8 The amount of miR-1 was measured by immunoprecipitation with G (Figure 7b). The amount of miR-1 was measured from RNA extracted from the same amount of plasma, and it was confirmed that miR-1 was present in plasma and that the amount was the same regardless of the induction of cardiac hypertrophy, as the measurement results between the experimental and control groups were not statistically significant (Figure 7c).

[0278] Then, miR-1:o present in plasma 8 To confirm G, small RNA isolated from plasma was 8 G-IP was performed (Figure 7b). 8 To correct for differences during the G-IP process and quantify 8 Human miR-124-3p, in which G was synthesized at position 5 of DNA, was added to the small RNA sample in the same amount before immunoprecipitation. As a result, oxidatively modified miR-1:o observed in cardiac hypertrophy plasma was 8 G increased by about 379% on average for each group of three mice, and this change was confirmed to be statistically significant through the Student's t-test (p = 0.031) (Figure 7d). Overall, there was no difference in microRNA-1 levels measured by qPCR in plasma between the cardiac hypertrophy and control groups, but o 8 Oxidatively modified microRNA-1 (miR-1:o) was detected by G-IP-qPCR. 8 G), we confirmed that it was significantly increased in patients with cardiac hypertrophy, and this led to the development of a non-invasive method to induce blood-based miR-1:o 8 It was observed that cardiac hypertrophy can be diagnosed through G measurement.

[0279] Experimental Example 8. Effect of antioxidants on myocardial hypertrophy and miR-1:7 during antioxidant treatment o 8 G Confirmation of the improved ability of anti-miR-1-7oxo, which inhibits miR-1, to suppress cardiomyocyte hypertrophy. It was confirmed that when the hypertrophied cells induced by PE treatment were treated with the antioxidant NAC, the hypertrophy was reduced as shown in Figure 8a (n = 4; inch 2 , ImageJ), as shown in FIG. 8b, co-treatment of ISO with NAC attenuated ISO-induced cardiac hypertrophy.

[0280] In addition, as shown in Fig. 8c, the o 8 It was confirmed that the increase in G was reduced by treatment with NAC (scale bar, 100 μm). In other words, treatment with the antioxidant NAC reduced the oxidation of miRNA.

[0281] After observing that ISO-induced cardiac hypertrophy was suppressed by NAC treatment (Fig. 1b), in order to confirm whether other antioxidants could suppress cardiac hypertrophy in the same way, H9c2 cells were treated with PE and ISO to induce hypertrophy of cardiomyocytes, and then treated with other antioxidants, butylated hydroxyanisole (BHA) and Antioxidant Supplement (A1345) from Sigma-Aldrich, which is sold as an antioxidant for cell culture (Fig. 8d). As a result, regardless of the type of antioxidant, all of them reduced the size of cardiomyocytes, and in particular, it was confirmed that the size of the H9c2 cardiomyocyte line did not increase at all when treated with PE or ISO, which was statistically significant in three repeated experiments (*, P<0.01).

[0282] We also confirmed that after incubation of primary rat embryo cardiac myocytes (rCMCs), PE treatment induced hypertrophy in the cells (Fig. 8e, upper panel). 8 G-modified form (miR-1:7o 8When the inhibitor anti-7oxo(4x) containing many 7oxo sites that recognize it was introduced to inhibit the hypertrophy of cardiomyocytes, it was confirmed that the hypertrophy of cardiomyocytes was inhibited after it had progressed, and when it was additionally treated with the antioxidant NAC, the maximum effect was observed in which the cardiomyocytes did not hypertrophy at all (Fig. 8e, middle panel). This result can be said to be a phenomenon that occurs when the effect of the antioxidant acts synergistically with anti-7oxo(4x), and it is also possible that the additional hypertrophy caused by the increased reactive oxygen species by PE treatment after anti-7oxo(4x) was introduced into the cells was suppressed. 8 This effect may be due to the prevention of G oxidation to anti-7oxo(4x). In fact, the additional o 8 To investigate whether G production inhibits the effect of miR-1:7o, we performed this experiment using miR-1:7o without PE treatment, which generates reactive oxygen species. 8 In order to induce cardiomyocyte hypertrophy by G introduction and simultaneously apply oxidative stress, we treated the cells with 100 μM hydrogen peroxide (H2O2) (Fig. 8e, lower panel).

