A pharmaceutical composition for preventing or treating cancer
A pharmaceutical composition targeting GLS, PHGDH, SHMT, and MTHFD2 genes and proteins provides a low-toxicity solution for preventing and treating cancer, especially gastric cancer, by inhibiting cancer cell proliferation and metastasis.
Patent Information
- Authority / Receiving Office
- KR · KR
- Patent Type
- Patents
- Current Assignee / Owner
- IND ACADEMIC COOP FOUND YONSEI UNIV
- Filing Date
- 2025-03-14
- Publication Date
- 2026-07-21
AI Technical Summary
Current cancer treatments are toxic and lack selectivity, and there is a need for low-toxicity anticancer drugs that can prevent cancer occurrence and treat it effectively, particularly in cases of gastric cancer with frequent recurrence and metastasis, and drug resistance.
A pharmaceutical composition that inhibits the expression or function of the GLS, PHGDH, SHMT, and MTHFD2 genes or proteins using specific inhibitors, including compounds and agents like miRNA, siRNA, shRNA, antisense oligonucleotides, antibodies, and aptamers, combined with conventional anticancer agents.
The composition effectively inhibits cancer cell proliferation and kills cancer cells, particularly in EMT molecular subtype cancers, with potential for prevention and treatment of various types of cancer, including gastric cancer, by targeting key metabolic pathways.
Smart Images

Figure 112025029147385-PAT00023_ABST
Abstract
Description
Technology Field
[0001] The present invention relates to a pharmaceutical composition for the prevention or treatment of cancer. Background Technology
[0002] Cancer is one of the incurable diseases that humanity must solve, and massive capital is being invested worldwide in the development of a cure for it. In Korea, it is the number one cause of death from disease, with over 100,000 people diagnosed and over 60,000 people dying annually.
[0003] Carcinogens that trigger cancer include smoking, ultraviolet radiation, chemicals, food, and other environmental factors; however, the diverse nature of these causes makes the development of treatments difficult, and the effectiveness of such treatments varies depending on the site of occurrence. Currently used therapeutic agents possess significant toxicity and fail to selectively eliminate cancer cells; therefore, there is an urgent need to develop effective, low-toxicity anticancer drugs not only to treat cancer after it develops but also to prevent its occurrence. Although there has been rapid progress in cancer diagnosis and treatment over the past decade, the mortality rate from cancer remains high.
[0004] In particular, gastric cancer is one of the most common malignant tumors and is the third leading cause of cancer mortality worldwide. Despite significant progress in the treatment of gastric cancer patients, limitations in treatment still exist due to frequent recurrence and metastasis, as well as the presence of drug resistance.
[0005] Active research is being conducted on the mechanisms associated with cancer recurrence, metastasis, and drug resistance, among which the cancer stem cell hypothesis is receiving significant attention. According to studies, stem-like cells exist and are reported to contribute to tumor aggressiveness, metastasis, recurrence, and resistance to chemotherapy. Prior art literature
[0006] Curr Opin Chem Biol. 2021 Jun:62:64-81. The problem to be solved
[0007] One objective of the present invention is to provide a pharmaceutical composition for the prevention, improvement, or treatment of cancer.
[0008] Another objective of the present invention is to provide a method for providing information on a treatment method for patients with EMT (Epithelial mesenchymal transition) subtype cancer.
[0009] However, the technical problems that the present invention aims to solve are not limited to those mentioned above, and other unmentioned problems will be clearly understood by those skilled in the art from the description below. means of solving the problem
[0010] In one embodiment of the present invention, a pharmaceutical composition for the prevention or treatment of cancer is provided.
[0011] In one embodiment of the present invention, the pharmaceutical composition comprises, as an active ingredient, a preparation capable of inhibiting the expression of the GLS (Glutaminase) gene, or a pharmaceutically acceptable salt thereof; and a preparation capable of inhibiting the expression of any one gene selected from the group consisting of the PHGDH (Phosphoglycerate Dehydrogenase) gene, the SHMT (Serine hydroxymethyltransferase) gene, and the MTHFD2 gene (Methylenetetrahydrofolate Dehydrogenase (NADP+ Dependent) 2, Methenyltetrahydrofolate Cyclohydrolase).
[0012] In another embodiment of the present invention, the pharmaceutical composition comprises as an active ingredient a preparation capable of inhibiting the function of a protein encoded by the GLS gene, or a pharmaceutically acceptable salt thereof; and a preparation capable of inhibiting the function of a protein encoded by any one gene selected from the group consisting of the PHGDH gene, the SHMT gene, and the MTHFD2 gene, or a pharmaceutically acceptable salt thereof.
[0013] The "GLS gene" of the present invention is a gene encoding k-type mitochondrial glutaminase, which catalyzes the hydrolysis of glutamine into glutamate and ammonia. In particular, it has been reported that in the case of cancer cells, glutamine is degraded by overexpressing the GLS gene to obtain a large amount of energy source and a source necessary for fatty acid synthesis. For the purposes of the present invention, cancer patients may have characteristics such as having the GLS gene overexpressed and thus not proliferating or dying due to agents capable of inhibiting the expression of the GLS gene or the function of the protein encoded by it, but are not limited thereto.
[0014] The GLS gene of the present invention may consist of a nucleotide sequence represented by SEQ ID NO. 1 or SEQ ID NO. 2, but is not limited thereto.
[0015] The agent of the present invention capable of inhibiting the function of the protein encoded by the GLS gene may be a compound represented by the following chemical formula 1 (CAS No. 1439399-58-2) or chemical formula 2 (CAS No. 314045-39-1), but is not limited thereto:
[0016] [Chemical Formula 1]
[0017]
[0018] [Chemical Formula 2]
[0019]
[0020] The "PHGDH gene" of the present invention is a gene that encodes an enzyme involved in the initial stage of L-serine synthesis in animal cells.
[0021] The PHGDH gene of the present invention may consist of a nucleotide sequence represented by SEQ ID NO. 3, but is not limited thereto.
[0022] The "SHMT gene" of the present invention is a gene encoding an enzyme that catalyzes the reversible conversion of serine and tetrahydrofolate into glycine and 5,10-methylenetetrahydrofolate.
[0023] The SHMT gene of the present invention may consist of a nucleotide sequence represented by SEQ ID NO. 4, but is not limited thereto.
[0024] The "MTHFD2 gene" of the present invention is a gene encoding an enzyme having methylenetetrahydrofolate dehydrogenase and methenyltetrahydrofolate cyclohydrolase activity.
[0025] The MTHFD2 gene of the present invention may consist of a nucleotide sequence represented by SEQ ID NO. 5, but is not limited thereto.
[0026] The agent capable of inhibiting the function of the protein encoded by the PHGDH gene of the present invention may be a compound represented by the following chemical formula 3 (CAS No. 1916571-90-8), but is not limited thereto:
[0027] [Chemical Formula 3]
[0028]
[0029] The agent of the present invention capable of inhibiting the function of the protein encoded by the MTHFD2 gene may be a compound represented by the following chemical formula 4 (CAS No. 2227149-22-4), but is not limited thereto:
[0030] [Chemical Formula 4]
[0031]
[0032] The agent capable of inhibiting the function of the protein encoded by the SHMT gene of the present invention may be a compound represented by the following chemical formula 5 (CAS No. 2146095-85-2), but is not limited thereto:
[0033] [Chemical Formula 5]
[0034]
[0035] For the purposes of the present invention, the PHGDH, SHMT, and MTHFD2 genes and the proteins encoded thereby are expressed at increased levels in cancer patients along with the GLS gene and the proteins encoded thereby. Therefore, when administered in combination with a preparation capable of inhibiting the expression of the GLS gene or the function of the proteins encoded thereby, a significant synergistic effect can be achieved in inhibiting cancer cell proliferation and killing cancer cells in cancer patients.
