Compounds and compositions for intracellular delivery of therapeutic agents - Patents.com

Abstract

To provide novel lipids and compositions involving the same.SOLUTION: Nanoparticle compositions include a novel lipid as well as additional lipids such as phospholipids, structural lipids, and PEG lipids. Nanoparticle compositions further including therapeutic and / or prophylactics such as RNA are useful in the delivery of therapeutic and / or prophylactics to mammalian cells or organs to, for example, regulate polypeptide, protein, or gene expression.SELECTED DRAWING: Figure 2

Description

[Technical Field]

[0001] The present disclosure provides novel compounds, compositions comprising such compounds, and methods involving lipid nanoparticle compositions for delivering one or more therapeutic and / or prophylactic agents and / or producing polypeptides in mammalian cells or organs. In addition to the novel lipids, the lipid nanoparticle compositions of the present disclosure may contain, in specific proportions, one or more cationic and / or ionic amino lipids, phospholipids including polyunsaturated lipids, PEG lipids, structured lipids, and / or therapeutic and / or prophylactic agents. [Background technology]

[0002] Effective targeted delivery of biologically active substances such as small molecule drugs, proteins and nucleic acids is an ongoing medical challenge.In particular, the delivery of nucleic acids into cells is difficult due to the relative instability and low cell permeability of these species.Therefore, there is a need to develop methods and compositions for facilitating the delivery of therapeutic and / or prophylactic drugs such as nucleic acids into cells.

[0003] Lipid-containing nanoparticle compositions, liposomes, and lipoplexes have been proven to be effective as a transport vehicle for biologically active substances, such as small molecule drugs, proteins, and nucleic acids, into cells and / or intracellular compartments.Such compositions generally comprise one or more "cationic" and / or amino (ionic) lipids, phospholipids including polyunsaturated lipids, structural lipids (e.g., sterols), and / or lipids containing polyethylene glycol (PEG lipids).Cationic and / or ionic lipids include, for example, amine-containing lipids that can be easily protonated. Summary of the Invention [Problem to be solved by the invention]

[0004] Although a variety of such lipid-containing nanoparticle compositions have been demonstrated, improvements in safety, efficacy, and specificity remain lacking. [Means for solving the problem]

[0005] The present disclosure provides novel compounds and compositions and methods involving same. A first aspect of the present disclosure is a compound of formula (I):

[0006] [ka]

[0007] (In the formula: R1 is C 5~30 Alkyl, C 5~20 Alkenyl, -R * selected from the group consisting of -YR", -YR", and -R"M'R'; R2 and R3 are independently H, C 1~14 Alkyl, C 2~14 Alkenyl, -R * YR”, -YR”, and -R * OR”, or R2 and R3 together with the atoms to which they are attached form a heterocyclic or carbocyclic ring; R4 is C 3~6 Carbocyclic ring, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1~6 alkyl, where Q is a carbocycle, a heterocycle, -OR, -O(CH) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -N(R)2, -C(O)N(R)2, -N( R)C(O)R, -N(R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -N(R)R8, -O(CH2) n-OR, -N(R)C(=NR9)N(R)2, -N(R)C(=CHR9)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR9)N(R)2, -N(OR)C(=CHR9)N(R)2, -C(=NR9)N(R)2, -C(=NR9)R, -C(O)N(R)OR, and -C(R)N(R)2C(O)OR, wherein each n is independently selected from 1, 2, 3, 4, and 5; Each R5 is independently C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; Each R6 is independently C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; R8, C 3~6 selected from the group consisting of carbocycles and heterocycles; R9 is H, CN, NO2, C 1~6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2~6 Alkenyl, C 3~6 selected from the group consisting of carbocycles and heterocycles; Each R is independently C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; Each R' is independently C 1~18 Alkyl, C 2~18 Alkenyl, -R *selected from the group consisting of Y-R", -Y-R", and H; Each R" is independently C 3~14 Alkyl and C 3~14 alkenyl; Each R * But independently, C 1~12 Alkyl and C 2~12 alkenyl; Each Y is independently C 3~6 It is a carbocyclic ring; each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13 or a salt or isomer thereof.

[0008] In certain embodiments, a subset of compounds of Formula (I) are those in which R4 is -(CH2) n Q, -(CH2) n When CHQR, -CHQR, or -CQ(R), compounds are included in which (i) when n is 1, 2, 3, 4, or 5, Q is not -N(R), or (ii) when n is 1 or 2, Q is not a 5-, 6-, or 7-membered heterocycloalkyl.

[0009] In another embodiment, another subset of compounds of formula (I) is R1 is C 5~30 Alkyl, C 5~20 Alkenyl, -R * selected from the group consisting of -YR", -YR", and -R"M'R'; R2 and R3 are independently H, C 1~14 Alkyl, C 2~14 Alkenyl, -R * YR”, -YR”, and -R * OR”, or R2 and R3 together with the atoms to which they are attached form a heterocyclic or carbocyclic ring; R4 is C 3~6 Carbocyclic ring, -(CH2) n Q, -(CH2) nCHQR, -CHQR, -CQ(R)2, and unsubstituted C 1~6 alkyl, wherein Q is selected from the group consisting of C 3~6 Carbocycle, 5- to 14-membered heteroaryl having one or more heteroatoms selected from N, O, and S, -OR, -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -C(O)N(R)2, -N(R)C(O)R, -N( R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -CRN(R)2C(O)OR, -N(R)R8, -O(CH2) n OR, -N(R)C(=NR9)N(R)2, -N(R)C(=CHR9)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR9)N(R)2, -N(OR)C(=CHR9)N(R)2, -C(=NR9)N(R)2, -C(=NR9)R, -C(O)N(R)OR, and oxo(=O), OH, amino, mono- or dialkylamino, and C 1~3 5- to 14-membered heterocycloalkyl having one or more heteroatoms selected from N, O, and S substituted with one or more substituents selected from alkyl, where each n is independently selected from 1, 2, 3, 4, and 5; Each R5 is independently C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; Each R6 is independently C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; R8, C 3~6 selected from the group consisting of carbocycles and heterocycles; R9 is H, CN, NO2, C 1~6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2~6 Alkenyl, C 3~6 selected from the group consisting of carbocycles and heterocycles; Each R is independently C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; Each R' is independently C 1~18 Alkyl, C 2~18 Alkenyl, -R * selected from the group consisting of Y-R", -Y-R", and H; Each R" is independently C 3~14 Alkyl and C 3~14 alkenyl; Each R * But independently, C 1~12 Alkyl and C 2~12 alkenyl; Each Y is independently C 3~6 It is a carbocyclic ring; each X is independently selected from the group consisting of F, Cl, Br, and I; compounds wherein m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0010] In yet another embodiment, another subset of compounds of formula (I) is R1 is C 5~30 Alkyl, C 5~20 Alkenyl, -R * selected from the group consisting of -YR", -YR", and -R"M'R'; R2 and R3 are independently H, C 1~14 Alkyl, C 2~14 Alkenyl, -R *YR”, -YR”, and -R * OR”, or R2 and R3 together with the atoms to which they are attached form a heterocyclic or carbocyclic ring; R4 is C 3~6 Carbocyclic ring, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1~6 alkyl, wherein Q is selected from the group consisting of C 3~6 Carbocycle, 5- to 14-membered heterocycle having one or more heteroatoms selected from N, O, and S, -OR, -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -C(O)N(R)2, -N(R)C(O)R, -N( R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -CRN(R)2C(O)OR, -N(R)R8, -O(CH2) n OR, -N(R)C(=NR9)N(R), -N(R)C(=CHR9)N(R), -OC(O)N(R), -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)R, -N(OR)C(O)OR, -N(OR)C(O)N(R), -N(OR)C(S)N(R), -N(OR)C(=NR9)N(R), -N(OR)C(=CHR9)N(R), -C(=NR9)R, -C(O)N(R)OR, and -C(=NR9)N(R), wherein each n is independently selected from 1, 2, 3, 4, and 5; Q is a 5- to 14-membered heterocycle, and (i) R4 is -(CH2) n Q, where n is 1 or 2, or (ii) R4 is -(CH2) n CHQR, where n is 1, or (iii) when R4 is -CHQR, and -CQ(R)2, Q is either a 5- to 14-membered heteroaryl or an 8- to 14-membered heterocycloalkyl; Each R5 is independently C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; Each R6 is independently C 1~3Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; R8, C 3~6 selected from the group consisting of carbocycles and heterocycles; R9 is H, CN, NO2, C 1~6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2~6 Alkenyl, C 3~6 selected from the group consisting of carbocycles and heterocycles; Each R is independently C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; Each R' is independently C 1~18 Alkyl, C 2~18 Alkenyl, -R * selected from the group consisting of Y-R", -Y-R", and H; Each R" is independently C 3~14 Alkyl and C 3~14 alkenyl; Each R * But independently, C 1~12 Alkyl and C 2~12 alkenyl; Each Y is independently C 3~6 It is a carbocyclic ring; each X is independently selected from the group consisting of F, Cl, Br, and I; compounds wherein m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0011] In yet another embodiment, another subset of compounds of formula (I) is R1 is C 5~30 Alkyl, C 5~20 Alkenyl, -R * selected from the group consisting of -YR", -YR", and -R"M'R'; R2 and R3 are independently H, C 1~14 Alkyl, C 2~14 Alkenyl, -R * YR”, -YR”, and -R * OR”, or R2 and R3 together with the atoms to which they are attached form a heterocyclic or carbocyclic ring; R4 is C 3~6 Carbocyclic ring, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1~6 alkyl, wherein Q is selected from the group consisting of C 3~6 Carbocycle, 5- to 14-membered heteroaryl having one or more heteroatoms selected from N, O, and S, -OR, -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -C(O)N(R)2, -N(R)C(O)R, -N( R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -CRN(R)2C(O)OR, -N(R)R8, -O(CH2) n -OR, -N(R)C(=NR9)N(R)2, -N(R)C(=CHR9)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR9)N(R)2, -N(OR)C(=CHR9)N(R)2, -C(=NR9)R, -C(O)N(R)OR, and -C(=NR9)N(R)2, wherein each n is independently selected from 1, 2, 3, 4, and 5; Each R5 is independently C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; Each R6 is independently C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; R8, C 3~6 selected from the group consisting of carbocycles and heterocycles; R9 is H, CN, NO2, C 1~6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2~6 Alkenyl, C 3~6 selected from the group consisting of carbocycles and heterocycles; Each R is independently C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; Each R' is independently C 1~18 Alkyl, C 2~18 Alkenyl, -R * selected from the group consisting of Y-R", -Y-R", and H; Each R" is independently C 3~14 Alkyl and C 3~14 alkenyl; Each R * But independently, C 1~12 Alkyl and C 2~12 alkenyl; Each Y is independently C 3~6 It is a carbocyclic ring; each X is independently selected from the group consisting of F, Cl, Br, and I; compounds wherein m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0012] In yet another embodiment, another subset of compounds of formula (I) is R1 is C 5~30 Alkyl, C 5~20 Alkenyl, -R * selected from the group consisting of -YR", -YR", and -R"M'R'; R2 and R3 are independently H, C 2~14 Alkyl, C 2~14 Alkenyl, -R * YR”, -YR”, and -R * OR”, or R2 and R3 together with the atoms to which they are attached form a heterocyclic or carbocyclic ring; R4 is -(CH2) n Q or -(CH2) n CHQR, where Q is -N(R)2 and n is selected from 3, 4, and 5; Each R5 is independently C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; Each R6 is independently C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; Each R is independently C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; Each R' is independently C 1~18 Alkyl, C 2~18 Alkenyl, -R *selected from the group consisting of Y-R", -Y-R", and H; Each R" is independently C 3~14 Alkyl and C 3~14 alkenyl; Each R * But independently, C 1~12 Alkyl and C 1~12 alkenyl; Each Y is independently C 3~6 It is a carbocyclic ring; each X is independently selected from the group consisting of F, Cl, Br, and I; compounds wherein m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0013] In yet another embodiment, another subset of compounds of formula (I) is R1 is C 5~30 Alkyl, C 5~20 Alkenyl, -R * selected from the group consisting of -YR", -YR", and -R"M'R'; R2 and R3 are independently selected from the group consisting of C 1~14 Alkyl, C 2~14 Alkenyl, -R * YR”, -YR”, and -R * OR”, or R2 and R3 together with the atoms to which they are attached form a heterocyclic or carbocyclic ring; R4 is -(CH2) n Q, -(CH2) n -CHQR, -CHQR, and -CQ(R)2, where Q is -N(R)2 and n is selected from 1, 2, 3, 4, and 5; Each R5 is independently C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; Each R6 is independently C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; Each R is independently C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; Each R' is independently C 1~18 Alkyl, C 2~18 Alkenyl, -R * selected from the group consisting of Y-R", -Y-R", and H; Each R" is independently C 3~14 Alkyl and C 3~14 alkenyl; Each R * But independently, C 1~12 Alkyl and C 1~12 alkenyl; Each Y is independently C 3~6 It is a carbocyclic ring; each X is independently selected from the group consisting of F, Cl, Br, and I; compounds wherein m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0014] In certain embodiments, a subset of compounds of formula (I) is of formula (IA):

[0015] [ka]

[0016] wherein l is selected from 1, 2, 3, 4, and 5; m is selected from 5, 6, 7, 8, and 9; M is a bond or M'; and R is an unsubstituted C 1~3 Alkyl, or -(CH2) n Q, where Q is OH, —NHC(S)N(R), —NHC(O)N(R), —N(R)C(O)R, —N(R)S(O)R, —N(R)R, —NHC(═NR)N(R), —NHC(═CHR)N(R), —OC(O)N(R), —N(R)C(O)OR, heteroaryl, or heterocycloalkyl; M and M′ are independently selected from —C(O)O—, —OC(O)—, —C(O)N(R′)—, —P(O)(OR′)O—, —SS—, an aryl group, and a heteroaryl group; R and R are independently selected from H, C 1~14 Alkyl, and C 2~14 alkenyl) or a salt or isomer thereof.

[0017] In certain embodiments, a subset of compounds of formula (I) is represented by formula (II):

[0018] [ka]

[0019] wherein l is selected from 1, 2, 3, 4, and 5; M is a bond or M'; and R is an unsubstituted C 1~3 Alkyl, or -(CH2) nQ, where n is 2, 3, or 4, and Q is OH, —NHC(S)N(R), —NHC(O)N(R), —N(R)C(O)R, —N(R)S(O)R, —N(R)R, —NHC(═NR)N(R), —NHC(═CHR)N(R), —OC(O)N(R), —N(R)C(O)OR, heteroaryl, or heterocycloalkyl; M and M′ are independently selected from —C(O)O—, —OC(O)—, —C(O)N(R′)—, —P(O)(OR′)O—, —SS—, an aryl group, and a heteroaryl group; R and R are independently selected from H, C 1~14 Alkyl, and C 2~14 alkenyl) or a salt or isomer thereof.

[0020] In certain embodiments, a subset of compounds of formula (I) is represented by formula (IIa), (IIb), (IIc), or (IIe):

[0021] [ka]

[0022] wherein R4 is as described herein, or a salt or isomer thereof. In certain embodiments, a subset of compounds of formula (I) is represented by formula (IId):

[0023] [ka]

[0024] wherein n is 2, 3, or 4; m, R′, R″, and R2-R6 are as described herein, or a salt or isomer thereof. For example, each of R2 and R3 is independently selected from the group consisting of C 5~14 Alkyl and C 5~14 alkenyl.

[0025] In another aspect, the disclosure features a nanoparticle composition including a lipid component that includes a compound described herein (e.g., a compound represented by Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe)).

[0026] In yet another aspect, the present disclosure features a pharmaceutical composition comprising a nanoparticle composition according to the previous aspect and a pharmaceutically acceptable carrier. For example, the pharmaceutical composition may be refrigerated or frozen for storage and / or transportation (e.g., stored at a temperature of 4°C or less, such as about -150°C to about 0°C or about -80°C to about -20°C (e.g., about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C). For example, the pharmaceutical composition may be a solution refrigerated for storage and / or transportation, e.g., at about -20°C, -30°C, -40°C, -50°C, -60°C, -70°C, or -80°C.

[0027] In another aspect, the disclosure provides a method for delivering a therapeutic and / or prophylactic agent (e.g., mRNA) to a cell (e.g., a mammalian cell), comprising administering to a subject (e.g., a mammal, a human, etc.) a nanoparticle composition comprising (i) a lipid component comprising a phospholipid (such as a polyunsaturated lipid), a PEG-lipid, a structured lipid, and a compound of Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe), and (ii) a therapeutic and / or prophylactic agent, wherein the administration comprises contacting the cell with the nanoparticle composition, whereby the therapeutic and / or prophylactic agent is delivered to the cell.

[0028] In another aspect, the present disclosure provides a method for producing a polypeptide of interest in a cell (e.g., a mammalian cell), comprising contacting the cell with (i) a nanoparticle composition comprising a lipid component comprising a phospholipid (such as a polyunsaturated lipid), a PEG-lipid, a structured lipid, and a compound of Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe), and (ii) an mRNA encoding the polypeptide of interest, whereby the mRNA can be translated within the cell to produce the polypeptide.

[0029] In another aspect, the present disclosure provides a method for treating a disease or disorder in a mammal (e.g., a human) in need thereof. The method comprises administering to the mammal a therapeutically effective amount of a nanoparticle composition comprising (i) a lipid component comprising a phospholipid (such as a polyunsaturated lipid), a PEG-lipid, a structured lipid, and a compound of Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe), and (ii) a therapeutic and / or prophylactic agent (e.g., mRNA). In some embodiments, the disease or disorder is characterized by dysfunctional or abnormal protein or polypeptide activity. For example, the disease or disorder is selected from the group consisting of rare diseases, infectious diseases, cancer and proliferative diseases, genetic diseases (e.g., cystic fibrosis), autoimmune diseases, diabetes, neurodegenerative diseases, cardiovascular and renal vascular diseases, and metabolic diseases.

[0030] In another aspect, the disclosure provides a method for delivering (e.g., specifically delivering) a therapeutic and / or prophylactic agent to an organ (e.g., liver, spleen, lung, or femur) of a mammal. The method includes administering to a subject (e.g., a mammal) a nanoparticle composition comprising (i) a lipid component comprising a phospholipid, a PEG-lipid, a structured lipid, and a compound of Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe), and (ii) a therapeutic and / or prophylactic agent (e.g., mRNA), wherein the administration includes contacting cells with the nanoparticle composition, whereby the therapeutic and / or prophylactic agent is delivered to the target organ (e.g., liver, spleen, lung, or femur).

[0031] In another aspect, the disclosure features a method for enhanced delivery of a therapeutic and / or prophylactic agent (e.g., mRNA) to a target tissue (e.g., liver, spleen, lung, or femur). The method includes administering to a subject (e.g., a mammal) a nanoparticle composition including: (i) a lipid component including a compound of Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe), a phospholipid, a structured lipid, and a PEG-lipid; and (ii) a therapeutic and / or prophylactic agent, wherein the administration includes contacting the target tissue with the nanoparticle composition, whereby the therapeutic and / or prophylactic agent is delivered to the target tissue.

[0032] In yet another aspect, the disclosure features a method of reducing immunogenicity, comprising introducing into a cell a nanoparticle composition of the disclosure, wherein the nanoparticle composition reduces induction of a cellular immune response in the cell to the nanoparticle composition compared to induction of a cellular immune response in the cell induced by a control composition comprising a control lipid instead of a compound of Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe). For example, the cellular immune response can be an innate immune response, an adaptive immune response, or both.

[0033] The present disclosure also includes methods of synthesizing compounds of Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe), and methods of making nanoparticle compositions that include a lipid component that includes a compound of Formula (I), (IA), (II), (II), (IIa), (IIb), (IIc), (IId), or (IIe). [Brief explanation of the drawings]

[0034] [Figure 1] FIG. 1 shows the results of pre-treatment of non-human primates with methotrexate or dexamethasone prior to administration of a nanoparticle composition comprising MC3. [Figure 2] FIG. 1 shows hEPO mRNA expression measured after intravenous administration of various nanoparticle compositions at a dose of 0.01 mpk via a 60 minute infusion to naive cynomolgus monkeys. [Figure 3] 1 shows the results of hEPO expression measured after intravenous administration of various nanoparticle compositions containing compounds 26, 18, 25, and MC3 to rats at various doses, respectively. [Figure 4] 1 shows the results of hEPO expression measured after intravenous administration of various nanoparticle compositions containing compounds 26, 18, 25, and MC3 to rats at various doses, respectively. [Figure 5] 1 shows the results of hEPO expression measured after intravenous administration of various nanoparticle compositions containing compounds 26, 18, 25, and MC3 to rats at various doses, respectively. [Figure 6] 1 shows the results of hEPO expression measured after intravenous administration of various nanoparticle compositions containing compounds 26, 18, 25, and MC3 to rats at various doses, respectively. [Figure 7] FIG. 1 shows the area under the curve (AUC) for nanoparticle compositions comprising compounds 18, 25, and 26 and MC3 at various doses ranging from 0.005 mpk to 2 mpk. [Figure 8]Figure 1 shows the results of luciferase expression measured after intramuscular administration of various nanoparticle compositions containing MC3, compounds 168-170, and 173-175 to mice at 0.01 mpk at various time points: 3 hours (left panel), 6 hours (middle panel), and 24 hours (right panel). Numbers 1-7 in this figure correspond to MC3, compounds 168-170, and 173-175, respectively. [Figure 9] Figure 1 shows the results of hEPO expression measured after intramuscular administration of various nanoparticle compositions containing MC3, compounds 18, 25, 30, 108-112, 60, and 122 to mice at 0.01 mpk at various time points: 3 hours (left block), 6 hours (middle block), and 24 hours (right block). Numbers 1-11 in this figure correspond to MC3, compounds 18, 25, 30, 108-112, 60, and 122, respectively. [Figure 10] Figure 1 shows the results of luciferase expression (total luminous flux) measured after intravenous administration of various nanoparticle compositions containing MC3 or various compounds disclosed herein. Numbers 1-12 in this figure correspond to compound 18, MC3, compounds 48-50, 54, 111, 60, 75, 68, 66, 128, 65, 130, 133-135, 147, 96, and 151, respectively. [Figure 11A] Figure 1 shows the results of anti-HA (anti-hemagglutinin) antibody expression measured after intravenous administration of various nanoparticle compositions containing MC3 and compound 18 at a dose of 0.1 mpk (A) via a 60-minute infusion to naive cynomolgus monkeys. [Figure 11B] Figure 1 shows the results of anti-HA (anti-hemagglutinin) antibody expression measured after intravenous administration of various nanoparticle compositions containing MC3 and compound 18 at a dose of 0.3 mpk (B) via a 60-minute infusion to naive cynomolgus monkeys. DETAILED DESCRIPTION OF THE INVENTION

[0035] The present disclosure relates to novel lipids and lipid nanoparticle compositions comprising the novel lipids. The present disclosure also provides methods for delivering therapeutic and / or prophylactic agents to mammalian cells, specifically methods for delivering therapeutic and / or prophylactic agents to mammalian organs, methods for producing a polypeptide of interest in mammalian cells, and methods for treating a disease or disorder in a mammal in need thereof. For example, a method for producing a polypeptide of interest in a cell can include contacting a nanoparticle composition comprising mRNA with a mammalian cell, whereby the mRNA can be translated to produce the polypeptide of interest. A method for delivering a therapeutic and / or prophylactic agent to a mammalian cell or organ can include administering to a subject a nanoparticle composition comprising the therapeutic and / or prophylactic agent, whereby the administration includes contacting the cell or organ with the composition, whereby the therapeutic and / or prophylactic agent is delivered to the cell or organ.

[0036] lipids The present disclosure provides lipids comprising a central amine moiety and at least one biodegradable group. The lipids described herein can be advantageously used in lipid nanoparticle compositions for the delivery of therapeutic and / or prophylactic agents to mammalian cells or organs. For example, the lipids described herein have little or no immunogenicity. For example, any lipid compound of formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe) has lower immunogenicity compared to a control lipid (e.g., MC3, KC2, or DLinDMA). For example, a formulation comprising a lipid disclosed herein and a therapeutic or prophylactic agent has an increased therapeutic index compared to a corresponding formulation comprising a control lipid (e.g., MC3, KC2, or DLinDMA) and the same therapeutic or prophylactic agent.

[0037] In a first aspect of the present invention, the compounds described herein have the formula (I):

[0038] [ka]

[0039] (In the formula: R1 is C 5~30 Alkyl, C 5~20 Alkenyl, -R * selected from the group consisting of -YR", -YR", and -R"M'R'; R2 and R3 are independently H, C 1~14 Alkyl, C 2~14 Alkenyl, -R * YR”, -YR”, and -R * OR”, or R2 and R3 together with the atoms to which they are attached form a heterocyclic or carbocyclic ring; R4 is C 3~6 Carbocyclic ring, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1~6 alkyl, where Q is a carbocycle, a heterocycle, -OR, -O(CH) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -N(R)2, -C(O)N(R)2, -N( R)C(O)R, -N(R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -N(R)R8, -O(CH2) n -OR, -N(R)C(=NR9)N(R)2, -N(R)C(=CHR9)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR9)N(R)2, -N(OR)C(=CHR9)N(R)2, -C(=NR9)N(R)2, -C(=NR9)R, -C(O)N(R)OR, and -C(R)N(R)2C(O)OR, wherein each n is independently selected from 1, 2, 3, 4, and 5; Each R5 is independently C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; Each R6 is independently C 1~3 Alkyl, C2~3 selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; R8, C 3~6 selected from the group consisting of carbocycles and heterocycles; R9 is H, CN, NO2, C 1~6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2~6 Alkenyl, C 3~6 selected from the group consisting of carbocycles and heterocycles; Each R is independently C 1~3 Alkyl, C 2~3 selected from the group consisting of alkenyl, and H; Each R' is independently C 1~18 Alkyl, C 2~18 Alkenyl, -R * selected from the group consisting of Y-R", -Y-R", and H; Each R" is independently C 3~14 Alkyl and C 3~14 alkenyl; Each R * But independently, C 1~12 Alkyl and C 2~12 alkenyl; Each Y is independently C 3~6 It is a carbocyclic ring; each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; and wherein R4 is -(CH2) n Q, -(CH2) nWhen Q is CHQR, -CHQR, or -CQ(R), (i) when n is 1, 2, 3, 4, or 5, Q is not -N(R), or (ii) when n is 1 or 2, Q is not a 5-, 6-, or 7-membered heterocycloalkyl. or a salt or isomer thereof.

[0040] In certain embodiments, a subset of compounds of formula (I) is of formula (IA):

[0041] [ka]

[0042] wherein l is selected from 1, 2, 3, 4, and 5; m is selected from 5, 6, 7, 8, and 9; M is a bond or M'; and R is an unsubstituted C 1~3 Alkyl, or -(CH2) n Q, where Q is OH, —NHC(S)N(R), —NHC(O)N(R), —N(R)C(O)R, —N(R)S(O)R, —N(R)R, —NHC(═NR)N(R), —NHC(═CHR)N(R), —OC(O)N(R), —N(R)C(O)OR, heteroaryl, or heterocycloalkyl; M and M′ are independently selected from —C(O)O—, —OC(O)—, —C(O)N(R′)—, —P(O)(OR′)O—, —SS—, an aryl group, and a heteroaryl group; R and R are independently selected from H, C 1~14 Alkyl, and C 2~14 For example, m is 5, 7, or 9. For example, Q is OH, -NHC(S)N(R), or -NHC(O)N(R). For example, Q is -N(R)C(O)R, or -N(R)S(O)R.

[0043] In certain embodiments, a subset of compounds of formula (I) is represented by formula (II):

[0044] [ka]

[0045] wherein l is selected from 1, 2, 3, 4, and 5; M is a bond or M'; and R is an unsubstituted C 1~3 Alkyl, or -(CH2) n Q, where n is 2, 3, or 4, and Q is OH, —NHC(S)N(R), —NHC(O)N(R), —N(R)C(O)R, —N(R)S(O)R, —N(R)R, —NHC(═NR)N(R), —NHC(═CHR)N(R), —OC(O)N(R), —N(R)C(O)OR, heteroaryl, or heterocycloalkyl; M and M′ are independently selected from —C(O)O—, —OC(O)—, —C(O)N(R′)—, —P(O)(OR′)O—, —SS—, an aryl group, and a heteroaryl group; R and R are independently selected from H, C 1~14 Alkyl, and C 2~14 alkenyl) or a salt or isomer thereof.

[0046] Compounds of any one of formula (I) or (IA) include one or more of the following features, as applicable: In some embodiments, M1 is M'.

[0047] In certain embodiments, M and M' are independently -C(O)O- or -OC(O)-. In certain embodiments, at least one of M and M' is -C(O)O- or -OC(O)-.

[0048] In some embodiments, M and M' are independently -SS-. In certain embodiments, at least one of M and M' is -SS. In some embodiments, one of M and M' is -C(O)O- or -OC(O)-, and the other is -SS-. For example, M is -C(O)O- or -OC(O)- and M' is -SS-, or M' is -C(O)O- or -OC(O)- and M is -SS-.

[0049] In certain embodiments, 1 is 1, 3, or 5. In certain embodiments, R4 is unsubstituted methyl or -(CH2) n Q, where Q is OH, —NHC(S)N(R)2, —NHC(O)N(R)2, —N(R)C(O)R, or —N(R)S(O)2R.

[0050] In some embodiments, Q is OH. In some embodiments, Q is —NHC(S)N(R) 2 . In some embodiments, Q is —NHC(O)N(R) 2 .

[0051] In certain embodiments, Q is —N(R)C(O)R. In certain embodiments, Q is —N(R)S(O)R. In one embodiment, Q is —O(CH) n N(R)2.

[0052] In one embodiment, Q is —O(CH) n It is OR. In some embodiments, Q is —N(R)R 8 . In some embodiments, Q is —NHC(═NR 9 )N(R) 2 .

[0053] In some embodiments, Q is —NHC(═CHR 9 )N(R) 2 . In some embodiments, Q is —OC(O)N(R) 2 . In certain embodiments, Q is —N(R)C(O)OR.

[0054] In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 4.

[0055] In one embodiment, M1 is absent. In some embodiments, R' is C 1~18 Alkyl, C 2~18 Alkenyl, -R * YR”, or -YR”.

[0056] In one embodiment, R2 and R3 are independently selected from the group consisting of C 3~14 Alkyl or C 3~14 It is alkenyl. In one embodiment, the compound of formula (I) has the formula (IIa)

[0057] [ka]

[0058] wherein R4 is as described herein, or a salt or isomer thereof. In another embodiment, the compound of formula (I) has the formula (IIb)

[0059] [ka]

[0060] wherein R4 is as described herein, or a salt or isomer thereof. In another embodiment, the compound of formula (I) has formula (IIc) or (IIe):

[0061] [ka]

[0062] wherein R4 is as described herein, or a salt or isomer thereof. In a further embodiment, the compound of formula (I) has the formula (IId)

[0063] [ka]

[0064] wherein n is 2, 3, or 4; m, R′, R″, and R2-R6 are as described herein, or a salt or isomer thereof. For example, each of R2 and R3 is independently selected from the group consisting of C 5~14 Alkyl and C 5~14 alkenyl.

[0065] The compounds of any one of Formulas (I), (IA), (II), (IIa), (IIb), (IIc), (IId), and (IIe) include one or more of the following features, if applicable:

[0066] In one embodiment, R4 is C 3~6 Carbocyclic ring, -(CH2) n Q, -(CH2) n -CHQR, -CHQR, -CQ(R)2, wherein Q is C 3~6 A 5- to 14-membered aromatic or non-aromatic heterocycle having one or more heteroatoms selected from carbocycles, N, O, S, and P, -OR, -O(CH2) n and -C(R)N(R)C(O)OR, -OC(O)R, -CX, -CXH, -CXH, -CN, -N(R), -C(O)N(R), -N(R)C(O)R, -N(R)S(O)R, -N(R)C(O)N(R), -N(R)C(S)N(R), and -C(R)N(R)C(O)OR, wherein each n is independently selected from 1, 2, 3, 4, and 5.

[0067] In another embodiment, R4 is C 3~6 Carbocyclic ring, -(CH2) n Q, -(CH2) n -CHQR, -CHQR, and -CQ(R), wherein Q is selected from the group consisting of C3~6 Carbocycle, 5- to 14-membered heteroaryl having one or more heteroatoms selected from N, O, and S, -OR, -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -C(O)N(R)2, -N(R)C(O)R, -N(R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -C(R)N(R)2C(O)OR, and oxo(=O), OH, amino, and C 1~3 and 5- to 14-membered heterocycloalkyl having one or more heteroatoms selected from N, O, and S substituted with one or more substituents selected from alkyl, where each n is independently selected from 1, 2, 3, 4, and 5.

[0068] In another embodiment, R4 is C 3~6 Carbocyclic ring, -(CH2) n Q, -(CH2) n -CHQR, -CHQR, and -CQ(R), wherein Q is selected from the group consisting of C 3~6 Carbocycle, 5- to 14-membered heterocycle having one or more heteroatoms selected from N, O, and S, -OR, -O(CH2) n and (i) R is -(CH)N(R)C(O)R, -C(O)OR, -OC(O)R, -CX, -CXH, -CXH, -CN, -C(O)N(R), -N(R)C(O)R, -N(R)S(O)R, -N(R)C(O)N(R), -N(R)C(S)N(R), -C(R)N(R)C(O)OR, where each n is independently selected from 1, 2, 3, 4, and 5; Q is a 5- to 14-membered heterocycle, and (ii) R is -(CH) n Q, where n is 1 or 2, or (ii) R4 is -(CH2) n (iii) when R4 is -CHQR, and -CQ(R)2, Q is either a 5- to 14-membered heteroaryl or an 8- to 14-membered heterocycloalkyl.

[0069] In another embodiment, R4 is C 3~6Carbocyclic ring, -(CH2) n Q, -(CH2) n -CHQR, -CHQR, and -CQ(R), wherein Q is selected from the group consisting of C 3~6 Carbocycle, 5- to 14-membered heteroaryl having one or more heteroatoms selected from N, O, and S, -OR, -O(CH2) n and n is independently selected from 1, 2, 3, 4, and 5.

[0070] In another embodiment, R4 is unsubstituted C 1~4 Alkyl, for example, unsubstituted methyl. In certain embodiments, the present disclosure provides a compound of formula (I) wherein R4 is -(CH2) n Q or -(CH2) n CHQR, where Q is —N(R) 2 and n is selected from 3, 4, and 5.