[0283] As a result, the existing miR-1:7o 8 We observed that the cardiomyocyte hypertrophy induced by G expression was inhibited by hydrogen peroxide treatment, whereas treatment with the antioxidant NAC suppressed the expression of miR-1:7o 8 It could be confirmed that G-induced cardiomyocyte hypertrophy was demonstrated more efficiently.

[0284] Therefore, based on these results, it was confirmed that antioxidant treatment can suppress cardiomyocyte hypertrophy not only with NAC, but also with BHA and other common antioxidants for cell culture that can show antioxidant effects. 8It was found that the additional oxidative modification that may occur in G-modified microRNA or RNA that inhibits it can be prevented, and that this can efficiently induce the regulation of cardiomyocyte size through artificial RNA expression. In particular, cardiac hypertrophy is shown to be physiological hypertrophy and pathological hypertrophy. Physiological hypertrophy is when the heart enlarges to smoothly supply sufficient blood when needed in athletes and pregnant women, and in some situations, it may be necessary to temporarily induce it for the purpose of strengthening the function of the heart. Therefore, the expression of miR-1:7o in cardiomyocytes was confirmed. 8 Cardiac hypertrophy induced by G administration can act as such physiological hypertrophy, and antioxidant treatment in this case can not only efficiently induce the effect of cardiomyocyte hypertrophy, but also prevent additional oxidative stress that generally causes pathological phenomena, thereby suppressing pathological cardiac hypertrophy.

[0285] The above description of the present invention is for illustrative purposes only, and those skilled in the art will understand that the present invention can be easily modified into other specific forms without changing the technical concept or essential features of the present invention. Therefore, it should be understood that the above-described embodiments are illustrative and not limiting in all respects. [Sequence List Free Text]

