Regulatable controlled expression of a transgene in primates

Abstract

The technology described herein relates generally to methods and compositions for regulatable and controllable expression of a transgene in a subject, e.g., a primate subject.

Description

REGULATABLE CONTROLLED EXPRESSION OF A TRANSGENE IN PRIMATESCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This Application claims benefit under 35 U.S.C. § 119(e) of the U.S. Provisional Application No. 63 / 459,850 filed April 17, 2023, and No. 63 / 459,853 filed April 17, 2023, the contents of each of which are incorporated herein by reference in their entireties.TECHNICAL FILED

[0002] The technology described herein relates generally to methods and compositions for regulatable and controllable expression of a transgene, e.g.. via multiple administrations of an inducer(s) to a subject, e.g., a primate subject.BACKGROUND

[0003] Correcting disease phenotypes by the transfer of genetic material into cells is the very essence of gene therapy (GT). Since the 1stapproved gene therapy procedure for severe combined immunodeficiency (SCID) in 1990, GT has been successfully deployed to revert diseased phenotypes in multiple human diseases. The remarkable progress and potential of this technology is reflected by 27 FDA approved cell and gene therapies as well as hundreds more in clinical pipelines. Indications that have approved treatments include spinal muscular atrophy (Zolgensma, Norvartis), lymphoma (Kymriah, Novartis), Haemophilia A and B (Roctavin and Hemgenix, CSL Behring LLC) and RPE65 mutation-associated retinal dystrophy (Luxtema). The key component of GT is the delivery of genetic material to a cell; however, in early GT experiments it was discovered that this had the potential to cause toxicity at a cellular and systemic level. Therefore, innovations to improve the expression cassette such as reducing CpG content, codon optimisation, reduction of viral components and tissue specific promoters have been vital in enabling the development of safe and efficacious therapies. Despite these advances all approved DNA-based gene therapies rely on the use of constitutively active promoters which gives you no control over the expression level of the transgene once the therapy has been delivered. This lack of control is the cause of adverse outcomes in patients as overexpression or under expression of the transgene could decrease the efficacy of the treatment or lead to toxicity. Indeed, it is known that overexpression of the B domain deleted factor VIII causes significant protein folding stress in hepatocytes which is known risk factor for hepatocellular carcinoma.

[0004] In addition, there are significant differences in physiology between rodents and primates. The preclinical results obtained in rodents are note easily extrapolated to humans, and preclinical data generated in rodents has limited predictive power in humans. Therefore, to increase the efficacy and safety of GT treatments, methods whereby expression levels could beexquisitely controlled in a robust and predictable manner, especially in primates, are needed. The present disclosure addresses this need.SUMMARY

[0005] In one aspect provided herein is a method of regulating expression of a transgene in a subject, e.g., a primate subject. The method comprises: (a) administering to a subject, e.g., primate subject at a first time point a first inducer (e.g., administering a dose of a first inducer at a first time point), wherein the subject, e.g., primate subject comprises at least one cell comprising an exogenous nucleotide sequence comprising an inducible promoter operably linked to a transgene, wherein the inducible promoter comprises a cis-regulatory element (CRE) that is capable of being bound and activated by a heterodimer of CAR and RXR (i.e., the inducible promoter comprises at least one PBREM enhancer), and wherein the first dose comprises an amount of the inducer that is sufficient to express a measurable level of the transgene in the subject; and (b) administering to the subject at least at a second time point a second inducer (e.g., administering a dose of a second inducer at a second time point) to continue expression of the transgene at a predetermined level for a predetermined time or to modulate expression of the transgene to a predetermined level. The first and second inducers can be same or different. In some embodiments of any of the aspects, at least the first or the induces are each, independently, artemisinin, a derivative of artemisinin, or a flavonoid compound. For example, then first and second inducers are each, independently, artemisinin or a derivative thereof.

[0006] In some embodiments, the method further comprises administering to the subject at least at a third time point a third inducer (e.g., administering a dose of a third inducer at a third time point) to continue expression of the transgene at a predetermined level for a predetermined time or to modulate expression of the transgene to a predetermined level. The third inducer can be the same as or different than the first inducer. The third inducer can be same or different than the second inducer. Stated another way, the first, the second and third inducer can be all same, all different, or two same (e.g., first and second same, or first and third same, or second and third same) and one different.

[0007] In some embodiments of any of the aspects, the a) first inducer and b) second inducer and third inducer are different, and the second inducer and third inducer are the same. In some embodiments of any of the aspects, the first inducer is a first artemisinin derivative, and the second inducer and third inducer are a second artemisinin derivative. In some embodiments of any of the aspects, the first inducer is artemisinin, and the second inducer and third inducer are an artemisinin derivative. In some embodiments of any of the aspects, the first inducer is an artemisinin derivative, and the second inducer and third inducer are artemisinin.

[0008] In another aspect provided herein is a method of regulating expression of a transgene in a subject, e.g., a primate subject. The method comprises: administering artemisinin or a derivative thereof to the subject, e.g., primate subject, wherein the subject, e.g., primate subject comprises at least one cell comprising an exogenous nucleotide sequence comprising an inducible promoter operably linked to a transgene, wherein the inducible promoter comprises a CRE that is capable of being bound and activated by a heterodimer of CAR and RXR (i.e., the inducible promoter comprises at least one PBREM enhancer), wherein the artemisinin or a derivative thereof is administered in an amount that is sufficient to express a measurable level of the transgene in the subject. In some embodiments of this, artemisinin or a derivative thereof is administered to the subject, e.g., primate subject following the prior administration of an inducer to the subject, e.g., primate subject, and optionally, the inducer is administered in an amount that is sufficient to express a measurable level of the transgene in the subject. In some cases, the inducer of the prior administration is different from the artemisinin or a derivative thereof administered to the subject. Alternatively, the inducer of the prior administration is same as the artemisinin or a derivative thereof administered to the subject but at a different dose.

[0009] In another aspect provided herein is a method of regulating expression of a transgene in a subject, e.g., a primate subject. The method comprises: administering a flavonoid compound to the subject, e.g., primate subject, wherein the subject, e.g., primate subject comprises at least one cell comprising an exogenous nucleotide sequence comprising an inducible promoter operably linked to a transgene, wherein the inducible promoter comprises a CRE that is capable of being bound and activated by a heterodimer of CAR and RXR (i.e., the inducible promoter comprises at least one PBREM enhancer), wherein the flavonoid compound is administered in an amount that is sufficient to express a measurable level of the transgene in the subject. In some embodiments of this, the flavonoid compound is administered to the subject, e.g., primate subject following the prior administration of an inducer to the subject, e.g., primate subject, and optionally, the inducer is administered in an amount that is sufficient to express a measurable level of the transgene in the subject. In some cases, the inducer of the prior administration is different from the flavonoid compound administered to the subject. Alternatively, the inducer of the prior administration is same as the flavonoid compound administered to the subject but at a different dose.

[0010] In another aspect provided herein is a first and at least a second inducer for use in a method of regulating expression of a transgene in a subject, e.g., a primate subject, the method comprising: (a) administering to the subject at a first time point a first inducer (e.g., administering a dose of a first inducer at a first time point), wherein the subject, e.g., primate subject comprises at least one cell comprising an exogenous nucleotide sequence comprising an inducible promoter operably linked to a transgene, wherein the synthetic inducible promoter comprises a CRE that iscapable of being bound and activated by a heterodimer of CAR and RXR (i.e., the inducible promoter comprises at least one PBREM enhancer), wherein the first dose comprises an amount of the inducer that is sufficient to express a measurable level of the transgene in the subject; and (b) administering to the subject at least at a second time point a second inducer (e.g., administering a dose of a second inducer at a second time point) to continue expression of the transgene at a predetermined level for a predetermined time or to modulate expression of the transgene to a predetermined level. In some embodiments, the first and second inducer are independently artemisinin, a derivative of artemisinin, or a flavonoid compound. In some embodiments, the first and second inducer are independently artemisinin or a derivative of artemisinin,

[0011] It is noted that the first and second inducers can be same or different.

[0012] In some embodiments, the first inducer is artemisinin or a derivative thereof. For example, the first inducer is artemisinin, artesunate, dihydroartemisinin, artemether or artemether. In some embodiments, the first inducer is artemisinin or artesunate.

[0013] In some embodiments, the first inducer is a flavonoid compound. For example, the first inducer is flavone. For example, the first inducer is flavone.

[0014] In some embodiments, the second inducer is artemisinin; derivative of artemisinin; a flavonoid compound, e.g. flavone, chrysin, baicalein, or galangin; l,4-Bis[2-(3,5- dichloropyridyloxy)]benzene (TCPOBOP); phenobarbital (PB); 6-(4Chlorophenyl)imidazo[2,l- b][l,3]thiazole-5-carbaldehyde-O-(3,4-dichlorobenzyl)oxime (CITCO); Acetaminophen; Buprenorphine; Phenytoin; Carbamazepine; Valproic Acid; Chlorpromazine; Efavirenz; Nevirapine; Rilpivirine; Etravirine; Diazepam; Cyclophosphamid; Ifosfamide; Cerivastatin; Simvastatin; lovastatin; substituted sulphonamides; Thiazolidin-4-one; Estradiol; Estrone and analogues; 17a-ethinyl-3;17B-estradiol (EE2); Dehydroepiandrost erone (DHEA); 513-pregnane- 3, 20-dione; Diethylstilbestrol; Gingko biloba extract; Galangin; chrysin; baicalein; Diallyl sulphide; Ellagic acid; Resveratrol; Squalestatin-1; Bilobalide; Triclocarban; Triclosan; Dichlorodiphenyltrichloroethane (DDT); Dieldrin; Methoxychlor; Metofluthrin; Permethrin; Pyrethrins; Sulfoxaflor; Diethylhexyl phthalate (DEHP); Cyproconazole; Fluconazole; Propiconazole; FL81; Tri-p-methylphenyl phosphate (TMPP); UM104; or UM145.

[0015] In some embodiments, the second inducer is artemisinin or a derivative thereof. For example, the second inducer is artemisinin, artesunate, dihydroartemisinin, artemether or artemether. In some embodiments, the second inducer is artemisinin or artesunate.

[0016] In some embodiments, the second inducer is a flavonoid compound. For example, the second inducer is flavone. For example, the second inducer is flavone.

[0017] In some embodiments, the third inducer or a subsequent inducer is artemisinin; derivative of artemisinin; a flavonoid compound, e.g. flavone, chrysin, baicalein, or galangin; 1,4-Bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP); phenobarbital (PB); 6-(4Chlorophenyl)imidazo[2,l-b][l,3]thiazole-5-carbaldehyde-O-(3,4-dichlorobenzyl)oxime (CITCO); Acetaminophen; Buprenorphine; Phenytoin; Carbamazepine; Valproic Acid; Chlorpromazine; Efavirenz; Nevirapine; Rilpivirine; Etravirine; Diazepam; Cyclophosphamid; Ifosfamide; Cerivastatin; Simvastatin; lovastatin; substituted sulphonamides; Thiazolidin-4-one; Estradiol; Estrone and analogues; I 7a-ethinyl-3; l 7b-estradiol (EE2); Dehydroepiandrost erone (DHEA); 5B-pregnane-3, 20-dione; Diethylstilbestrol; Gingko biloba extract; Galangin; chrysin; baicalein; Diallyl sulphide; Ellagic acid; Resveratrol; Squalestatin-1; Bilobalide; Triclocarban; Triclosan; Dichlorodiphenyltrichloroethane (DDT); Dieldrin; Methoxychlor; Metofluthrin; Permethrin; Pyrethrins; Sulfoxaflor; Diethylhexyl phthalate (DEHP); Cyproconazole; Fluconazole; Propiconazole; FL81; Tri-p-methylphenyl phosphate (TMPP); UM104; or UM145.

[0018] In some embodiments, the third or a subsequent inducer is artemisinin or a derivative thereof. For example, the or a subsequent third inducer is artemisinin, artesunate, dihydroartemisinin, artemether or artemether. In some embodiments, the third or a subsequent inducer is artemisinin or artesunate.

[0019] In some embodiments, the third or a subsequent inducer is a flavonoid compound. For example, the third or a subsequent inducer is flavone. For example, the third inducer is flavone.

[0020] In some embodiments of any of the aspects, the time between administrations is at least 24 hours, 48 hours, 72 hours, 1 week, 10 days, 2 weeks, 3 weeks, or 4 weeks. In some embodiments of any of the aspects, the time between administrations is at least 24 hours, 48 hours, or 72 hours. In some embodiments of any of the aspects, the time between administrations is no more than 2 months, 3 months, 4 months, 5 months, or 6 months. In some embodiments of any of the aspects, the time between administrations is no more than 2 months.

[0021] In some embodiments of any of the aspects, the time between administrations is 5-7 days, 5-10 days, 7-10 days, 7-14 days, 10-14 days, 10-20 days, 14-21 days, 14-28 days, 21-28 days, or 21-34 days.

[0022] In some embodiments, the time between administration is about 24 hours. For example, an inducer is administered the subject every day (e.g., about every 24 hours). In some embodiments, an inducer is administered the subject every day (e.g., about every 24 hours) for a period of about one week to about 6 months. In some embodiments, an inducer is administered the subject every day (e.g., about every 24 hours) for a period of about two weeks to about 3 months. For example, an inducer is administered to the subject every day (e.g., about every 24 hours) for a period of about two weeks, about three weeks, about 4 weeks, about 5 weeks or about 6 weeks. In some embodiments, an inducer is administered the subject every day (e.g., about every 24 hours) for a period of about 15 days, about 30 days, about 40 days, about 45 days, about 50 days, about65 days, about 75 days, about 80 days, or about 90 days. When the subject an inducer is administered to the subject every day (e.g., about every 24 hours), such dosing is also referred to as continuous dosing herein. Without wishing to be bound by theory, it is noted that continuous dosing shows no toxicity in the subject. Accordingly, in some embodiments, an inducer is administered to the subject every day (i.e., continuous dosing) for a period of about 15 days, about 30 days, about 40 days, about 45 days, about 50 days, about 65 days, about 75 days, about 80 days, or about 90 days, and the subject does not show signs of toxicity. It is noted that the same inducer can be administered every day or different inducers can be administered on different days. Further, amount of the inducer can be same or different on different days.

[0023] In some embodiments of any of the aspects, the inducer at the second time point (e.g., second inducer), or a subsequent time point (e.g. third inducer), is administered when it is determined that the level of expression of the transgene is decreased to 75% or less of the level of expression of the transgene within the 24 hours after administering at the first time point (e.g., the first inducer), or the previous time point (e.g., second time inducer). In some embodiments of any of the aspects, the inducer at the second time point (e.g., second inducer), or a subsequent time point (e.g. third inducer), is administered when it is determined that the level of expression of the transgene is decreased to 50% or less of the level of expression of the transgene within the 24 hours after administering at the first time point (e.g., the first inducer), or the previous time point (e.g., second time inducer). In some embodiments of any of the aspects, the inducer at the second time point (e.g., second inducer), or a subsequent time point (e.g. third inducer), is administered when it is determined that the level of expression of the transgene is decreased to a background level of expression of the transgene following the 24 hours after administering at the first time point (e.g., the first inducer), or the previous time point (e.g., second time inducer). In some embodiments of any of the aspects, the inducer at the second time point (e.g., second inducer), or a subsequent time point (e.g. third inducer), is administered when it is determined that the level of expression of the transgene is decreased to 25% or less of the level of expression of the transgene within the 24 hours after administering at the first time point (e.g., the first inducer), or the previous time point (e.g., second time inducer).

[0024] In some embodiments of any one of the aspects, the artemisinin derivative is of Formula (I) described herein, or a pharmaceutically acceptable salt thereof. For example the artemisinin derivative is a compound of Formula (I), (I- A), (I-B), (I-C), (I-D), (I-E), (I-F), (I-G), (I-H), (I-I), (I-J), (I-K), (I-L), (I-M), (I-M’), (I-N), (I-N’), (I-O) or (I-O’). In some embodiments, the artemisinin derivative is artesunate, dihydroartemisinin, artesunate, or artemether. For example, the artemisinin derivative is artesunate, or dihydroartemisinin.

[0025] In some embodiments of any one of the aspects, the flavonoid compound is flavone.

[0026] In some embodiments, the first and second inducer or a subsequent inducer) are administered at about the same amount. For example, dose of the inducer in successive administrations remains same.

[0027] In some embodiments, the first inducer and the second inducer (or a subsequent inducer) are administered at different amounts. For example, the second inducer (or a subsequent inducer) is administered at a lower amount relative to the amount of the first inducer (or the previous inducer), e.g., dose of the inducer in successive administrations is reduced from its prior administration. In some embodiments, the second inducer (or a subsequent inducer) is administered in amount about 1 / 2, 1 / 3, 1 / 4, 1 / 5, 1 / 6, 1 / 7, 1 / 8, 1 / 9, 1 / 10, 1 / 15, 1 / 20, 1 / 25, 1 / 30, 1 / 35, 1 / 40, 1 / 45, 1 / 50, 1 / 55, 1 / 60, 1 / 65, 1 / 70, 1 / 75, 1 / 80, 1 / 85, 1 / 90, 1 / 95, 1 / 100, 1 / 125, 1 / 150, 1 / 175, 1 / 200, 1 / 500, 1 / 1000 or even less of the amount of first the inducer (or the previous inducer). For example, the second inducer (or a subsequent inducer) is administered in amount about 1 / 2, 1 / 4, 1 / 5, 1 / 8, 1 / 10, 1 / 20, 1 / 40, 1 / 80 or less of the amount of the first inducer (or the prior inducer).

[0028] In some embodiments, the second inducer (or a subsequent inducer) is administered at a higher amount relative to the amount of the first inducer (or the previous inducer). For example, the amount of inducer administered at the second time point (or a subsequent time point) is at least about 25%, 50%, about 75%, about 1-fold, about 1.2-folds, about 1.25-folds, about 1.3-folds, about 1.5-folds, about 1.75-folds, about 2-folds, about 2.25-folds, about 2.5-folds, about 2.5-folds, about 2.75-folds, about 3-folds, 4-fold, 5-fold, 6-folds, 7-fold, 8-fold, 9-folds, 10-folds or higher than the amount of the first inducer (or previous time point).

[0029] In some embodiments, the first and second inducer (or a subsequent inducer, e.g., third inducer) are administered independently at a dose from about 0.5 mg / kg to about 150mg / kg.

[0030] In some embodiments, the first inducer is administered at a dose from about 1 mg / kg to about 100 mg / kg. For example, the first inducer is administered at a dose of about 80mg / kg, about 70mg / kg, about 60mg / kg, about 50mg / kg, about 40mg / kg, about 30mg / kg, about 20mg / kg, about lOmg / kg, about 6mg / kg, about 5mg / kg, or about 1 mg / kg.

[0031] In some embodiments, the second inducer is administered at a dose from about 1 mg / kg to about 100 mg / kg. For example, the second inducer is administered at a dose of 80mg / kg, about 70mg / kg, about 60mg / kg, about 50mg / kg, about 40mg / kg, about 30mg / kg, about 20mg / kg, about lOmg / kg, about 6mg / kg, about 5mg / kg, or about Img / kg.

[0032] In some embodiments, the third inducer is administered at a dose from about 1 mg / kg to about 100 mg / kg. For example, the third inducer is administered at a dose of 80mg / kg, about 70mg / kg, about 60mg / kg, about 50mg / kg, about 40mg / kg, about 30mg / kg, about 20mg / kg, about lOmg / kg, about 6mg / kg, about 5mg / kg, or about Img / kg.

[0033] In some embodiments, the first inducer is administered at a dose of about 80 mg / kg orless and the second inducer is administered at a dose of about 20mg / kg or less at the second or subsequent time point. In some embodiments, the first inducer is administered at a dose of about 40 mg / kg and the second inducer is administered at a dose of about 80mg / kg or less at the second or subsequent time point. In some embodiments, the first inducer is administered at a dose of about 20mg / kg and the second inducer is administered at a dose of about 80 mg / kg, 40mg / kg, 20mg / kg, 10 mg / kg, 6 mg / kg or 1 mg / kg at the second or subsequent time point. In some embodiments, the first inducer is administered at a dose of about 10 mg / kg and the second inducer is administered at a dose of about 80mg / kg or less at the second or subsequent time point. In some embodiments, the first inducer is administered at a dose of about 6 mg / kg and the second inducer is administered at a dose of about 80mg / kg or less at the second or subsequent time point. In some embodiments, the first inducer is administered at a dose of about 1 mg / kg and the second inducer is administered at a dose of about 80mg / kg or less at the second or subsequent time point. In some embodiments, the second inducer is administered at a dose of about 80 mg / kg and the first inducer is administered at a dose of about 80 mg / kg or less. In some embodiments, the second inducer is administered at a dose of about 40 mg / kg and the first inducer is administered at a dose of about 80 mg / kg or less.

[0034] In some embodiments, the second inducer is administered at a dose of about 20 mg / kg and the first inducer is administered at a dose of about 80 mg / kg or less. In some embodiments, the second inducer is administered at a dose of about 10 mg / kg and the first inducer is administered at a dose of about 80 mg / kg or less. In some embodiments, the second inducer is administered at a dose of about 6 mg / kg and the first inducer is administered at a dose of about 80 mg / kg or less. In some embodiments, the second inducer is administered at a dose of about 1 mg / kg and the first inducer is administered at a dose of about 80 mg / kg or less.

[0035] In some embodiments of any of the aspects, each dose is no more than 10 mg / kg. In some embodiments of any of the aspects, the second dose, and / or a subsequent dose (e.g., third dose) is no more than 10 mg / kg. In some embodiments of any of the aspects, the first dose, the second dose, and / or a subsequent dose (e.g., third dose) is 5 mg / kg or greater. In some embodiments of any of the aspects, the first dose is 1-80 mg / kg, the second dose is 1-40 mg / kg, and / or a subsequent dose (e.g., third dose) 1-40 mg / kg. In some embodiments of any of the aspects, the second dose and subsequent dose (e.g., third dose) is 1-10 mg / kg. In some embodiments of any of the aspects, the first dose and each subsequent dose is independently 1 mg / kg to 80 mg / kg. In some embodiments of any of the aspects, the first dose and each subsequent dose is independently 5 mg / kg to 80 mg / kg. In some embodiments of any of the aspects, the second dose and subsequent dose (e.g., third dose) is independently 5 mg / kg to 20 mg / kg. In some embodiments of any of the aspects, the second dose and subsequent dose (e.g., third dose) is independently 5 mg / kg to 10 mg / kg.

[0036] In some embodiments, the second time point is at least two days after the first time point. For example, the second time point is at least one month after the first time point, such as the second time point is at least two months of the first time point.

[0037] In some embodiments of any of the aspects, the expression of the transgene increases for a predetermined time after each administration. In some embodiments of any of the aspects, the expression of the transgene increases for a predetermined time after each administration and the magnitude of the increase is positively correlated with the size of the dose.

[0038] In some embodiments, the expression of the transgene goes down to a background expression level within one week of administering the inducer.

[0039] In some embodiments, the method further comprises a step of determining the expression level of the transgene after administering the first, second, or subsequent (e.g., third) inducer. For example, the method further comprises a step of determining the expression level prior of the transgene to administering the first, second, or subsequent (e.g., third) inducer.

[0040] In some embodiments, the method further comprises administering the exogenous nucleotide sequence to the subject prior to administering the first, second, or subsequent (e.g., third) inducer. For example, the method further comprises administering the exogenous nucleotide sequence to the subject prior to administering the first inducer.

[0041] In some embodiments, the method is a method of therapy, optionally, the method of therapy is a method of gene therapy.

[0042] In some embodiments, the exogenous nucleotide sequence comprising an inducible promoter operably linked to a transgene is a viral vector. For example, the exogenous nucleotide sequence comprising an inducible promoter operably linked to a transgene is adeno-associated viral (AAV), lentiviral, adenoviral, herpes viral, or hepatitis viral vector. In some embodiments the exogenous nucleotide sequence comprising an inducible promoter operably linked to a transgene is an AAV vector, e.g., an AAV gene therapy vector.

[0043] In some cases, the first and second inducers independently are administered orally or are intraperitoneally. In some embodiments, at least one of the first and second inducer is administered orally. For example, if the inducer is artemisinin or a derivative thereof, the artemisinin or a derivative thereof is administered orally. In some embodiments, the second inducer is administered orally. In some embodiments, the first inducer is orally. In some embodiments, both the first inducer and second inducer are administered orally.

[0044] In some embodiments, least one of the first and second inducer is administered intraperitoneally. For example, if the inducer is artemisinin or a derivative thereof, the artemisinin or a derivative thereof is administered intraperitoneally. In some embodiments, the second inducer is administered intraperitoneally. In some embodiments, the first inducer is intraperitoneally. Insome embodiments, both the first and second inducer are administered intraperitoneally.

[0045] In another aspect, provided herein is artemisinin or a derivative of artemisinin, for use as an inducer in a method of regulating expression of a transgene in a subject, e.g., a primate subject, wherein the subject, e.g., the primate subject comprises at least one cell comprising an exogenous nucleotide sequence comprising an inducible promoter operably linked to a transgene, wherein the synthetic inducible promoter comprises a CRE that is capable of being bound and activated by a heterodimer of CAR and RXR, wherein the inducer is administered to the subject at a dose which comprises an amount of the inducer that is sufficient to express a therapeutically effective level of the transgene in the subject. In some embodiments of this, the artemisinin or a derivative of artemisinin is administered to the subject, e.g., the primate subject following the prior administration of an inducer to the subject, e.g., the primate subject. In some cases, the inducer of the prior administration is a different inducer, or the inducer of the prior administration is the same inducer but at a different dose.

[0046] In another aspect, provided herein is a flavonoid compound (e.g., flavone) for use as an inducer in a method of regulating expression of a transgene in a subject, e.g., a primate subject, wherein the subject, e.g., the primate subject comprises at least one cell comprising an exogenous nucleotide sequence comprising an inducible promoter operably linked to a transgene, wherein the synthetic inducible promoter comprises a CRE that is capable of being bound and activated by a heterodimer of CAR and RXR, wherein the inducer is administered to the subject at a dose which comprises an amount of the inducer that is sufficient to express a therapeutically effective level of the transgene in the subject. In some embodiments of this, the flavonoid compound (e.g., flavone) is administered to the subject, e.g., the primate subject following the prior administration of an inducer to the subject, e.g., the primate subject. In some cases, the inducer of the prior administration is a different inducer, or the inducer of the prior administration is the same inducer but at a different dose.

