Method for in vitro culture of frozen-thawed fertilized eggs using medium for in vitro culture with 1α,25-Dihydroxyvitamin D3

A culture medium with 1α,25-Dihydroxyvitamin D3 enhances embryonic development efficiency by reducing apoptosis and ROS in bovine fertilized eggs, improving hatching rates and conception rates.

KR102992482B1Active Publication Date: 2026-07-21IND COOP FOUND CHONBUK NAT UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
KR1020240192176
Authority / Receiving Office
KR · KR
Patent Type
Patents
Current Assignee / Owner
Priority Date
2024-11-20
Filing Date
2024-12-20
Publication Date
2026-07-21
Estimated Expiration
2044-12-20

Smart Images

  • Figure 112024141690540-PAT00004_ABST
    Figure 112024141690540-PAT00004_ABST
Patent Text Reader

Abstract

The present invention relates to a method for in vitro culture of frozen-thaw fertilized eggs using an in vitro culture medium containing 1α,25-Dihydroxyvitamin D3.
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] The present invention relates to a method for in vitro culture of frozen-thaw fertilized eggs using an in vitro culture medium containing 1α,25-Dihydroxyvitamin D3. Background Technology

[0002] In vitro embryo production (IVP) technology for cattle, combined with ovum pick-up (OPU) technology, can effectively increase the productivity of embryos from both selected bulls and boars. Since the produced embryos can be implanted into surrogate mothers to generate multiple offspring, the generation interval can be effectively reduced, making it an effective technology for livestock improvement. In particular, IVP technology that applies sex-determined semen and genomic selection techniques to embryo production is being utilized commercially, and the efficiency of this utilization can be enhanced through embryo freezing technology.

[0004] Embryo freezing technology is used to preserve valuable genes or effectively utilize superior genetic capabilities. According to the International Embryo Transfer Society (IETS), the transition from fresh embryo transfer to embryo transfer using frozen in vitro fertilized eggs in North America increased from 19% in 2013 to nearly 60% in 2019. Cryopreservation of mammalian embryos was first successfully achieved in 1972 by a research team led by Whittingham et al. using rat embryos. Whittingham's research developed the traditional slow freezing method, which utilizes various cryoprotectants and cooling rates, and remains the most widely used method for embryo cryopreservation in the livestock industry today. This method involves progressively dehydrating the embryo in a cryoprotectant while gradually cooling the embryo and surrounding medium, followed by storage in liquid nitrogen. Equilibrating the embryo in permeable cryoprotectants such as glycerol or ethylene glycol draws water out of the cell, vitrifying the intracellular structure and preventing damage to the cell structure and membranes. This method does not require special skills, but the cost of building the cooling system can be high, and the freezing process takes a long time.

[0006] The vitrification freezing method has the advantage of requiring less time for the freezing process and allowing freezing without the need for specialized equipment. Vitrification is a rapid transition from a liquid to a glass-like solid, which inhibits the formation of lethal ice crystals, thereby increasing the survival rate of fertilized eggs. By inducing intracellular dehydration through a short equilibrium phase prior to freezing, the intracellular space and extracellular solution are simultaneously vitrified. This reduces the risk of osmotic damage and the formation of ice crystals that could damage cell membranes. Consequently, by suppressing the formation of ice crystals that are fatal to survival, the survival rate of fertilized eggs can be improved. While the vitrification method does not require expensive equipment, it does require a higher level of training than the slow freezing method. According to a recent meta-analysis, the vitrification method has been reported to temporarily protect fertilized eggs from freezing stress compared to the slow freezing method, thereby increasing the re-expansion, hatching rate, and survival rate of in vitro fertilized eggs.

[0008] Vitamin D plays a role in maintaining the stability of signaling pathways by regulating cellular signaling components, such as Ca2 and reactive oxygen species (ROS), to basal levels. Various studies have reported that maintaining normal levels of Vitamin D3 plays a crucial role in preserving normal ovarian and reproductive functions in women. Vitamin D deficiency is known to have negative effects on infertility, certain gynecological diseases such as polycystic ovary syndrome (PCOS) and endometriosis, and maternal-fetal interactions. Recently, it has been reported that Vitamin D3 supplementation can improve insulin resistance in PCOS patients, lower androgen levels, increase pregnancy rates, and improve the success rate of in vitro fertilization (IVF) in infertile patients.

