Selective gene therapy expression system

Abstract

To provide embodiments based on identification by the inventors that, after systemic administration, an expression system intended for production of a protein in a target tissue, preferably skeletal muscles, can simultaneously lead to expression in other tissues and organs potentially toxic, rendering the expression system unsuitable for therapeutic use.SOLUTION: The present invention relates to an expression system for systemic administration comprising a sequence encoding a protein, the expression system allowing: expression at a therapeutically acceptable level of the protein in target tissues including the skeletal muscles and / or the peripheral nervous tissue; and expression at toxically acceptable level of the protein in tissues other than the target tissues, especially in the heart.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to gene therapy, and in particular to the treatment of diseases affecting skeletal muscle, such as myotubular myopathy, caused by mutations in the MTM1 gene.

[0002] In the context of the present invention, the invention proposes an expression system comprising a transgene encoding a protein, ensuring the production of a therapeutically effective amount of the protein in target tissues, preferably skeletal muscle, and a toxicologically acceptable amount of the protein in non-target tissues, in particular the heart. [Background technology]

[0003] X-linked myotubular myopathy (i.e., XLMTM, OMIN 310400) is the most severe and common form of a group of diseases called centronuclear myopathies. Patients are affected already during foetal life, with myopathy that presents as reduced mobility during gestation and non-progressive at birth [1, 2, 3]. Patients have generalized muscle weakness and hypotonia, leading to respiratory failure and many dying within the first few years of life despite intensive medical care. More atypically, less severe forms of myotubular myopathy also exist in male and female subjects, with milder symptoms during childhood and worsening during the first or second decade of life [4].

[0004] Skeletal muscles of affected subjects contain thin fibers with an altered distribution of organelles, such as nuclei and mitochondria, which are typically located in the center of the fiber or, in less severe cases, are arranged in a collar-like configuration in the subsarcolemmal region [4, 5].

[0005] The disease is caused by inactivating mutations in the ubiquitously expressed MTM1 gene, which encodes a phosphoinositide phosphatase called myotubularin [6].

[0006] Animal models of the disease currently exist in zebrafish, mice, and dogs [7, 8, 9, 10]. Studies in these models have shown that in skeletal muscle, myotubularin plays a role in diverse mechanisms, including organization of T-tubules and intermediate filaments, excitation-contraction coupling, neuromuscular junction communication, and satellite cell survival and proliferation [11, 12, 13, 14].

[0007] Vector-based gene replacement therapy represents a potential therapeutic approach for myotubular myopathies. Thus, a single intramuscular injection of a recombinant adeno-associated viral vector (AAV) into mice with a muscle-specific symptomatic defect of myotubularin (mKO) was shown to ameliorate pathology and function of the targeted muscle as a proof of concept

[15] .

[0008] The question of how to treat muscle disorders remains important.Gene transfer, particularly by vectors derived from adeno-associated viruses, which have been found to be particularly suitable tools for muscle transfection, is a particularly promising approach.Gene transfer involves administering an intact copy of a gene to a patient to produce a functional protein that compensates for the mutated and inactive protein produced by the subject.

[0009] In the case of muscle diseases, administration can be by local injection of the transgene-carrying vector into the muscle, however systemic administration is clinically preferred, meaning that the transgene can be found in various tissues of the body.

[0010] Typically, a transgene is placed under the control of a regulatory sequence that controls its expression, particularly with respect to the level of expression or tissue specificity of expression. Thus, in the case of gene therapy for muscle diseases, a promoter that controls expression more specifically in muscle may be preferred. For example, a synthetic promoter C5-12 has been developed that is well known to those skilled in the art and is proposed to promote gene expression in muscle.

[0011] However, there is a clear need to develop new tools for gene therapy to treat neuromuscular diseases that lead to the production of effective amounts of protein in target tissues to compensate for the lack of activity of the mutated protein, and that are otherwise safe for the treated patient. [Prior art documents] [Patent documents]

[0012] [Patent Document 1] WO 2007 / 000668 [Non-patent literature]

[0013] [Non-Patent Document 1] Mendell et al., Annals of Neurology, Vol. 68, No. 5, pp. 629-638, 2010 [Non-Patent Document 2] Wang et al., Gene Therapy, Vol. 15, No. 22, pp. 1489-1499, 2008 [Non-Patent Document 3] Petrov et al., Methods Mol Biol, 2011, 709, 277-86 [Non-Patent Document 4] Gonin et al., J Gene Med, 2005, 7, 782-791 [Non-Patent Document 5] Laure et al., Febs J., 2010, vol. 277, pp. 4322-4337 [Non-Patent Document 6] Bartoli et al., Molecular Therapy, 2006, Vol. 13, No. 2, pp. 250-259 Summary of the Invention [Problem to be solved by the invention]

[0014] The present invention is based on the recognition by the inventors that expression systems intended for the production of proteins in target tissues, preferably skeletal muscle, after systemic administration can simultaneously cause expression in other tissues and organs that are potentially toxic, making said expression systems unsuitable for therapeutic use. [Means for solving the problem]

[0015] The present invention finds a technical solution to this newly identified problem, specifically relating to cardiac leakage associated with skeletal muscle-specific expression of a transgene.

[0016] More broadly, the present invention relates to a method for producing a medicament for a given expression system, comprising: - determining whether the expression system exhibits toxicity; - determining the tissues in which the expression system exhibits toxicity; - To provide a means to reduce the toxicity of the expression system to an acceptable level. This is accompanied by:

[0017] Thus, the proteins referred to in the present invention are proteins which, when expressed from a given expression system, display toxicity in at least one tissue, particularly in non-target tissues.

[0018] It is advantageous to administer the expression system systemically to the body, particularly in animals, and more preferably in humans.

[0019] The toxicity analysis is preferably carried out in an organism with a defective copy of the protein-encoding sequence, i.e. in an organism with the condition being treated, such as a "knock-out" (KO) animal model. Indeed, in the context of the present invention, when cardiotoxicity was observed in an expression system encoding myotubularin or calpain 3, it was only detected in KO mice in the case of myotubularin. In other words, this toxicity would not be evident if the toxicity analysis was carried out according to routine procedures in healthy animals.

[0020] Thus, in general, the present invention provides an expression system comprising a protein-encoding sequence, - expression of a therapeutically acceptable level of the protein in the target tissue; and - Expression of the protein in tissues other than the target tissue, i.e. in non-target tissues, at levels acceptable for toxicity. The present invention relates to an expression system which enables

[0021] According to the present invention, the target tissue is preferably defined as the tissue or organ in which the protein plays a therapeutic role, especially when the native gene encoding this protein is defective. According to a particular embodiment of the present invention, the target tissue is striated skeletal muscle, hereafter referred to as skeletal muscle, i.e. all muscles involved in motor performance, including the diaphragm. These muscles are particularly affected in diseases called myopathies. Another potential target tissue is the peripheral nerve tissue, which may also be affected in neuromuscular diseases. Thus, it is advantageous for the target tissue to include skeletal muscle and / or peripheral nerve tissue.

[0022] According to the present invention, non-target tissues are preferably defined as tissues or organs in which the protein does not play a therapeutic role, and optionally tissues or organs in which the presence of the protein in excess of endogenous amounts may prove harmful or even lethal and thus toxic.

[0023] In the context of the present invention, the tissue to be protected from this potential toxicity is preferably - heart or cardiac striated muscle, - liver, - brain, - lungs, - Kidneys, and / or - Smooth muscles, especially in the digestive tract It is.

[0024] These are important organs or tissues in which gene expression systems tend to accumulate.

[0025] In the context of the present invention, myocardium is considered to be a tissue of particular interest, as demonstrated at least for myotubularin and calpain 3. According to a particular embodiment, the expression system allows for toxicologically acceptable levels of protein expression in the heart.