[0047] In some embodiments of any one of the aspects described herein, the artemisinin or a derivative of artemisinin is administered at a dose of from about 0. Img / kg to 80mg / kg, from about 0. Img / kg to about 70mg / kg, from about 0. Img / kg to about 60mg / kg, from about 0. Img / kg to about 50mg / kg, from about 0. Img / kg to about 40mg / kg, from about 0. Img / kg to about 30mg / kg, from about 0. Img / kg to about 20mg / kg, from about 0. Img / kg to about lOmg / kg, from about 0. Img / kg to about 6mg / kg, from about 0. Img / kg to about 5mg / kg, or from about 0. Img / kg to about Img / kg.

[0048] In some embodiments, a first induction with artemisinin or a derivative thereof increases the transgene expression level to a maximum at about 24 hrs and declines thereafter, wherein, second induction and / or, successive inductions with artemisinin or a derivative thereof has similar induction profile as seen with the first induction, for at least about 1 month, or at leastabout 2 months, or, at least about 3 months, or, at least about 5 months or, at least about six months or, even more, and optionally, the method further comprises single administration of exogenous nucleotide sequence encoding the transgene operatively linked to the synthetic inducible promoter prior to first administering the inducer to induce said first induction.

[0049] In some embodiments of any one of the aspects described herein, flavonoid compound is administered at a dose of from about O.lmg / kg to 80mg / kg, from about O.lmg / kg to about 70mg / kg, from about O.lmg / kg to about 60mg / kg, from about O.lmg / kg to about 50mg / kg, from about O.lmg / kg to about 40mg / kg, from about O.lmg / kg to about 30mg / kg, from about O.lmg / kg to about 20mg / kg, from about 0. Img / kg to about lOmg / kg, from about 0. Img / kg to about 6mg / kg, from about O.lmg / kg to about 5mg / kg, or from about O.lmg / kg to about Img / kg.

[0050] In some embodiments, a first induction with the flavonoid compound increases the transgene expression level to a maximum at about 24 hrs and declines thereafter, wherein, second induction and / or, successive inductions with the flavonoid compound has similar induction profile as seen with the first induction, for at least about 1 month, or at least about 2 months, or, at least about 3 months, or, at least about 5 months or, at least about six months or, even more, and optionally, the method further comprises single administration of exogenous nucleotide sequence encoding the transgene operatively linked to the synthetic inducible promoter prior to first administering the inducer to induce said first induction.

[0051] In some embodiments, the transgene expression level at about 24 hrs in the first induction, or, second induction, or successive inductions is at least about 200-fold higher than that of prior to administering the inducer for the first time, or, the second time, or, any number of successive administrations.

[0052] In some embodiments, the first induction, the second induction, and / or, the successive inductions are not complete until about 24 hours, about 48 hours, about 72 hours, about 96 hours, about 120 hours, about 144 hours, about 150 hours, 160 hours, about 168 hours, about 192 hours, about 216 hours, about 240 hours, about 264 hours, or about 290 hours after administering the inducer. In some embodiments of any one of the aspects, the artemisinin or a derivative there of is administered at a dose from about 0.5 mg / kg to about 150mg / kg. For example, artemisinin or a derivative there of is administered at a dose from about 1 mg / kg to about 100 mg / kg, from about 1 mg / kg to about 80 mg / kg, from about 1 mg / kg to about 40 mg / kg, from about 1 mg / kg to about 20 mg / kg, or from about 1 mg / kg to about 10 mg / kg. For example, the artemisinin or a derivative there of is administered at a dose of about 80mg / kg, about 70mg / kg, about 60mg / kg, about 50mg / kg, about 40mg / kg, about 30mg / kg, about 20mg / kg, about lOmg / kg, about 6mg / kg, about 5mg / kg, or about Img / kg.

[0053] In some embodiments of any of the aspects, the transgene encodes an antibody or antigen binding portion an antibody, a coagulation factor, a cytokine, a hormone, a growth factor, a virus protein, a cell receptor ligand, a chimeric antigen receptor (CAR) or a CRISPR-Cas nuclease.

[0054] In some embodiments of any one of the aspects, the transgene encodes an antibody, optionally selected from the group consisting of an anti-TNFα, anti-PDl antibody, anti-HER2 antibody, anti-PCSK9 antibody, anti-VEGFR2 antibody, anti-IL17 antibody, anti-A03-42 antibody, or anti-Sema3A antibody or an antigen binding fragment thereof.

[0055] In some embodiments of any one of the aspects, the transgene encodes a coagulation factor, optionally selected from the group consisting of Factor VIII, Factor IX, Factor VII, Factor X, and Factor XI, optionally, the transgene encodes a coagulation factor selected from Factor VIII, Factor IX.

[0056] In some embodiments of any one of the aspects, the transgene encodes a hormone, optionally selected from the group consisting of selected from Erythropoietin (EPO) and parathyroid hormone (PTH).

[0057] In some embodiments of any one of the aspects, the transgene encodes a CRISPR-Cas nuclease, optionally selected from the group consisting of Cas9, Cast 2, Cas Phi, CasX, and CasRx.

[0058] In some embodiments of any one of the aspects, the transgene encodes a virus protein, optionally selected from the group consisting of viral envelop protein, viral nucleocapsid protein, viral membrane protein, REP, CAP, REV, VSV-G and RD114.

[0059]

[0060] In some embodiments of any of the aspects, the subject is a primate. In some embodiments of any one of the aspects, the subject is a non-human primate. In some embodiments of any of the aspects, the subject is a human.BRIEF DESCRIPTION OF THE DRAWINGS

[0061] This patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.

[0062] FIG. 1 is schematic representation of PK / PD of artemisinin and some exemplary derivatives thereof.

[0063] FIG. 2 is a bar-graph showing the induction of an exemplary inducible promoter by artemisinin, various exemplary derivatives of artemisinin and other compounds. Structures of artemisinin, exemplary derivatives of artemisinin, and other compounds are also shown.

[0064] FIG. 3A is a schematic representation of protocols for in vivo short-term induction in male mice via IP injection.

[0065] FIGS. 3B and 3C shows live imaging (FIG. 3B) and ex vivo imaging (FIG. 3C) of short-term induction in male mice via intraperitoneal (IP) injection.

[0066] FIG. 4A is a schematic representation of protocols for in vivo testing the sex differences on inducible promoters.

[0067] FIGS. 4B and 4C show imaging (FIG. 4B) and ex vivo imaging (FIG. 4C) of differences in background and induction between sex via IP injection.

[0068] FIG. 5A is a schematic representation of protocols for in vivo testing the effects of route of administration on inducible promoters.

[0069] FIGS. 5B and 5C show live imaging (FIG. 5B) and ex vivo imaging (FIG. 5C) of differences in induction between administration via oral gavage and IP injection.

[0070] FIG. 6 shows dose response in female mice via oral gavage administration.

[0071] FIG. 7 shows time course of induction in mice.

[0072] FIG. 8 shows effect of AAV dose on induction.

[0073] FIG. 9 is a schematic representation of a protocol for testing induction in non-human primates.

[0074] FIG. 10 shows results of repeated induction in non-human primates using the protocol shown in FIG. 9.

[0075] FIG. 11 is a schematic representation of another protocol for testing induction in non- human primates.

[0076] FIG. 12 shows induction in non-human primates using the protocol shown in FIG. 11. Results for the LSP control promoter and saline negative control are also shown. Pre-induction gonadotropin levels are indicated by blue arrows and gonadotropin levels after induction are illustrated by red arrows.

[0077] FIGS. 13A and 13B are bar-graph (FIG. 13A) and line-graph (FIG. 13B) showing individual results for each of the non-human primate in FIG. 12. M LSP and F LSP are the male and female LSP controls, respectively; Ml Ind and M2 Ind are males with the inducible promoter; Fl Ind and F2 Ind are females with the inducible promoter; M S and F S are Male and Female saline negative controls, respectively.

[0078] FIG. 14 is a schematic representation of a protocol for testing induction in non-human primates.

[0079] FIG. 15 is a line graph showing individual results for each of the non-human primate. M(S) and F(S) are male and female saline negative controls, respectively; Con-F and Con-M arethe female and male LSP controls, respectively; and Ind-M(2) and Ind-(F2) are male and female with the inducible promoter, respectively.

[0080] FIG. 16 is a bar graph showing results of repeated induction in non-human primates using the protocol shown in FIG. 14.

[0081] FIG. 17 is a line graph showing results of continuous oral dosing of the inducer. Female and Male are female and male with the inducible promoter, respectively; Control promoter is the the LSP control; and Saline is saline negative control.DETAILED DESCRIPTION

[0082] It is noted that the section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0083] The inducer(s) can be formulated for administration via parenteral or oral routes. For example, the inducer(s) can be formulated for intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intraperitoneal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, and / or oral administration.

[0084] The technology described herein is directed generally to methods for regulatable and controllable expression of a transgene in a subject, e.g., a primate subject. In particular, the technology described herein relates to methods for regulatable and controlled expression of a transgene, including but not limited to any of, sustained, e.g., long-lasting expression, transient expression of a transgene, controlled expression of a transgene, and / or dose-dependent and / or titratable expression of a transgene in a primate subject. Although gene therapy offers great promise in a number of situations, the constitutive expression of an added gene can have deleterious effects on a cell. For example, the over-expression or constitute expression of certain proteins can be toxic or determinantal to a cell, e.g., it can lead to unfolded protein responses, it can cause immunity problems. Thus, being able to regulate expression of such proteins so it is transient or temporary and provide expression at desired intervals and intensities is extremely desirable.

[0085] The methods disclosed herein permit one to personalize gene therapy throughout a subject’s lifespan to express a transgene at a duration and / or level that meets the subject’s needs, by sustaining the transgene expression level at a predetermined level for a pre-determined time, or alternatively, increasing the expression of the transgene by inducing expression of the transgene by one or more, e.g., multiple subsequent administrations of an inducer after initial induction of the transgene expression, thereby controlling the transgene expression level to a desired expression level or desired expression level range based on the time period between the administrations of the inducer and / or amount of the inducer in the re-dose administration, allowing for a regulatable and controlled modulation of the expression of the transgene in the subject.

[0086] Accordingly, in one aspect provided herein is a method of regulating expression of a transgene in a primate subject. The subject comprises an exogenous nucleotide sequence comprising an inducible promoter. The inducible promoter is operably linked to a transgene and comprises a cis-regulatory element (CRE) that is capable of being bound and activated by a heterodimer of CAR and RXR. The method comprises administering an effective amount of an inducer, e.g., artemisinin, a derivative of artemisinin, or a flavonoid compound to the subject, thereby inducing the expression of the transgene from the expression cassette, for example, inducing the expression of the transgene to a measurable or therapeutically effective level in the subject. It is noted that the exogenous nucleotide sequence can be inserted into the genome of the subject, or it can be present in an episomal vector.

[0087] In some embodiments of any of the aspects, the expression of the transgene increases for a predetermined time after each administration. In some embodiments of any of the aspects, the expression of the transgene increases for a predetermined time after each administration and the magnitude of the increase is positively correlated with the size of the dose.

[0088] Without wishing to be bound by a theory, the method described herein can permit control over timing of the expression of the transgene. One can create various positive and negative feedback loops to regulate expression of a transgene in a predetermined manner.

[0089] In some embodiments of any of the aspects described herein, the transgene product is detrimental to the liver cell or to the subject when constitutively expressed.

[0090] The inducer can be administered intermittently or continuously to have transgene expression level at a predetermined level for a predetermined time or to provide intermittent expression of the transgene at predetermined times and / or levels. For example, the inducer can be administered periodically (sometimes referred to herein as a “redose” or “booster” administration) to obtain transgene expression level at a predetermined level for a predetermined time, and / or to increase the expression level of the transgene above a reference expression level, e.g., background expression level or an expression level in the absence of the inducer. Accordingly, in some embodiments, the method further comprises administering to the subject at least a second dose of the inducer to continue expression of the transgene at a predetermined level for a predetermined time or to increase expression of the transgene to a predetermined level. Additionally, one can administer one or more inducers. Moreover, the level of inducer and / or use of multiple inducers can be varied depending upon the level of expression, e.g., level of protein, desired for a particular situation.

[0091] Therefore, in some embodiments, the method comprises: administering to the subject a first dose of an inducer in an amount that is sufficient to express a measurable level of the transgene in the subject; and administering to the subject at least a second dose and / or subsequentdoses of the inducer to continue expression of the transgene at a predetermined level for a predetermined time or to increase expression of the transgene to a predetermined level.

[0092] In some embodiments, the method comprises: administering to the subject at a first time point a dose of a first inducer in an amount that is sufficient to express a measurable level of the transgene in the subject; administering to the subject at at least a second time point a dose of a second inducer in an amount that is sufficient to express a measurable level of the transgene in the subject; and, optionally, administering to the subject at at least a third time point a dose of a third inducer in an amount that is sufficient to express a measurable level of the transgene in the subject. And so on as expression is needed. It is noted that the first, second and any subsequent inducers can be same or different.

[0093] The data presented herein show that once the administration of the inducer is stopped, the expression of the transgene goes down to a background expression level rapidly. Further, the background expression level remains relatively steady even after repeated administration of the inducer. This is contrast to the current methods in the art. With the current methods in the art, the background expression levels are seen to be significantly higher even after induction has been stopped for a period of more than one, two, three, four or more weeks. In contrast, in the methods described herein, the expression of the transgene goes down to a background expression level in less than a week once the administration of the inducer is stopped. The background expression level can be an expression level of the transgene prior to first induction or first administration of the inducer.

[0094] In some embodiments, the expression of the transgene goes down to the background level once the administration of the inducer is stopped. For example, once the administration of the inducer is stopped, the expression of the transgene goes down to an expression level that is no more than 50%, no more than 45%, no more than 40%, no more than 35%, no more than 30%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10%, or no more than 5% higher than the background expression level of the transgene prior to first induction.

[0095] In some embodiments, the expression of the transgene goes down to the background level within one week once administration of the inducer is stopped. For example, the expression of the transgene goes to an expression level that is no more than 50%, no more than 45%, no more than 40%, no more than 35%, no more than 30%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10%, or no more than 5% higher than the background expression level of the transgene prior to first induction within one week stopping the administration of the inducer.

[0096] In some embodiments, the inducer (or inducers) is administered two or more (e.g., 3,4, 5, 6, 7, 8, 9, 10 or more) times and the expression of the transgene goes down to the background level after the last administration of the inducer. For example, the inducer is administered two or more (e.g., 3, 4, 5, 6, 7, 8, 9, 10 or more) times and the expression of the transgene goes to an expression level that is no more than 50%, no more than 45%, no more than 40%, no more than 35%, no more than 30%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10%, or no more than 5% higher than the background expression level of the transgene prior to first induction within one week after the last administration of the inducer.

[0097] In some embodiments, the administration of the first inducer (e.g., artemisinin, a derivative of artemisinin, or a flavonoid compound such as flavone) increases the transgene expression level to a maximum at about 24 hours. For example, the transgene expression reaches a maximum level at about 24 hours after administration of the inducer and declines thereafter, without the administration of additional inducer.

[0098] In some embodiments, the administration of the second inducer (e.g., artemisinin, a derivative of artemisinin, or a flavonoid compound such as flavone) and / or a subsequent administration of inducer (e.g., artemisinin, a derivative of artemisinin, or a flavonoid compound such as flavone) has similar induction profile as seen with the first inducer for at least about 1 month, or at least about 2 months, or at least about 3 months, or at least about 5 months, or at least about six months, or at least one year, or even longer.

[0099] In some embodiments, the transgene expression level after the first or a subsequent administration is at least about 50-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, at least about 600-fold, at least about 700-fold, at least about 800-fold, at least about 900-fold, at least about 1000-fold, at least about 1100-fold, at least about 1200-fold, at least about 1300-fold, at least about 1400-fold, at least about 1500-fold, at least about 1600-fold, at least about 1700-fold, at least about 1800-fold, at least about 1900-fold, at least about 1000-fold, or higher than the level prior to the first or subsequent administration. In some embodiments, the transgene expression level after the first or a subsequent administration is at least 50-fold, at least 100-fold, at least 200-fold, at least 300-fold, at least 400- fold, at least 500-fold, at least 600-fold, at least 700-fold, at least 800-fold, at least 900-fold, at least 1000-fold, at least 1100-fold, at least 1200-fold, at least 1300-fold, at least 1400-fold, at least 1500- fold, at least 1600-fold, at least 1700-fold, at least 1800-fold, at least about 1900-fold, at least 1000- fold, or higher than the level prior to the first or subsequent administration.

[0100] In some embodiments, the transgene expression level at about 24 hours after the first or a subsequent administration is at least about 25-fold, at least about 50 fold, at least about 75- fold, at least about 100-fold, at least about 125-fold, at least about 150-fold, at least about 175-fold,at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, at least about 600-fold, at least about 700-fold, at least about 800-fold, at least about 900-fold, at least about 1000-fold, at least about 1100-fold, at least about 1200-fold, at least about 1300-fold, at least about 1400-fold, at least about 1500-fold, at least about 1600-fold, at least about 1700-fold, at least about 1800-fold, at least about 1900-fold, at least about 1000-fold, or higher than the level prior to the first or subsequent administration. In some embodiments, the transgene expression level at about 24 hours after the first or a subsequent administration is at least 25-fold, at least 50 fold, at least 75-fold, at least 100-fold, at least 125-fold, at least 150-fold, at least 175-fold, at least 200- fold, at least 300-fold, at least 400-fold, at least 500-fold, at least 600-fold, at least 700-fold, at least 800-fold, at least 900-fold, at least 1000-fold, at least 1100-fold, at least 1200-fold, at least 1300- fold, at least 1400-fold, at least 1500-fold, at least 1600-fold, at least 1700-fold, at least 1800-fold, at least about 1900-fold, at least 1000-fold, or higher than the level prior to the first or subsequent administration.

[0101] In some embodiments, the predetermined level of transgene expression level is at least about 50-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, at least about 600-fold, at least about 700-fold, at least about 800- fold, at least about 900-fold, at least about 1000-fold, at least about 1100-fold, at least about 1200- fold, at least about 1300-fold, at least about 1400-fold, at least about 1500-fold, at least about 1600- fold, at least about 1700-fold, at least about 1800-fold, at least about 1900-fold, at least about 1000- fold, or higher than the level prior to the first administration. In some embodiments, the predetermined level of transgene expression level is at least 50-fold, at least 100-fold, at least 200- fold, at least 300-fold, at least 400-fold, at least 500-fold, at least 600-fold, at least 700-fold, at least 800-fold, at least 900-fold, at least 1000-fold, at least 1100-fold, at least 1200-fold, at least 1300- fold, at least 1400-fold, at least 1500-fold, at least 1600-fold, at least 1700-fold, at least 1800-fold, at least about 1900-fold, at least 1000-fold, or higher than the level prior to the first administration.Dosing

[0102] Where more than one administration of an inducer(s) is administered (e.g., at a second or any subsequent time point), the second time point, or any subsequent time point is at least 12 hours after the inducer administration at the first time point, or the previous time point. For example, where more than one administration of the inducer is administered, the second time point, or any subsequent time point is at least 18 hours, at least 24 hours, at least 30 hours, at least 36 hours, at least 42 hours, at least 48 hours, at least 54 hours, at least 60 hours, at least 66 hours, or at least 72 hours after the first time point, or the previous time point. In some embodiments, where more than one administration of the inducer(s) is administered, the second time point, or anysubsequent time point is at least 24 hours, at least after 36 hours, at least 42 hours, at least 48 hours, at least 72 hours, at least 1 week, at least 10 days, at least 2 weeks, at least 3 weeks, or at least 4 weeks after the first time point, or the previous time point. In some embodiments, where more than one administration of the inducer(s) is administered, the second time point, or any subsequent time point is at least at least 24 hours after the first time point, or the previous time point. In some embodiments, where more than one administration of the inducer(s) is administered, the second time point, or any subsequent time point is at least at least 72 hours after the first time point, or the previous time point. In some embodiments, where more than one administration of the inducer(s) is administered, the second time point, or any subsequent time point is at least at least 1 week after the first time point, or the previous time point. In some embodiments, where more than one administration of the inducer(s) is administered, the second time point, or any subsequent time point is at least at least 2 weeks after the first time point, or the previous time point.

[0103] In some embodiments, the inducer (or inducers) is administered two or more (e.g., 3, 4, 5, 6, 7, 8, 9, 10 or more) times.

[0104] In some embodiments, where more than one administration of the inducer is administered, the second time point, or any subsequent time point is at least after one week, at least two weeks, at least three weeks, at least four weeks, five weeks, six weeks, seven weeks, eight weeks or more after the first time point, or the previous time point. In some embodiments, the subsequent administration is based upon need of the subject such as a flare-up of a condition the transgene expression product treats. For example, a particular antibody, such as a TNF-a antibody. Some exemplary non-limiting examples where the subsequent administration is based upon need of the subject include, but are not limited to inducing anti-inflammatory antibodies when there is a flare up of the inflammatory condition, inducing a transgene product that has on-target toxicity; inducing transient expression of anti-cancer biologic, e.g., antibody, bispecific, or cytokine; inducing GLP1 for diabetes and / or, weight loss; inducing transient expression of growth factors to initiate nerve or other tissue regeneration in acute spinal cord injury or other injuries. For example, where more than one administration of the inducer(s) is administered, the second time point, or any subsequent time point is at least one month, two months, three months, four months, five months, six months, seven months, eight months, nine months, eleven months, a year or longer after the first time point, or the previous time point.

[0105] In some embodiments, where more than one administration of the inducer(s) is administered, the second time point, or a subsequent time point is within two months of the first time point, or the previous time point. For example, where more than one administration of the inducer(s) is administered, the second time point, or any subsequent time point is within one month of the first time point, or the previous time point. In some embodiments, where more than oneadministration of the inducer(s) is administered, the second time point, or any subsequent time point is within seven weeks, within six weeks, within five weeks, within four weeks, within three weeks or within two weeks of the first time point, or the previous time point. Subsequent administrations can be longer.

[0106] In some embodiments, where more than one administration of the inducer(s) is administered, the second time point, or a subsequent time point is within 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days, 3 days or 2 days of the first time point, or the previous time point. In some embodiments of any one of the aspects described herein, where more than one administration of the inducer(s) is administered, the second time point, or any subsequent time point is 96 hours, 90 hours, 84 hours, or 78 hours of the first time point, or the previous time point. For example, where more than one administration of the inducer(s) is administered, the second time point, or a subsequent time point is within 72 hours, within 66 hours, within 60 hours, within 54 hours, within 48 hours, within 42 hours, or within 36 hours of the first time point, or the previous time point. In some embodiments, where more than one administration of the inducer(s) is administered, the second time point, or a subsequent time point is within 12-36 hours, e.g., within 20-28 hours of the first time point, or the previous time point. For example, where more than one administration of the inducer(s) is administered, the second time point, or a subsequent time point is within about 24 hours of the first time point, or the previous time point.

[0107] In some embodiments of any one of the aspects described herein, where more than one administration of the inducer(s) is administered, the second time point, or a subsequent time point is least 24 hours after and within two weeks of the first time point in a given regimen, or the previous time point. For example, where more than one administration of the inducer(s) is administered, the second time point, or any subsequent time point is at least 30 hours, at least 36 hours, at least 42 hours, at least 48 hours, at least 54 hours, at least 60 hours, at least 66 hours, or at least 72 hours after and within 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days, 3 days or 2 days of the first time point, or the previous time point. In some embodiments, where more than one administration of the inducer(s) is administered, the second time point, or any subsequent time point is at least after 36 hours, e.g., at least 42 hours or at least 48, at least 54 hours, at least 66 hours, at least 72 hours, at least 80 hours, at least 88 hours or at least 96 hours of the first time point, or the previous time point.

[0108] In some embodiments, where more than one administration of the inducer(s) is administered, the second time point, or any subsequent time point is at least 36 hours after the first time point, or the previous time point. For example, where more than one administration of the inducer(s) is administered, the second time point, or any subsequent time point is least 48 hours after or at least 72 hours after the first time point, or the previous time point.

[0109] In some embodiments, where more than one administration of the inducer(s)is administered, the time between administrations is 5-7 days. In some embodiments, where more than one administration of the inducer(s)is administered, the time between administrations is 5-10 days. In some embodiments, where more than one administration of the inducer(s)is administered, the time between administrations is 7-10 days. In some embodiments, where more than one administration of the inducer(s)is administered, the time between administrations is 7-14 days. In some embodiments, where more than one administration of the inducer(s)is administered, the time between administrations is 10-14 days. In some embodiments, where more than one administration of the inducer(s)is administered, the time between administrations is 10-20 days. In some embodiments, where more than one administration of the inducer(s)is administered, the time between administrations is 14-21 days. In some embodiments, where more than one administration of the inducer(s)is administered, the time between administrations is 14-28 days. In some embodiments, where more than one administration of the inducer(s)is administered, the time between administrations is 21-28 days. In some embodiments, where more than one administration of the inducer(s)is administered, the time between administrations is 21-34 days.

[0110] Times of administration can be periodic, as needed, or pulsed. This permits tailoring of both administration and dosing amounts. Administration is designed to prevent accumulation of proteins in a cell that can be detrimental to the cell.

[0111] In some embodiments, the at least second dose or at least third dose are administered when it is determined that the level of expression of the transgene is decreased to 75% or less, or 50% or less, or 25% or less of the level of expression of the transgene within the 24 hours after the first dose. In some embodiments, the at least second dose or at least third dose are administered when it is determined that the level of expression of the transgene is decreased to a background level of expression of the transgene. In some embodiments, the at least second dose or at least third dose are administered when it is determined that the level of expression of the transgene is decreased to a level of expression of the transgene prior to the first dose.

[0112] Generally, the inducer (or inducers) is administered in an amount sufficient to induce expression of the transgene from the expression cassette. In some embodiments, the inducer (or inducers) is administered at a dose from about 50 pg / kg to about 1000 mg / kg. For example, the inducer (or inducers) is used or given at a dose from about 75 pg / kg to about 900 mg / kg, from about 100 pg / kg to about 800 mg / kg, from about 150 pg / kg to about 700 mg / kg, from about 200 pg / kg to about 600 mg / kg, from about 250 pg / kg to about 250 mg / kg, from about 250 pg / kg to about 50 mg / kg, from about 100 pg / kg to about 1 mg / kg, or from about 1 mg / kg to about 80 mg / kg. In some embodiments, the inducer (or inducers) is administered at a dose from about 1 mg / kg to about 40 mg / kg. For example, the inducer (or inducers) is administered at a dose from about 1mg / kg to about 20 mg / kg, from about 1 mg / kg to about 10 mg / kg, or from about 1 mg / kg to about 6mg / kg. In some embodiments, the inducer (or inducers) is administered at a dose from about 1 mg / kg to about 80 mg / kg.