[0286] SEQ ID NO: 1: miR-1:2 (8-oxoguanine), 8-oxoguanine at position 2 SEQ ID NO: 2: miR-1:3(8-oxoguanine), 8-oxoguanine at position 3 SEQ ID NO: 3: miR-1:7 (8-oxoguanine), 7th position is 8-oxoguanine SEQ ID NO: 4: miR-1 2-oxo site SEQ ID NO: 5: miR-1 3-oxo site SEQ ID NO: 6: miR-1 7-oxo site SEQ ID NO: 7: miR-1, positions 1 to 22 are miR-1 SEQ ID NO: 8: miR-1 passenger SEQ ID NO: 9: miR-1:2GU SEQ ID NO: 10: miR-1:3GU SEQ ID NO: 11: miR-1:7GU SEQ ID NO: 12: cel-miR-67, positions 1 to 22 are cel-miR-67 SEQ ID NO: 13: thymine deoxynucleotide (dT), positions 23-24 are thymine deoxynucleotide (dT) SEQ ID NO: 14: passenger strand, positions 23-24 are thymine deoxynucleotide (dT) SEQ ID NO: 15: 39-oxo-R, 22nd position is 8-oxoguanine SEQ ID NO: 16: 39R SEQ ID NO: 17: 8-oxoguanine spike-in, 2-3 positions are 8-oxoguanine SEQ ID NO: 18: G spike-in SEQ ID NO: 19: miRNA: 8-oxoguanine spike-in, 5th position is 8-oxoguanine SEQ ID NO: 20: miR-1 seed site SEQ ID NO: 21: control NT site SEQ ID NO: 22: Oligo dT adapter primer SEQ ID NO: 23: miRNA reverse primer SEQ ID NO: 24: 8-oxoguanine or G spike-in forward primer SEQ ID NO: 25: 8-oxoguanine or G spike-in reverse primer SEQ ID NO: 26: miRNA:8-oxoguanine spike-in forward primer SEQ ID NO: 27: miRNA:8-oxoguanine spike-in reverse primer SEQ ID NO: 28: Control forward primer SEQ ID NO: 29: Control reverse primer SEQ ID NO: 30: RT primer SEQ ID NO: 31: 39-Oxo-R or 39R forward primer SEQ ID NO: 32: 39-Oxo-R or 39R reverse primer SEQ ID NO: 33: 22 nt synthetic RNA, 7th position is 8-oxoguanine SEQ ID NO: 34: 3' adapter: 5'-adenylated, guanine methylphosphonate at position 2, dideoxycytosine at position 2 SEQ ID NO: 35: 5' adapter, position 31 is 2'-methoxy-C SEQ ID NO: 36: RT primer SEQ ID NO: 37: Universal forward primer SEQ ID NO: 38: Barcode primer SEQ ID NO: 39: Forward primer of miR-1-seed site SEQ ID NO: 40: reverse primer of miR-1-seed site SEQ ID NO: 41: Forward primer for miR-1-2 oxo site SEQ ID NO: 42: Reverse primer of miR-1-2 oxo site SEQ ID NO: 43: Forward primer for miR-1-3 oxo site SEQ ID NO: 44: Reverse primer of miR-1-3 oxo site SEQ ID NO: 45: Forward primer for miR-1-7 oxo site SEQ ID NO: 46: reverse primer of miR-1-7 oxo site SEQ ID NO: 47: Forward primer for miR-1 control site SEQ ID NO: 48: reverse primer of miR-1 control site SEQ ID NO: 49: Forward primer for NheI and XhoI sites SEQ ID NO: 50: Reverse primer for NheI and XhoI sites SEQ ID NO: 51: Forward primer for ApaI and XbaI sites SEQ ID NO: 52: ApaI and XbaI site reverse primer SEQ ID NO: 53: Forward primer for the remaining 33 bp of the hluc+ sequence SEQ ID NO: 54: Reverse primer for the remaining 33 bp of the hluc+ sequence SEQ ID NO: 55: hGH poly(A) forward primer SEQ ID NO: 56: hGH poly(A) reverse primer SEQ ID NO: 57: Anti-7Oxo (alpha-MHC 13x) forward primer SEQ ID NO: 58: Anti-7oxo (alpha-MHC 13x) reverse primer SEQ ID NO: 59: Control (anti-NT 13x) forward primer SEQ ID NO: 60: Control (anti-NT 13x) reverse primer SEQ ID NO: 61: hGH poly(A) forward primer SEQ ID NO: 62: hGH poly(A) reverse primer SEQ ID NO: 63: Anti-7oxo(4x) primer SEQ ID NO: 64: 8-oxodeoxyguanosine RNA spike-in, 5th position is 8-oxodeoxyguanosine SEQ ID NO: 65: miR-122: 2,3 (8-oxoguanine), 8-oxoguanine at position 2, 8-oxoguanine at position 3 SEQ ID NO: 66: let-7:4 (8-oxoguanine), 8-oxoguanine at position 4 SEQ ID NO: 67: miR-124:4 (8-oxoguanine), 4th position is 8-oxoguanine SEQ ID NO: 68: miR-122 SEQ ID NO: 69: let-7 SEQ ID NO: 70: miR-124

Claims

1. An RNA interference-inducing nucleic acid, At least one strand of the double stranded nucleic acid contains one or more 8-oxoguanines (o8G) as the first to ninth nucleotides from the 5' end, the first to ninth nucleotides from the 5' end comprise a sequence of a microRNA, the microRNA is miR-1; When the RNA interference-inducing nucleic acid is injected into a cell or an animal, myocardial hypertrophy is induced. RNA interference-inducing nucleic acids.

2. The RNA interference-inducing nucleic acid of claim 1, comprising one or more of the polynucleotides of Group 2 below. [Group 2] A polynucleotide consisting of the base sequence of SEQ ID NO: 1 (5'p-Uo8GGAAUGUAAAGAAGUAUGUAU-3'); A polynucleotide consisting of the base sequence of SEQ ID NO: 2 (5'p-UGo8GAAUGUAAAGAAGUAUGUAU-3'); A polynucleotide consisting of the base sequence of SEQ ID NO:3 (5'p-UGGAAUo8GUAAAGAAGUAUGUAU-3').