[0026] Thus, according to a particular aspect, the present invention relates to an expression system comprising a sequence encoding a protein, - expression of therapeutically acceptable levels of the protein in target tissues, including skeletal muscle and / or peripheral nerve tissue; and - Expression of the protein in non-target tissues, particularly in the heart, at levels that are acceptable for toxicity The present invention relates to an expression system which enables

[0027] According to a first feature, the expression system of the invention comprises a protein-coding sequence, which corresponds to a transgene. In the context of the present invention, the term "transgene" means a sequence, preferably an open reading frame, that is provided in trans by means of the expression system of the invention.

[0028] According to a particular embodiment, this sequence is an identical or equivalent copy of an endogenous sequence present in the genome of the body into which the expression system is introduced. According to another particular embodiment, the endogenous sequence has one or more mutations that render the protein partially or completely non-functional or even absent (lack of expression or activity of the endogenous protein), especially in the target tissue, i.e. skeletal muscle. In other words, the expression system of the invention is preferably intended to be administered to a subject that carries a copy of a defective sequence that codes for a protein and has an associated pathogenicity. In this context, the protein encoded by the sequence delivered by the expression system of the invention can therefore be defined as the protein whose mutation causes a neuromuscular disorder.

[0029] According to another embodiment, this involves a sequence encoding a protein capable of "compensating" for the insufficiency of a defective protein (with respect to protein expression or activity) in a subject to which the expression system of the invention is administered. Thus, by way of example in the context of a neuromuscular pathology: - utrophin may be substituted for the mutated, defective dystrophin, - Decorin, fibromodulin and lumican help to compensate for the muscle wasting observed in neuromuscular diseases; - Activin also helps build muscle mass in diseases that are not caused by mutations in the protein.

[0030] Thus, more generally, the sequences delivered by the expression systems of the invention can be defined as encoding proteins having therapeutic activity in the context of neuromuscular diseases. The notion of therapeutic activity is defined below in relation to the term "therapeutically acceptable levels".

[0031] The sequence coding for a protein is a nucleic acid sequence, which may in particular be DNA (deoxyribonucleic acid), RNA (ribonucleic acid) or cDNA (complementary deoxyribonucleic acid).

[0032] It is advantageous that said sequence codes for a functional protein, i.e. a protein capable of ensuring its native or essential function, in particular in skeletal muscle. For each protein of interest, it is possible to define the desired activity and the sequences necessary to obtain this activity.

[0033] According to a preferred embodiment, said sequence codes for a natural protein, said protein being preferably of human origin. It may also be a derivative or fragment of this protein, provided that the derivative or fragment retains the desired activity. Preferably, the term "derivative" or "fragment" refers to a protein sequence having at least 60%, preferably 70%, even more preferably 80%, or even 90%, 95% or 99% identity with the human sequence of the protein in question. For example, proteins of other origin (such as non-human mammals) or that have been truncated or further mutated, but are still active, are designated. Thus, in the context of the present invention, the term "protein" is understood to mean a full-length protein, regardless of its origin, as well as functional derivatives and fragments thereof.

[0034] In the context of the present invention, proteins are included that allow for the therapeutic treatment of neuromuscular diseases that may affect skeletal muscle and / or peripheral nerve tissue. More particular mention is made of proteins that allow for the therapeutic treatment of diseases that affect skeletal muscle, commonly referred to as "myopathy".

[0035] In a particular embodiment, these diseases are caused by a mutation in at least one gene that causes the non-production of a protein or the production of a completely or partially non-functional protein. According to the present invention, the expression system helps to produce this protein in an active form and in an amount that at least partially compensates for the absence of the natural protein, or another protein that can compensate for the absence of the natural protein. The administration of the expression system thus allows the improvement or restoration of the normal phenotype in the target tissue, especially in skeletal muscle, in terms of mobility and respiration.

[0036] In particular, in the context of the present invention, the beneficial protein is myotubularin of human origin (SEQ ID NO: 1), mouse (SEQ ID NO: 2) or dog (SEQ ID NO: 3). Any sequence encoding these proteins, functional therapeutic derivatives or fragments thereof can be implemented as part of the expression system of the present invention. Thus, by way of example, the corresponding nucleotide sequences (cDNA) are the sequences of SEQ ID NO: 4, 5 (or 14) and 6, respectively.

[0037] Mutations in the MTM1 gene, in a known manner, result in a muscle disease called myotubular myopathy (MTM or XLMTM), and thus providing in trans a sequence encoding a therapeutic myotubularin, for example a natural one, according to a strategy for gene replacement or transfer, helps to treat this condition.

[0038] In another embodiment, the protein of interest is calpain 3 (CAPN3), mutations of which cause a recessive autosomal inherited disease, in particular called Limb Girdle Dystrophy Type 2A (LGMD 2A or calpainopathy, OMIN 253600). For example, human calpain 3 has the sequence SEQ ID NO: 7. Thus, as described above, any sequence encoding a therapeutic calpain 3, such as the sequence SEQ ID NO: 7, or a derivative or fragment thereof, may be present in the expression system of the invention. For example, it may be the cDNA sequence shown in SEQ ID NO: 8, or nucleotides 307 to 2772 corresponding to its open reading frame.

[0039] A non-exhaustive list of proteins involved in diseases affecting skeletal muscle and referred to in the present invention is given below: sarcoglycans (α, β, γ, δ), dystrophin, dysferlin (DYSF), selenium-containing protein 1 (SEPN1), amphiphysin 2 (BIN1), dynamin 2 (DNM2), cofilin 2 (CFL2), troponin T (TNNT1), tropomyosin 3 (TPM3), ACTA1, contactin 1 (CNTN1), TRIM32, rapsyn (RASPN), DOK7, agrin (AGRN), COLQ, CHAT, acetylcholine receptor (CHRNE, CHRNA1, CHRNB1, CHRND), GFPT1, MUSK.

[0040] According to a particular embodiment, the sequence contained in the expression system of the invention does not code for a protein of the sarcoglycan family, in particular α-sarcoglycan, or more particularly a sequence as described in Mendell et al. (Annals of Neurology, Vol. 68, No. 5, pp. 629-638, 2010).

[0041] In another particular embodiment, the sequence contained in the expression system of the present invention does not encode a dystrophin-like protein, including mini-dystrophin, in particular as described in Wang et al. (Gene Therapy, Vol. 15, No. 22, pp. 1489-1499, 2008).

[0042] More generally, the present invention refers to any protein having therapeutic activity in a neuromuscular disease, the mutation of which causes disease in one or more target tissues, for example if its production from an expression system manifests toxicity in at least one tissue, preferably a non-target tissue, in particular the heart, more comprehensively at least one tissue from the group of the heart, liver, brain, lung, kidney and smooth muscle.

[0043] According to the invention, advantageously, the expression system must allow for therapeutically acceptable levels of protein expression in target tissues, preferably skeletal muscle and / or peripheral nerve tissue, and, according to another preferred embodiment, for toxicologically acceptable levels of protein expression in non-target tissues, in particular the heart.

[0044] In the context of the present invention, the term "protein expression" may be understood as "protein production". The expression system must therefore allow both the transcription and translation of the protein at the levels defined above.

[0045] The levels defined in the context of the present invention, ie "therapeutically acceptable" and "toxicologically acceptable", relate to the amount of a protein and to the activity of the protein.

[0046] The assessment of the amount of protein produced in a given tissue can be carried out by immunodetection using antibodies against said protein, for example by Western blot or ELISA. Alternatively, the corresponding messenger RNA can be quantified, for example by PCR or RT-PCR. This quantification can be carried out for one sample of tissue or for several samples. Thus, if the target tissue is skeletal muscle, this can be done for a type of muscle, or for several types of muscle (for example quadriceps, diaphragm, tibialis anterior, triceps, etc.).