[0071] In certain embodiments, the present disclosure provides a compound of formula (I) wherein R4 is -(CH2) n Q, -(CH2) n and n is selected from the group consisting of -CHQR, -CHQR, and -CQ(R)2, where Q is -N(R)2 and n is selected from 1, 2, 3, 4, and 5.

[0072] In certain embodiments, the present disclosure provides a compound of formula (I), wherein R and R are independently selected from the group consisting of: 2~14 Alkyl, C 2~14 Alkenyl, -R * YR”, -YR”, and -R * OR" or R2 and R3 together with the atoms to which they are attached form a heterocycle or a carbocycle and R4 is selected from the group consisting of -(CH2) nQ or -(CH2) n CHQR, where Q is —N(R) 2 and n is selected from 3, 4, and 5.

[0073] In certain embodiments, R2 and R3 are independently C 2~14 Alkyl, C 2~14 Alkenyl, -R * YR”, -YR”, and -R * OR”, or R2 and R3 together with the atoms to which they are attached form a heterocyclic or carbocyclic ring.

[0074] In one embodiment, R is C 5~20 Alkyl and C 5~20 alkenyl. In other embodiments, R1 is -R * -YR", -YR", and -R"M'R'.

[0075] In certain embodiments, R is -R * In some embodiments, Y is a cyclopropyl group. In some embodiments, R * is C alkyl or C alkenyl. In certain embodiments, R" is C 3~12 For example, R" can be a C alkyl. For example, R" can be a C 4~8 It can be alkyl (e.g., C4, C5, C6, C7, or C8 alkyl).

[0076] In one embodiment, R is C 5~20 In certain embodiments, R1 is C6 alkyl. In certain embodiments, R1 is C8 alkyl. In other embodiments, R1 is C9 alkyl. In certain embodiments, R1 is C 14 In another embodiment, R is C 18 It is alkyl.

[0077] In one embodiment, R is C 21~30 In one embodiment, R is C 26 In one embodiment, R is C 28 In certain embodiments, R is alkyl.

[0078] [ka]

[0079] is. In one embodiment, R is C 5~20 In certain embodiments, R is C 18 alkenyl. In some embodiments, R1 is linoleyl.

[0080] In certain embodiments, R1 is branched (e.g., decan-2-yl, undecan-3-yl, dodecan-4-yl, tridecan-5-yl, tetradecan-6-yl, 2-methylundecan-3-yl, 2-methyldecan-2-yl, 3-methylundecan-3-yl, 4-methyldodecan-4-yl, or heptadec-9-yl).

[0081] [ka]

[0082] is. In certain embodiments, R is an unsubstituted C 5~20 Alkyl or C 5~20 In certain embodiments, R' is a substituted C 5~20 Alkyl or C 5~20 Alkenyl (e.g., C such as 1-cyclopropylnonyl) 3~6 substituted with a carbocyclic ring or substituted with OH or alkoxy). For example,

[0083] [ka]

[0084] is. In other embodiments, R1 is -R"M'R'. In some embodiments, R' is -R * In one embodiment, Y is selected from -YR" and -YR". 3~8 In one embodiment, Y is C 6~10 In certain embodiments, Y is aryl. In certain embodiments, Y is a cyclopropyl group. In certain embodiments, Y is a cyclohexyl group. In certain embodiments, R * is a C1 alkyl.

[0085] In one embodiment, R″ is C 3~12 Alkyl and C 3~12 In some embodiments, R″ adjacent to Y is C alkyl. In some embodiments, R″ adjacent to Y is C 4~9 alkyl (e.g., C4, C5, C6, C7 or C8 or C9 alkyl).

[0086] In certain embodiments, R' is selected from C4 alkyl and C4 alkenyl. In certain embodiments, R' is selected from C5 alkyl and C5 alkenyl. In certain embodiments, R' is selected from C6 alkyl and C6 alkenyl. In certain embodiments, R' is selected from C7 alkyl and C7 alkenyl. In certain embodiments, R' is selected from C9 alkyl and C9 alkenyl.

[0087] In other embodiments, R' is C 11 Alkyl and C 11 In another embodiment, R' is selected from C 12 Alkyl, C 12 Alkenyl, C 13 Alkyl, C 13 Alkenyl, C 14 Alkyl, C 14Alkenyl, C 15 Alkyl, C 15 Alkenyl, C 16 Alkyl, C 16 Alkenyl, C 17 Alkyl, C 17 Alkenyl, C 18 Alkyl, and C 18 In certain embodiments, R' is branched (e.g., decan-2-yl, undecan-3-yl, dodecan-4-yl, tridecan-5-yl, tetradecan-6-yl, 2-methylundecan-3-yl, 2-methyldecan-2-yl, 3-methylundecan-3-yl, 4-methyldodecan-4-yl, or heptadec-9-yl). In certain embodiments, R' is

[0088] [ka]

[0089] is. In certain embodiments, R' is unsubstituted C 1~18 In certain embodiments, R' is a substituted C 1~18 alkyl (e.g., alkoxy, such as methoxy, or C 1-cyclopropylnonyl, such as 1-cyclopropylnonyl) 3~6 Carbocyclic or C(O)O-alkyl or OC(O)-alkyl substituted C(O)OCH3 or OC(O)CH3 1~15 alkyl). For example, R' is

[0090] [ka]

[0091] is. In one embodiment, R″ is C 3~14 Alkyl and C 3~14In some embodiments, R" is selected from the group consisting of C alkyl, C alkyl, C alkyl, C alkyl, C alkyl, or C alkyl. In some embodiments, R" is selected from the group consisting of C alkyl, C 10 Alkyl, C 11 Alkyl, C 12 Alkyl, C 13 Alkyl, or C 14 It is alkyl.

[0092] In some embodiments, M' is -C(O)O-. In some embodiments, M' is -OC(O)-. In other embodiments, M' is an aryl or heteroaryl group. For example, M' may be selected from the group consisting of phenyl, oxazole, and thiazole.

[0093] In some embodiments, M is -C(O)O-. In some embodiments, M is -OC(O)-. In some embodiments, M is -C(O)N(R')-. In some embodiments, M is -P(O)(OR')O-.

[0094] In other embodiments, M is an aryl or heteroaryl group. For example, M can be selected from the group consisting of phenyl, oxazole, and thiazole. In some embodiments, M is the same as M'. In other embodiments, M is different from M'.

[0095] In certain embodiments, each R5 is H. In some such embodiments, each R6 is also H. In some embodiments, R7 is H. In other embodiments, R7 is C 1~3 alkyl (for example, methyl, ethyl, propyl, or i-propyl).

[0096] In one embodiment, R2 and R3 are independently selected from the group consisting of C 5~14 Alkyl or C 5~14 It is alkenyl. In some embodiments, R2 and R3 are the same. In some embodiments, R2 and R3 are C8 alkyl. In certain embodiments, R2 and R3 are C2 alkyl. In other embodiments, R2 and R3 are C3 alkyl. In some embodiments, R2 and R3 are C4 alkyl. In certain embodiments, R2 and R3 are C5 alkyl. In other embodiments, R2 and R3 are C6 alkyl. In some embodiments, R2 and R3 are C7 alkyl.

[0097] In other embodiments, R2 and R3 are different. In certain embodiments, R2 is C8 alkyl. In certain embodiments, R3 is C 1~7 (e.g., C1, C2, C3, C4, C5, C6, or C7 alkyl) or C9 alkyl.

[0098] In one embodiment, R7 and R3 are H. In certain embodiments, R2 is H. In certain embodiments, m is 5, 7, or 9.

[0099] In one embodiment, R4 is -(CH2) n Q and -(CH2) n Selected from CHQR. In some embodiments, Q is -OR, -OH, -O(CH2) n is selected from the group consisting of N(R), -OC(O)R, -CX, -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O)R, -N(H)S(O)R, -N(R)C(O)N(R), -N(H)C(O)N(R), -N(H)C(O)N(H)(R), -N(R)C(S)N(R), -N(H)C(S)N(R), -N(H)C(S)N(H)(R), -C(R)N(R)C(O)OR, carbocycle, and heterocycle.

[0100] In certain embodiments, Q is -N(R)R, -O(CH) n-OR, -N(R)C(=NR9)N(R)2, -N(R)C(=CHR9)N(R)2, -OC(O)N(R)2, or -N(R)C(O)OR.

[0101] In certain embodiments, Q is -N(OR)C(O)R, -N(OR)S(O)R, -N(OR)C(O)OR, -N(OR)C(O)N(R), -N(OR)C(S)N(R), -N(OR)C(=NR)N(R), or -N(OR)C(=CHR)N(R).

[0102] In certain embodiments, Q is thiourea or an isostere thereof, such as

[0103] [ka]

[0104] Or -NHC(=NR9)N(R)2. In certain embodiments, Q is -C(=NR9)N(R). For example, when Q is -C(=NR9)N(R), n is 4 or 5. For example, R is -S(O)2N(R).

[0105] In certain embodiments, Q is -C(=NR9)R or -C(O)N(R)OR, such as -CH(=N-OCH3), -C(O)NH-OH, -C(O)NH-OCH3, -C(O)N(CH3)-OH, or -C(O)N(CH3)-OCH3.

[0106] In certain embodiments, Q is —OH. In certain embodiments, Q is a substituted or unsubstituted 5- to 10-membered heteroaryl, e.g., Q is triazole, imidazole, pyrimidine, purine, 2-amino-1,9-dihydro-6H-purin-6-on-9-yl (or guanin-9-yl), adenin-9-yl, cytosin-1-yl, or uracil-1-yl, each of which is optionally substituted with one or more substituents selected from alkyl, OH, alkoxy, -alkyl-OH, -alkyl-O-alkyl, which may be further substituted. In certain embodiments, Q is, for example, oxo (=O), OH, amino, mono- or dialkylamino, and C 1~3 and substituted 5- to 14-membered heterocycloalkyl, substituted with one or more substituents selected from alkyl, for example, Q is 4-methylpiperazinyl, 4-(4-methoxybenzyl)piperazinyl, isoindolin-2-yl-1,3-dione, pyrrolidin-1-yl-2,5-dione, or imidazolidin-3-yl-2,4-dione.

[0107] In certain embodiments, Q is —NHR 8 , where R 8 is oxo (═O), amino (NH 2 ), mono- or dialkylamino, C 1~3 C optionally substituted with one or more substituents selected from alkyl and halo 3~6 For example, R8 is cyclobutenyl, such as 3-(dimethylamino)-cyclobut-3-en-4-yl-1,2-dione.

[0108] In certain embodiments, Q is —NHR 8 , where R 8 is amino (NH 2 ), mono- or dialkylamino, C 1~3 Heteroaryl optionally substituted with one or more substituents selected from alkyl and halo, For example, R8 is thiazole or imidazole.

[0109] In certain embodiments, Q is —NHC(═NR)N(R), where R is CN, C 1~6Alkyl, NO, —S(O)N(R), —OR, —S(O)R, or H. For example, Q is —NHC(═NR)N(CH), —NHC(═NR)NHCH, —NHC(═NR)NH.

[0110] In certain embodiments, Q is —NHC(═CHR 9 )N(R) 2 , where R 9 is NO 2 , CN, C 1~6 Alkyl, -S(O)2N(R)2, -OR, -S(O)2R, or H. For example, Q is -NHC(=CHR9)N(CH3)2, -NHC(=CHR9)NHCH3, or -NHC(=CHR9)NH2.

[0111] In certain embodiments, Q is -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)OR, e.g., -OC(O)NHCH3, -N(OH)C(O)OCH3, -N(OH)C(O)CH3, -N(OCH3)C(O)OCH3, -N(OCH3)C(O)CH3, -N(OH)S(O)2CH3, or -NHC(O)OCH3.

[0112] In certain embodiments, Q is unsubstituted or substituted C 6~10 Aryl (e.g., phenyl) or C 3~6 It is cycloalkyl. In some embodiments, n is 1. In other embodiments, n is 2. In further embodiments, n is 3. In some other embodiments, n is 4. For example, R4 can be -(CH2)2OH. For example, R4 can be -(CH2)3OH. For example, R4 can be -(CH2)4OH. For example, R4 can be benzyl. For example, R4 can be 4-methoxybenzyl.

[0113] In one embodiment, R4 is C 3~6 In one embodiment, R4 is C 3~6 For example, R4 is cycloalkyl, for example, OH, halo, C 1~6It can be cyclohexyl optionally substituted with alkyl, etc. For example, R4 can be 2-hydroxycyclohexyl.

[0114] In some embodiments, R is H. In some embodiments, R is unsubstituted C 1~3 Alkyl or unsubstituted C 2~3 For example, R4 can be -CH2CH(OH)CH3, -CH(CH3)CH2OH, or -CH2CH(OH)CH2CH3.

[0115] In one embodiment, R is substituted C 1~3 Alkyl, such as CHOH. For example, R can be —CHCH(OH)CHOH, —(CH)NHC(O)CHOH, —(CH)NHC(O)CHOBn, —(CH)O(CH)OH, or —CH(CHOH).

[0116] In one embodiment, R4 is one of the following groups:

[0117] [ka]

[0118] The value is selected from either: In one embodiment, R4 is one of the following groups:

[0119] [ka]

[0120] In certain embodiments, compounds of any of the formulae described herein are suitable for making nanoparticle compositions for intramuscular administration. In some embodiments, R2 and R3, together with the atoms to which they are attached, form a heterocyclic or carbocyclic ring. In some embodiments, R2 and R3, together with the atoms to which they are attached, form a 5- to 14-membered aromatic or non-aromatic heterocyclic ring having one or more heteroatoms selected from N, O, S, and P. In some embodiments, R2 and R3, together with the atoms to which they are attached, form an optionally substituted C ring, either aromatic or non-aromatic. 3~20 Carbocyclic rings (e.g., C 3~18 carbocycle, C 3~15 carbocycle, C 3~12 Carbocyclic, or C 3~10 In some embodiments, R2 and R3, together with the atoms to which they are attached, form a C 3~6 In other embodiments, R2 and R3, together with the atoms to which they are attached, form a C6 carbocyclic ring, such as a cyclohexyl or phenyl group. In certain embodiments, a heterocyclic or C 3~6 The carbocycle is substituted with one or more alkyl groups (e.g., on the same ring atom or adjacent or non-adjacent ring atoms). For example, R2 and R3, together with the atom to which they are attached, can form a cyclohexyl or phenyl group with one or more C5 alkyl substitutions. In certain embodiments, the heterocycle or C5 alkyl group formed by R2 and R3 can be substituted with one or more C5 alkyl groups. 3~6 The carbocycle is substituted with a carbocyclic group. For example, R2 and R3, together with the atom to which they are attached, can form a cyclohexyl or phenyl group substituted with cyclohexyl. In some embodiments, R2 and R3, together with the atom to which they are attached, form a C 7~15 It forms a carbocyclic ring, for example a cycloheptyl, cyclopentadecanyl, or naphthyl group.

[0121] In one embodiment, R4 is -(CH2) n Q and -(CH2) n In some embodiments, Q is selected from -OR, -OH, -O(CH) nIn another embodiment, Q is selected from the group consisting of imidazole, pyrimidine, and purine.

[0122] In some embodiments, R2 and R3, together with the atoms to which they are attached, form a heterocycle or a carbocycle. In some embodiments, R2 and R3, together with the atoms to which they are attached, form a C 3~6 In certain embodiments, a heterocycle or C 3~6 The carbocycle is substituted with one or more alkyl groups (e.g., on the same ring atom or adjacent or non-adjacent ring atoms). For example, R2 and R3, together with the atom to which they are attached, can form a phenyl group having one or more C5 alkyl substitutions.

[0123] In certain embodiments, the compound of formula (I) is

[0124] [ka]

[0125] [ka]

[0126] [ka]

[0127] [ka]

[0128] [ka]

[0129] [ka]

[0130] [ka]

[0131] [ka]

[0132] is selected from the group consisting of: In a further embodiment, the compound of formula (I) is

[0133] [ka]

[0134] is selected from the group consisting of: In certain embodiments, the compound of formula (I) is

[0135] [ka]

[0136] [ka]

[0137] [ka]

[0138] [ka]

[0139]

change

[0140]

change

[0141]

change

[0142]

change

[0143]

change

[0144]

change

[0145]

change

[0146]

change

[0147]

change

[0148]

change

[0149]

change

[0150] [ka]

[0151] [ka]

[0152] [ka]

[0153] [ka]

[0154] [ka]

[0155] [ka]

[0156] [ka]

[0157] [ka]

[0158] and salts and isomers thereof. The central amine moiety of the lipid represented by formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId) or (IIe) can be protonated at physiological pH.Therefore, the lipid can have a positive charge or partial positive charge at physiological pH.Such lipids can be called cationic or ionic (amino) lipids.Lipids can also be zwitterionic, i.e., neutral molecules with both positive and negative charges.

[0159] As used herein, the term "alkyl" or "alkyl group" means a straight- or branched-chain saturated hydrocarbon containing one or more carbon atoms (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more carbon atoms), which is optionally substituted. 1~14 The term "alkyl" means an optionally substituted, straight or branched chain saturated hydrocarbon containing from 1 to 14 carbon atoms. Unless otherwise specified, alkyl groups described herein refer to both unsubstituted and substituted alkyl groups.

[0160] As used herein, the term "alkenyl" or "alkenyl group" means an optionally substituted, straight- or branched-chain hydrocarbon containing two or more carbon atoms (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more carbon atoms) and at least one double bond. 2~14 The term "alkenyl" refers to an optionally substituted straight or branched chain hydrocarbon containing 2 to 14 carbon atoms and at least one carbon-carbon double bond. Alkenyl groups can contain one, two, three, four, or more carbon-carbon double bonds. For example, C 18 Alkenyl may contain one or more double bonds. C containing two double bonds 18The alkenyl group may be a linoleyl group. Unless otherwise specified, the alkenyl groups described herein refer to both unsubstituted and substituted alkenyl groups.

[0161] As used herein, the term "alkynyl" or "alkynyl group" means an optionally substituted, straight- or branched-chain hydrocarbon containing two or more carbon atoms (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more carbon atoms) and at least one carbon-carbon triple bond. 2~14 The term "alkynyl" refers to an optionally substituted straight or branched chain hydrocarbon containing 2 to 14 carbon atoms and at least one carbon-carbon triple bond. An alkynyl group can contain one, two, three, four, or more carbon-carbon triple bonds. For example, C 18 An alkynyl may contain one or more carbon-carbon triple bonds. Unless otherwise specified, alkynyl groups described herein refer to both unsubstituted and substituted alkynyl groups.

[0162] As used herein, the term "carbocycle" or "carbocyclic group" means an optionally substituted monocyclic or polycyclic ring system containing one or more rings of carbon atoms. The rings can be 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11-, 12-, 13-, 14-, 15-, 16-, 17-, 18-, 19-, or 20-membered rings. 3~6The term "carbocycle" refers to a carbocycle containing a single ring having 3 to 6 carbon atoms. A carbocycle may contain one or more carbon-carbon double or triple bonds and may be non-aromatic or aromatic (e.g., a cycloalkyl or aryl group). Examples of carbocycles include cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, and 1,2-dihydronaphthyl groups. The term "cycloalkyl," as used herein, refers to a non-aromatic carbocycle, which may or may not contain any double or triple bonds. Unless otherwise specified, carbocycles described herein refer to both unsubstituted and substituted carbocyclic groups, i.e., optionally substituted carbocycles.

[0163] As used herein, the term "heterocycle" or "heterocyclic group" refers to an optionally substituted monocyclic or polycyclic ring system containing one or more rings, wherein at least one ring contains at least one heteroatom. The heteroatom may be, for example, a nitrogen, oxygen, or sulfur atom. The ring may be a 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11-, 12-, 13-, or 14-membered ring. The heterocycle may contain one or more double or triple bonds and may be non-aromatic or aromatic (e.g., a heterocycloalkyl or heteroaryl group). Examples of heterocycle include imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thiophenyl, pyridinyl, piperidinyl, quinolyl and isoquinolyl groups.As used herein, the term "heterocycloalkyl" refers to non-aromatic heterocycle, and may or may not contain any double or triple bond.Unless otherwise specified, heterocycle described herein refers to both unsubstituted and substituted heterocyclic groups, that is, optionally substituted heterocycle.

[0164] As used herein, a "biodegradable group" is a group that can promote faster metabolism of lipids in mammalian organisms. The biodegradable group may be selected from the group consisting of, but not limited to, -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, an aryl group, and a heteroaryl group. As used herein, an "aryl group" is an optionally substituted carbocyclic group containing one or more aromatic rings. Examples of aryl groups include phenyl and naphthyl groups. As used herein, a "heteroaryl group" is an optionally substituted heterocyclic group containing one or more aromatic rings. Examples of heteroaryl groups include pyrrolyl, furyl, thiophenyl, imidazolyl, oxazolyl, and thiazolyl. Both aryl and heteroaryl groups can be optionally substituted. For example, M and M' can be selected from the non-limiting group consisting of optionally substituted phenyl, oxazole, and thiazole. In the formulas herein, M and M' can independently be selected from the list of biodegradable groups above. Unless otherwise specified, the aryl or heteroaryl groups described herein refer to both unsubstituted and substituted groups, i.e., optionally substituted aryl or heteroaryl groups.

[0165] Alkyl, alkenyl, and cyclyl (eg, carbocyclyl and heterocyclyl) groups may be optionally substituted, unless otherwise specified. Optional substituents include, but are not limited to, halogen atoms (e.g., chloride, bromide, fluoride, or iodide groups), carboxylic acids (e.g., —C(O)OH), alcohols (e.g., hydroxyl, —OH), esters (e.g., —C(O)OR or —OC(O)R), aldehydes (e.g., —C(O)H), carbonyls (e.g., represented by —C(O)R, or alternatively, C═O), acyl halides (e.g., —C(O)X, where X is a halide selected from bromide, fluoride, chloride, and iodide), carbonates (e.g., —OC(O)OR), alkoxy (e.g., —OR), acetals (e.g., —C(OR)R″″, where each OR is an alkoxy group, which may be the same or different, and R″″ is an alkyl or alkenyl group), phosphates (e.g., P(O) 3- ), thiol (e.g., -SH), sulfoxide (e.g., -S(O)R), sulfinic acid (e.g., -S(O)OH), sulfonic acid (e.g., -S(O)2OH), thial (e.g., -C(S)H), sulfate (e.g., S(O)4 2-), sulfonyl (e.g., -S(O)2-), amido (e.g., -C(O)NR2, or -N(R)C(O)R), azido (e.g., -N3), nitro (e.g., -NO2), cyano (e.g., -CN), isocyano (e.g., -NC), acyloxy (e.g., -OC(O)R), amino (e.g., -NR2, -NRH, or -NH2), carbamoyl (e.g., -OC(O)NR2, In some embodiments, the substituent may be selected from the group consisting of: -OC(O)NRH, or -OC(O)NH), sulfonamide (e.g., -S(O)NRH, -S(O)NH, -N(R)S(O)R, -N(H)S(O)R, -N(R)S(O)H, or -N(H)S(O)H), alkyl, alkenyl, and cyclyl (e.g., carbocyclyl or heterocyclyl) groups. In any of the above, R is an alkyl or alkenyl group as defined herein. In certain embodiments, the substituent itself may be further substituted, for example, with 1, 2, 3, 4, 5, or 6 substituents as defined herein. For example, C 1~6 Alkyl groups may be further substituted with 1, 2, 3, 4, 5, or 6 substituents as defined herein.

[0166] About, Approximately: As used herein, the terms "and" and "about" when applied to one or more values ​​of interest refer to values ​​similar to the stated reference value. In certain embodiments, the term "approximately" or "about" refers to a range in either direction (greater or less than) 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of the stated reference value, unless otherwise specified or the context clearly indicates otherwise (except when such value exceeds 100% of the possible value). For example, when used in reference to the amount of a given compound in the lipid component of a nanoparticle composition, "about" can mean + / - 10% of the stated value. For example, a nanoparticle composition comprising a lipid component with about 40% of a given compound may contain 30-50% of the compound.

[0167] As used herein, the term "compound" is intended to include all isomers and isotopes of the structure shown. "Isotope" refers to an atom that has the same atomic number but has different mass numbers due to the different number of neutrons in the nucleus. For example, hydrogen isotopes include tritium and deuterium. Furthermore, the compounds, salts, or complexes of the present disclosure can be prepared by conventional methods in combination with solvents or water molecules to form solvates and hydrates.

[0168] As used herein, the term "contacting" means establishing a physical connection between two or more entities. For example, contacting a mammalian cell with a nanoparticle composition means that the mammalian cell and the nanoparticle share a physical connection. Methods for contacting cells with external entities both in vivo and ex vivo are well known in the field of biology. For example, contacting a nanoparticle composition and a mammalian cell placed within a mammal may be performed by various administration routes (e.g., intravenous, intramuscular, intradermal, and subcutaneous) and may include various amounts of the nanoparticle composition. Furthermore, two or more mammalian cells may be contacted by the nanoparticle composition.

[0169] As used herein, the term "deliver" means providing an entity to a destination. For example, delivering a therapeutic and / or prophylactic agent to a subject can include administering a nanoparticle composition comprising the therapeutic and / or prophylactic agent to the subject (e.g., by intravenous, intramuscular, intradermal, or subcutaneous routes). Administering a nanoparticle composition to a mammal or mammalian cells can include contacting one or more cells with the nanoparticle composition.

[0170] As used herein, the term "enhanced delivery" refers to greater (e.g., at least 1.5-fold greater, at least 2-fold greater, at least 3-fold greater, at least 4-fold greater, at least 5-fold greater, at least 6-fold greater, at least 7-fold greater, at least 8-fold greater, at least 9-fold greater, at least 10-fold greater) delivery of a therapeutic and / or prophylactic agent by a nanoparticle to a target tissue of interest (e.g., the liver of a mammal) compared to the level of delivery of a therapeutic and / or prophylactic agent by a control nanoparticle to a target tissue of interest (e.g., MC3, KC2, or DLinDMA). The level of nanoparticle delivery to a particular tissue can be measured by comparing the amount of protein produced in the tissue to the weight of the tissue, the amount of therapeutic and / or prophylactic agent in the tissue to the weight of the tissue, the amount of protein produced in the tissue to the total amount of protein in the tissue, or the amount of therapeutic and / or prophylactic agent in the tissue to the total amount of therapeutic and / or prophylactic agent in the tissue. It will be understood that enhanced delivery of nanoparticles to target tissues need not be determined in the subject being treated, but can be determined in surrogate animal models (e.g., rat models), etc. In certain embodiments, nanoparticle compositions comprising compounds of Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe) have substantially the same level of enhanced delivery regardless of the route of administration. For example, certain compounds disclosed herein exhibit similar enhanced delivery when used to deliver therapeutic and / or prophylactic agents either intravenously or intramuscularly. In other embodiments, certain compounds disclosed herein (e.g., compounds of Formula (IA) or (II), e.g., compounds 18, 25, 30, 60, 108-112, or 122) exhibit higher levels of enhanced delivery when used to deliver therapeutic and / or prophylactic agents intramuscularly than intravenously.

[0171] As used herein, the terms "specific delivery," "specifically deliver," or "specifically delivering" refer to greater (e.g., at least 1.5-fold greater, at least 2-fold greater, at least 3-fold greater, at least 4-fold greater, at least 5-fold greater, at least 6-fold greater, at least 7-fold greater, at least 8-fold greater, at least 9-fold greater, at least 10-fold greater) delivery of a therapeutic and / or prophylactic agent by a nanoparticle to a target tissue of interest (e.g., the liver of a mammal) compared to a non-target tissue (e.g., the spleen of a mammal). The level of nanoparticle delivery to a particular tissue can be measured by comparing the amount of protein produced in the tissue to the weight of the tissue, the amount of therapeutic and / or prophylactic agent in the tissue to the weight of the tissue, the amount of protein produced in the tissue to the total amount of protein in the tissue, or the amount of therapeutic and / or prophylactic agent in the tissue to the total therapeutic and / or prophylactic agent in the tissue. For example, for renal vascular targeting, a therapeutic and / or prophylactic agent is specifically delivered to the kidney of a mammal compared to the liver and spleen if 1.5, 2, 3, 5, 10, 15, or 20 times more therapeutic and / or prophylactic agent is delivered to the kidney per gram of tissue compared to that delivered to the liver or spleen following systemic administration of the therapeutic and / or prophylactic agent. It will be understood that the ability of nanoparticles to specifically deliver to target tissues need not be determined in the subject being treated, but can be determined in a surrogate such as an animal model (e.g., a rat model).

[0172] As used herein, "encapsulation efficiency" refers to the amount of a therapeutic and / or prophylactic agent that becomes part of a nanoparticle composition relative to the initial total amount of the therapeutic and / or prophylactic agent used to prepare the nanoparticle composition. For example, if 97 mg of a therapeutic and / or prophylactic agent are encapsulated in the nanoparticle composition out of a total of 100 mg of the therapeutic and / or prophylactic agent initially provided in the composition, the encapsulation efficiency can be expressed as 97%. As used herein, "encapsulation" can refer to complete, substantial, or partial enclosure, confinement, surrounding, or encasement.

[0173] As used herein, "expression" of a nucleic acid sequence refers to translation of mRNA into a polypeptide or protein and / or post-translational modification of the polypeptide or protein.

[0174] As used herein, the term "in vitro" refers to events that take place not within a living organism (e.g., an animal, plant, or microorganism), but in an artificial environment, e.g., a test tube or reaction vessel, cell culture, petri dish, etc.

[0175] As used herein, the term "in vivo" refers to events that take place within an organism (e.g., an animal, plant, or microorganism, or cells or tissues thereof). As used herein, the term "ex vivo" refers to an event that occurs outside of an organism (e.g., an animal, plant, or microorganism, or cells or tissues thereof). An ex vivo event can occur in an environment that is minimally altered from the natural (e.g., in vivo) environment.

[0176] As used herein, the term "isomer" refers to any geometric isomer, tautomer, zwitterion, stereoisomer, enantiomer, or diastereomer of a compound. A compound may contain one or more chiral centers and / or double bonds and, therefore, can exist as stereoisomers, e.g., double bond isomers (i.e., geometric E / Z isomers) or diastereomers (e.g., enantiomers (i.e., (+) or (-)) or cis / trans isomers). The present disclosure encompasses all isomers of the compounds described herein, including stereomerically pure forms (e.g., geometrically pure, enantiomerically pure, or diastereomerically pure) and enantiomeric and stereoisomeric mixtures, e.g., racemates. Enantiomeric and stereoisomeric mixtures of compounds and means for resolving them into their component enantiomers or stereoisomers are well known.

[0177] As used herein, "lipid component" refers to a component of a nanoparticle composition that comprises one or more lipids.For example, the lipid component can comprise one or more cationic / ionic lipids, PEGylated lipids, structured lipids, or other lipids, such as phospholipids.

[0178] As used herein, a "linker" refers to a moiety that connects two moieties, such as the bond between two nucleosides of a capping species. The linker may contain one or more groups, including, but not limited to, a phosphate group (e.g., phosphate, boranophosphate, thiophosphate, selenophosphate, and phosphonate), an alkyl group, an amidate, or glycerol. For example, the two nucleosides of a capping analog may be linked at their 5' positions by a chain containing a triphosphate group or two phosphate moieties and a boranophosphate moiety.

[0179] As used herein, "method of administration" can include intravenous, intramuscular, intradermal, subcutaneous, or other methods of delivering a composition to a subject. The method of administration can be selected to target delivery (e.g., specifically deliver) to a particular area or system of the body.

[0180] As used herein, "modified" means non-natural. For example, RNA can be modified RNA. That is, RNA can contain one or more non-natural nucleic acid bases, nucleosides, nucleotides, or linkers. "Modified" species can also be referred to herein as "altered" species. Species can be chemically, structurally, or functionally modified or altered. For example, modified nucleic acid base species can contain one or more non-natural substitutions.

[0181] As used herein, "N:P ratio" is the molar ratio of ionic (in the physiological pH range) nitrogen atoms in lipids to phosphate groups in RNA, for example, in a nanoparticle composition comprising a lipid component and RNA.

[0182] As used herein, "nanoparticle composition" refers to a composition containing one or more lipids.Nanoparticle compositions are typically micrometer-sized or smaller and may contain a lipid bilayer.Nanoparticle compositions include lipid nanoparticles (LNPs), liposomes (e.g., lipid vesicles), and lipoplexes.For example, nanoparticle compositions may be liposomes with a lipid bilayer having a diameter of 500 nm or less.

[0183] As used herein, "naturally occurring" means existing in nature without artificial assistance. As used herein, "patient" refers to a subject who is seeking or may need treatment, who needs treatment, who is undergoing treatment, who is to receive treatment, or who is receiving professional medical care for a particular disease or condition.

[0184] As used herein, "PEG lipid" or "PEGylated lipid" refers to a lipid that includes a polyethylene glycol moiety. The phrase "pharmaceutically acceptable" is used herein to refer to compounds, materials, compositions, and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable risk-benefit ratio.

[0185] As used herein, the phrase "pharmaceutically acceptable excipient" refers to any ingredient other than the compounds described herein (e.g., a vehicle capable of suspending, complexing, or dissolving an active compound) that has substantially non-toxic and non-inflammatory properties in patients. Excipients include, for example, anti-caking agents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (pigments), emollients, emulsifiers, fillers (diluents), film-forming agents or coatings, flavors, fragrances, glidants (glidants), lubricants, preservatives, printing inks, adsorbents, suspending or dispersing agents, sweeteners, and water for hydration. Exemplary excipients include, but are not limited to: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, cross-linked polyvinylpyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropylmethylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methylparaben, microcrystalline cellulose, polyethylene glycol, polyvinylpyrrolidone, povidone-iodine, pregelatinized starch, propylparaben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethylcellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E (α-tocopherol), vitamin C, xylitol, and other species disclosed herein.

[0186] In this specification, for convenience, the structural formula of a compound represents a specific isomer in some cases, but the present disclosure includes all isomers, such as geometric isomers, optical isomers based on asymmetric carbons, stereoisomers, tautomers, etc., and it is understood that not all isomers may have the same level of activity.In addition, for compounds represented by formula, crystalline polymorphism may exist.It is noted that any crystalline form, crystalline mixture, or its anhydride or hydrate is included in the scope of the present disclosure.

