Compounds for use in the treatment of kidney damage

ABCA1-inducing factor compounds, such as pyridine carboxamide derivatives, address the ineffectiveness of current treatments by upregulating ATP-binding cassette transporter A1 protein, reducing proteinuria and improving renal function in chronic kidney diseases.

JP7879183B2Active Publication Date: 2026-06-23F HOFFMANN LA ROCHE & CO AG

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
F HOFFMANN LA ROCHE & CO AG
Filing Date
2024-04-19
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Current treatments for chronic kidney diseases, particularly glomerular disorders like Alport syndrome and diabetic nephropathy, are ineffective and often come with serious side effects, failing to target specific pathogenic mechanisms and showing unpredictable responses.

Method used

The use of ABCA1-inducing factor compounds, specifically pyridine carboxamide derivatives, to upregulate the ATP-binding cassette transporter A1 protein, reducing proteinuria and improving renal function.

Benefits of technology

ABCA1-inducing factor compounds effectively reduce proteinuria and prevent the progression of end-stage renal disease, offering a safer and more targeted treatment for chronic kidney diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007879183000010
    Figure 0007879183000010
  • Figure 0007879183000011
    Figure 0007879183000011
  • Figure 0007879183000012
    Figure 0007879183000012
Patent Text Reader

Abstract

To provide ABCA1 inducer compounds for use in treating kidney disorders, in particular, chronic kidney diseases, glomerular diseases or proteinuric kidney diseases, such as Alport syndrome, focal segmental glomerulosclerosis, and diabetic kidney disease.SOLUTION: The present invention provides a compound of formula (I) [where one of A1 and A2 is N and the other is CH, R1 is C1-7 alkyl or the like, R2 and R6 independently represent H or halogen, R3 and R5 independently represent H, C1-7 alkyl or the like, R4 is H, C1-7 alkyl or the like, R7 is C1-7 alkyl or the like, and G is selected from the group consisting of -(CH2)m- and-NR8].SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This disclosure relates to ABCA1-inducing factor compounds for use in the treatment of renal impairment, particularly chronic kidney disease, glomerular disease, or proteinuria, such as Alport syndrome, focal segmental glomerulosclerosis, and diabetic nephropathy. [Background technology]

[0002] Chronic kidney disease (CKD), which leads to end-stage renal disease (ESRD) requiring dialysis or kidney transplantation, is an ongoing epidemic affecting millions of people worldwide (Bello AK et al, JAMA, 317:1864, 2017). While diabetes remains the leading cause of ESRD worldwide, other causes such as hypertension, cystic kidney disease, and glomerulonephritis contribute to the majority of ESRD cases (USRDS database). Many of these disorders may present with proteinuria ranging from moderate to severe nephrotic proteinuria, with severe proteinuria being a major risk factor for progression to ESRD. Although kidney replacement improves patient mortality, current therapeutic strategies slow, not stop, the progression of CKD. Several intervention studies have failed to demonstrate efficacy. This is mainly due to the fact that many of the interventions tested so far target late-stage kidney disease rather than the early pathogenic process.

[0003] Currently, the treatment strategy consists of the use of angiotensin-converting enzyme (ACE) inhibitors and angiotensin receptor blockers (ARBs) that help reduce proteinuria and slow the progression of glomerulosclerosis. Traditionally, patients with proteinuria have been treated with ACE inhibitors, including but not limited to benazapril, cilazapril, enalapril (Vastotec), fosinopril (Monopril), lisinopril (Zestril, Plinivir), perinopril, ramipril, quinapril (Acupril), and trandolapril. ARBs include candesartan (Atacand), epresartan, irbesartan, losartan (Cozar), telmisartan, and valsartan. The only approved drug for the treatment of proteinuria in FSGS is ACTHar. The off-label use of many other immunosuppressants has also been implemented in several proteinuria-related kidney diseases, including FSGS. These include prednisone (or generally steroids), rituximab, calcineurin inhibitors (cyclosporine and tacrolimus), rapamycin, abatacept, and mycophenolate tomofetil. Other methods such as coenzyme Q10, fish oil, vitamin D derivatives, gluten-free diets, allopurinol, spironolactone, LDL apheresis, and plasmapheresis have also been utilized.

[0004] However, many of these treatments are based on case series, are not supported by randomized controlled studies, often come with serious side effects, and are not designed to target specific pathogenic mechanisms. Furthermore, responses to any of these treatments are unpredictable. Consequently, currently available drugs have not been able to provide safe and effective treatment. More specifically, there is a long-standing, unmet need for novel medicines for the prevention or treatment of glomerular disorders, and more broadly, chronic kidney disease. [Overview of the project]

[0005] The inventors further investigated a novel therapeutic strategy for the treatment of patients suffering from chronic kidney diseases, particularly primary glomerular diseases such as Alport syndrome and FSGS, and secondary glomerular diseases such as diabetic kidney disease (DKD). The inventors have shown that several pyridine carboxamide compounds have very promising effects in the treatment of such kidney diseases.

[0006] Pyridine carboxamides have been described as small molecule inducers of ATP-binding cassette transporter A1 protein (ABCA1 inducers). Such pyridine carboxamides are described, for example, in International Patent Application Publication Nos. 2011 / 029827, 2012 / 032018, 2013 / 037703, and 2014 / 180741.

[0007] Thus, the present disclosure relates to compounds used for treating kidney diseases that are ABCA1 inducer compounds. In certain embodiments, such ABCA1 inducer compounds have the following formula I [Chemical formula]

[0008] [Wherein, A 1 and A 2 One of them is N, and A 1 and A 2 The other is CH, R 1 is C 1~7 alkyl, C 3~7 cycloalkyl, C 3~7 cycloalkyl-C 1~7 alkyl, C 1~7 alkoxy-C 1~7 alkyl, halogen-C 1~7 alkyl, heterocyclyl-C 1~7 alkyl (where the heterocyclyl group is unsubstituted or substituted by oxo), and heteroaryl-C 1~7Selected from the group consisting of alkyl groups (where the heteroaryl group is unsubstituted or mono- or disubstituted with a lower alkyl group), R 2 and R 6 These are independently hydrogen or halogen, R 3 and R 5 They are hydrogen and C, independently of each other. 1~7 Alkyl, C 1~7 Alkyl, halogen, halogen-C 1~7 Alkyl, halogen-C 1~7 Selected from the group consisting of alkoxys and cyanos, R 4 is hydrogen, C 1~7 Alkyl, C 1~7 Alkyl, halogen, halogen-C 1~7 Alkyl, halogen-C 1~7 Selected from the group consisting of alkoxy, amino, and cyano, R 7 is C 1~7 Alkyl, C 3~7 Cycloalkyl (where the cycloalkyl is unsubstituted or substituted with hydroxyl), heterocyclyl (where the heterocyclyl contains 1, 2, or 3 heteroatoms selected from N, O, and S, and has 3 to 7 ring atoms, which are unsubstituted or substituted with hydroxyl or oxo), phenyl (where the phenyl is unsubstituted or C 1~7 Alkyl, hydroxy, C 1~7 Alkoxy, cyano, halogen, and halogen-C 1~7 (substituted with one or two groups selected from the group consisting of alkyls), and heteroaryls (where the heteroaryl is unsubstituted or C 1~7 Alkyl, hydroxy, C 1~7 Alkoxy, cyano, halogen, and halogen-C 1~7 Selected from the group consisting of alkyl groups (substituted with one or two groups selected from the group consisting of alkyl groups), G is -(CH2) m -(wherein m is selected from 0 or 1), and -NR 8 (In the formula, R8 is hydrogen or C 1~7 Selected from the group consisting of alkyl groups. They are also represented by pharmaceutically acceptable salts thereof.

[0009] In certain embodiments, G is a bond, and R 7 is C 3~7 It is a cycloalkyl group (the cycloalkyl group is either unsubstituted or substituted with hydroxyl).

[0010] In a particular embodiment that can be combined with the above-described embodiment, R 7 It is a cyclohexyl molecule substituted with hydroxyl.

[0011] In a particular embodiment that can be combined with the above-described embodiment, R 2 and R 6 Each of them is hydrogen, and R 4 is a halogen, and R 3 and R 5 One of them is a halogen, R 3 and R 5 The other is hydrogen.

[0012] In a particular embodiment that can be combined with the above-described embodiment, R 1 is halogen-C 1~7 It is alkyl. Typically, R 1 The following can be selected: -CF3, -CHF2, -CH2Cl, -CH2CF3, -CH(CF3)2, and -CF2-CF3.

[0013] In a preferred embodiment, the ABCA1-inducing factor compound for use as described herein is 6-(3,4-dichlorophenyl)-N-[(1R,2R)-2-hydroxycyclohexyl]-5-(2,2,2-trifluoroethoxy)pyridine-2-carboxamide.

[0014] In another preferred embodiment, the ABCA1-inducing factor compound for use as described herein is 5-(3,4-dichlorophenyl)-N-((1R,2R)-2-hydroxycyclohexyl)-6-(2,2,2-trifluoroethoxy)-nicotinamide.

[0015] In certain embodiments that can be combined with the embodiments described above, ABCA1-inducing factor compounds are useful in the treatment of chronic kidney disease, primary and secondary glomerular diseases, or proteinuria. Typically, such ABCA1-inducing factor compounds may be useful in the treatment of Alport syndrome, focal segmental glomerulosclerosis, or diabetic nephropathy.

[0016] In certain embodiments that can be combined with the embodiments described above, the ABCA1 inducer compound for use as described herein is formulated for oral administration.

[0017] In another specific embodiment, the ABCA1-inducing factor compound for use as described herein is formulated for topical, nasal, intraocular, intravenous, intramuscular, subcutaneous, intravitreous, intrathecal, or transdermal administration.

[0018] This disclosure also relates to a method for treating renal disease in a person requiring it, the method comprising administering a therapeutically effective amount of ABCA1 as defined above.

[0019] In certain embodiments of such methods, the ABCA1 inducer may be administered simultaneously, individually, or sequentially in combination with another agent effective for treatment, such as an angiotensin-converting enzyme inhibitor or an angiotensin receptor blocker. [Modes for carrying out the invention]

[0020] The inventors have shown that ABCA1-inducing factor compounds have very promising effects in the treatment of renal impairment, particularly glomerular diseases such as Alport syndrome or focal segmental glomerulosclerosis, or other chronic kidney diseases such as diabetic nephropathy. The compounds not only reduce proteinuria in these disorders but also improve renal function and prevent the progression of end-stage renal disease.

[0021] ABCA1-inducing factor compounds for use in accordance with this disclosure As used herein, the term “ABCA1-inducing compound” means a compound that can directly or indirectly induce the expression level or activity of the ATP-binding cassette transporter protein (ABCA1). Transporter ABCA1 is known as a major regulator of cellular cholesterol and phospholipid homeostasis. Specifically, ABCA1 mediates the efflux of cholesterol and phospholipids to lipid-insufficiently formed Apo lipoproteins (ApoA1 and ApoE), which subsequently form early high-density lipoprotein (HDL). In vitro assays for measuring the upregulation of ABCA1 protein in cells are described, for example, in International Publication No. 2012 / 031817. These in vitro assays include, but are not limited to, the cholesterol efflux assay or the fluorescent ApoA1 binding assay described in International Publication No. 2012 / 031817.

[0022] Pyridinecarboxamide has been described as a small molecule inducer (ABCA1 inducer) of the ATP-binding cassette transporter A1 protein. Such pyridinecarboxamides are described, for example, in International Patent Application Publications 2011 / 029827, 2012 / 032018, 2013 / 037703, and 2014 / 180741.