[0036] The “pharmaceuticalally acceptable salt” of the present invention is a salt generally considered by those skilled in the art to be suitable for medical application (e.g., because such salt is not harmful to the subject to be treated with said salt), or a salt that causes acceptable side effects within each treatment. Generally, said pharmaceutically acceptable salt is a salt considered to be acceptable by regulatory authorities such as the U.S. Food and Drug Administration (FDA), the European Medicines Agency (EMA), or the Pharmaceuticals and Medical Devices Agency (PMDA) of the Japanese Ministry of Health, Labour and Welfare.
[0037] In each case of the pharmaceutical composition of the present invention, a person skilled in the art can easily determine whether a specific compound according to the present invention or its physiologically active derivative can form a salt, that is, whether a substance corresponding to the inhibitor according to the present invention or its physiologically active derivative has a group capable of carrying a charge, such as an amino group, a carboxylic acid group, etc.
[0038] Where the inhibitory agent of the present invention is a compound, exemplary salts of the compound are acid addition salts or salts with bases, in particular pharmaceutically acceptable inorganic and organic acid addition salts and salts with bases commonly used in pharmaceuticals, which are water-insoluble or particularly water-soluble acid addition salts. Depending on the substituents of the compound, salts with bases may also be suitable. Acid addition salts may be formed, for example, by mixing a solution of the compound of the present invention with a solution of a pharmaceutically acceptable acid such as hydrochloric acid, sulfuric acid, fumaric acid, maleic acid, succinic acid, acetic acid, benzoic acid, citric acid, tartaric acid, carbonic acid, or phosphoric acid. Likewise, pharmaceutically acceptable base addition salts are alkali metal salts (e.g., sodium or potassium salts); alkaline earth metal salts (e.g., calcium or magnesium salts); It may include salts formed with suitable organic ligands (e.g., ammonium, quaternary ammonium, and amine cations formed using counteranions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, alkyl sulfons, and aryl sulfons).Exemplary examples of pharmaceutically acceptable salts include acetate, adipate, alginate, arginate, ascorbate, aspartate, benzenesulfonate, benzoate, bicarbonate, bisulfate, bitartrate, borate, bromide, butyrate, calcium edetate, camphorate, camphosulfonate, camsylate, carbonate, chloride, citrate, digluconate, dihydrochloride, dodecyl sulfate, edetate, edicylate, ethanesulfonate, formate, fumarate, galactate, galacturonate, gluconate, glutamate, glycerophosphate, hemisulfate, heptanoate, hexanoate, hexylresorcinate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate. Hydroxynaphthoate, iodide, isobutyrate, isothionate, lactate, laurate, lauryl sulfate, maleate, maleate, malonate, mandelate, methanesulfonate (mesylate), methyl sulfate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pantothenate, pectinate, persulfate, 3-phenylpropionate, phosphate / diphosphate, phthalate, picrate, pivalate, polygalacturonate, propionate, salicylate, stearate, sulfate, subverate, succinate, tannate, tartrate, tosylate, undecanoate, valerate, etc. are included, but are not limited thereto.
[0039] The agent capable of suppressing the expression of the above genes according to the present invention may be any one selected from the group consisting of a compound; miRNA, siRNA, shRNA, and antisense oligonucleotides that specifically bind to the mRNA of the said genes, but is not limited thereto.
[0040] The agent capable of inhibiting the function of the protein of the present invention may be any one selected from the group consisting of compounds, inverse agonists, antagonists, and antibodies or aptamers capable of specifically binding to the proteins, but is not limited thereto.
[0041] The "inverse agonist" or "antagonist" of the present invention refers to a molecule capable of directly or indirectly reducing the biological activity of a receptor, and includes, but is not limited to, a molecule capable of reducing the action of said ligand when used together with said ligand of the receptor.
[0042] The "antibody" of the present invention refers to a proteinaceous molecule capable of specifically binding to an antigenic site of a protein or peptide molecule, and such an antibody can be produced by cloning each gene into an expression vector according to a conventional method to obtain a protein encoded by the marker gene, and then producing the obtained protein by a conventional method.
[0043] The "aptamer" of the present invention refers to a nucleic acid molecule having binding activity to a specific target molecule. The aptamer may be RNA, DNA, modified nucleic acid, or a mixture thereof, and may be in a linear or cyclic form. Generally, it is known that the shorter the sequence of nucleotides constituting the aptamer, the easier chemical synthesis and mass production are, the better the cost advantages are, the easier the chemical modification is, the better the in vivo stability is, and the lower the toxicity is.
[0044] The cancer of the present invention may be any one selected from the group consisting of gastric cancer, thyroid cancer, parathyroid cancer, ovarian cancer, colorectal cancer, pancreatic cancer, liver cancer, breast cancer, cervical cancer, lung cancer, non-small cell lung cancer, prostate cancer, gallbladder cancer, bile duct cancer, non-Hodgkin lymphoma, Hodgkin lymphoma, blood cancer, bladder cancer, kidney cancer, melanoma, colon cancer, bone cancer, skin cancer, head cancer, uterine cancer, rectal cancer, brain tumor, pro-anal cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal cancer, vulvar carcinoma, esophageal cancer, small intestine cancer, endocrine gland cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, ureteral cancer, renal cell carcinoma, renopelvic carcinoma, central nervous system (CNS) tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma and pituitary adenoma, and may be, for example, gastric cancer, but is not limited thereto.
[0045] The cancer of the present invention may be an intractable cancer with metastasis, recurrence, and drug resistance, but is not limited thereto.
[0046] The above-mentioned cancer of the present invention may be an EMT (Epithelial mesenchymal transition) subtype, but is not limited thereto.
[0047] The "EMT molecular subtype" of the present invention refers to a subtype in which a process of epithelial cells transforming into mesenchymal cells exists; it is a mutation process in which the epithelial cells lose their appearance and acquire the characteristics of mesenchymal cells, and is known to be an important process in organism formation and development, and signifies a molecular subtype in which cancer cell growth, drug resistance, invasion, and metastasis may occur.
[0048] The above composition of the present invention may further include an anticancer agent.
[0049] The anticancer agent of the present invention is nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, vandetanib, nirotinib, cemasanib, bosutinib, axitinib, cediranib, restaurtinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, sorafenib, bevacizumab, cisplatin, cetuximab, viscolumabum, asparaginase, tretinoin, hydroxycarbamide, dasatinib, estramustine, gemtuzumab ozogamicin, ibritumomab tussetane, heptaplatin, methylaminolevulinic acid, amsacrin, alemtuzumab, procarbazine, alprostadil, holmium nitrate chitosan, gemcitabine, doxifluridine, Pemetrexed, Tegafur, Capecitabine, Gimeracin, Oteracil, Azacitidine, Methotrexate, Uracil, Cytarabine, Fluorouracil, Fludagabine, Enositabine, Flutamide, Kepecitabine, Decitabine, Mercaptopurine, Thioguanine, Cladribine, Carmoper, Raltitrexed, Docetaxel, Paclitaxel, Irinotecan, Belotecan, Topotecan, Vinorelbine, Etoposide, Vincristine, Vinblastine, Tenifoside, Doxorubicin, Idarubicin, Epirubicin, Mithoxantrone, Mitomycin, Bleromycin, Daunorubicin, Dactinomycin, Pirarubicin, Aclarubicin, Pepromycin, Temsirolimus, Temozolomide, Busulfan, One or more selected from the group consisting of ifosfamide, cyclophosphamide, melphalan, altretmin, dacarbazine, thiotepa, nimustine, chlorambucil, mitolactol, leucovorin, tretonin, exemestane, aminoglutesimide, anagrelide, olaparib, nabelbine, padrazol, tamoxifen, toremifene, testolactone, anastrozole, letrozole, borozol, bicalutamide, lomustine, vorinostat, entinostet, phenformin, metformin, talazoparib, and carmustine may be used, but are not limited thereto.