[0047] In the context of the present invention, the term "therapeutically acceptable levels" refers to the fact that the protein produced from the expression system of the present invention helps to improve the pathological condition of the patient, especially in terms of longevity and quality of life. Thus, in the context of diseases affecting skeletal muscles, it entails that the protein improves the muscle condition of the diseased subject or restores a muscle phenotype similar to that of a healthy subject. As mentioned above, the muscle condition, preferably defined by muscle strength, size, histology and function, can be evaluated by one of the following methods: biopsy, strength measurements, muscle tone, volume or muscle mobility, clinical examination, medical imaging, biomarkers, etc.

[0048] Thus, diagnostic criteria that help evaluate the therapeutic benefit with respect to skeletal muscle and that can be evaluated at various times after treatment include, in particular: - Increased life expectancy, - Increased muscle strength, - Improved histology, and / or - Improved diaphragm function.

[0049] In the context of the present invention, the term "toxicologically acceptable levels" refers to the fact that the protein produced from the expression system of the present invention does not cause significant changes in non-target tissues, in particular histologically, physiologically and / or functionally. In particular, the expression of the protein may not be lethal. Advantageously, the amount of protein produced in the non-target tissue should not exceed the endogenous level of said protein in this tissue, in particular compared to a healthy subject. As already described, toxicity in tissues can be evaluated histologically, physiologically and functionally. In the particular case of the heart, for illustrative purposes, any toxicity of the protein can be evaluated by tests of morphology and cardiac function, by clinical examinations, by electrophysiology, imaging, biomarkers, monitoring of life expectancy or by histological analysis, including detection of fibrosis and / or detection of cellular infiltrates, for example by staining with Sirius Red and / or Hematoxylin / Eosin.

[0050] Advantageously, the level of efficacy and / or toxicity of the expression system according to the invention is assessed in vivo in an animal, even more preferably in an animal that carries a defective copy of the gene encoding the protein and thus suffers from the associated pathology.

[0051] It is preferred that the expression system be administered systemically, for example by intravenous injection.

[0052] According to the invention, preferably, the expression system of the invention comprises: - preventing expression or reducing the level of expression of the protein in non-target tissues, particularly in non-target tissues where expression of the protein is toxic, and / or - maintaining expression or increasing the level of expression of a protein in a target tissue; The nucleic acid sequence includes at least one sequence that enables

[0053] According to one particular embodiment, the present invention provides a method for producing a medicament for the treatment of a pulmonary arthritis, comprising: - preventing expression or reducing the level of expression of a protein in tissues other than skeletal muscle and / or peripheral nervous tissue, preferably in tissues in which expression of the protein is toxic, and / or - maintaining expression or increasing the level of expression of a protein in skeletal muscle and / or peripheral nerve tissue The present invention relates to an expression system comprising at least one sequence enabling

[0054] In the context of the present invention, the term "prevent expression" preferably means that there is no expression even in the absence of said sequence, and the term "reduce the level of expression" means that expression is reduced (or decreased) by the provision of said sequence.

[0055] Similarly, the term "maintaining expression" preferably means that there is a comparable level of expression in the absence of the sequence, and the term "increasing the level of expression" means that there is an increase in expression due to the provision of the sequence.

[0056] In the context of the present invention, there are at least three ways to achieve the desired objective: - the use of sequences that are able to prevent expression of a protein in non-target tissues or reduce the level of expression without reducing the level of expression in target tissues; - the use of promoter sequences that can ensure high levels of expression in target tissues and low or no expression in non-target tissues, particularly in tissues in which expression of the protein is deemed toxic; - the use of vectors, preferably viral vectors, with appropriate tropism, in this case with a higher tropism for target tissues than for non-target tissues, in particular for tissues where expression of the protein is likely to be toxic; are present, and these may be combined.

[0057] Suitably, the expression system of the present invention comprises a promoter sequence, preferably located 5' of and operably linked to the transgene, directing transcription of the protein-encoding sequence, which preferably ensures therapeutically acceptable levels of protein expression in the target tissue, particularly skeletal muscle.

[0058] This may include inducible or constitutive promoters, natural or synthetic (artificial) promoters. Similarly, the promoter may be of any origin, including human, of the same origin as the transgene or of another origin.

[0059] According to a first embodiment, the promoter sequence corresponds to a ubiquitous or non-selective promoter, i.e. a promoter with low tissue specificity, ensuring broadly similar levels of expression in various tissues, both for target and non-target tissues. Examples include the cytomegalovirus promoter (pCMV), the Mtm1 promoter.

[0060] According to a particular embodiment, this refers to a promoter suitable for skeletal muscle and / or peripheral nerve tissue, but which can be expressed in other tissues, in particular other muscles. By way of example, mention may be made of the desmin promoter, preferably the sequence of SEQ ID NO: 11, the skeletal alpha-actin promoter, the muscle creatine kinase (MCK) promoter, the C5-12 synthetic promoter, the synapsin I (Syn) promoter or the CK6 promoter. For skeletal muscle, mention may also be made of the troponin, myogenic factor 5 (Myf5), myosin light chain 1 / 3 fast (MLC1 / 3f), muscle differentiation 1 (MyoD1), myogenin (Myog), paired box gene 7 (Pax7), MEF2 promoters. For peripheral nerve tissue, mention may also be made of the P0 and MBP (myelin basic protein) promoters.

[0061] According to a preferred embodiment of the invention, the promoter sequence of the expression system is selected for a promoter activity that discriminates between target and non-target tissues, in this case being superior in the target tissue, where the promoter sequence helps to increase expression of the protein in the target tissue, preferably skeletal muscle and / or peripheral nerve tissue, while preventing expression in non-target tissues, particularly tissues where expression of the protein is toxic.

[0062] By way of example, when the target tissue is skeletal muscle, it is preferred that the promoter is a muscle-specific promoter. According to another advantageous feature, said promoter has low or no promoter activity in non-target tissues, in particular the heart, allowing expression of the protein at toxicologically acceptable levels in these tissues.

[0063] According to a particular embodiment, said promoter sequence may correspond to the promoter of the calpain 3 gene, preferably of human origin, even more preferably of the sequence SEQ ID NO: 12. Another suitable promoter sequence is that of miRNA206 (miR206), preferably of human origin, even more preferably of the sequence SEQ ID NO: 13.

[0064] Thus, within the framework of the present invention, it is shown that, at least for calpain 3, an expression system comprising a sequence encoding said protein placed under the control of the calpain 3 or miRNA206 promoter is able to ensure therapeutically acceptable levels of expression of the protein in skeletal muscle and toxicologically acceptable levels of the protein in the heart and liver.

[0065] In another aspect, the present invention therefore relates to an expression system comprising a protein-coding sequence placed under the control of a promoter having the sequence SEQ ID NO: 12 or SEQ ID NO: 13. Promoter sequences derived from sequences corresponding to SEQ ID NO: 12 and SEQ ID NO: 13 or fragments thereof, but having similar promoter activity, in particular with regard to tissue specificity and optionally efficacy, are also encompassed under the present invention.

[0066] If the promoter sequence does not allow expression of the protein at toxically acceptable levels in non-target tissues, it is advantageous for the promoter sequence to be associated with a sequence that functions to reduce the level of expression of the protein in the non-target tissues, preferably in non-target tissues in which expression of the protein is toxic.

[0067] Thus, by way of example, it has been shown that the use of the desmin promoter in the case of both myotubularin and calpain 3 represents a cardiotoxic effect. In contrast, according to the present invention, the use of the desmin promoter, preferably of SEQ ID NO: 11, associated with at least one target sequence of miRNA-208a, preferably of SEQ ID NO: 10, - expression of a therapeutically acceptable level of the protein in the target tissue, preferably skeletal muscle; - Expression of the protein in non-target tissues, preferably the heart or liver, at toxicologically acceptable levels. This allows for both.