[0113] It is noted that an amount of inducer(s) administered at the second time point, or any subsequent time point can be about the same or different from the amount of the inducer(s) administered at the first time point, or the previous time point. In some embodiments, the second or subsequent dose of the inducer(s) can be determined using a dose-dependent relationship between the first or preceding dose of inducer(s) and the level of transgene expression from the expression cassette to achieve the desired level of expression of the transgene. For example, if the second administration, or any subsequent administration, is within a week or less of the prior administration, in one embodiment, the second or subsequent dose can be at a significant lower dose than the first dose, or the previous dose.

[0114] In some embodiments, the amount of inducer(s) administered at the second time point, or any subsequent time point is about the same as the amount of the inducer(s) administered at the first time point, or the previous time point. For example, the amount of inducer(s) administered at the second time point, or any subsequent time point is within about 10% (wt / wt or mol / mol) of the amount of the inducer administered at the first time point, or the previous time point. In some embodiments, the amount of inducer(s) administered at the second time point, or any subsequent time point is within about 7.5%, about 5%, about 2.5%, about 2%, about 1.5%, about 1%, or about 0.5%, (wt / wt or mol / mol) of the amount of the inducer(s) administered at the first time point, or the previous time point.

[0115] In some embodiments, the amount of inducer(s) administered at the second time point, or any subsequent time point is lower than the amount of the inducer(s) administered at the first time point, or the previous time point. For example, the amount of inducer(s) administered at the second time point, or any subsequent time point is at least about 10% (wt / wt or mol / mol) lower than the amount of the inducer(s) administered at the first time point, or the previous time point.

[0116] In some embodiments, the amount of inducer(s) administered at the second time point, or any subsequent time point is at least about 50% (wt / wt or mol / mol) lower than the amount of the inducer(s) administered at the first time point, or the previous time point. For example, the amount of inducer(s) administered at the second time point, or any subsequent time point is about 55%, at about 60%, about 65%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 98% (wt / wt or mol / mol) lower than the amount of the inducer(s) administered at the first time point, or the previous time point.

[0117] In some embodiments, the amount of inducer(s) administered at the second time point, or any subsequent time point is about half or less than half of the amount of the inducer(s)administered at the first time point, or the previous time point. For example, the amount of inducer(s) administered at the second time point, or any subsequent time point is about 1 / 2, 1 / 3, 1 / 4, 1 / 5, 1 / 6, 1 / 7, 1 / 8, 1 / 9, 1 / 10, 1 / 15, 1 / 20, 1 / 25, 1 / 30, 1 / 35, 1 / 40, 1 / 45, 1 / 50, 1 / 55, 1 / 60, 1 / 65, 1 / 70, 1 / 75, 1 / 80, 1 / 85, 1 / 90, 1 / 95, 1 / 100, 1 / 125, 1 / 150, 1 / 175, 1 / 200, 1 / 500, 1 / 1000 or less of the amount of the inducer(s) administered at the first time point, or the previous time point. In some embodiments, the amount of inducer(s) administered at the second time point, or any subsequent time point is about 1 / 2, 1 / 4, 1 / 5, 1 / 8, 1 / 10, 1 / 20, 1 / 40, 1 / 80 or less than the amount of the inducer(s) administered at the first time point, or the previous time point.

[0118] In some embodiments, the amount of inducer(s)administered at the second time point, or any subsequent time point is decreased by about 5 mg / kg, about 10 mg / kg, about 20 mg / kg, about 30 mg / kg, about 40 mg / kg or more compared to the amount of the inducer(s)administered at the first time point, or the previous time point. In some embodiments, the amount of inducer(s)administered at the second time point, or any subsequent time point is decreased by 5 mg / kg, 10 mg / kg, 20 mg / kg, 30 mg / kg, 40 mg / kg or more compared to the amount of the inducer(s)administered at the first time point, or the previous time point.

[0119] In some embodiments of any of the aspects, the decreased subsequent dose is sufficient to attain the predetermined level of transgene expression.

[0120] In some embodiments, the amount of inducer(s) administered at the second time point, or any subsequent time point is higher than the amount of the inducer(s) administered at the first time point, or the previous time point. For example, the amount of inducer(s) administered at the second time point, or any subsequent time point is at least about 10% (wt / wt or mol / mol) higher than the amount of the inducer(s) administered at the first time point, or the previous time point. In some embodiments, the amount of inducer(s) administered at the second time point, or any subsequent time point is at least 25%, 50%, about 75%, about 1-fold, about 1.2-folds, about 1.25- folds, about 1.3-folds, about 1.5-folds, about 1.75-folds, about 2-folds, about 2.25-folds, about 2.5- folds, about 2.5-folds, about 2.75-folds, about 3-folds, 4-fold, 5-fold, 6-folds, 7-fold, 8-fold, 9- folds, 10-folds or higher than the amount of the inducer(s) administered at the first time point, or the previous time point.

[0121] In some embodiments, the amount of inducer(s) administered at each subsequent time point is lower than the amount of the inducer(s) administered at an immediate previous time point and the amount of inducer(s) administered at the last time point is higher than the amount of the inducer(s) administered at the immediate previous time point. Generally, the inducer (or inducers) is administered in an amount sufficient to induce expression of the transgene from the expression cassette. In some embodiments, the inducer (or inducers) is administered at a dose from about 50 pg / kg to about 1000 mg / kg. For example, the inducer (or inducers) is used or given at a dose fromabout 75 pg / kg to about 900 mg / kg, from about 100 pg / kg to about 800 mg / kg, from about 150 pg / kg to about 700 mg / kg, from about 200 pg / kg to about 600 mg / kg, from about 250 pg / kg to about 250 mg / kg, from about 250 pg / kg to about 50 mg / kg, from about 100 pg / kg to about 1 mg / kg, or from about 1 mg / kg to about 80 mg / kg. In some embodiments, the inducer (or inducers) is administered at a dose from about 1 mg / kg to about 40 mg / kg. For example, the inducer (or inducers) is administered at a dose from about 1 mg / kg to about 20 mg / kg, from about 1 mg / kg to about 10 mg / kg, or from about 1 mg / kg to about 6mg / kg. In some embodiments, the inducer (or inducers) is administered at a dose from about 1 mg / kg to about 80 mg / kg

[0122] In some embodiments, the inducer(s) is administered at the second time point, or any subsequent time point at a dose from about 1 mg / kg to 80 mg / kg. For example, the inducer(s) can be administered at a dose of about 1 mg / kg, about 5 mg / kg, about 6 mg / kg, about 10 mg / kg, about 20 mg / kg, about 30 mg / kg, about 40 mg / kg, about 50 mg / kg, about 60 mg / kg, about 70 mg / kg, or about 80 mg / kg.

[0123] In some embodiments, the inducer(s) is administered at the first time point, or the previous time point at a dose from about 0.5 mg / kg to 15 mg / kg. For example, the inducer(s) is administered at the first time point, or the previous time point at a dose from about 0.75 mg / kg to about 15 mg / kg or from about 1 mg / kg to 10 mg / kg. In some embodiments the inducer(s) is administered at the first time point, or the previous time point at a dose of about 1 mg / kg, about 1.5 mg / kg, about 2 mg / kg, about 2.5 mg / kg, about 3 mg / kg, about 3.5 mg / kg, about 4 mg / kg, about 4.5 mg / kg, about 5 mg / kg, about 5.5 mg / kg, about 6 mg / kg, about 6.5 mg / kg, about 7 mg / kg, about 7.5 mg / kg, about 8 mg / kg, about 8.5 mg / kg, about 9 mg / kg, about 9.5 mg / kg, about 10 mg / kg, about 10.5 mg / kg, about 11 mg / kg, about 11.5 mg / kg, about 12 mg / kg, 12.5 mg / kg, about 13 mg / kg, about 13.5 mg / kg, about 14 mg / kg, about 14.5 mg / kg, or about 15 mg / kg.

[0124] In some embodiments, the inducer(s) is administered at each administration at a dose of no more than about 10 mg / kg. For example, the inducer(s) is administered at each administration at a dose of no more than about 10 mg / kg, no more than lOmg / kg, no more than about 5 mg / kg, or no more than 5 mg / kg.

[0125] In some embodiments, the first dose, second dose, third dose, and / or subsequent doses of the inducer(s) are administered at a dose of at least about 5 mg / kg. For example, the first dose, second dose, third dose, and / or subsequent doses of the inducer(s) are administered at a dose of at least about 5 mg / kg, of at least 5 mg / kg, of at least about 6 mg / kg, or at least 6 mg / kg.

[0126] In some embodiments, the first dose, second dose, third dose, and / or subsequent doses of the inducer(s) are administered at a dose of about 1 mg / kg to about 80 mg / kg. In some embodiments, the first dose, second dose, third dose, and / or subsequent doses of the inducer(s) are administered at a dose of 1 mg / kg to 80 mg / kg. In some embodiments, the first dose, second dose,third dose, and / or subsequent doses of the inducer(s) are administered at a dose of about 5 mg / kg to about 80 mg / kg. In some embodiments, the first dose, second dose, third dose, and / or subsequent doses of the inducer(s) are administered at a dose of 5 mg / kg to 80 mg / kg.

[0127] In some embodiments, the second dose, third dose, and / or subsequent doses of the inducer(s) are administered at a dose of no more than about 10 mg / kg. For example, the second dose, third dose, and / or subsequent doses of the inducer(s) are administered at a dose of no more than about 10 mg / kg, no more than lOmg / kg, no more than about 5 mg / kg, or no more than 5 mg / kg.

[0128] In some embodiments, the second dose, third dose, and / or subsequent doses of the inducer(s) are administered at a dose of about 1 mg / kg to about 80 mg / kg. In some embodiments, the second dose, third dose, and / or subsequent doses of the inducer(s) are administered at a dose of 1 mg / kg to 80 mg / kg. In some embodiments, the second dose, third dose, and / or subsequent doses of the inducer(s) are administered at a dose of about 5 mg / kg to about 80 mg / kg. In some embodiments, the second dose, third dose, and / or subsequent doses of the inducer(s) are administered at a dose of 5 mg / kg to 80 mg / kg. In some embodiments, the second dose, third dose, and / or subsequent doses of the inducer(s) are administered at a dose of about 10 mg / kg to about 80 mg / kg. In some embodiments, the second dose, third dose, and / or subsequent doses of the inducer(s) are administered at a dose of 10 mg / kg to 80 mg / kg. In some embodiments, the second dose, third dose, and / or subsequent doses of the inducer(s) are administered at a dose of about 5 mg / kg to about 20 mg / kg. In some embodiments, the second dose, third dose, and / or subsequent doses of the inducer(s) are administered at a dose of 5 mg / kg to 20 mg / kg. In some embodiments, the second dose, third dose, and / or subsequent doses of the inducer(s) are administered at a dose of about 5 mg / kg to about 10 mg / kg. In some embodiments, the second dose, third dose, and / or subsequent doses of the inducer(s) are administered at a dose of 5 mg / kg to 10 mg / kg.

[0129] In some embodiments, the first dose is 1-80 mg / kg, the second dose is 1-40 mg / kg, and / or the subsequent dose (e.g., third dose) is 1-40 mg / kg. In some embodiments, the first dose is 1-80 mg / kg, the second dose is 1-40 mg / kg, and the subsequent dose (e.g., the third dose) is 1-40 mg / kg.

[0130] In some embodiments, the administering comprises: administering a plurality of doses of a first inducer during a period of 2 to 4 weeks; administering 1 or 2 doses of a second inducer; and administering at least 1 dose of a third inducer. In some embodiments, the administering comprises: administering a plurality of doses of a first inducer during a period of 2 to 4 weeks, wherein each dose of the first inducer is 1-200 mg / kg; administering 1 or 2 doses of a second inducer, wherein each dose of the second inducer is 1-100 mg / kg; administering at least 1 dose of a third inducer, wherein each dose of the third inducer is 1-80 mg / kg. In some embodiments, theadministering comprises: administering a plurality of doses of a first inducer during a period of 2 to 4 weeks, wherein each dose of the first inducer is 160 mg / kg; administering 1 or 2 doses of a second inducer, wherein each dose of the second inducer is 80 mg / kg; administering at least 1 dose of a third inducer, wherein each dose of the third inducer is 40 mg / kg.

[0131] In some embodiments, a dose of the third inducer is administered until the subject no longer requires the expression of the transgene. In some embodiments, the method further comprises repeating the first and / or second administering step if the subject becomes non- responsive to the inducer(s). In some embodiments, the method further comprises repeating the administration of the first inducer and / or second inducer if the subject becomes non-responsive to the third inducer.

[0132] It is noted that the amount of inducer(s) administered to the subject can be varied over time by adjusting the dose, adjusting the time period between doses, or both. Thus, for example, to increase the amount of inducer(s) administered to a subject the dose can be increased while the time period between doses is kept constant, the dose can be kept constant while the time period between doses is reduced, or the dose can be increased and the time period between doses is reduced. To decrease the amount of inducer(s) administered to a subject the dose can be decreased while the time period between doses is kept constant, the dose can be kept constant while the time period between doses is reduced, or the dose can be decreased and the time period between doses is increased.

[0133] It is also noted that the inducer(s) is administered at the second time point, or any subsequent time point can be same as the inducer(s) administered at the first time point, or the previous time point. For example, the inducer(s) administered at the first time point, or the previous time point can be artemisinin and the inducer(s) is administered at the second time point, or any subsequent time point can be an artemisinin derivative. Alternatively, the inducer(s) administered at the first time point, or the previous time point can be an artemisinin derivative and the inducer(s) is administered at the second time point, or any subsequent time point can artemisinin. In another non-limiting example, the inducer(s) administered at the first time point, or the previous time point can be artemisinin or a derivative, and the inducer(s) administered at the second time point, or any subsequent time point can be same or different. For example, the inducer(s) can be a second artemisinin derivative, e.g., artesunate, artemether, dihydroartemisinin, a-dihydroartemisinin P-glucoronide, artemisone, arteether, artenimol, artesunic acid, artelinic acid, deoxyartemisinin, deoxy dihydroartemisinin, 9, 10-dihydrodeoxyaremisinin, artemotil, and artemiside, or any inducer such as a flavonoid compound, e.g. flavone, chrysin, baicalein, or galangin; l,4-Bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP); phenobarbital (PB); 6- (4Chlorophenyl)imidazo[2,l-b][l,3]thiazole-5-carbaldehyde-O-(3,4-dichlorobenzyl)oxime(CITCO); Acetaminophen; Buprenorphine; Phenytoin; Carbamazepine; Valproic Acid; Chlorpromazine; Efavirenz; Nevirapine; Rilpivirine; Etravirine; Diazepam; Cyclophosphamid; Ifosfamide; Cerivastatin; Simvastatin; lovastatin; substituted sulphonamides; Thiazolidin-4-one; Estradiol; Estrone and analogues; I 7a-ethinyl-3; l 7b-estradiol (EE2); Dehydroepiandrost erone (DHEA); 5B-pregnane-3, 20-dione; Diethylstilbestrol; Gingko biloba extract; Galangin; chrysin; baicalein; Diallyl sulphide; Ellagic acid; Resveratrol; Squalestatin-1; Bilobalide; Triclocarban; Triclosan; Dichlorodiphenyltrichloroethane (DDT); Dieldrin; Methoxychlor; Metofluthrin; Permethrin; Pyrethrins; Sulfoxaflor; Diethylhexyl phthalate (DEHP); Cyproconazole; Fluconazole; Propiconazole; FL81; Tri-p-methylphenyl phosphate (TMPP); UM104; or UM145.

[0134] In some embodiments, the inducer(s) administered at the first time point, or the previous time point can be a flavonoid compound, and the inducer(s) administered at the second time point, or any subsequent time point can be same or different. For example, the inducer(s) administered at the first time point, or the previous time point can be flavone, baicalein, chrysin, galangin, (OH)4 flavone, 6-hydroxyluteolin, acacetin, acerosin, alnetin, apigenin, apiin, artocarpetin, baicalein, beta-sitosterol, biochamin A, cannaflavin A, cannflavin A, cannflavin B, cannflavin C, catechin, catechin-3 -gallate, cerrosillin, chrysoeriol, chrysoeriol, cirsilineol, cirsiliol, cirsimaritin, corymbosin, cupressuflavone, cyanidine, daidzein, datiscetin, delphinidine, digidrokempferol , dihydroquercetin, diosmetin, diosmin, echioidinin, epicatechin, epicatechin-3 - gallate, epigallocatechin, epigallocatechin-3 -gallate, eriodiktiol, eupatilin, eupatorin, fisetin, fizetin, flavonol, formononetin, fortunelin, gallocatechin, gallocatechin-3 -gallate, gardenin D, genistein, genistin, genkwanin, geraldol, geraldone, glycitein, glycitin, gomoeriodiktiol, gossypetin, hesperetin, hinokiflavone, hispidulin, hymenoxin, hypolaetin, isoquercetin, isorhamnetin, isorhamnetin, isoscutellarein, isovitexin, jaceosidin, kaempferol, kaempferol, kampferide, largonidin, luteolin, luteolin, malvidine, mikanin, morin, myricetin, myricetin, naringenin, negletein, neodiosmin, nepetin, nevadensin, nobiletin, nodifloretin, norartocarpetin, norwogonin, onopordin, orientin, oroxylin a, pachipodol, pectolinarigenin, pedalitin, peonidin, petunidin, pilloin, pratol, primetin, primuletin, pruentin, quercetagetin, quercetin, ramnazin, rhoifolin, robinetin, rutin, scaposin, scutellarein, serpyllin, sinensetin, sorbifolin, sudachitin, tangeretin, tangeritin, taxifolin, tectochrysin, tithonine, tricetin, tricin, velutin, vitexin, wightin, wogonin, xanthomicrol, zapotin, zapotinin, 6,7,4’-trishydroxy isoflavone, 7,3 ’4’ -trihydroxy isoflavone, or a pharmaceutically acceptable salt thereof. In some embodiments, the inducer(s) administered at the first time point, or the previous time point is flavone.

[0135] In some embodiments, the inducer(s) administered at the first time point, or the previous time point can be a flavonoid compound and the inducer(s) administered at the second time point, or any subsequent time point can be artemisinin. For example, the inducer(s)administered at the first time point, or the previous time point can be can be flavone, baicalein, chrysin, galangin, (OH)4 flavone, 6-hydroxyluteolin, acacetin, acerosin, alnetin, apigenin, apiin, artocarpetin, baicalein, beta-sitosterol, biochamin A, cannaflavin A, cannflavin A, cannflavin B, cannflavin C, catechin, catechin-3 -gallate, cerrosillin, chrysoeriol, chrysoeriol, cirsilineol, cirsiliol, cirsimaritin, corymbosin, cupressuflavone, cyanidine, daidzein, datiscetin, delphinidine, digidrokempferol , dihydroquercetin, diosmetin, diosmin, echioidinin, epicatechin, epicatechin-3 - gallate, epigallocatechin, epigallocatechin-3 -gallate, eriodiktiol, eupatilin, eupatorin, fisetin, fizetin, flavonol, formononetin, fortunelin, gallocatechin, gallocatechin-3 -gallate, gardenin D, genistein, genistin, genkwanin, geraldol, geraldone, glycitein, glycitin, gomoeriodiktiol, gossypetin, hesperetin, hinokiflavone, hispidulin, hymenoxin, hypolaetin, isoquercetin, isorhamnetin, isorhamnetin, isoscutellarein, isovitexin, jaceosidin, kaempferol, kaempferol, kampferide, largonidin, luteolin, luteolin, malvidine, mikanin, morin, myricetin, myricetin, naringenin, negletein, neodiosmin, nepetin, nevadensin, nobiletin, nodifloretin, norartocarpetin, norwogonin, onopordin, orientin, oroxylin a, pachipodol, pectolinarigenin, pedalitin, peonidin, petunidin, pilloin, pratol, primetin, primuletin, pruentin, quercetagetin, quercetin, ramnazin, rhoifolin, robinetin, rutin, scaposin, scutellarein, serpyllin, sinensetin, sorbifolin, sudachitin, tangeretin, tangeritin, taxifolin, tectochrysin, tithonine, tricetin, tricin, velutin, vitexin, wightin, wogonin, xanthomicrol, zapotin, zapotinin, 6,7,4’-trishydroxy isoflavone, 7,3 ’4’ -trihydroxy isoflavone, or a pharmaceutically acceptable salt thereof; and the inducer(s) administered at the second time point, or any subsequent time point can be artemisinin, optionally, the inducer(s) administered at the first time point, or the previous time point can be flavone and the inducer(s) administered at the second time point, or any subsequent time point can be artemisinin.

[0136] In some embodiments, the inducer(s) administered at the first time point, or the previous time point can be artemisinin and the inducer(s) is administered at the second time point, or any subsequent time point can be a flavonoid compound, e.g., flavone. For example, the inducer(s) administered at the first time point, or the previous time point can be artemisinin and the inducer(s) is administered at the second time point, or any subsequent time point can be flavone, baicalein, chrysin, galangin, (OH)4 flavone, 6-hydroxyluteolin, acacetin, acerosin, alnetin, apigenin, apiin, artocarpetin, baicalein, beta-sitosterol, biochamin A, cannaflavin A, cannflavin A, cannflavin B, cannflavin C, catechin, catechin-3 -gallate, cerrosillin, chrysoeriol, chrysoeriol, cirsilineol, cirsiliol, cirsimaritin, corymbosin, cupressuflavone, cyanidine, daidzein, datiscetin, delphinidine, digidrokempferol , dihydroquercetin, diosmetin, diosmin, echioidinin, epicatechin, epicatechin-3 -gallate, epigallocatechin, epigallocatechin-3 -gallate, eriodiktiol, eupatilin, eupatorin, fisetin, fizetin, flavonol, formononetin, fortunelin, gallocatechin, gallocatechin-3 -gallate, gardenin D, genistein, genistin, genkwanin, geraldol, geraldone, glycitein, glycitin, gomoeriodiktiol,gossypetin, hesperetin, hinokiflavone, hispidulin, hymenoxin, hypolaetin, isoquercetin, isorhamnetin, isorhamnetin, isoscutellarein, isovitexin, jaceosidin, kaempferol, kaempferol, kampferide, largonidin, luteolin, luteolin, malvidine, mikanin, morin, myricetin, myricetin, naringenin, negletein, neodiosmin, nepetin, nevadensin, nobiletin, nodifloretin, norartocarpetin, norwogonin, onopordin, orientin, oroxylin a, pachipodol, pectolinarigenin, pedalitin, peonidin, petunidin, pilloin, pratol, primetin, primuletin, pruentin, quercetagetin, quercetin, ramnazin, rhoifolin, robinetin, rutin, scaposin, scutellarein, serpyllin, sinensetin, sorbifolin, sudachitin, tangeretin, tangeritin, taxifolin, tectochrysin, tithonine, tricetin, tricin, velutin, vitexin, wightin, wogonin, xanthomicrol, zapotin, zapotinin, 6,7,4’-trishydroxy isoflavone, 7,3 ’4’ -trihydroxy isoflavone, or a pharmaceutically acceptable salt thereof, optionally, the inducer(s) administered at the first time point, or the previous time point can be artemisinin and the inducer(s) administered at the second time point, or any subsequent time point can be flavone.

[0137] In some embodiments, the inducer(s) administered at the first time point, or the previous time point can be a flavonoid compound and the inducer(s) is administered at the second time point, or any subsequent time point can be an artemisinin derivative. For example, For example, the inducer(s) administered at the first time point, or the previous time point can be can be flavone, baicalein, chrysin, galangin, (OH)4 flavone, 6-hydroxyluteolin, acacetin, acerosin, alnetin, apigenin, apiin, artocarpetin, baicalein, beta-sitosterol, biochamin A, cannaflavin A, cannflavin A, cannflavin B, cannflavin C, catechin, catechin-3 -gallate, cerrosillin, chrysoeriol, chrysoeriol, cirsilineol, cirsiliol, cirsimaritin, corymbosin, cupressuflavone, cyanidine, daidzein, datiscetin, delphinidine, digidrokempferol , dihydroquercetin, diosmetin, diosmin, echioidinin, epicatechin, epicatechin-3 -gallate, epigallocatechin, epigallocatechin-3 -gallate, eriodiktiol, eupatilin, eupatorin, fisetin, fizetin, flavonol, formononetin, fortunelin, gallocatechin, gallocatechin-3 -gallate, gardenin D, genistein, genistin, genkwanin, geraldol, geraldone, glycitein, glycitin, gomoeriodiktiol, gossypetin, hesperetin, hinokiflavone, hispidulin, hymenoxin, hypolaetin, isoquercetin, isorhamnetin, isorhamnetin, isoscutellarein, isovitexin, jaceosidin, kaempferol, kaempferol, kampferide, largonidin, luteolin, luteolin, malvidine, mikanin, morin, myricetin, myricetin, naringenin, negletein, neodiosmin, nepetin, nevadensin, nobiletin, nodifloretin, norartocarpetin, norwogonin, onopordin, orientin, oroxylin a, pachipodol, pectolinarigenin, pedalitin, peonidin, petunidin, pilloin, pratol, primetin, primuletin, pruentin, quercetagetin, quercetin, ramnazin, rhoifolin, robinetin, rutin, scaposin, scutellarein, serpyllin, sinensetin, sorbifolin, sudachitin, tangeretin, tangeritin, taxifolin, tectochrysin, tithonine, tricetin, tricin, velutin, vitexin, wightin, wogonin, xanthomicrol, zapotin, zapotinin, 6,7,4’-trishydroxy isoflavone, 7,3’4’-trihydroxy isoflavone, or a pharmaceutically acceptable salt thereof; and the inducer(s) administered at the second time point, or any subsequent time point can be an artemisininderivative, optionally, the inducer(s) administered at the first time point, or the previous time point can be flavone and the inducer(s) administered at the second time point, or any subsequent time point can be artesunate, artemether, dihydroartemisinin, a-dihydroartemisinin P-glucoronide, artemisone, arteether, artenimol, artesunic acid, artelinic acid, deoxyartemisinin, deoxy dihydroartemisinin, 9, 10-dihydrodeoxyaremisinin, artemotil, or artemiside,

[0138] In some embodiments, the inducer(s) administered at the first time point, or the previous time point can be an artemisinin derivative and the inducer(s) is administered at the second time point, or any subsequent time point can be a flavonoid compound. For example, the inducer(s) administered at the first time point, or the previous time point can be an artemisinin derivative and the inducer(s) is administered at the second time point, or any subsequent time point can be flavone, baicalein, chrysin, galangin, (OH)4 flavone, 6-hydroxyluteolin, acacetin, acerosin, alnetin, apigenin, apiin, artocarpetin, baicalein, beta-sitosterol, biochamin A, cannaflavin A, cannflavin A, cannflavin B, cannflavin C, catechin, catechin-3 -gallate, cerrosillin, chrysoeriol, chrysoeriol, cirsilineol, cirsiliol, cirsimaritin, corymbosin, cupressuflavone, cyanidine, daidzein, datiscetin, delphinidine, digidrokempferol , dihydroquercetin, diosmetin, diosmin, echioidinin, epicatechin, epicatechin-3 -gallate, epigallocatechin, epigallocatechin-3 -gallate, eriodiktiol, eupatilin, eupatorin, fisetin, fizetin, flavonol, formononetin, fortunelin, gallocatechin, gallocatechin-3 -gallate, gardenin D, genistein, genistin, genkwanin, geraldol, geraldone, glycitein, glycitin, gomoeriodiktiol, gossypetin, hesperetin, hinokiflavone, hispidulin, hymenoxin, hypolaetin, isoquercetin, isorhamnetin, isorhamnetin, isoscutellarein, isovitexin, jaceosidin, kaempferol, kaempferol, kampferide, largonidin, luteolin, luteolin, malvidine, mikanin, morin, myricetin, myricetin, naringenin, negletein, neodiosmin, nepetin, nevadensin, nobiletin, nodifloretin, norartocarpetin, norwogonin, onopordin, orientin, oroxylin a, pachipodol, pectolinarigenin, pedalitin, peonidin, petunidin, pilloin, pratol, primetin, primuletin, pruentin, quercetagetin, quercetin, ramnazin, rhoifolin, robinetin, rutin, scaposin, scutellarein, serpyllin, sinensetin, sorbifolin, sudachitin, tangeretin, tangeritin, taxifolin, tectochrysin, tithonine, tricetin, tricin, velutin, vitexin, wightin, wogonin, xanthomicrol, zapotin, zapotinin, 6,7,4’-trishydroxy isoflavone, 7,3’4’-trihydroxy isoflavone, or a pharmaceutically acceptable salt thereof, optionally, the inducer(s) administered at the first time point, or the previous time point can be artesunate, artemether, dihydroartemisinin, a-dihydroartemisinin P-glucoronide, artemisone, arteether, artenimol, artesunic acid, artelinic acid, deoxyartemisinin, deoxy dihydroartemisinin, 9,10- dihydrodeoxyaremisinin, artemotil, or artemiside, and the inducer(s) administered at the second time point, or any subsequent time point can be flavone,

[0139] In another non-limiting example, the inducer(s) administered at the first time point, or the previous time point can be a flavonoid compound, e.g., flavone, and the inducer(s)administered at the second time point, or any subsequent time point can be l,4-Bis[2-(3,5- dichloropyridyloxy)]benzene (TCPOBOP); phenobarbital (PB); 6-(4Chlorophenyl)imidazo[2,l- b][l,3]thiazole-5-carbaldehyde-O-(3,4-dichlorobenzyl)oxime (CITCO); Acetaminophen; Buprenorphine; Phenytoin; Carbamazepine; Valproic Acid; Chlorpromazine; Efavirenz; Nevirapine; Rilpivirine; Etravirine; Diazepam; Cyclophosphamid; Ifosfamide; Cerivastatin; Simvastatin; lovastatin; substituted sulphonamides; Thiazolidin-4-one; Estradiol; Estrone and analogues; 17a-ethinyl-3;17B-estradiol (EE2); Dehydroepiandrost erone (DHEA); 513-pregnane- 3, 20-dione; Diethylstilbestrol; Gingko biloba extract; Galangin; chrysin; baicalein; Diallyl sulphide; Ellagic acid; Resveratrol; Squalestatin-1; Bilobalide; Triclocarban; Triclosan; Dichlorodiphenyltrichloroethane (DDT); Dieldrin; Methoxychlor; Metofluthrin; Permethrin; Pyrethrins; Sulfoxaflor; Diethylhexyl phthalate (DEHP); Cyproconazole; Fluconazole; Propiconazole; FL81; Tri-p-methylphenyl phosphate (TMPP); UM104; or UM145.