[0050] In the present invention, the term "prevention" refers to any act of suppressing or delaying the onset of a disease or pathology. For the purposes of the present invention, the composition refers to delaying the onset of cancer, particularly EMT molecular subtype cancer, or suppressing its onset.
[0051] The term "treatment" in the present invention refers to any act of delaying, stopping, or reversing the progression of a disease or pathology, and for the purposes of the present invention, the composition means stopping, alleviating, mitigating, eliminating, or reversing the progression of cancer, particularly EMT molecular subtype cancer.
[0052] The pharmaceutical composition of the present invention may be characterized in that it is in the form of a capsule, tablet, granule, injection, ointment, powder, or beverage, and the pharmaceutical composition may be characterized in that it is intended for humans.
[0053] The pharmaceutical composition of the present invention is not limited to these, but may be formulated and used in the form of oral formulations such as powders, granules, capsules, tablets, and aqueous suspensions, as well as topical preparations, suppositories, and sterile injectable solutions, according to conventional methods. The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. For oral administration, the pharmaceutically acceptable carrier may use a binder, lubricant, disintegrant, excipient, solubilizer, dispersant, stabilizer, suspending agent, colorant, flavoring agent, etc.; for injectable preparations, it may use a mixture of a buffer, preservative, analgesic, solubilizer, isotonic agent, stabilizer, etc.; and for topical administration, a base, excipient, lubricant, preservative, etc.
[0054] The formulations of the pharmaceutical composition of the present invention can be prepared in various ways by mixing with pharmaceutically acceptable carriers as described above. For example, for oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and for injectables, it can be prepared in the form of unit dosing ampoules or multiple dosing ampoules. In addition, it can be formulated into solutions, suspensions, tablets, capsules, sustained-release formulations, etc.
[0055] Examples of carriers, excipients, and diluents suitable for the formulation of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or mineral oil. Additionally, fillers, anticoagulants, lubricants, wetting agents, fragrances, emulsifiers, preservatives, etc. may be further included.
[0056] The routes of administration of the pharmaceutical composition of the present invention include, but are not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intradural, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, local, sublingual, or rectal. Oral or parenteral administration is preferred. In the present invention, "parenteral" includes subcutaneous, intradermal, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intradural, intralesional, and intracranial injection or infusion techniques. Additionally, the pharmaceutical composition may be administered in the form of a suppository for rectal administration.
[0057] The pharmaceutical composition of the present invention may vary depending on several factors including the activity of the specific compound used, age, body weight, general health, gender, diet, time of administration, route of administration, elimination rate, drug combination, and the severity of the specific disease to be prevented or treated, and the dosage of the pharmaceutical composition may be appropriately selected by a person skilled in the art, depending on the patient's condition, body weight, degree of disease, form of medication, route of administration, and duration, and may be administered at a dose of 0.0001 to 50 mg / kg or 0.001 to 50 mg / kg per day. Administration may be administered once a day or divided into several doses. The dosage does not limit the scope of the present invention in any way. The pharmaceutical composition according to the present invention may be formulated as a pill, coated tablet, capsule, liquid, gel, syrup, slurry, or suspension.
[0059] In another embodiment of the present invention, a method is provided for providing information on a treatment method for a cancer patient with an EMT molecular subtype.
[0060] The method of the present invention comprises: a step of measuring the expression level of a GLS gene or a protein encoded by it in a biological sample isolated from a target individual; and a step of determining, when the measured expression level of the gene or protein is increased, to administer in combination a preparation capable of inhibiting the expression of the following gene; or a preparation capable of inhibiting the function of a protein encoded by the following gene:
[0061] Phosphoglycerate Dehydrogenase (PHGDH) gene,
[0062] SHMT (Serine hydroxymethyltransferase) gene, and
[0063] MTHFD2 gene (Methylenetetrahydrofolate Dehydrogenase (NADP+ Dependent) 2, Methenyltetrahydrofolate Cyclohydrolase)
[0064] In the present invention, the term "target individual" refers to an individual whose therapeutic responsiveness to a preparation capable of inhibiting GLS gene expression or a preparation capable of inhibiting the function of a protein encoded by the same is uncertain, and who has developed cancer or has a high probability of developing cancer.
[0065] The "biological sample" of the present invention means any substance, biological body fluid, tissue, or cell obtained from or derived from an individual, and includes, for example, blood (including whole blood, leukocytes, peripheral blood mononuclear cells, buffy coat, plasma, and serum), sputum, tears, mucus, nasal washes, nasal aspirate, breath, urine, semen, saliva, peritoneal washings, pelvic fluids, cystic fluid, meningeal fluid, amniotic fluid, glandular fluid, pancreatic fluid, lymph fluid, pleural fluid, and nipple aspirate. It may include, but is not limited to, aspirate, bronchial aspirate, synovial fluid, joint aspirate, organ secretions, cell, cell extract, or cerebrospinal fluid.
[0066] The method for measuring the expression level of the protein according to the present invention may be at least one selected from the group consisting of protein chip analysis, immunoassay, ligand binding assay, MALDI-TOF (Matrix Assisted Laser Desorption / Ionization Time of Flight Mass Spectrometry) analysis, SELDI-TOF (Sulface Enhanced Laser Desorption / Ionization Time of Flight Mass Spectrometry) analysis, radioimmunoassay, radioimmunodiffusion, Ouchteroni immunodiffusion, Rocket immunoelectrophoresis, tissue immunostaining, complement fixation assay, two-dimensional electrophoresis analysis, liquid chromatography-mass spectrometry (LC-MS), LC-MS / MS (liquid chromatography-mass spectrometry / mass spectrometry), Western blotting, and ELISA (enzyme-linked immunosorbent assay).
[0067] The expression level of the protein of the present invention can be measured using a preparation capable of measuring the expression level of the protein. The preparation capable of measuring the expression level of the protein may be at least one selected from the group consisting of antibodies, oligopeptides, ligands, PNA (Peptide nucleic acid), and aptamers that specifically bind to the protein.
