Citrobacter portucarensis, hyaluronidase, method of preparation of the same, and its uses.

Abstract

To provide Citrobacter portucalensis, a hyaluronidase as well as preparation methods and applications of the hyaluronidase.SOLUTION: Disclosed herein is Citrobacter portucalensis strain HA2301, deposited in the China Center for Type Culture Collection on November 01, 2023 with the deposition number of CCTCC NO.M20232108. The invention further discloses a hyaluronidase and a preparation method and application thereof. According to the Citrobacter portucalensis, the hyaluronidase, preparation method and application thereof described in the invention, the Citrobacter portucalensis produces the hyaluronidase that enzymatically degrades high molecular weight sodium hyaluronate to prepare small molecular weight and oligomeric sodium hyaluronate.SELECTED DRAWING: Figure 1

Description

Technical Field

[0001] The present invention belongs to the technical field of biological fermentation, and specifically relates to Citrobacter portucalensis, hyaluronidase, its preparation method and uses.

Background Art

[0002] Hyaluronic acid (Hyaluronic acid, abbreviated as HA), also called nitric acid, is a chain polymer in which D-glucuronic acid and N-acetylglucosamine are alternately linked, and is the main component constituting the extracellular matrix. It is a polymer that widely exists in living tissues such as skin, cartilage, joints, and vitreous body and has important physiological functions. It is divided into high molecular weight hyaluronic acid (HMWHA) and low molecular weight hyaluronic acid (LMWHA) according to its molecular weight. HMWHA inhibits the migration of endothelial cells, has anti-angiogenic activity, promotes wound healing in the human body, and LMWHA promotes the differentiation of endothelial cells, resists apoptosis, promotes the migration of cartilage, endothelial and other cells, and also plays an anti-inflammatory role. HA plays an important role in medical and pharmaceutical research due to its unique physicochemical properties.

[0003] Currently, low molecular weight HA is mainly prepared by decomposing high molecular weight hyaluronic acid into low molecular weight HA by physical, chemical, and enzymatic decomposition methods. In physical decomposition, usually, ultra-low molecular weight HA cannot be obtained. Chemical decomposition of HA: There is a possibility that chemical reagents remain in the product or the aldehyde groups and hydroxyl groups in the hyaluronic acid monomer are modified, so the chemical method may destroy the structure of HA.

[0004] Enzymatic degradation is ideal for preparing low molecular weight hyaluronic acid (HA) due to its specificity, mild reaction conditions, and the immutable structure of polysaccharides, which allows for the acquisition of HA of different molecular weights by controlling different degradation times. Hyaluronidase (HAase) is a glycosidase that degrades high molecular weight hyaluronic acid into low molecular weight or oligomeric hyaluronic acid, and some HAases also have the ability to degrade chondroitin and heparin. In addition to being used for the preparation of low molecular weight or oligomeric HA, HAases can be used as drug dispersants, degrading HA in tissues, increasing tissue permeability, promoting diffusion after injection, and resulting in less contamination. HAases are classified into three categories based on their source: mammalian HAases, animal toxic HAases, and microbial HAases.

[0005] Because the supply of HAase is very limited, existing technologies mainly rely on extraction from bovine testes, which is expensive and severely restricts its applications. Microbial enzyme sources are rich in and diverse enzymatic properties, readily recombinant, and yield high-yield, making them a major source of enzyme preparations for future applications. Microbial enzyme production using microorganisms, which have rapid growth and reproduction, short growth cycles, simple culture methods, abundant raw materials, and are inexpensive, offers significant economic advantages and will undoubtedly replace animal extraction in the future.

[0006] In view of the above, the present invention proposes Citrobacter portucarensis, hyaluronidase, a method for preparing the same, and its uses. Citrobacter portucarensis produces hyaluronidase, which enzymatically degrades high molecular weight sodium hyaluronate to prepare low molecular weight and oligomeric sodium hyaluronate. [Overview of the project]

[0007] The first objective of the present invention is to provide Citrobacter portucarensis that can produce hyaluronidase.

[0008] To achieve the above objectives, the following technical scheme will be adopted.

[0009] This is Citrobacter portucarensis, strain number HA2301, deposited with the China Center for Typical Cultures Depository on November 1, 2023, deposit number CCTCC NO.M20232108.

[0010] Furthermore, the 16S rRNA nucleotide sequence of the aforementioned Citrobacter portucarensis is SEQ ID NO.1.

[0011] A second objective of the present invention is to provide a method for preparing hyaluronidase using Citrobacter portucarensis, the hyaluronidase prepared by this method having high enzyme activity, reaching a maximum of 6000 U / mL, high enzyme yield, suitable for large-scale industrial production of hyaluronidase, and capable of replacing conventional hyaluronidase extracted from expensive animal tissues, with potential for broad applications in fields such as pharmaceuticals and cosmetics.

[0012] To achieve the above objectives, the following technical scheme will be adopted.

[0013] The method for preparing hyaluronidase involves preparing hyaluronidase using the above-mentioned Citrobacter portucarensis.

[0014] Furthermore, the above preparation method involves centrifuging and pulverizing the bacterial solution obtained after culturing Citrobacter portucarensis to obtain hyaluronidase.

[0015] Furthermore, the rotational speed of the centrifugal separation process is 5000 to 12000 rpm, and the duration is 5 to 10 minutes.

[0016] A third objective of the present invention is to provide a hyaluronidase that has high specificity for hyaluronic acid.

[0017] The hyaluronidase has amino acid sequence and nucleotide sequence SEQ ID NO.2 and SEQ ID NO.3, respectively, and is obtained by the preparation method described above.