[0187] The terms "crystalline polymorph," "polymorph," or "crystalline form" refer to a compound (or a salt or solvate thereof) that has different crystal packing arrangements, all having the same elemental composition. The term "crystal structure" refers to a crystalline structure that can crystallize in a variety of packing arrangements. Different crystalline forms typically have different X-ray diffraction patterns, infrared spectra, melting points, densities, hardness, crystal shapes, optical and electrical properties, stability, and solubility. Depending on the recrystallization solvent, crystallization rate, storage temperature, and other factors, one crystalline form may predominate. Crystal polymorphs of a compound can be prepared by crystallization under various conditions.

[0188] The composition can also include one or more salts of compounds.Salt can be pharmaceutically acceptable salt.As used herein, " pharmaceutically acceptable salt " refers to the derivative of the disclosed compound, in which the parent compound is modified by converting existing acid or base moiety into its salt form (for example, by reacting free base group with suitable organic acid).Examples of pharmaceutically acceptable salt include, but are not limited to, inorganic or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids. Representative acid addition salts include acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, and 2-hydroxyethanesulfonate. Salts include hydroxybenzoates, ... The pharmaceutically acceptable salts of the present disclosure can be synthesized from the parent compound which contains a basic or acidic moiety by conventional chemical methods.Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or an organic solvent, or in a mixture of both; generally, non-aqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Lists of suitable salts can be found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418; Pharmaceutical Salts: Properties, Selection, and Use, P.H. Stahl and C.G. Wermuth (eds.), Wiley-VCH, 2008; and Berge et al., Journal of Pharmaceutical Science, 66, 1-19 (1977), each of which is incorporated herein by reference in its entirety.

[0189] As used herein, " phospholipid " refers to a lipid that comprises a phosphate moiety and one or more carbon chains, for example, unsaturated fatty acid chains.Phospholipids can comprise one or more multiple (for example, double or triple) bonds (for example, one or more unsaturated).Certain phospholipids can promote fusion with membranes.For example, cationic phospholipids can interact with one or more negatively charged phospholipids of membranes (for example, cell membranes or intracellular membranes).Fusion of phospholipids with membranes allows one or more components of lipid-containing compositions to pass through the membrane, for example, allows the one or more components to be delivered to cells.

[0190] As used herein, "polydispersity index" is a ratio that describes the uniformity of the particle size distribution of a system. For example, a small value less than 0.3 indicates a narrow particle size distribution. As used herein, the term "polypeptide" or "polypeptide of interest" refers to a polymer of amino acid residues typically joined by peptide bonds, which may be naturally or synthetically produced (e.g., isolated or purified).

[0191] As used herein, "RNA" refers to naturally occurring or non-naturally occurring ribonucleic acid. For example, RNA may contain modified and / or non-naturally occurring components such as one or more nucleic acid bases, nucleosides, nucleotides, or linkers. RNA may contain a cap structure, a chain-terminating nucleoside, a stem-loop, a polyA sequence, and / or a polyadenylation signal. RNA may have a nucleotide sequence encoding a polypeptide of interest. For example, RNA may be messenger RNA (mRNA). Translation of an mRNA encoding a specific polypeptide, for example, in vivo translation of an mRNA in a mammalian cell, can produce the encoded polypeptide. RNA may be selected from the non-limiting group consisting of small interfering RNA (siRNA), asymmetric interfering RNA (aiRNA), microRNA (miRNA), dicer substrate RNA (dsRNA), small hairpin RNA (shRNA), mRNA, and mixtures thereof.

[0192] As used herein, a "single unit dose" is a dose of any therapeutic agent administered in one dose / one time / single route / single point of contact, i.e., a single administration event. As used herein, a "split dose" is the division of a single unit dose or total daily dose into two or more doses.

[0193] As used herein, a "total daily dose" is the amount administered or prescribed in a 24-hour period. It may be administered as a single unit dose. As used herein, "size" or "average size" with respect to a nanoparticle composition refers to the average diameter of the nanoparticle composition.

[0194] As used herein, the term "subject" or "patient" refers to any living organism to which a composition according to the present disclosure can be administered, for example, for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans) and / or plants.

[0195] As used herein, "target cell" refers to any one or more cells of interest. The cells may be found in vitro, in vivo, in situ, or in the tissue or organ of an organism. The organism may be an animal, preferably a mammal, more preferably a human, and most preferably a patient.

[0196] As used herein, "target tissue" refers to any one or more tissue types of interest where delivery of a therapeutic and / or prophylactic agent can result in a desired biological and / or pharmacological effect. Examples of target tissues of interest include specific tissues, organs, and systems or groups thereof. In particular applications, the target tissue may be the kidney, lung, spleen, the vascular endothelium of a blood vessel (e.g., in a coronary artery or femur), or tumor tissue (e.g., by intratumoral administration). "Non-target tissue" refers to any one or more tissue types where expression of the encoded protein does not result in a desired biological and / or pharmacological effect. In particular applications, non-target tissues may include the liver and spleen.

[0197] The term "therapeutic agent" or "prophylactic agent" refers to any agent that has a therapeutic, diagnostic, and / or prophylactic effect and / or induces a desired biological and / or pharmacological effect when administered to a subject. A therapeutic agent is also referred to as an "active" or "agent." Such agents include, but are not limited to, cytotoxins, radioactive ions, chemotherapeutic agents, small molecule drugs, proteins, and nucleic acids.

[0198] As used herein, the term "therapeutically effective amount" means the amount of delivered agent (e.g., nucleic acid, drug, composition, therapeutic agent, diagnostic agent, prophylactic agent, etc.) that, when administered to a subject suffering from or susceptible to an infection, disease, disorder, and / or condition, is sufficient to treat, ameliorate the symptoms of, diagnose, prevent, and / or delay the onset of the infection, disease, disorder, and / or condition.

[0199] As used herein, "transfection" refers to the introduction of a species (e.g., RNA) into a cell. Transfection can be performed, for example, in vitro, ex vivo, or in vivo.

[0200] As used herein, the term "treating" refers to the partial or complete alleviation, remission, improvement, relief, delay in onset, inhibition of progression, reduction in severity, and / or reduction in incidence of one or more symptoms or characteristics of a particular infection, disease, disorder, and / or condition. For example, "treating" cancer can refer to the inhibition of tumor survival, growth, and / or spread. Treatment can be administered to subjects who do not show signs of a disease, disorder, and / or condition and / or who show only early signs of a disease, disorder, and / or condition, with the aim of reducing the risk of developing pathologies associated with the disease, disorder, and / or condition.

[0201] As used herein, "zeta potential" is the kinetic potential of, for example, lipids in a particle composition. Nanoparticle Composition The present disclosure also features nanoparticle compositions that include a lipid component that includes a compound represented by Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe), as described herein.

[0202] In certain embodiments, the largest dimension of the nanoparticle composition is 1 μm or less (e.g., 1 μm, 900 nm, 800 nm, 700 nm, 600 nm, 500 nm, 400 nm, 300 nm, 200 nm, 175 nm, 150 nm, 125 nm, 100 nm, 75 nm, 50 nm, or less), as measured, for example, by dynamic light scattering (DLS), transmission electron microscopy, scanning electron microscopy, or another method. Nanoparticle compositions include, for example, lipid nanoparticles (LNPs), liposomes, lipid vesicles, and lipoplexes. In certain embodiments, the nanoparticle composition is a vesicle comprising one or more lipid bilayers. In certain embodiments, the nanoparticle composition comprises two or more concentric bilayers separated by an aqueous compartment. The lipid bilayers may be functionalized and / or crosslinked to each other. The lipid bilayer may comprise one or more ligands, proteins, or channels.

[0203] The nanoparticle composition includes a lipid component comprising at least one compound represented by Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe). For example, the lipid component of the nanoparticle composition can include one or more of Compounds 1-147. The nanoparticle composition can also include various other components. For example, the lipid component of the nanoparticle composition can include one or more other lipids in addition to a lipid represented by Formula (I), (IA), (II), (II), (IIa), (IIb), (IIc), (IId), or (IIe).

[0204] Cationic / Ionic Lipids In addition to the lipids represented by Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe), the nanoparticle composition may include one or more cationic and / or ionic lipids (e.g., lipids that may have a positive or partial positive charge at physiological pH). Examples of cationic and / or ionic lipids include 3-(didodecylamino)-N1,N1,4-tridodecyl-1-piperazineethanamine (KL10), N1-[2-(didodecylamino)ethyl]-N1,N4,N4-tridodecyl-1,4-piperazinediethanamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-octatriacontane (KL25), 1,2-dilinoleyloxy-N,N-dimethylaminopropanol (KL26), 1,2-dilinoleyloxy-N,N-dimethylaminopropanol (KL27), 1,2-dilinoleyloxy-N,N-dimethylaminopropanol (KL28), 1,2-dilinoleyloxy-N,N-dimethylaminopropanol (KL29), 1,2-dilinoleyloxy-N,N-dimethylaminopropanol (KL30), 1,2-dilinoleyloxy-N,N-dimethylaminopropanol (KL31), 1,2-dilinoleyloxy-N,N-dimethylaminopropanol (KL32), 1,2-dilinoleyloxy-N,N-dimethylaminopropanol (KL33), 1,2-dilinoleyloxy-N,N-dimethylaminopropanol (KL34), 1,2-dilinoleyloxy-N,N-dimethylaminopropanol (KL35), 1,2-dilinoleyloxy-N,N-dimethylaminopropanol (KL36), 1,2-dilinoleyl DLin-DMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), Heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), 2,2-Dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-Dioleyl Oxy-N,N-dimethylaminepropane (DODMA), 2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA), (2R)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z

[0039] In addition, the cationic lipid may also be selected from the non-limiting group consisting of (2S)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA(2S)). In addition, the cationic lipid may also be a lipid containing a cyclic amine group.

[0205] PEG lipids The lipid component of the nanoparticle composition may contain one or more PEG or PEG-modified lipids. Such species are alternatively referred to as PEGylated lipids. PEG lipids are lipids modified with polyethylene glycol. The PEG lipids may be selected from the non-limiting group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. For example, the PEG lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipid.

[0206] structured lipids The lipid component of nanoparticle composition can comprise one or more structured lipids.The structured lipid can be selected from the group consisting of, but not limited to, cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, α-tocopherol, and mixtures thereof.In some embodiments, the structured lipid is cholesterol.In some embodiments, the structured lipid includes cholesterol and corticosteroids (such as prednisolone, dexamethasone, prednisone, and hydrocortisone), or combinations thereof.

[0207] phospholipids The lipid component of the nanoparticle composition can comprise one or more phospholipids, such as one or more (poly)unsaturated lipids. The phospholipids can be assembled into one or more lipid bilayers. Generally, the phospholipid can comprise a phospholipid moiety and one or more fatty acid moieties. For example, the phospholipid can be represented by the formula (III):

[0208] [ka]

[0209] (In the formula, R pwherein R represents a phospholipid moiety, and R and R represent fatty acid moieties with or without unsaturation, which may be the same or different. The phospholipid moiety may be selected from the non-limiting group consisting of phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidic acid, 2-lysophosphatidylcholine, and sphingomyelin. The fatty acid moiety may be selected from the non-limiting group consisting of lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, α-linolenic acid, erucic acid, phytanic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid. Non-naturally occurring species are also contemplated, including naturally occurring species with modifications and substitutions, including branching, oxidation, cyclization, and alkynes. For example, phospholipids can be functionalized or crosslinked with one or more alkynes (e.g., alkenyl groups in which one or more double bonds are replaced with triple bonds). Under appropriate reaction conditions, the alkyne groups can undergo copper-catalyzed cycloaddition when exposed to azides. Such reactions can be useful for functionalizing the lipid bilayer of nanoparticle compositions to facilitate membrane penetration or cellular recognition, or for linking nanoparticle compositions to useful components such as targeting or imaging moieties (e.g., dyes).

[0210] Phospholipids useful in the compositions and methods of the present invention include 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), and 1,2-dioleoyl-sn-glycero-3-phosphocholine (DLPC). ro-3-phosphocholine), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn -glycero-3-phosphocholine (POPC: 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16).The nanoparticle composition may be selected from the non-limiting group consisting of 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), and sphingomyelin. In certain embodiments, the nanoparticle composition comprises DSPC. In certain embodiments, the nanoparticle composition comprises DOPE. In certain embodiments, the nanoparticle composition comprises both DSPC and DOPE.

[0211] adjuvants In certain embodiments, nanoparticle compositions comprising one or more of the lipids described herein may further comprise one or more adjuvants, such as glucopyranosyl lipid adjuvant (GLA), CpG oligodeoxynucleotides (e.g., class A or B), poly(I:C), aluminum hydroxide, and Pam3CSK4.

[0212] therapeutic agent The nanoparticle composition can include one or more therapeutic and / or prophylactic agents. The disclosure features methods of delivering a therapeutic and / or prophylactic agent to a mammalian cell or organ, producing a polypeptide of interest in the mammalian cell, and treating a disease or disorder in a mammal in need thereof, comprising administering to the mammal a nanoparticle composition including the therapeutic and / or prophylactic agent and / or contacting mammalian cells with a nanoparticle composition including the therapeutic and / or prophylactic agent.

[0213] Therapeutic and / or prophylactic agents include biologically active substances, or alternatively referred to as "active agents." Therapeutic and / or prophylactic agents can be substances that, when delivered to a cell or organ, effect a desired change in the cell, organ, or other body tissue or system. Such species can be useful in treating one or more diseases, disorders, or conditions. In certain embodiments, the therapeutic and / or prophylactic agents are small molecule drugs useful in treating a particular disease, disorder, or condition. Examples of drugs useful in nanoparticle compositions include, but are not limited to, antitumor drugs (e.g., vincristine, doxorubicin, mitoxantrone, camptothecin, cisplatin, bleomycin, cyclophosphamide, methotrexate, and streptozotocin), anti-tumor agents (e.g., actinomycin D, vincristine, vinblastine, cystine arabinoside, anthracyclines, alkylating agents, platinum compounds, antimetabolites, and nucleoside analogs, e.g., methotrexate and purine and pyrimidine analogs), anti-infectives, local anesthetics (e.g., dibucaine and chlorpromazine), beta-adrenergic blockers (e.g., propranolol, timolol, and labetalol), antihypertensives ( antihistamines (e.g., diphenylhydramine, chlorpheniramine, and promethazine), antibiotics / antibacterials (e.g., gentamicin, ciprofloxacin, and cefoxitin), antifungals (e.g., miconazole, terconazole, econazole, isoconazole, butoconazole, clotrimazole, itraconazole, nystatin, naftifine, and amphotericin B), antiparasitic agents, hormones, hormone antagonists, immunomodulators, neurotransmitter antagonists, antiglaucoma agents, vitamins, anesthetics, and imaging agents.

[0214] In certain embodiments, the therapeutic and / or prophylactic agent is a cytotoxin, a radioactive ion, a chemotherapeutic agent, a vaccine, a compound that elicits an immune response, and / or another therapeutic and / or prophylactic agent. A cytotoxin or cytotoxic agent includes any agent that can be harmful to cells. Examples include, but are not limited to, taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, teniposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracenedione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, maytansinoids, such as maytansinol, rachelmycin (CC-1065), and analogs or congeners thereof. Radioactive ions include, but are not limited to, iodine (e.g., iodine-125 or iodine-131), strontium-89, phosphorus, palladium, cesium, iridium, sulfate, cobalt, yttrium-90, samarium-153, and praseodymium. Vaccines include compounds and preparations capable of conferring immunization against one or more conditions associated with infectious diseases, such as influenza, measles, human papillomavirus (HPV), rabies, meningitis, whooping cough, tetanus, plague, hepatitis, and tuberculosis, and may include mRNA encoding antigens and / or epitopes derived from infectious diseases. Vaccines also include compounds and preparations that direct an immune response against cancer cells and may include mRNA encoding antigens, epitopes, and / or neoepitopes derived from tumor cells. Compounds that elicit an immune response may include vaccines, corticosteroids (e.g., dexamethasone), and other species. In one embodiment, the vaccine and / or compound capable of eliciting an immune response is administered intramuscularly via a composition comprising a compound represented by Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe) (e.g., compounds 3, 18, 20, 25, 26, 29, 30, 60, 108-112, or 122).Other therapeutic and / or prophylactic agents include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil dacarbazine), alkylating agents (e.g., mechlorethamine, thiotepa chlorambucil, rachelmycin (CC-1065), melphalan, carmustine (BSNU), lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, These include cis-dichlorodiamineplatinum(II) (DDP) (cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and antimitotic agents (e.g., vincristine, vinblastine, taxol, and maytansinoids).

[0215] In other embodiments, the therapeutic and / or prophylactic agent is a protein. Therapeutic proteins useful in the nanoparticles of the present disclosure include, but are not limited to, gentamicin, amikacin, insulin, erythropoietin (EPO), granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), factor VIR, luteinizing hormone-releasing hormone (LHRH) analogs, interferon, heparin, hepatitis B surface antigen, typhoid vaccine, and cholera vaccine.

[0216] Polynucleotides and Nucleic Acids In certain embodiments, the therapeutic agent is a polynucleotide or nucleic acid (e.g., ribonucleic acid or deoxyribonucleic acid). The term "polynucleotide," in its broadest sense, includes any compound and / or substance that is or can be incorporated into an oligonucleotide strand. Exemplary polynucleotides for use in accordance with the present disclosure include, but are not limited to, one or more of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), including messenger mRNA (mRNA), hybrids thereof, RNAi-inducing agents, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, RNA that induces triple helix formation, aptamers, vectors, and the like. In certain embodiments, the therapeutic and / or prophylactic agent is RNA. The RNA useful in the compositions and methods described herein may be selected from the group consisting of, but not limited to, shortmers, antagomirs, antisense, ribozymes, small interfering RNAs (siRNAs), asymmetric interfering RNAs (aiRNAs), microRNAs (miRNAs), dicer substrate RNAs (dsRNAs), small hairpin RNAs (shRNAs), transfer RNAs (tRNAs), messenger RNAs (mRNAs), and mixtures thereof. In certain embodiments, the RNA is mRNA.

[0217] In certain embodiments, the therapeutic and / or prophylactic agent is mRNA. The mRNA can encode any polypeptide of interest, including any natural or non-natural or modified polypeptide. The polypeptide encoded by the mRNA can be of any size and have any secondary structure or activity. In some embodiments, the polypeptide encoded by the mRNA can have a therapeutic effect when expressed in cells.

[0218] In other embodiments, the therapeutic and / or prophylactic agent is siRNA. siRNA can be capable of selectively knocking down or downregulating the expression of a gene of interest. For example, siRNA can be selected so that when a nanoparticle composition comprising siRNA is administered to a subject in need, it silences the gene associated with a specific disease, disorder, or pathological condition. siRNA can comprise a sequence complementary to the mRNA sequence encoding the gene or protein of interest. In some embodiments, siRNA can be immunomodulatory siRNA.

[0219] In some embodiments, therapeutic agent and / or prophylactic agent is shRNA or its encoding vector or plasmid.When appropriate construct is delivered to nucleus, shRNA can be produced inside target cell.The construct and mechanism related to shRNA are well known in the art.

[0220] Nucleic acids and polynucleotides useful in the present disclosure typically include a first region of linked nucleosides encoding a polypeptide of interest (e.g., a coding region), a first flanking region (e.g., a 5'-UTR) located at the 5' end of the first region, a second flanking region (e.g., a 3'-UTR) located at the 3' end of the first region, at least one 5'-cap region, and a 3'-stabilizing region. In certain embodiments, the nucleic acid or polynucleotide further includes a poly-A region or a Kozak sequence (e.g., in the 5'-UTR). In some cases, the polynucleotide may contain one or more intronic nucleotide sequences that can be excised from the polynucleotide. In certain embodiments, the polynucleotide or nucleic acid (e.g., mRNA) may include a 5'-cap structure, a chain-terminating nucleotide, a stem-loop, a polyA sequence, and / or a polyadenylation signal. Any one of the regions of the nucleic acid may include one or more modified components (e.g., modified nucleosides). For example, the 3'-stabilizing region may contain modified nucleosides, such as L-nucleosides, reverse thymidines, or 2'-O-methyl nucleosides, and / or the coding region, 5'-UTR, 3'-UTR, or cap region may include modified nucleosides, such as 5-substituted uridines (e.g., 5-methoxyuridine), 1-substituted pseudouridines (e.g., 1-methyl-pseudouridine or 1-ethyl-pseudouridine), and / or 5-substituted cytidines (e.g., 5-methyl-cytidine).

[0221] In general, the shortest length of a polynucleotide may be a length of polynucleotide sequence sufficient to encode a dipeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a tripeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a tetrapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a pentapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a hexapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a heptapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode an octapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a nonapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a decapeptide.

[0222] Examples of dipeptides that the modified polynucleotide sequences can encode include, but are not limited to, carnosine and anserine. In some embodiments, the polynucleotide is greater than 30 nucleotides in length. In another embodiment, the polynucleotide molecule is greater than 35 nucleotides in length. In another embodiment, the length is at least 40 nucleotides. In another embodiment, the length is at least 45 nucleotides. In another embodiment, the length is at least 55 nucleotides. In another embodiment, the length is at least 50 nucleotides. In another embodiment, the length is at least 60 nucleotides. In another embodiment, the length is at least 80 nucleotides. In another embodiment, the length is at least 90 nucleotides. In another embodiment, the length is at least 100 nucleotides. In another embodiment, the length is at least 120 nucleotides. In another embodiment, the length is at least 140 nucleotides. In another embodiment, the length is at least 160 nucleotides. In another embodiment, the length is at least 180 nucleotides. In another embodiment, the length is at least 200 nucleotides. In another embodiment, the length is at least 250 nucleotides. In another embodiment, the length is at least 300 nucleotides. In another embodiment, the length is at least 350 nucleotides. In another embodiment, the length is at least 400 nucleotides. In another embodiment, the length is at least 450 nucleotides. In another embodiment, the length is at least 500 nucleotides. In another embodiment, the length is at least 600 nucleotides. In another embodiment, the length is at least 700 nucleotides. In another embodiment, the length is at least 800 nucleotides. In another embodiment, the length is at least 900 nucleotides. In another embodiment, the length is at least 1000 nucleotides. In another embodiment, the length is at least 1100 nucleotides. In another embodiment, the length is at least 1200 nucleotides. In another embodiment, the length is at least 1300 nucleotides. In another embodiment, the length is at least 1400 nucleotides.In another embodiment, the length is at least 1500 nucleotides. In another embodiment, the length is at least 1600 nucleotides. In another embodiment, the length is at least 1800 nucleotides. In another embodiment, the length is at least 2000 nucleotides. In another embodiment, the length is at least 2500 nucleotides. In another embodiment, the length is at least 3000 nucleotides. In another embodiment, the length is at least 4000 nucleotides. In another embodiment, the length is at least 5000 nucleotides or more than 5000 nucleotides.

[0223] Nucleic acids and polynucleotides may contain one or more naturally occurring nucleotides, including any of the standard nucleotides A (adenosine), G (guanosine), C (cytosine), U (uridine), or T (thymidine). In one embodiment, all or substantially all of the nucleotides comprising (a) the 5'-UTR, (b) the open reading frame (ORF), (c) the 3'-UTR, (d) the poly-A tail, and any combination of (a, b, c, or d above) contain the naturally occurring standard nucleotides A (adenosine), G (guanosine), C (cytosine), U (uridine), or T (thymidine).

[0224] Nucleic acids and polynucleotides can contain one or more modified components described herein, which provide useful properties, including improved stability and / or substantially no induction of the natural immune response of the cells into which the polynucleotide is introduced.For example, modified polynucleotides or nucleic acids exhibit reduced degradation in the cells into which the polynucleotide or nucleic acid is introduced, compared with corresponding unmodified polynucleotides or nucleic acids.These modified species can improve the efficiency of protein production, intracellular retention of polynucleotides, and / or the viability of contacted cells, as well as have reduced immunogenicity.

[0225] Polynucleotides and nucleic acids can be natural or non-natural. Polynucleotides and nucleic acids can contain one or more modified (e.g., altered or alternative) nucleobases, nucleosides, nucleotides, or combinations thereof. Nucleic acids and polynucleotides useful in nanoparticle compositions can contain any useful modification or alteration, such as those to the nucleobase, sugar, or internucleoside linkage (e.g., linking phosphate / phosphodiester bond / phosphodiester backbone). In certain embodiments, modifications (e.g., one or more modifications) are present in each of the nucleobase, sugar, and internucleoside linkage. Modifications according to the present disclosure can be modifications of ribonucleic acid (RNA) to deoxyribonucleic acid (DNA) (e.g., replacement of 2'-OH with 2'-H in a ribofuranosyl ring), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA), or hybrids thereof. Additional modifications are described herein.

[0226] Polynucleotides and nucleic acids may be uniformly modified or not uniformly modified along the entire length of the molecule. For example, one or more or all types of nucleotides (e.g., purines or pyrimidines, or one or more or all of A, G, U, C) may be uniformly modified or not in a polynucleotide or nucleic acid, or in a given sequence region thereof. In some cases, all nucleotides X in a polynucleotide (or in a given sequence region thereof) are modified, where X can be any one of the nucleotides A, G, U, C, or any one of the combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C, or A+G+C.

[0227] Different sugar modifications and / or internucleoside linkages (e.g., backbone structures) can be present at various positions in a polynucleotide. Those skilled in the art will understand that nucleotide analogs or other modifications can be placed at any position in a polynucleotide so that the function of the polynucleotide is not substantially impaired. Modifications can also be 5'- or 3'-terminal modifications. In some embodiments, a polynucleotide contains a modification at the 3'-terminus. Polynucleotides may contain from about 1% to about 100% modified nucleotides (relative to the total nucleotide content, or relative to one or more types of nucleotides, i.e., any one or more of A, G, U, or C), or any percentage therebetween (e.g., 1%-20%, 1%-25%, 1%-50%, 1%-60%, 1%-70%, 1%-80%, 1%-90%, 1%-95%, 10%-20%, 10%-25%, 10%-50%, 10%-60%, 10%-70%, 10%-80%, 10%-90%, It may contain 10% to 95%, 10% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%. It will be understood that occurrences of standard nucleotides (eg, A, G, U, or C) may account for any remaining percentages.

[0228] A polynucleotide may contain a minimum of 0% and a maximum of 100% modified nucleotides, or any percentage therebetween, such as at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides. For example, a polynucleotide may contain modified pyrimidines, such as modified uracil or cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the uracils in a polynucleotide are substituted with modified uracils (e.g., 5-substituted uracils). The modified uracils may be substituted with a compound having a single unique structure, or with multiple compounds having different structures (e.g., two, three, four, or more unique structures). In some cases, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the cytosines in a polynucleotide are substituted with modified cytosines (e.g., 5-substituted cytosines). The modified cytosines may be substituted with a compound having a single unique structure, or may be substituted with multiple compounds having different structures (e.g., two, three, four, or more unique structures).

[0229] In some cases, the nucleic acid does not substantially induce an innate immune response in a cell into which the polynucleotide (e.g., mRNA) has been introduced, characterized by 1) increased expression of pro-inflammatory cytokines, 2) activation of intracellular PRRs (e.g., RIG-I, MDA5, etc.), and / or 3) termination or reduction of protein translation.

[0230] The nucleic acid may optionally contain other agents (e.g., RNAi-inducing agents, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, tRNA, RNA that induces triple helix formation, aptamers, vectors). In certain embodiments, the nucleic acid may contain one or more messenger RNAs (mRNAs) with one or more modified nucleosides or nucleotides (i.e., modified mRNA molecules).

[0231] In certain embodiments, the nucleic acid (e.g., mRNA) molecules, formulas, compositions, or methods related thereto are disclosed in WO 2002 / 098443, WO 2003 / 051401, WO 2008 / 052770, WO 2009127230, WO 2006122828, WO 2008 / 083949, WO 2010088927, WO 2010 / 037539, WO 2004 / 00 No. 4743, International Publication No. 2005 / 016376, International Publication No. 2006 / 024518, International Publication No. 2007 / 095976, International Publication No. 2008 / 014979, International Publication No. 2008 / 077592, International Publication No. 2009 / 030481, International Publication No. 2009 / 095226, International Publication No. 2011069586, International Publication No. 2011026641, International Publication No. 2011 / 144358 Lett., International Publication No. 2012019780, International Publication No. 2012013326, International Publication No. 2012089338, International Publication No. 2012113513, International Publication No. 2012116811, International Publication No. 2012116810, International Publication No. 2013113502, International Publication No. 2013113501, International Publication No. 2013113736, International Publication No. 2013143698, International Publication No. 201314 3699 pamphlet, International Publication No. 2013143700 pamphlet, International Publication No. 2013 / 120626 pamphlet, International Publication No. 2013120627 pamphlet, International Publication No. 2013120628 pamphlet, International Publication No. 2013120629 pamphlet, International Publication No. 2013174409 pamphlet, International Publication No. 2014127917 pamphlet, International Publication No. 2015 / 024669 pamphlet, International Publication No. 2015 / 024668 pamphlet, International Publication No. 2015 / 024667 pamphlet,The present invention also includes one or more polynucleotides comprising the features described in WO 2015 / 024665, WO 2015 / 024666, WO 2015 / 024664, WO 2015101415, WO 2015101414, WO 2015024667, WO 2015062738, WO 2015101416 (all of which are incorporated herein by reference).

[0232] Nucleobase Modification Modified nucleosides and nucleotides can contain modified nucleobases. The nucleobases of nucleic acids are organic bases, such as purines or pyrimidines or their derivatives. Nucleobases can be standard bases (such as adenine, guanine, uracil, thymine, and cytosine). These nucleobases can be modified or completely replaced to provide polynucleotide molecules with improved properties, such as improved stability, such as resistance to nucleases. Non-standard or modified bases can contain one or more substitutions or modifications, including, but not limited to, alkyl, aryl, halo, oxo, hydroxyl, alkyloxy, and / or thio substitutions; one or more fused or open rings; oxidation; and / or reduction.

[0233] Modified nucleotide base pairing encompasses not only standard adenine-thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between nucleotides and / or modified nucleotides containing non-standard or modified bases, where the configuration of hydrogen bond donors and hydrogen bond acceptors allows hydrogen bonding between the non-standard base and the standard base or between two complementary non-standard base structures. An example of such non-standard base pairing is base pairing between the modified nucleotide inosine and adenine, cytosine, or uracil.

[0234] In some embodiments, the nucleobase is a modified uracil. Exemplary nucleobases and nucleosides having modified uracil include pseudouridine (ψ), pyridin-4-one ribonucleoside, 5-aza-uracil, 6-aza-uracil, 2-thio-5-aza-uracil, 2-thio-uracil (s 2 U), 4-thio-uracil (s 4 U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil (ho 5 U), 5-aminoallyl-uracil, 5-halo-uracil (e.g., 5-iodo-uracil or 5-bromo-uracil), 3-methyl-uracil (m 3 U), 5-methoxy-uracil (mo 5 U), uracil 5-hydroxyacetic acid (cmo 5 U), uracil 5-hydroxyacetic acid methyl ester (mcmo 5 U), 5-carboxymethyl-uracil (cm 5 U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uracil (chm 5 U), 5-carboxyhydroxymethyl-uracil methyl ester (mchm 5 U), 5-methoxycarbonylmethyl-uracil (mcm 5 U), 5-methoxycarbonylmethyl-2-thiouracil (mcm 5 s 2 U), 5-aminomethyl-2-thio-uracil (nm 5 s 2 U), 5-methylaminomethyl-uracil (mnm 5 U), 5-methylaminomethyl-2-thiouracil (mnm 5 s 2 U), 5-methylaminomethyl-2-seleno-uracil (mnm 5 se 2 U), 5-carbamoylmethyl-uracil (ncm 5 U), 5-carboxymethylaminomethyl-uracil (cmnm 5 U), 5-carboxymethylaminomethyl-2-thiouracil (cmnm 5 s 2U), 5-propynyl-uracil, 1-propynyl-pseudouracil, 5-taurinomethyl-uracil (τm 5 U), 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uracil (τm 5 s 2 U), 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uracil (m 5 U, i.e., having the nucleobase deoxythymine), 1-methyl-pseudouridine (m 1 ψ), 1-ethyl-pseudouridine (Et 1 ψ), 5-methyl-2-thiouracil (m 5 s 2 U), 1-methyl-4-thio-pseudouridine (m 1 s 4 ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m 3 ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouracil (D), dihydropseudouridine, 5,6-dihydrouracil, 5-methyl-dihydrouracil (m 5 D), 2-thio-dihydrouracil, 2-thio-dihydropseudouridine, 2-methoxy-uracil, 2-methoxy-4-thio-uracil, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uracil (acp 3 U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp 3 ψ), 5-(isopentenylaminomethyl)uracil (inm 5 U), 5-(isopentenylaminomethyl)-2-thiouracil (inm 5 s 2 U), 5,2'-O-dimethyl-uridine (m 5 Um), 2-thio-2'-O_methyl-uridine (s 2 Um), 5-methoxycarbonylmethyl-2'-O-methyl-uridine (mcm 5Um), 5-carbamoylmethyl-2'-O-methyl-uridine (ncm 5 Um), 5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm 5 Um), 3,2'-O-dimethyl-uridine (m 3 Um), and 5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm 5 Um), 1-thio-uracil, deoxythymidine, 5-(2-carbomethoxyvinyl)-uracil, 5-(carbamoylhydroxymethyl)-uracil, 5-carbamoylmethyl-2-thio-uracil, 5-carboxymethyl-2-thio-uracil, 5-cyanomethyl-uracil, 5-methoxy-2-thio-uracil, and 5-[3-(1-E-propenylamino)]uracil.

[0235] In some embodiments, the nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides having modified cytosines include 5-aza-cytosine, 6-aza-cytosine, pseudoisocytidine, 3-methyl-cytosine (m3C), N4-acetyl-cytosine (ac4C), 5-formyl-cytosine (f5C), N4-methyl-cytosine (m4C), 5-methyl-cytosine (m5C), 5-halo-cytosine (e.g., 5-iodo-cytosine), 5-hydroxymethyl-cytosine (hm5C), 1-methyl-pseudoisocytidine, pyrrolo-cytosine, pyrrolo-pseudoisocytidine, 2-thio-cytosine (s2C), 2-thio-5-methyl-cytosine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine Pseudoisocytidine, Zebularine, 5-Aza-Zebularine, 5-Methyl-Zebularine, 5-Aza-2-Thio-Zebularine, 2-Thio-Zebularine, 2-Methoxy-Cytosine, 2-Methoxy-5-Methyl-Cytosine, 4-Methoxy-Pseudoisocytidine, 4-Methoxy-1-Methyl-Pseudoisocytidine, Lysidine (k2C), 5,2'-O-Dimethyl-Cytidine (m5Cm), N4-Aza- These include cetyl-2'-O-methyl-cytidine (ac4Cm), N4,2'-O-dimethyl-cytidine (m4Cm), 5-formyl-2'-O-methyl-cytidine (f5Cm), N4,N4,2'-O-trimethyl-cytidine (m42Cm), 1-thio-cytosine, 5-hydroxy-cytosine, 5-(3-azidopropyl)-cytosine, and 5-(2-azidoethyl)-cytosine.

