Endolisosomal-targeting conjugates for improving the delivery of cargo molecules to the endolysosomal compartment of target cells
Endolysosome-targeting conjugates address the inefficiencies of ADCs and LCs by enhancing delivery of cytotoxic drugs and imaging labels to late endosomes and lysosomes, achieving improved therapeutic efficacy and imaging contrast.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2023-03-16
- Publication Date
- 2026-03-18
AI Technical Summary
Current antibody-drug conjugates (ADCs) and protein-drug conjugates (PDCs) face challenges in delivering cytotoxic drugs effectively to tumor cells due to toxicity limitations, while labeling conjugates (LCs) struggle with inadequate tumor imaging contrast against background tissue.
Development of endolysosome-targeting conjugates that include a targeting component and a cargo component, configured to bind with a lower dissociation constant in the extracellular space and dissociate within the endolysosomal compartment, enhancing delivery of cytotoxic drugs or imaging labels to late endosomes and lysosomes.
Improves the delivery of cytotoxic drugs to tumor cells, reducing dosage requirements and enhances imaging contrast by targeting late endosomes and lysosomes, resulting in more potent ADCs and higher-contrast LCs.
Smart Images

Figure 0007832906000021 
Figure 0007832906000022 
Figure 0007832906000023
Abstract
Description
[Technical Field]
[0001] The present inventions disclosed herein generally relate to the creation of modified proteins that can be used as platforms for the delivery of cytotoxic drugs, imaging labels, and other cargo molecules to target cells such as tumor cells. These proteins are modified to more effectively deliver cargo molecules to late endosomes and lysosomes in target cells. [Background technology]
[0002] Antibody-drug conjugates (ADCs) or protein-drug conjugates (PDCs) represent a type of therapeutic agent that combines the high specificity of antibodies, antibody fragments, or other proteins that bind to cancer cells or other undesirable cells such as inflammatory cells or virus-infected cells with the delivery of highly toxic drugs. The current problem with ADCs and PDCs is that they possess toxicity that can limit doses. However, the development of ADCs and PDCs that enable more effective delivery of cytotoxic drugs to tumor cells remains challenging but rewarding.
[0003] Furthermore, antibodies, antibody fragments, and other targeted proteins can be labeled with radioactive, fluorescent, or near-infrared labels for use as labeling conjugates (LCs) in diagnostic imaging. However, developing LCs that enable more effective labeling of tumors with higher contrast against background tissue remains a challenging but rewarding endeavor. [Overview of the project]
[0004] This disclosure relates to a modified protein referred to herein as an endolysosome-targeting conjugate, which is configured to enable improved delivery of cargo molecules, such as cytotoxic drugs (e.g., in ADCs or PDCs) or imaging labels (e.g., in LCs), to the endolysosome pathway in target cells such as cancer cells or other cell types.
[0005] The first aspect describes the endolysosome-targeted conjugate. The endolysosome-targeted conjugate has a targeting component, which includes an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain, where the targeting component is configured to bind to the cell surface molecules of the target cell in the extracellular space with a lower dissociation constant within the endolysosomal compartment of the target cell. The endolysosome-targeted conjugate also has a cargo component, which includes a cargo molecule conjugated to an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain. The targeting component is directly or indirectly fused to the cargo component. The targeting component is configured to dissociate from the cell surface molecules upon entering the endolysosomal compartment. The endolysosome-targeted conjugate is configured to deliver the cargo molecule to the endolysosomal compartment of the target cell.
[0006] The second aspect describes endolysosome-targeted conjugates. Endolisosome-targeted conjugates have a targeting component which includes an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain, where the targeting component is configured to bind to cell surface molecules of the target cell. Endolisosome-targeted conjugates also have a cargo component which includes an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain It contains a conjugated cargo molecule. The targeting component is configured to bind to the cargo component in the extracellular space with a lower dissociation constant in the endolysosomal compartment of the target cell. The targeting component is configured to dissociate from the cargo component upon entering the endolysosomal compartment. The endolysosome-targeting conjugate is configured to deliver the cargo molecule to the endolysosomal compartment of the target cell.
[0007] The composition will be described in accordance with the third aspect. The composition comprises an endolysosome-targeting conjugate and a pharmaceutically acceptable vehicle.
[0008] A fourth aspect describes a method for treating cancer. The method involves administering an effective dose of an endolysosome-targeted conjugate composition to a patient, where the cargo molecule is a cytotoxic drug, and the administration of the composition inhibits tumor growth in the patient.
[0009] A fifth aspect describes a method for imaging tumors in patients. The method comprises (1) administering an effective dose of an endolysosome-targeted conjugate composition to a patient, wherein the cargo molecule is an imaging label, and (2) performing an imaging method suitable for detecting the imaging label in the patient. The administration of the composition provides a sufficient concentration of the imaging label to be detectable by the imaging method.
[0010] In accordance with the sixth aspect, a method for providing an endolysosome-targeted conjugate for the treatment of cancer is described. The method includes (1) a step of selecting a targeting component, wherein the targeting component comprises an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain configured to selectively bind to a cell surface molecule on a selected type of tumor target cell, wherein the targeting component is configured to bind to the cell surface molecule in the extracellular space with a lower dissociation constant in the endolysosomal compartment; (2) a step of selecting a cargo component, wherein the cargo component comprises an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain conjugated to a cargo molecule, wherein the cargo molecule is a cytotoxic drug having efficacy for inhibiting the growth of a selected type of tumor target cell; and (3) a step of providing an endolysosome-targeted conjugate comprising a targeting component directly or indirectly fused to the cargo component.
[0011] In accordance with the seventh aspect, a method for providing an endolysosome-targeted conjugate for the treatment of cancer is described. The method comprises (1) a step of selecting a targeting component, wherein the targeting component comprises an antibody, antibody fragment, nanobody, protein, protein fragment, or protein domain configured to selectively bind to a cell surface molecule on a selected type of tumor target cell; and (2) a step of selecting a cargo component, wherein the cargo component comprises an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain conjugated to a cargo molecule, wherein the cargo molecule is a cytotoxic drug having efficacy for inhibiting the growth of a selected type of tumor target cell. In the method, the targeting component is modified to further include a first protein domain, the cargo component is modified to further include a second protein domain, and the first protein domain is configured to bind to the second domain in extracellular space with a lower dissociation constant in the endolysosomal compartment.
[0012] The above endolysosome-targeting conjugates and methods may further include the following details, which may be combined with each other unless they are clearly mutually exclusive: (i) The targeting component may include an antibody, antibody fragment, or nanobody configured to bind to a cell surface molecule in the extracellular space with a dissociation constant of less than 500 nM; (ii) The targeting component may have a lower dissociation constant at acidic endolysosome pH near neutral pH. iii) May contain antibodies, antibody fragments, or nanobodies configured to bind to cell surface molecules in H; the pH near neutral may be higher than approximately pH 6.8 and lower than approximately pH 7.5, and the acidic endolysosome pH may be higher than approximately pH 5.0 and lower than approximately pH 6.5; iv) The targeted component is endolysosomal Ca 2+ Extracellular Ca at lower dissociation constants at higher concentrations 2+ may include antibodies, antibody fragments, or nanobodies configured to bind to cell surface molecules at a given concentration, v) extracellular Ca 2+The concentration may be around 2 mM, and endolysosomal Ca 2+ The concentration may be approximately 2 μM; vi) The targeted component may include a protein, protein fragment, or protein domain configured to bind to cell surface molecules in the extracellular space with a dissociation constant of less than 500 nM; vii) The targeted component may include a protein, protein fragment, or protein domain configured to bind to cell surface molecules at near-neutral pH with a lower dissociation constant at acidic endolysosome pH; viiii) The targeted component may include endosomal Ca 2+ Extracellular Ca at lower dissociation constants at higher concentrations 2+ix) The cargo component may include a protein, protein fragment, or protein domain configured to bind to a cell surface molecule at a given concentration; x) The cargo component may include an antibody, antibody fragment, antibody Fc region, or domain of an antibody Fc fragment; x) The antibody Fc region or domain of an antibody Fc fragment may be derived from human IgG1; xi) The cargo component may include an albumin molecule or domain of albumin; xii) The targeting component may include a Fab fragment or scFv fragment of a HER2-specific antibody, where the heavy chain variable domain of the Fab fragment or scFv fragment has a mutation to histidine at Ser55 and a mutation to glutamate at Gly57; xiii) The targeting component may include a Fab fragment or scFv fragment of a HER2-specific antibody, where the heavy chain variable domain of the Fab fragment or scFv fragment has a mutation to histidine at Ser103 and the light chain variable domain has a mutation to histidine at Tyr55; xiv) Endolisosomal targeting conjugate xv) The first and second targeting components may be fused to a heterodimer of two immunoglobulin Fc fragments, xvi) The targeting components may include a phosphatidylserine-binding protein, and the target cells may be cells having phosphatidylserine on their cell surface, xvii) The phosphatidylserine-binding protein may be the core domain of AnxA1, Sy xviii) The phosphatidylserine-binding protein may be selected from the group consisting of the C2A domain of t1 and the C2 domain of PKCα, xix) The targeted component may contain two C2A domains of Syt1, xx) The targeted component may contain four C2A domains of Syt1, xxi) The targeted component may contain more than four C2A domains of Syt1, xxii) The targeted component may contain a phosphatidylserine-binding protein, and the cargo component contains the Fc portion of human IgG1.xxiii) The targeting component may be covalently fused to the cargo component by a linker protein, the linker protein may be a Gly4Ser linker, the cargo molecule may be a cytotoxic drug, the cytotoxic drug may be monomethyl auristatin E (MMAE), the cargo molecule may be an imaging label, the targeting component may be configured to bind to the cargo compartment at near-neutral pH with a lower dissociation constant at acidic endosomal pH, the targeting component may be endosomal Ca, 2+ Extracellular Ca at lower dissociation constants at higher concentrations 2+ xxix) The targeting component may be configured to bind to the cargo component at a given concentration, the targeting component may contain calbindin D9K domain 2, and the cargo component may contain calbindin D9K domain 1, xxx) Calbindin domain 1 D9K may be fused to the cargo component by a linker peptide, and / or calbindin D9K domain 2 may be fused to the targeting component by a linker peptide, xxxi) The composition may target tumors of one or more types of target cells. The cargo molecule may consist of at least one endolysosome-targeting conjugate, and may be conjugated by a peptide linker or chemical conjugation reaction. xxxiii) The targeting component may be conjugated to an antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain via a reaction; xxxiv) The imaging label may be radioactive, fluorescent, or near-infrared; xxxv) The N-terminus of the targeting component may be fused to the C-terminus of the cargo component; xxxvi) The targeting component may be fused to the cargo component at a non-terminal position; xxxvii) The cargo component may contain an immunoglobulin Fc fragment, and the targeting component may be fused to the immunoglobulin Fc fragment of the cargo component at the N-terminus or C-terminus of the hinge-CH2-CH3 domain of the immunoglobulin Fc fragment; xxxviii) The targeting component may contain an antibody, antibody fragment, antibody domain, or nanobody configured to bind to human epidermal growth factor receptor 2; xxxix) The targeting component may contain a prostate-specific membrane antibody xl) Endolisosome-targeted conjugates may include antibodies, antibody fragments, antibody domains, or nanobodies configured to bind to the target, xl) Endolisosome-targeted conjugates may include one or more proteins having at least one amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48 or their homologues, xli) Endolisosome-targeted conjugates may include heterodimers of proteins having amino acid sequences of SEQ ID NO: 2 plus SEQ ID NO: 4, SEQ ID NO: 6 plus SEQ ID NO: 8, SEQ ID NO: 42 plus SEQ ID NO: 44 or SEQ ID NO: 46 plus SEQ ID NO: 48 or their homologues, xlii) Endolisosome-targeted conjugates may include SEQ ID NO: 18 plus SEQ ID NO: 20 plus SEQ ID NO: 22,xliii) The targeting component may include an antibody, antibody fragment, antibody domain or nanobody configured to bind to a cell surface molecule with a dissociation constant higher than 1.5 μM at acidic pH. xliv) The targeting component may include a protein, protein fragment or protein domain configured to bind to a cell surface molecule with a dissociation constant higher than 1.5 μM at acidic pH. xlv) The acidic pH may be about 5.8. xlvi) The targeting component may include an antibody, antibody fragment, antibody domain or nanobody configured to bind to a cell surface molecule at a pH from about 6.8 to about 7.5 with a lower dissociation constant at a pH from about 5.0 to about 6.5. xlvii) The targeting component binds to a cell surface molecule at a concentration of about 2 mM Ca with a lower dissociation constant at a concentration of about 2 μM Ca, 2+ and may include an antibody, antibody fragment, antibody domain or nanobody configured to do so. xlviii) The targeting component may include a protein, protein fragment or protein domain configured to bind to a cell surface molecule at a pH from about 6.8 to about 7.5 with a lower dissociation constant at a pH from about 5.0 to about 6.5. xlix) The targeting component binds to a cell surface molecule at a concentration of about 2 mM Ca with a lower dissociation constant at a concentration of about 2 μM Ca, 2+ and may include an antibody, antibody fragment, antibody domain or nanobody configured to do so. xlix) The targeting component binds to a cell surface molecule at a concentration of about 2 mM Ca with a lower dissociation constant at a concentration of about 2 μM Ca, 2+ and may include a protein, protein fragment or protein domain configured to do so.lxx) The targeting component may be configured to bind to a cargo compartment at a pH from about 6.8 to about 7.5 with a lower dissociation constant at a pH from about 5.0 to about 6.5. lxxi) The targeting component binds to a cargo compartment at a concentration of about 2 mM Ca with a lower dissociation constant at a concentration of about 2 μM Ca, 2+ and may include a protein, protein fragment or protein domain configured to do so. lxx) The targeting component may be configured to bind to a cargo compartment at a pH from about 6.8 to about 7.5 with a lower dissociation constant at a pH from about 5.0 to about 6.5. lxxi) The targeting component binds to a cargo compartment at a concentration of about 2 mM Ca with a lower dissociation constant at a concentration of about 2 μM Ca, 2+ and may include a protein, protein fragment or protein domain configured to do so. lxxi) The targeting component binds to a cargo compartment at a concentration of about 2 mM Ca with a lower dissociation constant at a concentration of about 2 μM Ca, 2+(xxii) The cargo molecule may be configured to bind to the cargo component at a given concentration; (xxiii) The cargo molecule may be a cytotoxic radiolabel; (xxiii) The cargo molecule may be a drug or other agent that modifies the behavior of the target cell.
[0013] To fully understand the present invention and its features and advantages, the following description is to be understood together with the accompanying drawings, which are not scaled to any particular degree, and the same numbers in the drawings refer to the same features. [Brief explanation of the drawing]
[0014] [Figure 1] This is a representative schematic diagram of selected cell events that lead to the delivery of cargo molecules into late endosomes and lysosomes by endolysosome-targeted conjugates. [Figure 2] This is a representative schematic diagram of selected cellular events that lead to the dissociation of cargo and targeting components of an endolysosome-targeting conjugate within an endosome, and the subsequent delivery of the cargo component into late endosomes and lysosomes. [Figure 3A] This is a schematic diagram of a typical endolysosome-targeting conjugate containing an antibody that binds to a cell surface protein or cell surface receptor at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3B] This is a schematic diagram of a typical endolysosome-targeting conjugate containing an antibody scFv-Fc fusion protein that binds to cell surface proteins or cell surface receptors at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3C]This is a schematic diagram of a typical endolysosome-targeting conjugate containing an antibody-variable domain / antibody-variable domain fragment-Fc fusion protein that binds to cell surface proteins or cell surface receptors at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3D] This is a schematic diagram of a typical endolysosome-targeting conjugate containing a Fab fragment fused to the N-terminal position of an immunoglobulin hinge and CH3 domain, which binds to cell surface proteins or cell surface receptors at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3E] This is a schematic diagram of a typical endolysosome-targeting conjugate containing an immunoglobulin hinge and an scFv fragment fused to the N-terminal position of a CH3 domain, which binds to cell surface proteins or cell surface receptors at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3F] This is a schematic diagram of a typical endolysosome-targeting conjugate containing an immunoglobulin hinge that binds to cell surface proteins or cell surface receptors at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) at acidic endosomal pH (or lower endosomal Ca2+ concentration) and an antibody variable domain / antibody variable domain fragment fused to the N-terminal position of the CH3 domain. [Figure 3G] This is a schematic diagram of a typical endolysosome-targeting conjugate containing an antibody-variable domain / antibody-variable domain fragment fused to albumin that binds to cell surface proteins or cell surface receptors at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3H] This is a schematic diagram of a typical endolysosome-targeting conjugate containing an antibody Fab fragment fused to albumin that binds to cell surface proteins or cell surface receptors at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3I] This is a schematic diagram of a typical endolysosome-targeting conjugate containing an antibody scFv fragment fused to albumin that binds to cell surface proteins or cell surface receptors at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3J] This is a schematic diagram of a typical endolysosome-targeting conjugate containing a protein, protein domain, or fragment fused to the N-terminal position of an Fc fragment. The protein, protein domain, or protein fragment binds to cell surface proteins or cell surface receptors at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3K] This is a schematic diagram of a typical endolysosome-targeting conjugate containing a protein, protein domain, or fragment fused to the C-terminal position of an Fc fragment. The protein, protein domain, or protein fragment binds to cell surface proteins or cell surface receptors at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3L]This is a schematic diagram of a typical endolysosome-targeting conjugate containing a protein, protein domain, or fragment fused to both the N-terminus and C-terminus of an Fc fragment. The protein, protein domain, or protein fragment binds to cell surface proteins or cell surface receptors at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3M] This is a schematic diagram of a typical endolysosome-targeting conjugate that contains a protein, protein domain, or protein fragment fused to both the N-terminus and C-terminus of an Fc fragment, forming a heterodimer with two protein domains or fragment molecules per Fc fragment. The protein, protein domain, or protein fragment binds to cell surface proteins or cell surface receptors at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3N] This is a schematic diagram of a typical endolysosome-targeting conjugate that contains a protein, protein domain, or protein fragment fused to the C-terminal position of an Fc fragment, forming a heterodimer with one protein, protein domain, or fragment molecule per Fc fragment. The protein, protein domain, or protein fragment binds to cell surface proteins or cell surface receptors at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3O]This is a schematic diagram of representative endolysosome-targeting conjugates, including Fab-proteins (domains) and protein (domain)-Fc fusions, designed to associate with each other at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3P] This is a schematic diagram of representative endolysosome-targeting conjugates, including scFv fragment-protein(domain) and protein(domain)-Fc fusions, designed to associate with each other at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3Q] This is a schematic diagram of typical endolysosome-targeting conjugates, including antibody-variable domain-protein(domain) and protein(domain)-Fc fusions, designed to associate with each other at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3R] This is a schematic diagram of a typical endolysosome-targeting conjugate containing an antibody that includes two Fab fragments that bind to two or more cell surface receptors or cell surface molecules at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 3S] This is a schematic diagram of a typical endolysosome-targeting conjugate containing an antibody that includes two scFv fragments that bind to two or more cell surface receptors or cell surface molecules at near-neutral pH (or extracellular Ca2+ concentration) with higher affinity (lower dissociation constant) at acidic endosomal pH (or lower endosomal Ca2+ concentration). [Figure 4A]This section presents representative data on the binding analysis of typical HER2-targeted endolysosome-targeted drugs (without conjugates) to HER2 at various pH values. [Figure 4B] This section presents representative data on the dissociation constants to HER2 at various pH values for typical HER2-targeted endolysosome-targeted drugs (without conjugates). [Figure 5A] This graph shows representative data from flow cytometry analysis of HER2 expression levels in various tumor cell lines. [Figure 5B] This graph shows representative data from flow cytometry analysis of the internalization and accumulation of representative HER2-targeted endolysosome-targeted conjugates in various tumor cell lines. [Figure 5C] A series of representative microscopic images comparing the localization of typical HER2-targeted endolysosome-targeted conjugates in dextran-positive lysosomes is shown. [Figure 6] This graph shows representative data regarding the effects of HER2-targeted endolysosome-targeted conjugates and control MMAE conjugates on tumor cell survival. [Figure 7A] The graphs show representative whole-body counts and blood counts over time for representative HER2-targeted endolysosome-targeted conjugates in mice. [Figure 7B] This graph shows representative data on the effects of typical HER2-targeted endolysosome-targeted conjugates and control proteins on tumor growth (MDA-MB-453 cells) in mice. [Figure 8A] Representative binding data for interactions between representative HER2-targeted fusion proteins, including antibody Fab (HER2-specific) and calbindin domains 2 and 1 fused to Fc fragments, are shown. [Figure 8B]The graphs show representative data from flow cytometry analysis of internalization and accumulation in prostate cancer cells for representative prostate-specific membrane antigen (PSMA) targeted antibodies, including antibody Fab(026, PSMA-specific) and representative calbindin domains 2 and 1 fused to Fc fragments, respectively. [Figure 9] This graph shows representative gel filtration chromatography analyses of typical PS-targeted Fc fusion proteins. [Figure 10A] This is a schematic