[0068] As already mentioned, said sequences are capable of preventing expression or reducing the level of expression of the protein in non-target tissues, preferably in non-target tissues in which expression of the protein is toxic. This effect is in particular - the level of transcription of the protein-coding sequence, - transcripts resulting from the transcription of sequences coding for proteins, e.g. their degradation, - Translation of transcripts into proteins This can occur according to a variety of mechanisms.

[0069] Such an array is - MicroRNAs, - endogenous small interfering RNA, i.e. siRNA; - a small fragment of transfer RNA (tRNA), - RNA in intergenic regions, - ribosomal RNA (rRNA), - Small nuclear RNA (snRNA), - Nucleolar small RNA (snoRNA), - RNA interacting with piwi proteins (piRNA) etc. Preferably, the target is a small RNA molecule selected from the group:

[0070] Advantageously, this sequence helps to maintain expression or even increase the level of expression of the protein in the target tissue, preferably in skeletal muscle.

[0071] Such sequences are preferably selected for efficacy in non-target tissues where expression of the protein is toxic, and since efficacy of the sequence may vary depending on the tissue, it may be necessary to combine several of these sequences selected for efficacy in all target tissues where toxicity has been demonstrated.

[0072] According to a preferred embodiment, this sequence is a target sequence for a microRNA (miRNA). As is known, such carefully chosen sequences help to specifically suppress gene expression in selected tissues.

[0073] Thus, according to a particular embodiment, the expression system of the present invention comprises a target sequence for a microRNA (miRNA) expressed or present in a non-target tissue where the expression of the protein is toxic, such as the heart. Suitably, the amount of this miRNA present in the target tissue, preferably skeletal muscle, is less than the amount of the miRNA present in the non-target tissue, or this miRNA may not even be expressed in the target tissue. According to a particular embodiment, the target miRNA is specifically expressed in the non-target target tissue, such as the heart.

[0074] As known to those skilled in the art, the presence or level of expression of a miRNA, particularly in a given tissue, can be assessed by PCR, preferably by RT-PCR, or by Northern blot.

[0075] Various miRNAs have now been identified, their target sequences as well as their tissue specificity are known to the person skilled in the art and are described, for example, in document WO 2007 / 000668.

[0076] According to a particular embodiment, the expression system of the invention comprises the target sequence of miRNA-208a (also written miR208a, SEQ ID NO: 9). Preferably, this sequence is identical in human, dog and mouse and has the sequence of SEQ ID NO: 10 of 22 pb. Of course, any derived or truncated sequence recognized by miRNA-208a can be implemented as part of the invention. Thus, within the framework of the invention, the use of this target sequence in the context of both myotubularin and calpain 3 makes it possible to solve the problem of cardiotoxicity, or even hepatotoxicity in the case of calpain 3.

[0077] As already mentioned, target sequences for microRNAs can be used alone or in combination with other sequences, advantageously target sequences for microRNAs that may be the same or different. These sequences can be used in tandem or in opposite orientations.

[0078] According to a preferred embodiment, one or more, in particular two or four sequences may be implemented, particularly for the target sequence of miRNA-208a. These are preferably used in series, i.e. all in the same orientation. When implementing multiple target sequences, they may be separated by DNA spacers of random sequence, in a manner known to those skilled in the art.

[0079] In the case of target sequences of miRNAs, especially miR208a, it is preferred to place them 3' of the protein-coding sequence, and more advantageously to insert them in the 3'UTR ("untranslated region") region of the expression system, preferably in the cDNA encoding the protein. Even more preferably, if the expression system contains a polyadenylation signal 3' of the cDNA encoding the protein, this sequence is inserted between the stop codon of the open reading frame and the polyadenylation signal.

[0080] In the context of the present invention, it has been demonstrated that at least one target sequence of miRNA-208a has been applied to obtain toxicologically acceptable levels of proteins, at least in the heart, in particular with regard to myotubularin and calpain 3.

[0081] According to a particular embodiment, the expression system comprises: - a sequence encoding myotubularin placed under the control of a promoter, preferably desmin, even more preferably human desmin (SEQ ID NO: 11), at least one target sequence of a miRNA expressed in the heart, preferably of miRNA-208a, preferably a single target sequence such as the sequence of SEQ ID NO: 10 Includes.

[0082] In another particular embodiment, the expression system comprises: - a sequence encoding calpain 3 placed under the control of a promoter, preferably desmin, even more preferably human desmin (SEQ ID NO: 11), or calpain 3, even more preferably human calpain 3 (SEQ ID NO: 12), or miRNA206, even more preferably human miRNA206 (SEQ ID NO: 13); at least one target sequence of a miRNA expressed in the heart, preferably of miRNA-208a, even more preferably of two tandem target sequences; Includes.

[0083] According to the invention, an expression system or expression cassette comprises the elements necessary for the expression of a present transgene. In addition to sequences such as those defined above for ensuring and modulating the expression of the transgene, such a system may also comprise: a polyadenylation signal, such as the polyA of SV40 or human hemoglobin, preferably inserted 3' of the coding sequence or 3' of the target sequence of the miRNA, - sequences for stabilizing transcription, such as intron 1 of human hemoglobin; - enhancer sequences, etc. It may contain other sequences such as:

[0084] The expression system according to the invention can be introduced into cells, tissues or the body, in particular in humans. In one way known to the skilled artisan, the introduction can be carried out ex vivo or in vivo, for example by transfection or transduction. In another aspect, the invention therefore encompasses cells or tissues, preferably of human origin, which contain the expression system of the invention.

[0085] The expression system according to the invention, in this case an isolated nucleic acid, can be administered to a subject, i.e. in the form of naked DNA. To facilitate the introduction of this nucleic acid in cells, the nucleic acid can be combined with various chemical means, such as colloidal dispersion systems (polymer complexes, nanocapsules, microspheres, beads) or lipid-based systems (oil-in-water emulsions, micelles, liposomes).

[0086] Alternatively, according to another preferred embodiment, the expression system of the invention comprises a plasmid or vector. Such vector is advantageously a viral vector. The viral vectors commonly used in gene therapy in mammals, including humans, are known to those skilled in the art. Such viral vectors are preferably selected from the following list: herpesvirus-derived vectors, baculovirus vectors, lentivirus vectors, retrovirus vectors, adenovirus vectors and adeno-associated virus vectors (AAV).

[0087] This is preferably an adeno-associated virus vector (AAV) corresponding to a natural serotype (AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 and AAV9), a variant thereof or an artificial serotype. In a manner known to those skilled in the art, chimeric AAV vectors can also be implemented.

[0088] It is preferred that the expression system of the present invention is inserted between two ITR ("inverted terminal repeat") sequences of an AAV vector.

[0089] In the context of systemic administration, for which the expression system of the present invention is entirely applicable, AAV vectors of serotypes 8 or 9 are particularly preferred. This may include, for example, AAV2 / 8 or AAV2 / 9 vectors.

[0090] In one method known to those skilled in the art, recombinant viral particles can be obtained, for example, by tri-transfection of HEK293 cells or by the baculovirus system. The vector titer is customarily expressed as viral genomes per milliliter (vg / ml).

[0091] According to a preferred embodiment, the expression system of the present invention comprises a vector with appropriate tropism, particularly in cases where expression of the protein is deemed toxic, in this case a higher tropism for the target tissue than for non-target tissues. This vector may be an AAV vector selected for minimal or no targeting / transduction of non-target tissues such as the heart, or comprising a capsid that specifically targets / transduces the target tissue, particularly skeletal muscle.

[0092] As is evident from the above, the expression system according to the invention, in particular in the form of a recombinant AAV vector or a recombinant viral particle, has obvious applications, especially in the therapeutic field.

[0093] Thus, according to another aspect, the present invention relates to the use of the described expression system as a medicament. In other words, it also covers pharmaceutical compositions comprising such expression systems. Suitably, the pharmaceutical composition may further comprise a pharmaceutically acceptable and inert carrier, preferably adapted for systemic administration, such as intravenous administration. Various excipients, stabilizers and other known suitable compounds known to those skilled in the art may be added to such compositions.