[0018] Furthermore, the upstream and downstream genes of the hyaluronidase gene are SEQ ID NO.4 and SEQ ID NO.5, respectively. The amino acid sequence of the conserved region of the hyaluronidase is SEQ ID NO.6. The nucleotide sequence of the ribosome binding site of the hyaluronidase is SEQ ID NO.7.

[0019] A fourth object of the present invention is to provide a use for the hyaluronidase in the preparation of hyaluronic acid, wherein the hyaluronidase can enzymatically degrade high molecular weight sodium hyaluronate to prepare low molecular weight and oligomeric sodium hyaluronate.

[0020] To achieve the above objectives, the following technical scheme will be adopted.

[0021] The above-mentioned use of hyaluronidase is in the preparation of hyaluronic acid.

[0022] Furthermore, the method for preparing hyaluronic acid involves mixing the above-mentioned hyaluronidase with hyaluronic acid or sodium hyaluronate and performing enzymatic degradation.

[0023] Furthermore, the temperature for the enzymatic decomposition is 20-60°C, and the pH value is 3-10. The volume ratio of hyaluronidase to hyaluronic acid or sodium hyaluronate is 1-5:5-15. [Effects of the Invention]

[0024] Compared to prior art, the present invention has the following beneficial effects.

[0025] The present invention provides a wild-type Citrobacter portucalensis capable of producing hyaluronidase, which can produce hyaluronidase, and the hyaluronidase can enzymatically decompose high molecular weight hyaluronic acid or sodium hyaluronate to prepare low molecular weight and oligomeric sodium hyaluronate.

[0026] Moreover, in the technical scheme of the present invention, Citrobacter portucalensis has a high hyaluronidase production ability, can replace the conventional hyaluronidase extracted from expensive animal tissues, and has broad application prospects in fields such as medicine and cosmetics.

Brief Description of the Drawings

[0027] [Figure 1] It is a diagram showing the colony morphology of the Citrobacter portucalensis strain provided by the present invention on a solid medium. [Figure 2] It is a diagram showing the clear halo generated by the dissolution of hyaluronic acid by the hyaluronidase provided by the present invention. [Figure 3] It is a diagram showing the optimal pH result of the crude enzyme solution provided by the present invention. [Figure 4] It is a diagram showing the optimal temperature result of the crude enzyme solution provided by the present invention. [Figure 5] It is a diagram showing the phylogenetic tree result of Citrobacter portucalensis provided by the present invention. [Figure 6] It is a diagram showing the protein gel of the crude enzyme solution provided by the present invention. [Figure 7] It is a diagram showing the predicted three-dimensional structure of the hyaluronidase provided by the present invention. [Figure 8] It is a diagram showing the gene comparison between the hyaluronidase provided by the present invention and the hyaluronidase genes from different biological species. [Figure 9]This figure shows the viscosity-time relationship results of the degradation characteristics of sodium hyaluronate by the hyaluronidase enzyme provided by the present invention. [Figure 10] This figure shows the electrophoresis of an agarose gel of enzymatically degraded sodium hyaluronate. [Figure 11] This is a diagram showing the glucose standard curve. [Modes for carrying out the invention]

[0028] The present invention will now describe in more detail the citrobacter portucarensis, hyaluronidase, its preparation method, and its uses, and in order to achieve the intended objective of the invention, the following description will detail, in relation to preferred embodiments, the citrobacter portucarensis, hyaluronidase, its preparation method, its uses, its specific embodiments, structure, features, and effects. In the following description, different “Embodiment” or “Example” does not necessarily mean the same embodiment. Furthermore, specific features, structures, or properties in one or more embodiments can be combined in any suitable form.

[0029] Before describing in detail the citrobacter portucarensis, hyaluronidase, method of preparation, and uses of the present invention, it is necessary to further explain the relevant background described in the present invention in order to obtain better effects.

[0030] Currently, the preparation of low molecular weight hyaluronic acid (HA) mainly involves degrading high molecular weight hyaluronic acid (MHL) into low molecular weight HA using physical, chemical, and enzymatic degradation methods. Physical degradation methods include heating, mechanical shearing, ultraviolet light, ultrasound, gamma-ray irradiation, and high-pressure homogenization. Physical degradation methods have advantages such as a clear principle, no need to add any reagents during the degradation process, simplified post-processing steps, a narrow Mr distribution range for the resulting low molecular weight HA, and good thermal stability. However, ultra-low molecular weight HA cannot usually be obtained.

[0031] Chemical decomposition methods for hyaluronic acid (HA) mainly include alkaline hydrolysis, acid hydrolysis, and oxidative decomposition. Chemical decomposition methods are low-cost and easy for large-scale production. However, chemical reagents may remain in the product. Furthermore, chemical decomposition, especially oxidative decomposition, can potentially disrupt the HA structure by modifying the aldehyde and hydroxyl groups in the hyaluronic acid monomer.

[0032] Enzymatic degradation is ideal for preparing low molecular weight hyaluronic acid (HA) due to its specificity, mild reaction conditions, and the immutable structure of polysaccharides, which allows for the acquisition of HA of different molecular weights by controlling different degradation times. Hyaluronidase (HAase) is a glycosidase that degrades high molecular weight hyaluronic acid into low molecular weight or oligomeric hyaluronic acid, and some HAases also have the ability to degrade chondroitin and heparin. In addition to being used for the preparation of low molecular weight or oligomeric HA, HAases can be used as drug dispersants, degrading HA in tissues, increasing tissue permeability, promoting diffusion after injection, and resulting in less contamination. HAases are classified into three categories based on their source: mammalian HAases, animal toxic HAases, and microbial HAases.