[0140] As used herein, the term “administer” refers to the placement of an inducer or expression cassette into a subject by a method or route which results in at least partial localization of the inducer or the expression cassette at a desired site such that desired effect, e.g., expression of the transgene is produced.

[0141] An inducer or exogenous nucleotide sequence (e.g., a vector comprising the exogenous nucleotide sequence) described herein can be administered by any appropriate route known in the art including, but not limited to, oral or parenteral routes, including intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), pulmonary, nasal, rectal, and topical (including buccal and sublingual) administration. Exemplary modes of administration include, but are not limited to, injection, infusion, instillation, inhalation, or ingestion. “Injection” includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrastemal injection and infusion. In some embodiments, administration will generally be systemic. In some other embodiments, administration will be local.

[0142] The phrases “parenteral administration” and “administered parenterally” as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrastemal injection, infusion and other injection or infusion techniques, without limitation. The phrases “systemic administration,” “administered systemically”, “peripheral administration” and “administered peripherally” as used herein mean the administration of apharmaceutical composition comprising an inducer such that it enters the subject's system and, thus, is subject to metabolism and other like processes, for example, subcutaneous administration.

[0143] In some embodiments, the inducer administration is intraperitoneal administration. In some embodiments, the administration of the inducer(s) administered at the first time point is intraperitoneal administration. In some embodiments, the administration of the inducer(s) administered at the second time point is intraperitoneal administration. In some embodiments, the administration of the inducer(s) administered at the first time point and the administration of the inducer(s) administered at the second time point are intraperitoneal administration. In some embodiments, the administration of the subsequent inducer(s) at subsequent time point(s) is intraperitoneal administration.

[0144] In some embodiments, the inducer administration is oral administration. In some embodiments, the administration of the inducer(s) administered at the first time point is oral administration. In some embodiments, the administration of the inducer(s) administered at the second time point is oral administration. In some embodiments, the administration of the inducer(s) administered at the first time point and the administration of the inducer(s) administered at the second time point are oral administration. In some embodiments, the administration of the subsequent inducer(s) at subsequent time point(s) is oral administration. Without limitations, oral administration can be in the form of solutions, suspensions, tablets, pills, capsules, sustained- release formulations, oral rinses, powders and the like.

[0145] In jurisdictions that forbid the patenting of methods that are practiced on the human body, the meaning of “administering” of an inducer or expression cassette to a human subject shall be restricted to prescribing a controlled substance that a human subject will be administer to the subject by any technique (e.g., orally, inhalation, topical application, injection, insertion, etc.). The broadest reasonable interpretation that is consistent with laws or regulations defining patentable subject matter is intended. In jurisdictions that do not forbid the patenting of methods that are practiced on the human body, the “administering” includes both methods practiced on the human body and also the foregoing activities.Inducible promoter

[0146] Embodiments of the various aspects described herein include an inducible promoter. Generally, the inducible promoter comprises a cis-regulatory motif (CRE) that is capable of being bound and activated by a heterodimer of constitutive androstane receptor (CAR) and retinoid X receptor (RXR).

[0147] Constitutive androstane receptor (CAR) is a member of the nuclear receptor superfamily, and it is a key regulator of xenobiotic and endobiotic metabolism. Unlike most nuclearreceptors, CAR is constitutively active in the absence of ligand and is regulated by both agonists and inverse agonists. Activation results in translocation of CAR from the cytosol into the nucleus, where the protein can bind to specific DNA sites, called response motifs. Binding occurs both as a monomer and together with the retinoid X receptor (RXR) resulting in activation or repression of target gene transcription. Retinoid X receptor (RXR) is a member of the nuclear receptor superfamily that is activated by 9-cis retinoic acid and 9-cis-13,14-dihydro-retinoic acid.

[0148] When CAR is activated (by either direct or indirect activation), it translocates to the nucleus where CAR and RXR form a heterodimer (referred to herein as “CAR-RXR heterodimer” or “CAR-RXR”) that can bind to an activate genes comprising an appropriate target sequence. The CAR-RXR heterodimer binds to and induces target genes via the PB-responsive enhancer module (PBREM). Accordingly, in some embodiments of any one of the aspects described herein, the CRE that is capable of being bound and activated by a CAR-RXR heterodimer comprises a PBREM element / enhancer, or a functional variant thereof. For example, the inducible promoter comprises at least one PBREM enhancer, e.g., a wild-type PBREM enhancer. In some embodiments, the inducible promoter comprises at least two or more (e.g., 2, 3, 4, 5 or more) PBREM enhancers. For example, the inducible promoter comprises two PBREM enhancers. Exemplary PBREM sequences include, but are not limited to, mouse PBREM sequence:TCTGTACTTTCCTGACCTTGGG4G4GTGCG4CCATCAACTTGCCTGACACC(SEQ ID NO: 1), and human PBREM sequence:ACTGTACTTTCCTGACCCTGA4GAGGTGGG4GCATGGACTTTCCTGAACCA(SEQ ID NO: 2)

[0149] PBREM is a 51 -bp DNA inducible enhancer consisting of two nuclear receptor DR4 motifs (NR1 and NR2) flanking a nuclear factor -1 (NF1) binding site. It has been proposed in the literature that the NR1 sequence is the binding site for the CAR-RXR heterodimer, and the remaining sequences are partially or completely redundant. A triple repeat of NR1 (was shown to remain inducible in Sueyoshi, et al. (J. BIOL. CHEM. Vol. 274,10, pp. 6043-6046, 1999). However, it is believed that parts other than NR1 may play a role in making the PBREM motif more specific and inducible (e.g., reducing background, constitutive expression and allowing from a greater magnitude of induction). In SEQ ID NO: 1 and SEQ ID NO: 2, the NR1 motif is underlined, the NF1 motif is in italics, and the NR2 motif is in bold.

[0150] In some embodiments of any one of the aspects described herein, the CRE that is capable of being bound and activated by a CAR-RXR heterodimer comprises each of an NR1 motif, an NF1 motif, and an NR2 motif. It is noted that the NR1 motif, the NF1 motif and the NR2 motifcan be present in any order. For example, the CRE comprises the motifs in the order NR1-NF1- NR2.NR1

[0151] A CRE that is capable of being bound and activated by a CAR-RXR heterodimer suitably comprises at least one NR1 motif. In some embodiments of any one of the aspects described herein, the NR1 motif comprises the nucleotide sequence TGTACT-X-TGACC[C / T] (SEQ ID NO: 3), wherein X represents any sequence which is from 3 to 6 nucleotides in length. For example, X can be 3 to 5 nucleotides in length. In some embodiments, X is 4 nucleotides in length. In some other embodiments, X is 5 nucleotides in length. Some exemplary nucleotide sequences for X include, but are not limited to, TTCC and TTTCC. In some preferred embodiments, X comprises the sequence TTCC. For example, X consists of the nucleotide sequence TTCC or TTTCC.

[0152] Where nucleotides are shown within square brackets with a slash, it indicates that one of the indicated nucleotides within the square brackets is present at that location.

[0153] In some embodiments of any one of the aspects described herein, the NR1 motif comprises a nucleotide sequence that is at least 90% identical to nucleotides 3 to 18 of SEQ ID NO: 1 or SEQ ID NO: 2

[0154] For example, the NR1 motif comprises a nucleotide sequence that is at least 90% identical the sequence TGTACTTTCCTGACCT (SEQ ID NO: 4, mouse NR1) or TGTACTTTCCTGACCC (SEQ ID NO: 5, human NR1). For example, the NR1 motif comprises a sequence that is at least 95% identical to SEQ ID NO: 4 or SEQ ID NO: 5. In some embodiments, the NR1 motif comprises a sequence that is at least 99% identical to SEQ ID NO: 4 or SEQ ID NO: 5 In some embodiments of any one of the aspects described herein, the NR1 motif comprises a nucleotide sequence that is at least 90% identical, preferably at least 95% identical, more preferably at least 99%, and most preferably perfectly identical to SEQ ID NO: 4 or SEQ ID NO: 5 In some embodiments of any one of the aspects described herein, the NR1 motif comprises the nucleotide sequence TGTACTTTCCTGACCN (SEQ ID NO: 6) or CTGTACTTTCCTGACCN (SEQ ID NO: 7).

[0155] The functional variant of a motif can comprise two or more operably linked NR1 motif- containing sequences. For example, the functional variant of a PBREM motif can comprise three, four, five or more operably linked NR1 motif-containing sequences. When two or more NR1 motifs are present, they can be immediately adjacent to one another or separated by a spacer. In some embodiments, a CRE that is capable of being bound and activated by a CAR-RXR heterodimer suitably comprises the general structure NR1-S-NR1, wherein NR1 represents anyNR1 motif as discussed herein, and S represents an optional spacer. When two or more NR1 motifs are present, they can be identical NR1 or they can be different to one another Further, when a spacer is present, it can have any sequence and be of any suitable length. For example, each spacer can be independently from 2 to 50 nucleotides in length. In some embodiments, each spacer is from 3 to 40, from 4 to 30, from 5 to 20, from 6 to 10, or from 7 to 9 nucleotides in length. In some embodiments, each spacer is independently, 5, 6, 7, 8, 9, 10 or 11 nucleotides in length.

[0156] In some embodiments of any one of the aspects described herein, the NR1 motif comprises the nucleotide sequence [TGTACTTTCCTGACCN-S-]n(SEQ ID NO: 8), or [CTGTACTTTCCTGACCN-S-]n(SEQ ID NO: 9), wherein N is any nucleotide, n is an integer from 1 to 10, and S is absent or a spacer.

[0157] In some embodiments, n is an integer from 1 to 6. For example, n is an integer from 2 to 4. In some embodiments, n is selected from 2, 3, or 4. For example, n is 1, 2 or 3. In some embodiments, n is 1. In some other embodiments, n is 2. In yet some other embodiments, n is 3.

[0158] When present, each spacer, S, can be independently from 2 to 50 nucleotides in length. In some embodiments, each spacer, S, is from 3 to 40, from 4 to 30, from 5 to 20, from 6 to 10, or from 7 to 9 nucleotides in length. In some embodiments, each spacer, S, is independently, 5, 6, 7, 8, 9, 10 or 11 nucleotides in length.

[0159] In some embodiments of any one of the aspects described herein, n is 2 or 3. For example, the functional variant of a PBREM motif comprises the nucleotide sequence:TGTACTTTCCTGACCN-S-TGTACTTTCCTGACCN (SEQ ID NO: 10);TGTACTTTCCTGACCN-S-TGTACTTTCCTGACCN-S-TGTACTTTCCTGACCN (SEQ ID NO: 11);CTGTACTTTCCTGACCN-S-CTGTACTTTCCTGACCN (SEQ ID NO: 12);CTGTACTTTCCTGACCN-S-CTGTACTTTCCTGACCN-S-CTGTACTTTCCTGACCN (SEQ ID NO: 13);NCTGTACTTTCCTGACCNTG-S-NCTGTACTTTCCTGACCNTG (SEQ ID NO: 14); orNCTGTACTTTCCTGACCNTG-S-NCTGTACTTTCCTGACCNTG-S-NCTGTACTTTCCTGACCNTG (SEQ ID NO: 15), wherein N is any nucleotide, and S is absent or a spacer.

[0160] In some embodiments of any one of the aspects described herein, n is 3. For example, the functional variant of a PBREM motif comprises the nucleotide sequence:TCTGTACTTTCCTGACCTTG-S-TCTGTACTTTCCTGACCTTG-S-TCTGTACTTTCCTGACCTTG (SEQ ID NO: 16); orACTGTACTTTCCTGACCCTG-S-ACTGTACTTTCCTGACCCTG-S- ACTGTACTTTCCTGACCCTG (SEQ ID NO: 17), wherein N is any nucleotide, and S is absent or a spacer.

[0161] In some embodiments of any one of the aspects described herein, the functional variant of a PBREM motif comprises the nucleotide sequence: gatcTCTGTACTTTCCTGACCTTGgatcgatcTCTGTACTTTCCTGACCTTGgatcgatcTC TGTACTTTCCTGACCTTGgatc (SEQ ID NO: 18); or gatcACTGTACTTTCCTGACCCTGgatcgatcACTGTACTTTCCTGACCCTGgatcgatcA CTGTACTTTCCTGACCCTGgatc (SEQ ID NO: 19).NF1

[0162] Generally, the NF1 motif comprises a nucleotide sequence that varies by 7 or fewer nucleotides (e.g., 6, 5, 4, 3, 2, or 1 nucleotides) from nucleotides 19 to 31 of SEQ ID NO: 1 or SEQ ID NO: 2. For example, the NF1 motif comprises the nucleotide sequence TGGCACAGTGCCA (SEQ ID NO: 20) or TGAAGAGGTGGCA (SEQ ID NO: 21), or a nucleotide sequence that varies no more than 7 nucleotides from SEQ ID NO: 20 or SEQ ID NO: 21 In some embodiments of any one of the aspects described herein, the NF1 motif comprises a nucleotide sequence that varies by no more than 1 to 6 nucleotides from SEQ ID NO: 20 or SEQ ID NO: 21. For example, the NF1 motif comprises a nucleotide sequence that varies by no more than 1, 2, 3, 4 or 5 nucleotides from SEQ ID NO: 20 or SEQ ID NO: 21 In some embodiments of any one of the aspects described herein, the NF1 motif comprises a nucleotide sequence that varies by no more than 1 or 2 nucleotides from SEQ ID NO: 20 or SEQ ID NO: 21.

[0163] In some embodiments of any one of the aspects described herein, the NF1 motif comprises the nucleotide sequence TGNNNNNGTGNCA (SEQ ID NO: 22), where N is any nucleotide.

[0164] In some embodiments of any one of the aspects described herein, the NF1 motif consists of SEQ ID NO: 20 or SEQ ID NO: 21NR2 motif

[0165] Generally, the NR2 motif comprises a nucleotide sequence that varies by 5 or fewer nucleotides (e.g., 4, 3, 2, or 1 nucleotides) from nucleotides 35 to 50 of SEQ ID NO: 1 or SEQ ID NO: 2. For example, the NR2 motif suitably comprises the nucleotide sequence TCAACTTGCCTGACAC (SEQ ID NO: 23) or TGGACTTTCCTGAACC (SEQ ID NO: 24), or a nucleotide sequence that varies by no more than by 5 nucleotides from SEQ ID NO: 23 or SEQID NO: 24. In some embodiments of any one of the aspects described herein, the NR2 motif comprises a nucleotide sequence that varies by no more than 1 to 4 nucleotides from SEQ ID NO: 23 or SEQ ID NO: 24 For example, the NR2 motif comprises a nucleotide sequence that varies by no more than 1, 2, or 3 nucleotides from SEQ ID NO: 23 or SEQ ID NO: 24. In some embodiments of any one of the aspects described herein, the NR2 motif comprises a nucleotide sequence that varies by no more than 1 or 2 nucleotides from SEQ ID NO: 23 or SEQ ID NO: 24.

[0166] In some embodiments of any one of the aspects described herein, the NR2 motif comprises the nucleotide sequence TNNACTTNCCTGANNC (SEQ ID NO: 25), where N is any nucleotide.

[0167] In some embodiments of any one of the aspects described herein, the NR2 motif consists of SEQ ID NO: 23 or SEQ ID NO: 24CRE

[0168] In some embodiments, the CRE that is capable of being bound and activated by a CAR- RXR heterodimer comprises a nucleotide sequence that is at least 60% identical to SEQ ID NO: 1 or SEQ ID NO: 2 For example the CRE that is capable of being bound and activated by a CAR- RXR heterodimer comprises a nucleotide sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99 % identical to SEQ ID NO: 1 or SEQ ID NO: 2. It is noted that mouse PBREM (SEQ ID NO: 1) and human PBREM (SEQ ID NO: 2) are 71% identical along their entire length (i.e., 51 nucleotides). Mouse PBREM remains functional in human cells, and human function in PBREM remains functional in mouse cells. Thus, at least this level of overall sequence difference across the PBREM motif can be tolerated.

[0169] In some embodiments of any one of the aspects described herein, the CRE comprises a nucleotide sequence having at least 90% identity to SEQ ID NO: 1 or SEQ ID NO: 2. For example, the CRE comprises a comprises a nucleotide sequence having at least 95% identity to SEQ ID NO: 1 or SEQ ID NO: 2 In some embodiments of any one of the aspects described herein, the CRE comprises a nucleotide sequence having at least 99% identity to SEQ ID NO: 1 or SEQ ID NO: 2

[0170] In some embodiments of any one of the aspects described herein, the CRE comprises a sequence that is at least 90% identical to nucleotides 3 to 18 of SEQ ID NO: 1 or SEQ ID NO: 2. For example, the CRE comprises a sequence that is at least 95% identical to nucleotides 3 to 18 of SEQ ID NO: 1 or SEQ ID NO: 2 In some embodiments, the CRE comprises a sequence that is at least 99% identical to nucleotides 3 to 18 of SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments of any one of the aspects described herein, the CRE that is capable of being bound and activated by a CAR-RXR heterodimer comprises a nucleotide sequence that is at least 90%identical, preferably at least 95% identical, more preferably at least 99%, and most preferably perfectly identical to SEQ ID NO: 1 or SEQ ID NO: 2 in the region spanning nucleotides 3 to 18, and at least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or 99% identical across the remainder of SEQ ID NO: 1 or SEQ ID NO: 2 (i.e., nucleotides 1, 2, and 19 to 51, or nucleotides 21 to 51). Nucleotides are of course numbered with reference to SEQ ID NO: 1 or SEQ ID NO: 2. Preferably the overall sequence is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99 % identical to either SEQ ID NO: 1 or SEQ ID NO: 2.

[0171] In some embodiments of any one of the aspects described herein, the CRE comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence:NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN(SEQ ID NO: 26)

[0172] For example, the CRE comprises a nucleotide sequence having at least 95% identity to SEQ ID NO: 26. In some embodiments, the CRE comprises a nucleotide sequence having at least 99% identity to SEQ ID NO: 26. For example the CRE comprises a nucleotide sequence having 100% identity to SEQ ID NO: 26.

[0173] It is noted that % identity is calculated with respect to the specifically defined nucleotides rather than the undefined “Ns”. Functional variants of a PBREM sequence where one or more nucleotides identified as N are deleted are specifically contemplated as part of such embodiments of the invention, for example where up to 7, 6, 5, 4, 3, 2, or 1 nucleotides marked N are deleted. Furthermore, functional variants of a PBREM sequence where one or more nucleotides are inserted are specifically contemplated as part of such embodiments of the invention, for example where up to 7, 6, 5, 4, 3, 2, or 1 nucleotides are inserted. As one specific example, the rat PBREM element from the CYP2B2 gene comprise a T inserted between the T and C at position 10-11, i.e., within NR1 of the PBREM element. Replacement, deletion or insertion of nucleotides in regions outside of the NR1 motif are likely to be well-tolerated.

[0174] It will be noted that the PBREM element or functional variant thereof can be present in either orientation. The reverse complement of the PBREM elements described herein thus form part of disclosure. It is noted that the human PBREM element is naturally present in the reverse orientation compared to the mouse PBREM element, and that the human PBREM element was shown to remain functional in the “reverse” orientation (i.e., the same orientation as mouse PBREM) in Sueyoshi, et al. (J. BIOL. CHEM. Vol. 274,10, pp. 6043-6046, 1999).

[0175] In some embodiments of the invention, the inducible promoter comprises a plurality of CREs that are each capable of being bound and activated by a heterodimer of CAR and RXR. Accordingly, in some embodiments of any one of the aspects described herein, the inducible promoter comprises a plurality of CREs that are each capable of being bound and activated by aheterodimer of CAR and RXR. Stated in another way, the inducible promoter comprises a cis- regulatory module (CRM) that comprises a plurality of CREs that are each capable of being bound and activated by a heterodimer of CAR and RXR. The CREs that are capable of being bound and activated by a heterodimer of CAR and RXR can be identical, or they can be different to one another.

[0176] In some embodiments, the inducible promoter comprises from 2 to 10 CREs that are each capable of being bound and activated by a heterodimer of CAR and RXR. For example, the inducible promoter comprises from 2 to 7 CREs. In some embodiments, the inducible promoter comprises from 2 to 5 CREs. For example, inducible promoter comprises from 2 to 4 CREs. In some embodiments, inducible promoter comprises 2 or 3 CREs. For example, the inducible promoter comprises 2 or 3 CREs.

[0177] When two or more CREs that are each capable of being bound and activated by a heterodimer of CAR and RXR are present, they can be immediately adjacent to one another or separated by a spacer. Accordingly, in some embodiments, the inducible promoter comprises the the general structure CRE-L-CRE, wherein CRE represents any CRE as discussed herein, and L represents an optional spacer.

[0178] It is noted the optional spacer, L, can have any suitable length. For example, each spacer, L, can be independently from 2 to 100 nucleotides in length. In some embodiments, each spacer, L, can be independently from 3 to 50 nucleotides, or from 5 to 30 nucleotides, or from 10 to 25 nucleotides in length. For example, each spacer, L, is independently from 15 to 25 nucleotides in length. In some embodiments, each spacer, L, is independently 18, 19, 20, 21 or 22 nucleotides in length. A spacer of approximately 20 nucleotides in length has been found to be particularly suitable. In some non-limiting examples, each spacer, L, is a multiple of 5 nucleotides in length.

[0179] In some embodiments of any one of the aspects described herein, the CRM comprises the amino acid sequence:[NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN-L-]m(SEQ ID NO: 27), where m is an integer from 1 to 10, N is any nucleotide, and L is absent or a spacer.

[0180] In some embodiments, m is an integer from 1 to 6. For example, m is an integer from 2 to 4. In some embodiments, m is selected from 2, 3, or 4. For example, m is 1, 2 or 3. In some embodiments, m is 1. In some other embodiments, m is 2. In yest some other embodiments, m is 3.

[0181] When present, each spacer, L, can be independently from 2 to 100 nucleotides in length. In some embodiments, each spacer, L, can be independently from 3 to 50 nucleotides, or from 5 to 30 nucleotides, or from 10 to 25 nucleotides in length. For example, each spacer, L, isindependently from 15 to 25 nucleotides in length. In some embodiments, each spacer, L, is independently 18, 19, 20, 21 or 22 nucleotides in length. A spacer of approximately 20 nucleotides in length has been found to be particularly suitable. In some non-limiting examples, each spacer, L, is a multiple of 5 nucleotides in length.

[0182] In some embodiments of any one of the aspects described herein, the CRM comprises the nucleotide sequence:NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN-L- NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN (SEQ ID NO: 28); or NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN-L- NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN-L- NCTGTACTTTCCTGACCNTGNNNNNGTGNCANCATNNACTTNCCTGANNCN (SEQ ID NO: 29), wherein N is any nucleotide and L is absent or a spacer.

[0183] In some embodiments of any one of the aspects described herein, the CRM comprises a nucleotide sequence having at least 60% identity to the nucleotide sequence:TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-L- TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 30);TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-L- TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC-L- TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 31);ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA-L- ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA-L- ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA (SEQ ID NO: 32); or ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA-L- ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA (SEQ ID NO: 33), wherein L is absent or a spacer.