[0068] The "antibody" of the present invention refers to a substance that specifically binds to an antigen and causes an antigen-antibody reaction. For the purposes of the present invention, an antibody means an antibody that specifically binds to the said protein. The antibodies of the present invention include polyclonal antibodies, monoclonal antibodies, and recombinant antibodies. The said antibodies can be easily manufactured using techniques widely known in the art. For example, a polyclonal antibody can be produced by a method widely known in the art that includes the process of injecting an antigen of the said protein into an animal and collecting blood from the animal to obtain serum containing the antibody. Such a polyclonal antibody can be produced from any animal, such as a goat, rabbit, sheep, monkey, horse, pig, cattle, or dog. In addition, monoclonal antibodies may be prepared using the hybridoma method (see Kohler and Milstein (1976) European Journal of Immunology 6:511-519), which is widely known in the art, or phage antibody library technology (see Clackson et al, Nature, 352:624-628, 1991; Marks et al, J. Mol. Biol., 222:58, 1-597, 1991). Antibodies prepared by the above methods may be separated and purified using methods such as gel electrophoresis, dialysis, salt precipitation, ion exchange chromatography, and affinity chromatography. Furthermore, the antibody of the present invention comprises not only a complete form having two full-length light chains and two full-length heavy chains, but also functional fragments of the antibody.
[0069] The functional fragment of the antibody of the present invention refers to a fragment possessing at least an antigen-binding function, and includes Fab, F(ab'), F(ab')2, and Fv, etc.
[0070] In the present invention, the "PNA (Peptide Nucleic Acid)" refers to an artificially synthesized polymer similar to DNA or RNA, which was first introduced in 1991 by Professors Nielsen, Egholm, Berg, and Buchardt of the University of Copenhagen, Denmark. While DNA has a phosphate-ribose sugar backbone, PNA has a repeating N-(2-aminoethyl)-glycine backbone connected by peptide bonds, which significantly increases its binding affinity and stability to DNA or RNA, and is therefore used in molecular biology, diagnostic analysis, and antisense therapy.
[0071] The "aptamer" of the present invention refers to an oligonucleotide or peptide molecule.
[0072] The preparation capable of measuring the expression level of the protein of the present invention can be easily prepared by a person skilled in the art based on the amino acid sequences constituting the proteins of the present invention, such as antibodies, PNAs, and aptamers that specifically bind to the protein.
[0073] The method for measuring the expression level of the gene according to the present invention may be at least one selected from the group consisting of reverse transcription polymerase chain reaction (RT-PCR), competitive reverse transcription polymerase chain reaction (Competitive RT-PCR), real-time reverse transcription polymerase chain reaction (Real-time RT-PCR), RNase protection assay (RPA), Northern blotting, and DNA chips.
[0074] The expression level of the gene of the present invention can be measured using a preparation capable of measuring the expression level of the gene. The preparation capable of measuring the expression level of the gene may be at least one selected from the group consisting of a primer, a probe, and an antisense nucleotide that binds complementarily to the gene.
[0075] The "primer" of the present invention is a fragment that recognizes a target gene sequence and comprises a forward and a reverse primer pair, but preferably is a primer pair that provides analysis results having specificity and sensitivity. High specificity can be conferred when the nucleic acid sequence of the primer is a sequence that is inconsistent with the non-target sequence present in the sample, so that it amplifies only the target gene sequence containing the complementary primer binding site and does not induce non-specific amplification.
[0076] The term "probe" in the present invention refers to a substance capable of binding complementarily to a target substance to be detected within a sample, and means a substance capable of specifically confirming the presence of the target substance within the sample through said binding. The type of probe is not limited to substances commonly used in the art, but preferably may be PNA (peptide nucleic acid), LNA (locked nucleic acid), peptide, polypeptide, protein, RNA, or DNA, and most preferably PNA. More specifically, the probe may be a biomaterial derived from an organism or similar, or manufactured in vitro, and may be, for example, enzymes, proteins, antibodies, microorganisms, animal and plant cells and organs, nerve cells, DNA, and RNA; DNA includes cDNA, genomic DNA, and oligonucleotides, and RNA includes genomic RNA, mRNA, and oligonucleotides.
[0077] The "LNA (Locked nucleic acids)" of the present invention refers to nucleic acid analogs containing a 2'-O, 4'-C methylene bridge [J Weiler, J Hunziker and J Hall Gene Therapy (2006) 13, 496.502]. LNA nucleosides contain common nucleic acid bases of DNA and RNA and can form base pairs according to the Watson-Crick base pairing rule. However, due to the 'locking' of the molecule caused by the methylene bridge, LNAs are unable to form an ideal shape in Watson-Crick bonds. When LNAs are included in DNA or RNA oligonucleotides, LNAs can pair more quickly with complementary nucleotide chains, thereby increasing the stability of the double helix.