[0033] Microbial enzyme sources are rich in and diverse enzymatic properties, readily undergo recombinant expression, and yield increased results, making them a major source of enzyme preparations for future applications. Microbial enzyme production using microorganisms offers significant economic advantages, including rapid growth and reproduction, short growth cycles, simple culture methods, abundant and inexpensive raw materials, and will undoubtedly replace animal-derived extraction in the future.

[0034] Currently, HAases derived from microorganisms are mainly produced by bacteria, such as Fusobacterium, Micrococcus, Streptococcus, and Streptomyces. They act on β-1,4 glycosidic bonds and are degraded by a β-elimination mechanism. Hyaluronic acid, chondroitin, and chondroitin sulfate are viable substrates, with 2-(acetylamino)-2-deoxy-D-glucose being the main product. Gram-positive bacteria that produce HAases include Streptococcus pneumoniae, intermediate streptococci, Streptococcus constellatus, Clostridium, Bacillus perfringens, septic Clostridium, Clostridium chauvoei, Mycoplasma, Propionibacterium acnes, Streptococcus gracilis, Peptic Streptococcus pneumoniae, Propionibacterium granulosum, and Streptococcus zoepidemicus. Gram-negative bacteria that produce hyaluronidase include Aeromonas, Vibrio, Benecare, Rhacobacteria vulgaris, Bacteroides fragilis, Bacteroides ovatus, Streptobacillus, Bacteroides asaccharoretica, dead Fusobacterium, Treponema, and Treponema pertenue. HAase expressed by Gram-negative bacteria is not released extracellularly and is not involved in pathogenic processes. In contrast, HAase expressed by Gram-positive bacteria exacerbates wound infections in humans and animals, but the role of this enzyme—whether it promotes bacterial spread or invasion—has not yet been investigated. Candida and Coccidioides parapsis are pathogenic fungi that commonly infect humans. These fungi have the ability to secrete and produce various enzymes, including hyaluronidase, causing secondary infections in the mucous membranes, skin, adrenal glands, and lymph node regions of the body. Hyaluronidases and chondroitinases play important roles in the pathogenicity of Candida and Coccidioides parapsis. Fungi that have been identified to date as HAase-producing include Candida albicans, Perprogenum, Penicillium funiclosum, and Tropicalis.

[0035] Most HAase-producing bacteria reported in the literature are pathogenic, using the HAase they produce to break down host HA, reducing its viscosity, disrupting the defense system, and causing skin or mucosal infections in animals or humans. Most bacterial HAases also act on chondroitin sulfate and chondroitin, further promoting toxin diffusion. Therefore, when discovered in 1928, they were called "diffusion factors." Bacterial HAases are easy to isolate and purify, have high application value, and have high market prospects. Hyaluronidase was discovered in the 1970s, commercialized, and is widely used, but it is too expensive for large-scale preparation.

[0036] Currently, the most common HAase-producing bacterial strain is Streptococcus, and the literature reports that this strain possesses good genetic stability. By fermenting and culturing it, HAase with high hyaluronic acid degradation activity is purified from the fermentation broth. Preliminary isolation and purification of HAase were performed from the fermentation broth of Arthrobacter nicotinoborans, and its enzymatic properties were investigated. The crude enzyme solution was desalted by ultrafiltration concentration using a hollow fiber membrane with a molecular weight of 6000, freeze-dried to obtain hyaluronidase in powder form, and the crude enzyme solution was purified by column chromatography separation. The activity of the crude and purified enzymes was measured. As a result of studying the enzymatic properties of this hyaluronidase, it was found that a new hyaluronidase was isolated from the fermentation broth of Arthrobacter nicotinoborans that is stable, highly active, less affected by the environment, and easy to isolate and purify, providing an important experimental basis for the development of hyaluronidases. HAase production by Arthrobacter, Streptomyces, etc., has also been reported in the literature.

[0037] Hyaluronidase produced by microorganisms is easy to isolate and purify, making it a promising technology. Currently, many microorganisms, including bacteria, and a small number of fungi can produce hyaluronidase. For example, Bloomage Freda Biomedical Co., Ltd. introduced a leech-derived HAase gene into Streptococcus zoepidemicus as a host and expressed it secretion. The maximum enzyme activity secreted in a shaken flask was 21,333 U / mL, while wild-type hyaluronidase-producing Bacillus has a maximum enzyme activity of 10,000 U / mL.

[0038] After understanding the relevant background described in this invention, the following will describe in more detail, with reference to specific examples, the citrobacter portucarensis, hyaluronidase, its preparation method, and its uses according to the present invention.

[0039] The technical scheme of this invention is as follows. This is Citrobacter portucarensis, strain number HA2301, deposited with the China Center for Typical Cultures Depository on November 1, 2023, deposit number CCTCC NO.M20232108. Preferably, the 16S rRNA nucleotide sequence of Citrobacter portucarensis is SEQ ID NO.1.

[0040] In the above technical scheme, the present invention has isolated a yeast strain capable of producing hyaluronidase, but hyaluronidase-producing Citrobacter portucalensis has not been previously reported. The biological classification of Citrobacter portucalensis as described in the present invention is Bacteria, Pseudomonadota, Gammaproteobacteria, Enterobacterales, Enterobacteriaceae, Citrobacter, and Citrobacter portucalensis. The method for preparing hyaluronidase involves preparing hyaluronidase using the above-mentioned Citrobacter portucarensis, which can then be used to prepare low-molecular-weight hyaluronic acid.