[0094] The present invention demonstrates the advantages of the expression system described where administration is not localized to the target tissue, but instead systemically, resulting in delivery in non-target tissues.

[0095] Thus, preferably, the expression system according to the invention is administered by one of the following routes: enterally, parenterally, orally, intravenously, intraarterially and by inhalation.

[0096] Preferably, administration is systemic, more preferably intravenous. Note that systemic administration can be near the treatment area, such as near a skeletal muscle.

[0097] According to one embodiment of a particular form, administration is not locoregional administration. More specifically, the following can be excluded: intravascular, especially intravenous, injection (performed close to the target muscle under pressure and in the presence of a tourniquet), such as that described by Petrov et al. (Methods Mol Biol, 2011, vol. 709, pp. 277-86) or intraarterial injection (catheter in artery and venous clamping near the upstream artery to prevent diffusion), such as that described by Gonin et al. (J Gene Med, 2005, vol. 7, pp. 782-791).

[0098] If the composition of the present invention is to be injected, it is preferred that the composition is in liquid form. The effective concentration, in this case the expression system of the present invention, the amount to be injected, and the frequency of injection are determined by those skilled in the art. A single dose may be sufficient. It is preferred that the therapeutic effect is observed for at least 1 month, 3 months, 6 months, 1 year, 5 years, or more.

[0099] Such medicines are particularly intended for gene therapy for the treatment of neuromuscular disorders, more particularly diseases that primarily affect skeletal muscles (myopathies).More generally, the present invention helps to improve muscle function in a subject.

[0100] The patient to be treated is preferably a mammal, in particular a human being.

[0101] Diseases of particular mention in the context of the present invention are centronuclear myopathies, more precisely X-linked myotubular myopathy (XLMTM). Furthermore, other centronuclear myopathies and neuromuscular diseases associated with myotubularin, such as some forms of Charcot-Marie-Tooth disease, can be treated.

[0102] Limb-girdle dystrophy type 2A (LGMD2A) can also be treated with the expression system of the present invention.

[0103] More generally, a non-exhaustive list of diseases covered by the present invention is as follows: congenital muscular dystrophy with selenoprotein N deficiency, primary merosin-deficient congenital muscular dystrophy, Ullrich congenital muscular dystrophy, Duchenne muscular dystrophy (DMD) or Becker muscular dystrophy (BMD), central core congenital myopathy, multi-minicore congenital myopathy, centronuclear autosomal myopathy, myopathy with fibre dysproportion, nemaline myopathy, congenital myasthenic syndromes, other neuromuscular diseases associated with myotubularin, type 2B or type 2D limb-girdle dystrophy, Miyoshi distal myopathy, dysphaerinopathy, sarcoglycanopathy.

[0104] According to one particular embodiment, the condition is not Duchenne muscular dystrophy (DMD) or Becker muscular dystrophy (BMD), or is not LGMD2D.

[0105] It is therefore expected that a medicament according to the invention will both improve the condition and thus improve the quality and longevity of the patient's life, whilst avoiding potential side effects in other tissues of such treatment.

[0106] As demonstrated by the examples, the present invention demonstrates the potential cardiotoxicity of gene therapy treatments for muscle diseases and provides a technical solution to overcome this problem.

[0107] Experimental Example The invention and the advantages attributable to it will be better understood with the implementation examples given below and with the aid of the attached figures, which, however, are not exhaustive.

[0108] The invention is described in relation to the myotubularin gene (MTM1) and the calpain 3 gene (CAPN3), but the described strategy can be applied to any transgene encoding a protein of interest in skeletal muscle for which cardiotoxicity has been demonstrated. [Brief description of the drawings]

[0109] [Figure 1] Figure 3. Vector constructs: A / Mtm1 expression cassette without target sequence for miRNA-208a. B / Expression cassette with one, two or four (boxes) target sequences for miRNA-208a 3' of the Mtm1 gene. [Diagram 2] FIG. 1 shows a cross-section of the heart of an XLMTM mouse treated with the AAV-pDES-Mtm1 vector, where fibrotic areas were found in red due to Sirius red staining. [Diagram 3] Top: Distribution of vectors in skeletal muscle (TA; QUA; TRI) and in heart of wild type mice (WT) one month after intravenous administration of vectors (vg / diploid genome). Bottom: MTM1 protein levels in skeletal muscle and heart of wild type mice (WT) one month after vector administration. Values ​​indicate proliferation rate relative to endogenous levels. As controls, mice were injected with either PBS or empty AAV8 vector (AAV-MCS). [Figure 4] Figure 1 shows survival curves (left) and body weight curves (right) of Mtm1 KO mice ("knockout") injected with either PBS, AAV8-Des-MCS, AAV8-Des-Mtm1, or AAV8-Des-Mtm1-miRHT1. Wild-type mice (WT) received PBS as a control. [Diagram 5]Analysis of CAPN3 and miR-206 promoter activity in vivo. A / Histological analysis of myocardium after injection with PBS or vectors AAV2 / 9-desm-CAPN3 (pdes.C3), AAV2 / 9-pC3-CAPN3 (pC3.C3), AAV2 / 9-pmiR206-CAPN3 (p206.C3) and Sirius red staining (top, scale=500 μm) or Hematoxylin Phloxine Saffron (HPS) (bottom, scale=100 μm). B / qPCR evaluation of vector DNA levels in WT wild type mouse hearts after injection. C / qPCR evaluation of CAPN3 mRNA levels in WT wild type mouse hearts after injection. "H" line corresponds to CAPN3 endogenous mRNA levels in WT wild type mouse hearts. D / Analysis of serum enzymes. Alanine aminotransferase test (ALT) was performed on serum of WT mice treated with pC3.C3 on the left or p206.C3 on the right. Standard deviations and means (SEM) for each condition are shown by the vertical bars and circles, respectively. [Figure 6]Analysis of miR-208aT activity in vivo. A / Histological analysis of myocardium stained with Sirius red (top, scale=500 μm) or HPS (bottom, scale=100 μm) 35 days after injection with PBS or the same dose of vectors AAV2 / 9-desm-CAPN3 (pdes.C3) or AAV2 / 9-desmin-CAPN3-miR208aT (pdes.C3-T). B / Evaluation of vector DNA levels by qPCR (top) and mRNA levels of the CAPN3 transgene (bottom) in the hearts of WT wild-type mice after injection. The "H" line corresponds to the CAPN3 endogenous mRNA levels in the hearts of WT wild-type mice. C / Analysis of calpain 3 expression by Western blot in skeletal muscle and heart of WT mice injected with PBS or vectors AAV2 / 9-desmin-CAPN3 (pdes.C3) or AAV2 / 9-desm-CAPN3-miR208aT (pdes.C3-T). Total protein is indicated by arrows and its cleavage products (60, 58, and 55 kDa) by hooks. D / Quantification of miR-208a (miR208a), HOP (Hop), and connexin 40 (Cnx40) mRNA levels in hearts of WT mice injected with AAV2 / 9-desmin-CAPN3 (pdes.C3) or AAV2 / 9 desmin-CAPN3-miR208aT (pdes.C3-T). Quantification of RNA in pdes.C3-T state is shown as a percentage of RNA levels in pdes.C3 state. [Figure 7]Figure 2. Histological analysis of the efficiency of calpain 3 translocation in skeletal muscle of calpain 3-deficient mice: A / Cross sections of TA muscle of C3KO mice were stained with HPS 4 months after injection with PBS or vectors AAV2 / 9-desmin-CAPN3-miR208aT (pdes.C3-T), AAV2 / 9-PC3-CAPN3-miR208aT (pC3.C3-T), AAV2 / 9-pmiR206-CAPN3-miR208aT (P206.C3-T) (1.2x1013vg / kg). Scale = 100 μm. B / Number of centronuclear fibres (CNF / mm2) measured in HPS-stained sections in TA (left) and PSO (right) muscles of C3KO mice injected with either PBS or vectors AAV2 / 9-desmin-CAPN3-miR208aT (pdes.C3-T), AAV2 / 9-PC3-CAPN3-miR208aT (pC3.C3-T), AAV2 / 9-pmiR206-CAPN3-miR208aT (p206.C3-T) (1.2 × 1013 vg / kg). Differences with P values ​​< 0.05 are indicated by asterisks. TA: tibialis anterior; PSO: psoas. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0110] I) Materials and methods 1) Production of recombinant AAV vectors The vector rAAV-Des-Mtm1 was constructed by cloning the open reading frame of the mouse Mtm1 gene (SEQ ID NO: 14) downstream of the human desmin promoter (SEQ ID NO: 11) in the vector serotype 2 AAV. 22 pb of target sequences of miRNA-208a (SEQ ID NO: 10) (one, two, or four sequences, miRHT1, miRHT2, and miRHT4, respectively), each separated by a DNA spacer, were added in the 3'UTR region of Mtm1 cDNA. An empty vector (rAAV-Des-MCS) was also produced as a control. Recombinant viral particles of serotype 8 (AAV8) were obtained using a triple transfection protocol in HEK293 cells as previously described (15). Vector titers are expressed in terms of viral genomes per ml (vg / ml).