[0184] For example, the CRM comprises a nucleotide sequence that is at least 65%, 70%, 75%, 80%, 85%, or 90% identical to one of SEQ ID NO: 30-33. In some embodiments of any one of the aspects described herein, the inducible promoter comprises a nucleotide sequence having at least 95% identity to one of SEQ ID NO: 30-33. For example, the inducible promoter comprisesa nucleotide sequence having at least 99% identity to one of SEQ ID NO: 30-33. In some embodiments, the inducible promoter comprises a nucleotide sequence having 100% identity to one of SEQ ID NO: 30-33

[0185] In some embodiments of any one of the aspects described herein, the CRM comprises a nucleotide sequence having at least 60% identity to the nucleotide sequence:TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCA TTACTCGCATCCATTCTCTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATC AACTTGCCTGACACC (SEQ ID NO: 34, 2x mouse PBREM CREs);TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCA TTACTCGCATCCATTCTCTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATC AACTTGCCTGACACCGCACTGAAGGTCCTCAATCGTCTGTACTTTCCTGACCT TGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 35, 3x mouse PBREM CREs);TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCA TTACTCGCATCCATTCTCTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATC AACTTGCCTGACACCGCACTGAAGGTCCTCAATCGTCTGTACTTTCCTGACCT TGGCACAGTGCCACCATCAACTTGCCTGACACCCTGACCTCCTGCCAGCAATA TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 36, 4x mouse PBREM CREs);ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCACA TTACTCGCATCCATTCTCACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCAT GGACTTTCCTGAACCA (SEQ ID NO: 37, 2x human PBREM); or ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCACA TTACTCGCATCCATTCTCACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCAT GGACTTTCCTGAACCAGCACTGAAGGTCCTCAATCGACTGTACTTTCCTGACC CTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA (SEQ ID NO: 38, 3x human PBREM).

[0186] For example, the CRM comprises a nucleotide sequence that is at least 65%, 70%, 75%, 80%, 85%, or 90% identical to any one of SEQ ID NO: 34-38. In some embodiments of any one of the aspects described herein, the inducible promoter comprises a nucleotide sequence having at least 95% identity to any one of SEQ ID NO: 34-38. For example, the inducible promoter comprises a nucleotide sequence having at least 99% identity to any one of SEQ ID NO: 34-38. In some embodiments, the inducible promoter comprises a nucleotide sequence having 100% identity to any one of SEQ ID NO: 34-38.

[0187] In some embodiments of the various aspects described herein, a CRE that is capable of being bound and activated by a CAR-RXR heterodimer comprises a portion of the PBREM elements (e.g., NR1, NF1 and NR2) from two or more different species. For example, a CRE that is capable of being bound and activated by a CAR-RXR heterodimer comprises PBREM elements (e.g., NR1, NF1 and NR2) from species in two or more different genera (e.g., two different mammals). Such motifs can be referred to as “hybrid PBREM motifs”. A hybrid PBREM motif typically comprises all of the motifs of a wild-type PBREM motif (i.e., the NR1, NF1, and NR2 motifs), but these motifs are derived from two or more different species. In some embodiments a hybrid PBREM motif comprises a portion (e.g., the NR1, NF1, and NR2 motifs) from a first species, and a corresponding portion from a second species (e.g., the corresponding NR1, NF1, and NR2 motifs). By way of non-limiting example, a hybrid PBREM motif can comprise portions (e.g., the NR1, NF1, and NR2 motifs) of primate (e.g., human) and rodent (e.g., mouse) PBREM motifs. For example, a hybrid PBREM motif may comprise an NR1 motif from primate (e.g., human) and an NR2 motif from rodent (e.g., mouse), or an NR1 motif from rodent (e.g., mouse) and an NR2 motif from primate (e.g., human). Primate or rodent NR1 and NR2 motifs can also be combined with an NF1 motif from the corresponding species.

[0188] In some embodiments the hybrid PBREM motif comprises one of the following combinations of PBREM motifs: hNRl-mNFl-hNR2; hNRl-mNFl-mNR2; mNRl-hNFl-mNR2; or mNRl-hNFl-hNR2 (wherein “h” indicates the human motif and m indicates the mouse motif).

[0189] Accordingly, in some embodiments of any one of the aspects described herein, the inducible primer comprises a nucleotide sequence having at least 60% identity to the sequence.ACTGTACTTTCCTGACCCTGGCACAGTGCCACCATGGACTTTCCTGAACCA (SEQ ID NO: 39, HMH hybrid);ACTGTACTTTCCTGACCCTGGCACAGTGCCACCATCAACTTGCCTGACACC (SEQ ID NO: 40, HMM hybrid);TCTGTACTTTCCTGACCTTGAAGAGGTGGCACCATCAACTTGCCTGACACC (SEQ ID NO: 41, MHM hybrid); orTCTGTACTTTCCTGACCTTGAAGAGGTGGCAGCATGGACTTTCCTGAACCA (SEQ ID NO: 42, MHH hybrid).

[0190] For example, the inducible primer comprises a nucleotide sequence that is at least 65%, 70%, 75%, 80%, 85%, or 90% identical to one of SEQ ID NO: 39-42. In some embodiments ofany one of the aspects described herein, the inducible primer comprises a nucleotide sequence having at least 95% identity to one of SEQ ID NO: 39-42. For example, the inducible promoter comprises a nucleotide sequence having at least 99% identity to one of SEQ ID NO: 39-42. In some embodiments, the inducible promoter comprises a nucleotide sequence having 100% identity to one of SEQ ID NO: 39-42

[0191] Generally, the inducible promoter comprises no or only minimal nucleic acid sequences that would lead to constitutive expression or expression in cells which do not express CAR and / or RXR, e.g., non-liver cells. Thus, background expression and expression in cells which do not express CAR and RXR, e.g., non-liver cells is minimized or avoided entirely.

[0192] In some embodiments of any one of the aspects described herein, the inducible promoter comprises a CRE that is capable of being bound and activated by a heterodimer of CAR and RXR operably linked to a minimal promoter or proximal promoter. For example, the inducible promoter comprises a CRE that is capable of being bound and activated by a heterodimer of CAR and RXR operably linked to a minimal promoter. Where a proximal promoter is used, it is a cell or organ specific promoter. Generally, a minimal promoter is preferred, as a proximal promoter will tend to drive at least some degree of background expression. However, some amount of background expression may be desirable in some instances.

[0193] In some embodiments of any one of the aspects described herein, the minimal or proximal promoter is a liver-specific promoter. Thus, in some embodiments, the inducible promoter is a liver-specific inducible promoter.

[0194] The minimal promoter can be any suitable minimal promoter. A wide range of minimal promoters are known in the art. Some exemplary minimal promoters include, but are not limited to, HSV thymidine kinase minimal promoter (MinTK), CMV minimal promoter (CMVmp) and SV40 minimal promoter (SV40mp). The minimal promoter can be a synthetic minimal promoter.

[0195] In some embodiments of any one of the aspects described herein, the inducible promoter comprises one or more (e.g., two or three) CREs that are capable of being bound and activated by a heterodimer of CAR and RXR operably linked to the MinTK minimal promoter. Without wishing to be bound by a theory, this combination provides a desirable combination of low background expression and inducibility.

[0196] In some embodiments of any one of the aspects described herein, the inducible promoter comprises one or more (e.g., two or three) CREs that are capable of being bound and activated by a heterodimer of CAR and RXR operably linked to the SV40 minimal promoter. This combination has been shown to provide high levels of inducibility, albeit with some increase in background expression levels.

[0197] In some embodiments of any one of the aspects described herein, the inducible promoter comprises one or more (e.g., two or three) CREs that are capable of being bound and activated by a heterodimer of CAR and RXR operably linked to the CMVmp minimal promoter.

[0198] It is noted that the CRE that is capable of being bound and activated by a heterodimer of CAR and RXR (or, where a plurality of CREs are present, the most proximal CRE) and the minimal or proximal promoter can be immediately adj acent to one another or separated by a spacer. Accordingly, in some embodiments of any one of the aspects described herein, the CRE that is capable of being bound and activated by a heterodimer of CAR and RXR (or, where a plurality of CREs are present, the most proximal CRE) and the minimal or proximal promoter are separated by a spacer. It is noted that the spacer separating the CRE and the minimal or proximal promoter can have any suitable length. For example, spacer can be independently from 10 to 200 nucleotides in length. In some embodiments, spacer can be independently from 15 to 150 nucleotides, or from 20 to 125 nucleotides, or from 25 to 100 nucleotides in length. For example, spacer can be 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 70, 75, 80, 85, 90, 95 or 100 nucleotides in length. In some embodiments, the spacer is 20, 46, 80, or 100 nucleotides in length.

[0199] In some embodiments of any one of the aspects, the inducible promoter comprises a nucleotide sequence having at least 60% identity to the sequence:CTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCGAT CCGGCCCCGCCCAGCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGT CGGGGCGGCGCGGTCCGAGGTCCACTTCGCATATTAAGGTGACGCGTGTG GCCTCGAACACCGAGCGACCCTGCAGCGACCCGCTTAACAGCGTCAACAG CGTGCCGCAGATCTCGAGGAGCTTGGCGAGATTTTCAGGAGCTAAGGAAGCT AAAC (SEQ ID NO: 43, PBl-MinTk)TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCGC TGGGAGTTCGTAGACGGAGCGATTAATCCATATGCAGGTCTATATAAGCA GAGCTCGTTTAGTGAACCGTCAGATCGCCTAGATACGCCATCCACGCTG TTTTGACCTCCATAGAAGATCGCCACCC (SEQ ID NO: 44, PB1-CMV-MP);TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCGC TGGGAGTTCGTAGACGGACTAGCCCGGGCTCGAGATCTGCGATCTGCATCTC AATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCT AACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATCGCTGACTAATTTTTT TTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCC (SEQ ID NO: 45, PB1-SV40-MP);TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCA TTACTCGCATCCATTCTCTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCGCTGGGAGTTCGTAGACGGAGATCCGGCCCCGCCCAGCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCGAGGTCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGCGACCCGCTTAACAGCGTCAACAGCGTGCCGCAGATCTC GAGGAGCTTGGCGAGATTTTCAGGAGCTAAGGAAGCTAAAC (SEQ ID NO: 46, PBl-l-MinTk, 2xPBREM);TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCA TTACTCGCATCCATTCTCTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCGCACTGAAGGTCCTCAATCGTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCGCTGGGAGTTCGTAGACGGAGATCCGGCCCCGCCCAGCGTCTTGTCATTGGCGAATTCGAACACGCAGATG CAGTCGGGGCGGCGCGGTCCGAGGTCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGCGACCCGCTTAACAGCGTCAACAGCGTGCCGCAGATCTCGAGGAGCTTGGCGAGATTTTCAGGAGCTAAGGA AGCTAAAC (SEQ ID NO: 47, PBl-2-MmTk, 3xPBREM);TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCA TTACTCGCATCCATTCTCTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCGCACTGAAGGTCCTCAATCGTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCTGACCTCCTGCCAGCAATATCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCGCTGGGAGTTCGTAGACGGAGATCCGGCCCCGCCCAGCGTCTTGTCATTGGCGA ATTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCGAGGTCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGCGACCCGCTTAACAGCGTCAACAGCGTGCCGCAGATCTCGAGGAGCTTGGCGAGAT TTTC AGGAGCT A AGGA AGCTAAAC (SEQ ID NO: 48, PBl-3-MmTk);TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCA TTACTCGCATCCATTCTCTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCGCTGGGAGTTCGTAGACGGACTAGCCCGGGCTCGAGATCTGCGATCTGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATCGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTC TGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCC (SEQ ID NO: 50, PB-1-SV40);TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCATTACTCGCATCCATTCTCTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCGCACTGAAGGTCCTCAATCGTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCGCTGGGAGTTCGTAGACGGACTAGCCCGGGCTCGAGATCTGCGATCTGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATCGCTGACTAATTTTTTTTATTTATGCAGAGGC CGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTTGGCATTCCGGTACTGTTGGTA AAGCCACCC (SEQ ID NO: 51, PB1-2-SV40);TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCATTACTCGCATCCATTCTCTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCGCACTGAAGGTCCTCAATCGTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCTGACCTCCTGCCAGCAATATCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCGCTGGGAGTTCGTAGACGGACTAGCCCGGGCTCGAGATCTGCGATCTGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATCGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAA GTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCC (SEQ ID NO: 52, PB1-3-SV40);TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCATTACTCGCATCCATTCTCTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCGCTGGGAGTTCGTAGACGGAGCGATTAATCCATATGCAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTAGATACGCCATCCACGCTGTTTTGACCTCCATAGAAGATCGCCACCC (SEQ IDNO: 53, PB1-1-CMV);TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCATTACTCGCATCCATTCTCTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCGCACTGAAGGTCCTCAATCGTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCGCTGGGAGTTCGTAGACGGAGCGATTAATCCATATGCAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTAGATACGCCATCCACGCTGTTTTGACCTCCATAGAAG ATCGCCACCC (SEQ ID NO: 54, PB1-2-CMV);TCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCATTACTCGCATCCATTCTCTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCGCACTGAAGGTCCTCAATCGTCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCCTGACCTCCTGCCAGCAATATCTGTACTTTCCTGACCTTGGCACAGTGCCACCATCAACTTGCCTGACACCGCTGGGAGTTCGTAGACGGAGCGATTAATCCATATGCAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTAGATACGCCATCCACGCTG TTTTGACCTCCATAGAAGATCGCCACCC (SEQ ID NO: 55, PB1-3-CMV);ACTGTACTTTCCTGACCCTGAAGAGACTGTACTTTCCTGACCCTGAAGAGACT GTACTTTCCTGACCCTGAAGAGGATCCGGCCCCGCCCAGCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCGAGGTCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGCGACCCGCTTAACAGCGTCAACAGCGTGCCGCAGATCTCGAGGAGCTTGGCGAGATTTTCAGGAGCT (SEQ ID NO: XX, human NRlx3-MinTK);ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCAGATCCGGCCCCGCCCAGCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCGAGGTCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGCGACCCGCTTAACAGCGTCAACAGCGTGCCGCAGATCTCGAGGAGCTTGGCGAGATTTTCAGGAGCTAAGGAAGCTAAACATGGAAGATGCCAAAAACATTAAG (SEQ ID NO: 56, human PBREM- MinTK);ACTGTACTTTCCTGACCCTGGCACAGTGCCACCATGGACTTTCCTGAACCAGA TCCGGCCCCGCCCAGCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGT CGGGGCGGCGCGGTCCGAGGTCCACTTCGCATATTAAGGTGACGCGTGTG GCCTCGAACACCGAGCGACCCTGCAGCGACCCGCTTAACAGCGTCAACAGCGTGCCGCAGATCTCGAGGAGCTTGGCGAGATTTTCAGGAGCTAAGGAAGCT AAACATGGAAGATGCCAAAAACATTAAG (SEQ ID NO: 57, hNRl-mNFl-hNR2- MinTK (HMH MinTK));ACTGTACTTTCCTGACCCTGGCACAGTGCCACCATCAACTTGCCTGACACCGA TCCGGCCCCGCCCAGCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCGAGGTCCACTTCGCATATTAAGGTGACGCGTGTG GCCTCGAACACCGAGCGACCCTGCAGCGACCCGCTTAACAGCGTCAACAGCGTGCCGCAGATCTCGAGGAGCTTGGCGAGATTTTCAGGAGCTAAGGAAGCT AAACATGGAAGATGCCAAAAACATTAAG (SEQ ID NO: 58, hNRl-mNFl-mNR2- MinTK (HMM MinTK));TCTGTACTTTCCTGACCTTGAAGAGGTGGCACCATCAACTTGCCTGACACCGA TCCGGCCCCGCCCAGCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCGAGGTCCACTTCGCATATTAAGGTGACGCGTGTG GCCTCGAACACCGAGCGACCCTGCAGCGACCCGCTTAACAGCGTCAACAG CGTGCCGCAGATCTCGAGGAGCTTGGCGAGATTTTCAGGAGCTAAGGAAGCTAAACATGGAAGATGCCAAAAACATTAAG (SEQ ID NO: 59, mNRl-hNFl-mNR2- MinTK (MHM MinTK));TCTGTACTTTCCTGACCTTGAAGAGGTGGCAGCATGGACTTTCCTGAACCAGA TCCGGCCCCGCCCAGCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGT CGGGGCGGCGCGGTCCGAGGTCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGCGACCCGCTTAACAGCGTCAACAGCGTGCCGCAGATCTCGAGGAGCTTGGCGAGATTTTCAGGAGCTAAGGAAGCT AAACATGGAAGATGCCAAAAACATTAAG (SEQ ID NO: 60, mNRl-hNFl-hNR2- MinTK (MHH MinTK));ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCAGC TGGGAGTTCGTAGACGGACTAGCCCGGGCTCGAGATCTGCGATCTGCATCTC AATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATCGCTGACTAATTTTTT TTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAA GTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCC (SEQ ID NO: 61, hPB-SV40);TCTGTACTTTCCTGACCTTGAAGAGGTGGCACCATCAACTTGCCTGACACCGCTGGGAGTTCGTAGACGGACTAGCCCGGGCTCGAGATCTGCGATCTGCATCTC AATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAAC TCCGCCCAGTTCCGCCCATTCTCCGCCCCATCGCTGACTAATTTTTTTTATTTATGhPBCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAG GAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTTGGCATTCCGGTACTG TTGGTAAAGCCACCC (SEQ ID NO: 62, MHM-SV40);ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCACATTACTCGCATCCATTCTCACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCAT GGACTTTCCTGAACCAGCTGGGAGTTCGTAGACGGACTAGCCCGGGCTCGAGATCTGCGATCTGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCA TCGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCT CTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCC (SEQ ID NO: 63, 2xhPB SV40);TCTGTACTTTCCTGACCTTGAAGAGGTGGCACCATCAACTTGCCTGACACCCA TTACTCGCATCCATTCTCTCTGTACTTTCCTGACCTTGAAGAGGTGGCACCATC AACTTGCCTGACACCGCTGGGAGTTCGTAGACGGAGATCCGGCCCCGCCCAGCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCGAGGTCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGCGACCCGCTTAACAGCGTCAACAGCGTGCCGCAGATCTC GAGGAGCTTGGCGAGATTTTCAGGAGCTAAGGAAGCTAAAC (SEQ ID NO: 64, 2xMHM MinTK);TCTGTACTTTCCTGACCTTGAAGAGGTGGCACCATCAACTTGCCTGACACCCA TTACTCGCATCCATTCTCTCTGTACTTTCCTGACCTTGAAGAGGTGGCACCATC AACTTGCCTGACACCGCTGGGAGTTCGTAGACGGACTAGCCCGGGCTCGAGATCTGCGATCTGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTC CGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCAT CGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTC TGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTT GCAAAAAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCC (SEQ ID NO: 65, 2xMHM SV40);ACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCACA TTACTCGCATCCATTCTCACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCAT GGACTTTCCTGAACCAGCACTGAAGGTCCTCAATCGACTGTACTTTCCTGACC CTGAAGAGGTGGCAGCATGGACTTTCCTGAACCAGCTGGGAGTTCGTAGACG GAGATCCGGCCCCGCCCAGCGTCTTGTCATTGGCGAATTCGAACACGCAGAT GCAGTCGGGGCGGCGCGGTCCGAGGTCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGCGACCCGCTTAACAGCGTCA ACAGCGTGCCGCAGATCTCGAGGAGCTTGGCGAGATTTTCAGGAGCTAAGGA AGCTAAAC (SEQ ID NO: 66, 3xhPB-minTK); orACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCATGGACTTTCCTGAACCACA TTACTCGCATCCATTCTCACTGTACTTTCCTGACCCTGAAGAGGTGGCAGCAT GGACTTTCCTGAACCAGCACTGAAGGTCCTCAATCGACTGTACTTTCCTGACC CTGAAGAGGTGGCAGCATGGACTTTCCTGAACCAGCTGGGAGTTCGTAGACG GACTAGCCCGGGCTCGAGATCTGCGATCTGCATCTCAATTAGTCAGCAACC ATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATCGCTGACTAATTTTTTTTATTTATGCAGAGG CCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTT TTTTGGAGGCCTAGGCTTTTGCAAAAAGCTTGGCATTCCGGTACTGTTGGT AAAGCCACCC (SEQ ID NO: 67, 3xhPB-SV40);

[0200] For example, the inducible promoter comprises a nucleotide sequence that is at least 65%, 70%, 75%, 80%, 85%, or 90% identical to one of SEQ ID NO: 43-67. In some embodiments of any one of the aspects described herein, the inducible promoter comprises a nucleotide sequence having at least 95% identity to one of SEQ ID NO: 43-67. For example, the inducible promoter comprises a nucleotide sequence having at least 99% identity to one of SEQ ID NO: 43-67. In some embodiments, the inducible promoter comprises a nucleotide sequence having 100% identityto one of SEQ ID NO: 43-67. In SEQ ID NO: 43-67, PBREM elements are underlines and minimal promoter is in bold.

[0201] Additional exemplary inducible promoters are described in US Patent Publication No. US20220111078, contents of which are incorporated herein by reference in their entirety.Transgene

[0202] Embodiments of the various aspects described herein include a transgene. As used herein, the term “transgene” means a nucleic acid sequence (encoding, for example, a desired gene expression product such as a protein or RNA) that is partly or entirely heterologous, i.e., foreign, to the subject into which it is introduced, or is homologous to an endogenous gene of the subject into which it is introduced. A transgene for use in methods described herein typically encodes a desired gene expression product such as a polypeptide (protein) or RNA. The transgene can be a full-length cDNA or genomic DNA sequence, or any fragment, subunit or mutant thereof that has at least some desired biological activity.

[0203] Where the transgene encodes a protein, it can be essentially any type of protein. By way of non-limiting example, the protein can be an enzyme, an antibody or antibody fragment (e.g., a monoclonal antibody), a hormone, a blood clotting factor, a growth factor, a cytokine, a viral protein (e.g., REP, CAP, REV, VSV-G, or RD114), a therapeutic protein, or a toxic protein (e.g., Caspase 3, 8 or 9).

[0204] In some embodiments of the various aspects described herein, the gene encodes a therapeutic expression product. For example, the gene encodes a therapeutic protein suitable for use in treating a disease or condition associated with the liver. Such genes may be referred to as “therapeutic genes”. The therapeutic expression product can be a protein, e.g., a secretable protein such as, e.g., a clotting factor (e.g., factor IX or factor VIII), GAA, a cytokine, a growth factor, an antibody or nanobody, a chemokine, a plasma factor, insulin, erythropoietin, lipoprotein lipase, or a toxic protein. Alternatively, the therapeutic expression product can be RNA, such as an siRNA or miRNA. Some exemplary therapeutic expression products (and sequences encoding them) include, but are not limited to, factor VIII, factor IX, factor VII, factor X, von Willebrand factor, erythropoietin (EPO), interferon-a, interferon-B, interferon-y, interleukin 1 (IL-1), interleukin 2 (IL-2), interleukin 3 (IL-3), interleukin 4 (IL-4 ), interleukin 5 (IL-5), interleukin 6 (IL-6), interleukin 7 (IL-7), interleukin 8 (IL-8), interleukin 9 (IL-9), interleukin 10 (IL- 10), interleukin 11 (IL-11 ), interleukin 12 (IL-12), interleukin-37 (IL-37), interleukin-28 (11-38), chemokine (C-X-C motif) ligand 5 (CXCL5), granulocyte-colony stimulating factor (G-CSF), granulocyte- macrophage colony stimulating factor (GM-CSF), macrophage colony stimulating factor (M-CSF), stem cell factor (SCF), keratinocyte growth factor (KGF), monocyte chemoattractant protein- 1(MCP-1), tumour necrosis factor (TNF), afamin (AFM), al -antitrypsin, a-galactosidase A, a-L- iduronidase, ATP7b, ornithine transcarbamoylase, phenylalanine hydroxylase, lipoprotein lipase, aromatic amino acid decarboxylase (AADC), ATPase Sarcoplasmic / Endoplasmic Reticulum Ca2+ Transporting 2 (ATP2A2), cystic fibrosis transmembrane conductance regulator (CTFR), glutamic acid decarboxylase 65 kDa protein (GAD65), glutamic acid decarboxylase 67 kDa protein (GAD67), lipoprotein lipase (LPL), nerve growth factor (NGF), neurturin (NTN), porphobilinogen deaminase (PBGD), sarcoglycan alpha (SGCA), soluble fms-hke tyrosine kinase-1 (sFLT-1), apoliproteins, low-density lipoprotein receptor (LDL-R), albumin, glucose-6-phosphatase, antibodies, nanobodies, aptamers, anti-viral dominant-negative proteins, and functional fragments, subunits or mutants thereof. Preferably the protein is a primate protein, more preferably a human protein. In some embodiments, the therapeutic protein is AADC. In some embodiments, the therapeutic protein is porphobilinogen deaminase (PBGD).

[0205] Proteins or polypeptides of interest can be, for example, antibodies, enzymes or fragments thereof, viral proteins, cytokines, lymphokines, adhesion molecules, receptors and derivatives or fragments thereof, protein antibiotics, toxin fusion proteins, carbohydrate-protein conjugates, structural proteins, regulatory proteins, vaccines and vaccine like proteins or particles, process enzymes, growth factors, hormones, and any other polypeptides that can serve as agonists or antagonists and / or have therapeutic or diagnostic use. Accordingly, in some embodiments of any one of the aspects described herein, the protein is an immunoglobulin, preferably an antibody or antibody fragment, most preferably a Fab or scFv antibody. In some other embodiments, the protein is a viral protein.