[0041] In the above technical scheme, the hyaluronidase produced by Citrobacter portucarensis described in the present invention has high specificity for hyaluronic acid, and its enzyme production characteristics are an enzyme activity of 1000 to 10000 U / mL (hyaluronidase activity measured when high molecular weight sodium hyaluronate is used as a substrate). Preferably, the preparation method involves obtaining hyaluronidase by centrifuging and grinding the bacterial suspension obtained after culturing Citrobacter portucarensis.

[0042] In the above technical scheme, the culture process for obtaining the bacterial suspension is as follows: (1) Citrobacter portucarensis is inoculated into a liquid inoculum medium and inoculum culture is performed to obtain an inoculum suspension; (2) The inoculum suspension is scribed onto a solid medium and solid culture is performed to obtain a single colony; (3) The single colony is inoculated into a liquid fermentation medium and cultured to obtain a Citrobacter portucarensis bacterial suspension. During the inoculum culture process, the temperature is 10-60°C, the rotation speed is 50-300 rpm, and the duration is 10-30 hours. Preferably, the temperature is 37°C, the rotation speed is 150 rpm, and the duration is 12 hours. During the solid culture process, the temperature is 10-60°C and the duration is 10-30 hours. Preferably, the temperature is 37°C and the duration is 12 hours. During the growth culture process, the temperature is 10-60°C, the rotation speed is 50-300 rpm, and the duration is 10-30 hours. Preferably, the growth culture temperature is 37°C, the rotation speed is 250 rpm, and the duration is 12 hours.

[0043] In the above technical scheme, the substrate metabolic spectrum of Citrobacter portucarensis is broad, and carbon sources such as glucose, maltose, galactose, xylose, glycerol, sucrose, lactose, melibiose, and meletitose can be used, and nitrogen sources such as urea, ammonia, ammonium salts, nitrate, yeast extract, and peptone salts can be used, and all cultures of Citrobacter portucarensis with different substrates can produce hyaluronidase. Preferably, the liquid inoculum medium and liquid fermentation medium per liter consist of the following components by weight: 1-20 g peptone, 1-10 g yeast powder, 1-10 g sodium chloride, and 100-2000 mL of water, with a pH of 3-10. The solid culture medium per liter consists of the following weight components: 1-20 g peptone, 1-10 g yeast powder, 1-10 g sodium chloride, 15-25 g agar powder, and 100-2000 mL of water, with a pH of 3-10. In this invention, the pH is adjusted using one or more of hydrochloric acid, sodium hydroxide, and phosphoric acid. More preferably, the rotational speed of the centrifugal separation process is 5000 to 12000 rpm, and the time is 5 to 10 min.

[0044] In the above technical scheme, the centrifugal separation conditions are preferably 8000 rpm for 5 minutes. The hyaluronidase has amino acid sequence and nucleotide sequence SEQ ID NO.2 and SEQ ID NO.3, respectively, and is obtained by the preparation method described above. Preferably, the upstream and downstream genes of the hyaluronidase gene are SEQ ID NO.4 and SEQ ID NO.5, respectively. The conserved structure of the hyaluronidase was predicted, and the resulting amino acid sequence of the conserved region is SEQ ID NO. 6.

[0045] In the above technical scheme, the promoter of the hyaluronidase gene is ATG, and the terminator is TAG. The nucleotide sequence of the ribosome binding site of the hyaluronidase is SEQ ID NO.7. The above describes the use of hyaluronidase in the preparation of hyaluronic acid. Preferably, the method for preparing the hyaluronic acid involves mixing the hyaluronidase described above with hyaluronic acid or sodium hyaluronate and performing enzymatic degradation.

[0046] In the above technical scheme, the present invention uses the above-mentioned hyaluronidase to cleave high molecular weight sodium hyaluronate of 1,000,000 Da into 10,000 Da in 12 hours, making it applicable to industrial production, replacing expensive hyaluronidase extracted from animal tissue, and offering potential for broad applications in the pharmaceutical and cosmetic fields. More preferably, the temperature of the enzymatic decomposition is 20-60°C, and the pH value is 3-10. The volume ratio of hyaluronidase to hyaluronic acid or sodium hyaluronate is 1-5:5-15. More preferably, the temperature of the enzymatic decomposition is 37°C and the pH value is 6.5.

[0047] In the above technical scheme, the crude enzyme solution of Citrobacter portucarensis can enzymatically degrade 100 WDa high molecular weight sodium hyaluronate to 85,000 Da in one hour at this ratio. [Examples]

[0048] The screening and validation steps for Citrobacter portucalensis are as follows:

[0049] (1) The deposited strains are inoculated into numerous shake flasks containing liquid inoculum medium, and cultured on a shaker for 12 hours at a temperature of 37°C and a rotation speed of 150 rpm to obtain inoculum.

[0050] (2) Scrib the inoculum solution obtained in step (1) onto a solid culture medium and culture for 12 hours at a temperature of 37°C to obtain a single colony.

[0051] (3) Collect the single colonies obtained in step (2), inoculate them into liquid fermentation medium, and culture them for 12 hours at a temperature of 37°C and 150 rpm. The above-mentioned starter culture medium and liquid fermentation medium contain 2% by mass of peptone, 1% by mass of yeast powder, 2% by mass of sodium chloride, and distilled water. The above solid culture medium components include 2% by mass peptone, 1% by mass yeast powder, 2% by mass sodium chloride, 2% by mass agar powder, and distilled water.

[0052] (4) Collect the bacterial suspension prepared in step (3), centrifuge at 8000 rpm for 5 minutes to obtain bacterial cell precipitate, and then grind it.