[0236] In some embodiments, the nucleobase is a modified adenine.Exemplary nucleobases and nucleosides having modified adenines include 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza- 2,6-Diaminopurine, 1-methyl-adenine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenine (m6A), 2-methylthio-N6-methyl-adenine (ms2m6A), N6-isopentenyl-adenine (i6A), 2-methylthio-N6-isopentenyl-adenine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyl-adenine (g6A), N6-threonylcarbamoyl-adenine (t6A), N6-methyl-N6-threonylcarbamoyl-adenine (m6t6A), 2-methylthio-N6-threonylcarbamoyl-adenine (ms2g6A), N6,N6-dimethyl-adenine (m62A), N6-hydroxynorvalylcarbamoyl-adenine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenine (ms2hn6A), N6-acetyl-adenine (ac6A), 7-methyl-adenine, 2-methylthio- These include adenine, 2-methoxy-adenine, N6,2'-O-dimethyl-adenosine (m6Am), N6,N6,2'-O-trimethyl-adenosine (m62Am), 1,2'-O-dimethyl-adenosine (m1Am), 2-amino-N6-methyl-purine, 1-thio-adenine, 8-azido-adenine, N6-(19-amino-pentaoxanonadecyl)-adenine, 2,8-dimethyl-adenine, N6-formyl-adenine, and N6-hydroxymethyl-adenine.

[0237] In some embodiments, the nucleobase is a modified guanine. Exemplary nucleobases and nucleosides having modified guanine include inosine (I), 1-methyl-inosine (m1I), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wyobutosine (yW), peroxywyobutosine (o2yW), hydroxywyobutosine (OHyW), undermodified hydroxywyobutosine (OHyW), and hydroxywyobutosine (OHyW). * ), 7-deaza-guanine, queuosine (Q), epoxyqueuosine (oQ), galactosyl-queuosine (galQ), mannosyl-queuosine (manQ), 7-cyano-7-deaza-guanine (preQ0), 7-aminomethyl-7-deaza-guanine (preQ1), archaeosine (G+), 7-deaza-8-aza-guanine, 6-thio-guanine, 6-thio-7-deaza-guanine, 6-thio-7-deaza-8-aza-guanine, 7-methyl-guanine (m7G), 6-thio-7-methyl-guanine, 7-methyl-inosine, 6-methoxy-guanine, 1-methyl-guanine (m1G), N2-methyl-guanine (m2G), N2,N2-dimethyl-guanine (m22G), N2,7-di These include methyl-guanine (m2,7G), N2,N2,7-dimethyl-guanine (m2,2,7G), 8-oxo-guanine, 7-methyl-8-oxo-guanine, 1-methyl-6-thio-guanine, N2-methyl-6-thio-guanine, N2,N2-dimethyl-6-thio-guanine, N2-methyl-2'-O-methyl-guanosine (m2Gm), N2,N2-dimethyl-2'-O-methyl-guanosine (m22Gm), 1-methyl-2'-O-methyl-guanosine (m1Gm), N2,7-dimethyl-2'-O-methyl-guanosine (m2,7Gm), 2'-O-methyl-inosine (Im), 1,2'-O-dimethyl-inosine (m1Im), 1-thio-guanine, and O-6-methyl-guanine.

[0238] The modified nucleobase of a nucleotide can independently be a purine, a pyrimidine, a purine or pyrimidine analog. For example, the nucleobase can be a modified adenine, cytosine, guanine, uracil, or hypoxanthine. In another embodiment, the nucleobases can also include, for example, natural and synthetic derivatives of bases, such as pyrazolo[3,4-d]pyrimidine, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (e.g., 8-bromo), 8-amino, 8-thiol , 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, deazaguanine, 7-deazaguanine, 3-deazaguanine, deazaadenine, 7-deazaadenine, 3-deazaadenine, pyrazolo[3,4-d]pyrimidine, imidazo[1,5-a]1,3,5 triazinone, 9-deazapurine, imidazo[4,5-d]pyrazine, thiazolo[4,5-d]pyrimidine, pyrazin-2-one, 1,2,4-triazine, pyridazine; or 1,3,5 triazine. When nucleotides are designated using the abbreviations A, G, C, T, or U, each letter refers to a representative base and / or its derivatives, e.g., A includes adenine or an adenine analog, e.g., 7-deazaadenine).

[0239] Modifications in sugars Nucleosides comprise a sugar molecule (e.g., a 5-carbon or 6-carbon sugar, such as pentose, ribose, arabinose, xylose, glucose, galactose, or their deoxy derivatives) in combination with a nucleic acid base, while nucleotides are nucleosides containing a phosphate group or modified group (e.g., boranophosphate, thiophosphate, selenophosphate, phosphonate, alkyl group, amidate, and glycerol). The nucleoside or nucleotide may be a standard species, e.g., a nucleoside or nucleotide containing a standard nucleic acid base, sugar, and, in the case of a nucleotide, a phosphate group, or a modified nucleoside or nucleotide containing one or more modified components. For example, modified nucleosides and nucleotides may be modified in the sugar of the nucleoside or nucleotide. In certain embodiments, modified nucleosides or nucleotides have the structure:

[0240] [ka]

[0241] In each of formulas IV, V, VI and VII: each of m and n is independently an integer from 0 to 5; Each of U and U' is independently O, S, N(R U ) nu , or C(R U ) nu where nu is an integer from 0 to 2, and each R U is independently H, halo, or optionally substituted alkyl; R 1’ , R 2’ , R 1” , R 2” , R 1 , R 2 , R 3 , R 4 , and R 5each, if present, is independently H, halo, hydroxy, thiol, optionally substituted alkyl, optionally substituted alkoxy, optionally substituted alkenyloxy, optionally substituted alkynyloxy, optionally substituted aminoalkoxy, optionally substituted alkoxyalkoxy, optionally substituted hydroxyalkoxy, optionally substituted amino, azido, optionally substituted aryl, optionally substituted aminoalkyl, optionally substituted aminoalkenyl, optionally substituted aminoalkynyl, or absent; 3 and R 1’ , R 1” , R 2’ , R 2” , or R 5 (e.g., R 1’ and R 3 Combination of R 1” and R 3 Combination of R 2’ and R 3 Combination of R 2” and R 3 combination, or R 5 and R 3 (combinations of) can be joined together to form an optionally substituted alkylene or an optionally substituted heteroalkylene, which, together with the carbons to which they are attached, provide an optionally substituted heterocyclyl (e.g., a bicyclic, tricyclic, or tetracyclic heterocyclyl); where R 5 and R 1’ , R 1” , R 2’ , or R 2” (e.g., R 1’ and R 5 Combination of R 1” and R 5 Combination of R 2’ and R 5 combination, or R 2” and R 5(combinations of) can be joined together to form an optionally substituted alkylene or an optionally substituted heteroalkylene, which, together with the carbons to which they are attached, provide an optionally substituted heterocyclyl (e.g., a bicyclic, tricyclic, or tetracyclic heterocyclyl); where R 4 and R 1’ , R 1” , R 2’ , R 2” , R 3 , or R 5 can be joined together to form an optionally substituted alkylene or an optionally substituted heteroalkylene, which, together with the carbons to which they are attached, provide an optionally substituted heterocyclyl (e.g., a bicyclic, tricyclic, or tetracyclic heterocyclyl); each of m' and m" is independently an integer from 0 to 3 (e.g., 0 to 2, 0 to 1, 1 to 3, or 1 to 2); Y 1 , Y 2 , and Y 3 each independently represents O, S, Se, -NR N1 -, optionally substituted alkylene, or optionally substituted heteroalkylene, where R N1 is H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted aryl, or absent; Each Y 4 are independently H, hydroxy, thiol, boranyl, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted alkoxy, optionally substituted alkenyloxy, optionally substituted alkynyloxy, optionally substituted thioalkoxy, optionally substituted alkoxyalkoxy, or optionally substituted amino; Each Y 5 is independently O, S, Se, optionally substituted alkylene (e.g., methylene), or optionally substituted heteroalkylene; B is a nucleobase, either modified or unmodified. In some embodiments, the 2'-hydroxy group (OH) can be modified or substituted with several different substituents. Exemplary substitutions at the 2'-position include, but are not limited to, H, azido, halo (e.g., fluoro), optionally substituted C 1~6 alkyl (e.g., methyl); optionally substituted C 1~6 Alkoxy (e.g., methoxy or ethoxy); optionally substituted C 6~10 Aryloxy; optionally substituted C 3~8 Cycloalkyl; optionally substituted C 6~10 Aryl-C 1~6 Alkoxy, optionally substituted C 1~12 (heterocyclyl)oxy; sugars (e.g., ribose, pentose, or any described herein); polyethylene glycol (PEG), -O(CH2CH2O) n CH2CH2OR (wherein R is H or optionally substituted alkyl and n is an integer from 0 to 20 (e.g., 0 to 4, 0 to 8, 0 to 10, 0 to 16, 1 to 4, 1 to 8, 1 to 10, 1 to 16, 1 to 20, 2 to 4, 2 to 8, 2 to 10, 2 to 16, 2 to 20, 4 to 8, 4 to 10, 4 to 16, and 4 to 20); "locked" nucleic acids (LNAs) (wherein the 2'-hydroxy is C 1~6 Alkylene or C 1~6The ribose sugar is linked to the 4'-carbon of the same ribose sugar by a heteroalkylene bridge, exemplary bridges including methylene, propylene, ether, or amino bridges; aminoalkyl, as defined herein; aminoalkoxy, as defined herein; amino, as defined herein; and amino acid, as defined herein. Generally, RNA contains the sugar group ribose, which is a five-membered ring containing oxygen. Exemplary modified nucleotides include, but are not limited to, oxygen substitution in ribose (e.g., with S, Se, or alkylenes such as methylene or ethylene); double bond addition (e.g., to replace ribose with cyclopentenyl or cyclohexenyl); ribose ring contraction (e.g., to form a four-membered ring of cyclobutane or oxetane); ribose ring expansion (e.g., to add additional carbon or heteroatoms, such as anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino (also having a phosphoramidate backbone)). to form 6- or 7-membered rings having atoms therein; polycyclic forms (e.g., tricyclic and "unlocked" forms such as glycol nucleic acids (GNAs) (e.g., R-GNA or S-GNA, in which the ribose is replaced by a glycol unit linked to a phosphodiester bond), threose nucleic acids (TNA, in which the ribose is replaced by α-L-threofuranosyl-(3'→2')), and peptide nucleic acids (PNA, in which a 2-amino-ethyl-glycine bond replaces the ribose and phosphodiester backbone).

[0242] In certain embodiments, the sugar group contains one or more carbons that have the opposite stereochemical configuration as the corresponding carbon in ribose. Thus, a polynucleotide molecule can include nucleotides that contain, for example, arabinose or L-ribose as the sugar.

[0243] In certain embodiments, a polynucleotide comprises at least one nucleoside where the sugar is L-ribose, 2'-O-methyl-ribose, 2'-fluoro-ribose, arabinose, hexitol, LNA, or PNA.

[0244] Modifications in internucleoside linkages Modified nucleotides can be modified in the internucleoside linkage (e.g., phosphate backbone). In this specification, the terms "phosphate" and "phosphodiester" are used interchangeably with respect to polynucleotide backbone. The backbone phosphate group can be modified by replacing one or more of the oxygen atoms with different substituents.

[0245] Modified nucleotides can include wholesale substitution of unmodified phosphate moieties with other internucleoside linkages as described herein.Examples of modified phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenate, boranophosphate, boranophosphate ester, hydrogen phosphonate, phosphoramidate, phosphorodiamidate, alkyl or aryl phosphonate, and phosphotriester.Phosphorodithioate has both non-linked oxygens replaced by sulfur.Phosphate linker can also be modified by replacing the linking oxygen with nitrogen (bridged phosphoramidate), sulfur (bridged phosphorothioate), and carbon (bridged methylene-phosphonate).

[0246] Modified nucleosides and nucleotides can include substitution of one or more non-bridging oxygens with a borane moiety (BH3), sulfur (thio), methyl, ethyl, and / or methoxy. As a non-limiting example, two non-bridging oxygens at the same position (e.g., the alpha (α), beta (β), or gamma (γ) position) can be substituted with sulfur (thio) and methoxy.

[0247] Substitution of one or more oxygen atoms at the α-position of the phosphate moiety (e.g., α-phosphate thiolate) provides RNA and DNA with unnatural phosphorothioate backbone linkages to provide stability (e.g., against exonucleases and endonucleases).Phosphorothioate DNA and RNA have increased nuclease resistance and therefore a longer half-life in the cellular environment.

[0248] Other internucleoside linkages that can be used in accordance with the present disclosure are described herein, including internucleoside linkages that do not contain a phosphorus atom. Internal ribosome entry site A polynucleotide may contain an internal ribosome entry site (IRES). An IRES may act as the sole ribosome binding site or as one of multiple ribosome binding sites of an mRNA. A polynucleotide containing more than one functional ribosome binding site may encode several peptides or polypeptides that are independently translated by the ribosome (e.g., a polycistronic mRNA). When a polynucleotide comprises an IRES, a second translatable region is optionally further provided. Examples of IRES sequences that may be used in accordance with the present disclosure include, but are not limited to, those from picornaviruses (e.g., picornavirus (FMDV)), plague virus (CFFV), polio virus (PV), encephalomyocarditis virus (ECMV), foot-and-mouth disease virus (FMDV), hepatitis C virus (HCV), classical swine fever virus (CSFV), and the like. Examples include those derived from swine fever virus, murine leukemia virus (MLV), simian immune deficiency virus (SIV) or cricket paralysis virus (CrPV).

[0249] 5'-cap structure A polynucleotide (e.g., mRNA) may contain a 5'-cap structure. The 5'-cap structure of a polynucleotide is involved in nuclear export, enhances polynucleotide stability, and binds to mRNA cap-binding protein (CBP), which is involved in intracellular polynucleotide stability and translational competence through the binding of CBP to poly-A binding protein to form mature circular mRNA species. The cap also assists in the removal of 5'-proximal introns during mRNA splicing.

[0250] Endogenous polynucleotide molecules can be capped at the 5' end to form a 5'-ppp-5'-triphosphate linkage between the terminal guanosine cap residue of the polynucleotide and the 5'-terminal transcribed sense nucleotide. This 5'-guanylate cap can then be methylated to generate an N7-methyl-guanylate residue. The ribose sugar of the terminal and / or anteterminal transcribed nucleotide at the 5' end of the polynucleotide can also optionally be 2'-O-methylated. 5'-cap removal by hydrolysis and cleavage of the guanylate cap structure can target degradation of polynucleotide molecules, such as mRNA molecules.

[0251] Modifications to polynucleotides can generate non-hydrolyzable cap structures to prevent cap removal and thereby increase polynucleotide half-life. Because cap structure hydrolysis requires cleavage of the 5'-ppp-5' phosphorodiester bond, modified nucleotides can be used during the capping reaction. For example, Vaccinia Capping Enzyme from New England Biolabs (Ipswich, MA) can be used with α-thio-guanosine nucleotides according to the manufacturer's instructions to form phosphorothioate bonds within the 5'-ppp-5' cap. Additional modified guanosine nucleotides, such as α-methyl-phosphonate and seleno-phosphate nucleotides, can be used.

[0252] Further modifications include, but are not limited to, 2'-O-methylation (described above) of the ribose sugar of the 5'-terminus and / or penultimate nucleotide of the polynucleotide at the 2'-hydroxy group of the sugar. Several different 5'-cap structures can be used to generate the 5'-cap of a polynucleotide, such as an mRNA molecule.

[0253] 5'-cap structures include those described in International Patent Publication Nos. WO2008127688, WO2008016473, and WO2011015347, each of which is incorporated herein by reference.

[0254] A cap analog, also referred to herein as a synthetic cap analog, chemical cap, chemical cap analog, or structural or functional cap analog, differs in its chemical structure from the natural (i.e., endogenous, wild-type, or physiological) 5'-cap while retaining cap function. Cap analogs can be synthesized / linked to a polynucleotide chemically (i.e., non-enzymatically) or enzymatically.

[0255] For example, an anti-reverse cap analog (ARCA) cap contains two guanosines linked by a 5'-5'-triphosphate group, where one guanosine has an N7-methyl group as well as a 3'-O-methyl group (i.e., N7,3'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m 7 The N7- and 3'-O-methylated guanosine contains the N7- and 3'-O-methylated guanosine residues (which may also be referred to as 3'O-Me-m7G(5')ppp(5')G). The 3'-O atom of the other unmodified guanosine is linked to the 5'-terminal nucleotide of the capped polynucleotide (e.g., mRNA). The N7- and 3'-O-methylated guanosine provides the terminal portion of the capped polynucleotide (e.g., mRNA).

[0256] Another exemplary cap is mCAP, which is similar to ARCA but has a 2'-O-methyl group on the guanosine (i.e., N7,2'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, mCAP). 7 Gm-ppp-G).

[0257] The cap can be a dinucleotide cap analog. As a non-limiting example, dinucleotide cap analogs, such as those described in U.S. Pat. No. 8,519,110 (the cap structures of which are incorporated herein by reference), can be modified with boranophosphate or phosphoroselenoate groups at various phosphate positions.

[0258] Alternatively, the cap analog can be an N7-(4-chlorophenoxyethyl)-substituted dinucleotide cap analog known in the art and / or described herein. Non-limiting examples of N7-(4-chlorophenoxyethyl)-substituted dinucleotide cap analogs include N7-(4-chlorophenoxyethyl)-G(5')ppp(5')G and N7-(4-chlorophenoxyethyl)-m3'-OG(5')ppp(5')G cap analogs (see, e.g., the various cap analogs and methods for synthesizing cap analogs described in Kore et al., Bioorganic & Medicinal Chemistry 2013 21:4570-4574, the cap structures of which are incorporated herein by reference). In other cases, cap analogs useful for polynucleotides of the present disclosure are 4-chloro / bromophenoxyethyl analogs.

[0259] Although cap analogs allow for the simultaneous capping of polynucleotides in in vitro transcription reactions, up to 20% of transcripts remain uncapped. This, along with the structural differences between the cap analog and the endogenous 5'-cap structure of polynucleotides produced by the endogenous cellular transcription machinery, can result in reduced translational efficiency and reduced cellular stability.

[0260] Modified polynucleotides can also be post-transcriptionally capped using enzymes to generate more authentic 5'-cap structures. As used herein, the phrase "more authentic" refers to features that structurally or functionally resemble or mimic endogenous or wild-type features. That is, a "more authentic" feature better represents endogenous, wild-type, native, or physiological cellular function and / or structure compared to prior art synthetic features or analogs, or outperforms corresponding endogenous, wild-type, native, or physiological features in one or more respects. Non-limiting examples of more authentic 5'-cap structures useful for polynucleotides of the present disclosure are those that have, among others, increased binding of cap-binding proteins, increased half-life, reduced susceptibility to 5'-endonucleases, and / or decreased 5'-cap removal compared to synthetic 5'-cap structures (or wild-type, native, or physiological 5'-cap structures) known in the art. For example, recombinant vaccinia virus capping enzyme and recombinant 2'-O-methyltransferase enzyme can form a standard 5'-5'-triphosphate linkage between the 5'-terminal nucleotide of a polynucleotide and a guanosine cap nucleotide, where the cap guanosine contains an N7-methylation and the 5'-terminal nucleotide of the polynucleotide contains a 2'-O-methyl. Such a structure is called a Cap 1 structure. This cap results in higher translational capacity, cellular stability, and reduced activation of cellular pro-inflammatory cytokines, for example, compared to other 5'-cap analog structures known in the art. Other exemplary cap structures include 7mG(5')ppp(5')N,pN2p (cap 0), 7mG(5')ppp(5')NlmpNp (cap 1), 7mG(5')-ppp(5')NlmpN2mp (cap 2), and m(7)Gpppm(3)(6,6,2')Apm(2')Apm(2')Cpm(2)(3,2')Up (cap 4).

[0261] Because the modified polynucleotides can be capped after transcription, and because this process is more efficient, nearly 100% of the modified polynucleotides can be capped, as opposed to about 80% when a cap analog is attached to the polynucleotide during the in vitro transcription reaction.

[0262] The 5'-end cap can include an endogenous cap or a cap analog. The 5'-end can include a guanosine analog. Useful guanosine analogs include inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0263] In some cases, the polynucleotide contains a modified 5'-cap. Modifications at the 5'-cap can increase the stability of the polynucleotide, increase the half-life of the polynucleotide, and increase the translation efficiency of the polynucleotide. Modified 5'-caps include, but are not limited to, one or more of the following modifications: a modification at the 2' and / or 3' position of the capped guanosine triphosphate (GTP), a sugar ring oxygen replacement with a methylene moiety (CH2) (thereby generating a carbocyclic ring), a modification at the triphosphate bridge portion of the cap structure, or a modification at the nucleobase (G) portion.

[0264] 5'-UTR A 5'-UTR can be provided as a flanking region of a polynucleotide (e.g., mRNA). The 5'-UTR can be homologous or heterologous to the coding region found in the polynucleotide. Multiple 5'-UTRs can be included in the flanking region and can be of the same or different sequences. Any portion (including none) of the flanking region can be codon-optimized and can independently contain one or more different structural or chemical modifications before and / or after codon optimization.

[0265] Table 21 of U.S. Provisional Patent Application No. 61 / 775,509 and Tables 21 and 22 of U.S. Provisional Patent Application No. 61 / 829,372, which are incorporated herein by reference, provide lists of start and stop sites for modified polynucleotides (e.g., mRNAs). In Table 21, each 5'-UTR (5'-UTR-005 to 5'-UTR 68511) is identified by its start and stop sites relative to its native or wild-type (homologous) transcript (ENST; identification numbers used in the ENSEMBL database).

[0266] A 5'-UTR heterologous to the coding region of a modified polynucleotide (e.g., mRNA) can be engineered to modify one or more properties of the polynucleotide (e.g., mRNA). The polynucleotide (e.g., mRNA) can then be administered to a cell, tissue, or organism, and results such as protein level, localization, and / or half-life can be measured to assess the beneficial effects that the heterologous 5'-UTR may have on the modified polynucleotide (mRNA). 5'-UTR mutants can be used in which one or more nucleotides, including A, T, C, or G, are added or removed from the end. The 5'-UTR can also be codon-optimized or modified by any of the methods described herein.

[0267] 5'-UTR, 3'-UTR, and translation enhancer elements (TEEs) The 5'-UTR of a polynucleotide (e.g., mRNA) may contain at least one translational enhancer element. The term "translational enhancer element" refers to a sequence that increases the amount of a polypeptide or protein produced from a polynucleotide. As a non-limiting example, a TEE may be located between the transcription promoter and the start codon. A polynucleotide (e.g., mRNA) having at least one TEE in its 5'-UTR may include a cap in the 5'-UTR. Furthermore, at least one TEE may be located in the 5'-UTR of a polynucleotide (e.g., mRNA) to effect cap-dependent or cap-independent translation.

[0268] In one embodiment, TEEs are conserved elements in UTRs that can facilitate translational activity of a polynucleotide, including, but not limited to, cap-dependent or cap-independent translation. The conservation of these sequences has been previously demonstrated by Panek et al. (Nucleic Acids Research, 2013, 1-10) for 14 species, including humans.

[0269] In one non-limiting example, a known TEE can be found in the 5'-leader of the Gtx homeodomain protein (Chappell et al., Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004, which TEE is incorporated herein by reference).

[0270] In another non-limiting example, TEEs are disclosed in U.S. Patent Application Publication No. 2009 / 0226470 as SEQ ID NOs: 1-35, in U.S. Patent Application Publication No. 2013 / 0177581 as SEQ ID NOs: 1-35, in International Patent Publication No. WO 2009 / 075886 as SEQ ID NOs: 1-35, in International Patent Publication No. WO 2012 / 009644 as SEQ ID NOs: 1-5, and 7-645, in International Patent Publication No. WO 1999 / 024595 as SEQ ID NO: 1, in U.S. Patent No. 6,310,197 as SEQ ID NO: 1, and in U.S. Patent No. 6,849,405 as SEQ ID NO: 1, each of which TEE sequences is incorporated herein by reference.

[0271] In yet another non-limiting example, the TEE can be an internal ribosome entry site (IRES), HCV-IRES, or IRES element, such as, but not limited to, those described in U.S. Pat. No. 7,468,275, U.S. Patent Application Publication Nos. 2007 / 0048776 and 2011 / 0124100, and International Patent Publication Nos. WO 2007 / 025008 and WO 2001 / 055369 (the respective IRES sequences of which are incorporated herein by reference). IRES elements include, but are not limited to, the Gtx sequences (e.g., Gtx9-nt, Gtx8-nt, Gtx7-nt) described by Chappell et al. (Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004) and by Zhou et al. (PNAS 102:6273-6278, 2005), and in U.S. Patent Application Publication Nos. 2007 / 0048776 and 2011 / 0124100 and International Patent Publication No. WO 2007 / 025008, the IRES sequences of each of which are incorporated herein by reference.

[0272] "Translation enhancer polynucleotides" are exemplified herein and / or disclosed in the art (e.g., U.S. Pat. Nos. 6,310,197, 6,849,405, 7,456,273, 7,183,395, U.S. Patent Application Publication Nos. 20090 / 226470, 2007 / 0048776, 2011 / 0124100, 2009 / 0093049, etc.). See International Patent Publication Nos. WO 2009 / 075886, WO 2007 / 025008, WO 2012 / 009644, WO 2001 / 055371, WO 1999 / 024595, and European Patent Nos. 2610341 and 2610340 (each of which is a TEE). A sequence is a polynucleotide that contains one or more specific TEEs (incorporated herein by reference) or their variants, homologs, or functional derivatives. One or more copies of a specific TEE may be present in a polynucleotide (e.g., mRNA). A TEE in a translation enhancer polynucleotide may be organized in one or more sequence segments. A sequence segment can possess one or more of the specific TEEs exemplified herein, with each TEE being present in one or more copies. When multiple sequence segments are present in a translation enhancer polynucleotide, they may be homologous or heterologous. Thus, multiple sequence segments in a translation enhancer polynucleotide may possess the same or different types of the specific TEEs exemplified herein, the same or different numbers of copies of each of the specific TEEs, and / or the same or different configurations of TEEs within each sequence segment.

[0273] Polynucleotides (e.g., mRNA) can be prepared using methods described in International Patent Publication Nos. WO 1999 / 024595, WO 2012 / 009644, WO 2009 / 075886, WO 2007 / 025008, WO 1999 / 024595, European Patent Application Publication Nos. 2610341 and 2610340, U.S. Pat. No. 6,310,197 ... The TEE may comprise at least one TEE described in U.S. Patent Publication Nos. 849,405, 7,456,273, 7,183,395, and U.S. Patent Application Publication Nos. 2009 / 0226470, 2011 / 0124100, 2007 / 0048776, 2009 / 0093049, and 2013 / 0177581 (the TEE sequences of each of which are incorporated herein by reference). The TEE may be located in the 5'-UTR of a polynucleotide (e.g., mRNA).

[0274] Polynucleotides (e.g., mRNA) may be prepared using methods described in U.S. Patent Application Publication Nos. 2009 / 0226470, 2007 / 0048776, 2013 / 0177581, and 2011 / 0124100, International Patent Publication Nos. WO 1999 / 024595, WO 2012 / 009644, WO 2009 / 075886, and WO 2007 / 025008, European Patent Application Publication Nos. 2610341 and 26103 Nos. 40, 6,310,197, 6,849,405, 7,456,273, and 7,183,395 (the TEE sequences of each of which are incorporated herein by reference).

[0275] The 5'-UTR of a polynucleotide (e.g., mRNA) may contain at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, or more than 60 TEE sequences. The TEE sequences in the 5'-UTR of a polynucleotide (e.g., mRNA) may be the same or different TEE sequences. The TEE sequences may be in a pattern such as ABABAB, AABBAABBAABB, or ABCABCABC, or variations thereof, repeated once, twice, or more than three times. In these patterns, each letter A, B, or C represents a different TEE sequence at the nucleotide level.

[0276] In some cases, the 5'-UTR may include a spacer separating the two TEE sequences. As a non-limiting example, the spacer may be a 15-nucleotide spacer and / or other spacers known in the art. As another non-limiting example, the 5'-UTR may include a TEE sequence-spacer module that is repeated at least once, at least twice, at least three times, at least four times, at least five times, at least six times, at least seven times, at least eight times, at least nine times, or ten or more times in the 5'-UTR.

[0277] In other cases, the spacer separating the two TEE sequences may include other sequences known in the art that can regulate translation of a polynucleotide (e.g., an mRNA) of the present disclosure, such as, but not limited to, an miR sequence (e.g., an miR binding site and an miR seed). As a non-limiting example, each spacer used to separate the two TEE sequences may include a different miR sequence or component of a miR sequence (e.g., an miR seed sequence).

[0278] In some cases, the TEE in the 5'-UTR of a polynucleotide (e.g., mRNA) may be selected from the group consisting of those described in U.S. Patent Application Publication Nos. 2009 / 0226470, 2007 / 0048776, 2013 / 0177581, and 2011 / 0124100, International Patent Publication Nos. WO 1999 / 024595, WO 2012 / 009644, WO 2009 / 075886, and WO 2007 / 025008, European Patent Application Publication Nos. 2610341 and 2610340, and U.S. Pat. No. 6,310,197. The TEE sequences disclosed in the specification, US Pat. Nos. 6,849,405, 7,456,273, and 7,183,395 (each of which TEE sequences are incorporated herein by reference) may comprise at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or more than 99% of the TEE sequences disclosed in the specification, US Pat. Nos. 6,849,405, 7,456,273, and 7,183,395 (each of which TEE sequences are incorporated herein by reference).In another embodiment, the TEE in the 5'-UTR of a polynucleotide (e.g., mRNA) of the present disclosure is selected from the group consisting of those described in U.S. Patent Application Publication Nos. 2009 / 0226470, 2007 / 0048776, 2013 / 0177581, and 2011 / 0124100, International Patent Publication Nos. WO 1999 / 024595, WO 2012 / 009644, WO 2009 / 075886, and WO 2007 / 02500. The TEE sequences may include 5-30 nucleotide fragments, 5-25 nucleotide fragments, 5-20 nucleotide fragments, 5-15 nucleotide fragments, 5-10 nucleotide fragments of the TEE sequences disclosed in European Patent Application Publication No. 8, European Patent Application Publication Nos. 2610341 and 2610340, and U.S. Patent Nos. 6,310,197, 6,849,405, 7,456,273, and 7,183,395 (the TEE sequences of each of which are incorporated herein by reference).

[0279] In some cases, the TEE in the 5'-UTR of a polynucleotide (e.g., mRNA) of the present disclosure may be a TEE as described by Chappell et al. (Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004) and Zhou et al. (PNAS 102:6273-6278, 2005), Wellensiek et al. ("Genome-wide profiling of human cap-independent translation-enhancing elements," Nature Methods, 2006), and Zhou et al. (PNAS 102:6273-6278, 2005). The TEE sequences disclosed in Supplementary Table 1 and Supplementary Table 2 disclosed by the National Institute of Standards and Technology (NIS), 2013; DOI:10.1038 / NMETH.2522 (each of which TEE sequences is incorporated herein by reference) may comprise at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or more than 99% of the TEE sequences disclosed in Supplementary Table 1 and Supplementary Table 2 disclosed by the National Institute of Standards and Technology (NIS), 2013; DOI:10.1038 / NMETH.2522 (each of which TEE sequences is incorporated herein by reference).In another embodiment, the TEE in the 5'-UTR of a polynucleotide (e.g., mRNA) of the present disclosure is selected from the group consisting of Chappell et al. (Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004) and Zhou et al. (PNAS 102:6273-6278, 2005), Wellensiek et al. ("Genome-wide profiling of human cap-independent translation-enhancing elements," Nature Methods, 2006), and Zhou et al. (PNAS 102:6273-6278, 2005). The TEE sequences may include a 5-30 nucleotide fragment, a 5-25 nucleotide fragment, a 5-20 nucleotide fragment, a 5-15 nucleotide fragment, or a 5-10 nucleotide fragment of the TEE sequences disclosed in Supplementary Table 1 and Supplementary Table 2 disclosed by the National Institute of Standards and Technology (NIS), 2013; DOI: 10.1038 / NMETH.2522 (each of which TEE sequences is incorporated herein by reference).

[0280] In some cases, the TEE used in the 5'-UTR of a polynucleotide (e.g., mRNA) is an IRES sequence, such as, but not limited to, those described in U.S. Pat. No. 7,468,275 and International Patent Publication No. WO 2001 / 055369 (the TEE sequences of each of which are incorporated herein by reference).

[0281] In some cases, TEEs used in the 5'-UTR of a polynucleotide (e.g., an mRNA) can be identified by the methods described in U.S. Patent Application Publication Nos. 2007 / 0048776 and 2011 / 0124100 and International Patent Publication Nos. WO 2007 / 025008 and WO 2012 / 009644, each of which is incorporated herein by reference.

[0282] In some cases, the TEE used in the 5'-UTR of the polynucleotide (e.g., mRNA) of the present disclosure can be the transcriptional regulatory element described in U.S. Patent Nos. 7,456,273 and 7,183,395, U.S. Patent Application Publication No. 2009 / 0093049, and International Publication No. WO 2001 / 055371 (each of which TEE sequences are incorporated herein by reference).Transcriptional regulatory elements can be identified by methods known in the art, such as, but not limited to, the methods described in U.S. Patent Nos. 7,456,273 and 7,183,395, U.S. Patent Application Publication No. 2009 / 0093049, and International Publication No. WO 2001 / 055371 (each of which methods are incorporated herein by reference).

[0283] In still other cases, the TEE used in the 5'-UTR of a polynucleotide (e.g., an mRNA) is a polynucleotide or portion thereof described in U.S. Pat. Nos. 7,456,273 and 7,183,395, U.S. Patent Application Publication No. 2009 / 0093049, and International Publication No. WO 2001 / 055371 (the TEE sequences of each of which are incorporated herein by reference).