[0023] In preferred embodiments, the disclosure relates to ABCA1-inducible compound of formula I. [ka] [In the formula, A1 and A 2 One of them is N, and A 1 and A 2 The other side is N, R 1 C 1~7 Alkyl, C 3~7 Cycloalkyl, C 3~7 Cycloalkyl-C 1~7 Alkyl, C 1~7 Alkoxy-C 1~7 Alkyl, halogen-C 1~7 Alkyl, heterocyclyl-C 1~7 Alkyl (where the heterocyclyl group is either unsubstituted or substituted with an oxo), and heteroaryl-C 1~7 Selected from the group consisting of alkyl groups (where the heteroaryl group is unsubstituted or mono- or disubstituted with a lower alkyl group), R 2 and R 6 These are independently hydrogen or halogen, R 3 and R 5 They are hydrogen and C, independently of each other. 1~7 Alkyl, C 1~7 Alkyl, halogen, halogen-C 1~7 Alkyl, halogen-C 1~7 Selected from the group consisting of alkoxys and cyanos, R 4 is hydrogen, C 1~7 Alkyl, C 1~7 Alkyl, halogen, halogen-C 1~7 Alkyl, halogen-C 1~7 Selected from the group consisting of alkoxy, amino, and cyano, R 7 is C 1~7 Alkyl, C 3~7 Cycloalkyl (where the cycloalkyl is unsubstituted or substituted with hydroxyl), heterocyclyl (where the heterocyclyl contains 1, 2, or 3 heteroatoms selected from N, O, and S, and has 3 to 7 ring atoms, which are unsubstituted or substituted with hydroxyl or oxo), phenyl (where the phenyl is unsubstituted or C1~7 alkyl, hydroxy, C 1~7 alkoxy, cyano, halogen, and halogen-C 1~7 alkyl, and is selected from the group consisting of heteroaryl (wherein heteroaryl is unsubstituted or substituted by one or two groups selected from the group consisting of C 1~7 alkyl, hydroxy, C 1~7 alkoxy, cyano, halogen, and halogen-C 1~7 alkyl), and is selected from the group consisting of G is -(CH2) m -(wherein m is selected from 0 or 1), and -NR 8 (wherein R 8 is hydrogen or C 1~7 alkyl), and is selected from the group consisting of.], Relates to the use of their pharmaceutically acceptable salts.

[0024] The term "lower alkyl" or "C 1~7 alkyl" alone or in combination refers to a straight-chain or branched-chain alkyl group having 1 to 7 carbon atoms, particularly a straight-chain or branched-chain alkyl group having 1 to 6 carbon atoms, and more specifically, a straight-chain or branched-chain alkyl group having 1 to 4 carbon atoms. Straight-chain and branched-chain C 1~7 Examples of alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, isomeric pentyl, isomeric hexyl, and isomeric heptyl, particularly methyl, ethyl, propyl, isopropyl, and tert-butyl.

[0025] The term "lower alkoxy" or "C 1~7 alkoxy" means the group R'-O-, wherein R' is lower alkyl, and the term "lower alkyl" has the meaning described previously. Examples of lower alkoxy groups include methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy, and tert-butoxy, particularly methoxy.

[0026] The term "lower alkoxy" or "C 1~7 alkoxy-C 1~7 alkyl" means a lower alkyl group as defined above which is mono- or polysubstituted with a lower alkoxy group as defined above. Examples of lower alkoxyalkyl groups include, for example, -CH2-O-CH3, -CH2-CH2-O-CH3, -CH2-O-CH2-CH3, and the groups specifically exemplified herein. More specifically, the lower alkoxy is methoxyethyl.

[0027] The term hydroxy means the group -OH.

[0028] The term "cycloalkyl" or "C 3~7 cycloalkyl" means a saturated carbocyclic group containing 3 to 7 carbon atoms, such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, or cycloheptyl.

[0029] The term "lower cycloalkylalkyl" or "C 3~7 cycloalkyl-C 1~7 alkyl" means a lower alkyl group as defined above in which at least one hydrogen atom of the lower alkyl group is replaced by a cycloalkyl group as defined above. Among the lower cycloalkylalkyl groups, cyclopropylmethyl is of particular interest.

[0030] The term "halogen" means fluoro, chloro, bromo, and iodo, and particularly fluoro, chloro, and bromo are of interest. More specifically, the halogen means fluoro and chloro.

[0031] The term "lower halogenalkyl" or "halogen-C 1~7"Alkyl" means a lower alkyl group that is monosubstituted or pluralized with a halogen, especially a fluoro or chloro, most specifically a fluoro. Examples of lower halogen alkyl groups include, for example, -CF3, -CHF2, -CH2Cl, -CH2CF3, -CH(CF3)2, -CF2-CF3, -CH2-CH2-CF3, -CH(CH3)-CF3, and the groups specifically exemplified herein. Of particular interest are the groups trifluoromethyl (-CF3) and 2,2,2-trifluoroethyl (-CH2CF3).

[0032] The term "lower halogen alkoxy" or "halogen-C" 1~7 "Alkoxy" refers to the lower alkoxy group defined above, in which at least one hydrogen atom of the lower alkoxy group is replaced by a halogen atom, particularly fluoro or chloro, most specifically fluoro. Among the lower halogen alkoxys, trifluoromethoxy, difluoromethoxy, fluoromethoxy, and chloromethoxy are of particular interest, and more specifically, trifluoromethoxy.

[0033] The term "amino" refers to the group -NH2.

[0034] The term "cyano" refers to the group -CN.

[0035] The term "azid" refers to the base-N3.

[0036] The term "heteroaryl" refers to an aromatic five- or six-membered ring that may contain one, two, or three atoms selected from N, O, and S. Examples of heteroaryl groups include, for example, furanyl, pyridyl, pyrazinyl, pyrimidinyl, pyridadinyl, thienyl, isoxazolyl, thiazolyl, isothiazolyl, thiadiazolyl, oxazolyl, imidazolyl, pyrazolyl, triazolyl, oxadiazolyl, oxatriazolyl, tetrazolyl, pentazolyl, or pyrrolyl. The term "heteroaryl" also includes two five- or six-membered rings, one or both of which are aromatic and may contain one, two, or three atoms selected from nitrogen, oxygen, or sulfur, such as quinolinyl, isoquinolinyl, synnolinyl, pyrazolo[1,5-a]pyridyl, imidazo[1,2-a]pyridyl, quinoxalinyl, benzothiazolyl, benzotriazolyl, indolyl, indazolyl, and 3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazinyl. Particularly interesting heteroaryl groups are isoxazolyl, pyrazolyl, oxadiazolyl, thiazolyl, pyridyl, pyridadinyl, pyrimidinyl, and pyrazinyl. More specifically, heteroaryls are pyridyl or pyridadinyl.

[0037] The term "lower heteroarylalkyl" or "heteroaryl-C" 1~7 "Alkyl" refers to a lower alkyl group as defined above, in which at least one hydrogen atom of the low alkyl group is replaced by a heteroaryl group as defined above.

[0038] The term "heterocyclyl" refers to a saturated or partially unsaturated 3, 4, 5, 6, or 7-membered ring that may contain one, two, or three heteroatoms selected from N, O, and S. Examples of heterocyclyl rings include piperidinyl, piperazinyl, azetidinyl, azepinyl, pyrrolidinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, oxylanyl, thiadiazolylidinyl, oxetanyl, dioxolanyl, dihydrofuranyl, tetrahydrofuranyl, dihydropyranyl, tetrahydropyranyl, and thiomorpholinyl. Of particular interest are piperidinyl and tetrahydropyranyl.

[0039] The term "lower heterocyclylalkyl" or "heterocyclyl-C" 1~7 "Alkyl" refers to a lower alkyl group as defined above, in which at least one hydrogen atom of the low alkyl group is replaced by a heterocyclyl group as defined above.

[0040] The term "oxo" means that the carbon atom of a heterocyclyl or heteroaryl ring can be substituted with =O, and therefore, that a heterocyclyl or heteroaryl ring can contain one or more carbonyl (-CO-) groups.

[0041] In a particular embodiment relating to the use of the compound of formula (I), G is a bond, and R 7 is C 3~7 It is a cycloalkyl group (the cycloalkyl group is either unsubstituted or substituted with hydroxyl). For example, R 7 This is a cyclohexyl molecule that may or may not be substituted with hydroxyl.

[0042] In a particular embodiment, R 2 and R 6 Each of these is hydrogen.

[0043] In a particular embodiment, R 4R is a halogen, for example, chloro or fluoro, 3 and R 5 One of them is a halogen, for example, chloro or fluoro, and R 3 and R 5 The other is hydrogen.

[0044] In certain embodiments, R1 is halogen-C 1~7 It is alkyl, and typically R1 is selected from -CF3, -CHF2, -CH2Cl, -CH2CF3, -CH(CF3)2, and -CF2-CF3.

[0045] Specific examples of compounds are the following: [Table 1]

[0046] In certain embodiments, the compounds for use in the treatment of renal diseases described herein are selected from the group consisting of 5-(3,4-dichlorophenyl)-N-((1R,2R)-2-hydroxycyclohexyl)-6-(2,2,2-trifluoroethoxy)-nicotinamide and 6-(3,4-dichlorophenyl)-N-[(1R,2R)-2-hydroxycyclohexyl]-5-(2,2,2-trifluoroethoxy)pyridine-2-carboxamide.

[0047] This disclosure also includes compounds of formula (I), tautomers, enantiomers, diastereomers, racemic compounds, or mixtures thereof, or hydrates, solvates, or pharmaceutically acceptable salts, for use in renal diseases.

[0048] The term "pharmaceutically acceptable salt" means salts that retain the biological efficacy and properties of a free base or free acid and do not possess any undesirable properties of their own. Salts are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid, particularly hydrochloric acid, and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, salicylic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, and N-acetylcysteine. Therefore, in certain embodiments, "pharmaceutically acceptable salts" include acetates, bromides, chlorides, formates, fumarates, mesylates, nitrates, oxalates, phosphates, sulfates, tartrates, and tosylates of compounds of formula I. In addition, pharmaceutically acceptable salts can be prepared by adding an inorganic or organic base to a free acid. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, primary, secondary, and tertiary amines, naturally occurring substituted amines, cyclic amines, and substituted amines containing basic ion exchange resins, such as salts of isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, diethylamine, lysine, arginine, N-ethylpiperidine, piperidine, and piperazine. Compounds of formula I can also exist in zwitterionic or hydrate form. Specifically, pharmaceutically acceptable salts of compounds of formula I can be hydrochloride salts.

[0049] Examples of synthesis methods for compounds of formula I are described in International Publications 2011 / 029827, 2012 / 032018, 2013 / 37703, and 2014 / 180741. Compound G Exemplary methods for preparing the compound are described in International Publication No. 2011 / 029827, A An exemplary method for preparing it is described in International Publication No. 2014 / 180741.

[0050] Method of using the compound of formula I Compounds of formula I, typically the compounds described in the examples. A and G Salts of or pharmaceutically acceptable salts have been shown to be useful in the treatment of kidney disease.

[0051] As used herein, the term “renal disease” means any change in the normal physiology and function of the kidney. This term includes, but is not limited to, diseases and conditions such as kidney transplantation; nephropathy; primary glomerulopathy, focal segmental glomerulosclerosis including scattered idiopathic steroid-resistant nephrotic syndrome with focal segmental glomerulosclerosis, minimal change syndrome, membranous GN, C3 glomerulopathy, severe renal immunoglobulinemia, IgA nephropathy, chronic kidney disease (CKD); glomerulonephritis; genetic diseases such as polycystic kidney disease; acute and chronic interstitial nephritis, mesoamerican nephropathy; nephrotic syndrome; nephritis syndrome, end-stage renal disease (ESRD); acute and chronic renal failure; interstitial disease; nephritis; sclerosis, cirrhosis or hardening of tissues and / or blood vessels resulting from causes including inflammation due to disease or injury; renal fibrosis and scarring; pararenal proliferative disorders; and other primary or secondary renal conditions.

[0052] Kidney disease can also be generally defined as “(one or more) nephropathy.” The term “(one or more) nephropathy” encompasses any clinical and pathological changes in the kidney that may result in renal fibrosis, and / or glomerular disease (e.g., glomerulosclerosis or glomerulonephritis), and / or chronic renal insufficiency, and may lead to end-stage renal disease and / or renal failure.