[0053] (5) Validation using the hyaluronic acid plate method is performed as follows: Add 2% agar powder by mass and 0.2 g 1,000,000 Da sodium hyaluronate to 100 mL of distilled water and autoclave sterilization. Under constant stirring speed, 10 mL of 5% bovine serum albumin (BSA) stock solution is added to the medium by sterile filtration and shaken well. Pour the medium into plates and store at 4°C. Perforate the medium using Oxford cups. Add 100 μL of bacterial suspension to each well. React the plates at 37°C for 24 hours. The next day, wash with 2N acetic acid for at least 15 minutes. A clear halo appeared around the wells, indicating the degradation of HA.

[0054] (6) Strains that showed a clear halo on the hyaluronic acid plate were screened, and Citrobacter portucalensis was obtained.

[0055] The specimen of Citrobacter portucarensis has been deposited as a biological sample. Its taxonomic name is Citrobacter sp., strain number: HA2301, and it was deposited on November 1, 2023, at the China Center for Typical Cultures Depository (Wuhan University, Wuhan, China), with deposit number: CCTCC NO.M20232108. [Examples]

[0056] The Citrobacter portucalensis screened in Example 1 were observed to have grayish-white, rounded colonies with a moist surface and irregular edges on a solid medium plate (LB). The results after 12 hours of incubation are shown in Figure 1.

[0057] The plate method was used to validate the decomposition ability of hyaluronidase against hyaluronic acid: Add 2% agar powder by mass and 0.2 g 1,000,000 Da sodium hyaluronate to 100 mL of distilled water and autoclave sterilization. Under constant stirring speed, 10 mL of 5% bovine serum albumin (BSA) stock solution is added to the medium by sterile filtration and shaken well. Pour the medium into plates and store at 4°C. Perforate the medium using Oxford cups. Add 100 μL of bacterial suspension to each well. React the plates at 37°C for 24 hours. The next day, wash with 2N acetic acid for at least 15 minutes.

[0058] The results are shown in Figure 2, where a clear halo appeared around the well, indicating the degradation of HA. [Examples]

[0059] Example 3: Preparation of hyaluronic acid crude enzyme solution from Citrobacter portucalensis bacterial suspension The specific steps are as follows:

[0060] (1) The Citrobacter portucarensis screened in Example 1 were collected, inoculated into liquid inoculum medium, and cultured in a shaker for 12 hours at a temperature of 37°C and a rotation speed of 150 rpm to obtain an inoculum solution. The liquid inoculation medium consists of 10g peptone, 5g yeast powder, 5g sodium chloride, and 1000mL water per liter, with a pH of 6.5.

[0061] (2) Collect the inoculum solution obtained in step (1), scrib it onto a solid medium, and culture it for 12 hours at a temperature of 37°C to obtain a single colony. The solid culture medium consists of 10g peptone, 5g yeast powder, 5g sodium chloride, 20g agar powder, and 1000mL water per liter, with a pH of 6.5.

[0062] (3) Inoculate the single colonies obtained in step (2) into liquid fermentation medium and culture for 12 hours at a temperature of 37°C and 250 rpm to obtain a bacterial suspension. The liquid fermentation medium per liter consists of 10g peptone, 5g yeast powder, 5g sodium chloride, and 1000mL of water, with a pH of 6.5.

[0063] (4) The Citrobacter portucalensis fungal suspension obtained in step (3) is centrifuged at 8000 rpm for 5 minutes to obtain a cell precipitate, which is then ground to obtain a crude enzyme solution. The pH of the liquid inoculum medium, solid medium, and liquid fermentation medium is adjusted using one or more of hydrochloric acid, sodium hydroxide, and phosphoric acid.

[0064] (5) The samples were centrifuged at 5000, 7000, 10000, and 12000 rpm for 5 minutes each, and then centrifuged at 8000 rpm for 6, 7, 8, 9, and 10 minutes each to obtain bacterial cell precipitates, which were then ground to obtain a crude enzyme solution. [Examples]

[0065] Example 4: Measurement of the optimal conditions for the crude hyaluronic acid enzyme solution obtained in Example 3. The specific steps are as follows:

[0066] Each test tube was filled with 1 mL of Citrobacter portucalensis bacterial suspension, centrifuged to obtain cell precipitate, discarded the supernatant, resuspended the cells in 100 μL of sterile water, and crushed using a cell crusher for 20 mins. 100 μL of crude enzyme solution and 800 μL of 2 mg / mL 100 WDe sodium hyaluronate solution were placed in separate test tubes. 100 μL of each of the prepared sodium citrate buffers with different pH levels (4.5, 5.0, 5.5, 6.0, 6.5, 7.0, and 7.5) were added to each test tube, and the mixture was reacted in a water bath at 38°C for 1 hour. Afterwards, the samples were removed and inactivated in a boiling water bath for 5 mins, 2 mL of DNS was added, followed by a 6 min boiling water bath. Immediately after removal, the samples were cooled in an ice bath and OD was performed as shown in Figure 3. 540 Measure the absorbance.

[0067] Add 100 μL of the prepared pH 6 sodium citrate buffer to a test tube and react in a water bath at different temperatures (30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, and 40°C) for 1 hour. Then remove and inactivate in a boiling water bath for 5 minutes. Add 2 mL of DNS, boil in water for 6 minutes, and immediately after removal, cool in an ice bath and OD as shown in Figure 4. 540 Measure the absorbance.

[0068] As can be seen from Figures 3 and 4, the optimal pH for hyaluronidase in Citrobacter portucarensis cells is 5.5, and the optimal temperature is 37°C. [Examples]

[0069] Example 5: Measurement of enzyme activity of crude hyaluronic acid enzyme solution The method involves measuring the amount of reducing sugars produced by the degradation of hyaluronic acid by hyaluronidase using the 3,5-dinitrosalicylic acid (DNS) colorimetric method. Enzyme activity is defined as the amount of enzyme required to release 1 μg glucose reducing equivalent of reducing sugar from hyaluronic acid per hour at pH 5.5 and 38°C.