[0206] In some embodiments, the transgene encodes an anti-PDl antibody, anti-HER2 antibody, anti-PCSK9 antibody, anti-VEGFR2 antibody, anti-IL17 antibody, anti-A03-42 antibody, anti-Sema3A antibody, anti-4- IBB (CD137) antibody, anti-5*-nucleotidase antibody, anti-5T4 antibody, anti-activin receptor-like kinase 1 antibody, anti-ACVR2B antibody, anti- adenocarcinoma antigen antibody, anti-amyloid antibody, anti-Ang-2 antibody, anti-angiopoietin 2 antibody, anti-angiopoietin 2 antibody, anti-angiopoietin 3 antibody, anti-anthrax toxin antibody, anti-AOC3 (VAP-1) antibody, anti-AXL antibody, anti-BAFF-R antibody, anti-B-cell activating factor (BAFF) antibody, anti-B-cell maturation antigen (BCMA) antibody, anti-B-lymphoma cell antibody, anti-C242 antigen antibody, anti-C5 antibody, anti-C5a receptor (C5a) antibody, anti- CA-125 antibody, anti-calcitonin antibody, anti-calcitonin gene-related peptide alpha antibody, anti-calcitonin gene-related peptide beta antibody, anti-calcitonin gene-related peptide receptor (CGRP) antibody, anti-CanAg (a glycoform of MUC1) antibody, anti-carbonic anhydrase 9 (CA- IX) antibody, anti-Carcinoembryonic antigen (CEA) antibody, anti-Carcinoembryonic antigen (CEA)-related antigen antibody, anti-cardiac myosin antibody, anti-CCLl l antibody, anti-CCR2antibody, anti-CCR4 antibody, anti-CCR5 antibody, anti-CCR5 antibody, anti-CDl l antibody, antibody, anti-CD123 antibody, anti-CD125 antibody, anti-CD134 antibody, anti-CD134 antibody, anti-CD147 antibody, anti-CD15 antibody, anti-CD152 antibody, anti-CD154 antibody, anti-CD18 antibody, anti-CD19 antibody, anti-CD2 antibody, anti-CD20 antibody, anti-CD20 antibody, anti- CD20 antibody, anti-CD200 antibody, anti-CD22 antibody, anti-CD23 antibody, anti-CD25 antibody, anti-CD27 antibody, anti-CD276 antibody, anti-CD278 antibody, antibody, anti-CD279 antibody, anti-CD28 antibody, anti-CD3 antibody, anti-CD3 antibody, anti-CD3 antibody, anti- CD3 antibody, anti-CD3 antibody, anti-CD30 antibody, anti-CD319 antibody, anti-CD33 antibody, anti-CD37 antibody, anti-CD38 antibody, anti-CD3E antibody, anti-CD3E antibody, anti-CD4 antibody, anti-CD40 antibody, anti-CD41 antibody, anti-CD44 antibody, anti-CD45 antibody, anti- CD5 antibody, anti-CD51 antibody, anti-CD52 antibody, anti-CD56 antibody, anti-CD6 antibody, anti-CD70 antibody, anti-CD74 antibody, anti-CD79B antibody, anti-CD80 antibody, anti- CEACAM5 antibody, anti-Claudin 18 Isoform 2 antibody, anti-clumping factor A antibody, anti- cMet antibody, anti-c-Met antibody, anti-coagulation factor III antibody, anti-complement C5a antibody, anti-complement component Is (Cis) antibody, anti-Complement factor D (CFD) antibody, anti-connective tissue growth factor (CTGF) antibody, anti-CSFl antibody, antibody, anti-CSFIR antibody, anti-CSF2 antibody, anti-CTLA-4 antibody, anti-CXCLIO (IP-10) antibody, anti-CXCR4 (CD184) antibody, anti-dabigatran antibody, anti-dendritic cell-associated lectin 2 antibody, anti-DLL3 antibody, anti-DLL4 antibody, anti-DPP4 antibody, anti-DR5 antibody, anti- EGFL7 antibody, anti-EGFR antibody, anti-EGFR antibody, anti-EGFR antibody, anti-EGFR extracellular domain III antibody, anti-endoglin antibody, anti-endotoxin antibody, anti-EpCAM antibody, anti-EPHA3 antibody, anti-ephrin receptor A3 antibody, anti-episialin antibody, anti- ERBB1 antibody, anti-ERBB3 (HER3) antibody, anti -FAP (gene) (FAP) antibody, anti-FCGRT antibody, anti-FGF 23 antibody, anti-FGFR2 antibody, anti-FGFR2 antibody, anti-fibrin II antibody, anti-fibronectin extra domain-B antibody, anti-folate hydrolase antibody, anti-folate receptor 1 antibody, anti-folate receptor alpha antibody, anti-Frizzled receptor antibody, anti-FVIX antibody, anti-FVX antibody, anti-GD2 ganglioside antibody, anti-GD3 ganglioside antibody, anti- GDF-8 antibody, anti-gelatinase B antibody, anti-glucagon receptor (GCGR) antibody, anti- Glutamate carboxypeptidase II antibody, anti-glypican 3 antibody, anti-GMCSF antibody, anti- GPNMB antibody, anti-GPRC5D antibody, antibody, anti-growth differentiation factor 8 antibody, anti-GUCY2C antibody, anti -Hepatocyte growth factor (HGF) antibody, anti-HERl antibody, anti- HER1 antibody, anti-HERl antibody, anti-HER2 / neu antibody, anti-HGFR antibody, anti-histone complex antibody, anti-HLA-DR antibody, anti-Hsp90 antibody, anti-human scatter factor receptor kinase antibody, anti-ICAM-1 (CD54) antibody, anti-IFN receptor antibody, anti-IFN-a antibody, anti-IFN-a / p receptor antibody, anti-IFN-y antibody, anti-IgE antibody, anti-IgE Fc regionantibody, anti -IGF- 1 receptor (CD221) antibody, anti-IGF-2 antibody, anti-IGHE antibody, anti- IL-1 antibody, anti-IL-12 antibody, anti-IL-13 antibody, anti-IL-17A antibody, anti-IL-17AF antibody, anti-IL-17F antibody, anti-IL-la antibody, anti -IL- 10 antibody, anti -IL-2 antibody, anti- IL-20 antibody, anti-IL-22 antibody, anti-IL-23 antibody, anti-IL-23 antibody, anti-IL-23 antibody, anti -IL-23 antibody, anti -IL-23 antibody, anti -IL-23 A antibody, anti -IL-3 receptor antibody, anti- IL-31 receptor A antibody, anti-IL-4 antibody, anti-IL-4Ra antibody, anti-IL-5 antibody, anti-IL-6 antibody, anti-IL-6 receptor antibody, anti-IL-9 antibody, anti-inducible T-cell co-stimulatory ligand (ICOSL) antibody, anti-integrin a4 antibody, anti-integrin 07 antibody, anti-integrin a4 07 antibody, anti-integrin a4 07 antibody, anti-integrin a501 antibody, anti-integrin allb03 antibody, anti-integrin av03 antibody, anti-Interleukin 36 receptor (IL1RL2 / IL1RAP) antibody, anti-ITGA2 (CD49b) antibody, anti-ITGB2 (CD18) antibody, anti-kallikrein antibody, anti-KIR2D antibody, anti-LAG3 antibody, anti-Lewis-Y antigen antibody, anti-LFA-1 (CD 11 a) antibody, anti-LINGO- 1 antibody, anti-lipoteichoic acid antibody, anti-LIV-1 antibody, anti-L0XL2 antibody, anti- LRRC15 antibody, anti-L-selectin (CD62L) antibody, anti-lymphotoxin alpha (LT A) antibody, anti-LYPD3 antibody, anti -macrophage colony stimulating factor (MCSF) antibody, anti- macrophage migration inhibitory factor (MIF) antibody, anti-MASP-2 antibody, anti-MCP-1 antibody, anti-melanoma cell adhesion molecule (MCAM) antibody, anti-mesothelin antibody, anti-MS4Al antibody, antibody, anti-MSTIR antibody, anti-MUCl antibody, anti-MUC5AC antibody, anti-mucosal addressin cell adhesion molecule antibody, anti-myelin-associated glycoprotein antibody, anti-myostatin antibody, anti-NCA-90 (granulocyte antigen) antibody, anti- nectin-4 antibody, anti-nerve growth factor (NGF) antibody, anti-NGNA ganglioside antibody, anti-NKG2A antibody, anti-NOGO-A antibody, anti-Notch 1 antibody, anti-Notch receptor antibody, anti-NRPl antibody, anti-OX-40 antibody, anti-oxLDL antibody, anti-PCDCl antibody, anti-PCDPl antibody, anti-PDGFRA antibody, anti-PDGFRB antibody, anti-PD-Ll antibody, anti- phosphate-sodium co-transporter antibody, anti-phosphatidylserine antibody, anti-PTK7 antibody, anti-RANKL antibody, anti-repulsive guidance molecule A (RGMA) antibody, anti-RHD (gene) (RHD) antibody, anti-Rhesus factor antibody, anti-Rhesus factor antibody, anti-root plate-specific spondin 3 antibody, anti-RORl antibody, anti-RTN4 antibody, anti-sclerostin antibody, anti- sclerostin (SOST) antibody, anti-SDCl antibody, anti-selectin P antibody, anti-serum amyloid A protein antibody, anti-serum amyloid P component antibody, anti-SLAMF7 antibody, anti- SLITRK6 antibody, anti-SOST antibody, anti-sphingosine-1 -phosphate antibody, anti-STEAPl antibody, anti-TAG-72 antibody, anti-TAG-72 antibody, anti-tau protein antibody, anti-T-cell receptor antibody, anti-TEMl antibody, anti-tenascin C antibody, anti-TGF-0 antibody, anti-TGF- 01 antibody, anti-TGF-02 antibody, anti-thymic stromal lymphopoietin (TSLP) antibody, anti- TIGIT antibody, anti-tissue factor pathway inhibitor (TFPI) antibody, anti-TNF antibody, anti-TNFantibody, anti-TNF-a antibody, anti-TNF-a antibody, anti-TRAIL-Rl antibody, anti-TRAIL-R2 antibody, anti-TROP-2 antibody, anti-tumor antigen CTAA16.88 antibody, anti-tumor necrosis factor receptor (TNFR) antibody, anti-tumor necrosis factor related activation protein (TRAP) antibody, anti-Tumor-associated glycoprotein 72 (TAG-72) antibody, anti-TWEAK receptor antibody, anti-TYRPl (glycoprotein 75) antibody, anti-vascular endothelial growth factor A (VEGFA) antibody, anti-VEGFA antibody, anti-VEGFR-1 antibody, anti-vimentin antibody, anti- VISTA (protein) (VSIR) antibody, anti-VWF antibody, anti-a-fetoprotein antibody, anti-A- synuclein antibody or anti-P-amyloid antibody. In some embodiments, the transgene encodes an anti-PDl antibody. In some embodiments, the transgene encodes an anti-HER2 antibody. In some embodiments, the transgene encodes an anti-PCSK9 antibody. In some embodiments, the transgene encodes an anti-VEGFR2 antibody. In some embodiments, the transgene encodes an anti-IL17 antibody. In some embodiments, the transgene encodes an anti-Ap3-42 antibody. In some embodiments, the transgene encodes an anti-Sema3A antibody.

[0207] In some embodiments, the transgene encodes an antibody selected from the group consisting of 3F8, Abagovomab, Abciximab, Abituzumab, Abrezekimab, Abrilumab, Actoxumab, Adalimumab, Adecatumumab, Aducanumab, Afasevikumab, Afelimomab, Alacizumab pegol, Alemtuzumab, Alirocumab, Altumomab pentetate, Amatuximab, Amivantamab, Anatuniomab mafenatox, Andecaliximab, Anetumab ravtansine, Anifrolumab, Ansuvimab, Anrukinzumab, (IMA-638), Apolizumab, Aprutumab ixadotin, Arcitumomab, Ascrinvacumab, Aselizumab, Atezolizumab, Atidortoxumab, Atinumab, Atoltivimab, Atoltivimab / maftivimab / odesivimab, Atorolimumab, Avelumab, Azintuxizumab vedotin, Bamlanivimab, Bapineuzumab, Basiliximab, Bavituximab, BCD-100, Bebtelovimab, Bectumomab, Bedinvetmab, Begelomab, Belantamab mafodotin, Belimumab, Bemarituzumab, Benralizumab, Berlimatoxumab, Bermekimab, Bersanlimab, Bertilimumab, Besilesomab, Bevacizumab, Bezlotoxumab, Biciromab, Bimagrumab, Bimekizumab, Birtamimab, Bivatuzumab, Bleselumab, Blinatumomab, Blontuvetmab, Blosozumab, Bococizumab, Brazikumab, Brentuximab vedotin, Briakinumab, Brodalumab, Brolucizumab, Brontictuzumab, Burosumab, Cabiralizumab, Camidanlumab tesirine, Camrelizumab, Canakinumab, Cantuzumab niertansine, Cantuzumab ravtansine, Caplacizumab, Casinvimab, Capromab, Carlumab, , Carotuximab, Catumaxomab, cBR96-doxorubicin immunoconjugate, Cedelizumab, Cemiplimab, Cergutuzumab amunaleukin, Certolizumab pegol, Cetrelimab, Cetuximab, Cibisatamab, Cilgavimab, Cirmtuzumab, Citatuzumab bogatox, Cixutumumab, Clazakizumab, Clenoliximab, Clivatuzumab tetraxetan, Codrituzumab, Cofetuzumab pelidotin, Coltuximab ravtansine, Conatumumab, Concizumab, Cosfroviximab, Crenezumab, Crizanlizumab, Crotedumab, CR6261, Cusatuzumab, Dacetuzumab, Daclizumab, Dalotuzumab, Dapirolizumab pegol, Daratumumab, Dectrekumab, Demcizumab, Denintuzumabmafodotin, Denosumab, Depatuxizumab mafodotin, Derlotuximab biotin, Detumomab, Dezamizumab, Dinutuximab, Dinutuximab beta, Diridavumab, Domagrozumab, Donanemab, Dorlimomab antox, Dostarlimab, Drozitumab, DS-8201, Duligotuzumab, Dupilumab, Durvalumab, Dusigitumab, Duvortuxizuniab, Ecromeximab, Eculizumab, Edobacomab, Edrecolomab, Efalizumab, Efungumab, Eldelumab, Elezanumab, Elgemtumab, Elotuzumab, Elsilimomab, Emactuzumab, Emapalumab, Emibetuzumab, Emicizumab, Enapotamab vedotin, Enavatuzumab, Enfortumab vedotin, Enlimomab pegol, Enoblituzumab, Enokizumab, Enoticumab, Ensituximab, Epcoritamab, Epitumomab cituxetan, Epratuzumab, Eptinezumab, Erenumab, Erlizumab, Ertumaxomab, Etaracizumab, Etesevimab, Etigilimab, Etrolizumab, Evinacumab, Evolocumab, Exbivirumab, Fanolesomab, Faralimomab, Faricimab, Farletuzumab, Fasinumab, FBTA05, Felvizumab, Fezakinumab, Fibatuzumab, Ficlatuzumab, Figitumumab, Firivumab, Flanvotumab, Fletikumab, Flotetuzumab, Fontolizumab, Foralumab, Foravirumab, Fremanezumab, Fresolimumab, Frovocimab, Frunevetmab, Fulranumab, Futuximab, Galcanezumab, Galiximab, Gancotamab, Ganitumab, Gantenerumab, Gatipotuzumab, Gavilimomab, Gedivumab, Gemtuzumab ozogamicin, Gevokizumab, Gilvetmab, Gimsilumab, Girentuximab, Glembatumumab vedotin, Glofitamab, Golimumab, Gomiliximab, Gosuranemab, Guselkumab, lanaiumab, Ibalizumab, Sintilimab, Ibritumomab tiuxetan, Icrucumab, Idarucizumab, Ifabotuzumab, Igovomab, Iladatuzumab vedotin, Imalumab, Imaprelimab, Imciromab, Imdevimab, Imgatuzumab, Inclacumab, Indatuximab ravtansine, Indusatumab vedotin, Inebilizumab, Infliximab, Intetumumab, Inolimomab, Inotuzumab ozogamicin, Ipilimumab, lomab-B, Iratumumab, Isatuximab, Iscalimab, Istiratumab, Itolizumab, Ixekizumab, Keliximab, Labetuzumab, Lacnotuzumab, Ladiratuzumab vedotin, Lampalizumab, Lanadelumab, Landogrozumab, Laprituximab emtansine, Larcaviximab, Lebrikizumab, Lecanemab, Lemalesomab, Lendalizumab, Lenvervimab, Lenzilumab, Lerdelimumab, Leronlimab, Lesofavumab, Letolizumab, Lexatumumab, Libivirumab, Lifastuzumab vedotin, Ligelizumab, Loncastuximab tesinne, Losatuxizumab vedotin, Lilotomab satetraxetan, Lintuzumab, Lirilumab, Lodelcizumab, Lokivetmab, Lorvotuzumab mertansine, Lucatumumab, Lulizumab pegol, Lumiliximab, Lumretuzumab, Lupartumab, Lupartumab amadotin, Lutikizumab, Maftivimab, Mapatunwmab, Margetuximab, Marstacimab, Maslimomab, Mavrilimumab, Matuzumab, Mepolizumab, Metelimumab, Milatuzumab, Minretumomab, Mirikizumab, Mirvetuxiniab soravtansme, Mitumomab, Modotuximab, Mogamulizumab, Monalizumab, Morolimumab, Mosunetuzumab, Motavizumab, Moxetumomab pasudotox, Muromonab-CD3, Nacolomab tafenatox, Naniiluniab, Naptumomab estafenatox, Naratuximab emtansine, Namatumab, Natalizumab, Navicixizumab, Navivumab, Naxitamab, Nebacumab, Necitumumab, Nemolizumab, NEODOO 1, Nerelimomab, Nesvacumab, Netakimab, Nimotuzumab, Nirsevimab,Nivoluniab, Nofetumomab merpentan, Obiltoxaximab, Obinutuzumab, Ocaratuzumab, Ocrelizumab, Odesivimab, Odulimomab, Ofatumumab, Olaratumab, Oleclumab, Olendalizumab, Olokizumab, Omalizumab, Omburtamab, OMS721, Onartuzumab, Ontuxizumab, Onvatilimab, Opicinumab, Oportuzumab nionatox, Oregovomab, Orticumab, Otelixizumab, Otilimab, Otlertuzumab, Oxelumab, Ozanezumab, Ozoralizumab, Pagibaximab, Palivizumab, Pamrevlumab, Panitumumab, Pankomab, Panobacumab, Parsatuzumab, Pascolizumab, Pasotuxizumab, Pateclizumab, Patritumab, PDR001, Pembrolizumab, Penitumoniab, Perakizumab, Pertuzumab, Pexelizumab, Pidilizumab, Pinatuzumab vedotin, Pintumomab, Placulumab, Pozelimab, Prezalumab, Plozalizumab, Pogalizumab, Polatuzumab vedotin, Ponezumab, Porgaviximab, Prasinezumab, Prezalizumab, Priliximab, Pritoxaximab, Pritumumab, PRO 140, Quilizumab, Racotumomab, Radretumab, Rafivirumab, Ralpancizumab, Ramucirumab, Ranevetmab, Ranibizumab, Raxibacumab, Ravagalimab, Ravulizumab, Refanezumab, Regavirumab, Regdanvimab, Relatlimab, Remtolumab, Reslizumab, Retifanlimab, Rilotumumab, Rinucumab, Risankizumab, Rituximab, Rivabazumab pegol, Robatunmmab, Rmab, Roledumab, Romilkimab, Romosozumab, Rontalizumab, Rosmantuzumab, Rovalpituzumab tesirine, Rovelizumab, Rozanolixizumab, Ruplizumab, SA237, Sacituzumab govitecan, Samalizumab, Samrotamab vedotin, Sarilumab, Satralizumab, Satumomab pendetide, Secukinumab, Selicrelumab, Seribantumab, Setoxaxmiab, Setrusumab, Sevirumab, Sibrotuzumab, SGN-CD19A, SHP647, Sifalimumab, Siltuximab, Simtuzumab, Siplizumab, Sirtratumab vedotin, Sirukumab, Sofituzumab vedotin, Solanezumab, Solitomab, Sonepcizumab

[0104] , Sontuzumab, Sotrovimab, Spartalizumab, Spesolimab

[0107] , Stamulumab, Sulesomab, Suptavumab, Sutimlimab, Suvizumab, Suvratoxumab, Tabalumab, Tacatuzumab tetraxetan, Tadocizumab, Tafasitamab, Talacotuzumab, Talizumab, Talquetamab, Tamtuvetmab, Tanezumab, Taplitumomab paptox, Tarextumab, Tavolimab, Teclistamab, Tefibazumab, Telimomab aritox, Telisotuzumab, Telisotuzumab vedotin, Tenatumomab, Teneliximab, Teplizumab, Tepoditamab, Teprotumumab, Tesidolumab, Tetulomab, Tezepelumab, TGN1412, Tibulizumab, Tildrakizumab, Tigatuzumab, Timigutuzumab, Timolumab, tiragolumab, Tiragotumab, Tislelizumab, Tisotumab vedotin, Tixagevimab, TNX-650, Tocilizumab, Tomuzotuximab, Toralizumab, Tosatoxumab, Tositumomab, Tovetumab, Tralokinumab

[0115] , Trastuzumab, Trastuzumab duocarmazine, Trastuzumab emtansine, TRBS07

[0117] , Tregalizumab, Tremelimumab

[0118] , Trevogrumab, Tucotuzumab celmoleukin, Tuvirumab, Ublituximab

[0120] , Ulocuplumab, Urelumab, Urtoxazumab, Ustekinumab, Utomilumab, Vadastuximab talirine, Vanatimab, Vandortuzumab vedotin, Vantictumab, Vanucizumab, Vapaliximab, Varisacumab, Varlilumab, Vatelizumab, Vedolizumab, Veltuzumab, Vepalimomab, Vesencumab, Vilobelimab, Visilizumab, Vobarilizumab, Volociximab, Vonlerolizumab, Vopratelimab, Vorsetuzumab mafodotin,Votumuniab, Vunakizumab, Xentuzumab, XMAB-5574, Zalutumuniab, Zanolimumab, Zatuximab, Zenocutuzumab, Ziralimumab, Zolbetuximab, andZolimomab aritox.

[0208] In some embodiments, the transgene encodes a coagulation factor. For example, the transgene encodes coagulation factor VIII (FVIII). In another non-limiting example, the transgene encodes coagulation factor IX (FIX). In still another non-limiting example, the transgene encodes coagulation factor VII (FVII). In yet another non-limiting example, the transgene encodes coagulation factor XI (FXI ).

[0209] In some embodiments, the transgene encodes a cytokine, e.g., a protein or peptide cytokine. For example, the transgene encodes interleukin-la (IL-la), interleukin-1 / 3 (IL-1 / 3), interleukin-2 (IL-2), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-6 (IL-6), interleukin-7 (IL-7), interleukin-8 (IL-8 / CXCL8), interleukin- 10 (IL- 10), interleukin- 12 (IL- 12), interleukin- 13 (IL-13), interleukin- 15 (IL-15), interleukin- 17 (IL-17), interleukin- 18 (IL-18), interleukin-37 (IL- 37), interleukin-38 (IL-38), tumor necrosis factor-a (TNF-a), interferon-a (INF-a), interferon-b (INF-b), interferon-y (INF-y), granulocyte- monocyte colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), monocyte chemoattractant protein- 1 (MCP- 1 / CCL2), macrophage inflammatory protein Let (MCP-1 / CCL3), macrophage inflammatory protein-1 / 3, RANTES (CCL5), Eotaxin (CCL11), variable endothelial growth factor (VEGF), endothelial growth factor (EGF), or fibroblast growth factor (FGF). In some embodiments, the transgene encodes IL-2. In some embodiments, the transgene encodes IL-37. In some embodiments, the transgene encodes IL-38. In some embodiments of any of the aspects, the subject comprises at least one cell, e.g., at least one liver cell, comprising a plurality of exogenous nucleotide sequences, each exogenous nucleotide sequence comprising a synthetic inducible promoter operably linked to a transgene, wherein the transgenes collectively encode IL-37 and IL- 38.

[0210] In some embodiments, the transgene encodes a hormone, e.g., a protein or peptide hormone. For example, the transgene encodes erythropoietin (EPO), parathyroid hormone (PTH), adiponectin , adrenaline (or epinephrine), adrenocorticotropic hormone (ACTH or corticotropin), adropin, aldosterone, amylin (or islet amyloid polypeptide), androstenedione, angiotensin, angiotensinogen, antidiuretic hormone (or vasopressin), anti-mullerian hormone (or mullerian- inhibiting factor / hormone), arginine vasopressin), atrial natriuretic peptide (ANP or atriopeptin), brain natriuretic peptide, calcitonin, calcitriol, cholecystokinin (CCK), corticotropin-releasing hormone, cortisol, cortistatin, dehydroepiandrosterone, dihydrotestosterone, dopamine, endothelin, enkephalin, estradiol, estriol, estrone, follicle-stimulating hormone (FSH), galanin, gastric inhibitory polypeptide, gastrin, ghrelin, glucagon, glucagon-like peptide- 1, gonadotropin-releasing hormone, growth hormone, growth hormone-releasing hormone, guanylin, hepcidin, humanchorionic gonadotropin, human placental lactogen, inhibin, insulin, insulin-like growth factor (or somatomedin), leptin, leukotrienes, lipotropin, luteinizing hormone (LH), melanocyte stimulating hormone (MSH), melatonin, motilin, noradrenaline (or norepinephrine), orexin, osteocalcin, oxytocin (or pitocin), pancreatic polypeptide, pituitary adenylate cyclase-activating peptide, progesterone, prolactin (or leuteotropic hormone), prolactin-releasing hormone, prostacyclin, prostaglandins, relaxin, renin, secretin, somatostatin (or growth hormone-inhibiting hormone or growth hormone release-inhibiting hormone or somatotropin release-inhibiting factor or somatotropin release-inhibiting hormone), testosterone, thrombopoietin, thromboxane, thyroid- stimulating hormone (TSH or thyrotropin), thyrotropin-releasing hormone (TRH), thyroxine, triiodothyronine, uroguanylin, vasoactive intestinal peptide (VIP), or vasopressin. In some embodiments of any of the aspects described herein, the transgene encodes erythropoietin (EPO) or parathyroid hormone (PTH). In some embodiments of any of the aspects described herein, the transgene encodes erythropoietin (EPO). In some embodiments of any of the aspects described herein, the transgene encodes parathyroid hormone (PTH).

[0211] In some embodiments, the transgene encodes a growth factor, e.g., a protein or peptide growth factor. For example, the transgene encodes tumor necrosis factor-alpha (TNF-a), adrenomedullin (AM), angiopoietin (Ang), autocrine motility factor, bone morphogenetic protein (BMP), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), colony-stimulating factor (e.g., macrophage colony-stimulating factor (M-CSF), granulocyte colony-stimulating factor (G-CSF), or granulocyte macrophage colony-stimulating factor (GM-CSF)), epidermal growth factor (EGF), ephrin (e.g., ephrin Al, ephrin A2, ephrin A3, ephrin A4, ephrin A5, ephrin Bl, ephrin B2, or ephrin B3), erythropoietin (EPO), fibroblast growth factor (e.g., FGF1, FGF2, FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9, FGF10, FGF11, FGF12, FGF13, FGF14, FGF15, FGF16, FGF17, FGF18, FGF19, FGF20, FGF21, FGF22 or FGF23), glial cell line-derived neurotrophic factor (GDNF), neurturin, persephin, artemin, growth differentiation factor-9 (GDF9), hepatocyte growth factor (HGF), hepatoma-derived growth factor (HDGF), insulin-like growth factor (e.g., IGF-1 or IGF-2), interleukin (e.g., IL-1, IL-2, IL-3, IL-4, IL-5, IL-6 or IL-7), keratinocyte growth factor (KGF), migration-stimulating factor (MSF), macrophage-stimulating protein (MSP), myostatin (GDF-8), neuregulin (e.g., NRG1, NRG3, NRG3 or NRG4), neurotrophin (e.g., brain-derived neurotrophic factor (BDNF), nerve growth factor (NGF), neurotrophin-3 (NT-3) or neurotrophin-4 (NT-4)), placental growth factor (PGF), platelet-derived growth factor (PDGF), renalase (RNLS), T-cell growth factor (TCGF), thrombopoietin (TPO), transforming growth factor (e.g., TGF-a or TGF-0), or vascular endothelial growth factor (VEGF).