[0053] Some aspects of this disclosure relate to compositions and their use for the prevention and / or treatment of hypertensive nephropathy, diabetic nephropathy such as diabetic nephropathy, and analgesic nephropathy, immune-mediated glomerulonephropathy (e.g., IgA nephropathy, or Burger disease, lupus nephritis), ischemic nephropathy, paraHIV nephropathy, membranous nephropathy, glomerulonephritis, glomerulosclerosis, radiopaquery-induced nephropathy, toxic nephropathy, analgesic-induced nephrotoxicity, cisplatin nephropathy, transplant tissue nephropathy, and other forms of glomerular abnormalities or injuries, or other types of nephropathy such as glomerular capillary injury (tubular fibrosis). In some embodiments, the term “(one or more) nephropathy” specifically means any disorder or disease in which protein is present in the urine of the subject (i.e., proteinuria) and / or renal failure, also referred to herein as “proteinuria nephropathy.”

[0054] In some embodiments, the subjects have albuminuria or proteinuria. Exemplary disorders associated with albuminuria include, but are not limited to, chronic kidney disease, proliferative glomerulonephritis (e.g., immunoglobulin A nephropathy, membranoproliferative glomerulonephritis, mesangial proliferative glomerulonephritis, anti-GBM disease, nephrovasculitis, lupus nephritis, paracolonemia-associated glomerulonephritis, bacterial endocarditis, Henoch-Schönlein purpura, post-infectious glomerulonephritis, or hepatitis C), and nonproliferative glomerulonephritis (e.g., membranoglomerulonephritis, minimal change disease, primary focal segmental glomerulosclerosis (FSGS), fibrillary glomerulonephritis, immunotactoid glomerulonephritis, amyloidosis, Alport syndrome, hypertensive nephrosclerosis, light chain disease of multiple myeloma, and secondary focal segmental glomerulosclerosis).

[0055] In any of the embodiments provided herein, a subject can be subjected to specific tests to evaluate renal function. Such tests include, but are not limited to, measuring blood urea nitrogen in the subject; measuring creatinine in the subject's blood; measuring creatinine clearance in the subject's blood; measuring proteinuria in the subject; measuring the albumin:creatinine ratio in the subject; measuring the glomerular filtration rate in the subject; and measuring urinary output in the subject.

[0056] As used herein, the terms “to treat” or “treatment” mean the reversal, alleviation, inhibition of progression, or prevention of a disorder or condition to which such terms apply, or the reversal, alleviation, inhibition of progression, or prevention of one or more symptoms of a disorder or condition to which such terms apply. Accordingly, in another embodiment, this disclosure also includes reducing proteinuria, delaying the increase of proteinuria, delaying the increase of the urinary albumin:creatinine ratio (UACR), decreasing the UACR, delaying the increase of the UAER, decreasing the UAER, reducing albuminuria, delaying the increase of albuminuria, increasing glomerular epithelial cell density, preventing or delaying the increase in glomerular basement membrane (GBM) wall thickness, decreasing glomerular area, decreasing the number of renal interstitial macrophages, decreasing or delaying renal tissue fibrosis, stopping or reducing inflammation in the kidney, macrophage Compounds of Formula I, typically those described in the Examples, for use in reducing, inhibiting, or eliminating symptoms associated with renal impairment, including but not limited to cessation or reduction of purge-induced renal damage, increase or normalization of estimated glomerular filtration rate (eGFR), attenuation of eGFR decline, reduction of glomerulosclerosis, cessation or reduction of glomerular extracellular matrix expansion, cessation or reduction of hyaline mass deposition, cessation or reduction of glomerular epithelial hyperplasia (EPHL), and cessation or reduction of lymphocyte infiltration. A and G , or relating to pharmaceutically acceptable salts.

[0057] This disclosure therefore also relates to pharmaceutical compositions comprising the compound of Formula I as defined above, and a pharmaceutically acceptable carrier and / or adjuvant, for use in the treatment of the renal diseases defined above.

[0058] In particular, this disclosure relates to the pharmaceutical compositions defined above for use in the treatment and / or prevention of kidney diseases, including chronic kidney disease, proteinuria and / or glomerular disease. Preferred uses relate to Alport syndrome, focal segmental glomerulosclerosis, and diabetic nephropathy.

[0059] In another embodiment, the present invention relates to a method for treating and / or preventing kidney disease, comprising administering an effective amount of a compound of formula I to a patient in need of treatment. Examples of such kidney diseases include chronic kidney disease, proteinuria, and / or glomerular diseases. Methods for treating and / or preventing Alport syndrome, focal segmental glomerulosclerosis, and diabetic nephropathy are preferred.

[0060] Furthermore, this disclosure relates to compounds of Formula I as defined above, typically those described in the Examples, for preparing pharmaceuticals for the treatment and / or prevention of kidney disease. A and G This relates to the use of pharmaceutically acceptable salts. Examples of such kidney diseases include chronic kidney disease, proteinuria, and / or glomerular diseases. The use of compounds of Formula I as defined above for the preparation of medicines for the treatment and / or prevention of Alport syndrome, focal segmental glomerulosclerosis, and diabetic nephropathy is of particular interest.

[0061] The form, route of administration, dosage, and regimen of a pharmaceutical composition naturally depend on the conditions being treated, the severity of the disease, the patient's age, weight, and sex, among other factors.

[0062] The pharmaceutical compositions of this disclosure can be formulated for topical, oral, nasal, intraocular, intravenous, intramuscular, or subcutaneous administration. Preferably, the pharmaceutical compositions of this disclosure can be formulated for oral administration.

[0063] In certain embodiments, the pharmaceutical compositions of this disclosure can be formulated for intravitreous, intrathecal, or transdermal administration.

[0064] The pharmaceutical composition may take the form of a tablet, pill, capsule, semi-solid, powder, sustained-release formulation, solution, suspension, emulsion, syrup, elixir, aerosol, or any other suitable composition, and may contain at least one compound of Formula I as defined above.

[0065] In certain embodiments, the oral formulation may be a tablet, an orally dispersible tablet, a capsule, a solution, a patch, a sublingual tablet, an intranasal spray, or an oral spray. In a sub-embodiment, the formulation is prepared for sustained release of the compound of formula I as defined above.

[0066] For ease of administration, tablets and capsules present the most advantageous forms of oral medication, in which case solid drug carriers are obviously used. If desired, tablets can be sugar-coated by standard techniques or enteric-coated. Coating tablets or pills can result in dosage forms that offer the advantage of prolonged action. For example, tablets or pills may contain an internally administered component and an externally administered component, the latter in the form of an envelope covering the former. The two components can be separated by a single enteric-coated layer, which serves to withstand disintegration in the stomach, allowing the internal components to pass intact to the duodenum or to have their release delayed. Various materials can be used for such enteric-coated layers or coatings, including numerous polymeric acids containing such materials, such as shellac paint, cetyl alcohol, and cellulose acetate.

[0067] Suitable carrier materials are not only inorganic carrier materials but also organic carrier materials. For example, lactose, corn starch or its derivatives, talc, stearic acid or its salts can be used as carrier materials for tablets, coated tablets, sugar-coated pills, and hard gelatin capsules. Suitable support materials for soft gelatin capsules are, for example, vegetable oils, waxes, lipids, and semi-solid and liquid polyols (however, depending on the properties of the active ingredient, a carrier may not be necessary in the case of soft gelatin capsules). Suitable carrier materials for the manufacture of solutions and syrups are, for example, water, polyols, sucrose, and invert sugar. Suitable carrier materials for injections are, for example, water, alcohols, polyols, glycerol, and vegetable oils. Suitable carrier materials for suppositories are, for example, natural or hydrogenated oils, waxes, fats, and semi-solid or liquid polyols. Suitable carrier materials for topical preparations are glycerides, semi-synthetic and synthetic glycerides, hydrogenated oils, liquid waxes, liquid paraffin, liquid aliphatic alcohols, sterols, polyethylene glycol, and cellulose derivatives.

[0068] Conventional stabilizers, preservatives, wetting and emulsifying agents, consistency improvers, flavor improvers, salts for osmotic pressure changes, buffers, solubilizers, colorants, and masking agents and antioxidants are considered as pharmaceutical adjuvants.

[0069] The dosage used for administration can be adapted depending on the relevant medical condition, or alternatively, on various parameters of the desired duration of treatment, and in particular, on the method of administration used. It will be understood that the appropriate dosage of the compound and the composition containing the compound may vary from patient to patient. Determining the optimal dosage generally involves balancing the level of therapeutic effect against any risks or adverse side effects of the treatment described herein. The dose level to be selected depends on a variety of factors, including but not limited to the activity of the particular compound, the route of administration, the timing of administration, the rate of excretion of the compound, the duration of treatment, other drugs, compounds, and / or materials used in combination, and the patient's age, sex, weight, condition, overall health, and prior medical history. While the amount and route of administration of the compound are ultimately at the physician's discretion, generally, the dosage should achieve a local concentration at the site of action that achieves the desired effect without causing substantial harmful or deleterious side effects.

[0070] For adult patients, a daily dose of approximately 1–100 mg, particularly 1–50 mg, is considered. Depending on the severity of the disease and the precise pharmacokinetic profile, the compound can be administered in a single dose or in multiple daily doses, such as 1–3 doses.

[0071] In certain embodiments, the compound for use according to this disclosure is administered at a daily dose of 20 to 800 mg / day.

[0072] In another embodiment, the compound for use according to this disclosure is administered at a daily dose of 200 mg / day.

[0073] A pharmaceutical composition for use in accordance with this disclosure is conveniently prepared in an amount of about 1 to 200 mg, preferably 75 to 100 mg, of a compound of formula I, typically the compound described in the examples. A and G or contain pharmaceutically acceptable salts thereof. Dosage regimens can be tailored to the specific pharmacokinetic properties of the compounds of formula I.

[0074] In certain embodiments, the compound of formula I, typically the compound described in the examples, is used. A and G The drug, or a pharmaceutical composition containing the drug, is administered once daily, twice daily, three times daily, once every three days, once a week, once every two weeks, or once a month. Preferably, the dosing frequency is selected from twice daily, once daily, and once every two days.

[0075] In another specific embodiment, a compound of formula I, typically the compound described in the examples. A and G For , or pharmaceutically acceptable salts, the loading dose regimen involves doubling the dose during the first 7, 14, and 30 days.

[0076] In another specific embodiment, a pharmaceutical composition for use according to this disclosure contains about 20 to 800 mg, preferably about 50 to 400 mg, and more preferably about 200 mg, of a compound of formula I, typically the compound described in the examples. A and G or may contain pharmaceutically acceptable salts thereof.

[0077] In another specific embodiment, a compound of formula I, typically the compound described in the Examples, is used in accordance with the present disclosure. A and G With regard to the use of pharmaceutically acceptable salts, the daily dose is 20 to 800 mg / day, preferably about 200 mg / day.

[0078] Furthermore, the compounds of Formula I for use in accordance with this disclosure may also be useful in simultaneous, individual, or sequential combinations or associations with other agents for the prevention or treatment of renal disease or related disorders or complications. Examples of such known compounds include angiotensin-converting enzyme (ACE) inhibitors (e.g., captopril (Capoten®), enalapril (Innovace®), fosinopril (Staril®), lisinopril (Zestril®), perindopril (Coversyl®), quinapril (Accupro®), trandanalopril (Gopten®), lotensin, moexipril, ramipril); RAS blockers; angiotensin receptor blockers (ARBs) (e.g., olmesartan, irbesartan, losartan, valsartan, candesartan, eprosartan, telmisartan, etc.); protein kinase C (PKC) inhibitors (e.g., ruboxystaurine); and inhibitors of AGE-dependent pathways (e.g., aminoguanidine, ALT-946). Examples include, but are not limited to, pyridoxamine (pyridodrine), OPB-9295, and Aragebrium; anti-inflammatory agents (e.g., criclooxygenase-2 inhibitors, mycophenolate mofetil, mizoribine, pentoxifylline), GAGs (e.g., throdextrine (US Patent No. 5,496,807)); pyridoxamine (US Patent No. 7,030,146); endothelin antagonists (e.g., SPP301), COX-2 inhibitors, PPAR-γ antagonists, and amifostine (used for cisplatin nephropathy), captopril (used for diabetic nephropathy), cyclophosphamide and rituximab (used for idiopathic membranous nephropathy), sodium thiosulfate (used for cisplatin nephropathy), tranilast, cyclodextrin and other compounds, and their derivatives (e.g., hydroxypropyl-β-cyclodextrin) (Williams). and Tuttle (2005), Advances in Chronic Kidney Disease, 12(2):212-222; Giunti et al. (2006), Minerva Medica, 97:241-62).Known compounds for use in combination or association in certain embodiments include, but are not limited to, bardoxolone or oligonucleotide inhibitors of mir-21 (mir-21 antagonistil).