[0010] Accordingly, the inventors analyzed the correlation between the development of fertilized eggs and vitamin D using vitamin D in the production of in vitro fertilized eggs, and subsequently confirmed the effect on the development of thawed eggs by freezing and thawing. As a result, they confirmed that in thawed eggs cultured in a culture medium containing vitamin 1α,25-Dihydroxyvitamin D3 after vitrification freezing of fertilized eggs, the expression level of qualitative indicator genes increased and the cause of cell death decreased, thereby improving the growth rate, and thus completed the present invention. The problem to be solved

[0011] The objective of the present invention is to provide a composition that increases the efficiency of embryonic development of a bovine fertilized egg comprising 1α,25-Dihydroxyvitamin D3.

[0013] Another objective of the present invention is to provide a method for increasing the efficiency of embryonic development of bovine fertilized eggs using the above-described in vitro culture medium composition. means of solving the problem

[0014] To achieve the above objective, the present invention provides a composition that increases the efficiency of embryonic development of a bovine fertilized egg comprising 1α,25-Dihydroxyvitamin D3.

[0016] In one embodiment of the present invention, the composition may use an mSOFaa culture medium as the base medium and may include 1α,25-Dihydroxyvitamin D3, but is not limited thereto, and may appropriately select and use a generally used in vitro culture (IVC) medium or a modification thereof as the base medium.

[0018] In one embodiment of the present invention, the embryonic development can reduce reactive oxygen species or apoptosis in the blastocyst. To examine the cells of the blastocyst due to apoptosis, TUNEL analysis was performed 48 hours after thawing and the total number of cells in the blastocyst was analyzed simultaneously. As a result, it was confirmed that vitamin D treatment inhibited apoptosis in the blastocyst by inducing the neutralization of peroxides generated from mitochondria (Figs. 1A to 1D).

[0020] To investigate the relationship between vitamin D supplementation, ROS production, and cell death, the expression of related genes in freeze-thaw blastocysts was examined. As a result, BCL2L, a cell death inhibitory gene, was found to be high in the 25VD group, while BAX, a cell death inducing gene, was expressed significantly low, and Chloride intracellular channel protein 1 (CLIC1), a ROS indicator gene, was expressed significantly low. Additionally, it was confirmed that SOD2 gene expression decreased in the 25VD treatment group (Fig. 2).

[0022] In the present invention, the embryonic development of the bovine fertilized egg may be an increase in hatching rate, the formation of blastocysts, or the development of blastocysts. As a result of examining the effect of vitamin D supplementation on the survival rate and hatching rate of freeze-thawed bovine in vitro fertilized eggs, the hatching rate at 24 hours after thawing was 59.22% in the 25VD group, which was significantly higher than 41.03% in the control group, and based on re-expanded blastocysts, 92% of the 25VD group hatched, which is an increase compared to the control group (Table 3).

[0024] In the present invention, the composition can reduce the expression of CLIC1 and BAX.

[0026] In the present invention, the composition can increase the expression of BCL2L.

[0028] The above bovine fertilized egg may be thawed or thawed after being frozen or cryopreserved. The cryopreservation may be performed using a vitrification freezing method, but is not limited thereto.

[0030] In another aspect, the present invention relates to a method for increasing the efficiency of embryonic development of a bovine fertilized egg by culturing the bovine fertilized egg in vitro in a composition comprising 1α,25-Dihydroxyvitamin D3. Effects of the invention

[0031] When the in vitro culture medium composition containing 1α,25-Dihydroxyvitamin D3 of the present invention is cultured after vitrification freezing of bovine fertilized eggs, the hatching rate of the fertilized eggs increases, the neutralization of peroxides is induced to inhibit cell death of blastocysts, and the antioxidant and related genes are significantly increased. Therefore, the medium composition of the present invention can improve the quality of fertilized eggs during the freeze-thaw process and ultimately contribute significantly to improving the conception rate through fertilized egg transplantation. Brief explanation of the drawing

[0032] Figure 1 shows the results of showing embryonic and TUNEL and MitoSOX-positive cells in blastocysts frozen and thawed after 48 hours of culture, (A) is the result of staining apoptotic cells in blastocysts with the TUNEL kit and DNA and fragmented DNA with DAPI (blue), TdT (red), and MitoSOX (green), respectively, (B) is the total number of cells in bovine blastocysts, (C) is the apoptotic index, and (D) is the result of analyzing MitoSOX intensity. Figure 2 shows the results of analyzing the relative gene expression of freeze-thaw blastocysts derived from various culture conditions. Specific details for implementing the invention

[0033] The present invention will be explained in more detail below through examples. These examples are merely for the purpose of explaining the present invention more specifically, and it will be obvious to those skilled in the art that the scope of the present invention is not limited to these examples.