[0284] The 5'-UTR comprising at least one TEE as described herein can be incorporated into a monocistronic sequence, such as, but not limited to, a vector system or a polynucleotide vector. Non-limiting examples of vector systems and polynucleotide vectors include those described in U.S. Patent Nos. 7,456,273 and 7,183,395, U.S. Patent Application Publication Nos. 2007 / 0048776, 2009 / 0093049 and 2011 / 0124100, and International Patent Publication Nos. WO 2007 / 025008 and WO 2001 / 055371 (each of which TEE sequences is incorporated herein by reference).

[0285] The TEEs described herein can be located in the 5'-UTR and / or 3'-UTR of a polynucleotide (e.g., mRNA). The TEE located in the 3'-UTR can be the same and / or different from the TEE located in the 5'-UTR and / or described for incorporation into the 5'-UTR.

[0286] In some cases, the 3'-UTR of a polynucleotide (e.g., mRNA) may contain at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, or more than 60 TEE sequences. The TEE sequences in the 3'-UTR of a polynucleotide (e.g., mRNA) of the present disclosure may be the same or different TEE sequences. The TEE sequences may be in a pattern such as ABABAB, AABBAABBAABB, or ABCABCABC, or variations thereof, repeated once, twice, or more than three times. In these patterns, each letter A, B, or C represents a different TEE sequence at the nucleotide level.

[0287] In some cases, the 3'-UTR may include a spacer separating the two TEE sequences. As a non-limiting example, the spacer may be a 15-nucleotide spacer and / or other spacers known in the art. As another non-limiting example, the 3'-UTR may include a TEE sequence-spacer module that is repeated at least once, at least twice, at least three times, at least four times, at least five times, at least six times, at least seven times, at least eight times, at least nine times, or ten or more times in the 3'-UTR.

[0288] In other cases, the spacer separating the two TEE sequences may include other sequences known in the art that can regulate translation of a polynucleotide (e.g., an mRNA) of the present disclosure, such as, but not limited to, the miR sequences described herein (e.g., miR binding sites and miR seeds). As a non-limiting example, each spacer used to separate the two TEE sequences may include a different miR sequence or component of a miR sequence (e.g., a miR seed sequence).

[0289] In still other cases, incorporation of miR and / or TEE sequences alters the shape of the stem-loop region, which can increase and / or decrease translation (see, e.g., Kedde et al., "A Pumilio-induced RNA structure switch in p27-3'UTR controls miR-221 and miR-22 accessibility," Nature Cell Biology, 2010).

[0290] stem loop A polynucleotide (e.g., mRNA) can include a stem loop, such as, but not limited to, a histone stem loop. The stem loop can be a nucleotide sequence of about 25 or about 26 nucleotides in length, such as, but not limited to, SEQ ID NOS: 7-17, as set forth in International Patent Publication No. WO 2013 / 103659 (SEQ ID NOS: 7-17 of which are incorporated herein by reference). The histone stem loop can be located 3' to the coding region (e.g., at the 3' end of the coding region). As a non-limiting example, the stem loop can be located at the 3' end of a polynucleotide described herein. In some cases, a polynucleotide (e.g., mRNA) includes two or more stem loops (e.g., two stem loops). Examples of stem loop sequences are described in International Patent Publication Nos. WO 2012 / 019780 and WO 201502667 (these stem loop sequences are incorporated herein by reference). In some cases, the polynucleotide comprises the stem-loop sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO: 5). In other cases, the polynucleotide comprises the stem-loop sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO: 6).

[0291] The stem loop may be located in the second terminal region of the polynucleotide. As a non-limiting example, the stem loop may be located in the untranslated region (e.g., 3'-UTR) of the second terminal region.

[0292] In some cases, polynucleotides, such as, but not limited to, mRNAs containing histone stem loops, can be stabilized by the addition of a 3'-stabilizing region (e.g., a 3'-stabilizing region comprising at least one chain-terminating nucleoside). Without intending to be bound by theory, the addition of at least one chain-terminating nucleoside can slow down the degradation of the polynucleotide, thereby increasing the half-life of the polynucleotide.

[0293] In other cases, polynucleotides such as, but not limited to, mRNAs containing histone stem loops can be stabilized by modifications to the 3'-region of the polynucleotide that can prevent and / or inhibit the addition of oligo(U) (see, e.g., International Patent Publication No. WO 2013 / 103659).

[0294] In still other cases, polynucleotides such as, but not limited to, mRNAs containing histone stem loops can be stabilized by the addition of oligonucleotides terminating in 3'-deoxynucleosides, 2',3'-dideoxynucleosides, 3'-O-methylnucleosides, 3'-O-ethylnucleosides, 3'-arabinosides, and other modified nucleosides known in the art and / or described herein.

[0295] In some cases, the polynucleotides of the present disclosure may contain a histone stem loop, a poly-A region, and / or a 5'-cap structure. The histone stem loop may precede and / or follow the poly-A region. Polynucleotides containing histone stem loop and poly-A region sequences may contain chain-terminating nucleosides as described herein.

[0296] In other cases, polynucleotides of the present disclosure may comprise histone stem loop and 5'-cap structures, which may include, but are not limited to, those described herein and / or known in the art.

[0297] In some cases, the conserved stem-loop region can include a miR sequence described herein. As a non-limiting example, the stem-loop region can include a seed sequence of a miR sequence described herein. In another non-limiting example, the stem-loop region can include a miR-122 seed sequence.

[0298] In some cases, the conserved stem-loop region may comprise a miR sequence described herein and may also comprise a TEE sequence. In some cases, incorporation of miR and / or TEE sequences alters the shape of the stem-loop region, which can increase and / or decrease translation (see, e.g., Kedde et al., "A Pumilio-induced RNA structure switch in p27-3'UTR controls miR-221 and miR-22 accessibility," Nature Cell Biology, 2010, incorporated herein by reference in its entirety).

[0299] The polynucleotide may comprise at least one histone stem loop and poly-A region or polyadenylation signal. Non-limiting examples of polynucleotide sequences encoding at least one histone stem loop and poly-A region or polyadenylation signal are described in International Patent Publication Nos. WO 2013 / 120497, WO 2013 / 120629, WO 2013 / 120500, WO 2013 / 120627, WO 2013 / 120498, WO 2013 / 120626, WO 2013 / 120499 and WO 2013 / 120628 (each of which sequences is incorporated herein by reference). In some cases, the polynucleotide encoding the histone stem loop and poly-A region or polyadenylation signal may encode a pathogen antigen or fragment thereof, such as the polynucleotide sequences set forth in International Patent Publication Nos. WO 2013 / 120499 and WO 2013 / 120628 (both of which sequences are incorporated herein by reference). In other cases, the polynucleotide encoding the histone stem loop and poly-A region or polyadenylation signal may encode a therapeutic protein, such as the polynucleotide sequences set forth in International Patent Publication Nos. WO 2013 / 120497 and WO 2013 / 120629 (both of which sequences are incorporated herein by reference). In some cases, the polynucleotide encoding the histone stem loop and poly-A region or polyadenylation signal may encode a tumor antigen or a fragment thereof, such as the polynucleotide sequences set forth in International Patent Publication Nos. WO 2013 / 120500 and WO 2013 / 120627 (both of which sequences are incorporated herein by reference).In other cases, the polynucleotide encoding the histone stem loop and poly-A region or polyadenylation signal may encode an allergenic antigen or an autoimmune autoantigen, such as the polynucleotide sequences set forth in International Patent Publication Nos. WO 2013 / 120498 and WO 2013 / 120626 (both of which sequences are incorporated herein by reference).

[0300] Poly-A region A polynucleotide or nucleic acid (e.g., mRNA) can contain a polyA sequence and / or a polyadenylation signal. The polyA sequence can be composed entirely or predominantly of adenine nucleotides or analogs or derivatives thereof. The polyA sequence can be a tail located adjacent to the 3' untranslated region of the nucleic acid.

[0301] During RNA processing, long chains of adenosine nucleotides (poly-A tracts) are typically added to messenger RNA (mRNA) molecules to increase the molecule's stability. Shortly after transcription, the 3' end of the transcript is cleaved, releasing a 3'-hydroxyl group. Poly-A polymerase then adds chains of adenosine nucleotides to the RNA. This process, called polyadenylation, adds poly-A tracts that are 100 to 250 residues in length.

[0302] The length of the unique poly-A region may confer several advantages to the modified polynucleotides of the present disclosure. Generally, the length of a poly-A region of the present disclosure is at least 30 nucleotides. In another embodiment, the poly-A region is at least 35 nucleotides. In another embodiment, the length is at least 40 nucleotides. In another embodiment, the length is at least 45 nucleotides. In another embodiment, the length is at least 55 nucleotides. In another embodiment, the length is at least 60 nucleotides. In another embodiment, the length is at least 70 nucleotides. In another embodiment, the length is at least 80 nucleotides. In another embodiment, the length is at least 90 nucleotides. In another embodiment, the length is at least 100 nucleotides. In another embodiment, the length is at least 120 nucleotides. In another embodiment, the length is at least 140 nucleotides. In another embodiment, the length is at least 160 nucleotides. In another embodiment, the length is at least 180 nucleotides. In another embodiment, the length is at least 200 nucleotides. In another embodiment, the length is at least 250 nucleotides. In another embodiment, the length is at least 300 nucleotides. In another embodiment, the length is at least 350 nucleotides. In another embodiment, the length is at least 400 nucleotides. In another embodiment, the length is at least 450 nucleotides. In another embodiment, the length is at least 500 nucleotides. In another embodiment, the length is at least 600 nucleotides. In another embodiment, the length is at least 700 nucleotides. In another embodiment, the length is at least 800 nucleotides. In another embodiment, the length is at least 900 nucleotides. In another embodiment, the length is at least 1000 nucleotides. In another embodiment, the length is at least 1100 nucleotides. In another embodiment, the length is at least 1200 nucleotides. In another embodiment, the length is at least 1300 nucleotides. In another embodiment, the length is at least 1400 nucleotides.In another embodiment, the length is at least 1500 nucleotides. In another embodiment, the length is at least 1600 nucleotides. In another embodiment, the length is at least 1700 nucleotides. In another embodiment, the length is at least 1800 nucleotides. In another embodiment, the length is at least 1900 nucleotides. In another embodiment, the length is at least 2000 nucleotides. In another embodiment, the length is at least 2500 nucleotides. In another embodiment, the length is at least 3000 nucleotides.

[0303] In some cases, the poly-A region can be 80 nucleotides, 120 nucleotides, 160 nucleotides in length in the modified polynucleotide molecules described herein. In other cases, the poly-A region can be 20, 40, 80, 100, 120, 140, or 160 nucleotides in length in the modified polynucleotide molecules described herein.

[0304] In some cases, the poly-A region is designed for the entire length of the modified polynucleotide. This design can be based on the length of the coding region of the modified polynucleotide, the length of a particular feature or region of the modified polynucleotide (such as mRNA), or the length of the final product expressed from the modified polynucleotide. Compared to any feature of the modified polynucleotide (e.g., other than the mRNA portion containing the poly-A region), the poly-A region can be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% longer in length than the additional feature. The poly-A region can also be designed as part of the modified polynucleotide to which it belongs. In this regard, the poly-A region can be 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more of the total length of the construct or the total length of the construct minus the poly-A region.

[0305] In some cases, engineered binding sites and / or conjugation of polynucleotides (e.g., mRNA) for poly-A binding protein can be used to enhance expression. The engineered binding site can be a sensor sequence that can act as a binding site for a ligand in the local microenvironment of the polynucleotide (e.g., mRNA). As a non-limiting example, a polynucleotide (e.g., mRNA) can contain at least one engineered binding site to modify the binding affinity of poly-A binding protein (PABP) and its analogs. Incorporation of at least one engineered binding site can increase the binding affinity of PABP and its analogs.

[0306] Furthermore, multiple different polynucleotides (e.g., mRNAs) can be linked together via their 3' ends to PABP (poly-A binding protein) using modified nucleotides at the 3' end of the poly-A region. Transfection experiments can be performed in relevant cell lines, and protein production can be assayed by ELISA 12 hours, 24 hours, 48 ​​hours, 72 hours, and 7 days after transfection. As a non-limiting example, transfection experiments can be used to evaluate the effect on the binding affinity of PABP or its analogs as a result of the addition of at least one engineered binding site.

[0307] In some cases, poly-A regions may be used to regulate translation initiation. Without intending to be bound by theory, poly-A regions may be essential for protein synthesis because they recruit PABP, which can then interact with the translation initiation complex.

[0308] In some cases, poly-A regions may also be used in the present disclosure to protect against 3'-5'-exonuclease digestion. In some cases, a polynucleotide (e.g., mRNA) may contain a poly-AG quartet. A G-quartet is a cyclic hydrogen-bonded array of four guanosine nucleotides that can be formed by G-rich sequences in both DNA and RNA. In this embodiment, the G-quartet is incorporated at the end of a poly-A region. The resulting polynucleotide (e.g., mRNA) can be assayed for stability, protein production, and other parameters, including half-life, at various time points. It has been discovered that a poly-AG quartet results in protein production equivalent to at least 75% of that seen using only a 120-nucleotide poly-A region.

[0309] In some cases, a polynucleotide (e.g., mRNA) may contain a poly-A region and be stabilized by the addition of a 3'-stabilizing region. A polynucleotide (e.g., mRNA) that contains a poly-A region may further contain a 5'-cap structure.

[0310] In other cases, a polynucleotide (e.g., an mRNA) may comprise a poly-AG quartet. A polynucleotide (e.g., an mRNA) that comprises a poly-AG quartet may further comprise a 5'-cap structure.

[0311] In some cases, 3'-stabilizing regions that can be used to stabilize polynucleotides (e.g., mRNA) that contain poly-A regions or poly-AG quartets can be, but are not limited to, those described in International Patent Publication No. WO 2013 / 103659 (the poly-A regions and poly-AG quartets of which are incorporated herein by reference). In other cases, 3'-stabilizing regions that can be used in the present disclosure include chain-terminating nucleosides such as 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, 2',3'-dideoxynucleosides, e.g., 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymine, 2'-deoxynucleosides, or O-methylnucleosides.

[0312] In other cases, polynucleotides such as, but not limited to, mRNAs containing polyA tracts or poly-AG quartets can be stabilized by modifications to the 3'-region of the polynucleotide that can prevent and / or inhibit the addition of oligo(U) (see, e.g., International Patent Publication No. WO 2013 / 103659).

[0313] In still other cases, polynucleotides such as, but not limited to, mRNAs containing poly-A regions or poly-AG quartets can be stabilized by the addition of oligonucleotides terminating in 3'-deoxynucleosides, 2',3'-dideoxynucleosides, 3'-O-methylnucleosides, 3'-O-ethylnucleosides, 3'-arabinosides, and other modified nucleosides known in the art and / or described herein.

[0314] Chain-terminating nucleosides Nucleic acids can contain chain-terminating nucleosides.For example, chain-terminating nucleosides can contain nucleosides that are deoxygenated at the 2' and / or 3' positions of their sugar groups.Such species include 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, and 2',3'-dideoxynucleosides, such as 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, and 2',3'-dideoxythymine.

[0315] Other ingredients The nanoparticle composition may include one or more ingredients in addition to those described in the previous section. For example, the nanoparticle composition may include one or more hydrophobic small molecules, such as vitamins (e.g., vitamin A or vitamin E) or sterols.

[0316] The nanoparticle composition may also include one or more permeability enhancer molecules, carbohydrates, polymers, surface altering agents, or other components. Permeability enhancer molecules may be, for example, molecules described in U.S. Patent Application Publication No. 2005 / 0222064. Carbohydrates may include monosaccharides (e.g., glucose) and polysaccharides (e.g., glycogen and its derivatives and analogs).

[0317] Polymers may be included in the nanoparticle composition and / or used to encapsulate or partially encapsulate the nanoparticle composition. The polymer may be biodegradable and / or biocompatible. The polymer may be selected from, but is not limited to, polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, polystyrenes, polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyleneimines, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates. For example, polymers include poly(caprolactone) (PCL), ethylene vinyl acetate polymer (EVA), poly(lactic acid) (PLA), poly(L-lactic acid) (PLLA), poly(glycolic acid) (PGA), poly(lactic-co-glycolic acid) (PLGA), poly(L-lactic-co-glycolic acid) (PLLGA), poly(D,L-lactide) (PDLA), poly(L-lactide) (PLLA), poly(D,L-lactide-co-caprolactone), poly(D,L-lactide-co-caprolactone-co-glycolide), poly(D,L-lactide-co-PEO-co-D,L-lactide), poly(D,L-lactide-co-PPO-co-D,L-lactide), and poly(D,L-lactide-co-PPO-co-D,L-lactide).L-lactide), polyalkyl cyanoacrylates, polyurethanes, poly-L-lysine (PLL), hydroxypropyl methacrylate (HPMA), polyethylene glycol, poly-L-glutamic acid, poly(hydroxy acids), polyanhydrides, polyorthoesters, poly(ester amides), polyamides, poly(ester ethers), polycarbonates, polyalkylenes such as polyethylene and polypropylene, polyalkylene glycols such as poly(ethylene glycol) (PEG), polyalkylene oxides (PEO), polyalkylene terephthalates such as poly(ethylene terephthalate), polyvinyl alcohol (PVA), polyvinyl ethers, polyvinyl esters such as poly(vinyl acetate), polyvinyl halides such as poly(vinyl chloride) (PVC), polyvinylpyrrolidone (PVP), polysiloxanes, polystyrene (PS), polyurethanes, derivatized celluloses such as alkyl celluloses, hydroxyalkyl celluloses, cellulose ethers, cellulose esters, nitrocellulose, hydroxypropyl cellulose, carbo hydroxymethylcellulose, polymers of acrylic acid, such as poly(methyl(meth)acrylate) (PMMA), poly(ethyl(meth)acrylate), poly(butyl(meth)acrylate), poly(isobutyl(meth)acrylate), poly(hexyl(meth)acrylate), poly(isodecyl(meth)acrylate), poly(lauryl(meth)acrylate), poly(phenyl(meth)acrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), poly(octadecyl acrylate), Poly(N-acryloylmorpholine) (PAcM), poly(2-methyl-2-oxazoline) (PMOX), poly(2-ethyl-2-oxazoline) (PEOZ), and polyglycerol.

[0318] Surface modifiers include, but are not limited to, anionic proteins (e.g., bovine serum albumin), surfactants (e.g., cationic surfactants such as dimethyldioctadecyl-ammonium bromide), sugars or sugar derivatives (e.g., cyclodextrin), nucleic acids, polymers (e.g., heparin, polyethylene glycol, and poloxamer), mucolytic agents (e.g., acetylcysteine, artemisia princeps, bromelain, papain, clerodendrum, bromhexine, carbocysteine, eprazinone, mesna, ambroxol, sobrerol, domiodol, letosteine, stepronin, tiopronin, gelsolin, thymosin β4, dornase alfa, neltenexin, and erdosteine), and DNases (e.g., rhDNase). Surface modifiers can be disposed within the nanoparticles and / or on the surface of the nanoparticle composition (e.g., by coating, adsorption, covalent bonding, or other process).

[0319] Nanoparticle compositions can also contain one or more functionalized lipids.For example, lipids can be functionalized with alkyne groups that can undergo cycloaddition reaction when exposed to azide under suitable reaction conditions.In particular, lipid bilayers can be functionalized in this way with one or more groups that are useful for promoting membrane permeation, cell recognition, or imaging.The surface of nanoparticle compositions can also be bound with one or more useful antibodies.Functional groups and conjugates that are useful for target cell delivery, imaging, and membrane permeation are well known in the art.

[0320] In addition to these components, nanoparticle compositions can contain any substance useful in pharmaceutical compositions.For example, nanoparticle compositions can contain one or more pharmaceutically acceptable excipients or auxiliary components, such as, but not limited to, one or more solvents, dispersion media, diluents, dispersion aids, suspension aids, granulation aids, disintegrants, fillers, lubricants, liquid vehicles, binders, surfactants, isotonicity agents, thickeners or emulsifiers, buffers, lubricants, oils, preservatives, and other species.Excipients such as waxes, butters, colorants, coating agents, flavors, and fragrances can also be included. Pharmaceutically acceptable excipients are well known in the art (see, e.g., Remington's The Science and Practice of Pharmacy, 21st ed., A.R. Gennaro; Lippincott, Williams & Wilkins, Baltimore, MD, 2006).

[0321] Examples of diluents include, but are not limited to, calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, corn starch, powdered sugar, and / or combinations thereof. Granulating and dispersing agents may be selected from the non-limiting list consisting of potato starch, corn starch, tapioca starch, sodium starch glycolate, clay, alginic acid, guar gum, citrus pulp, agar, bentonite, cellulose and wood products, natural sponge, cation exchange resins, calcium carbonate, silicates, sodium carbonate, cross-linked poly(vinyl-pyrrolidone) (crospovidone), sodium carboxymethyl starch (sodium starch glycolate), carboxymethylcellulose, cross-linked sodium carboxymethylcellulose (croscarmellose), methylcellulose, pregelatinized starch (starch 1500), microcrystalline starch, water insoluble starch, calcium carboxymethylcellulose, magnesium aluminum silicate (VEEGUM®), sodium lauryl sulfate, quaternary ammonium compounds, and / or combinations thereof.

[0322] Surfactants and / or emulsifiers include, but are not limited to, natural emulsifiers (e.g., acacia, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax, and lecithin), colloidal clays (e.g., bentonite [aluminum silicate] and VEEGUM® [magnesium aluminum silicate]), long-chain amino acid derivatives, high molecular weight alcohols (e.g., stearyl alcohol, cetyl alcohol, oleyl alcohol, triacetin monostearate, ethylene glycol distearate, glyceryl monostearate, and propylene glycol monostearate, polyvinyl alcohol), carbomers (e.g., carboxypolymethylene, polyacrylic acid, acrylic acid polymers, and carboxyvinyl polymers), carrageenan, cellulose derivatives (e.g., sodium carboxymethylcellulose, powdered cellulose, hydroxymethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose). , methylcellulose), sorbitan fatty acid esters (e.g., polyoxyethylene sorbitan monolaurate [TWEEN® 20], polyoxyethylene sorbitan [TWEEN® 60], polyoxyethylene sorbitan monooleate [TWEEN® 80], sorbitan monopalmitate [SPAN® 40], sorbitan monostearate [SPAN® 60], sorbitan tristearate [SPAN® 65], ], glyceryl monooleate, sorbitan monooleate [SPAN® 80]), polyoxyethylene esters (e.g., polyoxyethylene monostearate [MYRJ® 45], polyoxyethylene hydrogenated castor oil, polyethoxylated castor oil, polyoxymethylene stearate, and SOLUTOL®), sucrose fatty acid esters, polyethylene glycol fatty acid esters (e.g., CREMOPHOR®), polyoxyethylene ethers,(e.g., polyoxyethylene lauryl ether [BRIJ® 30]), poly(vinyl-pyrrolidone), diethylene glycol monolaurate, triethanolamine oleate, sodium oleate, potassium oleate, ethyl oleate, oleic acid, ethyl laurate, sodium lauryl sulfate, PLURONIC® F 68, POLOXAMER® 188, cetrimonium bromide, cetylpyridinium chloride, benzalkonium chloride, docusate sodium, and / or combinations thereof.

[0323] The binder may be starch (e.g., corn starch and starch paste); gelatin; sugars (e.g., sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol); natural and synthetic gums (e.g., acacia, sodium alginate, extract of Irish moss, panwar gum, ghatti gum, isapol husk mucilage, carboxymethylcellulose, methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, microcrystalline cellulose, cellulose acetate, poly(vinyl-pyrrolidone), magnesium aluminum silicate (VEEGUM®), and larch arabinogalactan); alginates; polyethylene oxide; polyethylene glycol; inorganic calcium salts; silicic acid; polymethacrylates; waxes; water; alcohol; and combinations thereof, or any other suitable binder.

[0324] Examples of preservatives include, but are not limited to, antioxidants, chelating agents, antibacterial preservatives, antifungal preservatives, alcohol preservatives, acidic preservatives, and / or other preservatives. Examples of antioxidants include, but are not limited to, alpha-tocopherol, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerol, potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, sodium bisulfite, sodium metabisulfite, and / or sodium sulfite. Examples of chelating agents include ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, edetate disodium, edetate dipotassium, edetate, fumaric acid, malic acid, phosphoric acid, edetate sodium, tartaric acid, and / or edetate trisodium. Examples of antibacterial preservatives include, but are not limited to, benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin, hexetidine, imidurea, phenol, phenoxyethanol, phenylethyl alcohol, phenylmercuric nitrate, propylene glycol, and / or thimerosal. Examples of antifungal preservatives include, but are not limited to, butylparaben, methylparaben, ethylparaben, propylparaben, benzoic acid, hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, and / or sorbic acid. Examples of alcohol preservatives include, but are not limited to, ethanol, polyethylene glycol, benzyl alcohol, phenol, phenolic compounds, bisphenol, chlorobutanol, hydroxybenzoates, and / or phenylethyl alcohol. Examples of acidic preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, acetic acid, dehydroascorbic acid, ascorbic acid, sorbic acid, and / or phytic acid.Other preservatives include, but are not limited to, tocopherol, tocopheryl acetate, deteroxime mesylate, cetrimide, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), sodium bisulfite, sodium metabisulfite, potassium sulfite, potassium metabisulfite, GLYDANT PLUS®, PHENONIP®, methylparaben, GERMALL® 115, GERMABEN® II, NEOLONE™, KATHON™, and / or EUXYL®.

[0325] Examples of buffering agents include, but are not limited to, citrate buffer, acetate buffer, phosphate buffer, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, calcium glubionate, calcium gluceptate, calcium gluconate, d-gluconic acid, calcium glycerophosphate, calcium lactate, calcium lactobionate, propanoic acid, calcium levulinate, pentanoic acid, dibasic calcium phosphate, phosphoric acid, tribasic calcium phosphate, calcium hydroxide phosphate, potassium acetate, potassium chloride, potassium gluconate, potassium mixtures, dibasic potassium phosphate, dibasic potassium phosphate, potassium phosphate mixtures, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, dibasic sodium phosphate, monobasic sodium phosphate, sodium phosphate mixtures, tromethamine, amino-sulfonic acid buffers (e.g., HEPES), magnesium hydroxide, aluminum hydroxide, alginic acid, pyrogen-free distilled water, isotonic saline, Ringer's solution, ethyl alcohol, and / or combinations thereof. The lubricant may be selected from the non-limiting group consisting of magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, glyceryl behenate, hydrogenated vegetable oil, polyethylene glycol, sodium benzoate, sodium acetate, sodium chloride, leucine, magnesium lauryl sulfate, sodium lauryl sulfate, and combinations thereof.

[0326] Examples of oils include, but are not limited to, almond, apricot kernel, avocado, babassu, bergamot, blackcurrant seed, borage, cade, chamomile, canola, caraway, carnauba, castor, cinnamon, cocoa butter, coconut, cod liver, coffee, corn, cottonseed, emu, eucalyptus, evening primrose, fish, flaxseed, geraniol, gourd, grape seed, hazelnut, hyssop, isopropyl myristate, jojoba, kukui nut, lavandin, lavender, lemon, litsea cucumber, macadamia nut, mallow, mango seed, meadowfoam seed, mink, nutmeg, olive, orange, orange rough palm, palm kernel, peach kernel, peanut, poppy seed, pumpkin seed, rapeseed, rice bran, rosemary, safflower, sandalwood, sasquana, savory, sea buckthorn, sesame, shea butter, silicone, soybean, sunflower, tea tree, thistle, camellia, vetiver, walnut, and wheat germ oils as well as butyl stearate, caprylic triglyceride, capric triglyceride, cyclomethicone, diethyl sebacate, dimethicone 360, simethicone, isopropyl myristate, mineral oil, octyldodecanol, oleyl alcohol, silicone oil, and / or combinations thereof.

[0327] formulation The nanoparticle composition may include a lipid component and one or more additional components, such as a therapeutic agent and / or a prophylactic agent. The nanoparticle composition may be designed for one or more specific applications or targets. The components of the nanoparticle composition may be selected based on the specific application or target, and / or based on efficacy, toxicity, cost, ease of use, availability, or other characteristics of one or more components. Similarly, a specific formulation of the nanoparticle composition may be selected for a specific application or target, for example, depending on the efficacy and toxicity of a particular combination of components.

[0328] The lipid component of the nanoparticle composition can include, for example, a lipid represented by formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe), a phospholipid (an unsaturated lipid, such as DOPE or DSPC), a PEG-lipid, and a structural lipid. The elements of the lipid component can be provided in specific ratios.

[0329] In some embodiments, the lipid component of the nanoparticle composition comprises a lipid represented by Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe), a phospholipid, a PEG-lipid, and a structural lipid. In certain embodiments, the lipid component of the nanoparticle composition comprises about 30 mol% to about 60 mol% of a compound of Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe), about 0 mol% to about 30 mol% of a phospholipid, about 18.5 mol% to about 48.5 mol% of a structural lipid, and about 0 mol% to about 10 mol% of a PEG-lipid, provided that the total mol% does not exceed 100%. In some embodiments, the lipid component of the nanoparticle composition comprises about 35 mol% to about 55 mol% of a compound of Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe), about 5 mol% to about 25 mol% of a phospholipid, about 30 mol% to about 40 mol% of a structural lipid, and about 0 mol% to about 10 mol% of a PEG lipid. In certain embodiments, the lipid component comprises about 50 mol% of the compound, about 10 mol% of a phospholipid, about 38.5 mol% of a structural lipid, and about 1.5 mol% of a PEG lipid. In another specific embodiment, the lipid component comprises about 40 mol% of the compound, about 20 mol% of a phospholipid, about 38.5 mol% of a structural lipid, and about 1.5 mol% of a PEG lipid. In some embodiments, the phospholipid can be DOPE or DSPC. In other embodiments, the PEG lipid can be PEG-DMG and / or the structural lipid can be cholesterol.

[0330] Nanoparticle compositions can be designed for one or more specific applications or targets. For example, nanoparticle compositions can be designed to deliver therapeutic and / or prophylactic agents, such as RNA, to specific cells, tissues, organs, or systems or groups thereof in the mammalian body. The physiochemical properties of nanoparticle compositions can be modified to enhance selectivity for specific bodily targets. For example, particle size can be adjusted based on the size of fenestrations in various organs. The therapeutic and / or prophylactic agents included in the nanoparticle compositions can also be selected based on one or more desired delivery targets. For example, therapeutic and / or prophylactic agents can be selected for a particular indication, condition, disease, or disorder and / or for delivery (e.g., localized or specific delivery) to specific cells, tissues, organs, or systems or groups thereof. In certain embodiments, nanoparticle compositions can contain mRNA encoding a polypeptide of interest that can be translated intracellularly to produce the polypeptide of interest. Such compositions can be designed for specific delivery to a specific organ. In certain embodiments, compositions can be designed for specific delivery to the mammalian liver.

[0331] The amount of therapeutic and / or prophylactic agent in a nanoparticle composition can depend on the size, composition, desired target and / or use, or other characteristics of the nanoparticle composition and the properties of the therapeutic and / or prophylactic agent. For example, the amount of RNA useful in a nanoparticle composition can depend on the size, sequence, and other characteristics of the RNA. The relative amounts of therapeutic and / or prophylactic agent and other components (e.g., lipids) in the nanoparticle composition can also vary. In certain embodiments, the wt / wt ratio of lipid component to therapeutic and / or prophylactic agent in the nanoparticle composition can be from about 5:1 to about 60:1, e.g., 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, and 60:1. For example, the wt / wt ratio of lipid component to therapeutic and / or prophylactic agent can be from about 10:1 to about 40:1. In certain embodiments, the wt / wt ratio is about 20:1. The amount of therapeutic and / or prophylactic agent in the nanoparticle composition can be measured, for example, using absorption spectroscopy (e.g., ultraviolet-visible spectroscopy).

[0332] In certain embodiments, the nanoparticle composition comprises one or more RNAs, and the one or more RNAs, lipids, and their amounts can be selected to provide a specific N:P ratio. The N:P ratio of a composition refers to the molar ratio of nitrogen atoms in one or more lipids to the number of phosphate groups in the RNA. Generally, lower N:P ratios are preferred. The one or more RNAs, lipids, and their amounts can be selected to provide an N:P ratio of about 2:1 to about 30:1, e.g., 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 12:1, 14:1, 16:1, 18:1, 20:1, 22:1, 24:1, 26:1, 28:1, or 30:1. In certain embodiments, the N:P ratio can be about 2:1 to about 8:1. In other embodiments, the N:P ratio is about 5:1 to about 8:1. For example, the N:P ratio can be about 5.0:1, about 5.5:1, about 5.67:1, about 6.0:1, about 6.5:1, or about 7.0:1. For example, the N:P ratio can be about 5.67:1.

[0333] physical properties The properties of nanoparticle composition can depend on its components.For example, the nanoparticle composition that contains cholesterol as structural lipid can have different properties from the nanoparticle composition that contains different structural lipid.Similarly, the properties of nanoparticle composition can depend on the absolute amount or relative amount of its components.For example, the nanoparticle composition that contains a higher molar fraction of phospholipid can have different properties from the nanoparticle composition that contains a lower molar fraction of phospholipid.Properties can also vary depending on the method and conditions of nanoparticle composition preparation.

[0334] Nanoparticle compositions can be characterized by various methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of nanoparticle compositions. Dynamic light scattering or potentiometry (e.g., potentiometric titration) can be used to measure zeta potential. Dynamic light scattering can also be used to determine particle size. Instruments such as the Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) can also be used to determine several properties of nanoparticle compositions, such as particle size, polydispersity index, and zeta potential.

[0335] The average size of the nanoparticle composition can be, for example, tens of nanometers to hundreds of nanometers, as measured by dynamic light scattering (DLS). For example, the average size can be about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In certain embodiments, the average size of the nanoparticle composition can be about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In certain embodiments, the average size of the nanoparticle composition can be about 70 nm to about 100 nm. In certain embodiments, the average size can be about 80 nm. In other embodiments, the average size can be about 100 nm.