diagram and analysis of representative PS-targeting drugs (PS-targeting proteins, AnxA1, synaptotagmin 1 (Syt1) C2A domains, and Fc fusions containing human IgG1-derived Fc linked to PKCα). The black circles (filled circles) and rectangles represent the PS-targeting domain and IgG1 hinge region, respectively. The right panel shows the SDS-PAGE analysis of endolysosome-targeting drugs, with molecular weight (MW) shown in kDa on the left. [Figure 10B] This shows the typical lipid binding distribution of representative PS-targeting drugs that use lipid-coated nitrocellulose membranes. [Figure 10C] This graph shows the typical binding of representative PS-targeted drugs to PS-positive 2H11 and MDA-MB-231 cells, using flow cytometry analysis. [Figure 10D] This graph shows the systemic counts for representative PS-targeted drugs against typical time intervals. [Figure 10E] Figure 10D shows a graph reporting the area under the curve for representative PS-targeting drugs based on the data presented. [Figure 10F] This image shows a representative whole-body image of a tumor-carrying mouse injected with a representative PS-targeting drug labeled with a near-infrared dye (IRDye800CW). [Figure 10G] Figure 10F shows a graph reporting representative tumor-related fluorescence for representative PS-targeted drugs labeled with near-infrared dye (IRDye800CW) in relation to the image shown. [Figure 10H]This paper presents graphs reporting representative tumor images following 48 hours of injection into tumor-carrying mice, as well as the average dye intensity for representative PS-targeted drugs labeled with near-infrared dye (IRDye800CW). [Figure 11A] The left panel shows schematic diagrams and analyses of representative bivalent and tetravalent PS-targeting drugs, with black circles indicating the Syt1 C2A domain. The right panel shows the SDS-PAGE analysis of the Syt1-Fc fusion, with molecular weight (MW) indicated in kDa on the right. [Figure 11B] This shows a representative gel filtration chromatography analysis of a typical PS-targeted Fc fusion protein containing four Syt1 molecules per Fc fragment. [Figure 11C] This shows typical binding of PS-targeted drugs to PS-coated nitrocellulose membranes and lipid-coated nitrocellulose membranes. [Figure 11D] This graph shows the typical binding of representative PS-targeting drugs and control proteins to cells with exposed PS. [Figure 11E] This graph shows the typical internalization of representative PS-targeting drugs into cells with exposed PS. [Figure 11F] The images show representative microscopic images of a series of typical PS-targeting drugs and control proteins in endothelial cells (2H11), with lysosomes in the cells labeled with LAMP-1 specific antibodies. [Figure 11G] Representative microscopic images of a different series of representative PS-targeted drugs and control proteins in tumor cells (MDA-MB-231) are shown, with lysosomes in the cells labeled with a LAMP-1 specific antibody. [Figure 12A] The left panel shows a schematic diagram and analysis of representative PS-targeted endolysosome-targeted conjugates containing MMAE (small black circle) and a conjugated cargo component. The right panel shows the SDS-PAGE analysis of unconjugated or MMAE-conjugated PS-targeted drugs, with molecular weight (MW) indicated in kDa on the left. [Figure 12B]Representative mass spectrometry results for typical MMAE-conjugated PS-targeted endolysosome-targeted conjugates are shown. [Figure 12C] This shows typical gel filtration chromatography analysis of representative PS-targeted endolysosome-targeted conjugates. [Figure 12D] This panel shows representative analyses of the binding of typical PS-targeted endolysosome-targeted conjugates to PS in the presence of the indicated Ca2+ concentrations (left panel) or pH levels (right panel). Bead-associated proteins were analyzed using immunoblotting. [Figure 13A] This image shows a representative series of microscopic images of a typical PS-targeted endolysosome-targeted conjugate and a control MMAE conjugate in tumor cells (MDA-MB-231), where early endosomes in the cells are labeled with an EEA-1 specific antibody. Specific endosomes are cropped and magnified (labeled a and b). [Figure 13B] The images show a representative series of microscopic images of a typical PS-targeted endolysosome-targeted conjugate and a control MMAE conjugate in tumor cells (MDA-MB-231), where the lysosomes in the cells are labeled with a LAMP-1 specific antibody. [Figure 13C] A representative series of microscopic images showing the effects of representative PS-targeted endolysosome-targeted conjugates and control MMAE conjugates on tubulin in endothelial cells (2H11) and tumor cells (MDA-MB-231) are shown. [Figure 14A] This graph shows representative flow cytometry data illustrating the level of PS exposed on tumor cells. [Figure 14B] This graph shows representative data regarding the effects of representative PS-targeted endolysosome-targeted conjugates and control MMAE conjugates on tumor cell survival. [Figure 14C]This graph shows representative flow cytometry data illustrating the levels of representative PS-targeted endolysosome-targeted conjugates internalized in tumor cells after a 2-hour incubation. [Figure 14D] This graph shows representative data demonstrating that typical PS-targeted Fc fusions (without conjugated drugs) do not affect cell viability. [Figure 15A] This graph shows the whole-body count against typical time intervals for representative PS-targeted endolysosome-targeted conjugates. [Figure 15B] A representative graph reporting the area under the curve for the data shown in Figure 15A regarding typical PS-targeted endolysosome-targeted conjugates is shown. [Figure 15C] This graph shows representative data regarding the effects of typical PS-targeted endolysosome-targeted conjugates and control proteins on tumor growth (MDA-MB-231 cells) in mice. [Figure 15D] This graph shows representative data regarding the effects of typical PS-targeted endolysosome-targeted conjugates and control proteins on body weight in tumor-carrying mice. [Figure 15E] This graph shows representative data regarding the effects of typical PS-targeted endolysosome-targeted conjugates and control proteins on tumor growth (LNCaP cells) in mice. [Figure 16A] SDS-PAGE analysis of MMAE-conjugated and unconjugated control endolysosome-targeting conjugates (modified using DN mutations to reduce PS binding activity) and control proteins is shown. [Figure 16B] This shows the typical lipid binding distribution to a lipid-coated nitrocellulose membrane for representative PS-targeted endolysosome-targeted conjugates that bind to PS, or for (DN) control endolysosome-targeted conjugates that have been modified to bind to PS with low affinity. [Figure 16C]This graph shows representative binding of representative PS-targeted endolysosome-targeted conjugates (DN) that bind to PS or are modified to bind with low affinity to PS, to PS-positive 2H11 cells, as reported by flow cytometry analysis. [Figure 16D] This graph shows representative data regarding the effects of typical PS-targeted endolysosome-targeted conjugates and control proteins on tumor growth (LNCaP cells) in mice. [Figure 16E] Representative images of tumors (LNCaP cells) isolated from mice treated with typical PS-targeted endolysosome-targeted conjugates and control proteins are shown. [Figure 17A] A representative series of microscopic images showing the locations of typical PS-targeted endolysosome-targeted conjugates and controls (PBS vehicles) in CD31-positive endothelial cells within tumor tissue is presented. [Figure 17B] A representative series of microscopic images showing the locations of typical PS-targeted endolysosome-targeted conjugates and controls (PBS vehicles) in F4 / 80-positive macrophages within tumor tissue is presented. [Modes for carrying out the invention]
[0015] This disclosure relates to a modified antibody or fusion protein configured to enable enhanced delivery of cargo molecules, such as cytotoxic drugs or imaging labels, to late endosomes and lysosomes in target cells. As used herein, the terms “endolysosome” and “endolysosomal compartment” refer to the early endosomes, late endosomes, lysosomes, and associated tubulovesicular transport carriers of cells. Accordingly, as used herein, the term “endolysosome-targeting conjugate” refers to a modified antibody or fusion protein configured to enhance the delivery of cargo molecules to the endolysosomal compartment of target cells.
[0016] The antibodies or fusion proteins described herein include a targeting component and a cargo component. The targeting component may include antibodies, antibody fragments, antibody domains, nanobodies, proteins, protein fragments, or protein domains, which are configured to bind to cell surface molecules such as cell surface receptors or other cell surface molecules that may be present on the extracellular surface of the cell's plasma membrane, where the molecules are at least partially exposed to the extracellular space. The cargo component may include antibodies, antibody fragments, antibody domains, nanobodies, proteins, protein fragments, or protein domains conjugated to cargo molecules such as cytotoxic drugs or imaging labels.
[0017] As used herein, the terms “antibody-drug conjugate” or “ADC” refer to an antibody-based conjugate configured to deliver a drug to a cell. In particular, as used herein, the terms “antibody-drug conjugate” or “ADC” refer to an antibody comprising a targeting component and a cargo component. The targeting component may include an antibody Fab fragment, an antibody variable domain, or a nanobody. The targeting component is conjugated to a cargo component, which may include an antibody constant region (Fc fragment) or a domain of the constant region. One or more cytotoxic drug molecules may be conjugated to the antibody constant region (Fc fragment) or a domain of the constant region of the cargo component of the ADC.
[0018] As used herein, the terms “protein-drug conjugate” or “PDC” refer to a protein-based conjugate configured to deliver a drug to a cell. In particular, as used herein, the terms “protein-drug conjugate” or “PDC” refer to a protein containing a targeting component and a cargo component. The targeting component may include a protein or Fab fragment, antibody variable domain, or nanobody that binds to a cell surface receptor or cell surface molecule. The targeting component is ligated to a cargo component, which may include an antibody constant region (Fc fragment), a constant region domain, or a protein such as albumin. One or more cytotoxic drug molecules may be conjugated to an antibody constant region (Fc fragment), a constant region domain, or a protein such as albumin in the cargo component of the PDC.
[0019] As used herein, the terms “labeled conjugate” or “LC” refer to an antibody or protein containing a targeted component conjugated to a cargo component. Therefore, the targeted component may include an antibody Fab fragment, antibody variable domain, nanobody, or protein that binds to a cell surface receptor or cell surface molecule. The cargo component may include an antibody constant region (Fc fragment) or domain of the constant region, or a protein such as albumin. The antibody constant region (Fc fragment) or domain of the constant region or protein of the cargo component may be conjugated to one or more imaging labels, such as radiolabels, fluorescent molecules, or other labeled molecules.
[0020] Generally, for ADCs or PDCs to effectively deliver drugs to cells, they must selectively bind to target cells, be internalized within the cells, and enter degradative compartments called late endosomes and lysosomes. Before entering lysosomes, ADCs or PDCs enter early endosomes, where sorting for recirculation or the lysosomal pathway takes place. Improved delivery to late endosomes and lysosomes (endolysosomal pathway) results in more potent ADCs or PDCs, enabling the use of lower doses.
[0021] Furthermore, LCs that enable improved delivery of imaging labels to late endosomes and lysosomes in target cells will produce higher contrast in imaging of target cells against the background of untargeted cells or tissues.
[0022] Accordingly, the present invention generally relates to endolysosome-targeting conjugates modified to more effectively deliver cargo molecules to the endolysosomal compartment of target cells, wherein the modified conjugates described herein are configured to react to differences in chemical composition between the endosome or late endosome and the extracellular environment, thereby achieving more effective delivery of cargo molecules such as cytotoxic drugs or imaging labels to target cells. Examples of endolysosome-targeting conjugates described herein include improved ADCs, PDCs and LCs configured to enhance the targeting of conjugated cargo molecules such as drugs or imaging labels to the endolysosomal compartment of target cells, thereby producing more potent ADCs or PDCs or higher-contrast LCs.
[0023] The cargo molecules described herein may include any molecule that has a useful function for producing an effect in target cells. In addition to cytotoxic drugs or imaging labels, for example, additional cargo molecules may be radioactive labels that kill cells via radiation damage, i.e., can be used for therapeutic purposes rather than imaging. Examples of such radioactive labels are yttrium(Y)-90 and iodine(I)-131. Additional types of cargo molecules will be identifiable to those skilled in the art by reading this disclosure.
[0024] In addition to tumor cells, target cells in the sense of this disclosure may include other types of undesirable cells, such as inflammatory cells or virus-infected cells, among others that can be identified by those skilled in the art who read this disclosure.
[0025] As used herein, the term “cell surface molecule” refers to proteins and other biomolecules (e.g., phospholipids, carbohydrates) that are at least partially exposed on the extracellular surface of the cell’s plasma membrane.
[0026] Figures 1 and 2 show a schematic diagram of a typical mechanism by which the endolysosome-targeted conjugate of this disclosure enhances the delivery of cargo molecules. When the targeted component binds to a cell surface molecule, the endolysosome-targeted conjugate is internalized into the cell (Figures 1 and 2).
[0027] As shown in the typical schematic form in Figure 1, the endolysosome-targeting conjugate has a lower (acidic) pH and lower Ca 2+ Lower concentration of Cl - or Na + Higher concentration, higher K +Due to concentration or other environmental conditions that distinguish endosomes from the extracellular space, receptors or cell surface molecules may dissociate in early or late endosomes (as described, for example, in Scott, CC, Gruenberg, J. (2010) Ion flux and the function of endosomes and lysosomes: pH is just the start. Bioessays 33, 103-110). Therefore, in some examples of endolysosome-targeting conjugates described herein, cell surface molecules may dissociate. The affinity of the targeting component is higher in the extracellular space than within the endolysosomal compartment. Thus, the targeting component and cell surface molecules may bind with a lower dissociation constant in the extracellular space. The endolysosomal targeted conjugate is delivered to late endosomes or lysosomes, resulting in the release of the drug or label.
[0028] In another example, as shown in the typical schematic diagram in Figure 2, the targeting and cargo components of an endolysosome-targeting conjugate may associate with each other through non-covalent interactions, which may occur at near-neutral pH or extracellular Ca. 2+ It is stable in terms of concentration, but its endosomal (acidic) pH or endosomal Ca 2+ The targeting component is unstable under certain environmental conditions, such as concentration or other conditions that distinguish endosomes from the extracellular space. While the cargo component is released within early or late endosomes and enters lysosomes, the targeting component can be recirculated and reloaded with the cargo component. Therefore, in some examples of endolysosome-targeted conjugates described herein, the affinity of the targeting component for the cargo component is higher in the extracellular space than in the endolysosome compartment. Thus, the targeting component may bind to the cargo component in the extracellular space with a lower dissociation constant.
[0029] The targeting component and the cargo component may be linked by covalent bonds, or they may associate with each other non-covalently.
[0030] Examples of endolysosome-targeted conjugates described herein include a targeting component configured to bind to cell surface molecules such as HER2 or prostate-specific membrane antigen (PSMA). In particular, representative endolysosome-targeted conjugates may bind to cell surface molecules such as HER2 or PSMA with affinity less than 500 nM at near-neutral pH.
[0031] Examples of endolysosome-targeting conjugates described herein include a targeting component configured to bind to cell surface molecules such as PS. In particular, representative PDCs may bind to cell surface molecules such as PS with affinity less than 500 nM at near-neutral pH.
[0032] HER2 and PSMA are cell surface receptors that are overexpressed on tumors and are therefore well-characterized tumor targets. The endolysosome-targeting conjugates of this disclosure are not limited to targeting these receptors or cell surface molecules such as prostate stem cell-associated antigens, and many other targets such as EpCAM, c-MET, carcinoembryonic antigen (CEA), CD19, CD20, CD33, CD38, epidermal growth factor receptor (EGFR), glypican-2, CD56, insulin-like growth factor receptor 1, tumor endothelial marker 8 (TEM-8), CD46, and many others can be identified by those skilled in the art by reading this disclosure.
[0033] PS is present within the inner lobe of the plasma membrane of normal cells, but in response to oxidative stress and inflammatory factors in the tumor microenvironment, it becomes exposed on the outer lobe of the membrane of cancer endothelial cells. Based on studies in mouse models, PS exposure appears to be a "universal" marker of tumor vascularity. Typically, less than half of tumor vessels are PS-positive, and exposure can increase with radiation and chemotherapy. In addition to tumor endothelium, PS has also been reported to be exposed on many non-apoptotic cancer cells, including melanoma, breast cancer, prostate cancer, and renal cancer.
[0034] Therefore, the targeting component may include any type of molecule configured to specifically bind to cell surface receptors or other cell surface molecules. Such molecules may include proteins, protein fragments, polynucleotides such as ribonucleic acid or deoxyribonucleic acid, polypeptides, polysaccharides, lipids, amino acids, peptides, sugars and / or other small or large molecules and / or polymers that can be identified by those skilled in the art who read this disclosure. ru.
[0035] As shown in Figure 1, the endolysosome-targeting conjugate 20 contains a targeting component 20T and a cargo component 20C. The cargo component is bound to a drug or label indicated by a black circle. It may reversibly bind to cell surface receptors or other molecules 30 on the surface of cell 10. This binding typically occurs at near-neutral pH levels, such as pH above approximately 6.8 and below approximately 7.5, because this is the typical pH of the extracellular space 40. Binding to cell surface receptors or cell surface molecules is typical of extracellular Ca 2+ This can occur even at concentrations of approximately 2 mM. The cell surface receptor or molecule 30 bound to the endolysosome-targeting conjugate 20 is internalized within the cell 10 via receptor-mediated absorption into the endosome 50. The complex of the endolysosome-targeting conjugate 20 and the cell surface receptor or other molecule 30 is formed within early or late endosomes, in the acidic pH (approximately pH 5.0 to approximately pH 6.5) or low Ca in these compartments. 2+ Due to its concentration (approximately 2 μM), it dissociates from receptors and other molecules 30. Consequently, the receptor or cell surface molecule 30 is recirculated back to the cell surface within the recirculated endosome 60, and the endolysosome-targeted conjugate 20 may be reloaded. However, the endolysosome-targeted conjugate 20 that has dissociated endosomalally enters the lysosome and is broken down into fragments (70). The endolysosome-targeted conjugate is configured to bind to cell surface receptors and other molecules under extracellular conditions, and at least 10% of the endolysosome-targeted conjugate internalized in the cell dissociates in endosomes or late endosomes.
[0036] As shown in Figure 2, the endolysosome-targeting conjugate, containing the targeting component 80 and cargo component 90 (to which drugs or other labels are bound, indicated by black circles), may reversibly bind to cell surface receptors and other molecules 30 on the surface of cell 10. The association of the targeting component 80 and cargo component 90 typically occurs at near-neutral pH levels, such as pH above 6.8 and below 7.5, because this is the typical pH of the extracellular space 40. The association of the targeting component 80 and cargo component 90 occurs at extracellular Ca 2+ This can occur even at concentrations of approximately 2 mM. The cell surface receptor or molecule 80 bound to the endolysosome-targeting conjugate is internalized into the cell 10 via receptor-mediated absorption into the endosome 50. The targeted component 80 and cargo component 90 are absorbed within the early or late endosome in the acidic pH (typically less than pH 6.8) or low Ca within these compartments. 2+ Due to its concentration (approximately 2 μM), it dissociates. Therefore, the targeted component 80 bound to the receptor or cell surface molecule is recirculated back to the cell surface within the recirculating endosome 60, and the cargo component 90 may be reloaded. However, the cargo component 90 dissociated by the endosome enters the lysosome and is broken down into fragments (70). The endolysosome-targeted conjugate is configured to bind to cell surface receptors and other molecules under extracellular conditions, and at least 10% of the cargo component internalized in the cell dissociates in the endosome or late endosome.
[0037] Endlysosome-targeting conjugates according to this disclosure are near-neutral pH or extracellular Ca 2+The targeting component is configured to specifically bind to cell surface receptors / molecules at a given concentration. As used herein, the term “specifically bind” refers to a detectable, selective intermolecular interaction between the targeting component and the cell surface receptor / molecule. For example, to specifically bind, the targeting component must exhibit a detectable interaction with the targeted cell surface receptor or cell surface molecule, while exhibiting no detectable interaction with other cell surface receptors or cell surface molecules, or exhibiting a much lower affinity interaction. Methods for detecting specific binding are known in the art, such as ELISA and other methods that can be identified by those skilled in the art.
[0038] Therefore, the endolysosome-targeting conjugate internalizes the linked cargo component into cells expressing the targeted cell surface receptor or other targeted cell surface molecule, and then... It enables degradation within cells.
[0039] An endolysosome-targeting conjugate may contain at least a first targeting component and a second targeting component, where the first targeting component is different from the antibody Fab fragment, single-chain Fv(scFv), nanobody, protein, or protein fragment of the second targeting component. Therefore, an endolysosome-targeting conjugate containing at least a first targeting component and a second targeting component can bind to two types of cell surface receptors or cell surface molecules.
[0040] Furthermore, endolysosome-targeted conjugates may contain human or humanized proteins or protein fragments to avoid or reduce the possibility of an immune response to the endolysosome-targeted conjugate when administered to humans. For the administration of endolysosome-targeted conjugates to humans, the targeting and cargo components are preferably human proteins or protein fragments. For the administration of endolysosome-targeted conjugates to humans, the targeting and cargo components are preferably human antibodies, antibody fragments, or human proteins or protein fragments such as human albumin or albumin fragments, or humanized antibodies or humanized antibody fragments. When developing endolysosome-targeted conjugates for use in non-human animals, proteins or protein fragments derived from or modified to be immunologically compatible with those animals may be used instead.
[0041] Figure 3A shows the (or endosome Ca) at acidic endosome pH. 2+ (at concentration) with higher affinity at near-neutral pH (or extracellular Ca 2+ This is a schematic diagram of a typical endolysosome-targeting conjugate (20a) containing an antibody Fab fragment (100) configured to bind to a cell surface protein or cell surface molecule (at a given concentration). The Fc fragment (110) is homodimeric. As those skilled in the art will understand, the IgG Fc fragment is the entire Y-shaped base of the antibody, which includes a sulfhydryl-bridged hinge region and CH2 and CH3 domains. In this example, the cargo molecule (120) is bound to the hinge region via chemical conjugation to a cysteine residue.
[0042] Figure 3B shows (or endosome Ca) at acidic endosome pH. 2+ (at concentration) with higher affinity at near-neutral pH (or extracellular Ca 2+This is a schematic diagram of a typical endolysosome-targeting conjugate (20b) containing an antibody scFv fragment (260) configured to bind to a cell surface protein or cell surface molecule (at a given concentration). The Fc fragment (110) is homodimeric. In this example, the cargo molecule (120) is bound to the hinge region via chemical conjugation to a cysteine residue.