[0079] In another specific embodiment, known compounds for use in combination or in association include vitamin D derivatives, antihyperglycemic agents (e.g., SGLT2 inhibitors, GLP1 agonists, DPP4 inhibitors), and antihypercholesterolemia agents (e.g., statins, niacin, fibrates, PCSK9 inhibitors, ezetimive).

[0080] As used herein, the term “combination” means either a fixed-dose combination of a single unit dosage form, a non-fixed-dose combination, or a kit of multiple parts for co-administration, wherein the compound of formula I and one or more combination partners (e.g., ACE inhibitor drugs or ARB drugs) may be administered simultaneously and independently, or individually within a number of time intervals, in particular, where the combination partners can exert a joint, for example, synergistic effect due to these time intervals.

[0081] The term "fixed-dose combination" means that both active ingredients are administered to the patient simultaneously, either as a single component or in a single dose.

[0082] The term "non-fixed-dose combination" means that the active ingredient, e.g., a compound of formula I, and one or more combination partners (e.g., ACE inhibitors or ARBs) are both administered to the patient as separate components, either simultaneously or sequentially, without any specific time constraints, thereby providing the patient with effective concentrations of both compounds in their respective bodies.

[0083] Furthermore, the methods described herein may also include the concurrent administration of at least one other therapeutic agent for the treatment of another disease directly or indirectly related to renal disease complications, including but not limited to dyslipidemia, hypertension, obesity, neuropathy, inflammation, and / or retinopathy. Such additional therapeutic agents include, but are not limited to, corticosteroids; immunosuppressant drugs; antibiotics; antihypertensive and diuretic drugs (thiazide diuretics, and ACE inhibitors or β-adrenergic antagonists); bile stagnation resins, lipid-lowering agents such as cholestyramine, colestipol, and nicotinic acid, more specifically, drugs and medications used to lower cholesterol and triglycerides (e.g., fibrates (e.g., Gemfibrozil®) and HMG-CoA inhibitors such as Lovastatin®, Atorvastatin®, Fluvastatin®, Lescol®, Lipitor®, Mevacor®, Pravachol®, Pravastatin®, Simvastatin®, Zocor®, and Cerivastatin®); nicotinic acid; and vitamin D.

[0084] As used herein, the terms “concurrent administration” or “combined administration” encompass the administration of selected combination partners into a single subject and are intended to include treatment regimens in which the agents do not necessarily need to be administered via the same route or simultaneously.

[0085] The term "effective in combination for treatment" means that therapeutic agents, when administered individually at such time intervals (in a staggered manner over time, particularly in an order-specific manner), can exhibit (preferably synergistic) interactions (i.e., a combined therapeutic effect).

[0086] Therefore, this disclosure is, (i) Compounds of formula I as defined above, typically the compounds described in the examples. A or G A pharmaceutical product containing the following: (ii) Compounds selected from the group consisting of angiotensin-converting enzyme (ACE) inhibitors, RAS blockers; angiotensin receptor blockers (ARBs); protein kinase C (PKC) inhibitors; AGE-dependent pathway inhibitors; anti-inflammatory agents, GAGs; pyridoxamine (U.S. Patent No. 7,030,146); endothelin antagonists, COX-2 inhibitors, PPAR-γ agonists, and amifostine (used for cisplatin nephropathy), captopril (used for diabetic nephropathy), cyclophosphamide (used for idiopathic membranous nephropathy), sodium thiosulfate (used for cisplatin nephropathy), or tranilast; other compounds such as cyclodextrin and their derivatives (e.g., hydroxypropyl-β-cyclodextrin), and (iii) pharmaceutically acceptable carriers and / or adjuvants This also relates to pharmaceuticals, which are combined with or associated with the same thing.

[0087] As used herein, the term "pharmaceutical" means a single pharmaceutical composition or a combination of pharmaceutical compositions containing one or more active ingredients in the presence of one or more excipients.

[0088] This disclosure further relates to compounds of formula I as defined above, for simultaneous, sequential, or individual use with other compounds selected from the group consisting of angiotensin-converting enzyme (ACE) inhibitors, RAS blockers; angiotensin receptor blockers (ARBs); protein kinase C (PKC) inhibitors; AGE-dependent pathway inhibitors; anti-inflammatory agents, GAGs; pyridoxamine (U.S. Patent No. 7,030,146); endothelin antagonists, COX-2 inhibitors, PPAR-γ agonists, and other compounds such as amifostine (used for cisplatin nephropathy), captopril (used for diabetic nephropathy), cyclophosphamide (used for idiopathic membranous nephropathy), sodium thiosulfate (used for cisplatin nephropathy), tranilast, or cyclodextrin, as well as their derivatives (e.g., hydroxypropyl-β-cyclodextrin), vitamin D derivatives, antihyperglycemic agents, and antihypercholesterolemia agents. This disclosure relates to methods for the treatment and / or prevention of kidney disease, comprising an effective amount for treatment of angiotensin-converting enzyme (ACE) inhibitors, RAS blockers; angiotensin receptor blockers (ARBs); protein kinase C (PKC) inhibitors; AGE-dependent pathway inhibitors; anti-inflammatory agents, GAGs; pyridoxamine (U.S. Patent No. 7,030,146); endothelin antagonists, COX-2 inhibitors, PPAR-γ agonists, and amifostine (used for cisplatin nephropathy), captopril (used for diabetic kidney disease). The present invention also relates to a method comprising administering a compound according to Formula I in an effective amount for treatment, in combination with or in association with compounds selected from the group consisting of (for use in idiopathic membranous nephropathy), cyclophosphamide (for use in idiopathic membranous nephropathy), sodium thiosulfate (for use in cisplatin nephropathy), tranilast, or other compounds such as cyclodextrin, and their derivatives (e.g., hydroxypropyl-β-cyclodextrin), vitamin D derivatives, antihyperglycemic agents, and antihypercholesterolemia agents.

[0089] In the following examples, the compound of formula (I) was tested in vivo in animal models of at least three different kidney diseases, namely Alport syndrome, focal segmental glomerulosclerosis, and diabetic nephropathy, and the promising therapeutic effects of such compounds in numerous kidney diseases were observed. [Brief explanation of the drawing]

[0090] [Figure 1] Experimental design to test the optimal dose of a compound in ADR-induced nephropathy in Balb / c mice. Thirty female Balb / c mice were injected with doxorubicin (ADR, Adriamycin) at a dose of 12 mg / kg via tail vein injection. Five baseline mice received saline. The ADR-injected mice were then divided into six groups of five animals each, resulting in a total of seven experimental groups. Starting the following day, the compound was administered orally once daily for five weeks. Urine was collected weekly, and body weight was recorded weekly. Blood and renal cortex were collected 35 days after ADR injection as sacrifices. [Figure 2] Experimental design for testing compounds in ADR-induced nephropathy in Balb / c mice. Female Balb / c mice were injected with doxorubicin (ADR, adriamycin) at a dose of 12 mg / kg via tail vein injection. Five control mice received saline. Female mice injected with ADR were divided into five groups of six. Starting the following day, the vehicles or compounds were administered orally once daily for four weeks as indicated. Urine was collected weekly, and body weight was recorded weekly. Blood and renal cortex were collected 28 days after ADR injection as sacrifices. [Figure 3] Cytotoxicity of compounds in differentiated human glomerular epithelial cells. Differentiated human glomerular epithelial cells were treated with 0 μM (vehicle), 1 μM, 5 μM, and 10 μM Cpd A, Cpd C, Cpd D, Cpd E, Cpd F, and Cpd G for 18 hours. Cytotoxicity was evaluated using the Promega CytoTox Assay Kit. Plain medium (blank bars) was used as the baseline. Cytotoxicity signals were normalized to viability signals to eliminate bias due to differences in cell number. All treatments were compared to vehicle-treated cells. Significant toxicity was found only with Cpd A and Cpd C above 10 μM. One-way ANOVA, n=3, independent experiments, Dunnett's test, *p<0.5, ***p<0.001. [Figure 4]Treatment with Cpd C, Cpd A, and Cpd G increases ABCA1 expression and cholesterol efflux in differentiated glomerular epithelial cells. Differentiated human glomerular epithelial cells were treated with a vehicle (0.1% DMSO) or the described compounds for 18 hours, and their involvement in ABCA1 expression, localization, and cholesterol efflux was measured. (a) Western blots of ABCA1 and GAPDH in whole cell solubilite showing potent induction of ABCA1 expression by LXR agonists (Cpd C, E, and D) and moderate induction by 10 μM ABCA1 inducers Cpd A and G. (b-e) Cpd C, Cpd A, and Cpd G increase ABCA1 expression in the plasma membrane. Differentiated human glomerular epithelial cells treated with the vehicle or compounds C, A, and G for 18 hours as shown were passed through cell fractions. (b) Western blots of ABCA1 and GAPDH in whole cell solubilite showing a moderate increase in ABCA1 expression after treatment with Cpd A (5 μM) and Cpd G (10 μM). (c~e) Plasma membrane, microsome, and cytosolic fractions blotted and probed with ABCA1, Na+ / K+ ATPase pump, and MEK. (f~h) Cpd C, A, and G increase ApoA1-mediated cholesterol efflux in differentiated glomerular epithelial cells. Differentiated glomerular epithelial cells loaded with [3-H] cholesterol were incubated with the indicated compounds for 18 hours. ApoA1-mediated cholesterol efflux was calculated after incubating cells for 18 hours with or without ApoA1. Data are reported as the mean (including standard deviation) of at least three independent experiments. One-way ANOVA, Dunnett's test, *P<0.05%, **P<0.01% [Figure 5]Selection of the optimal dose of a compound to mitigate ADR-induced renal damage. (a-e) Albuminuria in ADR-injected mice during 5 weeks of treatment with the compound at the indicated dose. Mice developed massive proteinuria 2-3 weeks after ADR injection, which was mitigated in mice treated with a dose of 30 mg / kg Cpd A (b) and 100 mg / kg Cpd G (e). (f-j) ADR-injected mice were characterized by a significant decrease in body weight 2-3 weeks after ADR injection, a phenotype that was particularly mitigated in mice treated with 30 mg / kg Cpd A or 100 mg Cpd G. Results are shown as mean and SE for each group. One-way ANOVA, n=5, Dunnett's test, *P<0.05%. [Figure 6] ABCA1-inducing factors Cpd A and Cpd G significantly reduce albuminuria and weight loss in mice injected with ADR. Mice injected with ADR (12 mg / kg) received either a vehicle, the LXR agonist Cpd C, or the optimal dose of ABCA1-inducing factors Cpd A and Cpd G once daily for 28 days. Albuminuria and body weight were measured weekly. (a) Albuminuria after 4 weeks of treatment. (b) Weight loss, expressed as the difference in body weight, for each mouse 4 weeks after treatment and 1 day before ADR injection. The baseline group (shown on the left), consisting of mice not injected with ADR, reflects a phenotype without renal damage. Bars represent the median and the range for each treatment group. All groups were compared to those who received the vehicle using the Mann-Whitney test (n=8, *P<0.05%, **P< 0.01%, ****P<0.0001%). [Figure 7]Pathological examination of PAS and HE secretions from the kidneys of animals treated with ADR injection and either vehicle or 100 mg / kg / day of Cpd G for 4 weeks. Pathologists assessed the percentage of whole-segment sclerosis (A); segmental sclerosis (B); glomerular epithelial cell hypertrophy (C); glomerular epithelial cell hyperplasia (D); tubular vesicles (E); and interstitial inflammation (F). Scale values ​​represent the following: 0: 0%; 0.5+: 1-10%; 1+: 11-25%; 2+: 26-50%; 3+: 51-75%; 4+>75%. Samples from the Cpd G treatment group were compared to those from the vehicle treatment group using the Mann-Whitney test (n=7; *P<0.05%). [Figure 8] Mice injected with saline or ADR were treated with either a vehicle or 100 mg / kg of Cpd G for 28 days. Cross-sections of the renal cortex were stained with ORO to detect lipid droplet deposition. Representative photographs of secretions from a healthy baseline group (A), a group injected with ADR and treated with a vehicle (B), and a group treated with 100 mg / kg / day of Cpd G (C). [Figure 9] Cpd G reduces the accumulation of esterified cholesterol in the renal tissue of mice injected with ADR. Cholesterol esters, total cholesterol, and triglycerides were evaluated in lipids extracted from the renal cortex of ADR-injected mice treated with either vehicle or Cpd G for 28 days. The amount of each lipid species was normalized to the total protein present in the sample. (a) esterified cholesterol content, (b) total cholesterol content, and (c) triglyceride content found in renal tissue. Animals not treated with ADR are shown on the left, representing baseline values ​​when renal damage is not induced. The Cpd G and vehicle-treated groups were compared using a two-tailed Mann-Whitney U test (n=8; ****P<0.0001%). (d~f). Correlation between albuminuria in each mouse and the amount of lipid species present in the renal cortex. A strong correlation was found with cholesterol esters (d), but not with total cholesterol (e) or triglycerides (f). Pearson test, n=10 [Figure 10]Animals injected with 12 mg / kg of ADR were treated with either a vehicle or 100 mg / kg of Cpd G one day after ADR injection. Photographs were taken after 20 days of treatment with vehicle (A-B) and 100 mg / kg of Cpd G (C-D). [Figure 11] Treatment of Col4A3 KO mice with Cpd G delayed the progression of end-stage renal disease. Four-week-old 129-Col4A3 KO mice were treated with either a vehicle or 100 mg / kg of Cpd G for four weeks. At the end of the experiment (day 56), body weight was measured, and random urine and blood samples were collected to analyze lipid accumulation in the kidneys. (a) albuminuria, (b) serum creatinine, (c) blood urea nitrogen, and (d) body weight of KO mice treated with either vehicle or Cpd G. (e) Representative photographs of PAS-stained kidney sections from each group, and (f) quantification of mesangial enlargement after blinded pathological analysis of PAS-stained liver sections, as mentioned in e. Col4a3+ / + mice (wt) of the same age are included on the left to reflect the phenotype without chronic kidney disease. (g) Survival curves of 129-Col4a3 KO mice that received a 4-week vehicle or Cpd G (100 mg / kg / day) starting at 6 weeks of age. Horizontal bars represent the median of each group. Statistical differences between groups were calculated using a two-sided Mann-Whitney test (n=4, *P<0.05%, **P<0.01%). [Figure 12]Processed with Db / +, db / db vehicle, and db / db Using mice treated with ABCA1 inducer (compound A), the following were analyzed: (A) the ratio of albumin to creatinine measured at the start of treatment (14 weeks), 2 weeks after treatment (16 weeks), and at the time of sacrifice after 4 weeks of treatment (18 weeks); (B) blood urea nitrogen (BUN) measured from mouse serum and expressed in mg / dL; (C) renal cortical cholesterol pigment (multiplier change of cholesterol nmol per 1 mg of protein) in the form of total cholesterol (TC), free cholesterol (FC), and cholesterol esters (CE); (D) the correlation between BUN and CE; (F) the number of glomerular epithelial cells per glomerular cross-section measured and quantified by WT1 antibody (E); (H) the mesangial expansion score quantified using PAS-stained renal cortical sections (G); and (J) the disappearance of glomerular epithelial cell foot processes measured and quantified from TEM images (I). One-dimensional ANOVA after the Tukey test (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). [Figure 13] Cpd G reduced the accumulation of esterified cholesterol in the renal cortex. (a) esterified cholesterol (CE), (b) total cholesterol (TC), and (c) triglyceride content (TG) were measured in the renal cortex of 8-week-old Col4A3 KOs that received vehicle or Cpd G for 28 days, starting at 4 weeks of age. The content of each lipid was normalized relative to the total protein content. A group of wild-type littermates was also included in this study (white circle). Horizontal bars represent the median of each component. Statistical differences were measured using a two-sided Mann-Whitney test (n=8): *P<0.05, **P<0.001. [Examples]