[0336] The nanoparticle composition can be relatively homogeneous. The polydispersity index can be used to indicate the homogeneity of a nanoparticle composition, e.g., the particle size distribution of the nanoparticle composition. A small polydispersity index (e.g., less than 0.3) generally indicates a narrow particle size distribution. The nanoparticle composition can have a polydispersity index of about 0 to about 0.25, e.g., 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the nanoparticle composition can be about 0.10 to about 0.20.

[0337] The zeta potential of a nanoparticle composition can be used to indicate the kinetic potential of the composition. For example, the zeta potential can represent the surface charge of the nanoparticle composition. Nanoparticle compositions with a relatively low charge (whether positive or negative) are generally desirable because more highly charged species can undesirably interact with cells, tissues, and other elements in the body. In certain embodiments, the zeta potential of the nanoparticle composition can be about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, about -10 mV to about +5 mV, about -10 mV to about 0 mV, about -10 mV to about -5 mV, about -5 mV to about +20 mV, about -5 mV to about +15 mV, about -5 mV to about +10 mV, about -5 mV to about +5 mV, about -5 mV to about 0 mV, about 0 mV to about +20 mV, about 0 mV to about +15 mV, about 0 mV to about +10 mV, about 0 mV to about +5 mV, about +5 mV to about +20 mV, about +5 mV to about +15 mV, or about +5 mV to about +10 mV.

[0338] The encapsulation efficiency of a therapeutic and / or prophylactic agent refers to the amount of therapeutic and / or prophylactic agent encapsulated or otherwise associated with a nanoparticle composition after preparation, relative to the initial amount provided. A high encapsulation efficiency is desirable (e.g., near 100%). The encapsulation efficiency can be measured, for example, by comparing the amount of therapeutic and / or prophylactic agent in a solution containing the nanoparticle composition before and after dissolving the nanoparticle composition with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free therapeutic and / or prophylactic agent (e.g., RNA) in solution. In the nanoparticle compositions described herein, the encapsulation efficiency of a therapeutic and / or prophylactic agent can be at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In certain embodiments, the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency may be at least 90%.

[0339] Nanoparticle composition can optionally comprise one or more coatings.For example, nanoparticle composition can be formulated in capsule, film or tablet with coating.The capsule, film or tablet comprising the composition described herein can have any useful size, tensile strength, hardness or density.

[0340] Pharmaceutical Composition The nanoparticle composition can be formulated in whole or in part as a pharmaceutical composition. A pharmaceutical composition can contain one or more nanoparticle compositions. For example, a pharmaceutical composition can contain one or more nanoparticle compositions containing one or more different therapeutic and / or prophylactic agents. A pharmaceutical composition can further contain one or more pharmaceutically acceptable excipients or auxiliary ingredients, such as those described herein. General guidelines for the formulation and manufacture of pharmaceutical compositions and medicaments are available, for example, in "Remington's The Science and Practice of Pharmacy," 21st ed., by A.R. Gennaro; Lippincott, Williams & Wilkins, Baltimore, MD, 2006. Conventional excipients and auxiliary ingredients can be used in any pharmaceutical composition, except insofar as any conventional excipient or auxiliary ingredient is incompatible with one or more components of the nanoparticle composition. An excipient or auxiliary ingredient may be incompatible with a component of the nanoparticle composition if its combination with the component of the nanoparticle composition could result in some undesirable biological or other form of adverse effect.

[0341] In some embodiments, one or more excipients or auxiliary ingredients may comprise more than 50% of the total mass or volume of a pharmaceutical composition containing a nanoparticle composition. For example, one or more excipients or auxiliary ingredients may comprise 50%, 60%, 70%, 80%, 90%, or more, according to pharmaceutical convention. In some embodiments, a pharmaceutically acceptable excipient is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% pure. In some embodiments, the excipient is approved for human and veterinary use. In some embodiments, the excipient is approved by the United States Food and Drug Administration. In some embodiments, the excipient is pharmaceutical grade. In certain embodiments, the excipients meet the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and / or the International Pharmacopoeia.

[0342] The relative amounts of one or more nanoparticle compositions, one or more pharmaceutically acceptable excipients, and / or any additional components in a pharmaceutical composition according to the present disclosure will vary depending on the identity, size, and / or condition of the subject being treated, as well as the route by which the composition is administered. By way of example, a pharmaceutical composition may contain from 0.1% to 100% (wt / wt) of one or more nanoparticle compositions.

[0343] In certain embodiments, the nanoparticle compositions and / or pharmaceutical compositions of the present disclosure are refrigerated or frozen for storage and / or transportation (e.g., stored at a temperature of 4°C or less, such as about -150°C to about 0°C or about -80°C to about -20°C (e.g., about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C). For example, a pharmaceutical composition comprising a compound of any of Formulas (I), (IA), (II), and (IIa) to (IIe) can be refrigerated or frozen for storage and / or transportation (e.g., stored at a temperature of about -20°C, -30°C, -40°C, -50°C, -60°C, -70°C, or is a solution that is refrigerated for storage and / or transportation at -80° C. In certain embodiments, the present disclosure also relates to methods of increasing the stability of a nanoparticle composition and / or pharmaceutical composition comprising a compound of any of Formulas (I), (IA), (II), and (IIa)-(IIe) by storing the nanoparticle composition and / or pharmaceutical composition at a temperature of 4° C. or lower, e.g., from about -150° C. to about 0° C. or from about -80° C. to about -20° C., e.g., about -5° C., -10° C., -15° C., -20° C., -25° C., -30° C., -40° C., -50° C., -60° C., -70° C., -80° C., -90° C., -130° C., or -150° C. For example, the nanoparticle compositions and / or pharmaceutical compositions disclosed herein are stable for approximately at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 1 month, at least 2 months, at least 4 months, at least 6 months, at least 8 months, at least 10 months, at least 12 months, at least 14 months, at least 16 months, at least 18 months, at least 20 months, at least 22 months, or at least 24 months, e.g., at temperatures below 4°C (e.g., about 4°C to -20°C). In one embodiment, the formulation is stable at about 4°C for at least 4 weeks. In certain embodiments, the pharmaceutical composition of the present disclosure comprises a nanoparticle composition disclosed herein and a pharmaceutically acceptable carrier selected from one or more of Tris, acetate (e.g., sodium acetate), citrate (e.g., sodium citrate), saline, PBS, and sucrose.In certain embodiments, the pharmaceutical composition of the present disclosure has a pH of about 7 to 8 (e.g., 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0, or 7.5 to 8 or 7 to 7.8). For example, the pharmaceutical composition of the present disclosure comprises a nanoparticle composition disclosed herein, Tris, saline, and sucrose, and has a pH of about 7.5 to 8, suitable for storage and / or transportation at, for example, about -20°C. For example, the pharmaceutical composition of the present disclosure comprises a nanoparticle composition disclosed herein and PBS, and has a pH of about 7 to 7.8, suitable for storage and / or transportation at, for example, about 4°C or below. In the context of this disclosure, "stability," "stabilized," and "stable" refer to the resistance of the nanoparticle compositions and / or pharmaceutical compositions disclosed herein to chemical or physical changes (e.g., degradation, particle size change, aggregation, change in encapsulation, etc.) under given conditions of manufacture, preparation, transportation, storage, and / or use, for example, when subjected to stresses such as shear forces, freeze-thaw stress, etc.

[0344] Nanoparticle compositions and / or pharmaceutical compositions containing one or more nanoparticle compositions can be administered to any patient or subject, including those who may benefit from the therapeutic effect provided by delivery of a therapeutic and / or prophylactic agent to one or more specific cells, tissues, organs, or systems or groups thereof (e.g., the renal system). While the description of nanoparticle compositions and pharmaceutical compositions provided herein primarily relates to compositions suitable for administration to humans, it will be understood by those skilled in the art that such compositions are generally suitable for administration to any other mammal. Modifications of compositions suitable for administration to humans to make them suitable for administration to various animals are well understood, and an ordinary veterinary pharmacologist can design and / or implement such modifications, if any, with no more than routine experimentation. Subjects to which the compositions are contemplated include, but are not limited to, humans, other primates, and other mammals, including commercially valuable mammals such as cows, pigs, horses, sheep, cats, dogs, mice, and / or rats.

[0345] Pharmaceutical compositions containing one or more nanoparticle compositions can be prepared by any method known or hereafter developed in the field of pharmacology. Generally, such preparation methods include combining an active ingredient with an excipient and / or one or more other accessory ingredients, and then, if desired or necessary, dividing, shaping, and / or packaging the product into desired single- or multiple-dose units.

[0346] The pharmaceutical compositions of the present disclosure can be prepared, packaged, and / or sold in bulk as a single unit dose and / or multiple single unit doses. As used herein, a "unit dose" is a discrete amount of a pharmaceutical composition containing a predetermined amount of an active ingredient (e.g., a nanoparticle composition). The amount of the active ingredient is generally equal to the dosage of the active ingredient that would be administered to a subject, and / or a convenient fraction of such a dosage, for example, one-half or one-third of such a dosage.

[0347] Pharmaceutical compositions can be prepared in various forms suitable for various routes and methods of administration.For example, pharmaceutical compositions can be prepared in the form of liquid dosage forms (e.g., emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and elixirs), injectable forms, solid dosage forms (e.g., capsules, tablets, pills, powders, and granules), dosage forms for topical and / or transdermal administration (e.g., ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, and patches), suspensions, powders, and other forms.

[0348] Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and / or elixirs.In addition to active ingredients, liquid dosage forms can contain inert diluents commonly used in the art, such as water or other solvents, solubilizers and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerin, tetrahydrofurfuryl alcohol, polyethylene glycol, and fatty acid esters of sorbitan, and mixtures thereof.In addition to inert diluents, oral compositions can contain additional agents such as additional therapeutic and / or prophylactic agents, wetting agents, emulsifiers and suspending agents, sweeteners, flavorings, and / or fragrances. In certain embodiments for parenteral administration, the composition is mixed with a solubilizing agent such as Cremophor®, alcohol, oil, modified oil, glycol, polysorbate, cyclodextrin, polymer, and / or combinations thereof.

[0349] Injectable preparations, for example, sterile injectable aqueous or oily suspensions, can be formulated according to known techniques using suitable dispersants, wetting agents, and / or suspending agents.Sterile injectable preparations can be sterile injectable solutions, suspensions, and / or emulsions in non-toxic parenterally acceptable diluents and / or solvents, such as solutions in 1,3-butanediol.Among acceptable vehicles and solvents that can be used are water, Ringer's solution, USP, and isotonic sodium chloride solution.Sterile fixed oils are usually used as solvents or suspending media.For this purpose, any non-irritating fixed oil can be used, including synthetic mono- or diglycerides.Fatty acids such as oleic acid can be used to prepare injectables.

[0350] Injectable formulations can be sterilized, for example, by filtration through a bacteria-retaining filter, and / or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.

[0351] To prolong the effect of an active ingredient, it is often desirable to slow the absorption of the active ingredient from subcutaneous or intramuscular injection. This can be accomplished by using a liquid suspension of crystalline or amorphous material with poor water solubility. The rate of absorption of the drug depends on its dissolution rate, which in turn may depend on crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered drug form can be accomplished by dissolving or suspending the drug in an oil vehicle. Injectable depot forms are made by forming microencapsule matrices of the drug in biodegradable polymers such as polylactide-polyglycolide. The rate of drug release can be controlled depending on the drug-to-polymer ratio and the properties of the particular polymer used. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are prepared by entrapping the drug in liposomes or microemulsions that are compatible with body tissues.

[0352] Compositions for rectal or vaginal administration are typically suppositories, which can be prepared by mixing the composition with a suitable non-irritating excipient such as cocoa butter, polyethylene glycol or a suppository wax which is solid at ambient temperature but liquid at body temperature and therefore melts in the rectum or vaginal cavity and releases the active ingredient.

[0353] Solid dosage forms for oral administration include capsules, tablets, pills, films, powders, and granules. In such solid dosage forms, the active ingredient is mixed with at least one inert pharmaceutically acceptable excipient, such as sodium citrate or dicalcium phosphate and / or fillers or extenders (e.g., starches, lactose, sucrose, glucose, mannitol, and silicic acid), binders (e.g., carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia), humectants (e.g., glycerol), disintegrating agents (e.g., agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate), solution retarders (e.g., paraffin), absorption accelerators (e.g., quaternary ammonium compounds), wetting agents (e.g., cetyl alcohol and glycerol monostearate), absorbents (e.g., kaolin and bentonite clays, silicates), and lubricants (e.g., talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate), and mixtures thereof. In the case of capsules, tablets and pills, the dosage form may also comprise buffering agents.

[0354] Similar types of solid compositions can be used as fillers in soft and hard-filled gelatin capsules using excipients such as lactose or milk sugar and high molecular weight polyethylene glycol.Solid dosage forms such as tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical formulation field.They can optionally contain opacifying agents and can be of a composition that releases the active ingredient preferentially, or optionally delayed, in a certain part of the intestinal tract.Examples of embedding compositions that can be used include polymeric substances and waxes.Similar types of solid compositions can be used as fillers in soft and hard-filled gelatin capsules using excipients such as lactose or milk sugar and high molecular weight polyethylene glycol.

[0355] Dosage forms for topical and / or transdermal administration of the composition include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, and / or patches. Generally, the active ingredient is mixed with a pharmaceutically acceptable excipient and / or any necessary preservatives and / or buffers under sterile conditions, as needed. Furthermore, the present disclosure contemplates the use of transdermal patches, which often have the additional advantage of providing controlled delivery of the compound to the body. Such dosage forms can be prepared, for example, by dissolving and / or dispersing the compound in a suitable medium. Alternatively or additionally, the rate can be controlled by providing a rate-controlling membrane and / or dispersing the compound in a polymer matrix and / or gel.

[0356] Suitable devices for use in delivering intradermal pharmaceutical compositions described herein include short needle devices, such as those described in U.S. Patent No. 4,886,499; U.S. Patent No. 5,190,521; U.S. Patent No. 5,328,483; U.S. Patent No. 5,527,288; U.S. Patent No. 4,270,537; U.S. Patent No. 5,015,235; U.S. Patent No. 5,141,496; and U.S. Patent No. 5,417,662.Intradermal compositions can be administered by devices that limit the effective penetration length of needles into the skin, such as those described in PCT Publication WO 99 / 34850, and their functional equivalents.Preferably, liquid jet injectors and / or jet injection devices are used to deliver liquid compositions to the dermis through needles that generate a jet that penetrates the stratum corneum and reaches the dermis. Jet injection devices are described, for example, in U.S. Patent Nos. 5,480,381; 5,599,302; 5,334,144; 5,993,412; 5,649,912; 5,569,189; 5,704,911; 5,383,851; 5,893,397; 5,466,220; and 5,339,163. The present invention is described in the following documents: Patent Nos. 5,312,335; 5,503,627; 5,064,413; 5,520,639; 4,596,556; 4,790,824; 4,941,880; 4,940,460; and PCT Publication WO 97 / 37705 and WO 97 / 13537.Preferably, ballistic powder / particle delivery device uses compressed gas to accelerate powdered vaccine from the outer layer of skin to the dermis.Alternatively or additionally, conventional syringe can be used for the classical Mantoux method of intradermal administration.

[0357] Formulations suitable for topical administration include, but are not limited to, liquid and / or semi-liquid formulations such as oil-in-water and / or water-in-oil emulsions, and / or solutions and / or suspensions, such as liniments, lotions, creams, ointments, and / or pastes. Topically administrable formulations may contain, for example, about 1% to about 10% (wt / wt) active ingredient, although the concentration of the active ingredient may be as high as the solubility limit of the active ingredient in the solvent. Formulations for topical administration may further include one or more of the additional ingredients described herein.

[0358] Pharmaceutical compositions can be prepared, packaged, and / or sold as formulations suitable for pulmonary administration via the oral cavity. Such formulations can include dry particles containing the active ingredient. Such compositions are conveniently in the form of a dry powder for administration using a device containing a dry powder reservoir that can direct a flow of propellant to disperse the powder, and / or using a self-propelling solvent / powder dispensing container, such as a device containing the active ingredient dissolved and / or suspended in a low-boiling propellant in a sealed container. Dry powder compositions can include a solid fine powder diluent such as sugar and are conveniently provided in a unit dosage form.

[0359] Low-boiling propellants generally include liquid propellants having a boiling point below 18.3°C (65°F) at atmospheric pressure. Generally, the propellant may comprise 50% to 99.9% (wt / wt) of the composition, and the active ingredient may comprise 0.1% to 20% (wt / wt) of the composition. The propellant may further comprise additional components such as liquid nonionic and / or solid anionic surfactants and / or solid diluents (which may have particle sizes similar to those of the particles containing the active ingredient).

[0360] Pharmaceutical compositions formulated for pulmonary delivery may provide the active ingredient in the form of droplets of a solution and / or suspension. Such formulations may be prepared, packaged, and / or sold as optionally sterile aqueous and / or dilute alcoholic solutions and / or suspensions containing the active ingredient, and may be conveniently administered using any spray and / or atomizing device. Such formulations may further contain one or more additional ingredients, including, but not limited to, flavorings such as saccharin sodium, volatile oils, buffers, surfactants, and / or preservatives such as methylhydroxybenzoates. The droplets provided by this administration route may have an average diameter ranging from about 1 nm to about 200 nm.

[0361] The formulations described herein as being useful for pulmonary delivery are also useful for intranasal delivery of pharmaceutical compositions. Another formulation suitable for intranasal administration is a coarse powder containing the active ingredient and having an average particle size of about 0.2 μm to 500 μm. Such formulations are administered by nasal inhalation, i.e., by high-velocity inhalation through the nasal passages from a container of the powder held close to the nose.

[0362] Formulations suitable for nasal administration may contain, for example, as little as about 0.1% (wt / wt) to as much as 100% (wt / wt) of the active ingredient, and may include one or more additional ingredients described herein. Pharmaceutical compositions may be prepared, packaged, and / or sold as formulations suitable for buccal administration. Such formulations may be, for example, in the form of tablets and / or lozenges made using conventional methods and may contain, for example, 0.1% to 20% (wt / wt) of the active ingredient, with the remainder comprising an orally dissolvable and / or degradable composition and, optionally, one or more additional ingredients described herein. Alternatively, formulations suitable for buccal administration may comprise a powder and / or aerosolized and / or atomized solution and / or suspension comprising the active ingredient. Such powdered, aerosolized, and / or aerosolized formulations, when dispersed, may have an average particle and / or droplet size in the range of about 0.1 nm to about 200 nm and may further include one or more of any additional ingredients described herein.

[0363] The pharmaceutical composition may be prepared, packaged, and / or sold as a formulation suitable for ocular administration. Such a formulation may be, for example, in the form of eye drops, comprising, for example, a 0.1 / 1.0% (wt / wt) solution and / or suspension of the active ingredient in an aqueous or oily liquid vehicle. Such eye drops may further comprise one or more buffers, salts, and / or any other additional ingredients described herein. Other useful ophthalmically administrable formulations include those comprising the active ingredient in microcrystalline form and / or liposomal formulations. Ear drops and / or eye drops are considered within the scope of the present disclosure.

[0364] Method for producing polypeptides in cells The present disclosure provides a method for producing a polypeptide of interest in a mammalian cell. The method for producing the polypeptide comprises contacting the cell with a nanoparticle composition containing mRNA encoding the polypeptide of interest. When the cell is contacted with the nanoparticle composition, the mRNA can be taken up by the cell and translated within the cell to produce the polypeptide of interest.

[0365] Generally, contacting mammalian cells with a nanoparticle composition containing mRNA encoding a polypeptide of interest can be performed in vivo, ex vivo, in culture, or in vitro. The amount of nanoparticle composition contacted with cells and / or the amount of mRNA therein can depend on the type of cell or tissue contacted, the means of administration, the physicochemical properties (e.g., size, charge, and chemical composition) of the nanoparticle composition and the mRNA therein, and other factors. Generally, an effective amount of the nanoparticle composition enables efficient polypeptide production in cells. Metrics of efficiency include polypeptide translation (indicated by polypeptide expression), the level of mRNA degradation, and immune response indicators.

[0366] The step of contacting the nanoparticle composition containing mRNA with cells can include or cause transfection.The phospholipids comprising the lipid components of the nanoparticle composition can, for example, interact with and / or fuse with cell membranes or intracellular membranes, thereby promoting transfection and / or increasing transfection efficiency.Transfection can allow the translation of mRNA in cells.

[0367] In some embodiments, the nanoparticle compositions described herein can be used therapeutically. For example, the mRNA contained in the nanoparticle composition can encode a therapeutic polypeptide (e.g., in a translatable region) and produce the therapeutic polypeptide upon contact with and / or entry into a cell (e.g., transfection). In other embodiments, the mRNA contained in the nanoparticle composition can encode a polypeptide that can improve or enhance a subject's immunity. For example, the mRNA can encode granulocyte colony-stimulating factor or trastuzumab.

[0368] In certain embodiments, the mRNA contained in the nanoparticle composition may encode a recombinant polypeptide that can replace one or more polypeptides that are substantially absent in cells contacted with the nanoparticle composition. The one or more substantially absent polypeptides may be absent due to mutations in the encoding gene or its regulatory pathway. Alternatively, the recombinant polypeptide produced by translation of the mRNA may antagonize the activity of an endogenous protein present within the cell, on the surface of the cell, or secreted from the cell. Antagonistic recombinant polypeptides may be desirable to counter adverse effects caused by the activity of endogenous proteins, such as altered activity or localization caused by mutations. In another modification, the recombinant polypeptide produced by translation of the mRNA may indirectly or directly antagonize the activity of a biological moiety present within the cell, on the surface of the cell, or secreted from the cell. Antagonized biological moieties include, but are not limited to, lipids (e.g., cholesterol), lipoproteins (e.g., low-density lipoprotein), nucleic acids, carbohydrates, and small molecule toxins. Recombinant polypeptides produced by translation of mRNA can be engineered for localization within a specific compartment within the cell, for example, the nucleus, or can be engineered for secretion from the cell or translocation to the cell membrane.

[0369] In some embodiments, contacting cells with a nanoparticle composition containing mRNA can reduce the cellular innate immune response to exogenous nucleic acids. Cells can be contacted with a first nanoparticle composition containing a first amount of a first exogenous mRNA containing a translatable region, and the level of the cellular innate immune response to the first exogenous mRNA can be determined. Subsequently, the cells can be contacted with a second composition containing a second amount of the first exogenous mRNA, where the second amount is a lower amount of the first exogenous mRNA compared to the first amount. Alternatively, the second composition can contain a first amount of a second exogenous mRNA that is different from the first exogenous mRNA. The step of contacting cells with the first and second compositions can be repeated one or more times. Furthermore, the efficiency of intracellular polypeptide production (e.g., translation) can be optionally determined, and the cells can be repeatedly re-contacted with the first and / or second compositions until a target protein production efficiency is achieved.

[0370] Methods for delivering therapeutic agents to cells and organs The present disclosure provides a method for delivering a therapeutic and / or prophylactic agent to a mammalian cell or organ. Delivery of the therapeutic and / or prophylactic agent to a cell comprises administering a nanoparticle composition containing the therapeutic and / or prophylactic agent to a subject, wherein administering the composition comprises contacting the cell with the composition. For example, a protein, a cytotoxic agent, a radioactive ion, a chemotherapeutic agent, or a nucleic acid (such as RNA, e.g., mRNA) can be delivered to the cell or organ. When the therapeutic and / or prophylactic agent is mRNA, upon contacting the cell with the nanoparticle composition, translatable mRNA can be translated within the cell to produce a polypeptide of interest. However, substantially non-translatable mRNA can also be delivered to the cell. Substantially non-translatable mRNA can be useful as a vaccine and / or can sequester the translational components of the cell to reduce expression of other species within the cell.

[0371] In certain embodiments, the nanoparticle composition may target a particular type or class of cell (e.g., cells of a particular organ or system thereof). For example, a nanoparticle composition comprising a therapeutic and / or prophylactic agent of interest may be specifically delivered to the liver, kidney, spleen, femur, or lung of a mammal. Specific delivery to a particular class of cells, organ, or system or group thereof means, for example, that a higher percentage of the nanoparticle composition comprising the therapeutic and / or prophylactic agent is delivered to the desired destination (e.g., tissue) compared to other destinations after administration of the nanoparticle composition to a mammal. In certain embodiments, specific delivery may result in a 2-fold, 5-fold, 10-fold, 15-fold, or greater than 20-fold increase in the amount of therapeutic and / or prophylactic agent per gram of tissue in the targeted destination (e.g., tissue of interest such as the liver) compared to another destination (e.g., the spleen). In certain embodiments, the tissue of interest is selected from the group consisting of liver, kidney, lung, spleen, femur, ocular tissue (e.g., by intraocular, subretinal, or intravitreal injection), vascular endothelium of blood vessels (e.g., intracoronary or intrafemoral) or kidney, and tumor tissue (e.g., by intratumoral administration).

[0372] As another example of targeted or specific delivery, mRNA encoding a protein-binding partner (e.g., an antibody or functional fragment thereof, a scaffold protein, or a peptide) or a cell surface receptor can be included in the nanoparticle composition. The mRNA can additionally or alternatively be used to direct the synthesis and extracellular localization of lipids, carbohydrates, or other biological moieties. Alternatively, other therapeutic and / or prophylactic agents or components of the nanoparticle composition (e.g., lipids or ligands) can be selected based on their affinity for a particular receptor (e.g., low-density lipoprotein receptor) so that the nanoparticle composition can more readily interact with a target cell population containing the receptor. For example, ligands include, but are not limited to, members of specific binding pairs, antibodies, monoclonal antibodies, Fv fragments, single-chain Fv (scFv) fragments, Fab' fragments, F(ab')2 fragments, single-chain antibodies, camelized antibodies and fragments thereof, humanized antibodies and fragments thereof, and multivalent forms thereof; multivalent binding reagents including monospecific or bispecific antibodies, e.g., disulfide-stabilized Fv fragments, scFv tandems, diabodies, tribodies, or tetrabodies; and aptamers, receptors, and fusion proteins.

[0373] In some embodiments, the ligand can be a surface-bound antibody, which can allow for the adjustment of cell target specificity. This is particularly useful because highly specific antibodies can be raised against the epitope of interest for the desired targeting site. In one embodiment, multiple antibodies can be expressed on the surface of a cell, each with a different specificity for the desired target. This approach can increase the avidity and specificity of the targeting interaction.

[0374] Ligands can be selected by those skilled in the art of biology based on, for example, the desired localization or function of cells. For example, estrogen receptor ligands such as tamoxifen can target cells to estrogen-dependent breast cancer cells, which have an increased number of estrogen receptors on the cell surface. Other non-limiting examples of ligand / receptor interactions include CCR1 (e.g., for treating inflamed joint tissue or brain in rheumatoid arthritis and / or multiple sclerosis), CCR7, CCR8 (e.g., for targeting lymph node tissue), CCR6, CCR9, CCR10 (e.g., for targeting intestinal tissue), CCR4, CCR10 (e.g., for targeting skin), CXCR4 (e.g., for general improved migration), HCELL (e.g., for treating inflammation and inflammatory diseases, bone marrow), α4β7 (e.g., for targeting intestinal mucosa), and VLA-4NCAM-1 (e.g., for targeting endothelium). Generally, any receptor involved in targeting (eg, cancer metastasis) can be utilized for use in the methods and compositions described herein.

[0375] Targeted cells include, but are not limited to, hepatocytes, epithelial cells, hematopoietic cells, epithelial cells, endothelial cells, lung cells, bone cells, stem cells, mesenchymal cells, neural cells, cardiac cells, adipocytes, vascular smooth muscle cells, cardiac muscle cells, skeletal muscle cells, beta cells, pituitary cells, synovial lining cells, ovarian cells, testicular cells, fibroblasts, B cells, T cells, reticulocytes, leukocytes, granulocytes, and tumor cells.

[0376] In certain embodiments, the nanoparticle composition can target hepatocytes. Apolipoproteins, such as apolipoprotein E (apoE), have been shown to bind to neutral or nearly neutral lipid-containing nanoparticle compositions in the body and are known to bind to receptors, such as the low-density lipoprotein receptor (LDLR), found on the surface of hepatocytes. Therefore, nanoparticle compositions containing lipid components with a neutral or nearly neutral charge administered to a subject can acquire apoE in the subject's body, thereby enabling targeted delivery of therapeutic and / or prophylactic agents (e.g., RNA) to hepatocytes containing LDLR.

[0377] Methods of Treating Diseases and Disorders Nanoparticle compositions can be useful for treating diseases, disorders, or conditions. In particular, such compositions can be useful for treating diseases, disorders, or conditions characterized by missing or abnormal protein or polypeptide activity. For example, nanoparticle compositions containing mRNA encoding a missing or abnormal polypeptide can be administered or delivered to cells. Subsequent translation of the mRNA produces the polypeptide, thereby reducing or eliminating problems caused by the absence or abnormal activity of the polypeptide. Because translation can occur rapidly, this method and composition can be useful for treating acute diseases, disorders, or conditions, such as sepsis, stroke, and myocardial infarction. The therapeutic and / or prophylactic agents contained in the nanoparticle compositions can also alter the rate of transcription of a given species, thereby affecting gene expression.

[0378] Diseases, disorders, and / or conditions characterized by dysfunctional or abnormal protein or polypeptide activity to which the compositions can be administered include, but are not limited to, rare diseases, infectious diseases (both as vaccines and therapeutic agents), cancer and proliferative diseases, genetic diseases (e.g., cystic fibrosis), autoimmune diseases, diabetes, neurodegenerative diseases, cardiovascular and renal vascular diseases, and metabolic diseases. Several diseases, disorders, and / or conditions can be characterized by deficient (or substantially reduced to the point that proper protein function does not occur) protein activity. Such proteins may be absent, or they may be substantially non-functional. A specific example of a dysfunctional protein is a missense mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which generates a dysfunctional protein variant of the CFTR protein and causes cystic fibrosis. The present disclosure provides methods for treating such diseases, disorders, and / or conditions in a subject by administering a nanoparticle composition comprising RNA and a lipid component comprising a lipid represented by Formula (I), a phospholipid (optionally unsaturated), a PEG-lipid, and a structured lipid, wherein the RNA can be an mRNA encoding a polypeptide that antagonizes or otherwise overcomes aberrant protein activity present in the subject's cells.

[0379] The present disclosure provides nanoparticle compositions comprising one or more therapeutic and / or prophylactic agents, and methods comprising administering pharmaceutical compositions comprising the same. The terms therapeutic agent and prophylactic agent may be used interchangeably herein with respect to features and embodiments of the present disclosure. The therapeutic, imaging, diagnostic, or prophylactic composition may be administered to a subject using any reasonable amount and any route of administration effective for the prevention, treatment, diagnosis, or imaging of a disease, disorder, and / or condition, and / or any other purpose. The specific amount administered to a given subject may vary depending on the subject's species, age, and general condition; the purpose of administration; the specific composition; the method of administration; etc. Compositions according to the present disclosure may be formulated in dosage unit form for ease of administration and uniformity of dosage. However, it will be understood that the total daily usage of the compositions of the present disclosure will be determined by the attending physician within the scope of sound medical judgment. The specific therapeutically effective, prophylactically effective, or appropriate dose level (e.g., for imaging) for any particular patient will depend on a variety of factors, including the severity and identity of the disorder being treated, if any; the one or more therapeutic and / or prophylactic agents used; the specific composition used; the patient's age, weight, general health, sex, and dietary habits; the time of administration, route of administration, and excretion rate of the specific pharmaceutical composition used; the duration of treatment; drugs used in combination with or concurrently with the specific pharmaceutical composition used; and similar factors well known in the medical arts.

[0380] Nanoparticle compositions containing one or more therapeutic and / or prophylactic agents can be administered by any route. In some embodiments, compositions containing prophylactic, diagnostic, or imaging compositions containing one or more nanoparticle compositions described herein are administered by one or more of various routes, including oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, subcutaneous, intraventricular, transdermal or intradermal, intradermal, rectal, intravaginal, intraperitoneal, intraocular, subretinal, intravitreal, topical (e.g., powder, ointment, cream, gel, lotion, and / or liquid drop), mucosal, nasal, oral, enteral, vitreous, intratumoral, sublingual, intranasal; intratracheal instillation, bronchial instillation, and / or inhalation; oral spray and / or powder, nasal spray, and / or aerosol, and / or via portal vein catheter. In some embodiments, compositions can be administered intravenously, intramuscularly, intradermally, intraarterially, intratumoral, subcutaneously, intraocular, subretinal, intravitreal, or by inhalation. However, the present disclosure encompasses delivery or administration of the compositions described herein by any suitable route, taking into account possible advances in the science of drug delivery. Generally, the most appropriate route of administration will depend on various factors, including the properties of the nanoparticle composition comprising one or more therapeutic and / or prophylactic agents (e.g., its stability in various bodily environments, such as the bloodstream and gastrointestinal tract), the condition of the patient (e.g., whether the patient can tolerate a particular route of administration), etc.

[0381] In certain embodiments, the compositions of the present disclosure provide a given dose of about 0.0001 mg / kg to about 10 mg / kg, about 0.001 mg / kg to about 10 mg / kg, about 0.005 mg / kg to about 10 mg / kg, about 0.01 mg / kg to about 10 mg / kg, about 0.05 mg / kg to about 10 mg / kg, about 0.1 mg / kg to about 10 mg / kg, about 1 mg / kg to about 10 mg / kg, about 2 mg / kg to about 10 mg / kg, about 5 mg / kg to about 10 mg / kg, about 0.0001 mg / kg to about 5mg / kg, about 0.001mg / kg to about 5mg / kg, about 0.005mg / kg to about 5mg / kg, about 0.01mg / kg to about 5mg / kg, about 0.05mg / kg to about 5mg / kg, about 0.1mg / kg to about 5mg / kg, about 1mg / k g~about 5mg / kg, about 2mg / kg~about 5mg / kg, about 0.0001mg / kg~about 2.5mg / kg, about 0.001mg / kg~about 2.5mg / kg, about 0.005mg / kg~about 2.5mg / kg, about 0.01mg / kg~about 2.5m g / kg, about 0.05 mg / kg to about 2.5 mg / kg, about 0.1 mg / kg to about 2.5 mg / kg, about 1 mg / kg to about 2.5 mg / kg, about 2 mg / kg to about 2.5 mg / kg, about 0.0001 mg / kg to about 1 mg / kg, about 0.001 mg / kg~about 1mg / kg, about 0.005mg / kg~about 1mg / kg, about 0.01mg / kg~about 1mg / kg, about 0.05mg / kg~about 1mg / kg, about 0.1mg / kg~about 1mg / kg, about 0.0001mg / kg~about 0.25m The nanoparticle composition may be administered at a dosage level sufficient to deliver about 0.001 mg / kg to about 0.25 mg / kg, about 0.005 mg / kg to about 0.25 mg / kg, about 0.01 mg / kg to about 0.25 mg / kg, about 0.05 mg / kg to about 0.25 mg / kg, or about 0.1 mg / kg to about 0.25 mg / kg of therapeutic and / or prophylactic agent (e.g., mRNA), where a 1 mg / kg (mpk) dose provides 1 mg of therapeutic and / or prophylactic agent per kg of subject body weight. In certain embodiments, a dose of about 0.001 mg / kg to about 10 mg / kg of therapeutic and / or prophylactic agent (e.g., mRNA) of the nanoparticle composition may be administered.In other embodiments, a therapeutic and / or prophylactic agent may be administered at a dose of about 0.005 mg / kg to about 2.5 mg / kg. In certain embodiments, a dose of about 0.1 mg / kg to about 1 mg / kg may be administered. In other embodiments, a dose of about 0.05 mg / kg to about 0.25 mg / kg may be administered. Doses may be administered one or more times daily in the same or different amounts to achieve the desired level of mRNA expression and / or therapeutic, diagnostic, prophylactic, or imaging effect. The desired dose may be delivered, for example, three times daily, twice daily, once daily, every other day, every third day, weekly, every other week, every three weeks, or every four weeks. In certain embodiments, the desired dose may be delivered using multiple administrations (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or more administrations). In certain embodiments, for example, before or after surgery or in the case of an acute disease, disorder, or condition, a single dose may be administered.