3. A composition comprising the RNA interference-inducing nucleic acid of claim 1 or 2 and an antioxidant.

4. A modified nucleic acid that specifically binds to a microRNA in which one or more guanines (G) at the second, third or seventh nucleotides from the 5' end are modified to 8-oxoguanine (o8G), The modified nucleic acid includes a polynucleotide complementary to six or more consecutive polynucleotides starting from any one of the second and third nucleotides from the 5' end of the modified microRNA; The modified microRNA includes adenine (A) as a nucleotide at a position that binds to one or more 8-oxoguanines (o8G) among the second, third, or seventh nucleotides from the 5' end of the modified microRNA; The microRNA is one or more of the microRNAs of Group 1 below: Modified nucleic acids. [Group 1] miR-1, let-7f-5p, and miR-1-3p.

5. The modified nucleic acid of claim 4, comprising one or more of the following base sequences: 5'-ACAUUCA-3', 5'-ACAUUAC-3', and 5'-AAAUUCC-3'.

6. A recombinant vector comprising a gene encoding the modified nucleic acid according to claim 4 or 5.

7. A modified nucleic acid that specifically binds to a microRNA in which one or more guanines (G) among the 1st to 9th nucleotides from the 5' end are modified to 8-oxoguanine (o8G), The modified nucleic acid includes a polynucleotide complementary to six or more consecutive polynucleotides starting from either the second or third nucleotide from the 5' end of the microRNA; A modified nucleic acid containing adenine (A) at a nucleotide position that binds to one or more 8-oxoguanines (o8G) among the 1st to 9th nucleotides from the 5' end of the microRNA, or a recombinant vector comprising a gene encoding the modified nucleic acid; The microRNA is miR-1. A pharmaceutical composition for treating cardiac hypertrophy.

8. The pharmaceutical composition for treating cardiac hypertrophy according to claim 7, wherein the microRNA has one or more guanines (G) at the second, third or seventh nucleotides from the 5' end modified to 8-oxoguanine (o8G).

9. The pharmaceutical composition for treating cardiac hypertrophy according to claim 7 or 8, further comprising an antioxidant.

10. 10. The pharmaceutical composition of claim 9, wherein the antioxidant is N-acetylcysteine ​​(NAC) or butylated hydroxyanisole (BHA).

11. A step of confirming whether one or more guanines (G) in the nucleotides of the microRNA isolated from the cardiomyocytes of the animal are modified to 8-oxoguanine (o8G); and When one or more guanines (G) among the 1st to 9th nucleotides from the 5' end of the microRNA are modified to 8-oxoguanine (o8G), the microRNA is classified as having cardiac hypertrophy; The microRNA is miR-1, let-7f-5p, or miR-1-3p; A method for providing information for the diagnosis of cardiac hypertrophy.

12. The 8-oxoguanine ８ The method for providing information for diagnosing cardiac hypertrophy according to claim 11, wherein the nucleotide modified with G) is the second, third or seventh nucleotide from the 5' end of the microRNA.

13. (a) constructing a recombinant vector by operably linking a gene encoding the modified nucleic acid according to claim 4 to a promoter; (b) introducing the recombinant vector into a fertilized egg of a non-human animal; and (c) A method for producing a non-human cardiac hypertrophy-resistant animal model, comprising the step of developing the fertilized egg to obtain a transformed animal model.

14. A non-human cardiac hypertrophy-resistant animal model comprising a recombinant vector in which a gene encoding the modified nucleic acid according to claim 4 is operably linked to a promoter.

15. (a) treating cardiomyocytes of an animal model of cardiac hypertrophy with a candidate substance; (b) analyzing the frequency of modification of guanine (G) to 8-oxoguanine (o8G) among nucleotides of microRNA expressed in cardiomyocytes of the cardiac hypertrophy animal model; and (c) selecting the candidate substance as a therapeutic agent for cardiac hypertrophy when the level of 8-oxoguanine (o8G) is reduced compared to when the candidate substance is not treated, The microRNA is miR-1. A method for screening candidate substances for treating cardiac hypertrophy.

16. The method for screening a candidate substance for treating cardiac hypertrophy according to claim 15, wherein the candidate substance is an antioxidant.

Images