[0043] Figure 3C shows the (or endosome Ca) at acidic endosome pH. 2+ (at concentration) with higher affinity at near-neutral pH (or extracellular Ca 2+ This is a schematic diagram of a typical endolysosome-targeting conjugate (20c) containing an antibody-variable domain or fragment (130) configured to bind to a cell surface protein or cell surface molecule (at a given concentration). The Fc fragment (110) is homodimeric. In this example, the cargo molecule (120) is bound to the hinge region via chemical conjugation to a cysteine residue.
[0044] The antibody variable region 130 may include a portion of the antibody's non-variable region that is configured to bind to cell surface receptors or cell surface molecules. For example, the antibody variable region 130 may contain a single-dominant receptor. The variable region may be an in antibody (sdAb) or a camel-derived VHH domain (also commonly called a nanobody). Such a variable region has an overall fold of an immunoglobulin domain containing two antiparallel β-sheets and may also include domains from other members of the immunoglobulin superfamily, such as the T cell receptor variable domain, the constant region domain of an antibody, or the coreceptor, CD4 domain, among others that can be identified by those skilled in the art. The antibody variable region may also include a heterodimer of the heavy chain variable (VH) domain, which is linked to the light chain variable (VL) domain by a peptide linker to form the scFv fragment (260). Linker sequences used to link the VH and VL domains are well known to those skilled in the art and include the GGGGSGGGGSGGGGS[(G4S)3] sequence which links the C-terminus of the VH domain to the N-terminus of the VL domain. The C-terminus of the VL domain can be linked to the N-terminus of the VH domain using a similar linker sequence. pH-dependent, Ca 2+ scFvs, which bind to cell surface receptors and other cell surface molecules via dependency, etc., can be isolated from a library of scFvs using phage display, yeast display, or other antibody display methods. The targeting component of the endolysosome-targeting conjugate may include Fab fragments of antibodies that can be isolated from a library of Fab fragments using phage display or yeast display, among other methods known to those skilled in the art. With respect to nanobodies, scFvs, and Fab fragments, desired binding affinity (pH-dependent, Ca) to the target cell surface receptor or cell surface molecule can be determined by randomly mutating residues in the complementarity-determining regions (CDRs) or by forming a library of mutated nanobodies or variable domains using an Erer-prone polymerase chain reaction, and then selecting them. 2+The dependency can be further improved. Representative target CDR residues are those in CDR3 of the light chain variable domain (residues 89-97, Kabat numbering) and CDR3 of the heavy chain variable domain (residues 95-102, Kabat numbering). These libraries can be displayed on phages or yeast, and mutants with the desired binding behavior can be selected using methods known to those skilled in the art.
[0045] Figure 3D shows the acidic endosome pH (or endosome Ca) 2+ (at concentration) with higher affinity at near-neutral pH (or extracellular Ca 2+ This is a schematic diagram of a typical endolysosome-targeting conjugate (20d) containing an antibody Fab fragment (100) configured to bind to a cell surface protein or cell surface molecule (at a given concentration). The Fab fragment ligates to an immunoglobulin CH3 domain (140) to form a homodimer. In this example, the cargo molecule (120) is bound to the hinge region via chemical conjugation to a cysteine residue.
[0046] Figure 3E shows the (or endosome Ca) at acidic endosome pH. 2+ (at concentration) with higher affinity at near-neutral pH (or extracellular Ca 2+ This is a schematic diagram of a typical endolysosome-targeting conjugate (20e) containing an antibody scFv fragment (260) configured to bind to a cell surface protein or cell surface molecule (at a given concentration). The scFv fragment ligates to an immunoglobulin CH3 domain (140) to form a homodimer. In this example, the cargo molecule (120) is bound to the hinge region via chemical conjugation to a cysteine residue.
[0047] Figure 3F shows the (or endosome Ca) at acidic endosome pH. 2+ (at concentration) with higher affinity at near-neutral pH (or extracellular Ca 2+This is a schematic diagram of a typical endolysosome-targeting conjugate (20f) containing an antibody-variable domain or fragment (130) configured to bind to a cell surface protein or cell surface molecule (at a given concentration). The protein fragment or domain ligates to an immunoglobulin CH3 domain (140) to form a homodimer. In this example, the cargo molecule (120) is bound to the hinge region via chemical conjugation to a cysteine residue.
[0048] Figure 3G shows the (or endosome Ca) at acidic endosome pH. 2+ (at concentration) with higher affinity at near-neutral pH (or extracellular Ca 2+This is a schematic diagram of a typical endolysosome-targeting conjugate (20g) containing an antibody-variable domain or fragment (130) configured to bind to cell surface proteins or cell surface molecules (at a given concentration). The antibody-variable domain or fragment is linked to albumin or albumin fragment (150), which may be mutated or modified to bind to the neonatal Fc receptor (FcRn) with improved affinity. For example, mutations can be inserted into the FcRn-binding domain (DIII) of (human serum) albumin using error-prone PCR and subsequent display of a library of mutant albumin variants on yeast or phage and selection of higher-affinity variants. Alternatively, higher-affinity variants can be produced by mutating residues at or near the albumin:FcRn interface and selecting or screening for albumin variants with improved binding affinity. Figure 3G shows the antibody-variable domain or fragment (130) at the terminal position of albumin or albumin fragment 150, although it may instead be at a non-terminal position. The antibody variable domain or fragment may fuse to albumin or albumin fragment 150 by any suitable method, including chemical linkage or peptide linker linkage. In this example, the cargo molecule (120) is conjugated to an exposed amino acid such as cysteine or lysine via chemical conjugation.
[0049] In the representative schematic diagrams shown in Figures 3H and 3I, the antibody variable domain or fragment 130 shown in Figure 3G is replaced by Fab fragment 100 (Figure 3H) or scFv fragment 260 (Figure 3I), and these are used in acidic endosome pH (or endosome Ca 2+ (at concentration) with higher affinity at near-neutral pH (or extracellular Ca 2+It is configured to bind to cell surface proteins or cell surface molecules (at a given concentration). In this example, the cargo molecule (120) is bound to an exposed amino acid such as cysteine or lysine via chemical conjugation.
[0050] Figure 3J shows the (or endosome Ca) at acidic endosome pH. 2+ (at concentration) with higher affinity at near-neutral pH (or extracellular Ca 2+ This is a schematic diagram of a typical endolysosome-targeting conjugate (20j) containing a protein fragment or domain (160) configured to bind to a cell surface protein or cell surface molecule (at a given concentration). The protein fragment or domain ligates to the N-terminus of Fc fragment 110 to form a homodimer. In this example, the cargo molecule (120) is bound to the hinge region via chemical conjugation to a cysteine residue.
[0051] In the representative schematic diagrams shown in Figures 3K and 3L, the protein fragment or domain (160) either ligates to the C-terminus of the Fc fragment (110) to form a homodimer (Figure 3K), or ligates to both the N and C-terminuses of the Fc fragment (110) to form a homodimer (Figure 3L). In this example, the cargo molecule (120) is bound to the hinge region via chemical conjugate to a cysteine residue.
[0052] Figure 3M shows (or endosome Ca) at acidic endosome pH. 2+ (at concentration) with higher affinity at near-neutral pH (or extracellular Ca 2+ This is a schematic diagram of a typical endolysosome-targeting conjugate (20m) containing a protein fragment or domain (160) configured to bind to a cell surface protein or cell surface molecule (at a given concentration). The protein fragment or domain is ligated to the N and C-terminuses of Fc fragment (170), which is configured to heterodimerize with another Fc fragment 180 without the protein fragment or domain, as shown in Figure 3M. This generates a dorysosome-targeting conjugate 20m. Figure 3N shows a schematic diagram of a typical PDC or LC20n in which a protein fragment or domain (160) is fused to the C-terminus of an Fc fragment (170). In the examples shown in Figures 3M and 3N, the cargo molecule (120) is bound to the hinge region via chemical conjugation to a cysteine residue. To avoid Fc fragment homodimers in which both Fc fragments either have a fusion protein fragment or domain (160) or do not have a fusion protein or protein domain, knobs-into-holes mutations (e.g., Moore, GL, Bautista, C., Pong, E., Nguyen, DH, Jacinto, J., Eivazi, A., Muchhal, US, Karki, S., Chu, SY, Lazar, GA, (2011). A novel bispecific antibody This format enables simultaneous bivalent and monovalent co-engagement of distinct target antigens. Endolisosome-targeted conjugates can be designed to promote heterodimer formation using electrostatic steering mutations (such as those described in MAbs 3,546-557) and / or electrostatic steering mutations (e.g., Gunasekaran, K., Pentony, M., Shen, M., Garrett, L., Forte, C., Woodward, A., Ng, SB, Born, T., Retter, M., Manchulenko, K., Sweet, H., Foltz, IN, Wittekind, M., Yan, W. (2010) Enhancing antibody Fc heterodimer formation through electrostatic steering effects: applications to bispecific molecules and monovalent IgG. J. BiolChem. 285, 19637-19646). For heterodimer formation, (e.g., Zhou, L., Wang, HY., Tong, S., Okamono, CT, Shen, WC., Zaro, JL (2016)) Single chain Fc-dimer-human growth hormone fusion protein for improved drug delivery. (As described in Biomaterials, 117, 24-31) (G4S between the C-terminus of the antigen-Fc fusion and the N-terminus of the second Fc fragment) 13 Other methods, such as linker peptide insertion, can also be used. Examples of DNA and protein sequences of endolysosome-targeted conjugates, including Knob-in-Towholes mutations, electrostatic steering mutations, and / or other mutations, are described in Example 14.
[0053] Examples of Knobs-in-Two-Halls mutations include, among others identifiable to those skilled in the art (as described in, for example, Moore, GL, Bautista, C., Pong, E., Nguyen, DH, Jacinto, J., Eivazi, A., Muchhal, US, Karki, S., Chu, SY, Lazar, GA, (2011) A novel bispecific antibody format enables simultaneous bivalent and monovalent co-engagement of distinct target anatigens. MAbs 3,546-557), Y349T / T394F:S364H / F405A and Y349T / F405F:S364H / T394F, as well as (for example, Atwell, S., Ridgway, JBB, Wells, JA, Carter, P (1997) Stable heterodimers from remodeling the domain interface of a homodimer using a phage display) This includes T366W:T366S:L368A / Y407V, as described in libary.J.Mol.Biol.,270,26-35. These are representative residues of the Knob's-in-Two-Holes mutation. The numbering referred to is the EU Antibody Numbering System, as those skilled in the art will understand.
[0054] Examples of electrostatic steering mutations include E356K / D399K:K392D / K409D and K409D / K370D:D357K / D399K, among others that can be identified by those skilled in the art (for example, as described in Gunasekaran, K., Pentony, M., Shen, M., Garrett, L., Forte, C., Woodward, A., Ng, SB, Born, T., Retter, M., Manchulenko, K., Sweet, H., Foltz, IN, Wittekind, M., Yan, W. (2010) Enhancing antibody Fc heterodimer formation through electrostatic steering effects: applications to bispecific molecules and monovalent IgG. J Biol Chem 285, 19637-19646). The residue numbering of these representative electrostatic steering mutations refers to the EU antibody numbering system, as those skilled in the art will understand.
[0055] Figure 3O is a schematic diagram of a typical endolysosome-targeting conjugate (20o) containing an antibody Fab fragment (210) fused to domain 2 (CalD2, 190) of calbindin. The Fc fragment (110) is fused to domain 1 (CalD1, 200) of calbindin. CalD1 (200) and CalD2 (190) are related to extracellular Ca 2+ Endosomal Ca at lower concentrations 2+ They associate with each other with higher affinity at higher concentrations. Other examples include fusing with Fab fragment (210) or Fc(110) and Ca 2+ Alternatively, it may contain proteins or protein fragments (190, 200) that associate with each other in a pH-dependent manner. Ca 2+Other examples of proteins that interact in a dependent manner include (e.g., Miyawaki, A., Llopis, J., Heim, R., McCaffery, JM, Adams, JA, Ikura, M., Tsien, RY (1997) Fluorescent indicators for Ca 2+Calmodulin and calmodulin-binding peptide M13 (as described in Nature, 388, 882-887, based on green fluorescent proteins and calmodulin), S100C and the 13 N-terminal residues of annexin I (as described in Seeman, J., Weber, K., Gerke, V. (1996) Structural requirements for annexin I-S100C complex-formation. Biochem. J., 319, 123-129, Malliard, WS, Haigler, HT, Schlaepfer, DD (1995) Calcium-dependent binding of S100C to the N-terminal domain of Annexin IJBiol. Chem., 2, 719-725), (for example, Maurer, P., Hohenadl, C., Hohenester, E., Gohring, W., Timpl, R., Engel, J. (1995) The C-terminal protein of BM-40 (SPARC / Osteonectin) is an autonomously folding and crystallizable domain that binds calcium and collagen IV (as described in J.Mol.Biol., 253, 347-357). In other examples of endolysosome-targeted conjugates, the Fab fragment shown in Figure 3O is replaced by an scFv fragment (220) as shown in Figure 3P, or by an antibody-variable domain, fragment, or nanobody (230) as shown in Figure 3Q. In the examples shown in Figures 3O, 3P, and 3Q, the cargo molecule (120) is replaced by chemical conjugation to a cysteine residue. It is connected to the hinge region.
[0056] Figure 3R shows the (or endosome Ca) at acidic endosome pH. 2+(at concentration) with higher affinity at near-neutral pH (or extracellular Ca 2+ This is a schematic diagram of a typical endolysosome-targeting conjugate (20a) containing two antibody Fab fragments (100, 240) configured to bind to two different cell surface proteins or cell surface molecules (at their respective concentrations). The Fc fragments (170, 180) fuse with different Fab fragments (100, 240) to form heterodimers. Heterodimer formation is described (e.g., Moore, GL, Bautista, C., Pong, E., Nguyen, DH, Jacinto, J., Eivazi, A., Muchhal, US, Karki, S., Chu, SY, Lazar, GA, (2011).A Novel bispecific antibody formats enable simultaneous bivalent and monovalent co-engagement of distinct target antigens. They may be driven by knob-in-to-hole mutations (as described in MAbs 3,546-557) and / or electrostatic steering mutations (as described in, for example, Gunasekaran, K., Pentony, M., Shen, M., Garrett, L., Forte, C., Woodward, A., Ng, SB, Born, T., Retter, M., Manchulenko, K., Sweet, H., Foltz, IN, Wittekind, M., Yan, W. (2010) Enhancing antibody Fc heterodimer formation through electrostatic steering effects: applications to bispecific molecules and monovalent IgG. J. BiolChem. 285, 19637-19646). In another example shown in Figure 3S, the Fab fragment shown in Figure 3R is replaced by two scFv fragments (250, 260), which are located at the acidic endosome pH (or endosome Ca). 2+(at concentration) with higher affinity at near-neutral pH (or extracellular Ca 2+ It is configured to bind to two types of cell surface proteins or cell surface molecules (at a given concentration). In the examples shown in Figures 3R and 3S, the cargo molecule (120) is bound to the hinge region via chemical conjugation to a cysteine residue.
[0057] In the examples shown in Figures 3A-3S, the endolysosome-targeting conjugate has a targeting component comprising a Fab fragment, scFvs, or nanobody, and a cargo component comprising an Fc fragment, a subfragment of Fc (e.g., a CH2 domain), or albumin linked to a cargo molecule such as a cytotoxic drug or an imaging label such as a radiolabel or fluorescent label. The cargo molecules shown in Figures 3A, 3B, 3C, 3D, 3E, 3F, 3J, 3K, 3L, 3M, 3N, 3O, 3P, 3Q, 3R, and 3S are bound to the hinge region via one or more cysteine residues. In other examples, one or more cargo molecules may be bound to the cargo component via various chemicals known to those skilled in the art, such as amine-to-amine (NHS ester), sulfhydryl-to-sulfhydryl (maleimide), amine-to-sulfhydryl (NHS ester / maleimide), sulfhydryl-to-carbohydrate (maleimide / hydrazide), or non-natural amino acids with desired chemical reactivity, among other methods identifiable to those skilled in the art. Non-natural amino acids may be inserted during recombinant production of the targeted component. In other examples, such as those shown in Figures 3R and 3S, the targeted component may bind to two or more targets. Each of the targeted components may fuse to an Fc fragment having a knobs-into-hole mutation and / or electrostatic steering mutation to drive heterodimer formation.
[0058] In the examples shown in Figures 3J, 3K, 3L, 3M, and 3N, the endolysosome-targeted conjugate may include a PS-targeted drug, for example, created by fusing a PS-binding domain to a human IgG1 Fc fragment or other Fc fragment. For example, the targeting component may be conjugated to a cargo component containing a cytotoxic drug to produce endolysosome-targeted conjugate PDCs, or the targeting component may be conjugated to a cargo component containing an imaging label such as radiolabeling, fluorescent labeling, or near-infrared labeling to produce endolysosome-targeted conjugate LCs. Therefore, the endolysosome-targeted conjugates described herein may include, for example, Ca 2+ By using a PS-binding domain that interacts with PS in a dependent manner, Ca in endosomes 2+ They may contain proteins, protein fragments, or domains configured to dissociate from target cell surface molecules upon exposure to a significant decrease in their levels. For example, endolysosome-targeting conjugate PDCs or LCs may contain a targeting component such as Fc-Syt1. Endolisosome-targeting conjugate PDCs containing Fc-Syt1 may be bivalent, as shown in Figures 3J and 3K, or tetravalent, as shown in Figure 3L.
[0059] Endolisosomal targeting conjugates may contain a single targeting domain fused to an Fc fragment that forms a heterodimer with an Fc fragment that does not have a fusion protein. To promote heterodimer formation, the Fc fragment may be modified using knobs-into-holes mutations and / or electrostatic steering mutations, as shown in the examples in Figures 3M and 3N.
[0060] In some examples described herein, the targeting component and cargo component are not covalently linked, but are instead configured to associate with each other via linkage to modified domains that associate non-covalently. Non-covalent association, in particular, may have a stronger affinity when in contact with the chemical environment in the extracellular space than in the endolysosome compartment. For example, the modified domains may include calbindin domain 1 (CalD1) and calbindin domain 2 (CalD2). CalD1 and CalD2 are extracellular Ca 2+ Endosomal Ca 2+ It does not bind at high concentrations (see Example 6). Ca 2+ Other examples of proteins that interact in a dependent manner include (e.g., Miyawaki, A., Llopis, J., Heim, R., McCaffery, JM, Adams, JA, Ikura, M., Tsien, RY (1997) Fluorescent indicators for Ca 2+ based on green fluorescent proteins and Calmodulin (as described in Nature, 388, 882-887) and calmodulin-binding peptide M13 (e.g., Seeman, J., Weber, K., Gerke, V. (1996) Structural requirements for annexin I-S100C complex-formation. Biochem. J., 319, 123-129, Malliard, WS, Haigler, HT, Schlaepfer, DD (1995) Calcium-dependent binding of S100C to The N-terminal domain of Annexin I (as described in JBiol. Chem., 2, 719-725) is S100C and the 13 residues at the N-terminus of Annexin I (e.g., Maurer, P., Hohenadl, C., Hohenester, E., Gohring, W., Timpl, R., Engel, J. (1995) The C-terminal protein of BM-40 (SPARC / Osteonectin) is an autonomously Folding and crystallizable domain that binds calcium and collagen (as described in IV. J.Mol.Biol.,253,347-357) osteonectin and collagen This is IV. Several examples of shapes containing such domains are shown in Figures 3O, 3P, and 3Q, but other shapes are possible.
[0061] Endolisosomal targeting conjugates may contain a different number of targeting and cargo components. The shapes shown in Figures 3A, 3B, 3C, 3D, 3E, 3F, 3G, 3H, 3I, 3J, 3K, 3L, 3M, 3N, 3O, 3P, 3Q, 3R, and 3S are examples and not limitations, as several other shapes can be identified by those skilled in the art by reading this disclosure.
[0062] In some examples described herein, endolysosome-targeted conjugates may include toxins such as monomethyl auristatin (MMAE) conjugated via a valine-citrulline-PAB linker. Endolisosome-targeted conjugates may also include antibodies that bind to cell surface molecules such as HER2 with higher affinity at acidic endosomal pH than at near-neutral pH (HER2-ADCs; see Examples 2-5). The modified antibodies and proteins described herein can be expressed in mammalian cells in high yield and conjugated with drugs with high efficiency. Upon binding to HER2-positive cells, typical HER2-ADCs internalize within early endosomes, where the pH decreases from near-neutral to approximately pH 5.5–6.5. This decrease in pH dissociates the HER2-ADCs from the early / sorted endosomal membrane, leading to effective lysosomal delivery of MMAE drugs. In particular, pertuzumab mutants SG and YS have a dissociation constant higher than 1.5 μM at pH 5.8 (see, for example, Figure 4B), while WT pertuzumab has a much lower dissociation constant at the same pH. Therefore, HER2-ADCs can effectively eliminate HER2-positive cells, and treatment with HER2-ADCs in a mouse model of HER2-expressing breast cancer can effectively suppress tumor growth without signs of adverse effects.
[0063] In another example described herein, the endolysosome-targeted conjugate has a targeting component containing a PS-binding domain, such as the C2A domain of synaptotagmin 1 (Syt1), fused to a cargo component, such as the Fc region of an antibody conjugated to an MMAE via a maleimidocaproylvaline-citrulline-PAB linker (PS-PDCs; see Examples 7-13). PS-targeted proteins can also be expressed in mammalian cells in high yield and conjugated with drugs with high efficiency. Typical PS-PDCs are configured to specifically bind to PS in a calcium-dependent manner. Upon binding to PS-positive cells, PS-PDCs effectively internalize into early endosomes, where calcium levels decrease from 2 mM to less than 2 μM. This decrease in calcium concentration dissociates the PS-PDCs from the early / sorted endosomal membrane, leading to effective lysosomal delivery of the MMAE drug. PS-PDCs can effectively eliminate PS-positive cells, including but not limited to tumor endothelial cells, breast cancer cells, and prostate cancer cells. Treatment with PS-PDCs effectively suppresses tumor growth without adverse effects in mouse models of human triple-negative breast cancer and prostate cancer, although the unconjugated proteins do not have therapeutic effects. Since PS is a universal marker for cancer endothelial cells and stressed tumor cells, PDCs can be applied to the treatment of most solid tumors.