[0111] Similarly, vector rAAV-desm-CAPN3 (or AAV-desmin-CAPN3 or AAV-pDes-CAPN3) was constructed with the cDNA of human calpain 3 (SEQ ID NO: 8) under the control of the human desmin promoter (SEQ ID NO: 11). The rAAV-PC3-CAPN3 and rAAV-pmiR206-CAPN3 vectors were obtained by replacing this promoter with the promoter region of human calpain 3 (SEQ ID NO: 12) or the promoter region of miRNA206 (SEQ ID NO: 13), respectively. The vectors AAV-desm-CAPN3-miR208aT, AAV-PC3-CAPN3-miR208aT, and AAV-pmiR206-CAPN3-miR208aT were obtained by adding two target sequences for miRNA208a (SEQ ID NO: 9) (miR208aT) in tandem 3' of the calpain 3 gene. Recombinant viral particles of serotypes 1 (AAV1), 8 (AAV8), and / or 9 (AAV9) were generated.

[0112] 2) In vivo experiments Mice were treated according to French and European legislation on animal testing. In this study, WT C57Bl / 6 wild-type mice (Charles River Laboratories) and a mouse line constitutively inactivated (knockout) for myotubularin, also called BS53d4-129pas, KO-Mtm1, were used. For calpain 3, the C3KO mouse model described by Laure et al. (Febs J., 2010, vol. 277, pp. 4322-4337) was used.

[0113] The recombinant vectors were injected into the tail vein of mice (3 weeks to 2 months old) according to the indicated doses as indicated. An equal volume of buffered saline (PBS) was administered as a control. The clinical condition and animal weights were monitored weekly for WT animals and 3 times per week for mutant mice. Mice were sacrificed at the indicated times.

[0114] 3) Western Blot Muscles frozen in isopentane were cut into 30 μm cross sections and lysed on ice in a buffer containing 150 mM NaCl, 10 mM Tris HCl (pH 7.4), 1 mM EGTA, 1 mM EDTA, 100 mM sodium fluoride, 4 mM sodium pyrophosphate, 2 mM sodium orthovanadate, 1% Triton X100, and 0.5% IGEPAL, supplemented with a complete cocktail of protease inhibitors (Roche). Muscle extracts were incubated for 1 h and centrifuged at 12,000 × g for 30 min at 4 °C. Protein concentrations in the supernatants were determined using a Bio-Rad protein assay kit. Proteins were run on SDS-PAGE, transferred to nitrocellulose membranes, and incubated with polyclonal antibodies against myotubularin (p2348

[15] ) and GAPDH (#MAB374, Millipore). Protein bands were viewed by infrared fluorescence using an "Odyssey Imaging System" (LICOR Biotechnology Inc.) and quantified using the "Odyssey Infrared Imaging System Software" program (Software Applications, version 1.2, 2003).

[0115] A similar protocol was used for detection of calpain 3: muscles were homogenized by FastPrep using lysis buffer [20 mM Tris (pH 7.5), 150 mM NaCl, 2 mM EGTA, 0.1% Triton X-100, 2 mM E64 (Sigma)] and protease inhibitors (Complete Mini protease inhibitor cocktail; Roche Applied Science, 25 μl per mg of tissue). Samples were treated with Benzonase (Calbiochem) 250 U / 100 μl for 30 min at 4°C to digest DNA. Muscle lysates were mixed with loading buffer [NuPage LDS (Invitrogen), TNT 3M (Sigma)], denatured at 70°C for 10 min, and briefly centrifuged. The supernatant was separated by 4-12% gradient polyacrylamide gel NuPAGE Bis-Tris (Invitrogen). After transfer, the membrane was hybridized with an antibody against calpain 3 (mouse monoclonal antibody, Novocastra NCL-CALP-12A2, diluted 1 / 200) overnight at 4°C or for 2-3 hours at room temperature. Finally, the membrane was incubated with IRDye® for revealing on an Odyssey infrared scanner (LI-COR Biosciences, Lincoln, Nebraska, USA).

[0116] 4) PCR 4-1-Myotubularin DNA was isolated from muscle using the "Gentra Puregene Tissue Kit" (Qiagen) according to the manufacturer's instructions. The total DNA concentration was determined using a ND-8000 Nanodrop spectrophotometer (Nanodrop Technologies, France) and 80 ng of DNA for each sample was used as a matrix for real-time PCR. Taqman real-time PCR for each sample was performed on both the rAAV2 / X vector to identify copies of the viral genome and on the part of the skeleton common to the mouse gene of titin to normalize the number of mouse genomes present in each sample. The primers used for amplification of the rAAV vector were 5'-CTCCATCACTAGGGGTTCCTTG-3' (forward, SEQ ID NO: 15), 5'-GTAGATAAGTAGCATGGC-3' (reverse, SEQ ID NO: 16). The MGB probe was double-labeled (FAM-NFQ): 5'-TAGTTAATGATTAACCC-3' (probe, SEQ ID NO: 17). Primers and probes used for titin were 5'-AAAACGAGCAGTGACGTGAGC-3' (forward, SEQ ID NO: 18), 5'-TTCAGTCATGCTGCTAGCGC-3' (reverse, SEQ ID NO: 19), and 5'-TGCACGGAAGCGTCTCGTCTCAGTC-3' (probe, SEQ ID NO: 20) (Applied Biosystem). Amplification of titin was performed using 80 ng of DNA diluted in "Absolute QPCR ROX Mix" (Thermo Fischer Scientific), 0.1 μM Taqman probe, and 0.2 μM primers (forward and reverse) in a final volume of 25 μM. Cycling conditions consisted of an activation step for Thermo-Start DNA polymerase at 95°C for 15 min, followed by 40 cycles of a two-step cycle of denaturation at 95°C for 15 s and hybridization and extension at 60°C for 60 s. Amplification of rAAV was performed using 0.1 μM Taqman probe, 0.3 μM reverse primer, and 0.05 μM forward primer in a final volume of 25 μl.Cycling conditions consisted of an activation step for Thermo-Start DNA polymerase at 95°C for 15 min, followed by 40 cycles of a two-step cycle of denaturation at 95°C for 15 s and hybridization and extension at 54°C for 60 s. PCR was performed on a 7900 HT thermocycler (Applied Biosystems). A dilution series of a plasmid standard containing the rAAV skeleton and titin sequences was used in each real-time PCR plate as copy number controls. All samples and controls were performed in duplicate. Data are expressed as viral genome copy number per diploid genome.