[0035] [Example 1] Experimental Materials and Method

[0037] 1.1 Production of In Vitro Fertilized Eggs

[0039] 1.1.1 Collection and Maturation Culture of Oocytes

[0041] Oocytes from cows slaughtered at a slaughterhouse were collected, placed in a physiological saline solution at 30-35°C, and transported to the laboratory. Immature oocytes were collected from follicles with a diameter of 2-7 mm, and only those with homogeneous cumulus cells and cytoplasm were selected for oocyte maturation. The maturation culture of the oocytes (COCs) was performed in a maturation culture medium containing 10% FBS (Gibco-BRL, NY, USA), 0.2 mM Na-pyruvate, 50 µg / ml gentamycin (Sigma, ST Louis, MO, USA), and hormones (FSH 0.02 U / ml, LH 5 µg / ml, and Estradiol 1 µg / ml; Sigma) in TCM-199 medium, under conditions of 5% CO2, 5% O2, and 38.5°C for 20-22 hours.

[0043] 1.1.2 In Vitro Fertilization

[0045] In vitro fertilization was performed using frozen sperm with oocytes that had completed maturation culture. A modified IVF100 medium (Research Institute for the Functional Peptides, Yamagata, Japan) was used as the basic culture medium. The frozen sperm was thawed at 37°C for 45 seconds and washed by centrifugation at 800×g for 7 minutes using Percoll. The concentration of activated sperm required for fertilization was 1×10⁶. 6After diluting the sperm pellet to a concentration of 10 / ml, the number of viable sperm per in vitro matured embryo was 5–10 × 10 3 20 µl of sperm suspension was added to an 80 µl droplet containing eggs. The in vitro fertilization time was adjusted to 18 hours, and cumulus cells were removed from COCs using 300 IU hyaluronidase to culture the fertilized eggs in vitro.

[0047] 1.1.3 In Vitro Culture

[0049] After in vitro fertilization, oocytes from which cumulus cells had been removed were cultured for 9 days in a culture medium prepared according to the experimental design under conditions of 5% CO2, 5% O2, and 38.5℃.

[0051] 1) Control: mSOFaa culture medium

[0052] 2) VD25: mSOFaa supplemented with 25 ng / ml 1α,25-Dihydroxyvitamin D3

[0053] 3) VD50: mSOFaa supplemented with 50 ng / ml 1α,25-Dihydroxyvitamin D3

[0055] 1.1.4 Vitrification, Freezing, and Thawing

[0057] Vitrification was performed using a Cryotop (Kitazato Supply Co, Fujinomiya, Japan). 1 to 4 blastovases were washed with an equilibrium solution (PBS + 20% FBS), transferred to an equilibrium solution containing 7.5% dimethyl sulfoxide (DMSO) and 7.5% ethylene glycol (EG), and stored at room temperature for 3 minutes. Subsequently, the blastovases were transferred to an equilibrium solution containing 15% DMSO, 15% EG, and 0.5 M sucrose, loaded into a Cryotop within 60 seconds, and frozen in liquid nitrogen. The vitrified blastovases were thawed by immersing the Cryotop directly in a PBS melting solution containing 0.5 M sucrose and 20% FBS, and stored in melting solutions containing 0.5 M, 0.3 M, and 0.2 M sucrose for 5 minutes each. Afterwards, the blastocysts were cultured in a washing solution consisting of PBS containing 20% ​​FBS at room temperature for 5 minutes, and then cultured for 72 hours in an mSOFaa culture supplemented with 25 ng / ml 1α,25-Dihydroxyvitamin D3 (Sigma).

[0059] 1.2 Analysis of Fertilized Egg Development Efficiency

[0061] On days 3, 5, and 7 of culture after fertilization, the developmental stages of the fertilized eggs—including cleavage rate, 8-cell stage, morula stage, and blastocyst formation rate—were analyzed, and on day 8 of culture, the ratio of blastocysts to escaped blastocysts was analyzed. After vitrification, freezing, and thawing, the viability after 24 hours of culture and the ratio of escaped blastocysts after 72 hours were analyzed.