[0064] pH-dependent or Ca 2+ The targeting components of the endolysosome-targeting conjugates described herein, which bind to target cell surface molecules in a dependent manner, can be isolated from libraries of immunoglobulin-variable domains, scFvs (VH:VL heterodimers in which the VH and VL domains are linked to each other by a linker peptide such as GGGGSGGGGSGGGGS), or Fab fragments using phage display, yeast display, or other methods identifiable by those skilled in the art. These libraries may be derived from naturally occurring antibody-variable genes or from complementarity-determining regions (CDRs) that are randomized. These can be prepared using methods that produce a "semisynthetic" library using ligonucleotide sequences, or they can be induced by inserting random mutations into CDRs from the VH and VL domain genes of existing antibodies. Random mutations can be inserted into CDRs using error-prone PCR or biases toward histidine residues (due to pH dependence), followed by selection using phage display or yeast display. Representative target CDR residues are those in CDR3 of the light chain variable domain (residues 89-97, Kabat numbering) and CDR3 of the heavy chain variable domain (residues 95-102, Kabat numbering). Desired pH dependence or Ca 2+ The selection of pH-dependent scFvs or Fab fragments can be performed using methods known to those skilled in the art. Furthermore, for the isolation of pH-dependent binders, CDR residues can be systematically mutated to histidine, and the resulting Fab or scFv fragments can be overexpressed and analyzed for binding to targets, for example, using surface plasmon resonance or ELISAs.
[0065] The endolysosome-targeting conjugates described herein may have variations in the number of targeting components (e.g., Fab fragments or scFv fragments), ranging from 1 to 4 targeting components (Figure 3). These targeting components may be linked to immunoglobulin Fc fragments or other proteins such as albumin, and between the fusion protein, domain, or fragment, there may be linker sequences varying in length and composition, such as GGGGS or 2-3 repeats of that linker, among other linker sequences identifiable by those skilled in the art. Domains such as CalD1 or CalD2 may also be linked to the targeting and cargo components using similar linkers. The Fc fragments of the endolysosome-targeting conjugate may have mutations such as knobs-in-to-holes and / or electrostatic steering mutations, so that heterodimers of the linked and unlinked Fc fragments are formed.
[0066] In some cases, a targeted component may be fused to the Fc region of an antibody, while reducing the size of the protein, thereby preserving the therapeutic function and in vivo persistence derived from the Fc region. In other cases, the Fc region may be replaced with albumin or domain III of albumin, which has long-term in vivo persistence due to the interaction between albumin (or DIII) and the recirculation receptor FcRn.
[0067] Representative endolysosome-targeted conjugate ADCs and PDCs described herein exhibit enhanced efficacy in killing cancer cells through improved intracellular release of toxins (see Examples 3-5, 9-13). In addition to representative cytotoxic drugs and MMAEs, other cytotoxic drugs such as maytansinoids, tubulysin, benzodiazepines, and duocarmycin may be used, among those identifiable to those skilled in the art. Drugs may be conjugated to antibody fragments, antibody domains, nanobodies, proteins, protein fragments, or protein domains of cargo components via chemical conjugation. Examples of chemical couplings that may be used include amine-to-amine (NHS ester), sulfhydryl-to-sulfhydryl (maleimide), amine-to-sulfhydryl (NHS ester / maleimide), sulfhydryl-to-carbohydrate (maleimide / hydrazide), or coupling via unnatural amino acids with desired chemical reactivity, among other methods identifiable to those skilled in the art. Non-natural amino acids may be inserted during the recombinant production of the targeted component. Polyethylene glycol (PEG) spacers may be inserted between chemically conjugated proteins, protein fragments, or other molecules. Linkers such as valine-citrulline may be cleavable to enable the release of cytotoxic drugs in late endosomes or lysosomes by resident proteases such as cathepsin. Trastuzumab (trast In cases where the linkage is not cleavable, as in the case of uzumab-DM1, the antibody may be proteolytically degraded to release the drug. The chemistry of the linkage, the linkage site, and the selection of peptides can be derived by molecular modeling and, as those skilled in the art will understand, can be designed to minimize the loss of binding activity of the ADC or PDC to cell surface receptors or other cell surface molecules.
[0068] Cargo components for endolysosome-targeted conjugate LCs can be prepared by conjugating imaging labels, identifiable to those skilled in the art, to antibody fragments, antibody domains, proteins, protein fragments, or protein domains of the cargo components. Examples that are not limited to imaging labels include near-infrared dyes such as IRDye800CW or radioactive labels such as I-124, Cu-64, or Zr-89. Conjugation to Cu-64 or Zr-89 can be achieved via chelation to 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA), which chelates these radioactive labels, among other methods identifiable to those skilled in the art.
[0069] In further examples, the cargo component of an endolysosome-targeting conjugate may be a cytotoxic radiolabel (e.g., yttrium-90, Y-90, or iodine-131, I-131) or a drug or other agent that modifies the behavior of the targeted cell. For example, the drug may be an antagonistic ligand for the androgen receptor (AR) and may be used to downmodulate AR activity.
[0070] The term “behavior” relating to target cells or other cells may refer to activity, function, output, or other attributes or effects relating to the phenotype or genotype of target cells or other cells. As those skilled in the art will understand from reading this disclosure, drugs or other agents can generally be used to produce effects such as therapeutic effects or cytotoxic effects on specific target cells.
[0071] In some examples described herein, the endolysosome-targeting conjugate may include the amino acid sequences of SEQ ID NO: 2+SEQ ID NO: 4, SEQ ID NO: 6+SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18+SEQ ID NO: 20+SEQ ID NO: 22, SEQ ID NO: 22+SEQ ID NO: 24+SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42+SEQ ID NO: 44, SEQ ID NO: 46+SEQ ID NO: 48, or homologous thereof.
[0072] Endolisosome-targeted conjugates may contain amino acid sequences that have at least 50% identity with SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, and 48.
[0073] As used herein, “sequence identity” or “identity” in the context of two nucleic acid or polypeptide sequences refers to nucleotide bases or residues in two sequences that are identical when aligned with respect to maximum correspondence across a specified comparison window. When a percentage of sequence identity or similarity is used in reference to proteins, it is recognized that the positions of non-identical residues are often differed by homogeneous amino acid substitutions, in which an amino acid residue is replaced by a functionally equivalent residue of an amino acid residue having similar physicochemical properties, and therefore does not change the functional properties of the molecule.
[0074] As used herein, functionally equivalent amino acid residues typically refer to other amino acid residues having substantially similar physicochemical and stereochemical properties to the first amino acid. Physicochemical properties include water solubility (hydrophobic or hydrophilic), dielectric and electrochemical properties, physiological pH, partial charge of the side chain (positive, negative, or neutral), and other properties identifiable to those skilled in the art. Stereochemical properties include the spatial and conformational arrangement of amino acids and their chirality. For example, glutamic acid is considered functionally equivalent to aspartic acid in the sense of this disclosure. Tyrosine and tryptophan are considered functionally equivalent to phenylalanine. Arginine is considered functionally equivalent to lysine.
[0075] Those skilled in the art will understand that similarity between sequences is typically measured by a method that includes the steps of: arranging two polypeptide or polynucleotide sequences side by side to form an aligned sequence; then detecting the number of matching characters, i.e., similar or identical characters, between the two aligned sequences; and calculating the total number of matching characters by dividing it by the total number of aligned characters in each polypeptide or polynucleotide sequence, including gaps. The similarity result is expressed as a percentage of identity.
[0076] As used herein, “percentage of sequence identity” means a value determined by comparing two optimally aligned sequences across a comparison window, where portions of the polynucleotide sequence within the comparison window may contain additions or deletions (gaps) compared to a reference sequence (without additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions where identical nucleic acid bases or amino acid residues exist in both sequences, dividing the number of matching positions by the total number of positions within the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity.
[0077] As used herein, “reference sequence” is a defined sequence used as the basis for sequence comparison. A reference sequence may be a subset or the whole of a sequence identified, for example, as a full-length protein or a section of a protein fragment. A reference sequence may be a sequence that can be identified in databases such as GenBank and Uniprot and others that can be identified by those skilled in the art.
[0078] As those skilled in the art will understand, the determination of percentage identity between any two sequences can be performed using mathematical algorithms. A suitable computer implementation of a mathematical algorithm can be used for comparing sequences to determine sequence identity. Such implementations include, but are not limited to, CLUSTAL, ALIGN, GAP, BESTFIT, BLAST, and FASTA, among others that those skilled in the art can identify.
[0079] For example, an endolysosome-targeting conjugate according to this disclosure may contain an amino acid sequence having at least 50% sequence identity, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% sequence identity, compared to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8 or SEQ ID NO: 10 or SEQ ID NO: 12 or SEQ ID NO: 14 or SEQ ID NO: 16 or SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32 or SEQ ID NO: 34 or SEQ ID NO: 36 or SEQ ID NO: 38 or SEQ ID NO: 40 or SEQ ID NO: 42 or SEQ ID NO: 44 or SEQ ID NO: 46 or SEQ ID NO: 48.
[0080] The endolysosome-targeting conjugates described herein may be provided in a composition comprising the endolysosome-targeting conjugate and a pharmaceutically acceptable vehicle.
[0081] Endolisosomal-targeting conjugates or compositions thereof described herein may be administered by means of a suitable method for delivering them to a subject such as a single cell, multiple cells, or multicellular organism, particularly an animal or human, and especially an animal or human that may have one or more tumors, such as by injection, particularly by intravenous, subcutaneous, or intramuscular injection, among other methods that can be identified by those skilled in the art.
[0082] Endolisosomal-targeted conjugates or compositions thereof as described herein may be used in methods for treating cancer. The method comprises administering an effective dose of an endolisosomal-targeted conjugate or composition thereof to a patient, wherein the cargo molecule is a cytotoxic drug, and the administration of the composition inhibits tumor growth in the patient.
[0083] Endolisosomal-targeted conjugates or compositions thereof as described herein may be used in methods for imaging tumors in patients. The method includes the steps of administering an effective dose of an endolisosomal-targeted conjugate composition in which the cargo molecule is an imaging label to a patient, and performing an imaging method suitable for detecting the imaging label in the patient. In the method, the administration of the composition is in a dose effective to provide a sufficient concentration of the imaging label that can be detected by the imaging method, as can be identified by those skilled in the art.
[0084] The endolysosome-targeting conjugates or compositions thereof described herein may be administered at appropriate time intervals, for example, weekly, monthly, or whenever it is expected that 50% of patients have shown tumor regression.
[0085] In diagnostic / theranostic imaging, administration of endolysosome-targeted conjugate LCs containing imaging labels such as radiolabeling, near-infrared labeling, or fluorescent labeling may be followed by a 1-7 day period to allow for the localization of target cells in the patient, such as tumor localization. Following this period, the patient may be imaged using positron emission tomography or other suitable imaging methods such as localized or whole-body imaging to enable detection of the location of target cells, such as tumors.
[0086] The endolysosome-targeting conjugates described herein may be designed to selectively target specific cell types and thereby deliver cargo molecules to selected target cells. In particular, the endolysosome-targeting conjugates described herein may be designed to target specific types of tumor cells in a patient. Accordingly, a method for providing an endolysosome-targeted conjugate as described herein may include: (1) a step of selecting a targeting component, wherein the targeting component comprises an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain configured to selectively bind to a cell surface molecule on a selected type of cell, such as a tumor target cell, wherein the targeting component is configured to bind to a cell surface molecule expressed on the target cell in the extracellular space with higher affinity in the endolysosomal compartment; (2) a step of selecting a cargo component, wherein the cargo component comprises an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain conjugated to a cargo molecule, wherein the cargo molecule may be, for example, a cytotoxic drug having efficacy for inhibiting the growth of a selected type of tumor target cell or an imaging label suitable for imaging selected tumor cells; and (3) a step of providing an endolysosome-targeted conjugate comprising a targeting component directly or indirectly fused to the cargo component.
[0087] Alternatively, a method for providing an endolysosome-targeted conjugate for the treatment of cancer and / or imaging of tumors in a patient is (1) a step of selecting a targeting component, The method may include (1) a step of selecting a cargo component, where the cargo component comprises an antibody, antibody fragment, nanobody, protein, protein fragment, or protein domain configured to selectively bind to a cell surface molecule on a selected type of tumor target cell, where the cargo component comprises an antibody, antibody fragment, antibody domain, nanobody, protein, protein fragment, or protein domain conjugated to a cargo molecule, where the cargo molecule is, for example, a cytotoxic drug having efficacy for inhibiting the growth of a selected type of tumor target cell or an imaging label suitable for imaging selected tumor cells. In particular, in the above method, as described herein, the target component is further modified to include a first protein domain, and the cargo component is further modified to include a second protein domain, wherein the first protein domain is configured to bind to the second domain in the extracellular space with higher affinity in the endolysosomal compartment. [Examples]
[0088] Examples that are not limited to those described below are given to further illustrate the endolysosome-targeting conjugates and methods disclosed herein. It should be recognized by those skilled in the art that the methods disclosed in the following examples represent methods that have been found to function well in carrying out the invention and thus may be considered to constitute exemplary forms for carrying out the invention. However, those skilled in the art should see this disclosure and recognize that many modifications can be made within the specific examples disclosed without departing from the spirit and scope of the invention, and similar or comparable results can still be obtained. [Examples]
[0089] Materials and methods Cell lines and culture conditionsMouse endothelial cell lineage 2H11 (ATCC,CRL-2163) was cultured in Dulbecco's modified Eagle medium (DMEM) supplemented with 5% thermoinactivated fetal bovine serum (FBS). Human breast cancer cell lineage MDA-MB-231 (ATCC,HTB-26) was cultured in DMEM supplemented with 10% FBS. Human breast cancer cell lineages T-47D (ATCC,HTB-133), MDA-MB-453 (ATCC,HTB-131), and MDA-MB-468 (ATCC,HTB-132) were cultured in RPMI 1640 medium supplemented with 10% FBS. Human breast cancer cell lineage SK-BR-3 (ATCC,HTB-30) and human ovarian cancer cell lineage SK-OV-3 (ATCC,HTB-77) were cultured in McCoy's 5A medium supplemented with 10% FBS. Human prostate cancer cell lines LNCaP and 22Rv1 (ATCC, CRL-1740 and CRL-2505, respectively) were cultured in RPMI 1640 medium supplemented with 10% FBS. Human breast cancer cell lines HCC1954 (Gazdar, AF, Kurvari, V., Virmani, A., Gollahon, L., Sakaguchi, M., Westerfield, M., Kodagoda, D., Stasny, V., Cunningham, HT, Wistuba, II, Tomlinson, G., Tonk, V, Ashfaq., R., Leitch, AM, Minna, JD, Shay, JW (1998) Characterization of paired tumor and non-tumor cell lines established from patients with breast cancer. Int. J. Cancer. 78, 766-774) were cultured in RPMI 1640 medium supplemented with 10% FBS. All cancer cell lines were authenticated by the University of Arizona Genetics Core (UAGC) using DNA fingerprinting. Cells were cultured at 37°C under 5% CO2. Expi293F cells (Life Technologies, catalog number A14635), used for protein expression, were cultured in Expi293 expression medium at 37°C under 8% CO2 and 80% humidity.
[0090] Antibodies, antibody-drug conjugates, and dextran In this study, the following antibodies were used: rat anti-mouse LAMP1, mouse anti-human LAMP1 and mouse anti-betatubulin antibodies (Developmental Studies Hybridoma Bank, clone numbers 1D4B, H4A3 and E7), mouse anti-human EEA1 and rat anti-mouse CD31 antibodies (BD Biosciences, catalog numbers 610456 and 557355), goat anti-human IgG(H+L) antibody conjugated with HRP, donkey anti-rat (H+L) antibody conjugated with Alexa Fluor 488 and donkey anti-human IgG(H+L) antibody conjugated with Cy3 (Jackson ImmunoResearch, catalog numbers 109-035-003, 712-545-153 and 709-165-149), goat anti-human IgG(H+L) antibody conjugated with Alexa Fluor 555, and Alexa Fluor Goat anti-mouse IgG(H+L) antibody conjugated with 488 and goat anti-human IgG(H+L) antibody conjugated with Alexa Fluor 647 (Life Technologies, catalog numbers A21433, A11029, and A21445), and rabbit anti-human Ki-67 antibody (Abcam, catalog number 92742). Trastuzumab-DM1 (T-DM1, Kadcyla®) was obtained from UT Southwestern Medical Center Pharmacy (Dallas). Alexa Fluor 647-labeled dextran, 10 kDa molecular weight, was purchased from Life Technologies (catalog number D22914).
[0091] Preparation of expression constructs for the production of protein-drug conjugatesFor use as a control, the Fc region, including the hinge region (heavy chain residues 215-447, EU numbering) of chicken egg lysozyme-specific human IgG1, HuLys10 (Foote, J., Winter, G. (1992) Antibody framework residues affecting the conformation of the hypervariable loops. J.Mol.Biol.224, 487-499), was cloned into a pcDNA3.4 vector containing an N-terminal leader peptide derived from mouse IgG heavy chain (Foote, J., Winter, G. (1992) Antibody framework residues affecting the conformation of the hypervariable loops. J.Mol.Biol.224, 487-499, Neuberger, MS (1983) Expression and regulation of immunoglobulin heavy chain gene transfected into Lymphoid cells. EMBO J.2:1373-1378). Similarly, genes encoding the heavy and light chain genes (cDNA) of the HuLys10 antibody were cloned into pcDNA3.4. To regulate the IgG heavy and light chain constructs, both Cys220 (EU numbering) in the heavy chain of HuLys10 and Cys214 (EU numbering) in the light chain that forms sulfhydryl crosslinks were mutated at serine residues using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies, catalog number 200523).
[0092] cDNA clones for human annexin A1 (AnxA1), human synaptotagmin 1 (Syt1), and human PKCα were purchased from Open Biosystems (clone IDs: 3459615, 6187902, and 40028305, respectively). The genes encoding the AnxA1 PS-binding core domain (amino acids 41-346), the Syt1 PS-binding C2A domain (amino acids 141-266), and the PKCα PS-binding C2 domain (amino acids 157-288) were fused via the Gly4Ser linker sequence to the CH3 domain (residues 215-447, EU numbering) of the human IgG1 Fc region, which has a leader peptide derived from the mouse IgG heavy chain (Foote, J., Winter, G. (1992) Antibody framework). residues affecting the conformation of the hypervariable loops. J.Mol.Biol.224,487-499, Neuberger,MS (1983) Expression and regulation of immunoglobulin heavy chain gene transfected into lymphoid cells. (EMBO J.2:1373-1378). In all Fc fusion constructs, Cys220 (EU numbering) in the hinge region was mutated to have two cysteine residues per hinge. The gene encoding the Fc fusion was cloned into a pcDNA3.4 vector (Invitrogen, catalog number 14308).
[0093] To construct Syt1-Fc-Syt1, the Syt1 PS-binding C2A domain (amino acids 141-266) was linked to the N-terminus of the hinge region of the Fc-Syt1 construct via the Gly4Ser linker sequence. A leader peptide derived from the mouse IgG heavy chain (Foote, J., Winter, G. (1992) Antibody framework residues affecting the conformation of the hypervariable loops. J.Mol.Biol.224,487-499, Neuberger, MS (1983) Expression and regulation of immunoglobulin heavy A chain gene transfected into lymphoid cells (EMBO J.2:1373-1378) was added to the N-terminus of a hinged Syt1 PS-binding C2A domain, and the resulting Fc fusion was cloned into a pcDNA3.4 vector. Mutations that reduce PS binding to the Syt1 C2A domain (D173N, D179N, D231N, D233N, and D239N) (Striegel, AR, Biela, LM, Evans, CS, Wang, Z., Delehoy, JB, Sutton, RB, Chapman, ER, and Reist, NE 2012. Calcium binding by synaptotagmin's C2A domain is an essential element. The electrostatic switch that triggers synchronous synaptic transmission (J. Neurosci. 32, 1253-1260) was inserted into the Syt1-Fc construct to create Fc-Syt1(DN), which was then cloned into the pcDNA3.4 vector. All constructs were prepared using standard molecular biology methods and designed oligonucleotides.
[0094] Production of expression constructs for antibody-drug conjugates Synthetic genes encoding the HER2-specific antibody, pertuzumab heavy chain variable domain, and pertuzumab light chain variable domain (Franklin, MC, Carey, KD, Vajdos, FF, Leahy, DJ, de Vos, AM, Sliwkowski, MX (2004)). The pertuzumab heavy chain constant domain 1 (CH1) and human light chain constant domain (kappa chain, Cκ) were purchased from Genescript and cloned into an expression vector for Fab fragment production. To identify target residues in the pertuzumab heavy chain and light chain variable domain for histidine scanning, the crystal structure of pertuzumab in complex with the antigen and HER2 (Protein Data Bank accession code 1N8Z) was analyzed in PyMOL. The residues in HER2 domain II (Franklin, MC, Carey, KD, Vajdos, FF, Leahy, DJ, de Vos, AM, Sliwkowski, MX (2004) Insights into ErbB) were also analyzed. The amino acid numbers mentioned are those in the protein sequences of the pertuzumab heavy and light chain variable domains and do not refer to other numbering agreements. This involves splicing via overlap extension (Horton, RM, Hunt, HD, Ho, SN, Pullen, JK, Pease, LR (1989) Engineering hybrid genes without the use of restriction enzymes: ) the residues located in the pertuzumab CDRs that interact with the structure of the ErbB2-pertuzumab complex (His245, Val286, Ser288, Leu295, His296, and Lys311, as described in Cancer Cell, 4, 317-328). Gene splicing by overlap extension (Gen 77, 61-68) was used to systematically replace the gene with histidine. The resulting gene was cloned and expressed as a Fab fragment secreted periplasmically in E. coli.