[0078] The "antisense nucleotide" of the present invention refers to an oligomer having a backbone between nucleotide base sequences and subunits, wherein the antisense oligomer hybridizes with a target sequence within RNA by Watson-Crick base pairing, thereby allowing the formation of a mRNA and RNA:oligomer heterodimer within the target sequence. The oligomer may have exact sequence complementarity or approximate complementarity with respect to the target sequence.
[0079] The preparation capable of measuring the expression level of the above-mentioned gene according to the present invention can be easily prepared by a person skilled in the art based on the nucleotide sequences of the above-mentioned genes, such as primers, probes, etc. that bind complementarily to the said gene.
[0080] [Ranking List]
[0081] Sequence No. 1: GLS
[0082] ATGATCGGCTGCGAGGCTCGGGGATGCTGCGGGACCTGCTCCTGCGGTCGCCCGCCGGCGTGAGCGCGA
[0083] CTCTGCGGCGGGCACAGCCCTTGGTCACCCTGTGCCGGCGTCCCCGAGGCGGGGGACGGCCGGCCGCGGG
[0084] CCCGGCTGCCGCCGCGCGACTCCACCCGTGGTGGGGCGGGGGCGGCTGGCCGGCGGAGCCCCTCGCGCGG
[0085] GGCCTGTCCAGCTCTCCTTCGGAGATCTTGCAGGAGCTGGGCAAGGGGAGCACGCATCCGCAGCCCGGGG
[0086] TGTCGCCACCCGCTGCCCCGGCGGCGCCCGGCCCCAAGGACGGCCCCGGGGAGACGGACGCGTTTGGCAA
[0087] CAGCGAGGGCAAAGAGCTGGTGGCCTCAGGTGAAAATAAAATAAAACAGGGTCTGTTACCTAGCTTGGAA
[0088] GATTTGCTGTTCTATACAATTGCTGAAGGACAAGAGAAAATACCTGTTCATAAATTTATTACAGCACTCA
[0089] AATCTACAGGATTGCGAACGTCTGATCCCAGGTTGAAAGAGTGTATGGATATGTTAAGATTAACTCTTCA
[0090] AACAACATCAGATGGTGTCATGCTAGACAAAGATCTTTTTAAAAAATGTGTTCAGAGCAACATTGTTTTG
[0091] TTGACACAAGCATTTAGAAGAAAGTTTGTGATTCCTGACTTTATGTCTTTTACCTCACACATTGATGAGT
[0092] TATATGAAAGTGCTAAAAAGCAGTCTGGAGGAAAGGTTGCAGATTATATTCCTCAACTGGCCAAATTCAG
[0093] TCCCGATTTGTGGGGTGTGTCTGTTTGTACAGTAGATGGACAGAGGCATTCTACTGGAGATACCAAAGTT
[0094] CCCTTCTGTCTTCAGTCCTGTGTAAAACCTTTGAAAATATGCCATTGCTGTTAATGATCTTGGAACTGAAT
[0095] ATGTGCATCGATATGTTGGAAAAGAGCCGAGTGGACTAAGATTCAACAAAACTATTTTTGAATGAAGATGA
[0096] TAAACCACATAATCCTATGGTAAATGCTGGAGCAATTGTTGTGACTTCACTAATAAAGCAAGGAGTAAAT
[0097] AATGCTGAAAAATTTGACTATGTCATGCAGTTTTTGAATAAGATGGCTGGTGAATGAATATGTTGGATTCA
[0098] GTAATGCAACGTTTCAGTCTGAAAGAGAAAGTGGAGATCGAAATTTTGCAATAGGATATTACTTAAAAGA
[0099] AAAGAAGTGTTTTCCAGAAGGCACAGACATGGTTGGTATATTAGACTTCTACTTCCAGCTGTGCTCCATT
[0100] GAAGTGACTTGTGAATCAGCCAGTGTGATGGCTGCGACACTGGCTAATGGTGGTTTCTGCCCAATTACTG
[0101] GTGAAAGAGTACTGAGCCCTGAAGCAGTTCGAAATACATTGAGTTTGATGCATTCCTGTGGCATGTATGA
[0102] CTTCTCAGGGCAGTTTGCTTTCCATGTTGGTCTTCCTGCAAAATCTGGAGTTGCTGGGGGCATTCTTTTA
[0103] GTTGTCCCCAATGTTATGGGTATGATGTGCTGGTCTCCTCCTCTGGATAAGATGGGCAACAGTGTTAAGG
[0104] GAATTCACTTTTGTCACGATCTTGTTTCTCTGTGTAATTTCCATAACTATGATAATTTGAGACACTTTGC
[0105] AAAAAAACTTGATCCTCGAAGAGAAGGTGGTGATCAAAGGGTAAAGTCAGTGATAAATCTTTTGTTTGCT
[0106] GCATATACTGGAGATGTGTCTGCACTTCGAAGATTTGCTTTGTCAGCTATGGACATGGAACAGCGGGACT
[0107] ATGATTCTAGAACAGCACTCCATGTAGCTGCTGCAGAGGGTCATGTTGAAGTTGTTAAATTTTTGCTGGA
[0108] AGCCTGCAAAGTAAACCCTTTCCCCAAGGACAGGTGGAATAACACTCCCATGGATGAAGCACTGCACTTT
[0109] GGACACCATGATGTATTTAAAATTCTCCAAGAATACCAAGTCCAGTACACACCTCAAGGAGATTCTGACA
[0110] ACGGGAAGGAAAATCAAACCGTCCATAAGAATCTTGATGGATTGTTGTAA
[0111] 서열번호 2: GLS
[0112] ATGATGCGGCTGCGAGGCTCGGGGATGCTGCGGGACCTGCTCCTGCGGTCGCCCGCCGGCGTGAGCGCGA
[0113] CTCTGCGGCGGGCACAGCCCTTGGTCACCCTGTGCCGGCGTCCCCGAGGCGGGGGACGGCCGGCCGCGGG
[0114] CCCGGCTGCCGCCGCGCGACTCCACCCGTGGTGGGGCGGGGGCGGCTGGCCGGCGGAGCCCCTCGCGCGG
[0115] GGCCTGTCCAGCTCTCCTTCGGAGATCTTGCAGGAGCTGGGCAAGGGGAGCACGCATCCGCAGCCCGGGG
[0116] TGTCGCCACCCGCTGCCCCGGCGGCGCCCGGCCCCAAGGACGGCCCCGGGGAGACGGACGCGTTTGGCAA
[0117] CAGCGAGGGCAAAGAGCTGGTGGCCTCAGGTGAAAATAAAATAAAACAGGGTCTGTTACCTAGCTTGGAA
[0118] GATTTGCTGTTCTATACAATTGCTGAAGGACAAGAGAAAATACCTGTTCATAAATTTATTACAGCACTCA
[0119] AATCTACAGGATTGCGAACGTCTGATCCCAGGTTGAAAGAGTGTATGGATATGTTAAGATTAACTCTTCA
[0120] AACAACATCAGATGGTGTCATGCTAGACAAAGATCTTTTTAAAAAATGTGTTCAGAGCAACATTGTTTTG
[0121] TTGACACAAGCATTTAGAAGAAAGTTTGTGATTCCTGACTTTATGTCTTTTACCTCACACATTGATGAGT
[0122] TATATGAAAGTGCTAAAAAGCAGTCTGGAGGAAAGGTTGCAGATTATATTCCTCAACTGGCCAAATTCAG
[0123] TCCCGATTTGTGGGGTGTGTCTGTTTGTACAGTAGATGGACAGAGGCATTCTACTGGAGATACCAAAGTT
[0124] CCCTTCTGTCTTCAGTCCTGTGTAAAACCTTTGAAAATATGCCATTGCTGTTAATGATCTTGGAACTGAAT
[0125] ATGTGCATCGATATGTTGGAAAAGAGCCGAGTGGACTAAGATTCAACAAAACTATTTTTGAATGAAGATGA
[0126] TAAACCACATAATCCTATGGTAAATGCTGGAGCAATTGTTGTGACTTCACTAATAAAGCAAGGAGTAAAT
[0127] AATGCTGAAAAATTTGACTATGTCATGCAGTTTTTGAATAAGATGGCTGGTGAATGAATATGTTGGATTCA
[0128] GTAATGCAACGTTTCAGTCTGAAAGAGAAAGTGGAGATCGAAATTTTGCAATAGGATATTACTTAAAAGA
[0129] AAAGAAGTGTTTTCCAGAAGGCACAGACATGGTTGGTATATTAGACTTCTACTTCCAGCTGTGCTCCATT
[0130] GAAGTGACTTGTGAATCAGCCAGTGTGATGGCTGCGACACTGGCTAATGGTGGTTTCTGCCCAATTACTG
[0131] GTGAAAGAGTACTGAGCCCTGAAGCAGTTCGAAATACATTGAGTTTGATGCATTCCTGTGGCATGTATGA
[0132] CTTCTCAGGGCAGTTTGCTTTCCATGTTGGTCTTCCTGCAAAATCTGGAGTTGCTGGGGGCATTCTTTTA
[0133] GTGTCCCCAATGTTATGGGTATGATGTGCTGGTCTCCTCCTCTGGATAAGATGGGCAACAGTGTTAAGG
[0134] GAATTCACTTTTGTCACGATCTTGTTTCTCTGTGTAATTTCCATAACTATGATAATTTGAGACACTTTGC
[0135] AAAAAAACTTGATCCTCGAAGGAAGGTGGTGATCAAAGGCATTCCTTTGGACCATTGGACTATGAAAGT
[0136] CTCCAACAAGAACTTGCTTTAAAAGAGACAGTATGGAAAAAAGTGTCACCTGAGTCAAATGAGGACATCT