[0117] 4-2-Calpain 3 Muscles were extracted using the Trizol method (Invitrogen). During extraction, sample fractions were saved for DNA extraction to be quantified by quantitative PCR. Total RNA was extracted from the remaining extracts treated with the "DNA-Free" kit (Ambion) to remove residual DNA. To quantify the expression of endogenous microRNAs, a total of 20 ng of RNA was subjected to reverse transcription using the "Reverse Transcription TaqMan MicroRNA" kit (Applied Biosystems) and analyzed by microRNA ID511 Taqman assay (Applied Biosystems) for miR-208a. Sample normalization was performed with the expression of snoRNA202 in test ID 1232 (Applied Biosystems).

[0118] To amplify endogenous or transgenic calpain 3 mRNA, 1 μg of RNA was reverse transcribed using random hexamers and oligo dT and the cDNA Verso kit (Abgene) or the "RevertAid H Minus First Strand cDNA Synthesis" kit (Fermentas). Real-time PCR was performed with the aid of the following primer pairs (.f and .r) and Taqman probe (.p) using an ABI PRISM 7700 (Applied Biosystems) system and the "Absolute QPCR Rox The TaqMan® method was carried out by applying the "TaqMan® Mix" solution (ABgene): CAPN3sfr.f (SEQ ID NO: 21) 5'_CGCCTCCAAGGCCCGT_3' for the quantification of transgenic calpain; CAPN3sfr.r (SEQ ID NO: 22) 5'_GGCGGAAGCGCTGGCT_3'; MGBTUCAPN3.p (SEQ ID NO: 23) 5'_CTACATCAACATGAGAGAGGT_3; CAPN3.f (SEQ ID NO: 24) 5'_CGCCTCCAAGGCCAGG_3', CAPN3.r (SEQ ID NO: 25) 5'_GGCGGAAGCGCTGGGA_3, and CAPN3.p (SEQ ID NO: 26) 5'_TACATCAACATGCGGGAGGT_3 for the quantification of human calpain. To be able to compare different experiments, serial dilutions of control RNA were used in each experiment and processed with the experimental samples to avoid variations in the cDNA preparation and the efficiency of the PCR. This RNA was prepared by an in vitro transcription reaction from a plasmid carrying the cDNA calpain 3 mutated and amplified by all pairs of primers.

[0119] Analysis of the expression of connexin 40 and HOP was performed using the TaqMan® Gene Expression Assay (Applied Biosystems) as follows: for Cnx40; Gja-5 [Mus Musculus]: Mm00433619_s1 and hop: HOP homeobox [Mus Musculus]: Mm00558630_m1. qRT-PCR results are expressed in arbitrary units relative to the expression of the ubiquitous ribosomal phosphoprotein acid mouse gene (P0 GI: 15029771; MH181PO.F (SEQ ID NO: 27): 5'_CTCCAAGCAGATGCAGCAGA_3' / M267PO.R (SEQ ID NO: 28): 5'_ACCATGATGCGCAAGGCTAT_3' / M225PO.p (SEQ ID NO: 29): 5'_CCGTGGTGCTGATGGGCAAGAA_3').

[0120] 5) Histology Cross sections (8 μm thick) of heart, liver, or skeletal muscle cryosections were stained with hematoxylin and eosin (HE), Sirius red, or hematoxylin phloxine saffron (HFS) using standard protocols.

[0121] Sections were mounted in Eukitt medium (LABONORD). Digital images were captured using a CCD camera (Sony). The number of central nucleated fibers (CNF / mm 2 Morphometric analysis of skeletal muscle to define skeletal muscle mass (MMA) was performed using Histolab software (Microvision, Evry).

[0122] 6) Measurement of ALT activity Blood samples were collected without clotting. After centrifugation (8000g, 10 min, 4°C), serum was analyzed using a VITROS DT60 instrument (Ortho Clinical Diagnostics, UK) with the "Vitros ALT DT Slide" cassette for the determination of alanine aminotransferase (ALT) rates.

[0123] II) Results A-myotubularin 1) Cardiotoxicity of the construct AAV-pDES-Mtm1 The beneficial effect of a single intramuscular injection of the myotubularin (Mtm1) gene under the control of the CMV promoter in the vector AAV2 / 1 was known from Buj-Bello et al.

[15] .

[0124] We attempted a systemic gene therapy approach in Mtm1 knockout mice and showed that administration of an AAV8 vector expressing myotubularin under the control of the human desmin promoter (rAAV-Des-Mtm1) in mutant mice (Figure 1A) resulted in an extension of survival of at least 6 months, with strong improvement in pathology in striated muscles throughout the body, including the diaphragm, and normalization of motor activity (results not shown).

[0125] However, after systemic administration of the vector AAV8-DES-Mtm1 in Mtm1 KO mice, we observed that the levels of myotubularin protein were significantly higher in the heart compared to skeletal muscle (results not shown).Furthermore, the presence of inflammatory infiltrates and fibrosis was observed in the hearts of XLMTM mice treated with AAV at various times after virus injection (Figure 2).

[0126] 2) Development of a non-cardiac toxic expression system Because the biodistribution and transgene expression from the AAV8 vector is difficult to predict, especially after systemic administration in humans, we developed a new vector carrying regulatory sequences that increase muscle specificity to avoid potential side effects affecting the heart.

[0127] As shown in Figure 1B, three viral constructs (rAAV-Des-Mtm1-miRHT1, rAAV-Des-Mtm1-miRHT2, and rAAV-Des-MTM1-miRHT4) were developed, each containing one, two, or four target sequences for miRNA-208a. This sequence has SEQ ID NO: 10 and consists of 22 base pairs. It is clear that this sequence is conserved in humans, dogs, and mice.

[0128] 3) Muscle and cardiac generation of MTM1 after injection in WT mice To select the most suitable expression vector for MTM1, 3 × 10 13 A single dose of viral genomes (vg) / kg was administered into the tail vein of 3-week-old wild-type mice, with empty vector (AAV-Des-MCS) and PBS ("phosphate buffered saline") serving as internal controls.

[0129] Vector distribution and protein levels of myotubularin in the heart and in various skeletal muscles (tibialis anterior = TA, quadriceps = QUA, triceps = TRI) were evaluated one month after injection. Western blot results showed that these vectors can reduce the levels of myotubularin produced from the vector specifically in the heart. In addition, a single target sequence of miRNA208a is sufficient to reduce expression in this tissue (Figure 3 and Table 1).

[0130] [Table 1]

[0131] 4) Validation of vector constructs after injection into Mtm1 mutant mice Based on the previous results, the construct rAAV-Des-Mtm1-miRHT1 was selected for further experiments. AAV-Des-Mtm1, rAAV-Des-Mtm1-miRHT1, and rAAV-Des-MCS were each injected at 3 × 10 64-well into 3-week-old WT wild-type mice with a mutated MTM1 gene (KO, for "knockout"). 13 Mice were administered 100 mg / kg of glycerol, or PBS, and were clinically monitored for one month.

[0132] All mutant mice administered AAV8-Des-Mtm1-miRHT1 survived to the end of the study, and their growth curves were similar to those of KO mice treated with AAV8-Des-Mtm1, indicating that the inclusion of the miRHT1 sequence did not affect the therapeutic efficacy of the transgene (Figure 4).

[0133] The histology of the hearts of WT and KO mice was analyzed by hematoxylin-eosin and Sirius red staining 1 month after treatment. Fibrotic areas were observed in the hearts of 7 of 9 KO mice treated with 9-AAV8-Des-Mtm1, but not in KO mice treated with AAV8-Des-Mtm1-miRHT1 (n=10). Administration of the vector AAV8-Des-Mtm1 did not cause fibrosis in WT mice 1 month after injection (n=8).

[0134] In conclusion, these results indicate that inclusion of a single target sequence of miRNA208a is sufficient to reduce the cardiotoxicity of the AAV8-Des-Mtm1 construct.

[0135] A similar experiment was performed for calpain 3 (CAPN3).