[0212] Transgenes encoding a viral or virus protein can also be used. Thus, in some embodiments, the transgene encodes a viral protein. Exemplary, viral proteins include, but notlimited to viral envelop proteins, viral nucleocapsid proteins, viral membrane proteins, REP, CAP, REV, VSV-G and RD114. In some embodiments, the transgene encodes a viral spike protein, such as a coronavirus spike protein.

[0213] In some embodiments, the transgene encodes a cell receptor ligand, e.g., a protein or peptide cell receptor ligand. For example, the transgene encodes EGF, insulin, VEGF, cGMP, cGMP, cGTP, acetylcholine, ATP, dopamine, GABA, glutamate, glycine, serotonin, ketamine, nicotine, strychnine, cereulide, or muscarine. In some embodiments, the transgene encodes an enzyme.

[0214] In some embodiments of any one of the aspects described herein, the exogenous nucleotide sequence comprises a transgene useful for gene editing. For example, the exogenous nucleotide sequence comprises a transgene encoding a site-specific nuclease, such as a meganuclease, zinc finger nuclease (ZFN), transcription activator-like effector-based nuclease (TALEN), or the clustered regularly interspaced short palindromic repeats system (CRISPR-Cas). Typically, the site-specific nuclease is adapted to edit a desired target genomic locus by making a cut (typically a site-specific double-strand break) which is then repaired via non-homologous end- joining (NHEJ) or homology dependent repair (HDR), resulting in a desired edit. The edit can be the partial or complete repair of a gene that is dysfunctional, or the knock-down or knock-out of a functional gene.

[0215] In some embodiments, the nuclease is a CRISPR-Cas nuclease. For example, the transgene encodes Cas9 (also known as Csnl and Csxl2), C2cl, C2c3, Casl, CaslOO, Cast 2, Casl2a, Casl2b, Casl2c, Casl2d, Casl2e, Casl3a, Casl3b, Casl3c, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Casl, CaslB, CaslO, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Cpfl, Csa5, Csa5, CsaX, Csbl, Csb2, Csb3, Cscl, Csc2, Csel, Cse2, Csfl, Csf2, Csf3, Csf4, Csm2, Csm3, Csm4, Csm5, Csm6, Csn2, Csxl, CsxlO, Csxl4, Csxl5, Csxl6, Csxl7, Csx3, Csyl, Csy2, Csy3, Cas Phi, CasX or CasRx. In some embodiments, the transgene encodes Cas9. In some embodiments, the transgene encodes Cas 12. In some embodiments, the transgene encodes CasRx. In some embodiments, the transgene encodes Cas Phi. In some embodiments, the transgene encodes CasX.

[0216] In some embodiments of any of the aspects, described herein, the transgene encodes a chimeric antigen receptor (CAR). As used herein, “chimeric antigen receptor” or “CAR” refers to an artificially constructed hybrid polypeptide comprising an antigen-binding domain (e.g., an antigen-binding portion of an antibody (e.g., a scFV)), a transmembrane domain, and a T-cell signaling and / or T-cell activation domain. Most commonly, the CAR’s extracellular binding domain is composed of a single chain variable fragment (scFv) derived from fusing the variable heavy and light regions of a murine or humanized monoclonal antibody. Alternatively, scFvs may be used that are derived from Fab’s (instead of from an antibody, e.g. , obtained from Fab libraries),in various embodiments, this scFv is fused to a transmembrane domain and then to an intracellular signaling domain. The signaling and / or activation domain of a CAR may provide activation signals (e.g., TCRij, FcRy, FcR0, CD3y, CD38, CD3s, CD3^, CD22, CD79a, CD79b, and / or CD66d) and / or one or more costimulation (e.g., CARD11, CD2, CD7, CD27, CD28, CD30, CD40, CD54 (ICAM), CD83, CD134 (0X40), CD137 (4-1BB), CD150 (SLAMF1), CD152 (CTLA4), CD223 (LAG3), CD270 (HVEM), CD273 (PD-L2), CD274 (PD-L1), CD278 (ICOS), DAP10, LAT, NKD2C SLP76, TRIM, and / or ZAP70) signals upon antigen binding. Further discussion of CARs can be found, e.g., in Maus et al. Blood 2014 123:2624-35; Reardon et al. Neuro-Oncology 2014 16:1441-1458; Hoyos et al. Haematologica 2012 97: 1622; Byrd et al. J Clin Oncol 2014 32:3039- 47; Maher etal. Cancer Res 200969:4559-4562; and Tamadaez a / . Clin Cancer Res 2012 18:6436- 6445; each of which is incorporated by reference herein in its entirety. A large number of CARs are known in the art, e.g., 100s have entered clinical trials and / or been approved, as described in Ivica et la. Healthcare (Basel) 2021 9(8): 1062; which is incorporated by reference herein in its entirety.

[0217] In some embodiments of any of the aspects described herein, the transgene is detrimental to the liver cell or to the subject when constitutively expressed. A transgene is detrimental when it inhibits cellular or tissue function, survival, repair, or persistence. The detrimental effect can contribute to or increase the pathology of an existing condition, e.g., the condition the subject is receiving the transgene to treat, and / or contribute to or cause a new condition. Non-limiting examples of detrimental effects include toxicity and accumulation of misfolded proteins.

[0218] In some embodiments of any one of the aspects described herein, the expression product can be a nucleic acid, for example an RNA. For example, the expression product can be an antisense RNA, microRNA, siRNA, tRNA, rRNAs, guide RNA or any other regulatory, therapeutic or otherwise useful RNA.

[0219] In some embodiments of any one of the aspects described herein, the gene is not a reporter gene. Preferably, the gene encodes a therapeutic expression product (e.g., as discussed above) or another expression product that is useful in industry or research. Thus, in some embodiments of the various aspects described herein, the gene expresses a product which is not a reporter (such as a fluorescent protein, luminescent protein or a chromogenic protein), and preferably expresses a therapeutic expression product.

[0220] Suitably the exogenous nucleotide sequence comprises sequences providing or coding for one or more (e.g., 1, 2, 3 or all 4) of a ribosomal binding site, a start codon, a stop codon, and a transcription termination sequence. Accordingly, in some embodiments of any one of the aspects described herein, the exogenous nucleotide sequence comprises a nucleic acid sequence encodinga ribosomal binding site. In some embodiments, the exogenous nucleotide sequence comprises a nucleic acid sequence encoding a start codon. In some embodiments, the exogenous nucleotide sequence comprises a nucleic acid sequence encoding a stop codon. In some embodiments, the exogenous nucleotide sequence comprises a nucleic acid sequence encoding a transcriptional termination site.

[0221] In some embodiments, the exogenous nucleotide sequence further comprises a nucleic acid sequence encoding a posttranscriptional regulatory element. In some embodiments, the exogenous nucleotide sequence comprises a nucleic acid encoding a polyA element. Inducer

[0222] In some embodiments of the various aspects described herein, the inducer is artemisinin or a derivative thereof. Exemplary derivatives of artemisinin include, but are not limited to artesunate, arteether, artemether, and dihydroartemisinin (DHA). The derivatives can include those of Formula (I):(Formula I), wherein: X is –(O)n–, n is 1 or 2; Y is O or NRN; where: RNis a hydrogen atom or an optionally substituted alkyl, alkenyl, alkynyl, aralkyl or heterocyclylalkyl group; R1is hydrogen, halogen, hydroxyl, optionally substituted C1-C6alkyl, optionally substituted C2-C6alkenyl, optionally substituted C2-C6alkynyl, optionally substituted alkoxyl, optionally substituted cycloalkyl, optionally substituted aryl, C-linked heteroaryl or heterocyclylalkyl group, –NR7R8, -X1-R9, -NR10X2(=Z2)- R11, –OR12, –NHR12, –SR12, –O(CH2)b-CH(X6)CH(Y6)-Z6, where: R7and R8are independently H, optionally substituted C1-C6alkyl, optionally substituted C2-C6alkenyl, optionally substituted C2-C6alkynyl, optionallysubstituted aryl, optionally substituted heteroaryl, optionally substituted heterocyclyl, optionally substituted cycloalkyl; or R7and R8together with the nitrogen atom form optionally substituted heterocyclic group or an amino group derived from an optionally substituted amino acid ester; X1is O, O(CH2)p or OCHR9Awhere R9Ais C1-C6 alkyl, CN, CO2H, CO2Me or CO2Et, p is an integer of 1 to 4; R9is Ar—Y—Z or Ar—Z, where Ar is a phenyl group or a naphthyl group, Y is O(CH2)q, OCHMe, C1-C4alkyl, wherein q is an integer of 1 to 4; and Z is H, halogen, OR’, COOR’ or CONHCH2COOR’, wherein R’ is H, C1- C4 alkyl, o-methoxy phenyl or C1-C4 alkylamine group; R10is a hydrogen atom or an optionally substituted alkyl, alkenyl, alkynyl, cycloalkyl, aryl or aralkyl group; X2is a carbon atom, a sulfur atom, a sulfoxide group S═O, —PRX3, —P— O—RX3or —P—N(RX4)—RX4where RX3and RX4each independently represent a hydrogen atom or an optionally substituted alkyl, alkenyl, alkynyl, cycloalkyl, aryl or aralkyl group; Z2is an oxygen atom, a sulfur atom, or group NRX5where RX5is hydrogen or an optionally substituted alkyl, alkenyl, alkynyl, cycloalkyl, aryl or aralkyl group; and R11represents a hydrogen atom or an optionally substituted alkyl, alkenyl, alkynyl, cycloalkyl, aryl, aralkyl, N(RX6)2, NHNH2, NRX6NHRXX6or NRX6N(RX6)2, ORX6, SRX6, ORX7or NRX6RX7, where each RX6independently represents a hydrogen atom or an optionally substituted alkyl, alkenyl, alkynyl, cycloalkyl, aryl, aralkyl, or a 10α- dihydroartemisinyl group; RX7represents a bond attached as a substituent to RX5together with the group —X2═Z2— forming an optionally substituted heterocyclic group where Z2represents a group NRX5, or RX7represents a bond attached as a substituent to R10together with the group —N—X2(═Z2)— forming an optionally substituted heterocyclic group; each R12is independently H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl optionally substituted cycloalkyl, optionally substituted aryl, or C-linked heteroaryl or heterocyclylalkyl group; b is 0 or 1;X6is H or OH; Y6is H, CH3or phenyl; and Z6is NH2, NHR6N, N(R6N)2, NHCH2CH2OH, NHCH2CH2OH, NH(CH2)2-where each R6Nis independently C1-C6alkyl; R2is H, halogen, optionally substituted C1-C6alkyl, optionally substituted C2- C6alkenyl, optionally substituted C2-C6alkynyl; or R1and R2together form a carbonyl (=O); or R1and R2together are =NCH(R13)-(CH2)a-C(O)-R14, where: a is 0 to 10; R13is H, optionally substituted alkyl, optionally substituted aryl, optionally substituted aralkyl, optionally substituted hydroxyalkyl, optionally substituted polyhydroxyalkyl, optionally substituted hydroxyaryl, optionally substituted polyhydroxyaryl, optionally substituted heterocyclic-alkyl, optionally substituted mercapto-alkyl, optionally substituted dithio-alkyl, optionally substituted carboxyalkyl, optionally substituted amidoalkyl, or optionally substituted guanidinoalkyl; R14is ORA3, NRA3RA4, and peptide; and RA3and RA4are independently H, optionally substituted alkyl, or optionally substituted aryl; R3optionally substituted C1-C6alkyl, optionally substituted C2-C6alkenyl, optionally substituted C2-C6alkynyl, H, or halogen; R4is H, halogen, optionally substituted C1-C6alkyl, optionally substituted C2- C6alkenyl, optionally substituted C2-C6alkynyl; or R2and R4together form a double bond between the carbon atoms they are attached to; R5is optionally substituted C1-C6alkyl, optionally substituted C2-C6alkenyl, optionally substituted C2-C6alkynyl, H, or halogen; and R6is optionally substituted C1-C6alkyl, optionally substituted C2-C6alkenyl, optionally substituted C2-C6alkynyl, H, or halogen, or a pharmaceutically acceptable salt thereof.

[0223] The skilled artisan can readily select any permutation of substituents falling within Formula (I). For example, R1can be hydroxyl or optionally substituted C1-C6alkoxy, R2can be hydrogen, R3can be optionally substituted C1-C6alkyl, R4can be H, R5can be can be optionally substituted C1-C6alkyl, X can be -O-O-, Y can be O, etc. but any of the various substituents is contemplated herein.

[0224] The inducer for the first or any of the subsequent administration of the inducer can be artemisinin, an artemisinin derivative, or a flavonoid compound. In some embodiments, the first inducer is artemisinin or derivative thereof. For example, the first inducer is artemisinin or a derivative thereof selected from the group consisting of artesunate; artemether; dihydroartemisinin; α-dihydroartemisinin β-glucoronide; artemisone; arteether; artenimol; artesunic acid; artelinic acid; deoxyartemisinin; deoxydihydroartemisinin; 9,10-dihydrodeoxyaremisinin; artemotil; and artemiside. In some embodiments, the first inducer is artemisinin, artesunate, dihydroartemisinin, artesunate, or artemether. For example, the first inducer is artemisinin, artesunate or dihydroartemisinin. In some embodiments, the first inducer is artemisinin.

[0225] In some embodiments, the first inducer is a flavonoid compound. For example, the second inducer is flavone, baicalein, chrysin, galangin, (OH)4 flavone, 6-hydroxyluteolin, acacetin, acerosin, alnetin, apigenin, apiin, artocarpetin, balcalein, beta-sitosterol, biochamin A, cannaflavin A, cannflavin A, cannflavin B, cannflavin C, catechin, catechin-3-gallate, cerrosillin, chrysoeriol, chrysoeriol, cirsilineol, cirsiliol, cirsimaritin, corymbosin, cupressuflavone, cyanidine, daidzein, datiscetin, delphinidine, digidrokempferol , dihydroquercetin, diosmetin, diosmin, echioidinin, epicatechin, epicatechin-3-gallate, epigallocatechin, epigallocatechin-3-gallate, eriodiktiol, eupatilin, eupatorin, fisetin, fizetin, flavonol, formononetin, fortunelin, gallocatechin, gallocatechin-3-gallate, gardenin D, genistein, genistin, genkwanin, geraldol, geraldone, glycitein, glycitin, gomoeriodiktiol, gossypetin, hesperetin, hinokiflavone, hispidulin, hymenoxin, hypolaetin, isoquercetin, isorhamnetin, isorhamnetin, isoscutellarein, isovitexin, jaceosidin, kaempferol, kaempferol, kampferide, largonidin, luteolin, luteolin, malvidine, mikanin, morin, myricetin, myricetin, naringenin, negletein, neodiosmin, nepetin, nevadensin, nobiletin, nodifloretin, norartocarpetin, norwogonin, onopordin, orientin, oroxylin a, pachipodol, pectolinarigenin, pedalitin, peonidin, petunidin, pilloin, pratol, primetin, primuletin, pruentin, quercetagetin, quercetin, ramnazin, rhoifolin, robinetin, rutin, scaposin, scutellarein, serpyllin, sinensetin, sorbifolin, sudachitin, tangeretin, tangeritin, taxifolin, tectochrysin, tithonine, tricetin, tricin, velutin, vitexin, wightin, wogonin, xanthomicrol, zapotin, zapotinin, 6,7,4’-trishydroxy isoflavone, 7,3’4’-trihydroxy isoflavone, or a pharmaceutically acceptable salt thereof. In some embodiments, the first inducer is flavone.

[0226] The inducer for the second or any of the subsequent administration of the inducer can be independently artemisinin; an artemisinin derivative; a flavonoid compound, e.g. flavone, chrysin, baicalein, or galangin; 1,4-Bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP); phenobarbital (PB); 6-(4Chlorophenyl)imidazo[2,1-b][1,3]thiazole-5-carbaldehyde-O-(3,4- dichlorobenzyl)oxime (CITCO); Acetaminophen; Buprenorphine; Phenytoin; Carbamazepine; Valproic Acid; Chlorpromazine; Efavirenz; Nevirapine; Rilpivirine; Etravirine; Diazepam;Cyclophosphamid; Ifosfamide; Cerivastatin; Simvastatin; lovastatin; substituted sulphonamides; Thiazolidin-4-one; Estradiol; Estrone and analogues; 17α-ethinyl-3;17ß-estradiol (EE2); Dehydroepiandrost erone (DHEA); 5ß-pregnane-3,20-dione; Diethylstilbestrol; Gingko biloba extract; Galangin; chrysin; baicalein; Diallyl sulphide; Ellagic acid; Resveratrol; Squalestatin-1; Bilobalide; Triclocarban; Triclosan; Dichlorodiphenyltrichloroethane (DDT); Dieldrin; Methoxychlor; Metofluthrin; Permethrin; Pyrethrins; Sulfoxaflor; Diethylhexyl phthalate (DEHP); Cyproconazole; Fluconazole; Propiconazole; FL81; Tri-p-methylphenyl phosphate (TMPP); UM104; or UM145.

[0227] In some embodiments of any one of the aspects described herein, the second inducer is artemisinin; artesunate; artemether; dihydroartemisinin; α-dihydroartemisinin β-glucoronide; artemisone; arteether; artenimol; artesunic acid; artelinic acid; deoxyartemisinin; deoxydihydroartemisinin; 9,10-dihydrodeoxyaremisinin; artemotil; artemiside; or flavone. For example, the second inducer is artemisinin, artesunate, dihydroartemisinin, artesunate, artemether, or flavone. In some embodiments, the second inducer is artemisinin, artesunate or dihydroartemisinin.

[0228] In some embodiments of any one of the aspects described herein, the second inducer is a flavonoid compound. For example, the second inducer is flavone, baicalein, chrysin, galangin, (OH)4 flavone, 6-hydroxyluteolin, acacetin, acerosin, alnetin, apigenin, apiin, artocarpetin, balcalein, beta-sitosterol, biochamin A, cannaflavin A, cannflavin A, cannflavin B, cannflavin C, catechin, catechin-3-gallate, cerrosillin, chrysoeriol, chrysoeriol, cirsilineol, cirsiliol, cirsimaritin, corymbosin, cupressuflavone, cyanidine, daidzein, datiscetin, delphinidine, digidrokempferol , dihydroquercetin, diosmetin, diosmin, echioidinin, epicatechin, epicatechin-3-gallate, epigallocatechin, epigallocatechin-3-gallate, eriodiktiol, eupatilin, eupatorin, fisetin, fizetin, flavonol, formononetin, fortunelin, gallocatechin, gallocatechin-3-gallate, gardenin D, genistein, genistin, genkwanin, geraldol, geraldone, glycitein, glycitin, gomoeriodiktiol, gossypetin, hesperetin, hinokiflavone, hispidulin, hymenoxin, hypolaetin, isoquercetin, isorhamnetin, isorhamnetin, isoscutellarein, isovitexin, jaceosidin, kaempferol, kaempferol, kampferide, largonidin, luteolin, luteolin, malvidine, mikanin, morin, myricetin, myricetin, naringenin, negletein, neodiosmin, nepetin, nevadensin, nobiletin, nodifloretin, norartocarpetin, norwogonin, onopordin, orientin, oroxylin a, pachipodol, pectolinarigenin, pedalitin, peonidin, petunidin, pilloin, pratol, primetin, primuletin, pruentin, quercetagetin, quercetin, ramnazin, rhoifolin, robinetin, rutin, scaposin, scutellarein, serpyllin, sinensetin, sorbifolin, sudachitin, tangeretin, tangeritin, taxifolin, tectochrysin, tithonine, tricetin, tricin, velutin, vitexin, wightin, wogonin, xanthomicrol, zapotin, zapotinin, 6,7,4’-trishydroxy isoflavone, 7,3’4’-trihydroxy isoflavone, or a pharmaceutically acceptable salt thereof. In some embodiments, the second inducer is flavone.

[0229] In some embodiments of any one of the aspects described herein, the first inducer is artemisinin and the second inducer can be artemisinin or a derivative thereof, or the second inducer can be selected from the group consisting of a flavonoid compound, e.g. flavone, chrysin, baicalein, or galangin; 1,4-Bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP); phenobarbital (PB); 6- (4Chlorophenyl)imidazo[2,1-b][1,3]thiazole-5-carbaldehyde-O-(3,4-dichlorobenzyl)oxime (CITCO); Acetaminophen; Buprenorphine; Phenytoin; Carbamazepine; Valproic Acid; Chlorpromazine; Efavirenz; Nevirapine; Rilpivirine; Etravirine; Diazepam; Cyclophosphamid; Ifosfamide; Cerivastatin; Simvastatin; lovastatin; substituted sulphonamides; Thiazolidin-4-one; Estradiol; Estrone and analogues; 17α-ethinyl-3;17ß-estradiol (EE2); Dehydroepiandrost erone (DHEA); 5ß-pregnane-3,20-dione; Diethylstilbestrol; Gingko biloba extract; Galangin; chrysin; baicalein; Diallyl sulphide; Ellagic acid; Resveratrol; Squalestatin-1; Bilobalide; Triclocarban; Triclosan; Dichlorodiphenyltrichloroethane (DDT); Dieldrin; Methoxychlor; Metofluthrin; Permethrin; Pyrethrins; Sulfoxaflor; Diethylhexyl phthalate (DEHP); Cyproconazole; Fluconazole; Propiconazole; FL81; Tri-p-methylphenyl phosphate (TMPP); UM104; and UM145. For example, the first inducer is artemisinin and the second inducer is an artermisinin, artemisinin derivative or flavone. In some embodiments of any one of the aspects described herein, the first inducer is artemisinin and the second inducer is artemisinin, artesunate, dihydroartemisinin, artesunate, artemether, or flavone. For example, the first inducer is artemisinin and the second inducer is artemisinin, artesunate, dihydroartemisinin, or flavone. In some embodiments, the first inducer is artemisinin and the second inducer is flavone.

[0230] In some embodiments of any one of the aspects described herein, the first inducer is artemisinin and the second inducer is artemisinin, artesunate, dihydroartemisinin, artesunate, artemether, or flavone. For example, the first inducer is artemisinin and the second inducer is artemisinin, artesunate, dihydroartemisinin, or flavone.

[0231] In some embodiments, the first inducer is flavone and the second inducer is artemisinin, or an artemisinin derivative. For example, the first inducer is flavone and the second inducer is artemisinin, artesunate, dihydroartemisinin, artesunate, artemether. In some embodiments, the the first inducer is flavone and the second inducer is artemisinin, artesunate or dihydroartemisinin. For example, the first inducer is flavone and the second inducer is artemisinin.

[0232] In some embodiments, the first and second inducers are the same. For example, the first and second inducer are artemisinin. In another non-limiting example, the first and second inducer are flavone. In yet another non-limiting example, the first and second inducer are artesunate. In still another non-limiting example, the first and second inducer are dihydroartemisinin. In another non-limiting example, the first and second inducer are artesunate. In still another non-limiting example, the first and second inducer are artemether.

[0233] In some embodiments of any one of the aspects described herein, artemisinin or a derivative thereof is of Formula(Formula I), or a pharmaceutically acceptable salt thereof.

[0234] In some embodiments of any one of the aspects described herein, n is 2, i.e., X is –O– O–. In some other embodiments of any one of the aspects described herein, n is 1, i.e., X is –O–.

[0235] In some embodiments of any one of the aspects described herein, Y is O.

[0236] In some embodiments of any one of the aspects described herein, Y is NRN.

[0237] In some embodiments of any one of the aspects described herein, R6is methyl.

[0238] In some embodiments of any one of the aspects described herein, R5is methyl.

[0239] In some embodiments of any one of the aspects described herein, R4is H.

[0240] In some embodiments of any one of the aspects described herein R4is halogen. For example, R4is bromo, chloro, fluoro or iodo. In some embodiments, R4is bromo.

[0241] In some embodiments of any one of the aspects described herein, R3is methyl.

[0242] In some embodiments of any one of the aspects described herein, R3, R5and R6are methyl; and R4are is H.

[0243] In some embodiments of any one of the aspects described herein, R3, R5and R6are methyl; and R4is H.

[0244] In some embodiments of any one of the aspects described herein, n is 2 (i.e., X is –O- O–); R3, R5and R6are methyl; and R4are is H.

[0245] In some embodiments of any one of the aspects described herein, n is 2 (i.e., X is –O- O–); R3, R5and R6are methyl; and R4is H.

[0246] In some embodiments of any one of the aspects described herein, R3, R5and R6are methyl; and R2and R4are H.

[0247] In some embodiments of any one of the aspects described herein, R2is H; R3, R5and R6are methyl; and R4is halogen.

[0248] In some embodiments of any one of the aspects described herein, n is 2 (i.e., X is –O- O–); R3, R5and R6are methyl; and R2and R4are H.

[0249] In some embodiments of any one of the aspects described herein, n is 2 (i.e., X is –O- O–); R2is H; R3, R5and R6are methyl; and R4is halogen.

[0250] In some embodiments of any one of the aspects described herein, n is 2 (i.e., X is –O- O–); R1and R2are carbonyl (=O); R3, R5and R6are methyl; and R4is halogen.

[0251] In some embodiments of any one of the aspects described herein, the artemisinin derivative is of Formula (I-A):(Formula I-A), wherein: R1is halogen, —NR1AR2A, or an optionally substituted cycloalkyl, aryl, C-linked heteroaryl or heterocyclylalkyl group; where: R1Jis H or an optionally substituted alkyl, alkenyl or alkynyl group; R2Ais an optionally substituted alkyl, alkenyl, alkynyl, cycloalkyl, aryl or aralkyl group; or R1Aand R2Atogether with the interjacent nitrogen atom represent an optionally substituted heterocyclic group or an amino group derived from an optionally substituted amino acid ester.

[0252] In some compounds of Formula I-A, R1is halogen, optionally substituted cycloalkyl, optionally substituted aryl, C-linked heteroaryl or heterocyclylalkyl group, or –NR7R8.