[0091] Preparation of ABCA1-inducing factor compounds List of compounds: [Table 2]

[0092] The above compounds and their synthesis methods are described in International Publication No. 2014 / 180741.

[0093] compound G Preparation of 5-(3,4-dichlorophenyl)-N-((1R,2R)-2-hydroxycyclohexyl)-6-(2,2,2-trifluoroethoxy)-nicotinamide The compound was prepared from 5-bromo-6-chloro-3-pyridinecarboxylic acid, 2,2,2-trifluoroethanol, (1R,2R)-2-amino-cyclohexanol, and 3,4-dichlorophenylboronic acid according to the procedure described in Example 3 of International Publication No. 2011 / 029827. MS 463.079,465.077(M+H) + .

[0094] compound A Preparation of 6-(3,4-dichlorophenyl)-N-[(1R,2R)-2-hydroxycyclohexyl]-5-(2,2,2-trifluoroethoxy)pyridine-2-carboxamide Compound A was prepared according to the procedure described in International Publication No. 2014 / 180741 by the following steps:

[0095] a) 6-chloro-2-(3,4-dichlorophenyl)-3-fluoropyridine In a 100 mL four-necked flask, 2,6-dichloro-3-fluoropyridine (765 mg, 4.61 mmol, equivalent: 1.00, CAS registry number 52208-50-1) and potassium (3,4-dichlorophenyl)trifluoroborate (1.21 g, 4.61 mmol, equivalent: 1.00, CAN 850623-68-6) were combined with dioxane (23 mL) and water (13 mL). 2M Na2CO3 (6.91 mL, 13.8 mmol, equivalent: 3) was added, followed by PdCl2(DPPF)-CH2Cl2 adduct (169 mg, 230 μmol, equivalent: 0.05, CAS registry number 95464-05-4). The reaction mixture was degassed three times, purged with argon, and then heated overnight to 60°C with stirring. The reaction mixture was cooled to ambient temperature, 50 mL of H2O was added, and the mixture was extracted with tert-butyl methyl ether (2 × 100 mL). The organic layer was washed with H2O / brine, combined, dried over Na2SO4, and concentrated under vacuum. The crude product was purified twice by flash chromatography (silica gel, 70 g, dichloromethane in 5%-20% heptane) to obtain 540 mg of the title compound as a white semi-solid.

[0096] b) 6-Chloro-2(3,4-dichlorophenyl)-3-(2,2,2-trifluoroethyl)pyridine In a 25 mL pear-shaped flask, the 6-chloro-2-(3,4-dichlorophenyl)-3-fluoropyridine (530 mg, 1.44 mmol, equivalent: 1.00) prepared above was combined with DMSO (8 mL). KOH (118 mg, 2.1 mmol, equivalent: 1.46) and 2,2,2-trifluoroethanol (211 mg, 153 μL, 2.11 mmol, equivalent: 1.47) were added, and the reaction was continued at ambient temperature for 2 hours. The mixture was poured into 30 mL of H2O and extracted with tert-butyl methyl ether (2 × 40 mL). The organic layers were washed with H2O / brine, combined, dried over Na2SO4, and concentrated under vacuum. The crude product was purified by flash chromatography (HCl in 70 g silica gel, 5%-20% heptane) to obtain 444 mg of the title compound as a colorless liquid; MS(ESI) 356.3, 358.3, 360.3(M+H) +.

[0097] c) Methyl 6-(3,4-dichlorophenyl)-5-(2,2,2-trifluoroethoxy)pyridine-2-carboxylate In a 35 mL autoclave, the 6-chloro-2-(3,4-dichlorophenyl)-3-(2,2,2-trifluoroethoxy)pyridine (437 mg, 1.22 mmol, equivalent: 1.00) prepared above was dissolved in 5 mL of MeOH. Protected from oxygen and moisture with argon, PdCl2(DPPF)-CH2Cl2 adduct (75.2 mg, 92 μmol, equivalent: 0.083, CAS registry number 95464-05-4) was added, followed by triethylamine (233 mg, 321 mL, 2.31 mmol, equivalent: 2.31). Next, CO was passed through the reaction vessel three times, and after pressurizing to 70 bar, carbonylation was carried out at 110 °C for 20 hours. After cooling and releasing the pressure, the crude reaction mixture was concentrated under vacuum. The residue was then dissolved in AcOEt / H2O and transferred to a separatory funnel. The aqueous layer was back-extracted with HCl, the organic layer was washed with H2O and brine, combined, dried over Na2SO4, and concentrated under vacuum. Flash chromatography (HCl in 10%-40% heptane on 70 g of silica gel) was performed to obtain 327 mg of the title product as a white solid; MS(ESI) 380.4, 382.4(M+H). + .

[0098] d) 6-(3,4-dichlorophenyl)-5-(2,2,2-trifluoroethoxy)pyridine-2-carboxylic acid In a 25 mL pear-shaped flask, the 6-(3,4-dichlorophenyl)-5-(2,2,2-trifluoroethoxy) picolinate (326 mg, 858 μmol, equivalent: 1.00) prepared above was combined with tetrahydrofuran (5 mL) to obtain a colorless solution. Water (2.5 mL), followed by LiOH (41.1 mg, 1.72 mmol, equivalent: 2), was added, and the reaction mixture was stirred at 40°C for 2 hours. The reaction mixture was poured into 5 mL of saturated NH4Cl solution and 3 mL of 1N KHSO4 solution and extracted with RINKAN (2 × 30 mL). The organic layers were combined, dried over Na2SO4, and concentrated under vacuum, leaving 322 mg of the acid in question as a white foam; MS(ESI)366.4,368.4(M+H) + .

[0099] e) 6-(3,4-dichlorophenyl)-N-[(1R,2R)-2-hydroxycyclohexyl]-5-(2,2,2-trifluoroethoxy)pyridine-2-carboxamide In a 25 mL pear-shaped flask, the 6-(3,4-dichlorophenyl)-5-(2,2,2-trifluoroethoxy)-picolinic acid (322 mg, 879 μmol, equivalent: 1.00) synthesized above was dissolved in DMF (12 mL). TBTU (O-(benzothiazole)-1-yl)-N,N,N',N'-tetramethyluronium tetrafluoroborate (424 mg, 1.32 mmol, equivalent: 1.5, CAS registry number 125700-67-6) and N,N-diisopropylethylamine (568 mg, 768 μL, 4.4 mmol, equivalent: 5) were added, and the reaction mixture was stirred at ambient temperature for 10 minutes. Then, (1R,2R)-2-aminocyclohexanol hydrochloride (160 mg, 1.06 mmol, equivalent: 1.2, CAS registry number 13374-31-7) was added without additional solvent. The reaction was then allowed to proceed at room temperature for 3 hours. The crude mixture was diluted with H2O and extracted with CH2Cl2. The organic layers were combined, dried over Na2SO4, and concentrated under vacuum. The product was purified by flash chromatography (50 g of basic alumina, 10%-80% heptane with ethyl acetate), and the title amide was obtained as a white solid by precipitation of the crude product from ethyl acetate and heptane; high-resolution MS (ESI) 463.0798, 465.0769 (M+H). + Prediction: 463.0798, 465.0768.