[0382] Nanoparticle compositions containing one or more therapeutic and / or prophylactic agents can be used in combination with one or more other therapeutic, prophylactic, diagnostic, or imaging agents. "In combination with" is not intended to imply that the agents must be administered simultaneously and / or formulated for delivery together, although these delivery methods are within the scope of the present disclosure. For example, one or more nanoparticle compositions containing one or more different therapeutic and / or prophylactic agents can be administered in combination. The compositions can be administered simultaneously with, before, or after one or more other desired therapeutic agents or medical procedures. Generally, each agent is administered at a dose and / or time schedule determined for that agent. In certain embodiments, the present disclosure encompasses delivery of a composition, or imaging, diagnostic, or prophylactic composition, in combination with an agent that improves their bioavailability, inhibits and / or modulates their metabolism, inhibits their excretion, and / or modulates their distribution in the body.

[0383] It will be further understood that therapeutic, prophylactic, diagnostic, or imaging agents used in combination can be administered together in a single composition or separately in different compositions. In general, it is expected that agents used in combination will be used at levels that do not exceed the levels at which they are used individually. In certain embodiments, the levels used in combination are less than the levels at which they are used individually.

[0384] The particular combination of therapies (therapeutics or procedures) to use in a combination regimen will take into account the compatibility of the desired therapeutics and / or procedures and the desired therapeutic effect to be achieved. It will also be understood that the therapies used can achieve a desired effect for the same disorder (e.g., a composition useful for treating cancer can be administered simultaneously with a chemotherapeutic agent), or they can achieve different effects (e.g., control of any adverse effects, such as infusion-related reactions).

[0385] The nanoparticle compositions can be used in combination with pharmaceutical agents to enhance the efficacy and / or therapeutic window of the compositions. Such pharmaceutical agents can be, for example, anti-inflammatory compounds, steroids (e.g., corticosteroids), statins, estradiol, BTK inhibitors, S1P1 agonists, glucocorticoid receptor modulators (GRMs), or antihistamines. In certain embodiments, the nanoparticle compositions can be used in combination with dexamethasone, methotrexate, acetaminophen, H1 receptor antagonists, or H2 receptor antagonists. In certain embodiments, methods of treating a subject in need thereof or delivering therapeutic and / or prophylactic agents to a subject (e.g., a mammal) can include pretreating the subject with one or more pharmaceutical agents prior to administering the nanoparticle compositions. For example, a subject can be pretreated with a useful amount (e.g., 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, or any other useful amount) of dexamethasone, methotrexate, acetaminophen, an H1 receptor antagonist, or an H2 receptor antagonist. Pretreatment can occur within 24 hours (e.g., within 24 hours, 20 hours, 16 hours, 12 hours, 8 hours, 4 hours, 2 hours, 1 hour, 50 minutes, 40 minutes, 30 minutes, 20 minutes, or 10 minutes) prior to administration of the nanoparticle composition, and can occur once, twice, or more times, e.g., in increasing doses.

[0386] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the present disclosure described herein. The scope of the present disclosure is not intended to be limited to the above description, but is instead set forth in the appended claims.

[0387] In the claims, articles such as "a," "an," and "the" can mean one or more, unless stated to the contrary or the context clearly dictates otherwise. A claim or description herein containing "or" between one or more members of a group is considered satisfied if one, more than one, or all of the members of the group are present in, used in, or associated with a given product or process, unless stated to the contrary or the context clearly dictates otherwise. The present disclosure includes embodiments in which exactly one member of a group is present in, used in, or associated with a given product or process. The present disclosure includes embodiments in which two or more, or all, of the members of a group are present in, used in, or associated with a given product or process.

[0388] It is also noted that the term "comprising" is intended to be open-ended, allowing for, but not requiring, the inclusion of additional elements or steps. Thus, when the term "comprising" is used herein, it is understood to mean "consisting essentially of." The terms "of" and "consisting of" are also encompassed and disclosed. Throughout this specification, when a composition is described as having, comprising, or including particular components, it is contemplated that the composition also consists essentially of, or consists of, the described components. Similarly, when a method or process is described as having, comprising, or including particular process steps, it is contemplated that the process also consists essentially of, or consists of, the described process steps. Furthermore, it should be understood that the order of steps or order for performing certain actions is immaterial so long as the invention remains operable. Additionally, two or more steps or actions can be performed simultaneously.

[0389] When ranges are stated, both endpoints are included. Furthermore, unless otherwise stated or otherwise apparent from the context and the understanding of one of ordinary skill in the art, it should be understood that values ​​expressed as ranges can assume any specific value or subrange within the stated range in various embodiments of the present disclosure, to the tenth of the unit of the lower limit of that range, unless the context clearly dictates otherwise.

[0390] The synthetic methods of the present disclosure can tolerate a variety of functional groups, so that a variety of substituted starting materials can be used. The methods generally provide the desired final compound at or near the end of the overall process, although in some cases it may be desirable to further convert the compound to its pharmaceutically acceptable salt.

[0391] The compounds of the present disclosure can be prepared in a variety of ways from readily prepared intermediates using commercially available starting materials, compounds known in the literature, or by using standard synthetic methods and procedures that are known to, or will be apparent to, those skilled in the art in light of the teachings herein. Standard synthetic methods and procedures for the preparation of organic molecules and functional group transformations and manipulations can be obtained from the relevant scientific literature or from standard textbooks in the art. Any one or several sources, which are incorporated herein by reference, include, but are not limited to, Smith, MB, March, J., March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, 5th ed., John Wiley & Sons: New York, 2001; Greene, TW, Watts, PGM, Protective Groups in Organic Synthesis, 3rd ed., John Wiley & Sons: New York, 1999; R. Larock, Comprehensive Organic Transformations, VCH Publishers. Publishers (1989); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995). Classic texts such as "The Organic Synthesis of Organic Compounds" (Wiley and Sons, 1995) are useful and are recognized reference texts on organic synthesis known in the art. The following descriptions of synthetic methods are designed to illustrate, but not limit, general procedures for the preparation of compounds of the present disclosure.

[0392] Compounds of the present disclosure represented by any of the formulas described herein can be prepared from commercially available starting materials or starting materials that can be prepared using literature procedures according to the procedures shown in Schemes 1 and 2 below. Variables in the schemes (e.g., R1, R2, and R3, etc.) are as defined herein. Those skilled in the art will note that the order of certain steps, such as the introduction and removal of protecting groups, can be varied in the reaction sequences and synthetic schemes described herein.

[0393] Those skilled in the art will recognize that certain groups may require protection from the reaction conditions through the use of protecting groups. Protecting groups may also be used to distinguish between similar functional groups in a molecule. A list of protecting groups and how to install and remove these groups can be found in "Protective Groups in Organic Synthesis," by Greene, TW, and Wuts, PGM. "The Artificial Intelligence Synthesis," 3rd ed., John Wiley & Sons: New York, 1999.

[0394] Preferred protecting groups include, but are not limited to, the following: For hydroxyl moieties: TBS, benzyl, THP, Ac; For carboxylic acids: benzyl esters, methyl esters, ethyl esters, allyl esters; For amines: Fmoc, Cbz, BOC, DMB, Ac, Bn, Tr, Ts, trifluoroacetyl, phthalimide, benzylideneamine; For diols: Ac(x2)TBS(x2), or when combined, acetonide; For thiols: Ac; For benzimidazoles: SEM, benzyl, PMB, DMB; For aldehydes: di-alkyl acetals, for example dimethoxy acetal or diethylacetyl.

[0395] In the reaction scheme described herein, multiple stereoisomers can be produced.When no specific stereoisomer is indicated, it is understood to mean all possible stereoisomers that can be produced from the reaction.Those skilled in the art will recognize that the reaction can be optimized to preferentially obtain one isomer, or a new scheme can be devised to produce a single isomer.When a mixture is produced, techniques such as preparative thin layer chromatography, preparative HPLC, preparative chiral HPLC, or preparative SFC can be used to separate isomers.

[0396] [ka]

[0397] As shown in Scheme 1 above, 8-bromooctanoic acid is reacted with an alcohol a1 (e.g., heptadecan-9-ol) to produce an ester b1 (e.g., heptadecan-9-yl 8-bromooctanoate). Step 1 can be carried out, for example, in the presence of N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride, N,N-diisopropylethylamine, and DMAP in an organic solvent (e.g., dichloromethane). Step 1 can be carried out at room temperature for 18 hours. Next, ester b1 is reacted with 2-aminoethan-1-ol to produce an amine c1 (e.g., heptadecan-9-yl 8-((2-hydroxyethyl)amino)octanoate). Step 2 can be carried out, for example, in ethanol at a temperature of about 60°C. Amine c1 then reacts with a bromoalkyl R1-Br (e.g., 1-bromotetradecane) to give compound d1 (e.g., heptadecan-9-yl 8-((2-hydroxyethyl)(tetradecyl)amino)octanoate). Step 3 can be carried out in ethanol in the presence of N,N-diisopropylethylamine.

[0398] [ka]

[0399] As shown in Scheme 2 above, acid a2 (where t is an integer from 1 to 7; e.g., 8-bromooctanoic acid) reacts with alcohol b2 (e.g., nonan-1-ol) to produce ester c2 (e.g., nonyl-8-bromooctanoate). Step 1 can be carried out, for example, in the presence of N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride, N,N-diisopropylethylamine, and DMAP in an organic solvent (e.g., dichloromethane). Alcohol e2 (e.g., heptadecan-9-ol) can be reacted with aldehyde d2 (e.g., nonanal) via Grignard reagent R3-MgX (e.g., n-CH). 17MgBr). 8-Bromooctanoic acid is then reacted with alcohol e2 (e.g., heptadecan-9-ol) to give ester f2 (e.g., heptadecan-9-yl 8-bromooctanoate). Step 3 can be carried out, for example, in the presence of N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride, N,N-diisopropylethylamine, and DMAP in an organic solvent (e.g., dichloromethane). Ester f2 is then reacted with 2-aminoethan-1-ol to give amine g2 (e.g., heptadecan-9-yl 8-((2-hydroxyethyl)amino)octanoate). Step 4 can be carried out in ethanol in the presence of i-Pr2EtN. Next, amine g2 reacts with ester c2 (e.g., nonyl-8-bromooctanoate) to yield compound h2 (e.g., heptadecan-9-yl 8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate). Step 5 can be carried out, for example, at elevated temperature (about 70-90°C, e.g., about 80°C) in the presence of a base (an inorganic base (e.g., KCO) or a non-nucleophilic organic base (e.g., i-PrEtN)) and a catalyst (e.g., an iodide such as KI or NaI) in an organic solvent (e.g., a mixture of CPME and MeCN).

[0400] Those skilled in the art will recognize that the order of certain steps in the above schemes may be interchangeable. In certain embodiments, the present disclosure also includes methods of synthesizing compounds of any of Formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId), or (IIe) and intermediates for synthesizing the compounds.

[0401] In one embodiment, the method of synthesizing a compound of formula (I) comprises reacting a compound of formula (X2):

[0402] [ka]

[0403] with R1-Br to obtain a compound of formula (I), wherein each variable is as defined herein. For example, m is 5, 6, 7, 8, or 9, preferably 5, 7, or 9. For example, each of R5, R6, and R7 is H. For example, M is -C(O)O- or -OC(O)-. For example, R4 is an unsubstituted C 1~3 Alkyl, or -(CH2) n and Q, where n is 2, 3, or 4, and Q is OH, —NHC(S)N(R), —NHC(O)N(R), —N(R)C(O)R, or —N(R)S(O)R. For example, the reaction of a compound of formula (X) with R-Br is carried out in the presence of a base (such as an inorganic base (e.g., KCO) or a non-nucleophilic organic base (e.g., i-PrEtN). For example, the reaction is carried out in the presence of an inorganic base (e.g., KCO) and a catalyst (e.g., an iodide such as KI or NaI). For example, the reaction is carried out at elevated temperatures, e.g., about 50-100°C, 70-90°C, or about 80°C).

[0404] This method uses the formula (X1):

[0405] [ka]

[0406] with R 4 NH 2 to obtain a compound of formula (X2), wherein each variable is as defined herein. In one embodiment, the intermediate has formula (X1) and (X2):

[0407] [ka]

[0408] wherein each variable is as defined herein. For example, intermediates include heptadecan-9-yl 8-bromooctanoate, and heptadecan-9-yl 8-((2-hydroxyethyl)amino)octanoate, and morphic forms (e.g., crystalline forms) thereof.

[0409] Furthermore, it should be understood that any particular embodiment of the present disclosure that falls within the prior art may be explicitly excluded from any one or more of the claims. Because such embodiments are deemed to be known to those of ordinary skill in the art, they may be excluded even if the exclusion is not expressly set forth herein.

[0410] All cited materials, including references, publications, databases, database entries, and techniques cited herein, are incorporated by reference into this application, even if not explicitly stated in the citation. In the event of a conflict between the cited materials and the contents of this application, the contents of this application shall control.

[0411] (Example) Example 1: Synthesis of compounds represented by formula (I), (IA), (II), (IIa), (IIb), (IIc), (IId) or (IIe) A. General Considerations All solvents and reagents used were obtained from commercial sources and were used as received unless otherwise noted. 1 H NMR spectra were recorded in CDCl3 at 300 K using a Bruker Ultrashield 300 MHz instrument. Chemical shifts are 1 Silica gel chromatography was performed using an ISCO RediSep ISCO CombiFlash Rf+ Lumen Instruments (ISCO CombiFlash) was used with ISCO RediSep Rf Gold Flash Cartridges (particle size: 20-40 μm). Reverse-phase chromatography was performed on an ISCO CombiFlash Rf+ Lumen Instruments using a RediSep Rf Gold C18 High Performance column. All final compounds were determined to be >85% pure by analysis by reverse-phase UPLC-MS (retention time, RT, min) using a Waters Acquity UPLC instrument equipped with a DAD and ELSD and a ZORBAX Rapid Resolution High Definition (RRHD) SB-C18 LC column, 2.1 mm, 50 mm, 1.8 μm, and a gradient of 65–100% acetonitrile in water containing 0.1% TFA over 5 min at 1.2 mL / min. The injection volume was 5 μL, and the column temperature was 80 °C. Detection was based on electrospray ionization (ESI) in positive mode using a Waters SQD mass spectrometer (Milford, MA, USA) and an evaporative light scattering detector.

[0412] The procedures described below are useful for the synthesis of compounds 1-147. The following abbreviations are used herein: THF: tetrahydrofuran MeCN: acetonitrile LAH: Lithium aluminum hydride DCM: dichloromethane DMAP: 4-dimethylaminopyridine LDA: lithium diisopropylamide rt: room temperature DME: 1,2-dimethoxyethane n-BuLi: n-butyllithium CPME: Cyclopentyl methyl ether i-Pr2EtN: N,N-diisopropylethylamine B. Compound 2: Heptadecan-9-yl 8-((2-hydroxyethyl)(tetradecyl)amino)octanoate Typical procedure 1

[0413] [ka]

[0414] Heptadecan-9-yl 8-bromooctanoate (Method A)

[0415] [ka]

[0416] To a solution of 8-bromooctanoic acid (1.04 g, 4.6 mmol) and heptadecan-9-ol (1.5 g, 5.8 mmol) in dichloromethane (20 mL) was added N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (1.1 g, 5.8 mmol), N,N-diisopropylethylamine (3.3 mL, 18.7 mmol), and DMAP (114 mg, 0.9 mmol). The reaction was allowed to stir at room temperature for 18 hours. The reaction was diluted with dichloromethane and washed with saturated sodium bicarbonate. The organic layer was separated, washed with brine, and dried over MgSO4. The organic layer was filtered and evaporated under reduced pressure. The residue was purified by silica gel chromatography (0-10% ethyl acetate in hexanes) to give heptadecan-9-yl 8-bromooctanoate (875 mg, 1.9 mmol, 41%). 1 H NMR (300 MHz, CDCl3) δ: ppm 4.89(m,1H);3.42(m,2H);2.31(m,2H);1.89(m,2H);1.73-1.18(br.m,36H);0.88(m,6H). Heptadecan-9-yl 8-((2-hydroxyethyl)amino)octanoate (Method B)

[0417] [ka]

[0418] A solution of heptadecan-9-yl 8-bromooctanoate (3.8 g, 8.2 mmol) and 2-aminoethan-1-ol (15 mL, 248 mmol) in ethanol (3 mL) was stirred at 62 °C for 18 h. The reaction mixture was concentrated under reduced pressure, and the residue was taken up in ethyl acetate and water. The organic layer was separated, washed with water, brine, and dried over NaSO. The mixture was filtered and evaporated under reduced pressure. The residue was purified by silica gel chromatography (0-100% in dichloromethane (mixture of 1% NHOH, 20% MeOH in dichloromethane)) to give heptadecan-9-yl 8-((2-hydroxyethyl)amino)octanoate (3.1 g, 7 mmol, 85%). UPLC / ELSD: RT = 2.67 min. MS (ES): C 27 H 55 m / z (MH) for NO + )442.68 1 H NMR (300MHz, CDCl3)δ:ppm 4.89(p,1H);3.67(t,2H);2.81(t,2H);2.65(t,2H);2.30(t,2H);2.05(br.m,2H);1.72-1.41(br.m,8H);1.40-1.20(br.m,30H);0.88(m,6H). Heptadecan-9-yl 8-((2-hydroxyethyl)(tetradecyl)amino)octanoate (Method C)

[0419] [ka]

[0420] A solution of heptadecan-9-yl 8-((2-hydroxyethyl)amino)octanoate (125 mg, 0.28 mmol), 1-bromotetradecane (94 mg, 0.34 mmol), and N,N-diisopropylethylamine (44 mg, 0.34 mmol) in ethanol was stirred at 65 °C for 18 h. The reaction was cooled to room temperature, and the solvent was evaporated under reduced pressure. The residue was taken up in ethyl acetate and saturated sodium bicarbonate. The organic layer was separated, dried over Na2SO4, and evaporated under reduced pressure. The residue was purified by silica gel chromatography (0-100% dichloromethane (mixture of 1% NH4OH, 20% MeOH in dichloromethane)) to give heptadecan-9-yl 8-((2-hydroxyethyl)(tetradecyl)amino)octanoate (89 mg, 0.14 mmol, 50%). UPLC / ELSD: RT=3.61 minutes. MS(ES):C 41 H 83 m / z (MH) for NO + )638.91. 1 H NMR (300MHz, CDCl3)δ:ppm 4.86(p,1H);3.72-3.47(br.m,2H);2.78-2.40(br.m,5H);2.28(t,2H);1.70-1.40(m,10H);1.38-1.17(br.m,54H);0.88(m,9H). Synthesis of intermediates: Intermediate A: 2-octyldecanoic acid

[0421] [ka]

[0422] A solution of diisopropylamine (2.92 mL, 20.8 mmol) in THF (10 mL) was cooled to -78 °C, and a solution of n-BuLi (7.5 mL, 18.9 mmol, 2.5 M in hexanes) was added. The reaction was warmed to 0 °C. To a solution of decanoic acid (2.96 g, 17.2 mmol) and NaH (754 mg, 18.9 mmol, 60% w / w) in THF (20 mL) at 0 °C, the solution of LDA was added, and the mixture was allowed to stir at room temperature for 30 min. After this time, 1-iodooctane (5 g, 20.8 mmol) was added, and the reaction mixture was heated at 45 °C for 6 h. The reaction was quenched with 1 N HCl (10 mL). The organic layer was dried over MgSO4, filtered, and evaporated under reduced pressure. The residue was purified by silica gel chromatography (0-20% ethyl acetate in hexanes) to give 2-octyldecanoic acid (1.9 g, 6.6 mmol, 38%). 1 H NMR (300MHz, CDCl3)δ:ppm 2.38(br.m,1H);1.74-1.03(br.m,28H);0.91(m,6H). Intermediate B: 7-bromoheptyl 2-octyldecanoate

[0423] [ka]

[0424] 7-Bromoheptyl 2-octyldecanoate was synthesized using Method A from 2-octyldecanoic acid and 7-bromoheptan-1-ol. 1 H NMR (300MHz, CDCl3)δ:ppm 4.09(br.m,2H);3.43(br.m,2H);2.48-2.25(br.m,1H);1.89(br.m,2H);1.74-1.16(br.m,36H);0.90(m,6H). Intermediate C: (2-hexylcyclopropyl)methanol

[0425] [ka]

[0426] A solution of diethylzinc (20 mL, 20 mmol, 1 M in hexanes) in dichloromethane (20 mL) was cooled to −40° C. over 5 minutes. Then, a solution of diiodomethane (3.22 mL, 40 mmol) in dichloromethane (10 mL) was added dropwise. The reaction was allowed to stir at −40° C. for 1 hour, after which a solution of trichloro-acetic acid (327 mg, 2 mmol) and DME (1 mL, 9.6 mmol) in dichloromethane (10 mL) was added. The reaction was allowed to warm to −15° C. and stirred at this temperature for 1 hour. Next, a solution of (Z)-non-2-en-1-ol (1.42 g, 10 mmol) in dichloromethane (10 mL) was added to the −15° C. solution. The reaction was allowed to slowly warm to room temperature and stirred for 18 hours. After this time, saturated NH4Cl (200 mL) was added, and the reaction was extracted with dichloromethane (3 times), washed with brine, and dried over Na2SO4. The organic layer was filtered and evaporated under reduced pressure, and the residue was purified by silica gel chromatography (0 to 50% ethyl acetate in hexanes) to give (2-hexylcyclopropyl)methanol (1.43 g, 9.2 mmol, 92%). 1 H NMR (300MHz, CDCl3)δ:ppm 3.64(m,2H);1.57-1.02(m,12H);0.99-0.80(m,4H);0.72(m,1H), 0.00(m,1H). C. Compound 1: Heptadecan-9-yl 8-((2-hydroxyethyl)(octadecyl)amino)octanoate

[0427] [ka]

[0428] Compound 1 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.86 min. MS(ES): C 45 H 91 m / z (MH) for NO + )694.93. 1H NMR (300MHz, CDCl3)δ:ppm 4.86(m,1H);3.77-3.47(br.m,2H);2.78-2.37(br.m,5H);2.28(t,2H);1.73-1.40(br.m,10H);1.38-1.18(br.m,62H);0.88(m,9H). D. Compound 3: Heptadecan-9-yl 8-((2-hydroxyethyl)(nonyl)amino)octanoate

[0429] [ka]

[0430] Compound 3 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.36 min. MS(ES): C 36 H 73 m / z (MH) for NO + )568.80. 1 H NMR (300MHz, CDCl3)δ:ppm 4.86(p,1H);3.72-3.45(br.m,2H);2.79-2.34(br.m,5H);2.28(t,2H);1.70-1.38(m,10H);1.38-1.16(br.m,44H);0.88(m,9H). E. Compound 4: Heptadecan-9-yl 8-((2-hydroxyethyl)(octyl)amino)octanoate

[0431] [ka]

[0432] Compound 4 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=2.99 min. MS(ES): C 35 H 71 m / z (MH) for NO + )554.777. 1H NMR (300MHz, CDCl3)δ:ppm 4.86(p,1H);3.71(br.s,2H);2.70(br.s,5H);2.26(t,2H);1.48-1.59(br.m.,10H);1.24(m,42H);0.86(t,9H). F. Compound 5: Heptadecan-9-yl 8-(hexyl(2-hydroxyethyl)amino)octanoate

[0433] [ka]

[0434] Compound 5 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.10 min. MS(ES): C 33 H 67 m / z (MH) for NO + )526.73. 1 H NMR (300MHz, CDCl3)δ:ppm 4.86(p,1H);3.67-3.48(br.m,2H);2.74-2.39(br.m,5H);2.28(t,2H);1.68-1.39(br.m,10H);1.38-1.16(br.m,38H);0.88(m,9H). G. Compound 6: Heptadecan-9-yl 8-((2-hydroxyethyl)((9Z,12Z)-octadeca-9,12-dien-1-yl)amino)octanoate

[0435] [ka]

[0436] Compound 6 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.77 min. MS(ES): C 45 H 87 m / z (MH) for NO + )690.84. 1H NMR (300MHz, CDCl3)δ:ppm 5.37(m,4H);4.86(br.m,1H);3.53(br.m;2H);2.78(br.m,2H);2.58(br.m,2H); 2.45(br.m,4H);2.28(m,2H);2.05(m,4H);1.68-1.15(br.m,57H);0.89(m,9H). H. Compound 7: Heptadecan-9-yl 8-((3-hydroxypropyl)(nonyl)amino)octanoate

[0437] [ka]

[0438] Compound 7 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.24 min. MS(ES): C 37 H 75 m / z (MH) for NO + )582.987. 1 H NMR (300MHz, CDCl3)δ:ppm 4.84(p,1H);3.76(t,2H);2.42-2.66(br.s,5H);2.25(t,2H);1.47-1.68(br.m,12H);1.24(m,42H);0.86(t,9H). I. Compound 8: Heptadecan-9-yl 8-((3-(1H-imidazol-1-yl)propyl)(nonyl)amino)octanoate Step 1: Heptadecan-9-yl 8-((3-chloropropyl)(nonyl)amino)octanoate

[0439] [ka]

[0440] To a 0°C solution of heptadecan-9-yl 8-((3-hydroxypropyl)(nonyl)amino)octanoate (0.53 g, 0.91 mmol) in 4 mL of DCM was added mesyl chloride (0.070 mL, 0.91 mmol), followed by triethylamine (0.13 mL, 0.91 mmol). The reaction was allowed to warm slowly to room temperature and stirred overnight. The reaction was quenched by the addition of water (ca. 10 mL). The mixture was extracted three times with DCM, and the pooled organics were washed with brine, dried over MgSO4, filtered, and concentrated under reduced pressure. The crude oil was purified by silica gel chromatography to give heptadecan-9-yl 8-((3-chloropropyl)(nonyl)amino)octanoate (0.23 g, 42%). 1 H NMR (300MHz, CDCl3)δ:ppm 4.84(p,1H);3.58(t,2H);2.51(br.s,2H);2.35(br.s,2H);2.26(2, 2H);1.86(br.s,2H);1.40-1.60(br.m,12H);1.24(br.m,42H);0.86(t,9H). Step 2: Heptadecan-9-yl 8-((3-(1H-imidazol-1-yl)propyl)(nonyl)amino)octanoate

[0441] [ka]

[0442] In a round-bottom flask, heptadecan-9-yl 8-((3-chloropropyl)(nonyl)amino)octanoate (50 mg, 0.083 mmol) was combined with imidazole (17 mg, 0.25 mmol) and K2CO3 (35 mg, 0.25 mmol) in MeCN (0.5 mL). The flask was fitted with a condenser, placed in a heating mantle at 82 °C, and allowed to stir for 24 h. After this time, the reaction was cooled to room temperature, filtered, and the filtrate concentrated under reduced pressure. The crude oil was purified by silica gel chromatography (0-100% [DCM, 20% MeOH, 1% NH4OH] / MeOH) to afford the desired product as a clear oil (39 mg, 74%). UPLC / ELSD: RT = 2.92 min. MS (ES): C 40 H 77 m / z (MH) for N3O2 + )633.994. 1 H NMR (300MHz, CDCl3)δ:ppm 7.46(s,1H);7.05(s,1H);6.91(s,1H);4.84(dt,1H);4.02(br.s,2H);2.47(br.s,4H) ;2.26(t,2H);2.00(br.s,2H);1.47-1.59(br.m,10H);1.24(br.m,44H);0.86(t,9H). J. Compound 9: Heptadecan-9-yl 8-((2-acetoxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

[0443] [ka]

[0444] To a solution of heptadecan-9-yl 8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (100 mg, 0.14 mmol) and acetic acid (8 mg, 0.13 mmol) in dichloromethane (1 mL) was added N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (31 mg, 0.16 mmol), N,N-diisopropylethylamine (73 mg, 0.56 mmol), and DMAP (3 mg, 0.02 mmol). The reaction was allowed to stir at room temperature for 18 hours. The reaction was diluted with dichloromethane and washed with saturated sodium bicarbonate. The organic layer was separated, washed with brine, and dried over MgSO4. The organic layer was filtered and evaporated under reduced pressure. The residue was purified by silica gel chromatography (0-100% dichloromethane (mixture of 1% NH4OH, 20% MeOH in dichloromethane)) to give heptadecan-9-yl 8-((2-acetoxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (63 mg, 0.08 mmol). UPLC / ELSD: RT = 3.63 min. MS (ES): C 46 H 89 m / z (MH) for NO + )753.07. 1 H NMR (300MHz, CDCl3)δ:ppm 4.87(p,1H);4.17-3.99(m,4H);2.67(m,2H);2.43(m,3H);2.29(m,4H);2.05(s,3H);1.71-1.17(br.m,63H);0.88(m,9H). K. Compound 10: Heptadecan-9-yl 8-((2-hydroxypropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

[0445] [ka]

[0446] Compound 10 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.73 min. MS(ES): C 45 H89 m / z (MH) for NO + )725.10. 1 H NMR (300MHz, CDCl3)δ:ppm 4.86(p,1H);4.05(t,2H);3.80-3.54(br.m,1H);2.61-2.13(br.m,9H);1.69-1.03(br.m,67H);0.88(m,9H). L. Compound 11: Heptadecan-9-yl (R)-8-((2-hydroxypropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

[0447] [ka]

[0448] Compound 11 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=5.21 min. MS(ES): C 45 H 89 m / z (MH) for NO + )725.02. 1 H NMR (300MHz, CDCl3)δ:ppm 4.86(p,1H);4.05(t,2H);3.72(br.m,1H);2.65-2.10(br.m,8H);1.71-0.99(br.m,68H);0.88(m,9H). M. Compound 12: Heptadecan-9-yl (S)-8-((2-hydroxypropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

[0449] [ka]

[0450] Compound 12 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=5.30 min. MS(ES): C 45 H 89 m / z (MH) for NO + )725.10. 1H NMR (300MHz, CDCl3)δ:ppm 4.86(p,1H);4.05(t,2H);3.71(br.m,1H);2.64-2.10(br.m,8H);1.71-1.03(br.m,68H);0.88(m,9H). N. Compound 13: Heptadecan-9-yl 8-((2-hydroxybutyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

[0451] [ka]

[0452] Compound 13 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.89 min. MS(ES): C 46 H 91 m / z (MH) for NO + )739.21. 1 H NMR (300MHz, CDCl3)δ:ppm 4.86(p,1H);4.05(t,2H);3.58-3.38(br.m,1H);2.65-2.15(br.m,9H);1.72-1.12(br.m,66H);0.98(t,3H);0.88(m,9H). O. Compound 14: Heptadecan-9-yl 8-((2-(dimethylamino)ethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

[0453] [ka]

[0454] Compound 14 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.51 min. MS(ES): C 46 H 92 m / z (MH) for N2O4 + )738.23. 1H NMR (300MHz, CDCl3)δ:ppm 4.84(p,1H);4.04(t,2H);2.95(m,2H);2.78(m,6H);2.44(s,6H);2.28(m,4H);1.70-1.41(br.m,14H);1.41-1.14(br.m,48H);0.87(m,9H). P. Compound 15: Heptadecan-9-yl 8-((2-methoxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

[0455] [ka]

[0456] Compound 15 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.90 min. MS(ES): C 45 H 89 m / z (MH) for NO + )725.19. 1 H NMR (300MHz, CDCl3)δ:ppm 4.86(p,1H);4.05(t,2H);3.43(m,2H);3.34(s,3H);2.61(m,2H);2.43(m,3H);2.29(m,4H);1.70-1.15(br.m,63H);0.88(m,9H). Q. Compound 16: Heptadecan-9-yl 8-((3-methoxypropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

[0457] [ka]

[0458] Compound 16 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.90 min. MS(ES): C 46 H 91 m / z (MH) for NO + )739.13. 1H NMR (300MHz, CDCl3)δ:ppm 4.89(p,1H);4.08(t,2H);3.42(m,2H);3.35(s,3H);2.55-2.21(m,9H);1.81-1.18(br.m,65H);0.88(m,9H). R. Compound 17: Heptadecan-9-yl 8-((2-(2-(dimethylamino)ethoxy)ethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

[0459] [ka]

[0460] Compound 17 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.72 min. MS(ES): C 48 H 96 m / z (MH) for N2O5 + )782.27. 1 H NMR (300MHz, CDCl3)δ:ppm 4.88(p,1H);4.08(t,2H);3.57(m,4H);2.72(m,2H);2.52(m,5H);2.38-2.13(br.m,12H);1.73-1.19(br.m,61H);0.90(m,9H). S. Compound 18: Heptadecan-9-yl 8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

[0461] [ka]

[0462] Compound 18 was synthesized according to the general procedures and representative procedure 1 described above, or according to the following scheme.