[0070] The principle of measuring the enzyme activity described above is as follows: When 3,5-dinitrosalicylic acid is heated under alkaline conditions, it reacts with reducing sugars. The 3,5-dinitrosalicylic acid is reduced to a brownish 3-amino-5-nitrosalicylic acid. This red substance has a specific absorption peak and can be detected by a detector at 540 nm. Simultaneously, the reducing sugars are oxidized to saccharic acid and other substances. Within a certain range, the amount of reducing sugars is linearly related to the color of the brownish substance.

[0071] The specific operating procedure is as follows:

[0072] Preparation of DNS solution: Weigh (10 ± 0.1) g of 3,5-dinitrosalicylic acid, add to approximately 600 mL of water, gradually add 10 g of sodium hydroxide, and dissolve by stirring in a 50°C water bath (magnetic). Then, sequentially add 200 g of sodium potassium tartrate, 2 g of phenol, and 5 g of anhydrous sodium sulfite. After dissolving and clarifying, cool to room temperature, add water to a constant volume of 1000 mL, and filter. Store in a brown reagent bottle and leave in the dark for 7 days (Standard DNS reagent preparation for the Light Industry Department).

[0073] The reaction system consisted of a total of 3 mL. 0 μL, 50 μL, 100 μL, 150 μL, and 200 μL of glucose standard solution (2 mg / mL) were added to 2 mL of DNS solution, and the total volume was diluted to 3 mL with water. The mixture was boiled in a boiling water bath for 10 minutes, cooled to room temperature, and diluted to 10 mL with water. The absorbance was measured at 540 nm, and a standard curve was created with absorbance on the x-axis and glucose mass concentration on the y-axis (shown in Figure 11).

[0074] The measurement procedure for hyaluronic acid crude enzyme solution samples is as follows:

[0075] Prepare the following reagents: 2 mg / mL sodium hyaluronate (molecular weight 1000 kDa) aqueous solution, 50 mmol / L, pH 6.0 sodium citrate buffer. For the reaction system (1 mL): 800 μL sodium hyaluronate aqueous solution, 100 μL crude hyaluronic acid enzyme solution, and sodium citrate buffer to make 1 mL. React in a water bath at 37°C for 1 hour. Use 1 mL of the reaction sample instead of the glucose standard solution, and 100 μL of sterile water instead of the crude hyaluronic acid enzyme solution as a blank control. Measure the absorbance and substitute it into the standard curve to determine the glucose mass concentration of the reducing equivalent.

[0076] When the Citrobacter portucalensis of the present invention was measured using the DNS method described above, the enzyme activity reached 9600 U / mL. [Examples]

[0077] In the enzyme activity measurement procedure in Example 5, the enzyme activity of Bacillus in the laboratory was measured, and the enzyme activity reached a maximum of 4000 U / ml, which was lower compared to the enzyme activity of Citrobacter. [Examples]

[0078] A single colony of Citrobacter portucarensis from Example 1 was collected in an EP tube, and DNA was extracted using a yeast strain DNA extraction kit as a template. PCR amplification was performed, the success of the amplification was validated by agarose gel electrophoresis, and the sample was sent for sequencing. The kit and gene amplification reagents used were purchased from Shanghai Biotechnology Co., Ltd.

[0079] Upstream primer 16S rRNA1 (TCCGTAGGTGAACCTGCGG) and downstream primer 16S rRNA4 (TCCTCCGCTTATTGATATGC) were used.

[0080] Amplification procedure: 50 μL reaction system (1 μL upstream primer, 1 μL downstream primer, 25 μL 2× Taq PCR Master mix, 1 μL DNA template, 22 μL dd H2O).

[0081] Reaction conditions: Pre-denaturation at 94°C for 2 minutes, denaturation at 94°C for 30 seconds, annealing at 55°C for 40 seconds, extension at 72°C for 1 minute, and finally extension at 72°C for 10 minutes. Purification, cloning, and sequencing of the PCR product were performed at Shanghai Biotechnology Co., Ltd. Identification was obtained by homology comparison of the 16S rRNA gene sequencing results with the NCBI database (Query Cover 100%, Per.ident 100%), and it was confirmed to be Citrobacter portucalensis.

[0082] The citrobacter portucarensis 16S rRNA sequence is SEQ ID NO.1, i.e., the sequence is <210> It is 1.

[0083] The phylogenetic tree analysis of the 16S rRNA sequence of the strain of the present invention is shown in Figure 5. Its gene sequence was compared using the BLAST program of the National Center for Biotechnology Information (NCBI), and the 16S rRNA gene sequence of the strain of the present invention shows high homology to the 16S rRNA gene sequence of the Citrobacter portucarensis portion registered with NCBI. A large number of literature studies were conducted, and no reports of hyaluronidase production by this yeast strain were found among strains with similar homology. [Examples]

[0084] The Citrobacter portucalensis strain of the present invention was sent for whole-genome triple sequencing (sequencing was performed by Shanghai Meiji Biotechnology Co., Ltd.), and analyzed using the Kyoto Encyclopedia of Genes and GeNomes (https: / / www.kegg.jp / ). The genome length of the strain was 5,358,987 bp, the G+C% content was 51.66%, there was one chromosome, the number of genes was 5050, and there were 654 pathogenic genes. [Examples]

[0085] The entire gene sequence was analyzed using BLAST in the Kyoto Encyclopedia of Genes and GeNomes (https: / / www.kegg.jp / ), and the analyzed hyaluronidase gene sequence is SEQ ID NO.3( <210> As shown in 3). [Examples]

[0086] The crude enzyme solution described in Example 3 was subjected to polyacrylamide gel electrophoresis as follows.