[0095] Phage display vector, pHEN1 (Hoogenboom, HR, Griffiths, AD, Johnson, KS, Chiswell, DJ, Hudson, P., Winter, G. (1991) Multi-subunit) To construct the pertuzumab scFv gene in proteins on the surface of filamentous phage: methodologies for displaying antibody (Fab) heavy and light chains (Nucl. Acids Res. 19, 4133-4137), a Fab fragment expression vector for pertuzumab was modified using standard molecular biology methods, and a linker peptide was placed between the heavy and light chain variable domain genes. [(Gly 4 Ser) 3 Gly 2 [Ser Linker] The CDRs were inserted, and then the scFv gene was re-cloned into pHEN1. The following oligonucleotides were used to create a library of mutant pertuzumab scFvs containing randomly mutated residues in the CDRs. For each oligonucleotide, the DNA sequence is shown in the direction from 5' to 3': CDRH1Back, GCTTCTGGATTCACATTCACANNBNNBNNBATGGATTGGGTGAGACAGGCT (SEQ ID NO: 49), CDRH1For, TGTGAATGTGAATCCAGAAGC (SEQ ID NO: 50), CDRH2Back, TGGGTGGCTGATGTGAATCCTNNBNNBNNBNNBTCTATCTACAATCAGAGATTC (SEQ ID NO: 51), CDRH2For, AGGATTCACATCAGCCACCCA (SEQ ID NO: 52), CDRH3Back, TACTACTGTGCTAGAAATCTGNNBCCTNNBTTCNNBTTCGATNNBTGGGGACAGGGAACACTG (SEQ ID NO: 53), CDRH3For, CAGATTTCTAGCACAGTAGTA (SEQ ID NO: 54), CDRL2-1Back, CCTAAGCTGCTGATCTACTCTNNBTCTNNBAGA NNBACAGGAGTGCCTTCTAGA (SEQ ID NO: 55), CDRL2-1For, AGAGTAGATCAGCAGCTTAGG (SEQ ID NO: 56), CDRL2-2Back, GGAAAGGCTCCTAAGCTGCTGNNBNNBNNBGCTTCTTACAGATACACAGGA (SEQ ID NO: 57), and CDRL2-2For5, CAGCAGCTTAGGAGCCTTTCC (SEQ ID NO: 58). Using molecular biology methods known to those skilled in the art, a library of scFvs genes was prepared, and approximately 5x10⁻¹⁰ samples were obtained for each target CDR using electroporation with E. coli TG1 (Lucigen, catalog number 60502). 7 A library of individual mutants was created.
[0096] Pooled colonies from the library, M13KO7 helper far Phage (NEB, catalog number N0315S) was used to inoculate cultures supplemented with 100 μg / mL ampicillin and 50 μg / mL kanamycin overnight at 30°C. The extruded phages were harvested from the supernatant by precipitation using 4% polyethylene glycol 8000 and 3% NaCl. 12100 μL of pfu / mL was pre-panned using a Maxisorp 96-well microtiter plate (Thermofisher, catalog no. 44-2404-21) coated with 4% skim milk / phosphate-buffered saline (PBS), and then panned using a Maxisorp 96 cell plate coated with 2 μg / mL recombinant human HER2 (extracellular domain)-Fc fusion protein (HER2-ECD-Fc, R&D Research, catalog no. 1129-ER-050). The phages were incubated with 4% skim milk pH 7.4 for 2 hours. The plates were vigorously washed with PBS pH 7.4 (PBST) supplemented with 0.1% Tween-20, followed by washing with PBS pH 7.4. Phages exhibiting pH-dependent binding were selectively eluted using 20 mM 2-(N-morpholino)ethanesulfonic acid (MES) at pH 5.8 for 10 minutes at room temperature. The eluted phages were used to infect exponentially growing E. coli TG1. Four rounds of panning were performed, and the isolated phages were screened for binding to HER2 at pH 7.0 with higher affinity at pH 5.8. Recombinant scFvs encoded by the selected phages were analyzed for binding to HER2 by ELISA and / or surface plasmon resonance.
[0097] Heavy and light chain variable domain genes for pertuzumab scFv or Fab fragments, which exhibit higher affinity at pH 7.0 compared to pH 5.8, were cloned into cassette vectors for the expression of human IgG1 heavy and light chain (Cκ) sequences, respectively, using pcDNA4.3 as the backbone vector. The hinged disulfide bond linking the Cκ domain to the hinge region and the single hinged disulfide linking the two heavy chains to each other were removed from the heavy and light chains by mutating the light chain cysteine (Cys214, EU numbering) and the two heavy chain cysteines (Cys220, Cys229, EU numbering) to serine.
[0098] To construct an expression construct encoding a trastuzumab HER2-specific Fab fragment fused to the calbindin D9K domain 2 (CalD2), the gene encoding the trastuzumab heavy chain and light chain variable domain (Carter, P., Presta, L., Gorman, CM, Ridgway, JB, Henner, D., Wong, WL, Rowland, AM, Kotts, C., Carver, ME, Shepard, HM (1992) Humanization of an anti-p185HER2 antibody for human cancer therapy. Proc Natl Acad Sci USA, 89, 4285-4289) was synthesized using Genescript. The calbindin D9K gene (Berggard, T., Julenius, K., Ogard, A., Drakenberg, T., Linse, S. (2001) Fragment complementation studies of protein stabilization by hydrophobic core residues. Biochemistry, 5, 1257-1264) was synthesized by Genescript, and the trastuzumab Fab heavy chain (VH-CH1-linker including part of the hinge) and the CalD2 domain gene were fused together using a Ser-Gly-Gly linker via overlap extension splicing (Horton, RM, Hunt, HD, Ho, SN, Pullen, JK, Pease, LR (1989) Engineering hybrid genes without the use of restriction n enzymes: gene splicing by overlap extension. Gene 77, 61-68). The VH-CH1-CalD2 fusion protein gene and the gene encoding the trastuzumab light chain (with a C-terminal polyhistidine tag) were cloned separately into the pcDNA3.4 vector.
[0099] Using a similar method, an expression construct encoding a PSMA-specific (026)VH-CH1-linker peptide fused to the CalD2 domain was constructed. The gene encoding the 026 heavy and light chain variable domains (U.S. Patent No. 7850971B2) was synthesized by Genescript. The CalD2 domain gene and the 026 VH-CH1-linker were fused together by overlap extension splicing, and the resulting fusion protein gene was cloned into pcDNA3.4. The gene encoding the 026 light chain with a C-terminal polyhistidine tag was cloned into another pcDNA3.4 vector.
[0100] To construct an expression construct encoding calbindin D9K domain 1 (CalD1) fused to a human IgG1-derived Fc fragment, overlap extension splicing (Horton, RM, Hunt, HD, Ho, SN, Pullen, JK, Pease, LR (1989) Engineering hybrid) was used. Genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77,61-68) The Fc domain (hinge-CH2-CH3, derived from human IgG1) gene was fused to the calbindin D9K domain 1 gene via a Gly-Ser-Ser linker and cloned into the pcDNA3.4 vector.
[0101] Protein expression and purificationRecombinant antibodies and Fc fusion proteins were produced using the Expi293 expression system from Life Technologies, following the manufacturer's instructions. In short, cells were transfected with the expression construct (described above) for 6-7 days, and recombinant PDCs or ADCs were purified from the culture supernatant using protein G-Sepharose. The bound proteins were eluted using 50 mM diethylamine with 150 mM NaCl. The eluted proteins were neutralized with 2 M Tris pH 7.0, dialyzed against PBS, concentrated, and loaded onto a Hiload 16 / 600 Superdex 200 gel filtration column (GE Healthcare). Monomerized proteins were separated, concentrated, and analyzed using a Superdex 200 5 / 150 gel filtration column (GE Healthcare) or a Yarra 3 μm SEC-3000 column (Phenomenex).
[0102] Using the Expi293 expression system described above, trastuzumab Fab-CalD2, 026Fab-CalD2, and CalD1-Fc fusion proteins were produced, and Ni 2+ Recombinant proteins were purified from the culture supernatant using NTA-agarose.
[0103] Using E. coli as a host, pertuzumab scFv and Fab fragment were expressed as recombinant proteins. scFv and Fab fragment were secreted into the pericellular space, Ni 2+ -NTA-agarose was used to purify E. coli cells that were osmotically shocked.
[0104] Protein conjugation with maleimidocaproyl-val-cit-PAB-MMAE The Fc fusion or control antibody in PBS was reduced by adding 16 molar equivalents (8 molar equivalents x number of hinged disulfides) of TCEP at room temperature for 3 hours to reduce the hinged disulfide bonds. The reduced Fc fusion was then treated with maleimidocaproyl-val-cit-PAB-MMAE (MC-VC-PAB-MMAE, Levena Biopharma). (Catalog number SET0201) was added in 8 molar equivalents (4 molar equivalents x number of free cysteine) and incubated at room temperature for 3 hours. Following the conjugate reaction, free MMAE was removed by vigorous dialysing of the protein against PBS. The conjugated Fc fusion or control antibody was stored at 4°C.
[0105] For the preparation of ADCs, a similar method was used, except that 8 molar equivalents of TCEP and 4 molar equivalents of MC-VC-PAB-MMAE were used because only one hinged disulfide was present. Furthermore, the antibody was reduced at 37°C for 2 hours.
[0106] Surface Plasmon Resonance Analysis. Coupling analysis was performed using a BIAcore T200 (GE Healthcare). Using amine coupling chemistry, flow cells with CM5 sensor chips were coupled with recombinant HER2-ECD-Fc (a fusion of the HER2 extracellular domain to an immunoglobulin Fc fragment), wild-type (WT) pertuzumab, mutated pertuzumab variants, or a control coupling buffer (10 mM sodium acetate, pH 4.8). Antibodies were injected onto immobilized HER2-ECD-Fc, or HER2-ECD-Fc onto immobilized antibodies, at a flow rate of 5 or 10 μL / min in phosphate-buffered saline (PBS) plus 0.01% (v / v) Tween-20 and 0.05% (v / v) NaN3 (pH 7.4, 7.0, 6.5, and 5.8) at 25°C. After each injection, the flow cells were regenerated using 0.15 M NaCl / 0.1 M glycine (pH 2.8) buffer. To determine the equilibrium dissociation constant, antibodies were injected onto immobilized HER2-ECD-Fc cells, and the interaction was modeled as a 1:1 interaction using custom-written software (Ober, RJ, Ward, ES (2002) Compensation for loss of ligand activity in surface plasmon resonance experiments. Anal. Biochem., 306, 228-236), giving an apparent dissociation constant (due to the divalent binding of the antibody to the immobilized HER2-ECD-Fc cells).
[0107] To investigate the calcium dependence of the interaction between Fab-CalD2 and CalD1-Fc fusion proteins, Fab-CalD2 was infused, followed by co-infusion with CalD1-Fc in buffers containing various calcium concentrations. Specifically, 100 nM trastuzumab Fab-CalD2 fusion was immobilized on HER2-ECD-Fc in PBS, 0.01% (v / v) Tween-20, 0.05% (v / v) NaN3 pH 7.4 (PBS). + Inject the fused material into 2 mM CaCl2 at a flow rate of 10 μL / min at 25°C, followed by 100 nM CalD1-Fc fusion in PBS.+ The sample was injected at a flow rate of 10 μL / min in 2 mM CaCl2 at 25°C. During the dissociation phase, the sample was infused in PBS containing various concentrations of CaCl2 or EDTA2Na. + The solution was injected. The data was processed using BIAevaluation and custom-made software.
[0108] Membrane lipid strip binding assay for PS-targeted proteins Lipid-coated membrane strips (Echelon, catalog number P-6002) were first hydrated with TBST (20 mM Tris, 150 mM NaCl, 0.1% Tween 20, pH 7.5), and then incubated with a barrier solution (4% fatty acid-free BSA dissolved in TBST) at room temperature for 1 hour. Proteins were diluted to 2 μg / ml in barrier buffer and incubated with the membranes at room temperature for 2 hours. The lipid strips were then washed with TBST, and the bound proteins were detected using horseradish peroxidase (HRP) conjugated goat anti-human IgG (H+L) antibody.
[0109] Flow cytometry analysis of internalization of antibody-drug conjugates Cancer cells were cultured in 48-well plates and incubated overnight at 37°C. Cells were cultured at 10 nM. Cells were treated with Alexa 488-labeled ADCs for 0.5, 4, and 20 hours. Treated cells were cooled on ice, and the Alexa 488 surface signal was quenched with 5 μg / mL rabbit anti-Alexa 488 antibody at 4°C for 30 minutes. Samples were washed, harvested by trypsinization, resuspended in PBS, analyzed using FACS-Accuri, and data processed using FlowJo (FLOWJO, LLC).
[0110] To analyze the accumulation of CalD1-Fc within cells, LNCaP cells were cultured and adhered in 48-well plates. The LNCaP cells were then pulsed for 1 or 2 hours with either 100 nM Alexa 647-labeled CalD1-Fc or a mixture of 100 nM Alexa 647-labeled CalD1-Fc plus 100 nM O26 Fab-CalD2. The cells were washed and detached by trypsin treatment with trypsin-EDTA (Gibco catalog no. 25200056), and Alexa 647-labeled CalD1-Fc was dissociated from the cell surface-bound O26 Fab-CalD2. The cells were harvested, washed, and analyzed using a BD Accuri C6 flow cytometer.
[0111] Fluorescence microscopy analysis of PS and HER2-targeted drugsTo study the intracellular localization of PS-targeted drugs, 2H11 or MDA-MB-231 cells were grown on coverslips (Zeiss, reference no. 0109030091) and incubated for 3 hours with 50 nM control IgG (HuLys10) or 50 nM PS-targeted drugs diluted in growth medium. The cells were then washed with PBS and fixed at room temperature for 20 minutes using ice-cold 4% paraformaldehyde (PFA). Following fixation, the cells were permeabilized with 0.1% Triton X-100 and incubated at room temperature for 30 minutes with barrier buffer (PBS, 5% serum, and 0.1% Tween20). Primary antibodies specific to mouse LAMP-1 (clone 1D4B), human LAMP-1 (clone H4A3), or mouse EEA1 were diluted in barrier buffer and incubated with the cells at room temperature for 2 hours. The cells were then washed with PBST (PBS containing 0.1% Tween 20) and incubated at room temperature for 1 hour with a fluorescently labeled secondary antibody diluted in a barrier buffer. Fluorescently labeled goat or donkey anti-human IgG(H+L) antibody was used to detect endogenized PS-targeting agents. Following incubation, the cells were washed with PBST and mounted using ProLong Gold antifade mountant (Life Technologies, catalog number P36930). Fluorescence images were acquired using a Zeiss Axiovert 200M inverted fluorescence microscope with a 63X, 1.4NA plan apochromatic objective lens (Carl Zeiss) and a 1.6X internal optovar. The acquired data were processed using the microscopy image analysis tool (MIATool) software (www4.utsouthwestern.edu / wardlab / miatool.asp).
[0112] To study the intracellular fate of endogenous HER2-targeted ADCs, MDA-MB-453 cells were cultured on Mattek dishes. Cells were pre-treated with 5 μM Alexa 647-labeled dextran (pulsed for 2 hours, followed for 3 hours), followed by 20 hours of treatment with 10 nM Alexa 488-labeled mutants of pertuzumab conjugated to MMAE (SG-MMAE, YS-MMAE) or T-DM1. Wild-type (WT) pertuzumab conjugated to MMAE was used as a control. Samples were treated on ice with 33.3 nM rabbit anti-Alexa 488 antibody (Thermofisher, catalog no. A11094) for 30 minutes to quench surface fluorescence. Cells were fixed at room temperature for 10 minutes using 1.7% (w / v) paraformaldehyde with 0.025% glutaraldehyde added. The samples were imaged, and the data was processed as described above.
[0113] PS pulldown assay for PS-targeted drugs Ca binding of PS-targeted Fc fusion to PS 2+ For dependency studies, the protein was bound in a binding buffer (2 mM or 2 μM Ca). 2+ The protein was diluted to 100 nM in 10 mM HEPES (pH 7.4) and 150 mM NaCl. 50 μl of PS-coated beads (Echelon, catalog number P-B0PS) were added and incubated at room temperature for 2 hours. The beads were then washed with binding buffer, and the binding protein was detected by immunoblotting using HRP-conjugate goat anti-human IgG(H+L) antibody. To investigate pH-dependent binding to PS, the protein was diluted to 100 nM in PBS (pH 7.4 or 6.0). 50 μl (bed volume) of PS-coated beads were added and incubated at room temperature for 2 hours. The beads were then washed with PBS, and the binding protein was detected by immunoblotting using HRP-conjugate goat anti-human IgG(H+L) antibody.
[0114] Annexin V binding assay for analyzing the level of exposed PS on cellsOne million cells were suspended in annexin V-conjugated solution (10 mM HEPES pH 7.4 with 150 mM NaCl and 2.5 mM CaCl2). Annexin V (Life Technologies, catalog number A13201), conjugated with Alexa 488 Fluor, was added to the cell suspension at a 1:100 dilution and incubated with the cells at room temperature for 10 minutes. The cells were then washed once with annexin V-conjugated solution and analyzed by flow cytometry (BD FACSCalibur). Flow cytometry data were processed using FlowJo (FLOWJO, LLC).
[0115] Flow cytometry analysis of PS-targeted drugs The cells were treated with trypsin and then sterilized with flow cytometry buffer (PBS w / Ca). 2+ / Mg 2+ The cells were resuspended using 1% BSA. 50 nM PS-targeted Fc fusions were incubated with the cells at room temperature or on ice for 30 minutes, assay-dependent. The cells were washed with flow cytometry buffer and incubated with fluorophore-conjugated secondary antibody on ice for 30 minutes. The cells were then washed and analyzed by flow cytometry (BD FACSCalibur). Flow cytometry data were processed using FlowJo (FLOWJO, LLC).
[0116] Cell growth and survival assay Cancer cell lines (2H11, MCF-7, SK-BR-3, SK-OV-3, LNCaP, 22Rv1, MDA-MB-231, MDA-MB-453, MDA-MB-468, and HCC1954) were cultured in 96-well plates. Cells were grown overnight, followed by the addition of PS-targeted PDCs or HER2-targeted ADCs. After 3-5 days of incubation, cell growth and survival were measured using the Cell Proliferation AQ One Solution Cell Proliferation Assay kit (Promega, catalog number G3581). Dose-response curves were plotted using GraphPad Prism software.
[0117] Whole-body imaging, pharmacokinetics, and therapeutic research in mice All animal handling procedures used in the mouse studies were approved by the Institutional Animal Care and Use Committee of the University of Texas Southwestern Medical Center and Texas A&M University. BALB / c SCID mice were purchased from Jackson Laboratory (stock number 001803) and housed in-house. Pharmacokinetic studies were performed as previously described (19). In short, Lugol's solution was added to the drinking water 96 hours before the experiment. SCID BALB / c female mice (8 weeks old, body weight 18-22g) were anesthetized with 2% isoflurane in oxygen. 125 I-labeled protein (100-120 μCi, 10-12 μg / m A dose of (us) was administered intravenously. Systemic counting was performed at various time points using a dose calibrator (Capintec Inc.).
[0118] For whole-body near-infrared imaging (NIR) using PS-targeted drugs, female nude mice (6-7 weeks old, purchased from Envigo, catalog number 6903F) or BALB / c SCID mice (6-8 weeks old) were used. For transplantation of MDA-MB-231 tumors, mice were anesthetized with 2% isoflurane in oxygen, and small surgical incisions were made to expose the mammary fat pad. MDA-MB-231 cells were trypsin-treated and dispersed in PBS to form single-cell suspensions. 5 x 10⁶ cells were used per mouse. 6 Individual cells were injected into the mammary fat pad at a dose of 100 μl using a 25G needle, and the wound was then closed with a wound clip. Buprenorphine was administered subcutaneously at a dose of 50 μg / kg immediately after surgery and 12 hours later. Mice were monitored daily, and the wound clip was removed one week after surgery. For imaging of nude mice, the tumor was approximately 150 mm. 3When the mice reached the specified size, they were divided into three groups (n = 3 mice per group) and anesthetized with 2% isoflurane in oxygen. Anesthetized mice were injected intravenously with 1 n mole of IRDye800CW-labeled PS-specific agent in PBS. Fluorescence imaging (FLI) was performed at 0 hours (before injection) and at 3, 24, and 48 hours after injection using the Caliper Xenogen IVIS Spectrum (Perkin Elmer) in vivo imaging system. FLI was performed using 745 nm excitation, 800 nm emission, binning 8, FOV 12.9 cm, f-stop 2, and auto exposure. Absolute radiative efficiency (photons / second) at manually written ROIs was used to outline the tumor FLI signal, and the data was quantified and normalized to tumor volume using Living Imaging software. For imaging in BALB / c SCID mice, the tumor was approximately 300 mm². 3 When the tumors reached the specified size, the mice were divided into three groups (n = 3 mice per group) and injected intravenously with 1 n moles of IRDye800CW-labeled PS-specific drug in PBS. Forty-eight hours after injection, the tumors were dissected and imaged as described above. Fluorescence in manually drawn ROIs was quantified and normalized to tumor weight to outline the tumor's FLI signaling.