[0137] CTACAACTGTAGTATATAGAATGGAAAGTCTGGGAGAGAAAAGCTAA
[0138] sökðiboldeh 3: PHGDH
[0139] atgg ctttgcaaa tctgcggaaa gtgctcatca gtgacagcct ggacccttgc tgccggaaa tcttgcaaga tggagggctg caggtggtgg aaaagcagaa ccttagcaaa gaggagctga tagcggagct gcagactgt gaaggcctta ttgttcgctc tgccaccaag gtgaccgctg atgtcatcaa cgcagctgag aaactccagg tggtgggcag ggctggcaca ggtgtggaca atgtggatct ggaggccgca acaaggaagg gcatcttggt tatgaacacc cccaatggga acagcctcag tgccgcagaa ctcacttgtg gaatgatcat gtgcctggcc aggcagattc cccaggcgac ggcttcgatg aaagggagcgac aagcggca aatgggagcg ggaagttc atgggaacag agctgaatgg aaagaccctg ggaattcttg gcctgggcag gattgggaga gaggtagcta cccggatgca gtcctttggg atgaagcta tagggtatga ccccatcatt tccccagagg tctcggctc ctttggtgtt cagcagctgc ccctggagga gatctggcct ctctgtgatt tcatcactgt gcacactcct ctcctgccct ccacgacagg cttgctgaat gacaacacct ttgcccagtg caagaagggg gtgcgtgtgg tgaactgtgc ccgtggaggg atcgtggacg aaggcgccct gctccgggcc ctgcagtctg gccagtgtgc cggggctgca ctggacgtgt ttacggagaa gccgccacgg gaccgggcct tggtggacca tgagaatgtc atcagctgtc cccacctgg tgccagcacc aaggggctc agagccgctg tggggaggaa attgctgttcagttcgtgga catggtgaag gggaaatctc tcacgggggt tgtgaatgcc caggccctta ccagtgcctt ctctccacac accaagcctt ggattggtct ggcagaagct ctggggacac tgatgcgagc ctgggctggg tcccccaaag ggaccatcca ggtgataaca cagggaacat ccctgaagaa tgctgggaac tgcctaagcc ccgcagtcat tgtcggcctc ctgaaagagg cttccaagca ggcggatgtg aacttggtga acgctaagct gctggtgaaa gaggctggcc tcaatgtcac cacctcccac agccctgctg caccagggga gcaaggcttc ggggaatgcc tcctggccgt ggccctggca ggcgcccctt accaggctgt gggcttggtc caaggcacta cacctgtact gcaggggctc aatggagctg tcttcaggcc agaagtgcct ctccgcaggg acctgcccct gctcctattc cggactcaga cctctgaccc tgcaatgctg cctaccatga ttggcctcct ggcagaggca ggcgtgcggc tgctgtccta ccagacttca ctggtgtcag atggggagac ctggcacgtc atgggcatct cctccttgct gcccagcctg gaagcgtgga agcagcatgt gactgaagcc ttccagttcc acttctaa
[0140] 서열번호 4: SHMT2
[0141] atgctgtactt ctctttgttt tgggcggctc ggcctctgca gagatgtggg cagctggtca ggatggccat tcgggctcag cacagcaacg cagcccagac tcagactggg gaagcaaaca ggggctggac aggccaggag agcctgtcgg acagtgatcc tgagatgtgg gagttgctgc agagggagaa ggacaggcag tgtcgtggcc tggagctcat tgcctcagag aacttctgca gccgagctgc gctggaggcc ctggggtcct gtctgaacaa caagtactcg gagggttatc ctggcaagag atactatggg ggagcagagg tggtggatga aattgagctg ctgtgccagc gccgggcctt ggaagccttt gacctggatc ctgcacagtg gggagtcaat gtccagccct actccgggtc cccagccaac ctggccgtct acacagccct tctgcaacct cacgaccgga tcatggggct ggacctgccc gatgggggcc atctcaccca cggctacatg tctgacgtca agcggatatc agccacgtcc atcttcttcg agtctatgcc ctataagctc aacctggcac tgactgctcg acttttccgg ccacggctca tcatagctgg caccagcgcc tatgctcgcc tcattgacta cgcccgcatg agagaggtgt gtgatgaagt caaagcacac ctgctggcag acatggccca catcagtggc ctggtggctg ccaaggtgat tccctcgcct ttcaagcacg cggacatcgt caccaccact actcacaaga ctcttcgagg ggccaggtca gggctcatct tctaccggaa aggggtgaag gctgtggacc ccaagactgg ccgggagatc ccttacacatttgaggaccg aatcaacttt gccgtgttcc catccctgca ggggggcccc cacaatcatg ccattgctgc agtagctgtg gccctaaagc aggcctgcac ccccatgttc cgggagtact ccctgcaggt tctgaagaat gctcgggcca tggcagatgc cctcgcctcgctc aggtggtact gacaaccacc tggtgctggt ggacctgcgg cccaagggcc tggatggagc tcgggctgag cgggtgctag agcttgtac catcactgcc aacaagaaca cctgtcctgg agaccgaagt gccatcacac cgggcggcct gcggctggg gaggatgact tccggagagt tgtggacttt atagatgaag gggtcaacat tggcttagag gtgaagagca agactgccaa gctccaggat ttcaaatcct tcctgcttaa ggactcagaa acaagtcagc gtctggccaa cctcaggcaa cgggtggagc agttttgccag gcccccc ttgagctt
[0142] 서열번호 5: MTHFD2
[0143] ATGGCTGCGACTTCTCTAATGTCTGCTTTGGCTGCCCGGCTGCTGCAGCCCGCGCACAGCTGCTCCCTTC
[0144] GCCTTCGCCCTTTCCACCTCGCGGCAGTTCGAAATGAAGCTGTTGTCATTTCTGGAAGGAAACTGGCCCA
[0145] GCAGATCAAGCAGGAAGTGCGGCAGGAGGTAGAAGAGTGGGTGGCCTCAGGCAACAAACGGCCACACCTG
[0146] AGTGTGATCCTGGTTGGCGAGAATCCTGCAAGTCACTCCTATGTCCTCAACAAAACCAGGGCAGCTGCAG
[0147] TTGTGGGAATCAACAGTGAGACAATTATGAAACCAGCTTCAATTTCAGAGGAAGAATTGTTGAATTTAAT
[0148] CAATAAACTGAATAATGATGATAATGTAGATGGCCTCCTTGTTCAGTTGCCTCTTCCAGAGCATATTGAT
[0149] GAGAGAAGGATCTGCAATGCTGTTTCTCCAGACAAGGATGTTGATGGCTTTCATGTAATTAATGTAGGAC
[0150] GAATGTGTTTGGATCAGTATTCCATGTTACCGGCTACTCCATGGGGTGTGTGGGAAATAATCAAGCGAAC
[0151] TGGCATTCCAACCCTAGGGAAGAATGTGGTTGTGGCTGGAAGGTCAAAAAACGTTGGAATGCCCATTGCA
[0152] ATGTTACTGCACACAGATGGGGCGCATGAACGTCCCGGAGGTGATGCCACTGTTACAATATCTCATCGAT
[0153] ATACTCCCAAAGAGCAGTTGAAGAAACATACAATTCTTGCAGATATTGTAATATCTGCTGCAGGTATTCC
[0154] AAATCTGATCACAGCAGATATGATCAAGGAAGGAGCAGCAGTCATTGATGTGGGAATAAATAGAGTTCAC
[0155] GATCCTGTAACTGCCAAACCCAAGTTGGTTGGAGATGTGGATTTTGAAGGAGTCAGACAAAAAGCTGGGT
[0156] ATATCACTCCAGTTCCTGGAGGTGTTGGCCCCATGACAGTGGCAATGCTAATGAAGAATACCATTATTGC
[0157] TGCAAAAAGGTGCTGAGGCTTGAAGAGCGAGAAGTGCTGAAGTCTAAAGAGCTTGGGGTAGCCACTAAT
[0158] TAA Effects of the invention
[0159] The present invention relates to a method for the prevention, improvement, or treatment of cancer patients, particularly patients with EMT (Epithelial mesenchymal transition) subtype cancer. In cancer patients in whom the expression level of the GLS (Glutaminase) gene or the protein encoded by it is increased, when PHGDH, SHMT, and MTHFD2 inhibitors are administered in combination, 1C metabolism is more effectively inhibited, and there is a synergistic effect in inhibiting the proliferation of cancer cells in patients with intractable cancer that is difficult to treat due to recurrence, metastasis, and resistance to anticancer drugs, thereby enabling very effective treatment of cancer.