[0100] compound H Preparation of (N'-(6-chloropyridazine-3-yl)-5-(4-cyanophenyl)-N'-methyl-6(2,2,2-trifluoroethoxy)pyridine-3-carbohazide) Compound H was prepared according to the procedure described in International Publication No. 2014 / 180741 by the following steps:

[0101] a) 5-(4-cyanophenyl)-6-(2,2,2-trifluoroethoxy)-methyl nicotinate In a 50 mL four-necked flask, methyl 5-bromo-6-(2,2,2-trifluoroethoxy)nicotinate (1 g, 3.18 mmol, equivalent: 1.00, CAS registry number 1211589-51-3) and cesium carbonate (3.11 g, 9.55 mmol, equivalent: 3) were combined with toluene (25 mL) and water (2.8 mL) to obtain a colorless solution. The reaction mixture was degassed three times and purged with argon. Then, palladium(II) acetate (14.3 mg, 63.7 μmol, equivalent: 0.02), potassium (4-cyanophenyl)trifluoroborate (732 mg, 3.5 mmol, equivalent: 1.1, CAS registry number 850623-36-8), and butyldi-1-adamantylphosphine (68.5 mg, 191 μmol, equivalent: 0.06, CAS registry number 321921-71-5) were added in succession. The degassing-purging cycle was repeated after each addition. Next, the reaction mixture was heated to 120°C for 5 hours. After cooling, the reaction mixture was poured into 50 mL of H2O and extracted with AcOEt (2 × 50 mL). The organic layers were washed with H2O / brine, combined, dried over Na2SO4, and concentrated under vacuum. Purification by flash chromatography (50 g of silica gel, CH2Cl2 in 50%-100% heptane) yielded 898 mg of the title compound as a white foamy substance; MS(ESI) 337.2(M+H) + .

[0102] b) 5-(4-cyanophenyl)-6-(2,2,2-trifluoroethoxy)-nicotinic acid In a 25 mL round-bottom flask, 5-(4-cyanophenyl)-6-(2,2,2-trifluoroethoxy)-nicotinic acid methyl ester (0.891 g, 2.65 mmol, equivalent: 1.00) prepared above was combined with THF (7 mL) and water (3.5 mL) to obtain a pale yellow two-phase system. When TLC indicated completion of the reaction, lithium hydroxide (127 mg, 5.3 mmol, equivalent: 2) was added, and the reaction mixture was stirred at 40 °C for 3 hours. Preparatory steps: 10 mL of H2O and 7 mL of HCl 1N were added, and the mixture was extracted with AcOEt (2 × 50 mL). The organic layers were washed together with brine, dried over Na2SO4, and concentrated under vacuum. Grinding with heptane / siRNA (9:1) finally yielded 794 mg of the desired title product as a white solid; MS(ESI) 321.2(MH) - .

[0103] c) N'-(6-chloropyridazine-3-yl)-5-(4-cyanophenyl)-N'-methyl-6-(2,2,2-trifluoroethoxy)pyridine-3-carbozide In a 5 mL round-bottom flask, the 5-(4-cyanophenyl)-6-(2,2,2-trifluoroethoxy)-nicotinic acid (0.050 g, 155 μmol, equivalent: 1.00) prepared above was combined with THF (2 mL) to obtain a colorless solution. TBTU(O-(benzothiazole)-1-yl)-N,N,N',N'-tetramethyluronium tetrafluoroborate, 74.7 mg, 233 μmol, equivalent: 1.5, CAS registry number 125700-67-6) and N,N-diisopropylethylamine (100 mg, 135 μL, 776 μmol, equivalent: 5) were added. The reaction mixture was stirred at room temperature for 10 minutes, then 3-chloro-6-(1-methylhydrazinyl)-pyridazine (29.5 mg, 186 μmol, equivalent: 1.2, CAN76953-33-8) was added, and the reaction mixture was maintained at room temperature overnight. The mixture was poured into 25 mL of 1 M HCl, extracted with ethyl acetate (2 × 50 mL), washed with 1 M NaOH, dried over Na₂SO₄, and all solvent was evaporated under vacuum. Flash chromatography was then performed (silica gel, 10 g, 2%~10%). The title compound was finally obtained as a white solid in 28 mg by recrystallization from heptane / AcOEt using MeOH in CH2Cl2; MS(ESI) 463.1, 465.3(M+H) + .

[0104] compound J Preparation of 6-(4-chlorophenyl)-5-(2,2,2-trifluoroethoxy)-pyridine-2-carboxylic acid (3-isopropyl-isoxazole-5-ylmethyl)amide Compound J was prepared according to the procedure described in International Publication No. 2014 / 180741 by the following steps:

[0105] The title compound was synthesized from 6-(4-chlorophenyl)-5-(2,2,2-trifluoroethoxy)-2-pyridinecarboxylic acid and 3-(1-methylethyl)-5-isoxazolemethaneamine (CAS registry number 543713-30-0) according to the method described in Example 64 of International Publication No. 2012 / 032018. LC-MS (UV peak area / ESI) 100.0%, 454.4 (M+H)+ .

[0106] compound F Preparation of (6-(4-chlorophenyl)-N-(pyrimidine-5-yl)-5-(2,2,2-trifluoroethoxy)picolinamide, comparative compound): 6-(4-chlorophenyl)-5-(2,2,2-trifluoroethoxy)-pyridine-2-carboxylic acid (prepared as described in International Publication No. 2012 / 032018, Example AE) was combined with DMF (30 mL) at room temperature to obtain a colorless solution. Pyrimidine-5-amine, TBTU, and N-ethyldiisopropylamine were added. The reaction mixture was stirred at room temperature for 15 hours. The reaction mixture was poured into 150 mL of H2O and extracted with ethyl (2 × 150 mL). The combined organic layer was washed with brine, dried over MgSO4, and evaporated. The crude material was purified by flash chromatography (silica gel, 20 g, 0%~50%, ethyl in hexane). LC-MS (ESI) 409.068 (M+H) + .

[0107] Other compounds for comparison [Table 3]

[0108] compound C The synthesis of (1,1,1,3,3,3-hexafluoro-2-{2-methyl-1-[5-methyl-2-(3-trifluoromethylphenyl)-oxazole-4-ylmethyl]-1H-indole-5-yl}propan-2-ol, LXR agonist) was described in International Publication No. 2005 / 105791, Example 56.

[0109] compound D(4-{5-[(RS)-(3-bromo-benzenesulfonyl)-((SR)-7-chloro-1,2,3,4-tetrahydrocyclopenta[b]indole-2-yl)-fluoromethyl]-[1,3,4]oxadiazole-2-yl}benzoic acid, a partial LXR agonist) was described in Example 113 of International Publication No. 2005 / 092856.

[0110] compound E ((R)-2-[(S)-benzenesulfonyl-fluoro-(5-methyl-[1,3,4]oxadiazole-2-yl)-methyl]-7-chloro-1,2,3,4-tetrahydrocyclopenta[b]indole, a partial LXR agonist) was described in International Publication No. 2005 / 092856, Example 74(6).

[0111] Materials and methods For in vitro experiments, the lyophilized compound was reconstituted in DMSO(Sigma) and diluted in the same solvent to produce 20 mM, 10 mM, 5 mM, 1 mM, and 0 mM stocks, which were stored at -20°C.

[0112] For in vivo experiments, lyophilized compounds were suspended in a vehicle (a specific formulation designed by Roche: 1.25% hydroxypropyl methylcellulose, 0.10% doxate sodium salt, 0.18% propylparaben sodium, 0.02% citrate monohydrate, pH 6). The particulate suspension was secured by three simple pulsed ultrasonic treatments (on ice). The compound concentrations in the suspension were adjusted to 2 mg / mL for Cpd C (LXR agonist) and to two concentrations (6 mg / mL and 20 mg / mL) for both ABCA1 inducers, Cpd A and Cpd G. The compound suspensions were stored at -20°C for long-term storage and at 4°C if the compounds were to be used within one week. The suspensions were administered after thorough mixing to ensure uniform dose delivery.

[0113] cell culture Rat collagen type I, RPMI, and ITS were purchased from Corning. FBS was purchased from GIBCO, and fat-free BSA from Sigma-Aldrich. Human ApoA1 and for cholesterol efflux assays were purchased. 3 H-cholesterol was purchased from Calbiochem and American Radiolabeled Chemicals, respectively.

[0114] Conditionally immortalized human glomerular epithelial cells were a gift from Moin Saleem. The cells were seeded in collagen type I coated flasks and grown in complete medium (RPMI, 10% FBS, 1×Pen / streptomycin) at 33°C and 5% CO2, supplemented with 1×ITS. For differentiation, the cells were incubated in ITS-free complete medium at a rate of 2,500 cells / cm³. 2 Seeds were sown at a certain density and cultured at 37°C and 5% CO2 for 15 days.

[0115] Cytotoxicity Glomerular epithelial cells were seeded in 96-well plates (Greiner) and differentiated for 14 days. Next, the cells were washed with PBS and incubated for 18 hours at 37°C, 5% CO2, in vehicle and compound-containing or compound-free medium (RPMI-0.2% BSA). The concentrations of the tested compounds were 1 μM, 5 μM, 10 μM, and 20 μM. The final concentration of the vehicle (DMSO) was 0.1%. All treatments were performed twice. Cytotoxicity was assayed using the ApoTox-Glo Triplex Assay (Promega) according to the manufacturer's instructions. Briefly, cell-permeable (GF-AFC) and cell-impermeable (bis-AAF-R110) peptide substrates were diluted and added to all wells, and the cells were incubated at 37°C, 5% CO2, for 1 hour. Cell aggregates were treated with saponin (2 mg / mL) as a positive control for cytotoxicity. Cell viability and cytotoxic fluorescence signals were measured using a fluorescence microplate reader (SpectraMax i3) at excitation / emission wavelengths of 400 nm / 505 nm and 485 nm / 520 nm, respectively. The RFU signals obtained with cytotoxic substrates were normalized to the signals obtained with viable substrates in the same well to eliminate the effect of different cell numbers per well.

[0116] Cholesterol leakage Human glomerular epithelial cells differentiated for 13 days were subjected to RPMI medium containing 2% FBS at a concentration of 1 μCi / mL. 3Cells were labeled with [H]-cholesterol for 24 hours. Next, the cells were washed with PBS and incubated for 18 hours in equilibrium medium (RPMI-0.2% fat-free BSA) supplemented with the vehicle or compounds Cpd C (1 μM), Cpd A (1 μM, 5 μM), and Cpd G (1 μM, 5 μM, 10 μM). Next, the cells were washed with PBS and incubated for 18 hours at 37°C, 5% CO2, in equilibrium medium containing or without 20 μg / mL human ApoA1. The medium was collected, spun at 12,000 x g for 5 minutes, and the radioactivity of a 200 μL aliquot was measured by liquid scintillation. The cells were washed with PBS, dissolved in 250 μL of 0.1% SDS, 0.1 M NaOH, and the radioactivity of a 100 μL aliquot was measured by liquid scintillation. Cholesterol efflux was calculated as the ratio of labeled cholesterol removed from cells to the culture medium using the following formula: Erosion (%) = 100 × {(cpm of culture medium) / [(cpm of culture medium) + (cpm of lysates)]}

[0117] ApoA1-mediated cholesterol efflux was calculated as the difference between efflux in the presence or absence of ApoA1. All treatments were performed in two variations. Four or more independent experiments were conducted.

[0118] Expression of ABCA1. Glomerular epithelial cells differentiated for 14 days were starved for 18 hours in RPMI-0.2% FBS, and then treated with freshly prepared compound dilutions for 18 hours in complete medium at 37°C and 5% CO2. Compound concentrations of 1 μM, 5 μM, and 10 μM were evaluated. Next, the cells were washed with PBS and lysed in 1X cell lysis buffer (Cell Signaling) supplemented with a protease and phosphatase inhibitor cocktail (Roche). Total protein content was measured by BCA (Pierce, Thermoscientific). ABCA1 expression was analyzed by Western blotting.