[0136] B-calpain 3 The article by Bartoli et al. (Molecular Therapy, 2006, Vol. 13, No. 2, pp. 250-259) points out beneficial effects and non-toxicity after intramuscular or local administration of AAV-type constructs carrying the calpain 3 gene under the control of a muscle-specific promoter. However, experiments carried out in the context of the present invention have revealed toxicity after systemic administration of such constructs.

[0137] 1) Cardiac toxicity of the AAV-desm-CAPN3 construct After intravenous injection of the various constructs, the status of WT mice was monitored and is shown in Table 2 below.

[0138] [Table 2]

[0139] For all AAVs tested, cardiac tissue destruction was observed upon systemic administration, precluding the therapeutic use of these gene expression systems.

[0140] 2) Reducing the cardiotoxicity of the construct AAV-desm-CAPN3 by replacing the promoter Two vectors were constructed by exchanging the desmin promoter with the promoter of CAPN3 (AAV2 / 9-pC3-CAPN3) or miR-206 (AAV2 / 9-pmiR206-CAPN3). After preparation of the vector virus, the vectors were injected intravenously (6 × 10 12 The in vivo consequences of the changes induced by 100 mg / kg (vg / kg) were analyzed in 2-month-old C57BL / 6 mice (WT).

[0141] Thirty-five days after injection, no cardiac fibrosis was observed in mice treated with vectors AAV2 / 9-pC3-CAPN3 and AAV2 / 9-pmiR206-CAPN3, unlike mice injected with AAV2 / 9-desm-CAPN3 (Fig. 5A), despite similar levels of transduction (Fig. 5B). The levels of CAPN3 transgene mRNA in the hearts of mice treated with AAV2 / 9-desm-CAPN3 were approximately 15-fold higher than the endogenous levels (Fig. 5C), but remained lower in mice treated with AAV2 / 9-pC3-CAPN3 and AAV2 / 9-pmiR206-CAPN3 (13% and 30%, respectively, Fig. 5C), correlating with the non-toxic effect of these two vectors. Moreover, these two promoters were able to upregulate 10% of the IL-16 expression by measuring the levels of alanine aminotransferase activity (ALT) for approximately 5 weeks. 13 vg / kg did not cause hepatotoxicity in WT mice, and no increase in enzyme activity was observed in the injected animals compared to PBS-injected animals (Figure 5D).

[0142] Finally, the promoter CAPN3 and miR-206 reduce the cardiotoxicity of transgene CAPN3 without causing hepatotoxicity.

[0143] 3) Reduction of cardiotoxicity of the AAV-desm-CAPN3 construct by adding two target sequences of miR208a The two target sequences of miRNA208a (SEQ ID NO: 10) were cloned in tandem in the miR208aT cassette, which was then inserted into the 3'UTR area of ​​the construct AAV2 / 9-desm-CAPN3 to generate the construct AAV2 / 9-desm-CAPN3-miR208aT.

[0144] 6×10 12 After injection of a dose of 1000 mg / kg, no cardiac fibrosis was observed in treated mice, unlike those injected with AAV2 / 9-desm-CAPN3 (Figure 6A), but the level of transduction was similar in the heart, with mRNA levels 5-fold higher than the endogenous levels of calpain 3 (Figure 6B). Regarding protein levels, calpain 3 is not normally expressed in myocardium and is not detectable (Figure 6C). In WT mice injected with AAV2 / 9-desm-CAPN3, the whole protein is not detected, but fragments resulting from its cleavage (60, 58, and 55 kDa) are (Figure 6C). In contrast, neither the whole protein nor the cleavage fragments were observed in the hearts of WT mice injected with AAV2 / 9-desm-CAPN3-miR208aT (Figure 6C), pointing to translational control (Figure 6D). Taken together, these results indicate that miR208aT can reduce the cardiotoxicity of the CAPN3 transgene.

[0145] 4) Combination of two strategies New vectors were constructed by combining the promoters CAPN3 and miR-206, and the target sequences of miR-208a: AAV2 / 9-pC3-CAPN3-miR208aT and AAV2 / 9-pmiR206-CAPN3-miR208aT, with two copies each. C3KO mice (knockout for calpain 3) were transfected with 1.2 × 10 13vg / kg was injected.

[0146] As previously observed in wild-type mice, none of the three vectors (AAV2 / 9-desm-CAPN3-miR208aT, AAV2 / 9-pC3-CAPN3-miR208aT, and AAV2 / 9-pmiR206-CAPN3-miR208aT) proved to be toxic to the heart 3 months after injection (results not shown).

[0147] In contrast, histological and morphological examination of skeletal muscles from 4-week-old C3KO mice injected with these vectors demonstrated a positive effect of calpain 3 expression on pathological signs in the mouse model. Tibialis anterior (TA) muscles injected with these vectors showed improved histological features compared to those injected with PBS (Figure 7A). Morphological analysis of HPS-stained TA muscle sections revealed a marked reduction in centrally nuclear fibers (CNFs) in vector-injected muscles (Figure 9B, left). Similar results were obtained in PSO muscles (iliopsoas muscles), although the reductions observed with AAV2 / 9-pC3-CAPN3-miR208aT and AAV2 / 9-pmiR206-CAPN3-miR208aT were not statistically significant.

[0148] In conclusion, these results indicate that expression of calpain 3 in skeletal muscles transduced with these recombinant vectors is able to correct the pathological signs of calpain 3-deficient mice without manifesting cardiotoxicity. (References) TIFF0007655700000003.tif244170TIFF0007655700000004.tif169170

Claims

1. An expression system for systemic administration comprising a nucleic acid sequence encoding calpain 3, a promoter sequence selected from the group consisting of a promoter sequence of calpain 3, a promoter sequence of miR206, a promoter sequence of desmin, a promoter sequence of skeletal alpha-actin, and a promoter sequence of troponin, and at least one target sequence of miRNA208a.

2. 2. The expression system of claim 1, wherein calpain 3 comprises SEQ ID NO:

7.

3. 3. The expression system of claim 1 or 2, wherein the target sequence of miR208a comprises SEQ ID NO:

10.

4. 4. An expression system according to any one of claims 1 to 3, comprising at least two target sequences of miR208a.

5. The expression system of claim 4, comprising two target sequences of miR208a in tandem.

6. 6. An expression system according to any one of claims 1 to 5, wherein the promoter sequence of calpain 3 comprises SEQ ID NO:

12.

7. 6. The expression system of claim 1, wherein the promoter sequence of miR206 comprises SEQ ID NO:

13.

8. 6. An expression system according to any one of claims 1 to 5, wherein the desmin promoter comprises SEQ ID NO:

11.

9. 9. An expression system according to any one of claims 1 to 8, comprising a vector.

10. 10. The expression system of claim 9, wherein the vector is a viral vector.

11. 11. The expression system of claim 10, wherein the viral vector is an adeno-associated viral vector (AAV).

12. 12. The expression system of claim 11, wherein the AAV is of serotype AAV8 or AAV9.

13. A pharmaceutical composition comprising an expression system according to any one of claims 1 to 12.

14. 13. An expression system according to any one of claims 1 to 12 for use as a medicament.

15. 13. An expression system according to any one of claims 1 to 12 for use in gene therapy.

16. 13. An expression system according to any one of claims 1 to 12 for use in the treatment of a neuromuscular disorder.

17. 17. The expression system for use according to claim 16, wherein the neuromuscular disorder is a myopathy.

18. 18. The expression system for use according to claim 17, wherein the myopathy is LGMD2A, multiminicore congenital myopathy, or centronuclear autosomal myopathy.

19. 19. An expression system for use according to any one of claims 14 to 18, which is administered systemically.

20. 20. The expression system for use according to claim 19, which is administered by intravenous injection.

21. 13. An agent for treating a neuromuscular disorder, comprising the expression system according to any one of claims 1 to 12.

Images