[0160] Furthermore, by measuring the expression levels of the GLS gene or the protein encoded by it, information regarding personalized treatment methods can be provided to individual patients from the early stages, thereby increasing the success rate of treatment. Brief explanation of the drawing
[0161] Figure 1 shows the results of gastric transcriptome analysis performed on Yonsei cohort gastric cancer patients according to one embodiment of the present invention. Figure 2 shows the results of confirming the expression levels of proteins encoded by the GLS (Glutaminase) gene in intestinal subtype cell lines (NCIN87 and SNU601) and stem-like subtype cell lines (MKN1 and HS746T) according to one embodiment of the present invention through Western blot analysis. Figure 3 shows the results of genomic analysis performed on an intestinal subtype organoid (GA326) and a stem-like subtype organoid (GA077) according to one embodiment of the present invention. FIGS. 4 to 7 show the results of confirming the proliferation level of a cell line according to the presence or absence of glutamine (Fig. 4) and the concentration of DON, a glutamine analog, according to one embodiment of the present invention (Fig. 5), and the results of confirming the proliferation level of a cell line according to the concentrations of GLS inhibitors CB839 (Fig. 6) and BPTES (Fig. 7). Figure 8 shows the results of confirming the size change of stem-like subtype organoids by treatment with CB839 alone, a GLS inhibitor according to one embodiment of the present invention. FIGS. 9 to 11 show the results of confirming the proliferation levels of stem-like subtype cell lines in the presence or absence of glutamine and combined treatment with PHGD (Fig. 9), SHMT (Fig. 10), or MTFHD2 (Fig. 11) inhibitors according to one embodiment of the present invention. Figure 12 shows the results of confirming the size change of stem-like subtype organoids by combined treatment with a GLS inhibitor (CB839) and NCT504 according to one embodiment of the present invention. Specific details for implementing the invention
[0162] The present invention will be explained in detail below through the following examples. However, the following examples are merely illustrative of the present invention, and the scope of the present invention is not limited by the following examples.
[0163] Examples
[0164] [Example 1] Stomach transcriptome analysis
[0165] Fresh frozen tumor tissues were obtained from gastric cancer patients who underwent curative intent gastrectomy at the Yonsei Cancer Center, and gastric transcriptome analysis data was obtained through a process of matching clinical data. All experiments in this study were conducted with the approval of the Institutional Review Board (IRB) of Yonsei University College of Medicine, and the samples were collected after obtaining written consent from the patients. Gastric cancer patients were classified into five subtypes (gastric, inflammatory, intestinal, mixed, and stem-like (refractory, stem-like, EMT molecular subtype) according to a clinically validated classification system, and genes related to glycolysis and glutaminolysis were analyzed using a heatmap according to conventional methods, and the results are shown in Figure 1.
[0166] As shown in Figure 1, transcriptome analysis was performed on Yonsei cohort gastric cancer patients, and as seen in the heatmap, it was confirmed that the expression level of the GLS (Glutaminase) gene was increased, particularly in patients classified as stem-like subtypes (EMT molecular subtypes) among the gastric cancer subtypes.
[0168] [Example 2] Confirmation of GLS gene and protein expression levels in gastric cancer cell lines
[0169] To confirm the expression levels of GLS genes and proteins, NCIN87, SNU601, MKN1, and HS746T cell lines were purchased from the Korean Cell Line Bank. Here, NCIN87 and SNU601 cell lines represent the intestinal subtype, while MKN1 and HS746T cell lines represent the stem-like subtype. The purchased cell lines were cultured in RPMI1640 (containing 10% fetal bovine serum (FBS), 2 mM L-glutamine, 100 U / ml penicillin, and 100 µg / ml streptomycin) or DMEM (containing 10% FBS, 2 mM L-glutamine, 100 U / ml penicillin, and 100 µg / ml streptomycin) in a 37°C, 5% CO2 incubator. At this time, all of the above cell lines were used in the experiment after confirming that they were not contaminated with mycoplasma following a microplasma contamination test. EBC200 (200 mM NaCl, 50 mM Tris-HCl (pH 8.0), 0.5% NP-40) containing a protease inhibitor mixture (genedepot) was added to each cultured cell line, and the cell lysis process was performed. Then, proteins were isolated from the lysed cells, the amount of protein was quantified using the BCA assay method (Pierce), an equal amount of protein was loaded onto an SDS-PAGE and electrophoresis was performed, and the SDS-PAGE was transferred to a PVDF membrane (Biorad). 5% skim milk (BD difco) was added to the membrane after the transfer was completed, and a blocking process was performed at room temperature for one hour. Subsequently, an antibody (abcam) that specifically binds to GLS protein diluted 1:2000 and β-actin diluted 1:5000 were added, and the sample was incubated at 4°C for one day. Afterward, a secondary antibody diluted in 5% skim milk was added and incubated for one hour. Then, the protein expression level was checked using a LAS 4000 mini (Fujifilm), and the results are shown in Figure 2.
[0170] As shown in Figure 2, it was confirmed that the expression level of the protein encoded by the GLS gene was significantly increased in the MKN1 and HS746T cell lines, which correspond to the stem-like subtype, compared to the NCI N87 and SNU601 cell lines, which correspond to the intestinal subtype.
[0171] Based on the above results, it can be seen that the expression level of the protein encoded by the GLS gene is increased, particularly in the stem-like subtype, compared to other subtypes of gastric cancer.
[0172] [Example 3] Genomic analysis results of patient-derived organoids
[0173] Patient-derived tissues were obtained with the approval of the Institutional Review Board (IRB) of Yonsei University College of Medicine. Then, using the said patient-derived tissues, GA326 organoids corresponding to the intestinal subtype and GA077 organoids corresponding to the stem-like subtype were constructed.
[0174] Specifically, after obtaining patient tissue classified into intestinal subtypes or stem-like subtypes according to a clinically validated classification system, 40% advanced DMEM / F12 (gibco), 50% Wnt3A cell culture medium (conditioned media), 10% R-spond1 cell culture medium (conditioned media), 1% HEPES (gibco), 1% GlutaMax (gibco). Organoids were fabricated by forming a 3D structure using Matrigel (corning) with a medium containing 0.2% primocin (invivogen), 2% B-27 (Invitrogen), 10 mM Nicotinamide (sigma), 1 mM N-Acetylcysteine (sigma), 2 μM A8301, 50 ng / ml mEGF (invitrogen), 100 ng / ml mNoggin (peprotech), 1 nM Gastrin (sigma), 200 ng / ml hFGF10 (peprotech), and 12.5 μM Y-27632 (Enzo).
[0175] To perform transcriptome analysis on each of the above organoids, the obtained genomic analysis data was normalized to TPM, and transcriptome expression values for the GLS gene and genes related to one-carbon metabolism, such as MTR, SHMT1, SHMT2, MTHFD1, and MTHFD2, were confirmed and are shown in Figure 3.