[0119] Cell fractionation Glomerular epithelial cells differentiated for 14 days were treated with compounds Cpd C (1 μM), Cpd A (5 μM), and Cpd G (10 μM) for 18 hours, washed, and scraped off on ice-cold PBS. The cells were centrifuged at 1,000 x g for 5 minutes, the supernatant was carefully aspirated, and the pellet was suspended in hypotonic buffer (15 mM KCl, 1.5 mM MgCl2, 10 mM HEPES, and 1 mM DTT) supplemented with Roche's protease inhibitor cocktail. Cells were further definitively disrupted by foaming in a glass downsinker with two freeze-thaw cycles. Sucrose was added to a final concentration of 227 mM, and the cells were centrifuged at 1,000 x g for 30 minutes at 4°C. The supernatant was then transferred to a new tube and centrifuged at 10,000 x g for 15 minutes at 4°C. A pellet containing the microsomal fraction was collected, and the supernatant was transferred to a new tube and centrifuged at 100,000xg for 1 hour at 4°C. The pelletized plasma membrane fraction was collected, and the supernatant containing the non-membrane cytosol fraction was concentrated in a Vivaspin 500 filter column. ABCA1 and other proteins known to be present in the plasma membrane were extracted from each fraction. + / K + The presence of sodium pumps and cytoplasm (MEK) was confirmed by Western blotting.

[0120] Western blot Lysates or cell fractions were incubated with buffer samples at 55°C for 10 minutes under reduced pressure. A total of 30 g of protein from the lysates and one-third of the volume collected from the cell fraction preparations were separated using SDSPAGE (Biorad) in a 4-20% gel, and the proteins were transferred to a PVDF membrane. The membrane was blocked with 5% milk and blotted with protein-specific antibodies at 4°C for 18 hours. The following antibodies were used: mouse anti-ABCA1 (Abcam; 1:1,000), rabbit anti-GAPDH antibody (Millipore; 1:10,000), rabbit anti-MEK and anti-Na + / K +ATPase (Cell Signaling; 1:1,000). After washing with PBS-T, the membranes were incubated in 5% milk with anti-mouse and anti-rabbit specific antibodies conjugated to HRP (Promega) at a ratio of 1:10,000. The membranes were washed, and the signal was developed using Western bright ECL substrate (Advansta).

[0121] In vivo experiment research approval The research procedures for testing compounds in mice were accredited by the University of Miami's IACUC. The University of Miami (UM), together with the Office of Laboratory Animal Welfare, NIH, has an Animal Welfare Assurance file (A-3224-01, activated November 24, 2014). Furthermore, UM is registered with the US Department of Agriculture Animal and Plant Health Inspection Service (Registration 58-R-007, December 2014). As of October 22, 2013, the Council on Accreditation of the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC International) maintains full accreditation of UM.

[0122] Adriamycin-induced kidney injury The female Balb / c mice we purchased were acquired from Jackson Labs at 6 weeks of age and kept in our facility for two weeks prior to the start of the experiment.

[0123] First, preliminary experiments were conducted to determine the optimal dose of the compound to be used and to decide whether adjustments to other experimental variables were necessary. In this experiment, 30 mice received a single dose of adriamycin (Sigma-Aldrich, 12 mg / kg, administered via tail vein injection) and were then randomly divided into six groups of five mice each. Another five mice were injected with 0.9% NaCl via the same route and used as a baseline group without renal damage. Starting 24 hours after ADR injection, the vehicle or different doses of the compound were administered orally once daily for 35 days. The doses of the test compounds were as follows: LXR agonist (Cpd C, 10 mg / kg); ABCA1 inducers Cpd A and Cpd G (30 mg / kg and 100 mg / kg). Body weight and random urine collection were performed once a week. Animals were sacrificed 35 days after ADR injection (Figure 1).

[0124] The second experiment was repeated to confirm the improvement in renal function achieved with the Cpd A and G doses used in the first experiment. In short, 30 eight-week-old female Balb / c mice were injected with 12 mg / kg of ADR via tail vein and randomly distributed into five groups of six animals each. The animals were given either a vehicle or the compound orally once daily for 28 days, starting one day after ADR injection. The following compound doses were tested: Cpd C, 10 mg / kg / day; Cpd A, 30 mg / kg / day; and Cpd G, 30 mg / kg / day, and 100 mg / kg / day. A group of five animals, receiving saline via tail vein injection and treated with the vehicle, was used as a healthy baseline control. Body weight and random urine collection were performed once a week. Animals were sacrificed 28 days after ADR injection (Figure 2).

[0125] Alport Mouse Model 129 Col4a3 tm1 / Dec / J mice were purchased from Jackson Labs and bred to produce Col4a3 KO mice. The mice were genotyped and selected by PCR (5 minutes at 94C, followed by 30 cycles of 30 seconds at 95C, 15 seconds at 60C, and 30 seconds at 72C, and 1 minute at 72C) using primers: F(TGCTCTCTCAAATGCACCAG), R(CCAGGCTTAAAGGGAAATCC), and Rm(GCTATCAGGACATAGCGTTGG). 129 Col4A3-KO mice were divided into two groups of 5 mice each (male and female). At 4 weeks of age, the mice were started to receive either vehicle or Cpd G (100 mg / kg) orally daily for 4 weeks. Weight measurements and random urine collection were performed once a week. The animals were sacrificed at 8 weeks of age at the end of the treatment. Subsequent studies were also conducted to evaluate whether treating Col4A3-KO mice at the time the disease was established extended mouse survival. In this study, mice were treated with daily oral feeding of Cpd G (100 mg / kg / day) starting at 6 weeks of age, and survival was evaluated.

[0126] DKD Mouse Model From Jackson Laboratory, B6.BKS db / db , and B6.BKS db / + Mice were purchased. At 14 weeks of age, the mice were started receiving Cpd A (30 mg / kg), a vehicle or ABCA1 inducer, orally once daily for 4 weeks. Weight measurements and urine collection were performed weekly. Mice were sacrificed at 18 weeks of age, blood was collected, and tissue was processed and analyzed as follows.

[0127] Mouse phenotypic analysis Random urine samples were collected from all mice at baseline and at sacrificial time. Albumin and creatinine in the urinary tract were measured using an albumin ELISA kit (Bethyl Laboratories) and a colorimetric assay for creatinine measurement (Stanbio). Albuminuria was calculated and expressed as albumin (μg) divided by creatinine (mg). For the diabetic mouse model, body weight and blood glucose were measured on a bi-weekly basis.

[0128] At the time of sacrificial administration, blood was collected using heparinized tubes, and the mice were perfused with isotonic saline solution for left ventricular perfusion. The renal cortex was carefully resected and further fragmented for the following analyses: counting of glomerular epithelial cells, staining of lipid droplets, electron microscopy (EM), renal lipid content assay, and PAS&HE staining for pathological evaluation.

[0129] Measurement of the number of glomerular epithelial cells Renal cortical cross-sections were embedded in OCT for further analysis of immunofluorescence and lipid droplets. Specifically, the number of glomerular epithelial cells per glomerular section was measured using 4 μm thick tissue fragments that had been cleaved and stained with WT1 antibody (1:200, Santa Cruz) and ProLong GOLD DAPI-fixed medium. Images were obtained by confocal microscopy using a Leica SP5 inverted microscope with a 40x wet objective lens. Twenty glomeruli per mouse were quantified.

[0130] A lipid droplet staining solution, Filtered Oil-Red O-Isopropanol (Electron Microscopy Science, PA), was diluted with water (6:4). 4 μm kidney fragments were incubated in 100 μL of freshly prepared Oil-Red O solution (ORO) for 15 minutes, and counterstained with hematoxylin Harris Hg Free (VWR, PA) to detect lipid deposition. Glomerular staining was evaluated using a light microscope (Olympus BX 41, Tokyo, Japan).

[0131] Electron microscopy. For transmission electron microscopy, fragments of the renal cortex were placed in 0.1 M phosphate buffer (pH 7.4) containing 4% paraformaldehyde and 1% glutaraldehyde. Foot processes were quantified per 1 μm of glomerular basement membrane.

[0132] Renal Lipid Species Assay. Renal cortical fragments were rapidly frozen and used for lipid extraction and cholesterol content measurement. The tissue was homogenized in 2 mM potassium phosphate buffer in a glass downsink on ice. Lipids in 100 μL of homogenate (approximately 5-10 mg of tissue) were extracted with 1 mL of hexane:isopropanol (3:2) by two consecutive 30-minute extractions. The lipid-containing solvent was then dried under a nitrogen atmosphere. The lipids were then reconstituted using isopropanol:NP-40 (9:1), and cholesterol content was quantified using the Amplex Red Cholesterol Assay Kit (Invitrogen) according to the manufacturer's procedure. Triglycerides in the lipid extract were assayed using a colorimetric analysis kit according to the manufacturer's instructions (Cayman). Total cholesterol and cholesterol esters were assayed using enzyme fluorescence quantification. For total cholesterol, renal lipid extracts were diluted with assay buffer (100 mM potassium phosphate, 50 mM NaCl, 5 mM cholic acid, 0.1% Triton X-10, pH 7.4) and incubated with the same buffer supplemented with 1 U / mL cholesterol oxidase, 1 U / mL cholesterol ester, 1 U / mL horseradish peroxidase, and 75 μM Amplex Red. The reaction mixture was incubated in a black opaque 96-well plate (Greiner) at 37°C for 30 minutes, and fluorescence was measured using a microplate reader (Spectramax i3X, Molecular Devices) with excitation at 530 nm and emission at 580 nm.

[0133] Cholesterol esters were assayed using the direct method described by Mizoguchi et al (Mizoguchi, 2004). Briefly, 150 μL of FC decomposition reagent (45 U / mL bovine catarase and 1 U / mL cholesterol oxidase, as described in the assay buffer) was added to a 25 μL sample containing up to 1 mM total cholesterol. Free cholesterol was decomposed overnight at 37°C, after which 75 μL of 4X cholesterol ester detection reagent (1 U / mL cholesterol oxidase, 4 U / mL cholesterol ester, 24 U / mL horseradish peroxidase, and 300 μM Amplex Red) was added. The reaction mixture was incubated at 37°C for 30 minutes, and the fluorescence of total cholesterol was measured as described above. The sensitivity and specificity of the assay were confirmed using 1 mM cholesterol and 5 μM cholesterol oleate standards as internal controls.

[0134] Pathological evaluation. Renal cortical fragments were paraffin-embedded and cut into 4 μm thick sections using periodate-Schiff (PAS) and HE. Mesangial dilation was scored based on semi-quantitative analysis (scale 0-5) performed in a double-blind vein, or based on the percentage of glomeruli with mesangial dilation.

[0135] statistics Statistics. All values ​​are expressed as mean + standard deviation. Statistical analysis was performed using Prism GraphPad 7 software. When two or more compound doses were used and the groups showed a normal data distribution, the results were analyzed using one-way ANOVA. Where differences were observed, the mean of the control (vehicle) was compared to the mean of each group using Dunnett's test. Tukey's test was performed for multiple comparisons.

[0136] For in vivo studies, groups treated with the vehicle and those treated with the compound were compared using a two-tailed t-test. Welch's correction was used for unequal variances. The Mann-Whitney test was also used to compare groups when a normal distribution could not be claimed. A p-value less than 0.05% was considered statistically significant.

[0137] result Cytotoxicity of compounds Cytotoxic assays were performed to determine the concentration range of compounds that can be safely used in cultured human glomerular epithelial cells.

[0138] All compounds could be used at concentrations up to 10 μM without any indication of cytotoxicity. However, when using compounds A and C, these two compounds induced significant cytotoxicity at 20 μM (Figure 3), so concentrations were kept below 5 μM.

[0139] ABCA1 expression and cholesterol efflux In vitro experiments were conducted to select compounds that better induce functional expression of ABCA1 in glomerular epithelial cells for further use in animal studies. Therefore, the effects of these compounds on ABCA1 protein expression, ABCA1 localization in the plasma membrane, and ApoA1-mediated cholesterol efflux were studied.