[0463] [ka]

[0464] UPLC / ELSD: RT=3.59 minutes. MS(ES):C 44 H 87 m / z (MH) for NO + )710.89. 1 H NMR (300MHz, CDCl3)δ:ppm 4.86(m,1H);4.05(t,2H);3.53(br.m,2H);2.83-2.36(br.m,5H);2.29(m,4H);0.96-1.71(m,64H);0.88(m,9H). T. Compound 19: Heptadecan-9-yl 8-((3-hydroxypropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

[0465] [ka]

[0466] Compound 19 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=4.51 min. MS(ES): C 45 H 89 m / z (MH) for NO + )725.19. 1 H NMR (300MHz, CDCl3)δ:ppm 4.86(p,1H);4.05(t,2H);3.80(m,2H);2.92-2.36(br.m,5H);2.29(m,4H);1.89-1.42(br.m,16H);1.42-1.02(br.m,50H);0.88(m,9H). U. Compound 20: Heptadecan-9-yl 8-((4-hydroxybutyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

[0467] [ka]

[0468] Compound 20 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.84 min. MS(ES): C46 H 91 m / z (MH) for NO + )739.21. 1 H NMR (300MHz, CDCl3)δ:ppm 4.86(p,1H);4.05(t,2H);3.77-3.45(br.m,2H);2.63-2.20(br.m,8H);1.82-1.40(br.m,18H);1.40-1.15(br.m,51H);0.88(m,9H). V. Compound 21: Heptadecan-9-yl 8-((2-cyanoethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

[0469] [ka]

[0470] Compound 21 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=4.04 min. MS(ES): C 45 H 86 m / z (MH) for N2O4 + )720.18. 1 H NMR (300MHz, CDCl3)δ:ppm 4.88(p,1H);4.07(t,2H);2.81(m,2H);2.44(m,5H);2.30(m,4H);1.73-1.18(br.m,63H);0.89(m,9H). W. Compound 22: Heptadecan-9-yl 8-((2-hydroxycyclohexyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

[0471] [ka]

[0472] Compound 22 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=4.54 min. MS(ES): C 48 H 93 m / z (MH) for NO+ )765.21. 1 H NMR (300MHz, CDCl3)δ:ppm 4.86(p,1H);4.05(t,2H);2.89-2.34(br.m,4H);2.28(m,4H);2.00(m,1H);1.86-0.99(br.m,72H);0.88(m,9H). X. Compound 23: Heptadecan-9-yl 10-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)decanoate

[0473] [ka]

[0474] Compound 23 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.75 min. MS(ES): C 46 H 91 m / z (MH) for NO + )739.13. 1 H NMR (300MHz, CDCl3)δ:ppm 4.86(m,1H);4.05(m,2H);3.72-3.46(br.m,2H);2.81-2.35(br.m,5H);2 .29(m,4H);1.71-1.40(br.m,13H);1.40-1.15(br.m,55H);0.88(m,9H). Y. Compound 24: Heptadecan-9-yl (Z)-8_((2-hydroxyethyl)(8-(non-2-en-1-yloxy)-8-oxooctyl)amino)octanoate

[0475] [ka]

[0476] Compound 24 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.54 min. MS(ES): C 44 H 85 m / z (MH) for NO +)708.95. 1 H NMR (300MHz, CDCl3)δ:ppm 5.74-5.44(br.m,2H);4.86(m,1H);4.62(m,2H);3.71-3.40(br.m,2H);2.81-2 .37(br.m,5H);2.29(m,4H);2.09(m,2H);1.70-1.14(br.m,58H);0.88(m,9H). Z. Compound 25: Heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate

[0477] [ka]

[0478] Compound 25 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.66 min. MS(ES): C 44 H 87 m / z (MH) for NO + )711.00. 1 H NMR (300MHz, CDCl3)δ:ppm 4.86(m,1H);4.05(t,2H);3.68-3.46(br.m,2H);2.77-2.37(br.m,5H);2.29(m,4H);1.74-1.41(br.m,14H);1.39-1.18(m,50H);0.88(m,9H). AA. Compound 26: Heptadecan-9-yl 8-((2-hydroxyethyl)(4-(nonyloxy)-4-oxobutyl)amino)octanoate

[0479] [ka]

[0480] Compound 26 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=4.29 min. MS(ES): C 40 H 79 m / z (MH) for NO+ )655.07. 1 H NMR (300MHz, CDCl3)δ:ppm 4.86(p,1H);4.06(t,2H);3.79(br.m,2H);2.91-2.20(br.m,10H);1.98-1.03(br.m,55H);0.88(m,9H). AB. Compound 27: Nonyl 8-((6-(heptadecan-9-yloxy)-6-oxohexyl)(2-hydroxyethyl)amino)octanoate

[0481] [ka]

[0482] Compound 27 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.57 min. MS(ES): C 42 H 83 m / z (MH) for NO + )683.12. 1 H NMR (300MHz, CDCl3)δ:ppm 4.86(m,1H);4.05(m,2H);3.70-3.45(br.m,2H);2.78-2.35(br.m,5H);2.29(m,4H);1.73-1.41(m,13H);1.41-1.16(m,47H);0.88(m,9H). AC. Compound 28: Heptadecan-9-yl 8-((8-((2-hexylcyclopropyl)methoxy)-8-oxooctyl)(2-hydroxyethyl)amino)octanoate

[0483] [ka]

[0484] Compound 28 was synthesized using intermediate C according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=5.17 min. MS(ES): C 45 H 87 m / z (MH) for NO + )722.97.1 H NMR (300MHz, CDCl3)δ:ppm 4.86(p,1H);4.17(m,1H);3.93(m,1H);3.61(br.m,2H);2.97-2.37(br.m,6H);2.35 -2.21(m,4H);1.74-0.97(br.m,60H);0.94-0.79(m,10H);0.74(m,1H);0.01(m,1H). AD. Compound 29: Di(heptadecan-9-yl) 8,8'-((2-hydroxyethyl)azanediyl) dioctanoate

[0485] [ka]

[0486] Compound 29 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.98 min. MS(ES): C 52 H 103 m / z (MH) for NO + )823.19. 1 H NMR (300MHz, CDCl3)δ:ppm 4.86(m,2H);3.72-3.44(br.m,2H);2.83-2.34(br.m,5H);2.28(m,4H);1.69-1.39(br.m,16H);1.39-1.16(br.m,62H);0.88(m,12H). AE. Compound 30: 7-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)heptyl 2-octyldecanoate

[0487] [ka]

[0488] Compound 30 was synthesized using intermediate B according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.55 min. MS(ES): C 44 H 87 m / z (MH) for NO +)711.16. 1 H NMR (300MHz, CDCl3)δ:ppm 4.06(m,4H);3.69-3.44(br.m,2H);2.71-2.39(br.m,5H);2.29(m,3H);1.70-1.16(br.m,64H);0.88(m,9H). AF. Compound 31: Heptadecan-9-yl (Z)-8-((2-hydroxyethyl)(octadec-9-en-1-yl)amino)octanoate

[0489] [ka]

[0490] Compound 31 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.83 min. MS(ES): C 45 H 89 m / z (MH) for NO + )693.20. 1 H NMR (300MHz, CDCl3)δ:ppm 5.37(m,2H);4.89(p,1H);3.58(br.m,2H);2.72-2.43(br.m,5H);2.30(m,2H), 2.05(m,4H);1.71-1.03(br.m,63H), 0.90(m,9H). AG. Compound 32: Nonyl 8-((2-hydroxyethyl)(8-oxo-8-(pentadecan-7-yloxy)octyl)amino)octanoate

[0491] [ka]

[0492] Compound 32 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.45 min. MS(ES): C 42 H 83 m / z (MH) for NO + )683.20. 1H NMR (300MHz, CDCl3)δ:ppm 4.89(p,1H);4.08(t,2H);3.60(br.m,2H);2.85-2.40(br.m,5H);2.31(m,4H), 1.78-1.01(m,59H), 0.90(m,9H). AH. Compound 33: Nonyl 8-((2-hydroxyethyl)(8-oxo-8-(tetradecan-6-yloxy)octyl)amino)octanoate

[0493] [ka]

[0494] Compound 33 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.39 min. MS(ES): C 41 H 81 m / z (MH) for NO + )669.09. 1 H NMR (300MHz, CDCl3)δ:ppm 4.89(p,1H);4.08(t,2H);3.84-3.54(br.m,2H);2.99-2.41(br.m,5H);2.31(m,4H), 1.76-1.02(br.m,57H), 0.90(m,9H). AI. Compound 34: Dodecan-4-yl 8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

[0495] [ka]

[0496] Compound 34 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.21 min. MS(ES): C 39 H 77 m / z (MH) for NO + )641.05. 1H NMR (300MHz, CDCl3)δ:ppm 4.91(p,1H);4.08(t,2H);3.67(br.m,2H);3.03-2.44(br.m,5H);2.30(m,4H), 1.75-1.00(br.m,53H), 0.90(m,9H). AJ. Compound 35: Nonyl 8-((2-hydroxyethyl)(8-oxo-8-(undecan-3-yloxy)octyl)amino)octanoate

[0497] [ka]

[0498] Compound 35 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.16 min. MS(ES): C 38 H 75 m / z (MH) for NO + )627.11. 1 H NMR (300MHz, CDCl3)δ:ppm 4.83(p,1H);4.08(t,2H);3.63(br.m,2H);2.81-2.39(br.m,5H);2.31(m,4H), 1.74-1.01(br.m,51H), 0.90(m,9H). AK. Compound 36: Decane-2-yl 8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

[0499] [ka]

[0500] Compound 36 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.05 min. MS(ES): C 37 H 73 m / z (MH) for NO + )613.00. 1H NMR (300MHz, CDCl3)δ:ppm 4.91(p,1H);4.08(t,2H);3.55(m,2H);2.60(m,2H);2.47(m,4H);2.29(m,4H), 1.731-1.01(m,51H), 0.90(m,6H). AL. Compound 47: Heptadecan-9-yl 8-((2-hydroxyethyl)(8-(2-octylcyclopropyl)octyl)amino)octanoate

[0501] [ka]

[0502] Compound 47 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.92 min. MS(ES): C 46 H 91 m / z (MH) for NO + )707.39. 1 H NMR (300MHz, CDCl3)δ:ppm 4.86 (p, 1H); 3.56 (br. m, 2 H); 2.72-2.38 (br. AM. Compound 48: Decane-2-yl 8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)octanoate

[0503] [ka]

[0504] Compound 48 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.60 min. MS(ES): C 45 H 89 m / z (MH) for NO + )725.10. 1H NMR (300MHz, CDCl3)δ:ppm 4.91(m,2H);3.59(br.m,2H);2.79-2.37(br.m,5H);2.29(m,4H);1.74-1.13(m,66H);0.90(m,9H). AN. Compound 49: Heptadecan-9-yl 8-((2-hydroxyethyl)(8-oxo-8-(undecan-3-yloxy)octyl)amino)octanoate

[0505] [ka]

[0506] Compound 49 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.68 min. MS(ES): C 46 H 91 m / z (MH) for NO + )739.21. 1 H NMR (300MHz, CDCl3)δ:ppm 4.89(m,2H);3.56(br.m,2H);2.68-2.39(br.m,5H);2.30(m,4H);1.71-1.19(m,66H);0.90(m,12H). AO. Compound 50: Dodecan-4-yl 8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)octanoate

[0507] [ka]

[0508] Compound 50 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.73 min. MS(ES): C 47 H 93 m / z (MH) for NO + )753.23. 1H NMR (300MHz, CDCl3)δ:ppm 4.89(m,2H);3.60(br.m,2H);2.75-2.43(br.m,5H);2.30(m,4H);1.71-1.44(m,16H);1.28(m,51H);0.90(m,12H). AP. Compound 51: Heptadecan-9-yl 8-((4-butoxy-4-oxobutyl)(2-hydroxyethyl)amino)octanoate

[0509] [ka]

[0510] Compound 51 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.05 min. MS(ES): C 35 H 69 m / z (MH) for NO + )584.87. 1 H NMR (300MHz, CDCl3)δ:ppm 4.89(p,1H);4.10(t,2H);3.61(br.m,2H);2.81-2.21(br.m,9H);1.87(br.m,2H), 1.70-1.04(m,43H), 0.98-0.82(m,9H). AQ. Compound 52: Heptadecan-9-yl 8-((2-hydroxyethyl)(4-oxo-4-(pentyloxy)butyl)amino)octanoate

[0511] [ka]

[0512] Compound 52 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.11 min. MS(ES): C 36 H 71 m / z (MH) for NO + )598.90. 1H NMR (300MHz, CDCl3)δ:ppm 4.89(p,1H);4.09(t,2H);3.61(br.m,2H);2.89-2.22(br.m,9H);1.87(br.m,2H), 1.73-1.43(m,11H), 1.28(m,34H);0.90(m,9H). AR. Compound 53: Heptadecan-9-yl 8-((4-(hexyloxy)-4-oxobutyl)(2-hydroxyethyl)amino)octanoate

[0513] [ka]

[0514] Compound 53 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.22 min. MS(ES): C 37 H 73 m / z (MH) for NO + )612.92. 1 H NMR (300MHz, CDCl3)δ:ppm 4.86(p,1H);4.06(t,2H);3.55(br.m,2H);2.68-2.38(br.m,5H);2.28(m,4H);1.79(br.m,2H);1.71-0.96(m,48H);0.88(m,9H). AS. Compound 54: Heptadecan-9-yl 8-((4-(heptyloxy)-4-oxobutyl)(2-hydroxyethyl)amino)octanoate

[0515] [ka]

[0516] Compound 54 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.28 min. MS(ES): C 38 H 75 m / z (MH) for NO + )626.94. 1H NMR (300MHz, CDCl3)δ:ppm 4.89(p,1H);4.09(t,2H);3.60(br.m,2H);2.77-2.42(br.m,5H);2.32(m,4H);1.84(br.m,2H);1.75-1.03(m,49H);0.90(m,9H). AT. Compound 55: Heptadecan-9-yl 8-((4-((2-hexylcyclopropyl)methoxy)-4-oxobutyl)(2-hydroxyethyl)amino)octanoate

[0517] [ka]

[0518] Compound 55 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.37 min. MS(ES): C 41 H 79 m / z (MH) for NO + )667.04. 1 H NMR (300MHz, CDCl3)δ:ppm 4.83(p,1H);4.15(m,1H);3.95(m,1H);3.53(br.m,2H);2.66-2.39(br.m,5H);2.34-2. 19(m,4H);1.78(br.m,2H);1.66-0.98(m,50H);0.85(m,10H);0.70(m,1H);0.00(m,1H). AU. Compound 56: Nonyl 8-((2-hydroxyethyl)(8-oxo-8-(tridecan-7-yloxy)octyl)amino)octanoate

[0519] [ka]

[0520] Compound 56 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.28 min. MS(ES): C 40 H 79 m / z (MH) for NO +)654.99. 1 H NMR (300MHz, CDCl3)δ:ppm 4.89(p,1H);4.08(t,2H);3.60(br.m,2H);2.77-2.40(br.m,5H);2.30(m,4H);1.78-0.99(m,55H);0.90(m,9H). AV. Compound 57: Nonan-5-yl 8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

[0521] [ka]

[0522] Compound 57 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=2.88 min. MS(ES): C 36 H 71 m / z (MH) for NO + )598.98. 1 H NMR (300MHz, CDCl3)δ:ppm 4.89(p,1H);4.08(t,2H);3.59(br.m,2H);2.82-2.37(br.m,5H);2.31(m,4H);1.73-1.03(m,47H);0.91(m,9H). AW. Compound 58: Heptan-4-yl 8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

[0523] [ka]

[0524] Compound 58 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=2.67 min. MS(ES): C 34 H 67 m / z (MH) for NO + )570.93. 1H NMR (300MHz, CDCl3)δ:ppm 4.93(p,1H);4.08(t,2H);3.57(br.m,2H);2.69-2.42(br.m,5H);2.30(m,4H);1.72-1.04(m,43H);0.93(m,9H). AX. Compound 59: Nonyl 8-((2-hydroxyethyl)(8-oxo-8-(pentan-3-yloxy)octyl)amino)octanoate

[0525] [ka]

[0526] Compound 59 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=2.39 min. MS(ES): C 32 H 63 m / z (MH) for NO + )542.80. 1 H NMR (300MHz, CDCl3)δ:ppm 4.78(p,1H);4.08(t,2H);3.57(br.m,2H);2.71-2.39(br.m,5H);2.31(m,4H);1.77-1.05(m,39H);0.90(m,9H). AY. Compound 60: (5Z,12Z)-Hexadeca-5,12-dien-9-yl 8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (5Z,12Z)-Hexadeca-5,12-dien-9-ol

[0527] [ka]

[0528] To a solution of (Z)-1-bromooct-3-ene (6.2 g, 32.4 mmol) in THF (45 mL) was added Mg turnings (0.843 g, 34.7 mmol). The reaction was heated to 45° C. for 3 h. The reaction was cooled to 0° C. and ethyl formate (2.4 g, 32.4 mmol) in THF (5 mL) was added dropwise. The reaction was allowed to warm to room temperature and stirred for 30 min. The reaction was cooled to 0° C. and quenched with water (15 mL) and 6 N HCl (15 mL). The reaction was stirred until all the Mg was dissolved. Water (25 mL) was added and the mixture was extracted with hexane (3×25 mL). The combined organic layers were washed with brine, separated, dried over Na2SO4, filtered, and evaporated under reduced pressure. The residue was dissolved in EtOH (20 mL), and a solution of KOH in water (1.76 g in 8 mL of water) was added and stirred for 15 min. The EtOH was evaporated under reduced pressure. The residue was diluted with water (20 mL), acidified with 6 N HCl (20 mL), and extracted with hexane (3 times). The combined organic layers were washed with brine, separated, dried over Na2SO4, filtered, and evaporated under reduced pressure. The residue was purified by silica gel chromatography using 0-5% EtOAc in hexane to give (5Z,12Z)-heptadeca-5,12-dien-9-ol (2.3 g, 9.1 mmol, 28%). 1 H NMR (300MHz, CDCl3)δ:ppm 5,41(m,4);3.66(m,1H);2.13(m,8H);1.51(m,5H);1.36(m,8H);0.92(m,6H). (5Z,12Z)-Hexadeca-5,12-dien-9-yl 8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

[0529] [ka]

[0530] Compound 60 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.36 min. MS(ES): C 44 H 83m / z (MH) for NO + )707.10. 1 H NMR (300MHz, CDCl3)δ:ppm 5.37(m,4H);4.92(p,1H);4.08(t,2H);3.57(br.m,2H);2.73-2.38(br.m,5H);2.31(m,4H);2.04(m,8H);1.73-1.01(m,47H);0.92(m,9H). AZ. Compound 61: (5Z,12Z)-heptadeca-5,12-dien-9-yl 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate

[0531] [ka]

[0532] Compound 61 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.39 min. MS(ES): C 44 H 83 m / z (MH) for NO + )707.10. 1 H NMR (300MHz, CDCl3)δ:ppm 5.37(m,4H);4.92(p,1H);4.08(t,2H);3.58(br.m,2H);2.70-2.41(br.m,5H);2.32(m,4H);2.04(m,8H);1.77-1.03(m,47H);0.92(m,9H). X1. Compound 65: 1-cyclopropylnonyl 8-((8-(heptadecan-9-yloxy)-8-oxooctyl)(2-hydroxyethyl)amino)octanoate

[0533] [ka]

[0534] Compound 65 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.72 min. MS(ES): C 47H 91 m / z (MH) for NO + )750.9. 1 H NMR (300MHz, CDCl3)δ:ppm 4.89(m,1H);4.28(m,1H);3.54(m,2H);2.59(m,2H);2.46(m,4H);2.29(m ,4H), 1.73-1.18(m,61H);0.90(m,10H);0.62-0.33(m,3H);0.28(m,1H). X2. Compound 66: Heptadecan-9-yl 8-((2-hydroxyethyl)(8-oxo-8-((4-pentylcyclohexyl)oxy)octyl)amino)octanoate

[0535] [ka]

[0536] Compound 66 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.72 min. MS(ES): C 46 H 89 m / z (MH) for NO + )736.9. 1 H NMR (300MHz, CDCl3)δ:ppm 5.00(m,0.5H);4.89(m,1H);4.68(m,0.6H);3.56(m,2H), 2.61(br.m,2H);2.48(m,4H) ;2.30(m,4H);1.98(m,1H);1.82(m,2H);1.73-1.14(m,61H);1.04(m,1H);0.90(m,9H). X3. Compound 67: Heptadecan-9-yl 8-((2-hydroxyethyl)(4-oxo-4-((4-pentylcyclohexyl)oxy)butyl)amino)octanoate

[0537] [ka]

[0538] Compound 67 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.56 min. MS(ES): C 42 H 81 m / z (MH) for NO + )680.8. 1 H NMR (300MHz, CDCl3)δ:ppm 5.01(m,0.4H);4.89(m,1H);4.68(m,0.6H);3.59(m,2H), 2.72-2.43(br.m,6H);2.30(m,4 H);1.98(m,1H);1.83(m,4H);1.69-1.44(m,10H);1.28(m,41H);1.03(m,1H);0.90(m,9H). X4. Compound 68: Heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-((4-pentylcyclohexyl)oxy)hexyl)amino)octanoate

[0539] [ka]

[0540] Compound 68 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.66 min. MS(ES): C 44 H 85 m / z (MH) for NO + )708.9. 1 H NMR (300MHz, CDCl3)δ:ppm 5.00(m,0.5H);4.89(m,1H);4.68(m,0.6H);3.55(m,2H), 2.66-2.39(br.m,6H);2.30(m,4H); 1.97(m,1H);1.83(m,2H);1.73-1.41(m,15H);1.41-1.17(m,42H);1.04(m,1H);0.90(m,9H). XX1. Compound 69: Heptadecan-9-yl 8-((2,3-dihydroxypropyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

[0541] [ka]

[0542] Compound 69 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.60 min. MS(ES): C 45 H 89 m / z (MH) for NO + )741.0. 1 H NMR (300MHz, CDCl3)δ:ppm 4.89(p,1H);4.08(t,2H);3.76(br.m,2H);3.51(m,1H);2.57(m,6H);2.31(m,4H);1.71-1.41(m,14H);1.41-1.12(m,48H);0.90(m,9H). XX2. Compound 70: Heptadecan-9-yl 8-((4-(decane-2-yloxy)-4-oxobutyl)(2-hydroxyethyl)amino)octanoate

[0543] [ka]

[0544] Compound 70 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.44 min. MS(ES): C 41 H 81 m / z (MH) for NO + )668.9. 1 H NMR (300MHz, CDCl3)δ:ppm 4.91(m,2H);3.57(m,2H);2.71-2.40(m,5H);2.30(m,4H), 1.80(m,2H);1.71-1.40(m,11H);1.39-1.05(m,45H);0.90(m,9H). X5. Compound 71: Heptadecan-9-yl 8-((2-hydroxyethyl)(4-oxo-4-(tetradecan-6-yloxy)butyl)amino)octanoate

[0545] [ka]

[0546] Compound 71 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.72 min. MS(ES): C 45 H 89 m / z (MH) for NO + )724.9. 1 H NMR (300MHz, CDCl3)δ:ppm 4.89(m,2H);3.56(m,2H);2.70-2.41(m,6H);2.33(m,4H), 1.80(m,2H);1.69-1.41(m,13H);1.28(m,48H);0.90(m,12H). XX3. Compound 72: Heptadecan-9-yl 8-((2-hydroxyethyl)(4-oxo-4-(undecan-3-yloxy)butyl)amino)octanoate

[0547] [ka]

[0548] Compound 72 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.57 min. MS(ES): C 42 H 83 m / z (MH) for NO + )683.0. 1 H NMR (300MHz, CDCl3)δ:ppm 4.86 (m, 2H); 3.58 (br. m, 2 H); 2.75-2.41 (br. X6. Compound 73: Heptadecan-9-yl 8-((2-hydroxyethyl)(4-oxo-4-(pentadecan-7-yloxy)butyl)amino)octanoate

[0549] [ka]

[0550] Compound 73 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.80 min. MS(ES): C 46 H 91 m / z (MH) for NO + )739.09. 1 H NMR (300MHz, CDCl3)δ:ppm 4.89 (m, 2H); 3.59 (br. m, 2 H); 2.81-2.43 (br. X7. Compound 74: Heptadecan-9-yl 8-((4-(dodecan-4-yloxy)-4-oxobutyl)(2-hydroxyethyl)amino)octanoate

[0551] [ka]

[0552] Compound 74 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.68 min. MS(ES): C 43 H 85 m / z (MH) for NO + )696.9. 1 H NMR (300MHz, CDCl3)δ:ppm 4.89(m,2H);3.56(m,2H);2.70-2.41(m,6H);2.30(m,4H), 1.80(m,2H);1.70-1.40(m,12H);1.28(m,44H);0.90(m,12H). XX4. Compound 75: Heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-(undecan-3-yloxy)hexyl)amino)octanoate

[0553] [ka]

[0554] Compound 75 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.67 min. MS(ES): C 44 H 87 m / z (MH) for NO + )711.1. 1 H NMR (300MHz, CDCl3)δ:ppm 4.86(m,2H);3.57(m,2H);2.72-2.40(br.m,5H);2.30(m,4H);1.70-1.42(m,16H);1.28(m,45H);0.90(m,12H). XX5. Compound 79: Nonyl 8-((2-hydroxyethyl)(8-oxo-8-((4-pentylcyclohexyl)oxy)octyl)amino)octanoate

[0555] [ka]

[0556] Compound 79 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.10 min. MS(ES): C 38 H 73 m / z (MH) for NO + )624.8. 1 H NMR (300MHz, CDCl3)δ:ppm 5.00(br.m,0.5H);4.68(m,0.5H);4.08(t,2H);3.56(m,2H);2.72-2.38(m,6 H);2.31(m,4H), 1.97(m,1H);1.82(m,2H);1.73-0.95(m,48H), 0.90(m,6H). XX6. Compound 80: [1,1'-bi(cyclohexane)]-4-yl 8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

[0557] [ka]

[0558] Compound 80 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.10 min. MS(ES): C 39 H 73 m / z (MH) for NO + )636.9. 1 H NMR (300MHz, CDCl3)δ:ppm 5.01(br.m,0.5H);4.65(m,0.5H);4.08(t,2H);3.56(m,2H);2.69-2.36(m,6H);2.31(m,4H);2.07-0.84(m,57H). XX7. Compound 81: Cyclopentadecyl 8-((2-hydroxyethyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate

[0559] [ka]

[0560] Compound 81 was synthesized according to the general procedure and representative procedure 1 described above. UPLC / ELSD: RT=3.36 min. MS(ES): C 42 H 81 m / z (MH) for NO + )681.0. 1 H NMR (300MHz, CDCl3)δ:ppm 4.91(p,1H);4.08(t,2H);3.57(br.m,2H);2.74-2.39(m,6H);2.30(m,4H), 1.73-1.03(m,62H), 0.90(m,3H). XX8. Compound 94: Heptadecan-9-yl)8-(benzyl(8-nonyloxy)-8-oxooctyl)amino)octanoate Heptadecan-9-yl 8-(benzylamino)octanoate

[0561] [ka]

[0562] A solution of heptadecan-9-yl 8-bromooctanoate (250 mg, 0.542 mmol) in phenylmethanamine (1.2 mL, 10.83 mmol) was stirred at room temperature for 6 hours. The reaction was cooled to room temperature, and the solvent was evaporated under reduced pressure. The residue was taken up in ethyl acetate and washed with saturated aqueous sodium bicarbonate. The organic layer was separated, washed with brine, dried over Na2SO4, and evaporated under reduced pressure. The residue was purified by silica gel chromatography (20-100% in dichloromethane (mixture of 1% NH4OH, 20% MeOH in dichloromethane)) to give heptadecan-9-yl 8-(benzylamino)octanoate (200 mg, 0.41 mmol, 76%). UPLC / ELSD: RT = 2.87 min. MS (ES): C 32 H 57 m / z (MH) for NO + )488.4. 1 H NMR (300MHz, CDCl3)δ:ppm 7.35-7.25(br.m,5H);4.89(p,1H);3.81(s,2H);2.65(t,2H);2.29(t,2H);1.65-1.51(br.m,8H);1.28(m,30H);0.90(m,6H). Heptadecan-9-yl 8-(benzyl(8-(nonyloxy)-8-oxooctyl)amino)octanoate

[0563] [ka]

[0564] A solution of heptadecan-9-yl 8-(benzylamino)octanoate (200 mg, 0.41 mmol), nonyl 8-bromooctanoate (172 mg, 0.49 mmol), and N,N-diisopropylethylamine (100 μL, 0.57 mmol) was dissolved in ethanol and stirred at 62 °C for 48 h. The reaction was cooled to room temperature, and the solvent was evaporated under reduced pressure. The residue was taken up in ethyl acetate and washed with saturated aqueous sodium bicarbonate. The organic layer was separated, washed with brine, dried over NaSO, and evaporated under reduced pressure. The residue was purified by silica gel chromatography (0-100% dichloromethane (mixture of 1% NH4OH, 20% MeOH in dichloromethane)) to give heptadecan-9-yl 8-(benzyl(8-(nonyloxy)-8-oxooctyl)amino)octanoate (138 mg, 0.18 mmol, 45%). UPLC / ELSD: RT=3.78 min. MS(ES): C 49 H 89 m / z (MH) for NO + )757.0. 1 H NMR (300MH...

Claims

【Request 1】 【Chemical 1-1】 【Chemistry 1-2】 【Chemistry 1-3】 or a salt thereof. 【Request 2】 【Chemistry 2-1】 【Chemistry 2-2】 【Chemistry 2-3】 【Chemistry 2-4】 【Chemistry 2-5】 【Chemistry 2-6】 or a salt thereof. 【Request 3】 【Chemistry 3-1】 【Chemistry 3-2】 【Chemistry 3-3】 【Chemistry 3-4】 【Chemistry 3-5】 or a salt thereof.

4. A nanoparticle composition comprising a lipid component containing a compound according to any one of claims 1 to 3.

5. The nanoparticle composition of claim 4, wherein the lipid component further comprises a phospholipid.

6. The phospholipid is 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-diundecanoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-diureto ... 1-Oleyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sphingomyelin, and mixtures thereof.

7. The nanoparticle composition of claim 6, wherein the phospholipid is DSPC or DOPE.

8. The nanoparticle composition of claim 4, wherein the lipid component further comprises a structured lipid.

9. The nanoparticle composition of claim 8, wherein the structured lipid is selected from the group consisting of cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, α-tocopherol, and mixtures thereof.

10. The nanoparticle composition of claim 9, wherein the structured lipid is cholesterol.

11. The nanoparticle composition of any one of claims 4 to 10, wherein the lipid component further comprises a PEG lipid.

12. The nanoparticle composition of claim 11, wherein the PEG lipid is selected from the group consisting of PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof.

13. The nanoparticle composition of any one of claims 4 to 12, wherein the lipid component further comprises a cationic / ionic lipid.

14. The cationic / ionic lipid is selected from the group consisting of 3-(didodecylamino)-N1,N1,4-tridodecyl-1-piperazineethanamine (KL10), N1-[2-(didodecylamino)ethyl]-N1,N4,N4-tridodecyl-1,4-piperazinediethanamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-octatriacontane (KL25), 1,2-dilinoleyloxy-N,N-dimethylamine protease (KL26), and 1,2-diamino-N,N-dimethylamine protease (KL27). lopane (DLin-DMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-dioleyloxy-N,N- Dimethylaminepropane (DODMA), 2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA), (2R)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine 14. The nanoparticle composition of claim 13, wherein the nanoparticle is selected from the group consisting of (2S)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA(2S)).

15. A nanoparticle composition described in any one of claims 4 to 14, wherein the lipid component comprises 30 mol% to 60 mol% of the compound, 0 mol% to 30 mol% of phospholipid, 18.5 mol% to 48.5 mol% of structural lipid, and 0 mol% to 10 mol% of PEG lipid.

16. The nanoparticle composition described in claim 15, wherein the lipid component comprises 50 mol% of the compound, 10 mol% phospholipid, 38.5 mol% structural lipid, and 1.5 mol% PEG lipid.

17. The nanoparticle composition of any one of claims 4 to 16, further comprising a therapeutic and / or prophylactic agent.

18. The nanoparticle composition of claim 17, wherein the therapeutic and / or prophylactic agent is a nucleic acid.

19. The nanoparticle composition of claim 18, wherein the therapeutic and / or prophylactic agent is ribonucleic acid (RNA).

20. The nanoparticle composition of claim 19, wherein the RNA is selected from the group consisting of small interfering RNA (siRNA), asymmetric interfering RNA (aiRNA), microRNA (miRNA), dicer substrate RNA (dsRNA), small hairpin RNA (shRNA), messenger RNA (mRNA), and mixtures thereof.

21. The nanoparticle composition described in claim 20, wherein the RNA is mRNA.

22. The nanoparticle composition of claim 21, wherein the mRNA comprises one or more of a stem loop, a chain terminating nucleoside, a polyA sequence, a polyadenylation signal, and / or a 5' cap structure.

23. A nanoparticle composition described in any one of claims 17 to 22, wherein the encapsulation efficiency of the therapeutic and / or prophylactic agent is at least 80%, or at least 90%.

24. The nanoparticle composition of any one of claims 17 to 23, wherein the wt / wt ratio of the lipid component to the therapeutic and / or prophylactic drug is from 10:1 to 60:

1.

25. The nanoparticle composition of any one of claims 17 to 24, wherein the wt / wt ratio of the lipid component to the therapeutic and / or prophylactic drug is 20:

1.

26. A pharmaceutical composition comprising the nanoparticle composition of any one of claims 17 to 25 and a pharma- ceutically acceptable carrier.

27. A nanoparticle composition according to any one of claims 17 to 25 or a pharmaceutical composition according to claim 26 for use in delivery of a therapeutic and / or prophylactic agent to a mammalian cell, comprising: A nanoparticle composition or pharmaceutical composition, wherein the composition is administered to a subject, and the therapeutic and / or prophylactic agent is delivered to the cells by contacting the cells with the nanoparticle composition upon administration.

28. A nanoparticle composition according to any one of claims 17 to 25 or a pharmaceutical composition according to claim 26 for use in producing a polypeptide of interest in a mammalian cell, comprising: A nanoparticle composition or pharmaceutical composition, wherein the composition contacts the cell, and the therapeutic and / or prophylactic agent is an mRNA, the mRNA encoding the desired polypeptide, such that the mRNA can be translated in the cell to produce the desired polypeptide.

Images