[0176] As shown in Figure 3, it was confirmed that the expression level of the GLS gene was significantly increased in the GA077 organoid, which corresponds to the stem-like subtype, compared to the GA326 organoid, which corresponds to the intestine subtype.
[0177] The above results indicate that, not only in cell lines but also in organoids highly similar to patients, the expression level of the GLS gene is particularly increased in stem-like subtypes compared to other gastric cancer subtypes.
[0179] [Example 4] Confirmation of cell proliferation of stem-like subtype cell lines induced by GLS inhibitors
[0180] 5,000 cells each of the intestinal subtype cell line NCIN87 and the stem-like subtype cell line HS746T were seeded into 96-well plates (black) and replaced with glutamine-deficient culture medium (Gibco) the next day. Then, the cell lines were treated with DON (1 μM, 50 μM, 150 μM; selleckchem, cat no. S8620), CB839 (1 μM, 5 μM, 25 μM; cayman, cat no. S7655), or BPTES (5 μM, 10 μM, 25 μM; MCE, cat no. HY-12683), with the treatment time set to 0 hours. After discarding the cell culture medium at 24, 28, and 72 hours, the cells were stored in an ultra-low temperature freezer at -80°C. After sufficiently culturing the stored cells at room temperature, 200 µl of cell lysate containing GR dye included in the cell viability analysis kit (CyQUANT cell proliferation assay, Invitrogen) was added to each well of the cultured cells and incubated at room temperature for 5 minutes. Subsequently, the intensity of fluorescence was measured at wavelengths of excitation 480 nm and emission 520 nm using a fluorescence photometer (thermo, varioskan flash 3001), and the measured values were standardized to the number of cells at 0 hours and quantified as a percentage, with the values shown in Figures 4 to 7.
[0181] As shown in Figure 4, in the case of the intestinal subtype cell line NCIN87, cell proliferation was significantly reduced in the culture medium without glutamine (Gln-) compared to the culture medium containing glutamine (Gln+), whereas in the case of the stem-like subtype cell line HS746T, cell proliferation was not reduced depending on whether glutamine was included.
[0182] As shown in Figures 5 to 7, in the case of the intestinal subtype cell line NCIN87, cell proliferation was inhibited by glutamine analogs (DON) and GLS activity inhibitors (CB839 and BPTES), whereas in the case of the stem-like cell line HS746T, cell proliferation was not reduced even by the said drugs.
[0183] From the above results, it can be seen that in the case of stem-like subtypes, i.e., intractable cancers, cell proliferation is not inhibited by glutamine deficiency or GLS activity inhibitors.
[0185] [Example 5] Confirmation of whether proliferation is reduced in organoids induced by GLS inhibitors
[0186] Each GA077 organoid prepared in Example 3 above was treated with 5 μM of CB839 (cayman, cat no. S7655). With the treatment time point designated as D0, images were taken using an optical microscope (Olympus) on day 1 (D1), day 2 (D2), day 3 (D3), and day 4 (D4). Using Image J, the longest and shortest diameters passing through the center were measured, and the two values were averaged to determine the diameter of the organoid. The experiment was repeated 5 times for the control group (veh; DMSO-treated group) and 6 times for the CB839-treated group. The organoid diameters measured in this way were converted to μm using the microscope size bar, averaged based on the diameter at day 0, and expressed as a percentage, which is shown in Fig. 8.
[0187] As shown in Figure 8, in the case of the stem-like subtype GA077 organoid, the size was not reduced by CB839, which is a GLS activity inhibitor.
[0188] From the above results, it can be seen that in the case of stem-like subtypes, i.e., intractable cancers, cell proliferation is not inhibited by GLS activity inhibitors.
[0190] [Example 6] Confirmation of reduction in proliferation in stem-like subtype cell lines by combination therapy
[0191] As described in Example 4 above, the stem-like subtype cell line HS746T was inoculated and cultured, then replaced with a glutamine-deficient culture medium, administered a PHGDH inhibitor (25 μM), a SHMT inhibitor (1 μM), or an MTHFD2 inhibitor (0.5 μM), and the viability measured using a cell viability analysis kit is shown in FIGS. 9 to 11.
[0192] As shown in Figures 9 to 11, it was confirmed that there is a significant synergistic effect on inhibiting the viability of the stem-like subtype cell line HS746T when glutamine deficiency is combined with PHGDH, SHMT, or MTHFD2 inhibitors (Gln(-) / PHGDHi, Gln(-) / SHMTi, Gln(-) / MTHFD2i) compared to when glutamine deficiency is treated alone (Gln(-) / Veh) and when each inhibitor is treated alone (Gln(+) / PHGDHi, Gln(+) / SHMTi, Gln(+) / MTHFD2i).
[0193] Based on the above results, in the case of stem-like subtypes that are glutamine deficient and resistant to GLS inhibitors, i.e., intractable cancers, administering PHGDH, SHMT, and MTHFD2 inhibitors in combination can effectively suppress cell viability.
[0195] [Example 7] Confirmation of reduction in proliferation in stem-like subtype organoids by combination therapy
[0196] As described in Example 5 above, the stem-like subtype organoid GA077 was treated with a GLS inhibitor (CB839, 5 μM), a PHGDH inhibitor (NCT503, 50 μM), or a combination thereof, respectively, and the average value of the organoid diameter is shown in FIG. 12.
[0197] As shown in Figure 12, the average value of the organoid diameter was significantly reduced when the GLS inhibitor (CB839) or the PHGDH inhibitor (NCT503) was administered in combination (combi) to the stem-like subtype organoid GA077 compared to when they were treated alone.
[0198] The above results show that in the case of stem-like subtypes, i.e., refractory cancers, which are glutamine deficient and resistant to GLS inhibitors, administering PHGDH, SHMT, and MTHFD2 inhibitors in combination can very effectively reduce tumor size.
[0200] Foregoing, specific parts of the present invention have been described in detail. It is evident to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. Accordingly, the actual scope of the invention is defined by the appended claims and their equivalents.
Claims
Claim 1 delete Claim 2 delete Claim 3 A pharmaceutical composition for the prevention or treatment of epithelial mesenchymal transition (EMT) subtype gastric cancer comprising, as active ingredients: a preparation capable of inhibiting the function of a protein encoded by the GLS gene, or a pharmaceutically acceptable salt thereof; and a preparation capable of inhibiting the function of a protein encoded by the PHGDH gene, or a pharmaceutically acceptable salt thereof, wherein the preparation capable of inhibiting the function of the protein encoded by the GLS gene is a compound represented by the following Chemical Formula 1, and the preparation capable of inhibiting the function of the protein encoded by the PHGDH gene is a compound represented by Chemical Formula 3: [Chemical Formula 1] [Chemical Formula 3] Claim 4 In claim 3, the above composition is a pharmaceutical composition further comprising an anticancer agent. Claim 5 A method for providing information on a treatment method for a patient with EMT molecular subtype gastric cancer, comprising: a step of measuring the expression level of a protein encoded by the GLS gene in a biological sample isolated from a target individual; and a step of determining, when the measured expression level of the protein is increased, that an agent capable of inhibiting the function of the protein encoded by the GLS gene and an agent capable of inhibiting the function of the protein encoded by the PHGDH gene are administered in combination; wherein the agent capable of inhibiting the function of the protein encoded by the GLS gene is a compound represented by the following Chemical Formula 1, and the agent capable of inhibiting the function of the protein encoded by the PHGDH gene is a compound represented by Chemical Formula 3. [Chemical Formula 3]