[0087] (1) Gel preparation (Separation gel: Mix 4 mL 30% acr / bis solution, 2.6 mL 1.5 M Tris-HCl (pH 8.8), 100 μL 10% SDS, 100 μL 10% ammonium persulfate, and 3.3 mL of distilled water, then add 4 μL TEMED and shake well immediately. Concentration gel: Mix 0.83 mL 30% acr / bis solution, 0.675 mL 1 M Tris-HCl buffer (pH 6.8), 50 μL 10% SDS, 75 μL 10% ammonium persulfate, and 3.42 mL of distilled water, then add 6 μL TEMED and shake well immediately. The above are volume % content).

[0088] (2) Sample preparation: Take 160 μL of crude enzyme solution and add it to 40 μL of 5× SDS-PAGE protein sample loading buffer, then boil in a boiling water bath for 10 minutes.

[0089] (3) Sample loading: Once the gel has completely solidified, remove the gel holder, pull the comb vertically upwards, remove the holder, and fix the gel, along with the front and rear glassware, into the electrophoresis tank. Add 1x electrophoresis buffer to the electrophoresis tank until it exceeds the sample loading chamber. Spot 5 μL of marker and 25 μL of sample separately.

[0090] (4) Electrophoresis: Prepare a 90V concentrated gel electrophoresis machine. After the indicator has entered the separation gel, adjust to a 120V separation gel electrophoresis machine and perform electrophoresis until the gel plate turns blue up to 1 cm from the bottom edge.

[0091] (5) Staining and decolorization: After electrophoresis, the gel was removed from the gel chamber, the glass plate was pried open to remove the gel, the gel was peeled off, and the gel was stained with Coomassie Brilliant Blue for gels (1g Coomassie Brilliant Blue R-250, 450mL methanol, 100mL glacial acetic acid, 450mL distilled water) using a shaker for 30-60 minutes. The stained gel was then destained with acetic acid destaining solution (100mL acetic acid, 100mL methanol, 800mL water) until the background was colorless.

[0092] The results are shown in Figure 6. After crushing the bacterial cells, a clear band is observed between 75 and 100 kDa, whereas no clear band is observed in the supernatant. Therefore, it is considered that the hyaluronidase in this strain is an intracellular enzyme. [Examples]

[0093] The hyaluronidase gene obtained in Example 8 was entered into NCBI and compared, and the amino acid sequence was found to be SEQ ID NO.2( <210> As shown in 2). [Examples]

[0094] The hyaluronidase gene obtained in Example 8 was entered into the RCSB Protein Data Bank (https: / / www.rcsb.org / ), and the predicted three-dimensional structure of hyaluronidase is shown in Figure 7. As can be seen from Figure 7, the model is similar to the enzyme protein structure of the PL8 family, and the catalytic mechanism is the same. [Examples]

[0095] The results predicted using Expasy (https: / / www.expasy.org / ) indicate that the molecular weight of the above hyaluronidase is 88kDaBased on the input of the hyaluronidase amino acid sequence and subsequent analysis, the theoretical isoelectric point of the above hyaluronidase is 8.68. [Examples]

[0096] Using the CD-search tool (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi) from the National Center for Biotechnology Information, the conservative structure of the above hyaluronidase gene was analyzed, and the conserved region obtained was identified as SEQ ID NO. 8 ( <210> As shown in 6). [Examples]

[0097] A search of a large-scale database for hyaluronidase gene sequences from different species and a homology comparison revealed that, as shown in Figure 8, this enzyme does not show significant similarity to other reported hyaluronidase genes. [Examples]

[0098] The hyaluronidase gene from Example 8 was entered into the National Center for Biotechnology Information (https: / / www.ncbi.nlm.nih.gov / ) and compared and analyzed. The results showed that the promoter of the gene is ATG, the terminator is TGA, and the upstream gene of the hyaluronidase gene is SEQ ID NO. 4 ( <210> 4) As shown, the downstream gene is SEQ ID NO.5( <210> As shown in 5).

[0099] Genetic analysis using the JASPAR-A database of transcription factor binding profiles (https: / / jaspar.genereg.net / ) tool revealed that the ribosome binding site of the gene in question is SEQ ID NO. 7( <210> 7): GAGAGGTTAGAGT. [Examples]

[0100] A 5 mL crude enzyme solution was mixed with 15 mL of 2 mg / mL high molecular weight 100 WDe sodium hyaluronate and reacted. The molecular weight was measured every 2 hours using a 0.45 mm Ouabain viscometer, and the molecular weight size was determined using the Ouabain viscometer formula.

[0101] In conjunction with the characteristic viscosity-time relationship results of the enzymatic degradation of sodium hyaluronate by hyaluronidase shown in Figure 9, high molecular weight sodium hyaluronate was enzymatically degraded to 10,000 Da after 12 hours. [Examples]

[0102] The crude enzyme solution was mixed with sodium hyaluronate with a concentration of 2 mg / mL and a high molecular weight of 100 WDe, and the reaction was carried out under the following conditions.

[0103] (1) 5 ml of crude enzyme solution was mixed with 5, 25, 30, and 75 ml of sodium hyaluronate, respectively, and reacted under conditions of 37°C and pH 6.5. Molecular weight was measured every 4 hours using a 0.45 mm Ouabain viscometer and high-temperature gel chromatography (GPC), and it was found that all of them could be enzymatically degraded to produce low molecular weight hyaluronic acid.