[0119] For tumor treatment studies using PS-targeted PDCs, MDA-MBA-231 tumor xenografts were transplanted into BALB / c SCID mice as described in the whole-body imaging experiment. For LNCaP tumor transplantation, 7-8 week old male BALB / c SCID mice (body weight 18-22g) were anesthetized with 2% isoflurane in oxygen, and 5x10⁻¹⁰�⁻¹⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰⁰� 6LNCaP cells were injected subcutaneously. When the MDA-MBA-231 or LNCaP tumor reached a size of approximately 100 mm, the mice were injected with 5 mg / kg of docetaxel 72 and 48 hours prior to treatment (intraperitoneal). Subsequently, the mice were injected with 1 n mole of unconjugated protein, PDCs, or PBS vehicle twice a week (intravenously). Tumor weight and body weight were measured twice a week. Fc-Syt1(DN) For the MMAE treatment experiment (Figure 16D), mice were treated for 4 weeks and then monitored for an additional 2.5 weeks. The experiment was stopped when the tumor size reached 2 cm in any dimension.
[0120] For therapies using HER2-specific ADCs, 6-8 week old female BALB / c SCID mice were subjected to whole-body imaging experiments using the method described above, with 4-5x10⁻¹⁰ images. 6 Individual MDA-MB-453 cells were transplanted. The tumor was approximately 60-100 mm. 3 Once the mice reached the specified size, they were intravenously injected with 2 mg / kg of ADC, T-DM1, unconjugated protein, or PBS vehicle once every three weeks (a total of two doses).
[0121] Immunohistochemical analysisFemale BALB / c SCID mice carrying MDA-MB-231 tumors were treated with 5 mg / kg docetaxel (intraperitoneal) 72 and 48 hours prior to delivery (intravenously) of either PBS or 1 nmol of Fc-Syt1 conjugated with MMAE. Mice were perfused with PBS and then 4% PFA at various time points. The tumors were then dissected, embedded in OCT (Fisher Scientific, catalog no. 23-730-571), and stored at -80°C. 10 μm tissue sections were dissected, hydrated with PBS at room temperature, and fixed with 4% PFA for 30 minutes. The tumor sections were then washed with PBS and incubated with permeabilization / blocking solution (PBS + 0.5% Triton X-100 and 3% BSA) at room temperature for 1 hour. Primary antibodies against human Ki-67 and mouse CD31 were diluted in a barrier buffer (PBS + 0.1% Tween 20 + 5% serum) and incubated overnight at 4°C with tissue sections. The following day, the tissue sections were washed with PBST (PBS + 0.1% Tween 20) and incubated at room temperature for 2 hours with fluorophore-conjugated secondary antibodies diluted in barrier buffer. After washing with PBST, the tissue sections were mounted on ProLong Gold antifade mounting medium. Confocal images were acquired using a Nikon A1R confocal microscope with a 40X, 1.3NA plan fluor objective lens and processed using NIS-Elements software (Nikon). [Examples]
[0122] Development of HER2-targeted drugs with pH-dependent binding to HER2 Figures 4A and 4B show the analysis of binding to two mutant pertuzumab targeting HER2. The SG mutant has a mutation in the heavy chain variable domain where Ser55 is mutated to histidine and Gly57 is mutated to glutamate (SEQ ID NO: 4), and the YS mutant has a mutation in the light chain variable domain where Tyr55 is mutated to histidine and Ser103 is mutated to histidine in the heavy chain variable domain (SEQ ID NOs: 6, 8). Data were obtained using surface plasmon resonance. Figure 4A shows representative sensorgrams at pH 7.0 and 5.8 regarding the interaction between 1 μM HER-extracellular domain (ECD)-Fc fusion and mutant and wild-type (WT) pertuzumab. The antibody was immobilized on a flow cell for the analysis shown in Figure 4A. Figure 4B shows the equilibrium dissociation constants (nM) for WT pertuzumab, SG, and YS obtained by injecting the antibody onto the immobilized HER2-ECD-Fc. The data show that both the SG and YS variants of pertuzumab exhibit greater pH dependence on HER2 binding than WT pertuzumab. [Examples]
[0123] Internalization and accumulation of HER2-targeted drugs in HER2-expressing cells Pertuzumab (WT) and mutated mutants SG and YS were conjugated to maleimidocaproyl-val-cit-PAB-MMAE (MC-VC-PAB-MMAE) via two hinge cysteine residues at a drug-to-antibody ratio (DAR) of two drugs per antibody. Subsequently, the binding and accumulation of HER2-targeted ADCs (HER2-ADCs) were analyzed in a panel of various HER2-expressing cell lines. Figure 5A shows the expression levels of HER2 on various cancer cell lines detected by flow cytometry with Alexa 647-labeled pertuzumab (solid line) or Alexa 647-labeled control antibody (dotted line). Figure 5B shows the internalized Alexa following incubations of 0.5, 4, and 20 hours. The levels of 488-labeled WT pertuzumab-MMAE (WT-MMAE), SG-MMAE, YS-MMAE, control antibody-MMAE (C-MMAE), or trastuzumab-DM1 (T-DM1) are shown. Cell surface-bound ADCs were quenched using Alexa 488-specific antibodies. Error bars indicate the standard deviation. * The difference is statistically significant (Student's t-test, p<0.05). The data show that SG-MMAE and YS-MMAE accumulate to higher levels than WT-MMAE and T-DM1 in all cancer cell lines examined. MDA-MB-453 cancer cells expressing moderate levels of HER2 (Figure) Delivery of ADCs to lysosomes in 5A) was also investigated using fluorescence microscopy (Figure 5C). Lysosomes in MDA-MB-453 cells were labeled by pulse chasing using Alexa 647-labeled dextran. Subsequently, the cells were incubated with 10 nM Alexa 488-labeled ADCs for 20 hours, washed, and surface signals were quenched with an Alexa-488-specific antibody. Microscopic images (size bar = 3 μm) show substantially higher levels of SG-MMAE and YS-MMAE accumulation in lysosomes compared to WT-MMAE or T-DM1. [Examples]
[0124] Suppression of HER2-positive cell growth and survival by HER2-ADCs Analysis of the effect of HER2-ADCs on the survival rate of HER2-+ breast cancer cells shows that SG-MMAE and YS-MMAE are more effective than WT pertuzumab conjugated to MMAE (WT-MMAE) or T-DM1 in reducing the survival rates of MDA-MBA-MB-453, SK-OV-3, and JIMT-1 cells (Figure 6). Error bars indicate the standard deviation. * This shows a statistically significant difference (Student's t-test, p<0.05). [Examples]
[0125] Suppression of tumor growth by HER2-ADCs in a mouse xenograft model Pharmacokinetic analysis of HER2-ADCs (WT-MMAE, SG-MMAE, and YS-MMAE) shows that the in vivo persistence of SG-MMAE and YS-MMAE in BALB / c SCID mice is similar to that of WT-MMAE (Figure 7A, n = 5 mice per group). The ADCs were radiolabeled with 125-I and injected into mice (5 mice per group), and residual radioactivity in the blood and systemic levels was determined at the indicated time points. MDA-MBA-MB-453 A therapeutic study using ADCs in BALB / c SCID mice carrying xenografts (moderate HER2 expression levels) showed that SG-MMAE and YS-MMAE were more effective than WT-MMAE or T-DM1 in treatment (Figure 7B). Mice were treated with two doses of 2 mg / kg ADC at days 17 and 38 (Experiment 1, indicated by arrows) or 24 and 45 (Experiment 2, indicated by arrows). Error bars indicate standard deviation, and statistically significant differences at the end of treatment (SG-MMAE vs. WT-MMAE or T-DM1, YS-MMAE vs. WT-MMAE or T-DM1) were identified. * This is demonstrated by Student's t-test (p<0.05, n=5-8 mice per group). Together, the data show that SG-MMAE and YS-MMAE have favorable pharmacokinetics and are also more effective than their parent WT pertuzumab and the clinically approved HER2-specific ADC T-DM1 in reducing tumor growth. [Examples]
[0126] Fabrication and characterization of ADCs with calcium-dependent association The interaction between a HER2-specific Fab fragment (derived from trastuzumab) fused to domain 2 (CalD2) of calbindin D9K via a hinge-SGG linker at the C-terminus of the CH1 domain (trastuzumab Fab-CalD2, trastuzumab light chain, SEQ ID NO: 18 associated with SEQ ID NO: 20) and a human-IgG-derived Fc fragment (CalD1-Fc, SEQ ID NO: 22) fused to domain 1 of calbindin D9K, using surface plasmon resonance, is Ca 2+Dependent association is shown (Figure 8A). The sensorgram shows the binding of 100 nM trastuzumab Fab-CalD2 to immobilized HER2-ECD, followed by 100 nM CalD1-Fc and then various Ca2+ molecules in the range of 0-2 mM. 2+ This shows the injection of a buffer solution with a concentration of (the area enclosed by the rectangle shown in the enlarged view in the right panel). The data shows a representative sensorgram, which is Ca 2+ This shows that the dissociation of Fab-CalD2 and CalD1-Fc increases with decreasing concentration. Additional experiments showed that at the C-terminus A PSMA-specific VH-CH1 domain (PRGX1-XG1-029, abbreviated as 026) fused to CalD2 via a hinge-SGG linker, as described by Schuelke, N., Varlamova, OA, Donovan, GP, Ma., D., Gardner, JP, Morrissey, DM, Arrigale, RR, Zhan, C., Chodera, AJ, Surowitz, KG, Maddon, PJ, Heston, WDW, Olson, WC (2003). The homodimer of prostate-specific membrane antigen is a functional target for cancer. A fusion protein (026-CalD2, SEQ ID NO: 24) containing 026-CalD2 (Therapy. Proc. Natl. Acad. Sci., USA, 100, 1259-12595) was also constructed. This CalD2 fusion combines with the 026 light chain (SEQ ID NO: 26) to form Fab-CalD2. Flow cytometry analysis showed that the accumulation of fluorescently labeled CalD1-Fc (SEQ ID NO: 22) in PSMA-expressing LNCaP cells was enhanced when cells were treated with a mixture of 026-CalD2 and Alexa 647-labeled CalD1-Fc (100 nM each) compared to treatment with 100 nM Alexa 647-labeled CalD1-Fc without 026-CalD2 ("Fab-less") (Figure 8B). [Examples]
[0127] Preparation and Characterization of PS-Targeted Drugs A panel of PS-targeting agents was created by fusing the Fc region of human IgG1 with the following PS-binding domains: the core domain of annexin A1 (AnxA1), the C2A domain of synaptotagmin 1 (Syt1), and the C2 domain of PKCα. The resulting fusion proteins are called Fc-AnxA1, Fc-Syt1, and Fc-PKCα, respectively. The PS-targeting agents were purified as homodimers (evaluated using Figure 9, Figure 10A, SDS-PAGE, and HPLC) and bound to PS in a lipid binding assay using lipid strips (Figure 10B). They also bound to cardiolipin, which is located on the inner mitochondrial membrane of eukaryotic cells and is therefore not relevant to targeting. Fc-AnxA1 showed a broad lipid binding distribution and bound to both neutral and negatively charged lipids (Figure 10B). Importantly, none of the PS-binding agents bound to phosphatidylcholine (PC) or sphingomyelin, which are lipids present in the outer layer of the plasma membrane.
[0128] The ability of PS-binding agents to interact with lipids on the cell surface was investigated using tumor endothelial cell line 2H11. Binding of fluorescent annexin V indicated that these cells were exposed to PS and that PS exposure increased after docetaxel treatment. Flow cytometry analysis showed that all PS-binding agents interacted with PS-positive cells, with Fc-Syt1 showing relatively low levels of binding (Figure 10C, 2nd only shows secondary antibody control, Fc shows PS-targeting protein or Fc fragment without a domain).
[0129] The pharmacokinetic behavior and tumor localization of three PS-binding agents in mice were evaluated, and it was determined which recombinant protein is suitable for further development as protein-drug conjugates (PDCs). Pharmacokinetic studies of the PS-binding agents revealed that Fc-Syt1 has a significantly longer half-life in mice (Figures 10D, E). Whole-body counts (n = 5 mice per group) following injection of radioiodinated PS-targeted fusion proteins into mice are shown in the graph in Figure 10D, and 10E shows the corresponding area under the curve for each radiolabeled protein. Additionally, the protein was labeled with a residualizing dye, IRDye800CW, and injected (intravenously) into female nude mice bearing MDA-MB-231 xenografts (n = 3 mice per group), imaged at the indicated time points (Figure 10F), and tumor fluorescence was quantified in tumors excised 48 hours after injection (Figure 10G). Similar experiments were performed in tumor-bearing BALB / c SC ID mice (n = 3 mice per group), and tumors were excised 48 hours later and the dye levels were determined (Figure 10H). Among the three PS-specific agents, Fc-Syt1 showed the highest level of tumor localization. Statistically significant differences regarding Figures 10E, 10G, and 10H were analyzed using one-way ANOVA and subsequent Tukey post-hoc test( ** , p < 0.01, *** , p < 0.001, **** , p < 0.0001), and error bars indicate SEM.
Example
[0130] The quadrivalent form of PS-targeted drugs improves binding and internalization into target cells. In some receptor systems, mixtures of crosslinking ligands such as multivalent ligands or antibodies have been shown to promote receptor internalization and degradation. For the study of the role of avidity in the behavior of PS-targeted PDCs, quadruple Syt1-Fc-Syt1 containing four Syt1 C2A domains was generated (sketched in Fig. 11A). The quadruple protein was purified as a homodimer (evaluated using SDS-PAGE and HPLC in Fig. 11A, B). Binding assays using lipids immobilized on nitrocellulose indicated that Syt1-Fc-Syt1 had higher affinity / avidity for PS than its bivalent parent, Fc-Syt1, and had the same lipid selectivity (Fig. 11C). Consistent with the binding data shown in Fig. 11C, when analyzed using flow cytometry, quadruple Syt1-Fc-Syt1 bound to 2H11 cells at significantly higher levels (Fig. 11D).
[0131] Internalization of Fc-Syt1 and Syt1-Fc-Syt1 was also studied using Alexa 647-labeled proteins. 2H11 cells were incubated on ice with labeled Fc-Syt1 and Syt1-Fc-Syt1 at various concentrations to achieve similar surface binding, and then incubated at 37 °C for various times for internalization. Surface-bound proteins were stripped using EDTA (due to the Ca 2+ -dependency of binding), and the internalized levels (resistant to stripping) were determined by flow cytometry. These studies indicated that both proteins accumulated effectively intracellularly, but quadruple Syt1-Fc-Syt1 internalized more rapidly (Fig. 11E). For Figs. 11D and 11E, statistically significant differences were analyzed using two-way ANOVA and subsequent Tukey post hoc test ( * , p < 0. 05, ** , p < 0. 01, *** , p < 0. 001, **** , p < 0. 0001). Error bars in Figs. 11D and 11E indicate SEM.
[0132] Fluorescence microscopy was also used to study the intracellular transport (trafficking) behavior of Syt1-Fc fusion proteins. 2H11 and MDA-MB-231 cells were incubated with 50 nM PS-targeted drug or control IgG for 4 hours, followed by washing, fixation, and staining with Cy3 / Alexa 555-labeled anti-human IgG (H+L). The lysosomal marker, LAMP-1, was detected using a LAMP-1-specific antibody followed by an Alexa 488-labeled secondary conjugate. Fc-Syt1 and Syt1-Fc-Syt1 were internalized in 2H11 (Figure 11F) and MDA-MB-231 (Figure 11G) cells and delivered into LAMP-1-positive lysosomes. Scale bars are 10 μm (F) and 5 μm (G). [Examples]
[0133] Calcium sensing and endosomal release of PS-PDCs The lysosomal transport and internalization behavior of Fc-Syt1 and Syt1-Fc-Syt1 demonstrated that they may be effective as delivery vehicles for conjugated drugs. Maleimidocaproyl-val-cit-PAB-MMAE was conjugated to hinge cysteine. Conjugation was performed (Figure 12A, left panel). For use as a negative control, maleimidocaproyl-val-cit-PAB-MMAE was conjugated to chicken egg lysozyme-specific human IgG1 in which the heavy / light chain interaction cysteine residue was mutated to serine. SDS-PAGE analysis showed that conjugation was complete and a drug-to-antibody ratio (DAR) of 4 was produced (Figure 12A, right panel). This is Fc-Syt1 MMAE was confirmed by MALDI-TOF mass spectrometry. Complete conjugation splits the two disulfide bonds in the hinge region, resulting in a molecular weight of 43.6 kDa using mass spectrometry (Figure 12B). This contrasts with unconjugated or partially conjugated proteins, which retain two or one disulfide bonds respectively, resulting in an apparent molecular weight of approximately 82 kDa (Figure 12B). Importantly, HPLC analysis showed that the conjugation process does not lead to protein aggregation (Figure 12C).
[0134] The Syt1 C2A domain is Ca for PS binding 2+ Extracellular Ca is required. 2+ Lower Ca levels in initial / sorted endosomes compared to levels (1-2 mM) 2+ The concentration (approximately 2 μM) suggests that PS-targeted PDCs (PS-PDCs) will dissociate from the boundary membrane of these endosomes following internalization. This dissociation is thought to lead to improved lysosome delivery. Both PS-PDCs containing the Syt1 domain were found at 2 mM Ca 2+ The PS beads bound in a buffer containing Ca 2+ No detectable interactions were observed when the concentration was reduced to 2 μM (Figure 12D). Furthermore, since the pH inside the sorted endosomes is acidic (pH 6.0-6.5), the effect of pH on PDC:PS interactions was analyzed. Both PDCs bound to PS at similar levels in the pH range of 6.0-7.4 (Figure 12D). Regarding Figure 12D, the bead-associated protein was analyzed using immunoblotting and detection with horseradish peroxidase-conjugated goat anti-human IgG(H+L).
[0135] Ca 2+Consistent with in vitro binding analysis showing dependent binding, MDA-MB-453 cells were incubated with 100 nM PS-PDCs or MMAE-conjugated controls for 30 minutes, followed by washing and fluorescence microscopy analysis after staining early endosomes with early endosomal antigen 1 (EEA1) specific antibody showed the presence of PS-PDCs in the lumen rather than the boundary membrane of sorted endosomes following internalization into the cell (Figure 13A). PS-PDCs were detected in these experiments using Alexa 555-labeled anti-human IgG(H+L) antibody, and intensity analysis of harvested and expanded early endosomes (labeled a and b) is shown on the right side of the panel in the figure. Furthermore, Fc-Syt1 was detected within 4 hours of delivery. MMAE and Syt1-Fc-Syt1 MMAE could be detected in lysosomes (detected using a LAMP-1 specific antibody) (Figure 13B). Both PS-PDCs divided the microtubule network in 2H11 and MDA-MB-231 cells after incubation of 2H11 or MDA-MB-453 cells with 100 nM or 50 nM PS-PDCs for 10 or 20 hours, respectively (Figure 13C). Scale bars = 5 μm (Figure 13A), 10 μm (Figure 13B), 15 μm (Figure 13C, upper panel), and 10 μm (Figure 13C, lower panel). [Examples]
[0136] Suppression of PS-positive cell growth and survival by PS-PDCs The effects of PS-specific PDCs on the growth of multiple cell lines, including tumor endothelium (2H11), ER-positive breast cancer (T-47D), HER2-positive breast cancer (SK-BR-3), triple-negative breast cancer (MDA-MB-231), androgen-sensitive prostate cancer (LNCaP), and androgen-insensitive prostate cancer (22Rv1), were investigated. Cell staining with fluorescently labeled annexin V and subsequent flow cytometry analysis showed that all of these cell lines were PS-positive (Figure 14A). Cell incubation with PS-PDCs effectively inhibited cell growth and survival in a dose-dependent manner (Figure 14B). 72 hours ( Cell viability following incubation periods of 2H11, 96 hours (SK-BR-3, MDA-MB-231, and 22Rv1), or 120 hours (T-47D) is shown. (4-valent Syt1-Fc-Syt1) MMAE inhibits T-47D cell growth by divalent Fc-Syt1 Although more potent than MMAE, the two PDCs showed similar effects in other cell lines. In contrast, relatively high concentrations of control IgG (egg lysozyme-specific human IgG1) conjugated with MMAE inhibited cell growth, likely due to nonspecific drug fluid phase absorption (Figure 14B). Consistent with the growth inhibitory effect of PS-PDCs, flow cytometry analysis of the internalization of the two PDCs at concentrations close to their corresponding IC50s showed that Syt1-Fc-Syt1 Except for MMAE internalization at a relatively high level in T-47D cells, all other cell lines showed similar behavior after 2 hours of incubation (Figure 14C). Regarding Figure 14C, statistically significant differences were analyzed using two-way ANOVA followed by the Bonferroni post-hoc test (ns, no significant difference). * p<0.05, *** (p<0.001, and error bars indicate SEM). Furthermore, unconjugated PS-targeted proteins did not show any effect on cell growth in a cell viability assay when added to cells at a concentration of 1 μM for 96 hours (Figure 14D). Thus, the data demonstrate that Syt1-based PDCs are powerful inhibitors of tumor endothelial and cancer cell growth in vitro. [Examples]
[0137] Suppression of tumor growth by PS-PDCs in a mouse xenograft model The therapeutic effect of PS-PDCs on tumor xenografts in BALB / c SCID mice was investigated. Prior to treatment, pharmacokinetic studies of PS-PDCs were performed using tetravalent Syt1-Fc-Syt1 MMAE, probably due to increased target-mediated absorption, divalent Fc-Syt1 It was shown to have a shorter half-life than MMAE (Figures 15A, B). Figure 15A shows the whole-body count in BALB / c SCID mice (n = 5 mice per group) following injection of radioactive iodized PS-PDC. Figure 15B shows the area under the clearance curve shown in Figure 15A, and statistically significant differences were analyzed using independent Student's t-test. **** (p<0.0001). To investigate the therapeutic effect of PDCs, they were delivered to female BALB / c SCID mice (n=5-6 mice per group) carrying orthotopic MDA-MB-231 mammary tumors. Tumor-carrying mice were pre-treated with docetaxel and delivered the following doses (equivalent to 1 n moles of protein) of PDCs or control unconjugated protein twice weekly: Fc-Syt1 or Fc-Syt1 For MMAE, 4.1 mg / kg, Syt1-Fc-Syt1 or Syt1-Fc-Syt1 In the case of MMAE, the dose was 5.6 mg / kg. In these experiments, divalent Fc-Syt1 MMAE effectively inhibited breast tumor growth (Figure 15C). (4-valent Syt1-Fc-Syt1) MMAE also suppressed tumor growth, but bivalent Fc-Syt1 The efficacy was lower than that of MMAE. Treatment with unconjugated Fc-Syt1 and Syt1-Fc-Syt1 had no effect on tumor growth (Figure 15C). Importantly, no weakness or weight loss was observed in any of the treatment groups (Figure 15D), indicating that PS-specific PDCs are well tolerated in vivo.