[0063] 1.3 Qualitative Analysis of Fertilized Eggs

[0065] 1.3.1 Apoptosis Analysis (TUNEL assay) and ROS Expression Measurement

[0067] Vitrified freeze-thawed blastocysts were washed with PBS and fixed in 4% paraformaldehyde solution at 4°C for 24 hours. After permeabilization with 0.5% Triton X-100, the cells were incubated with an in situ cell death detection kit (TMR red, Roche) at 38.5°C for 1 hour. Subsequently, the cells were fixed to slides using a Prolong antifade Kit (Molecular Probes) containing 10 μg / ml Hoechest 33342, and the total cell count and apoptotic cells were examined using a fluorescence microscope. ROS expression was measured by incubating with 1 μM Mito-SOX (Invitrogen™) at 38.5°C under 5% CO2 conditions for 30 minutes, followed by image acquisition using a fluorescence microscope. The captured images were analyzed using Image J software (http: / / rsbwebnih.gov / ij / ).

[0069] 1.3.2 Analysis of Gene Expression Patterns in Fertilized Eggs

[0071] cDNA was prepared from blastocysts of each treatment group using the FastLane Cell cDNA Kit (Qiagen, Valencia, USA). Real-Time RT-PCR was performed using the Rotor-Gene SYBR Green PCR Kit (Qiagen, USA) and the Real-Time PCR System (Life Technologies, USA). The primers used are summarized in Table 1. The amplification conditions for Real-Time RT-PCR involved 40 cycles of pre-incubation at 95°C for 1 minute, followed by denaturation at 95°C for 15 seconds, and annealing at 60°C for 1 minute. The expression levels of each gene were compared using the 2ΔΔCT method.

[0073] Primer set for Real Time RT-PCR. Gene Primer sequences (5' to 3') Product size (bps) References SOD 2 GTGAACAACCTCAACGTCGC 165 NM_201527.2 GGGTTCTCCACCACCGTTAG CLIC 1 GGCTCCTGAAAGCCCTGAAA 132 NM_001015608.1 CCAGAGTGAGCTCATTGCCA BCL2L CGTGGAAAGCGTAGACAAGGAG 133 AB238936 GTAGAGTTCCACAAAAGTGTC BAX GCAGAGGATGATCGCAGCTG 197 U92569 CCAATGTCCAGCCCATGATG 18S rRNA AAACGGCTACCACATCCAAGG 138 DQ066896 GCGGAAGGATTTAAAGTGGACTC

[0075] 1.4 Statistical Analysis

[0077] The significance of all results was examined using SPSS software (IBM, USA). The significance of growth rate results was examined using the chi-squared test, while the significance of gene expression, cell number, cell death, and ROS expression levels was examined using the independent samples t-test (P<0.05).

[0079] [Example 2] Results and Discussion

[0081] 2.1 Confirmation of the Effects of Vitamin D on the Development of Bovine In Vitro Fertilized Eggs

[0083] The study was conducted to examine the effect of vitamin D supplementation on the in vitro development of bovine in vitro fertilized eggs, and the results are shown in Table 2. When the cleavage rate of fertilized eggs was examined on the 2nd day after in vitro fertilization, the control group was 69.12±17.6% (197 / 285), and the treatment group ranged from 58.33±21.06% to 66.94±7.79%. Since there was no significant difference according to treatment, it was confirmed that vitamin D treatment had no effect on the early cleavage of fertilized eggs after fertilization. The morula and blastocyst development rates in the 50VD treatment group were 24.16±11.1% and 17.5±10.83%, respectively, which were significantly lower than those in the control group (42.45±13.13% and 34.73±13%) and the 25VD treatment group (36.77±10.97% and 33.88±10.74%) (p<0.05). Therefore, high levels of vitamin D supplementation were found to inhibit the development of in vitro fertilized eggs.

[0085]

[0086] 2.2 Effects of Vitamin D on the Viability and Development of Frozen-Thawed Blastocysts

[0088] The effects of vitamin D supplementation on the survival rate and hatching rate of freeze-thawed bovine in vitro fertilized eggs were examined (Table 3). When examining the survival rate of blastocysts at 24 hours after thawing, the control group showed 73.08% (57 / 78) and the 25VD group showed 82.89% (63 / 76). Since there was no significant difference between treatments, it was confirmed that vitamin D treatment had no effect on the survival rate after thawing. At 24 hours after thawing, the hatching rate in the 25VD group was 59.22%, which was significantly higher than that of the control group (41.03%) (p<0.05). Based on re-expanded blastocysts, 92% of the 25VD group hatched, while 82.45% of the control group hatched.