[0140] Compound-induced ABCA1 expression was addressed by Western blotting. All LXR agonists, Cpd C, Cpd E, and Cpd D significantly increased ABCA1 expression in glomerular epithelial cells at doses as low as 1 μM. Of the three ABCA1 inducers tested (Cpd A, Cpd F, and Cpd G), only Cpd A and Cpd G increased ABCA1 expression, but not at 10 μM, and not as significantly as with the LXR agonists (Figure 4a).

[0141] To address whether the observed increase in ABCA1 expression is associated with the production of more functional proteins, cell fractions of glomerular epithelial cells treated with 1 μM Cpd C, 5 μM Cpd A, and 10 μM Cpd G were performed. First, the increased expression of ABCA1 with respect to the drug concentration used was confirmed (Figure 4b), and the localization of ABCA1 in each of the obtained fractions was confirmed by Western blotting. The obtained fractions were then divided into plasma membrane and cytosol fractions, respectively, to identify proteins known to be located in these fractions (Na + / K + We also blotted against ATPase and MEK to confirm the success of cell fractionation (Figures 4c-e). The doses of the three compounds used promoted the localization of ABCA1 in the plasma membrane (Figure 4c), and as expected, ABCA1 was not found in the non-membrane cytosolic fraction. Less ABCA1 was found in the microsomal compartments of cells treated with the ABCA1 inducers Cpd A and Cpd G (Figure 4d), suggesting that these compounds promote the localization of this protein in the plasma membrane more effectively than LXR agonists. Furthermore, we performed a cholesterol efflux assay using ApoA1 as a cholesterol carrier. Since ABCA1 specifically interacts with ApoA1 regarding the movement of cholesterol from cells to early HDL particles, this assay measures the functionality of ABCA1 in relation to cholesterol efflux. Significant increases in outward flux and efflux mediated by ApoA1 were achieved with 1 μM Cpd C (LXR agonist), 5 μM Cpd A, and 10 μM Cpd G (Figures 4d-e).

[0142] Based on these in vitro experiments, we selected ABCA1 inducers Cpd A and Cpd G and tested them, along with the LXR agonist Cpd C as a reference, in an animal model of kidney injury.

[0143] ABCA1-inducing factors protect experimental FSGS. The ADR model of renal injury is a model of drug-induced proteinuria and is the most widely used experimental model for focal segmental glomerulosclerosis (FSGS). Experiments to determine the dose range were conducted using compounds selected in in vitro experiments.

[0144] ADR injections induced severe transient proteinuria and weight loss. Albuminuria and body weight were monitored weekly. No significant differences were observed in the group treated with the LXR agonist (Cpd C) (Figure 5a). However, proteinuria was reduced in the groups treated with 30 mg / Kg Cpd A and 100 mg / Kg Cpd G (Figures 5b and e), and reduced to a smaller degree in the group treated with 30 mg / Kg Cpd G (Figure 5d). Similarly, animals injected with ADR experienced a 10–20% weight loss, which was prevented in animals treated with 30 mg / Kg Cpd A and 100 mg / Kg Cpd G (Figures 5g and j), but not in animals treated with the LXR agonist (Figure 5f).

[0145] In a second independent in vivo experiment, a large number of mice were used, and the doses of Cpd A and G that had been shown to be beneficial in previous experiments, namely 30 mg / kg of Cpd A and 100 mg / kg of Cpd G, were selected. Similar to the previous experiments, both ABCA1 inducers reduced albuminuria and weight loss (Figure 6b).

[0146] Compound G was found to have the most beneficial effect, and since the ADR model of renal disease did not show renal failure, further quantitative histological studies were conducted in animals treated with this compound. Blinded pathological studies of the renal cortex revealed a reduction in overall and partial glomerulosclerosis, glomerular epithelial cell hypertrophy and hyperplasia, tubular vesicles, and septal inflammation in animals treated with 100 mg / kg / day of Cpd G (Figure 7). Taken together, these data revealed that compound G is highly effective in reducing the characteristics of adriamycin-induced FSGS and is more effective than the LXR agonist evaluated as a comparator.

[0147] Because the experimental animals were administered compounds expected to affect cholesterol metabolism, the concentrations of cholesterol and triglycerides in their blood were measured. No significant differences were found for either clinical parameter (Tables 1 and 2). [Table 4] [Table 5]

[0148] Lipid deposition in renal tissue was recorded in a renal injury setting. Oil Red O (ORO) staining was performed to measure whether lipid accumulation occurred in animals injected with ADR and whether Cpd G could reduce this effect. Significant lipid droplet deposition was found in the kidneys of ADR-injected mice, which was significantly reduced in animals treated with Cpd G (Figure 8). Indeed, ADR-injected mice that received the vehicle showed significant lipid deposition in the renal cortex, while Cpd G completely prevented glomerular lipid accumulation in response to ADR. This indicates the absence of detectable lipid accumulation in the renal cortex compared to age-matched normal control mice.

[0149] To measure the lipid species accumulated in renal tissue, lipids were extracted from the renal cortex and analyzed for triglycerides, total cholesterol, and cholesterol esters. No difference in triglyceride and total cholesterol content was found between the kidneys of animals injected with ADR and those injected with plain saline. However, a very significant increase in esterified cholesterol content was found in mice injected with ADR, which was significantly reduced by Cpd G treatment (Figures 9a-c). There was a strong correlation between the severity of albuminuria and the cholesterol ester content detected in renal tissue (Figure 9d), but no correlation with other lipid species analyzed (Figures 9e and f). Treatment of ADR-injected mice with Cpd G prevented cholesterol ester accumulation, and although not constrained by any theory, it is thought that this compound can improve glomerular cholesterol removal through the upregulation of ABCA1.

[0150] Next, the toxicity of compounds C, A, and G was investigated by serology. More specifically, hematocrit levels, hemoglobin white cell counts, and hepatic aminotransferases ALT and AST were measured in all treated animals to determine whether hepatotoxicity and blood cachexia were associated with the compounds. No clear signs of such toxicity were found in the experimental mice (Table 3). [Table 6]

[0151] Animals treated with the optimal dose of Cpd G exhibited better physical appearance throughout the experiment than animals that received ADR. This was particularly evident at weeks 3 and 4 of treatment (Figure 10).

[0152] CpdG protection from renal destruction in a mouse model of progressive renal disease (Alport syndrome) Untreated CoL4a3 knockout mice developed severe albuminuria and elevated BUN and serum creatinine levels between 4 and 8 weeks of age. These mice reached ESRD by 8 weeks of age and did not survive beyond that point.

[0153] To study the renal protective effects of Cpd G in this model of Alport syndrome, CoL4a3 knockout mice were treated with either 100 mg / kg of Cpd G or a vehicle for 4 weeks, starting at 4 weeks of age. Animals treated with 100 mg / kg of Cpd G showed delayed progression to ESRD and had significantly lower albuminuria, BUN, and serum creatinine compared to animals treated with the vehicle alone (see Figure 11). Animals treated with Cpd G also experienced less weight loss than animals treated with the vehicle alone.

[0154] Histological analysis of kidney fragments revealed significantly lower mesangial enlargement in Col4a3 KO mice treated with Cpd G compared to Col4a3 KO mice treated with vehicle. Individual studies were conducted to investigate whether treatment with Cpd G in mice with established renal impairment improved survival. Indeed, even when Cpd G treatment was initiated in 6-week-old mice with relatively advanced CKD, improved renal function in Cpd G-treated Col4a3 KO mice was associated with reduced mortality and an approximately 15% increase in lifespan.

[0155] Ultimately, renal cortical fragments from 8-week-old Col4a3 KO mice showed significant lipid accumulation (increased Oil-Red O staining), which decreased in animals treated with Cpd G (see Figure 13). Consistent with previous results in the ADR model, cholesterol esters in the kidneys of Col4a3 KO mice, which were significantly higher than in wild littermates, were significantly reduced by treatment with Cpd G.

[0156] Cpd A partially protects a mouse model of diabetic nephropathy. Increased ABCA1 levels repair glomerular epithelial cell damage and DKD. The goal was to identify ABCA1 as a treatment target for DKD in an obese diabetic db / db mouse model. db / db mice treated with a pharmacological inducer of ABCA1 experienced a reduction in albuminuria 2 weeks (16 weeks) after treatment, and further 4 weeks (18 weeks) (Figure 12A), compared to mice treated with the db / db vehicle. Blood urea nitrogen (BUN) levels were significantly improved (Figure 12B), which correlated with a significant decrease in cholesterol esters in the ABCA1 inducer (compound A) treated group compared to db / db mice (Figures 12C-D). Renal cortical fragments were used for various histological evaluations, demonstrating that treatment with ABCA1-inducible factors in the db / db mouse experience improved the number of glomerular epithelial cells as measured by quantifying WT1-soluble cells (Figure 12E-F), mesangial expansion as measured using PAS-stained fragments (Figure 12G-H), and disappearance of glomerular epithelial cell foot processes as measured using TEM imaging (Figure 12I-J).

Claims

1. A pharmaceutical composition for use in the treatment of renal disease, comprising an ABCA1-inducing factor compound and a pharmaceutically acceptable carrier and / or adjuvant, The ABCA1-inducing factor compound is, 【Chemistry 1】 [In the formula, A 1 and A 2 One of them is N, and A 1 and A 2 The other side is CH, R 1 It is a halogen-C2 alkyl, R 2 and R 6 It is hydrogen, One of R3 and R5 is hydrogen, and the other of R3 and R5 is a halogen. R 4 It is a halogen, R 7 is cyclohexyl in which the ortho position is substituted by hydroxy, G is a single bond. A pharmaceutical composition characterized by being represented as such.

2. In the ABCA1 inducer compound, R 1 The pharmaceutical composition according to claim 1, wherein is -CH2-CF3.

3. The pharmaceutical composition according to claim 1 or 2, wherein the kidney disease is selected from chronic kidney disease, primary or secondary glomerular disease, or proteinuria.

4. The pharmaceutical composition according to claim 3, wherein the glomerular disease is Alport syndrome or focal segmental glomerulosclerosis.

5. The pharmaceutical composition according to claim 3, wherein the kidney disease is selected from diabetic kidney disease.

6. A pharmaceutical composition according to any one of claims 1 to 5, formulated for oral administration.

7. A pharmaceutical composition according to any one of claims 1 to 5, formulated for local, nasal, intraocular, intravenous, intramuscular, subcutaneous, intravitreous, intrathecal, or transdermal administration.

8. A pharmaceutical composition according to any one of claims 1 to 7, wherein the daily dose is 20 to 800 mg / day.

9. The pharmaceutical composition according to claim 8, wherein the daily dose is 200 mg / day.

10. The pharmaceutical composition according to any one of claims 1 to 9, wherein the administration regimen is once daily, twice daily, three times daily, once every three days, once a week, once every two weeks, or once a month.

11. The pharmaceutical composition according to any one of claims 1 to 9, wherein the loading dose regimen involves doubling the dose during the first 7, 14, or 30 days.

12. A pharmaceutical composition according to any one of claims 1 to 11, for use simultaneously, sequentially, or individually with compounds selected from the group consisting of angiotensin-converting enzyme (ACE) inhibitors, RAS blockers; angiotensin receptor blockers (ARBs); protein kinase C (PKC) inhibitors; AGE-dependent pathway inhibitors; anti-inflammatory agents; GAGs; pyridoxamine; endothelin antagonists, COX-2 inhibitors, PPAR-γ antagonists, and compounds selected from the group consisting of amiphostine, captopril, cyclophosphamide, sodium thiosulfate, tranilast or cyclodextrin and their derivatives, vitamin D derivatives, antihyperglycemic agents and antihypercholesterolemia agents.

13. Use of an ABCA1-inducing factor compound as defined in claim 1 in the manufacture of a pharmaceutical product for the treatment and / or prevention of kidney disease.