[0138] Similar to the drug efficacy in breast tumor models, bivalent Fc-Syt1 MMAE completely inhibited tumor growth in male BALB / c SCID mice carrying docetaxel-pre-treated prostate cancer LNCaP xenografts (Figure 15E). Tumor-bearing mice were administered the same drug as in the MDA-MB-231 xenograft experiment (above). Consistent with in vitro data (Figure 14D), the non-conjugated PS-targeted fusion protein was ineffective. However, tetravalent Syt1-Fc-Syt1 MMAE did not significantly inhibit tumor growth in the LNCaP model. The most likely explanation for this difference is the relatively short in vivo persistence of quadrivalent PDCs. For both Figures 15C and 15E, statistical analysis at the treatment endpoint was performed using one-way ANOVA followed by the Bonferroni post-hoc test. * p<0.05, *** , p<0.001, **** (p<0.0001). Error bars in Figures 15A, 15C, and 15E indicate SEM results. [Examples]
[0139] The suppression of tumor growth by Fc-Syt1 MMAE is dependent on PS binding. To rule out the possibility of drug accumulation in tumors via nonspecific mechanisms such as enhanced permeability and retention (EPR) effects, and to demonstrate that in vivo efficacy was dependent on PS binding, we created mutant synaptotagmin 1 C2A domain mutations with reduced affinity for PS. The synaptotagmin 1 C2A domain has three Ca25 chelated by five aspartic acid (D) molecules in domain loops I and III. 2+ It interacts with PS via ions (Striegel, AR, Biela, LM, Evans, CS, Wang, Z., Delehoy, JB, Sutton, RB, Chapman, ER and Reist, NE 2012. Calcium binding by synaptotagmin's C2A domain is an essential element of the electrostatic switch that triggers synchronous synaptic transmission. J. Neurosci. 32, 1253-1260). Ca 2+To cleave the bond, all five aspartic acid residues (D173N, D179N, D231N, D233N, and D239N) were mutated to asparagine (N) to create Fc-Syt1(DN). Fc-Syt1(DN) was purified and conjugated to MMAE with 4 DARs (Figure 16A), and it interacted with PS essentially at a background level in a protein-lipid overlay assay using lipid-coated nitrocellulose strips (Figure 16B). Further flow cytometry analysis showed that Fc-Syt1(DN) had significantly reduced binding to PS-positive cells compared to its wild-type counterpart (Figure 16C). In Figure 16C, statistically significant differences were analyzed using two-way ANOVA and subsequent Tukey-Posthoc test ( *** , p<0.001, **** (p<0.0001), error bars indicate SEM.
[0140] BALB / c SCID mice (n = 6 mice per group) carrying orthotopic MDA-MB-231 tumors were pre-treated with docetaxel and then treated with PS-PDCs or controls for 4 weeks until the mice in the control (PBS) group were euthanized due to their large tumor size. Mice were treated twice a week for 4 weeks (28-56 days) or less with doses equivalent to 1 n mole of protein. Fc-Syt1 MMAE or Fc-Syt1(DN) For MMAE, 4.1 mg / kg, Fc For MMAE, the dosage is 2.6 mg / kg. Fc-Syt1 Treatment of MDA-MB-231 tumors using MMAE led to significant growth inhibition (Figure 16D). More importantly, Fc-Syt1 Tumor growth remained suppressed after discontinuing MMAE delivery for 4 weeks. Fc-Syt1 at the end of treatment MMAE and Fc-Syt1(DN) Statistically significant differences between MMAE treatment groups were analyzed using one-way ANOVA followed by the Bonferroni Posthoc test. ***(p<0.001), error bars indicate SEM. At the end of the experiment, tumors were isolated from mice in each group and Fc-Syt1 Tumors could not be isolated from 3 out of 6 mice in the MMAE-treated group (Figure 16E). MMAE or Fc-Syt1(DN) MMAE delivery initially slowed tumor growth, but rapid proliferation was observed following the discontinuation of treatment (Figure 16D). In summary, the data suggest that PS binding is effective against Fc-Syt1 This indicates that it is essential for MMAE activity. [Examples]
[0141] Fc-Syt1 MMAE targets multiple cell types, including both tumor endothelium and cancer cells in tumor tissue. Fc-Syt1 after docetaxel treatment To further demonstrate that MMAE binds to PS-positive cells in tumor tissue, immunohistochemistry was performed 1 hour (Figure 17A) or 24 hours (Figure 17B) after delivery of this PDC to tumor-bearing mice. PBS was injected as a vehicle control, and Fc-Syt1 was eluted using Alexa 555-labeled anti-human IgG (H+L). MMAE was detected. Fc-Syt1 MMAEs were localized to CD31-positive vessels capable of exposing PS (Figure 17A), tumor cells, and tumor-infiltrating F4 / 80-positive macrophages (Figure 17B). The data indicate that cancer cells not only expose PS in vitro (Figure 14A), but also retain this loss of PS asymmetry in vivo. [Examples]
[0142] DNA and protein sequences of typical antibody-drug conjugates and protein-drug conjugates Table 1 shows the DNA sequences of polynucleotides encoding representative proteins described herein, and Table 2 shows the amino acid sequences of representative proteins encoded by the polynucleotides shown in Table 1. In the table, the DNA sequence of SEQ ID NO: 1 encodes the protein of SEQ ID NO: 2, the DNA sequence of SEQ ID NO: 3 encodes the protein of SEQ ID NO: 4, the DNA sequence of SEQ ID NO: 5 encodes the protein of SEQ ID NO: 6, the DNA sequence of SEQ ID NO: 7 encodes the protein of SEQ ID NO: 8, the DNA sequence of SEQ ID NO: 9 encodes the protein of SEQ ID NO: 10, the DNA sequence of SEQ ID NO: 11 encodes the protein of SEQ ID NO: 12, the DNA sequence of SEQ ID NO: 13 encodes the protein of SEQ ID NO: 14, the DNA sequence of SEQ ID NO: 15 encodes the protein of SEQ ID NO: 16, the DNA sequence of SEQ ID NO: 17 encodes the protein of SEQ ID NO: 18, the DNA sequence of SEQ ID NO: 19 encodes the protein of SEQ ID NO: 20, and the DNA sequence of SEQ ID NO: 21 encodes SEQ ID NO: The DNA sequence codes for 22 proteins; the DNA sequence of SEQ ID NO: 23 codes for the protein of SEQ ID NO: 24; the DNA sequence of SEQ ID NO: 25 codes for the protein of SEQ ID NO: 26; the DNA sequence of SEQ ID NO: 27 codes for the protein of SEQ ID NO: 28; the DNA sequence of SEQ ID NO: 29 codes for the protein of SEQ ID NO: 30; the DNA sequence of SEQ ID NO: 31 codes for the protein of SEQ ID NO: 32; the DNA sequence of SEQ ID NO: 33 codes for the protein of SEQ ID NO: 34; the DNA sequence of SEQ ID NO: 35 codes for the protein of SEQ ID NO: 36; the DNA sequence of SEQ ID NO: 37 codes for the protein of SEQ ID NO: 38; the DNA sequence of SEQ ID NO: 39 codes for the protein of SEQ ID NO: 40; the DNA sequence of SEQ ID NO: 41 codes for the protein of SEQ ID NO: 42; the DNA sequence of SEQ ID NO: 43 codes for the protein of SEQ ID NO: 44; the DNA sequence of SEQ ID NO: 45 codes for the protein of SEQ ID NO: 46; and the DNA sequence of SEQ ID NO: 47 codes for the protein of SEQ ID NO: 48. [Table 1-1] [Table 1-2] [Table 1-3] Table 1-4 Table 1-5 Table 1-6 Table 1-7 Table 1-8 Table 1-9 Table 1-10 Table 1-11 Table 1-12 Table 1-13 Table 1-14 Table 1-15 Table 2-1 Table 2-2 Table 2-3 Table 2-4 Table 2-5
[0143] The DNA sequence of Sequence ID No. 1 is a representative HE with a serine mutation at Cys214. This is a polynucleotide encoding the light chain (SEQ ID NO: 2) of the R2-specific antibody pertuzumab, and is configured, for example, to form a heterodimer with the SG heavy chain variant of pertuzumab (SEQ ID NO: 4).
[0144] In particular, the amino acid sequence of the light chain (SEQ ID NO: 2) of the representative HER2-specific antibody pertuzumab has a HER2-specific VL domain at residues 1-108 and an immunoglobulin CL domain (human Cκ) at residues 109-214, in order from the N-terminus to the C-terminus. The cysteine residue (214) that would normally be paired with the immunoglobulin heavy chain has been mutated to serine. The amino acid residue numbers mentioned in SEQ ID NO: 2 refer to the protein sequence and do not refer to the EU numbering agreement.
[0145] The DNA sequence of Sequence ID No. 3 is a polynucleotide that encodes the heavy chain (Sequence ID No. 4) of pertuzumab, a representative HER2-specific antibody that has serine mutations at Cys222 and Cys231 and an SG mutation. The encoded heavy chain (Sequence ID No. 4) is configured to form a heterodimer with, for example, a pertuzumab light chain variant (Sequence ID No. 2) to form a pertuzumab SG variant.
[0146] In particular, the amino acid sequence of the representative antibody heavy chain of Sequence ID No. 4 has, in order from the N-terminus to the C-terminus, a HER2-specific VH domain at residues 1-119, an immunoglobulin CH1 domain (derived from human IgG1) at residues 120-216, an immunoglobulin hinge (derived from human IgG1) at residues 217-232, an immunoglobulin CH2 domain (derived from human IgG1) at residues 233-342, and an immunoglobulin CH3 domain (derived from human IgG1) at residues 343-449. The representative HER2-specific antibody heavy chain of Sequence ID No. 4 has mutations (SG mutations) to histidine and glutamic acid at Ser55 and Gly57, respectively. The cysteine residues (222 and 231) that normally pair with the immunoglobulin light chain and form a hinge sulfhydryl crosslink have been mutated to serine. The amino acid residue numbers mentioned in Sequence ID No. 4 refer to the protein sequence and do not refer to the EU numbering agreement.
[0147] The DNA sequence of Sequence ID No. 5 is a polynucleotide that encodes the light chain (Sequence ID No. 6) of pertuzumab, a representative HER2-specific antibody with serine mutations at Cys214 and histidine mutations at Tyr55. The encoded light chain (Sequence ID No. 6) is configured for heterodimer formation with, for example, the YS heavy chain variant of pertuzumab (Sequence ID No. 8).
[0148] In particular, the amino acid sequence of the light chain of the representative HER2-specific antibody pertuzumab (SEQ ID NO: 6) has a HER2-specific VL domain at residues 1-108 and an immunoglobulin CL domain (human Cκ) at residues 109-214, in order from the N-terminus to the C-terminus. The representative HER2-specific antibody light chain of SEQ ID NO: 6 has a mutation to histidine at residue 55. The cysteine residue (214) that is normally paired with the immunoglobulin heavy chain has been mutated to serine. The amino acid residue numbers mentioned in SEQ ID NO: 6 refer to the protein sequence and do not refer to the EU numbering agreement.
[0149] The DNA sequence of Sequence ID No. 7 is a polynucleotide that encodes the heavy chain (Sequence ID No. 8) of pertuzumab, a representative HER2-specific antibody that has serine mutations at Cys222 and Cys231 and a histidine mutation at Ser103. The encoded heavy chain (Sequence ID No. 8) is configured, for example, to form a heterodimer with a pertuzumab light chain variant (Sequence ID No. 6) to create a pertuzumab YS variant.
[0150] In particular, the amino acid sequence of the representative antibody heavy chain of SEQ ID NO: 8 shows that residues 1-119 contain the HER2-specific VH domain, and residues 120-216 contain immunoglobulin C, in order from the N-terminus to the C-terminus. It has an H1 domain (derived from human IgG1), an immunoglobulin hinge (derived from human IgG1) at residues 217-232, an immunoglobulin CH2 domain (derived from human IgG1) at residues 233-342, and an immunoglobulin CH3 domain (derived from human IgG1) at residues 343-449. The typical HER2-specific antibody heavy chain of Sequence ID No. 8 has a mutation to histidine at residue 103. The cysteine residues (222 and 231) that normally pair with the immunoglobulin light chain and form a hinge sulfhydryl crosslink have been mutated to serine. The amino acid residue numbers mentioned in Sequence ID No. 8 refer to the protein sequence and do not refer to the EU numbering agreement.
[0151] The DNA sequence of SEQ ID NO: 9 is a polynucleotide encoding a single-stranded Fv (SEQ ID NO: 10) of pertuzumab, a representative HER2-specific antibody, fused to the N-terminus of an immunoglobulin Fc fragment containing serine mutations at Cys251 and Cys260 and an SG mutation. The encoded fusion protein (SEQ ID NO: 10) is configured to form a homodimer.
[0152] In particular, the amino acid sequence of the representative antibody heavy chain of Sequence ID No. 10 has, in order from the N-terminus to the C-terminus, a HER2-specific VH domain at residues 1-119, a (G4S)3 linker peptide at residues 120-134, a HER2-specific VL domain at residues 135-242, a GGS linker peptide at residues 243-245, an immunoglobulin hinge (derived from human IgG1) at residues 246-261, an immunoglobulin CH2 domain (derived from human IgG1) at residues 262-371, and an immunoglobulin CH3 (derived from human IgG1) at residues 372-478. The representative HER2-specific antibody scFv-heavy chain fusion of Sequence ID No. 10 has mutations (SG mutations) to histidine and glutamic acid at Ser55 and Gly57, respectively. The cysteine residues (251 and 260) that normally pair with the immunoglobulin light chain and form a hinge sulfhydryl crosslink have been mutated to serine. The amino acid residue numbers mentioned in Sequence ID No. 10 refer to the protein sequence and do not refer to the EU Numbering Agreement.
[0153] The DNA sequence of Sequence ID No. 11 is a polynucleotide encoding a single-stranded Fv (Sequence ID No. 12) of pertuzumab, a representative HER2-specific antibody, fused to the N-terminus of an immunoglobulin Fc fragment containing serine mutations at Cys251 and Cys260 and a YS mutation. The encoded fusion protein (Sequence ID No. 12) is configured to form a homodimer.
[0154] Specifically, the amino acid sequence of the representative anti - heavy chain antibody of SEQ ID NO: 12 has a HER2 - specific VH domain at residues 1 - 119 in order from the N - terminus to the C - terminus, a (G4S)3 linker peptide at residues 120 - 134, a HER2 - specific VL domain at residues 135 - 242, a GGS linker peptide at residues 243 - 245, an immunoglobulin hinge (derived from human IgG1) at residues 246 - 261, an immunoglobulin CH2 domain (derived from human IgG1) at residues 262 - 371, and an immunoglobulin CH3 (derived from human IgG1) at residues 372 - 478. The representative HER2 - specific antibody scFv - heavy chain fusion of SEQ ID NO: 12 has mutations to histidine at Ser103 and Tyr189 (YS mutation). The cysteine residues (251 and 260) that normally pair with the normal immunoglobulin light chain to form a hinge disulfide bridge are mutated to serine. The numbers of the amino acid residues referred to in SEQ ID NO: 12 are those of the protein sequence and do not refer to the EU numbering convention.
[0155] The DNA sequence of SEQ ID NO: 13 is that of a polynucleotide encoding a single - chain Fv (SEQ ID NO: 14) of the representative HER2 - specific antibody pertuzumab fused to the C - terminus of an immunoglobulin Fc fragment having mutations to serine at Cys6 and Cys15 and an SG mutation. The encoded fusion protein (SEQ ID NO: 14) is configured to form a homodimer.
[0156] In particular, the amino acid sequence of the representative antibody heavy chain of Sequence ID No. 14 has, in order from the N-terminus to the C-terminus, an immunoglobulin hinge (derived from human IgG1) at residues 1-16, an immunoglobulin CH2 domain (derived from human IgG1) at residues 17-126, an immunoglobulin CH3 domain (derived from human IgG1) at residues 127-233, a GGS linker peptide at residues 234-236, a HER2-specific VH domain at residues 237-355, a (G4S)3 linker peptide at residues 356-370, and a HER2-specific VL domain at residues 371-478. The representative HER2-specific antibody scFv-heavy chain fusion of Sequence ID No. 14 has mutations to histidine and glutamic acid at Ser291 and Gly293, respectively (SG mutations). The cysteine residues (6 and 15) that normally pair with the immunoglobulin light chain and form a hinge sulfhydryl crosslink have been mutated to serine. The amino acid residue numbers mentioned in Sequence ID No. 14 refer to the protein sequence and do not refer to the EU Numbering Agreement.
[0157] The DNA sequence of Sequence ID No. 15 is a polynucleotide encoding a single-stranded Fv (Sequence ID No. 16) of pertuzumab, a representative HER2-specific antibody, fused to the C-terminus of an immunoglobulin Fc fragment containing serine mutations at Cys6 and Cys15 and a YS mutation. The encoded fusion protein (Sequence ID No. 16) is configured to form a homodimer.
[0158] In particular, the amino acid sequence of the representative antibody heavy chain of Sequence ID No. 16 has, in order from the N-terminus to the C-terminus, an immunoglobulin hinge (derived from human IgG1) at residues 1-16, an immunoglobulin CH2 domain (derived from human IgG1) at residues 17-126, an immunoglobulin CH3 domain (derived from human IgG1) at residues 127-233, a GGS linker peptide at residues 234-236, a HER2-specific VH domain at residues 237-355, a (G4S)3 linker peptide at residues 356-370, and a HER2-specific VL domain at residues 371-478. The representative HER2-specific antibody scFv-heavy chain fusion of Sequence ID No. 16 has histidine mutations (YS mutations) at Ser339 and Tyr425. The cysteine residues (6 and 15) that normally pair with the immunoglobulin light chain and form a hinge sulfhydryl crosslink have been mutated to serine. The amino acid residue numbers mentioned in Sequence ID No. 16 refer to the protein sequence and do not refer to the EU Numbering Agreement.
[0159] The DNA sequence of Sequence ID No. 17 is a polynucleotide encoding a representative CalD2 fusion protein (SEQ ID No. 18) containing the VH domain and CH1 domain of the HER2-specific antibody trastuzumab, which is fused to the N-terminus of calbindin domain 2 (CalD2) via a linker peptide containing a portion of the immunoglobulin hinge (with a serine mutation at Cys223) and SGG. The encoded fusion protein (SEQ ID No. 18) forms a heterodimer with, for example, the light chain of trastuzumab (SEQ ID No. 20), Ca 2+ It is configured to associate with sequence number 22 in a dependent manner.
[0160] In particular, the amino acid sequence of the representative CalD2 fusion protein, Sequence ID No. 18, has a HER2-specific VH domain at residues 1-120, an immunoglobulin CH1 domain (derived from human IgG1) at residues 121-217, a linker sequence containing part of the heavy chain hinge region at residues 218-228, followed by an SGG sequence at residues 229-231 and a CalD2 domain at residues 232-263. The cysteine residue (223), which is normally paired with the immunoglobulin light chain, has been mutated to serine. The amino acid residue numbers mentioned in Sequence ID No. 18 refer to the protein sequence and do not refer to the EU numbering agreement.
[0161] The DNA sequence of sequence number 19 is a representative H2 with a serine mutation at Cys214. This is a polynucleotide encoding the light chain (SEQ ID NO: 20) of the ER2-specific antibody trastuzumab. The encoded light chain (SEQ ID NO: 20) is configured for heterodimer formation with, for example, the trastuzumab VH-CH1:CalD2 fusion protein (SEQ ID NO: 18).
[0162] In particular, the amino acid sequence of the light chain (SEQ ID NO: 20) of the representative HER2-specific antibody trastuzumab has a HER2-specific VL domain at residues 1-108 and an immunoglobulin CL domain (human Cκ) at residues 109-214, followed by a hexahistidine peptide tag at residues 215-220, in order from the N-terminus to the C-terminus. The cysteine residue (214) that would normally be paired with the immunoglobulin heavy chain has been mutated to serine. The amino acid residue numbers mentioned in SEQ ID NO: 20 refer to the protein sequence and do not refer to the EU numbering agreement.