[0090]

[0091] 2.3 Effects of Vitamin D Supplementation on Cell Number and Cell Death in Bovine Blastocysts

[0093] To examine blastocyst cells undergoing apoptosis, TUNEL analysis was performed 48 hours after thawing and culture, and the total number of blastocyst cells was analyzed simultaneously (Figs. 1A, 1B, 1C, 1D). There was no difference in the total number of blastocyst cells. When the apoptotic cell index and mitochondrial peroxides were examined, both were found to be significantly lower in the 25VD treatment group compared to the control group (p<0.05). This indicates that vitamin D treatment inhibited blastocyst apoptosis by inducing the neutralization of mitochondrial peroxides.

[0095] 2.4 Effects of Vitamin D Supplementation on Gene Expression in Cryo-Thawed Blastodes

[0097] To investigate the relationship between vitamin D supplementation, ROS production, and cell death, the expression of relevant genes in freeze-thawed blastocysts was examined (Fig. 2). BCL2L, a cell death inhibitory gene, was found to be high in the 25VD group, while conversely, BAX, a cell death inducing gene, was expressed at a significantly lower level (p<0.05). Additionally, Chloride intracellular channel protein 1 (CLIC1), a ROS indicator gene, was expressed at a significantly higher level in the control group (p<0.05). In this invention, the expression of the SOD2 gene was found to be high in the control group. Superoxide dismutase (SOD) functions to neutralize produced ROS, and it has been reported that higher relative expression of SOD mRNA leads to higher quality mouse fertilized eggs. However, under conditions of relatively high ROS levels, SOD mRNA expression may also be high (Sakatani et al., 2012; Mishra et al., 2017). Therefore, rather than judging fertilized eggs based on SOD expression levels, they should be evaluated together with CLIC1, a ROS indicator gene. In the present invention, the low SOD2 gene expression in the 25VD treatment group is believed to be due to the relatively lower ROS generation caused by the treatment with vitamin D.

[0099] In this invention, the correlation between embryo development and vitamin D was analyzed using vitamin D in the production of in vitro fertilized eggs, and subsequently, the effect on the development of thawed eggs was examined after freeze-thawing. Unlike previous studies, the results of this study showed no effect of vitamin D treatment on the development of in vitro fertilized eggs. However, in thawed eggs cultured in a medium supplemented with 25 ng / ml vitamin D3 after vitrification freezing, the growth rate improved due to an increase in the expression of qualitative indicator genes and a decrease in cell death. Therefore, the embryo freeze-thaw system established in this study, along with embryo transfer technology, can be utilized as an effective means for the breeding and improvement of Hanwoo cattle.

Claims

Claim 1 A composition for increasing the efficiency of embryonic development of a bovine fertilized egg, comprising 1α,25-Dihydroxyvitamin D3, wherein the 1α,25-Dihydroxyvitamin D3 is included at a concentration of 25 ng / ml, and the bovine fertilized egg is thawed or thawed after being frozen or cryopreserved. Claim 2 In claim 1, the composition is a composition that increases the efficiency of embryonic development of bovine fertilized eggs, comprising 1α,25-Dihydroxyvitamin D3 in an mSOFaa culture medium. Claim 3 In claim 1, the composition that increases the efficiency of embryonic development of a bovine fertilized egg by reducing reactive oxygen species or apoptosis of the blastocyst during embryonic development of the bovine fertilized egg. Claim 4 A composition that increases the efficiency of embryonic development of a bovine fertilized egg, wherein, in claim 1, the embryonic development of the bovine fertilized egg is an increase in the hatching rate, the formation of a blastocyst, or the development of a blastocyst. Claim 5 delete Claim 6 In claim 1, the composition is a composition that increases the efficiency of embryonic development of a bovine fertilized egg by reducing the expression of CLIC1 and BAX. Claim 7 In claim 1, the composition is a composition that increases the efficiency of embryonic development of a bovine fertilized egg by increasing the expression of BCL2L. Claim 8 A method for increasing the efficiency of embryonic development of a bovine fertilized egg, wherein a bovine fertilized egg is cultured in vitro in a composition containing 1α,25-Dihydroxyvitamin D3, wherein the 1α,25-Dihydroxyvitamin D3 is contained at a concentration of 25 ng / ml, and the bovine fertilized egg is thawed or thawed after being frozen or cryopreserved. Claim 9 delete

Citation Information

Patent Citations

  • Embryo culture medium and embryo culture method

    JP2020028248A