[0104] (2) 5 ml of crude enzyme solution was added to 15 ml of sodium hyaluronate and enzymatically digested at room temperature at pH values ​​of 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, and 10. Molecular weight was measured every four hours using a 0.45 mm Ouabein viscometer and high-temperature gel chromatography (GPC). It was found that both could be enzymatically degraded to produce low-molecular-weight hyaluronic acid. Among these, the enzymatic degradation was most effective at a pH of 6.5.

[0105] (3) 5 ml of crude enzyme solution was added to 15 ml of sodium hyaluronate and enzymatically decomposed at pH 6.5, 20, 25, 30, 35, 37, 40, 45, 50, and 60°C. Molecular weight was measured every 4 hours using a 0.45 mm Ouabein viscometer and high-temperature gel chromatography (GPC). It was found that both could be enzymatically degraded to produce low-molecular-weight hyaluronic acid. The best enzymatic degradation effect was observed at a temperature of 37°C. [Examples]

[0106] The bacterial suspension (cultured for 12 hours) and 1 g / 100 mL of sodium hyaluronate were homogeneously mixed in volume ratios of 1:5, 1:10, 1:15, and 1:20. For example, 8 mL, 4 mL, 2.67 mL, and 2 mL of the bacterial suspension were added to centrifuge tubes containing 40 mL of hyaluronic acid solution, respectively, and shaken well. The mixtures were allowed to react under 37°C conditions, and samples were taken at 0h, 2h, 4h, 6h, 8h, 10h, and 12h, and agarose gel electrophoresis was performed.

[0107] Agarose gel electrophoresis: TBE (Tris boric acid) concentrated preservative solution (5x): 54g Tris base, 27.5g boric acid, 20ml 0.5mol / L EDTA. Dissolve uniformly in sterile water, adjust pH to 8.0 with NaOH, and make a solution volume of 1L.

[0108] Preparation of 1% agarose gel: (1) Measure 100 mL of 1×TBE buffer solution using a graduated cylinder, put it into a 250 mL wide-mouthed bottle, weigh 1.0 g of agarose and add it, shake well, and heat in a microwave oven for 3 minutes to dissolve completely. (2) Gel plate preparation: Place the dissolved gel into an organic glass bath with a comb already inserted, leave it at room temperature for 30 minutes, wait for the gel to cool and solidify, then carefully remove the comb and place the organic glass bath and gel into the electrophoresis tank: Add 1×TAE buffer to the electrophoresis tank so that it exceeds the gel plane, at which point the voltage across both ends of the gel becomes equal to the applied voltage, increasing the electrophoresis efficiency. (3) Spotting: Mix the sodium hyaluronate sample with Loading Buffer in a ratio of 10:3 and add the entire amount to the sampling well using a pipette gun. (4) Electrophoresis: Turn on the electrophoresis apparatus, set the voltage to 80V, and perform electrophoresis until the dye is 1-2 cm away from the front edge of the gel (approximately 2 hours). Then turn off the electrophoresis apparatus to stop the electrophoresis. (5) Staining and observation: Place the gel in toluidine blue staining solution and immerse for 2 hours. Then remove the gel and destain it with distilled water for 5 hours (do not destain overnight). Electrophoresis is detected using UV light with a fully automated gel imager.

[0109] As shown in Figure 10, the crude enzyme solution could be decomposed from 1000 kDa to approximately 80 kDa molecular weight over 1 hour in a 1:5 ratio, and after 5 hours of decomposition, the molecular weight was 16 kDa.

[0110] As described above, preferred embodiments of the present invention have been explained, but in no way do these embodiments limit the embodiments of the present invention. Any simple changes, equivalent variations, and modifications to the above embodiments based on the technical substance of the embodiments of the present invention are still included within the scope of the technical scheme of the embodiments of the present invention.

Claims

1. Citrobacter portucarensis, characterized by strain number: HA2301, deposited with the China Typical Culture Depository Center on November 1, 2023, with deposit number: CCTCC NO. M20232108, and having a 16S rRNA nucleotide sequence of SEQ ID NO.

1.

2. A method for preparing hyaluronidase, characterized by preparing hyaluronidase using Citrobacter portucarensis as described in claim 1.

3. The preparation method according to claim 2, characterized in that hyaluronidase is obtained by centrifuging and pulverizing the bacterial solution after culturing with Citrobacter portucarensis as described in claim 1.

4. The rotational speed of the centrifugal separation process is 5,000 to 12,000 rpm, and the duration is 5 to 10 minutes. The preparation method according to feature 3.

5. The preparation method according to claim 4, wherein the amino acid sequence and nucleotide sequence of the hyaluronidase are SEQ ID NO. 2 and SEQ ID NO. 3, respectively.

6. The upstream and downstream genes of the hyaluronidase gene are SEQ ID NO. 4 and SEQ ID NO. 5, respectively. The amino acid sequence of the conserved region of the hyaluronidase is SEQ ID NO.

6. The preparation method according to claim 5, wherein the nucleotide sequence of the ribosome binding site of the hyaluronidase is SEQ ID NO.

7.

7. Use of hyaluronidase according to claim 5 in the preparation of hyaluronic acid.

8. The preparation of the hyaluronic acid is characterized by the use according to claim 7, which involves mixing the hyaluronidase described in claim 5 with hyaluronic acid or sodium hyaluronate and performing enzymatic decomposition.

9. The use according to claim 8, wherein the temperature of the enzymatic decomposition is 20 to 60°C and the pH value is 3 to 10.

Images