[0163] The DNA sequence of Sequence ID No. 21 is a polynucleotide encoding a representative CalD1 fusion protein (Sequence ID No. 22) containing a calbindin domain 1 (CalD1) fused to the N-terminus of an immunoglobulin Fc fragment with a Cys52 serine mutation. The encoded fusion protein (Sequence ID No. 22) is, for example, a trastuzumab VH-CH1:CalD2 fusion protein (Sequence ID No. 18) or an O26 VH-CH1:CalD2 fusion protein (Sequence ID No. 24) with Ca 2+ It is structured to be a dependent meeting.
[0164] In particular, the amino acid sequence of the representative CalD1 fusion protein of Sequence ID No. 22 has the CalD1 domain at residues 1-43, the GSS linker peptide at residues 44-46, the immunoglobulin hinge (derived from human IgG1) at residues 47-62, the immunoglobulin CH2 domain (derived from human IgG1) at residues 63-172, and the immunoglobulin CH3 domain (derived from human IgG1) at residues 173-279, in order from the N-terminus to the C-terminus. The cysteine residue (52) that normally pairs with the immunoglobulin light chain has been mutated to serine. The amino acid residue numbers mentioned in Sequence ID No. 22 refer to the protein sequence and do not refer to the EU numbering agreement.
[0165] The DNA sequence of Sequence ID No. 23 is a polynucleotide encoding a representative CaLD2 fusion protein (SEQ ID No. 24) containing the VH domain and CH1 domain of PSMA-specific antibody 026, which is fused to the N-terminus of calbindin domain 2 (CalD2) via a linker peptide containing a portion of the immunoglobulin hinge (with a serine mutation at Cys227) and SGG. The encoded fusion protein (SEQ ID No. 24) forms a heterodimer with, for example, the light chain of 026 (SEQ ID No. 26) and CaLD2. 2+ It is structured to be a dependent meeting.
[0166] In particular, the amino acid sequence of the representative CalD2 fusion protein of Sequence ID No. 24, in order from the N-terminus to the C-terminus, contains a PSMA-specific VH domain at residues 1-124, an immunoglobulin CH1 domain (derived from human IgG1) at residues 125-221, a linker sequence including part of the heavy chain hinge region at residues 222-232, followed by an SGG sequence at residues 233-235 and a CalD2 domain at residues 236-267. The cysteine residue (227), which is normally paired with the immunoglobulin light chain, has been mutated to serine. The amino acid residue numbers mentioned in Sequence ID No. 24 refer to the protein sequence and do not refer to the EU numbering agreement.
[0167] The DNA sequence of Sequence ID No. 25 is a polynucleotide encoding the light chain (Sequence ID No. 26) of the representative PSMA-specific antibody 026, which has a serine mutation at Cys214. The encoded light chain (Sequence ID No. 26) is, for example, 026VH-CH1:CalD2 fusion. It is structured for heterodimer formation with the synthetic protein (SEQ ID NO: 24).
[0168] In particular, the amino acid sequence of the light chain (SEQ ID NO: 26) of the representative PSMA-specific antibody 026 has a HER2-specific VL domain at residues 1-108 and an immunoglobulin CL domain (human Cκ) at residues 109-214, followed by a hexahistidine peptide tag at residues 215-220, in order from the N-terminus to the C-terminus. The cysteine residue (214) that would normally be paired with the immunoglobulin heavy chain has been mutated to serine. The amino acid residue numbers mentioned in SEQ ID NO: 26 refer to the protein sequence and do not refer to the EU numbering agreement.
[0169] The DNA sequence of Sequence ID No. 27 is a polynucleotide encoding a representative Fc fusion protein (Sequence ID No. 28) that contains the Syt1 C2A domain of synaptotagmin fused to the C-terminus of an immunoglobulin Fc fragment with a Cys6 serine mutation. The encoded fusion protein (Sequence ID No. 28) is configured to form a homodimer.
[0170] In particular, the amino acid sequence of the representative Fc-Syt1 in Sequence ID No. 28 has an immunoglobulin hinge (derived from human IgG1) at residues 1-16, an immunoglobulin CH2 domain (derived from human IgG1) at residues 17-126, and an immunoglobulin CH3 domain (derived from human IgG1) at residues 127-233, in the order from the N-terminus to the C-terminus. The C2A PS-binding domain of synaptotagmin (Syt1) residues 141-266 are fused to the C-terminus of the CH3 domain as residues 239-364 via the GGGGS linker peptide (residues 234-238). The cysteine residue (6) paired with the immunoglobulin light chain has been mutated to serine. The amino acid residue numbers mentioned in Sequence ID No. 28 refer to the protein sequence and do not refer to the EU numbering agreement.
[0171] The DNA sequence of SEQ ID NO: 29 is a polynucleotide encoding a representative Fc fusion protein (SEQ ID NO: 30) containing the Syt1 C2A domain of synaptotagmin fused to both the N and C-terminuses of an immunoglobulin Fc fragment with a serine mutation at Cys137. The encoded fusion protein (SEQ ID NO: 30) is configured to form a homodimer.
[0172] In particular, the representative amino acid sequence of Syt1-Fc-Syt1 in Sequence ID No. 30 has an immunoglobulin hinge (derived from human IgG1) at residues 132-147, an immunoglobulin CH2 domain (derived from human IgG1) at residues 148-257, and an immunoglobulin CH3 domain (derived from human IgG1) at residues 258-364, in order from the N-terminus to the C-terminus. Remnants 141-266 of the C2A PS-binding domain of synaptotagmin (Syt1) are fused to the N-terminus and C-terminus of the hinge and CH3 domain via the GGGGS linker peptide (residues 127-131 and 365-369) as residues 1-126 and 370-495, respectively. The cysteine residue (137) paired with the immunoglobulin light chain has been mutated to serine. The amino acid residue numbers mentioned in Sequence ID No. 30 refer to the protein sequence and do not refer to the EU numbering agreement.
[0173] The DNA sequence of Sequence ID No. 31 is a polynucleotide encoding a representative Fc fusion protein (Sequence ID No. 32) that contains the C2 domain of PKCα fused to the C-terminus of an immunoglobulin Fc fragment with a Cys6 serine mutation. The encoded fusion protein (Sequence ID No. 32) is configured to form a homodimer.
[0174] In particular, the amino acid sequence of the representative Fc-PKCα of SEQ ID NO: 32 shows that, from the N-terminus to the C-terminus, residues 1-16 contain an immunoglobulin hinge (derived from human IgG1), residues 17-126 contain an immunoglobulin CH2 domain (derived from human IgG1), and residues 127-233 contain an immunoglobulin It possesses a brin CH3 domain (derived from human IgG1). Residues 157-288 of the PKCα C2 domain are fused to the C-terminus of the CH3 domain as residues 239-370 via the GGGGS linker peptide (residues 234-238). The cysteine residue (6) paired with the immunoglobulin light chain has been mutated to serine. The amino acid residue numbers mentioned in Sequence ID No. 32 refer to the protein sequence and do not refer to the EU numbering agreement.
[0175] The DNA sequence of SEQ ID NO: 33 is a polynucleotide encoding a representative Fc fusion protein (SEQ ID NO: 34) that contains an AnxA1 PS-binding core domain fused to the C-terminus of an immunoglobulin Fc fragment with a Cys6 serine mutation. The encoded fusion protein (SEQ ID NO: 34) is configured to form a homodimer.
[0176] In particular, the amino acid sequence of the representative Fc-AnxA1 of Sequence ID No. 34 has an immunoglobulin hinge (derived from human IgG1) at residues 1-16, an immunoglobulin CH2 domain (derived from human IgG1) at residues 17-126, and an immunoglobulin CH3 domain (derived from human IgG1) at residues 127-233, in order from the N-terminus to the C-terminus. Remnants 41-346 of the AnxA1 core domain are fused to the C-terminus of the CH3 domain as residues 239-544 via the GGGGS linker peptide (residues 234-238). The cysteine residue (6) paired with the immunoglobulin light chain has been mutated to serine. The amino acid residue numbers mentioned in Sequence ID No. 34 refer to the protein sequence and do not refer to the EU Numbering Agreement.
[0177] The DNA sequence of SEQ ID NO: 35 is a polynucleotide encoding a representative Fc fusion protein (SEQ ID NO: 36) containing the Syt1 C2A domain of synaptotagmin fused to the N-terminus of an immunoglobulin Fc fragment with a serine mutation at Cys137. The encoded fusion protein (SEQ ID NO: 36) is configured to form a homodimer.
[0178] In particular, the representative amino acid sequence of Syt1-Fc in Sequence ID No. 36 has residues 1-126 representing the C2A PS-binding domain of synaptotagmin (Syt1) in N-terminus to C-terminus, with the GGGGS linker peptide at residues 127-131, the immunoglobulin hinge (derived from human IgG1) at residues 132-147, the immunoglobulin CH2 domain (derived from human IgG1) at residues 148-257, and the immunoglobulin CH3 domain (derived from human IgG1) at residues 258-364. The cysteine residue (137) paired with the immunoglobulin light chain has been mutated to serine. The amino acid residue numbers mentioned in Sequence ID No. 36 refer to the protein sequence and do not refer to the EU numbering agreement.
[0179] The DNA sequence of SEQ ID NO: 37 is a polynucleotide encoding a representative Fc fusion protein (SEQ ID NO: 38) that contains the C2 domain of PKCα fused to the N-terminus of an immunoglobulin Fc fragment with a serine mutation at Cys143. The encoded fusion protein (SEQ ID NO: 38) is configured to form a homodimer.
[0180] In particular, the amino acid sequence of the representative PKCα-Fc of SEQ ID NO: 38 is such that residues 157-288 of the PKCα C2 domain are treated as residues 1-132, with the GGGGS linker peptide at residues 133-137, the immunoglobulin hinge (derived from human IgG1) at residues 138-153, the immunoglobulin CH2 domain (derived from human IgG1) at residues 154-263, and the immunoglobulin CH3 domain (derived from human IgG1) at residues 264-370. The cysteine residue (143) paired with the immunoglobulin light chain is spontaneously converted to serine. They are different. The amino acid residue numbers mentioned in Sequence ID No. 38 refer to the protein sequence, not the EU Numbering Agreement.
[0181] The DNA sequence of SEQ ID NO: 39 is a polynucleotide encoding a representative Fc fusion protein (SEQ ID NO: 40) that contains an AnxA1 PS-binding core domain fused to the N-terminus of an immunoglobulin Fc fragment with a serine mutation at Cys317. The encoded fusion protein (SEQ ID NO: 40) is configured to form a homodimer.
[0182] In particular, the representative amino acid sequence of AnxA1-Fc, sequence number 40, shows that residues 41-346 of the AnxA1 core domain are treated as residues 1-306 from the N-terminus to the C-terminus, with the GGGGS linker peptide at residues 307-311, the immunoglobulin hinge (derived from human IgG1) at residues 312-327, the immunoglobulin CH2 domain (derived from human IgG1) at residues 328-437, and the immunoglobulin CH3 domain (derived from human IgG1) at residues 438-544. The cysteine residue (317) paired with the immunoglobulin light chain has been mutated to serine. The amino acid residue numbers mentioned in sequence number 40 refer to the protein sequence and do not refer to the EU numbering agreement.
[0183] The DNA sequence of Sequence ID No. 41 is a polynucleotide encoding a representative Fc fusion protein (Sequence ID No. 42) containing the Syt1 C2A domain of synaptotagmin fused to the N and C-terminuses of an immunoglobulin Fc fragment having a Knob's-into-Hole mutation and a Cys137 serine mutation. The encoded fusion protein (Sequence ID No. 42) is configured to form a heterodimer with, for example, a representative Fc fragment (Sequence ID No. 44).
[0184] In particular, the amino acid sequence of the representative Syt1-Fc-Syt1 of Sequence ID No. 42 has an immunoglobulin hinge (derived from human IgG1) at residues 132-147, an immunoglobulin CH2 domain (derived from human IgG1) at residues 148-257, and an immunoglobulin CH3 domain (derived from human IgG1) at residues 258-364, in the order from the N-terminus to the C-terminus. Resides 141-266 of the C2A PS-binding domain of synaptotagmin (Syt1) are fused to the N-terminus and C-terminus of the hinge and CH3 domain via the GGGGS linker peptide (residues 127-131 and 365-369) as residues 1-126 and 370-495, respectively. The representative Syt1-Fc-Syt1 of Sequence ID No. 42 has a "knobs in to holes" mutation at residues 266 and 311. The cysteine residue (137) paired with the immunoglobulin light chain has been mutated to serine. The amino acid residue numbers mentioned in Sequence ID No. 42 refer to the protein sequence and do not refer to the EU numbering agreement.
[0185] The DNA sequence of SEQ ID NO: 43 is a polynucleotide encoding a representative Fc fragment (SEQ ID NO: 44) that has a knobs-into-holes mutation and a Cys6 serine mutation. The Fc fragment of SEQ ID NO: 44 is configured to form a heterodimer with, for example, a representative Syt1-Fc-Syt1 fusion (SEQ ID NO: 42).
[0186] In particular, the amino acid sequence of a representative Fc fragment of SEQ ID NO: 44 has an immunoglobulin hinge (derived from human IgG1) at residues 1-16, an immunoglobulin CH2 domain (derived from human IgG1) at residues 17-126, and an immunoglobulin CH3 domain (derived from human IgG1) at residues 127-233, in order from the N-terminus to the C-terminus. The representative Fc fragment of SEQ ID NO: 44 has a knobs-into-holes mutation at residues 150 and 191. The cysteine residue (6) that normally pairs with the immunoglobulin light chain has been mutated to serine. The amino acid residue numbers mentioned in SEQ ID NO: 44 refer to the protein sequence. This does not refer to the EU numbering agreement.
[0187] The DNA sequence of Sequence ID No. 45 is a polynucleotide encoding a representative Fc fusion protein (Sequence ID No. 46) containing the Syt1 C2A domain of synaptotagmin fused to both the N and C terminals of an immunoglobulin Fc fragment having a knobs-into-holes mutation, an electrostatic steering mutation, and a Cys137 serine mutation. The encoded fusion protein (Sequence ID No. 46) is configured to form a heterodimer with, for example, a representative Fc fragment (Sequence ID No. 48).
[0188] In particular, the amino acid sequence of the representative Syt1-Fc-Syt1 of Sequence ID No. 46 has an immunoglobulin hinge (derived from human IgG1) at residues 132-147, an immunoglobulin CH2 domain (derived from human IgG1) at residues 148-257, and an immunoglobulin CH3 domain (derived from human IgG1) at residues 258-364, in order from the N-terminus to the C-terminus. Resides 141-266 of the C2A PS-binding domain of synaptotagmin (Syt1) are fused to the N-terminus and C-terminus of the hinge and CH3 domain via the GGGGS linker peptide (residues 127-131 and 365-369) as residues 1-126 and 370-495, respectively. The representative Syt1-Fc-Syt1 of Sequence ID No. 46 has "knobs in to holes" mutations at residues 266 and 311, and electrostatic steering mutations at residues 309 and 326. The cysteine residue (137) paired with the immunoglobulin light chain has been mutated to serine. The amino acid residue numbers mentioned in Sequence ID No. 46 refer to the protein sequence and do not refer to the EU numbering agreement.
[0189] The DNA sequence of Sequence ID No. 47 is a polynucleotide encoding a representative Fc fragment (Sequence ID No. 48) that has a knobs-into-holes mutation, an electrostatic steering mutation, and a Cys6 serine mutation. The Fc fragment of Sequence ID No. 48 is configured to form a heterodimer with, for example, a representative Syt1-Fc-Syt1 fusion (Sequence ID No. 46).
[0190] In particular, the amino acid sequence of the representative Fc fragment of SEQ ID NO: 48 has an immunoglobulin hinge (derived from human IgG1) at residues 1-16, an immunoglobulin CH2 domain (derived from human IgG1) at residues 17-126, and an immunoglobulin CH3 domain (derived from human IgG1) at residues 127-233, in order from the N-terminus to the C-terminus. The representative Fc fragment of SEQ ID NO: 48 has knobs-into-hole mutations at residues 150 and 191, and electrostatic steering mutations at residues 143 and 185. The cysteine residue (6) that normally pairs with the immunoglobulin light chain has been mutated to serine. The amino acid residue numbers mentioned in SEQ ID NO: 48 refer to the protein sequence and do not refer to the EU numbering agreement.
[0191] The subject matter disclosed above should be considered illustrative and not restrictive, and the attached claims are intended to encompass all modifications, emphasis, and other aspects that fall within the true spirit and scope of this disclosure. Thus, to the maximum extent permitted by law, the scope of this disclosure should be determined by the broadest possible interpretation of the following claims and their equivalents, and should not be limited or restricted by the foregoing detailed description.
[0192] The various methods and techniques described above provide multiple ways of carrying out the application. Of course, it should be understood that not all of the described objectives or benefits can necessarily be achieved according to the specific embodiments described herein. Thus, for example, a person skilled in the art will recognize that the methods can be carried out in a way that achieves or optimizes one of the benefits or groups of benefits described herein, without necessarily achieving other objectives or benefits described or suggested herein. A variety of alternatives are listed herein. It should be understood that a preferred embodiment specifically includes one, another, or several features, while another specifically excludes one, another, or several features, and yet another mitigates a particular feature by including one, another, or several advantageous features.
[0193] Furthermore, those skilled in the art will recognize the applicability of various features from various embodiments. Similarly, those skilled in the art can use the various elements, features, and steps discussed above, as well as other known equivalents relating to each of such elements, features, or steps, in various combinations to carry out the method according to the principles described herein. Some of the various elements, features, and steps will be specifically included in various embodiments, while others will be specifically excluded.
[0194] While this application has disclosed certain aspects and embodiments, it will be understood by those skilled in the art that the aspects of this application extend beyond the specifically disclosed aspects to other aspects and / or uses, as well as modifications thereof and equivalents.
[0195] In some embodiments, it should be understood that numerical values representing the quantities and properties of components, such as molecular weight and reaction conditions, used to describe and assert certain embodiments of this application, are in some cases modified with the term "approximately." Therefore, in some embodiments, the numerical parameters shown in the specification and appended claims are approximations and may vary depending on the desired properties that a particular embodiment seeks to achieve. In some embodiments, numerical parameters should be interpreted by looking at the significant figures reported and by applying the usual rounding technique. Despite the approximations of the numerical ranges and parameters representing a wide range of embodiments of this application, the numerical values shown in specific examples are reported as accurately as possible.
[0196] In some embodiments, the terms “a,” “an,” and “the,” and similar references used in contexts describing specific aspects of this application (particularly in the context of those with claims below), may be interpreted as encompassing both singular and plural. Descriptions of ranges of values herein are intended to serve as a shorthand method for referring to each individual value included within the range. Unless otherwise specified herein, each individual value is introduced in the specification as if it were described individually herein. All methods described herein may be implemented in any suitable order, as otherwise clearly inconsistent with the context. Any use of any example or representative language (e.g., “like”) given in relation to a particular aspect of this specification is intended merely to clarify the application and does not imply limitations on the scope of the claimed application as otherwise. No word in the specification should be interpreted as indicating an unclaimed element essential to the implementation of this application.
[0197] Preferred embodiments of this application, including the best forms known to the inventors for the purpose of carrying out this application, are described herein. Variations of these preferred embodiments will be apparent to those skilled in the art by reading the foregoing description. It is intended that those skilled in the art may use such variations as appropriate and that this application may be carried out in ways other than those specifically described herein. Accordingly, many embodiments of this application include all modifications and equivalents of the subject matter described in the claims appended herein, as permitted by applicable law. Furthermore, any combination of the above elements in all possible variations thereof is incorporated herein unless otherwise specified herein or otherwise clearly inconsistent with the context.
[0198] All patents, patent applications, publications of patent applications, and other materials such as articles, books, specifications, publications, documents, objects, etc., referenced herein are not necessarily consistent with this document. Except for any conflicting prosecution file history related to any of them or any that may have a limiting effect on the broadest scope of claims currently or later relating to this document, the entirety of these references becomes part of this specification for all purposes. For example, if there is any inconsistency or contradiction between the explanations, definitions and / or uses of terms related to any of the materials that become part of this specification and those related to this document, the explanations, definitions and / or uses of terms in this document should prevail.
[0199] The embodiments of this application disclosed herein should be understood as examples of the principles of the embodiments of this application. Other modifications that may be used may fall within the scope of this application. Thus, as examples, but not as an limitation, other forms of the embodiments of this application may be used in accordance with the description herein. Accordingly, the embodiments of this application are not strictly limited to those shown and described.
Claims
1. A method for providing an endolysosome-targeted conjugate for improved endolysosome delivery, The process involves selecting mutants of a targeted component by mutating the targeted component, which comprises an antibody, antibody fragment, antibody domain, or nanobody configured to selectively bind to cell surface molecules on a selected type of tumor target cell, and screening the mutants for binding to cell surface molecules with higher affinity at pH 7.0 compared to pH 5.
8. A step of selecting a cargo component, which includes an antibody, antibody fragment, antibody domain, nanobody, protein, or cargo molecule conjugated to a protein fragment or protein domain, A step of providing an endolysosome-targeting conjugate comprising a mutant of a selected targeting component directly or indirectly fused to the cargo component; Methods that include...
Citation Information
Patent Citations
In vivo imaging of apoptosis
JP2005523945A
Attenuation of reperfusion injury
JP2009543876A
Drugs for detecting and imaging cell death
JP2011519367A
Drug containing carrier into cell for forming immune complex
WO2013081143A1
Ligand-cytotoxicity drug conjugate, preparation method therefor, and uses thereof
WO2015113476A1