[0253] In some compounds of Formula I-A, R1is halogen; phenyl; 2-methoxyphenyl, 2,4- dimethoxyphenyl; 2,4,5-trimethoxyphenyl; 2,4,6-trimethoxyphenyl; 4-F-phenyl; 4-Cl-phenyl; 4- Br-phenyl; 4-I-phenyl; 4-vinylphenyl; 4-C(O)OH-phenyl; 2 –naphthyl; 2-hydroxyl-naphthyl; morpholino; thiomorpholino; 2-furyl; 4’-(S,S-dioxothiomorpholin-1’-yl); 4’-benzyl-1’- piperazinyl; 2-pyrrolyl; 4’-benzyl-4’-methylpiperazinium-1’-yl; indolinyl; 1,2,3,4- tetrahydroisoqionolinyl; N-methylpiperazino; 9-anthryl; 9-phenathryl; 4-phenylpiperazino; 4-(2’- methoxyphenyl)-piperazino; 4-(4’-fluorophenyl)piperazino; 4-(2’-pyridyl)piperazino; 4-(2’- pyridyl)-piperazino; 4-(3’-trifluromethylphenyl)-piperazino; 1-(2-pyrimidyl)-piperazino; 1-(4- chlorophenyl)-piperazino); 1-(3-chlorophenyl)-piperazino); 1-(2-chlorophenyl)-piperazino); 1-(4- methoxyphenyl)-piperazino); 1-(3-methoxyphenyl)-piperazino); 1-(2-methoxyphenyl)- piperazino); 1-(chloro-tolyl)-piperazino; 4-benzylpiperdino; or methoxynaphthyl.

[0254] In some compounds of Formula I-A, R1is –NR7R8, wherein R7is H, methyl, ethyl or propyl; and R8is phenyl; 4-F-phenyl; 4-Cl-phenyl; 4-Br-phenyl; 4-I-phenyl; 4-biphenyl; benzyl; 2-F-benzyl; 4-F-benzyl; 3,5-trifluoromethylbenzyl; methyl, ethyl, propyl, butyl, - CH(CH3)phenyl; -CH(C(O)OCH3)phenyl; 4-(C(O)OCH3)phenyl; cyclopentyl; or cyclohexyl. For example, R7is H and R8is phenyl; 4-F-phenyl; 4-Cl-phenyl; 4-Br-phenyl; 4-I-phenyl; 4-biphenyl; benzyl; 2-F-benzyl; 4-F-benzyl; 3,5-trifluoromethylbenzyl; methyl, ethyl, propyl, butyl, - CH(CH3)phenyl; -CH(C(O)OCH3)phenyl; 4-(C(O)OCH3)phenyl; cyclopentyl; or cyclohexyl.

[0255] In some embodiments of any one of the aspects described herein, the compound of Formula I-A is selected from the group consisting of 10β-fluoro-10-deoxo-10-dihydro- artemisinin, 10β-phenyl-10-deoxo-10-dihydroartemisinin, 10α-(4′-fluorobenzylamino)-10-deoxo- 10 –dihydroartemisinin, 10-(2′,4′-dimethoxyphenyl)-10-deoxo-10-dihydroartemisinin, 10α-(2′- hydroxy-1′-naphthyl)dihydro artemisinin, 10α-(4′-thiomorpholino-1′-yl)-10-deoxo-10- dihydroartemisinin, 10α-(4′-(S,S-dioxothiomorpholin-1′-yl)-10-deoxo-10-dihydroartemisinin, 10α-(4′-benzylpiperazin-1′-yl)-10-deoxo-10-dihydroartemisinin, 10α-(2′-furyl)-10-deoxo-10- dihydroartemisinin, 10α-(Pyrrol-2′-yl)-10-deoxo-10-dihydroartemisinin, and 10α-(4′-Benzyl-4′- methylpiperazinium-1′-yl)-10-deoxo-10-dihydroartemisinin iodide salt.

[0256] Compounds of Formula I-A and their synthesis are described, for example, in US Pat. No.7,43,238, content of which is incorporated herein by reference in its entirety.

[0257] In some embodiments of any one of the aspects described herein, the artemisinin derivative is of Formula (I-B):(Formula I-B), wherein: X1is O, O(CH2)p or OCHR9A, where R9Ais C1-C4 alkyl, CN, COOH, COOMe or COOEt, and p is an integer of 1 to 4; R9is Ar—Y—Z or Ar—Z, where Ar is a phenyl group or a naphthyl group, Y is O(CH2)q, OCHMe, C1-C4alkyl; and Z is H, halogen, OR′, COOR′ orCONHCH2COOR′, where q is an integer of 1 to 4 and R′ is H, C1-C4alkyl, o- methoxy phenyl or C1-C4alkylamine group.

[0258] In some compounds of Formula I-B, X1is O, O(CH2)p (e.g., p is 1 , 2, 3 or 4), or OCHR9A(e.g., R9Ais C1-C4alkyl, CN, CO2H, CO2Me or CO2Et,); R9is Ar—Y—Z or Ar—Z (e.g., Ar is a phenyl group or a naphthyl group; Y is O(CH2)q(e.g., q is 1, 2, 3, or 4); OCHMe or C1-C4alkyl); and Z is H, halogen, OR’, COOR’ or CONHCH2COOR’ (wherein R’ is H, C1- C4 alkyl, o-methoxy phenyl or C1-C4 alkylamine group).

[0259] In some compounds of Formula I-B, X is O or OCH2; R9is Ar—Y—Z; and Y is O(CH2)p, OCHMe, or C1-C4hydrocarbyl; and Z is COOR’, wherein, p is 1 or 2; Ar is phenyl, and R’ R’ is H, Me, Et or o-methoxyphenyl.

[0260] In some embodiments of any one of the aspects described herein, the compound of Formula I-B is selected form the group consisting of methyl 4-(12β-artemisininoxy)phenyl acetate; 4-(12β-artemisininoxy)phenyl acetic acid; ethyl 4-(12β-artemisininoxy)-phenoxy acetate; 3-(12β-artemisininoxy)phenoxy succinic acid; ethyl-[4-(12β-artemisininoxy)benzoyl] aminoacetate; methyl 2-[4-(12β-artemisininoxy)phenyl] propionate; o-methoxy-phenyl 2-[4- (12β-artemisininoxy)phenyl] propionate; ethyl 2-[4-(12β-artemisininoxy)phenoxy] propionate; 2- [4-(12β-artemisininoxy)phenoxy] propanoic acid; o-methoxy-phenyl 2-[4-(12β- artemisininoxy)phenoxy] propionate; o-methoxy-phenyl 2-[3-(12β-artemisininoxy)phenoxy] propionate’ and 2-[4-(12β-artemisininoxy)phenyl] propanoic acid.

[0261] Compounds of Formula I-B and their synthesis are described, for example, in US Pat. No.7,910,750, content of which is incorporated herein by reference in its entirety.

[0262] In some embodiments of any one of the aspects described herein, the artemisinin derivative is of Formula (I-C):(Formula I-C), wherein:R10represents a hydrogen atom or an optionally substituted alkyl, alkenyl, alkynyl, cycloalkyl, aryl or aralkyl group; X2represents a carbon atom, a sulfur atom, a sulfoxide group S═O or a group PRX3, P—O—RX3or P—N(RX44)—RX3, where RX3and RX4each independently represent a hydrogen atom or an optionally substituted alkyl, alkenyl, alkynyl, cycloalkyl, aryl or aralkyl group; Z2represents an oxygen atom, a sulfur atom or a group NRX5where RX5represents a hydrogen atom or an optionally substituted alkyl, alkenyl, alkynyl, cycloalkyl, aryl or aralkyl group; and R11represents a hydrogen atom or an optionally substituted alkyl, alkenyl, alkynyl, cycloalkyl, aryl or aralky group, or a group N(RX6)2, NHNH2, NRX6NHRX6or NRX6N(RX6)2, or a group ORX6or SRX6where each RX6independently represents a hydrogen atom or an optionally substituted alkyl, alkenyl, alkynyl, cycloalkyl, aryl or aralkyl group, or a 10α-dihydroartemisinyl group, or RX2represents a group ORX6or NRX6RX7where RX6represents a group as defined above and RX7represents a bond attached as a substituent to RX5together with the group — X2═Z2- forming an optionally substituted heterocyclic group where Z2represents a group NRX5, or RX7represents a bond attached as a substituent to R10together with the group —N—X2(═Z2)- forming an optionally substituted heterocyclic group.

[0263] In some compounds of Formula I-C, R10represents a hydrogen atom, a methyl group, ethyl group or longer chain alkyl group or a branched alkyl group containing up to 9 carbon atoms, preferably a hydrogen atom, a methyl group or an ethyl group.

[0264] In some compounds of Formula I-C, X2represents a carbon atom, a sulfur atom, or a group —PRX3, —P—O—RX3or —P—N(RX44)—RX3where RX3and RX4each independently represent a C6-18aryl group or a 5- to 10-membered C-linked heteroaryl group or a 5- to 10- membered heterocyclyl-C1-6alkyl group optionally substituted by one or more substituents selected from the group consisting of halogen atoms, hydroxyl, C1-4 alkyl, C2-4 alkenyl, C1- 4 haloalkyl, C1-4 alkoxy, C1-4 haloalkoxy, amino, C1-4 alkylamino, di(C1-4 alkyl)amino and carboxyl groups. Preferably, X2represents a carbon atom or a sulfur atom.

[0265] In some compounds of Formula I-C, Z2represents an oxygen atom, or a group NRX5where RX5represents a hydrogen atom, a methyl group, ethyl group or longer chain alkyl group or branched alkyl group containing up to 9 carbon atoms, or a C6-18 aryl group or a 5- to 10- membered C-linked heteroaryl group or a 5- to 10-membered heterocyclyl-C1-6alkyl group optionally substituted by one or more substituents selected from the group consisting of halogenatoms, hydroxyl, C1-4alkyl, C2-4alkenyl, C1-4haloalkyl, C1-4alkoxy, C1-4haloalkoxy, amino, C1-4alkylamino, di(C1-4alkyl)amino and carboxyl groups.

[0266] In some compounds of Formula I-C, R11represents a hydrogen atom or an optionally substituted alkyl, alkenyl, alkynyl, cycloalkyl, aryl or aralkyl group, or a group ORX6, SRX6, NH2, NHRX6, or N(RX6)2where each RX6indepently represents a methyl group, ethyl group or longer chain alkyl group or branched alkyl group containing up to 9 carbon atoms atoms, or is a C6-18 aryl group or a 5- to 10-membered C-linked heteroaryl group or a 5- to 10-membered heterocyclyl-C1-6 alkyl group optionally substituted by one or more substituents selected from the group consisting of halogen atoms, hydroxyl, C1-4 alkyl, C2-4 alkenyl, C1-4 haloalkyl, C1-4 alkoxy, C1-4haloalkoxy, amino, C1-4alkylamino, di(C1-4alkyl)amino and carboxyl groups. Preferably, R11represents a group NH2, or a group NHRX6where RX6represents an alkyl or aryl group, or a group N(R6)2where R6represent identical or differentiated alyl groups.

[0267] In some compounds of Formula I-C, R11represents a hydrogen atom or an optionally substituted allyl, alkenyl, alkynyl, cycloalkyl, aryl or aralkyl group, preferably a hydrogen atom or an alkyl group, more preferably a hydrogen atom or a methyl group or an ethyl group; X2represents a carbon, phosphorus or sulfur atom, preferably a carbon or sulfuir atom; Z2represents an oxygen atom or a group NRX5in where RX5represents a hydrogen atom or an optionally substituted alkyl, alkenyl, alkynyl, cycloalkyl, aryl or aralkyl group, preferably an oxygen atom; and R11represents a group ORX6, SRX6, NH2, NHRX6, or N(RX6)2where each RX6independently represents a hydrogen atom or an optionally substituted alkyl, alkenyl, alkynyl, cycloalkyl, aryl or aralkyl group, or a 10α-dihydroartemisinyl group, preferably a hydrogen atom or an optionally substituted alkyl or aryl group, more preferably R11represents a group NH2, or a group NHRX6where RX6represents an alkyl group, or a group N(RX6)2 where RX6represent identical or differentiated alkyl groups.

[0268] In some compounds of Formula I-C, R10represents a hydrogen atom, X2represents a sulfoxide group S═O, Z2represents an oxygen atom, and R11represents a group NH2; or R9represents a hydrogen atom, X2represents a carbon atom, Z2represents a group NH, and R11represents a group NHRX6where RX6represents a hydrogen atom or an optionally substituted alkyl, cycloalkyl, aryl or aralkyl group; or R9represents a hydrogen atom, X2represents a carbon atom, Z2represents an oxygen atom, and R11represents a group NHRX6where RX6is a hydrogen atom or an optionally substituted alkyl, cycloalkyl, aryl or aralkyl group.

[0269] In some embodiments of any one of the aspects described herein, the compound of Formula I-C is 10α-(Sulfamino)dihydroartemisinin or Bis[(10α-dihydroartemisinyl)]sulfamide.

[0270] Compounds of Formula I-C and their synthesis are described, for example, in US Pat. Pub. No.2005 / 0119232, content of which is incorporated herein by reference in its entirety.

[0271] In some embodiments of any one of the aspects described herein, the artemisinin derivative is of Formula (I-D):(Formula I-D), wherein: R4is halogen (e.g., F, Cl or Br); and R1is H, –R12, –OR12, –NHR12, –NR12R12, or –SR12, where each R12is independently H, optionally substituted cycloalkyl, optionally substituted aryl, or C-linked heteroaryl or heterocyclylalkyl group.

[0272] In some compounds of Formula I-D, R1is –OCH3, –OCH2CH3, –OCH2CH2OH, – NHPh, –CH2N(CH3)2, –SPh or –CH2Ph.

[0273] In some compounds of Formula I-D, R1is –OCH3, –OCH2CH3, –OCH2CH2OH and R4is Br. For example, R1is –OCH3.

[0274] In some compounds of Formula I-D, R1is –OCH3, –OCH2CH3, –OCH2CH2OH and R4is Cl. For example, R1is –OCH2CH3.

[0275] In some compounds of Formula I-D, R1is –OCH3, –OCH2CH3, –OCH2CH2OH and R4is I. For example, R1is –OCH3.

[0276] In some compounds of Formula I-D, R1is –OCH3, –OCH2CH3, –OCH2CH2OH and R4is F. For example, R1is –OCH3.

[0277] Compounds of Formula I-D and their synthesis are described, for example, in Chinese Pat. App. No.10135977 (Pub. No. CN 201310069722), content of which is incorporated herein by reference in its entirety.

[0278] In some embodiments of any one of the aspects described herein, the artemisinin derivative is of Formula (I-E):ĨFormula I-E), wherein: a is 0 to 10; R13is H, optionally substituted alkyl, optionally substituted aryl, optionally substituted aralkyl, hydroxyalkyl, polyhydroxyalkyl, hydroxyaryl, polyhydroxyaryl, heterocyclic-alkyl, mercapto-alkyl, dithio-alkyl, carboxyalkyl, amidoalkyl, or guanidinoalkyl; R14is ORA3, NRA3RA4, or peptide; and RA3and RA4are independently H, optionally substituted alkyl, or optionally substituted aryl;

[0279] In some embodiments of any one of the aspects described herein, the compound of Formula I-E is selected from the group consisting of:are independently H, alkyl or aryl; and R1, R2, R3, R4, and R5are independently H or OH.

[0280] Compounds of Formula I-E and their synthesis are described, for example, in U.S. Pat. App. No.8,232,417, content of which is incorporated herein by reference in its entirety.

[0281] In some embodiments of any one of the aspects described herein, the artemisinin derivative is of Formula (I-F):(Formula I-F), wherein: b is 0 or 1; X6is H or OH; Y6is H, CH3 or phenyl; and Z6is NH2, NHR6N, N(R6N)2, NHCH2CH2OH, NHCH2CH2OH, NH(CH2)2-3NMe2, e6Nach R is independently C1-C6alkyl.

[0282] In some compounds of Formula I-F, b is 0; X6and Y6are H; and Z6is NH2.

[0283] In some compounds of Formula I-F, b is 1; X6is OH; Y6is H; and Z6is NH2, NHMe,

[0284] In some compounds of Formula I-F, b is 1; X6is OH; Y6is CH3 or phenyl; and Z6is, where each R6Nis independently C1-C6alkyl.

[0285] In some embodiments of any one of the aspects described herein, the compound of Formula I-F is selected from the group consisting of 2′-amino arteether, 3′-amino-2′-hydroxy- artemisinin propyl ether, 3′-methylamino-2′-hydroxy-artemisinin propyl ether, 3′-methylamino- 2′-hydroxy-artemisinin butyl ether, 3′-amino-2′-hydroxy-artemisinin butyl ether, 3′- hydroxyethylamino-2′-hydroxy-artemisinin propyl ether, 3′-phenyl-3′-methylamino-2′-hydroxy- artemisinin propyl ether, 3′-phenyl-3′-amino-2′-hydroxy-artemisinin propyl ether, 3′- hydroxyethylamino-2′-hydroxy-artemisinin butyl ether, 3′-dimethylamino-2′-hydroxy-artemisinin butyl ether, 3′-pyrrolidinyl-2′-hydroxy-artemisinin propyl ether, 3′-piperidyl-2′-hydroxy- artemisinin propyl ether, 3′-methylamino-2′-hydroxy-artemisinin butyl ether, 3′-tert-butylamino- 2′-hydroxy-artemisinin propyl ether, 3′-phenyl-3′-pyrrolidinyl-2′-hydroxy-artemisinin propyl ether, 3′-phenyl-3′-piperidyl-2′-hydroxy-artemisinin propyl ether, 3′-phenyl-3′-dimethylamino-2′- hydroxy-artemisinin propyl ether, and 3-phenyl-3′-tert-butylamino-2′-hydroxy-artemisinin propyl ether.

[0286] Compounds of Formula I-F and their synthesis are described, for example, in US Pat. No.8,129,426, content of which is incorporated herein by reference in its entirety.

[0287] In some embodiments of any one of the aspects described herein, the artemisinin derivative is of Formula (I-G):(Formula I-G), wherein: X is –O– or –O–O–; R1is H, substituted or unsubstituted alkyl, substituted or unsubstituted aryl, substituted or unsubstituted arylalkyl, substituted or unsubstituted heteroaryl,substituted or unsubstituted heteroarylalkyl, —(CH2)jR2G, —(CH2)jO(CH2)kR2G, —(CH2)jC(O)(CH2)kR2G, —(CH2)jC(O)(CH2)kR2G, —(CH2)jC(O)O(CH2)kR2G, — (CH2)jNR3GR4G, —(CH2)jC(O)(CH2)kNR3GR4G, —(CH2)jNR5GC(O)(CH2)kR2G, — (CH2)jC(O)(CH2)kNR3GR4G, —(CH2)jNR5GC(O)(CH2)kOR2G, — (CH2)jNR5GC(O)(CH2)kNR3GR4G, wherein each j and each k is independently an integer from 0 to 6; and m is independently an integer from 0 to 2; R2Gis hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, perfluoroalkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted arylalkyl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heteroarylalkyl, substituted or unsubstituted (aryl or heteroaryl)-XG- (aryl or heteroaryl) wherein XGis O, S, NH or N(C1-C6)alkyl, cholesterol, or a substituted or unsubstituted monosaccharide, and wherein each R2Gis optionally independently substituted with 1 to 5 R10Ggroups; R3G, R4G, and R5Gare independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, perfluoroalkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted arylalkyl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heteroarylalkyl, wherein R3G, R4G, and R5G, are each optionally independently substituted with 1 to 5 R10Ggroups; R3Gand R4G, together with the N atom to which they are attached, form substituted or unsubstituted heterocycloalkyl, or substituted or unsubstituted heteroaryl, wherein substituted or unsubstituted heterocycloalkyl, and substituted or unsubstituted heteroaryl are each optionally independently substituted with 1 to 5 R10Ggroups; and each R10Gis independently hydrogen, halogen, hydroxyl, amino, aminoalkyl, aminodialkyl, cyano, nitro, alkyl, —O-alkyl, —S-alkyl, perfluoroalkyl, —O- perfluoroalkyl, oxo, acetyl, or -benzyl.

[0288] In some embodiments of any one of the aspects described herein, the compound of Formula I-G is of Formula I-GA:

[0289] In some embodiments of any one of the aspects described herein, the compound of Formula I-G is of Formula I-GB:(Formula I-GB).

[0290] In some compounds of Formula I-G, I-GA or I-GB, R1is H, substituted or unsubstituted phenyl, substituted or unsubstituted naphthyl, substituted or unsubstituted biphenyl, substituted or unsubstituted benzyl, substituted or unsubstituted pyrrolyl, substituted or unsubstituted furyl, substituted or unsubstituted thienyl, substituted or unsubstituted pyrazolyl, substituted or unsubstituted imidazolyl, substituted or unsubstituted oxazolyl, substituted or unsubstituted isoxazolyl, substituted or unsubstituted 1,2,4-oxadiazolyl, substituted or unsubstituted 1,3,4-oxadiazolyl, substituted or unsubstituted tetrazolyl, substituted or unsubstituted thiazolyl, substituted or unsubstituted isothiazolyl, substituted or unsubstituted triazolyl, substituted or unsubstituted pyridinyl, substituted or unsubstituted pyridazinyl, substituted or unsubstituted pyrimidinyl, substituted or unsubstituted pyrazinyl, substituted or unsubstituted indolyl, substituted or unsubstituted indazolyl, substituted or unsubstituted benzofuryl, substituted or unsubstituted benzothienyl, substituted or unsubstituted benzopyrazolyl, substituted or unsubstituted benzimidazolyl, substituted or unsubstituted benzoxazolyl, substituted or unsubstituted benzisoxazolyl, substituted or unsubstituted benzothiazolyl, substituted or unsubstituted benzisothiazolyl, substituted or unsubstituted benzotriazolyl, substituted or unsubstituted quinolinyl, substituted or unsubstituted isoquinolinyl,substituted or unsubstituted phthalazinyl, substituted or unsubstituted quinazolinyl, substituted or unsubstituted quinoxalinyl, — (CH2)jC(O)(CH2)kR2G, — (CH2)jOC(O)(CH2)kR2G, — (CH2)jC(O)O(CH2)kR2G, or — (CH2)jC(O)(CH2)kNR3GR4G.

[0291] In some compounds of Formula I-G, I-GA or I-GB, R2Gis hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted phenyl, substituted or unsubstituted naphthyl, substituted or unsubstituted biphenyl, substituted or unsubstituted benzyl, substituted or unsubstituted pyrrolyl, substituted or unsubstituted furyl, substituted or unsubstituted thienyl, substituted or unsubstituted pyrazolyl, substituted or unsubstituted imidazolyl, substituted or unsubstituted oxazolyl, substituted or unsubstituted isoxazolyl, substituted or unsubstituted 1,2,4- oxadiazolyl, substituted or unsubstituted 1,3,4-oxadiazolyl, substituted or unsubstituted tetrazolyl, substituted or unsubstituted thiazolyl, substituted or unsubstituted isothiazolyl, substituted or unsubstituted triazolyl, substituted or unsubstituted pyridinyl, substituted or unsubstituted pyridazinyl, substituted or unsubstituted pyrimidinyl, substituted or unsubstituted pyrazinyl, substituted or unsubstituted indolyl, substituted or unsubstituted indazolyl, substituted or unsubstituted benzofuryl, substituted or unsubstituted benzothienyl, substituted or unsubstituted benzopyrazolyl, substituted or unsubstituted benzimidazolyl, substituted or unsubstituted benzoxazolyl, substituted or unsubstituted benzisoxazolyl, substituted or unsubstituted benzothiazolyl, substituted or unsubstituted benzisothiazolyl, substituted or unsubstituted benzotriazolyl, substituted or unsubstituted quinolinyl, substituted or unsubstituted isoquinolinyl, substituted or unsubstituted phthalazinyl, substituted or unsubstituted quinazolinyl, or substituted or unsubstituted quinoxalinyl.

[0292] In some compounds of Formula I-G, I-GA or I-GB, R3Gand R4Gare independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted phenyl, substituted or unsubstituted benzyl.

[0293] In some compounds of Formula I-G, I-GA or I-GB, R3Gand R4G, together with the N atom to which they are attached, form substituted or unsubstituted pyrrolidinyl, substituted or unsubstituted piperidinyl, substituted or unsubstituted piperazinyl, substituted or unsubstituted morpholinyl, substituted or unsubstituted thiomorpholinyl, substituted or unsubstituted pyrrolyl, or substituted or unsubstituted imidazolyl.

[0294] In some compounds of Formula I-G, I-GA or I-GB, R1is — C(O)R2G, — OC(O)R2G, — C(O)OR2G, or — C(O)NR3GR4G; R2Gis hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted phenyl; and R3Gand R4Gindependently are hydrogen, or substituted or unsubstituted alkyl.

[0295] In some compounds of Formula I-G, I-GA or I-GB, R1is — (CH2)jC(O)O(CH2)kR2G; and R2Gis substituted or unsubstituted glucose, substituted or unsubstituted galactose, substituted or unsubstituted mannose, substituted or unsubstituted fructose.

[0296] In some compounds of Formula I-G, I-GA or I-GB, R1is — C(O)OR2; and R2Gis tetraacetyl a-D glucopyranose, tetraacetyl 0-D glucopyranose, tetraacetyl a-D galactose, tetraacetyl 0-D galactose, tetraacetyl a-D mannose, tetraacetyl 0-D mannose, tetraacetyl a-D fructose, or tetraacetyl 0-D fructose.

[0297] In some embodiments of any one of the aspects described herein, the compound of Formula I-G is selected from the group consisting of:

[0298] Compounds of Formula I-XXXX and their synthesis are described, for example, in U.S. Pat. No. 8,431,611, content of which is incorporated herein by reference in its entirety.

[0299] In some embodiments of any one of the aspects described herein, the artemisinin derivative is of Formula (I-H):n is an integer from 1 to 10.

[0300] In some embodiments of any one of the aspects described herein, the compound of Formula I-H is selected from the group consisting of:

[0301] Compounds of Formula I-H and their synthesis are described, for example, in Chinese Pat. App. No. 107383048 (Pub. No. CN 201710687057), content of which is incorporated herein by reference in its entirety.

[0302] In some embodiments of any one of the aspects described herein, the artemisinin derivative is of Formula (I-I):R91-R" are independently hydrogen, halogen, nitro, cyano group, trifluoromethyl, trifluoromethoxy, Ci-C4alkyl, Ci-C4alkoxymethyl, di(Ci-C4alkyl)amino, or C3- Crcycloalkyl.

[0303] In some embodiments of any one of the aspects described herein, the compound of Formula I-I is selected from the group consisting of:

[0304] Compounds of Formula I-I and their synthesis are described, for example, in Chinese Pat. App. No.101580510 (Pub. No. CN 200910011753), content of which is incorporated herein by reference in its entirety.

[0305] In some embodiments of any one of the aspects described herein, the artemisinin derivative is of Formula (I-J):wherein: YJis O or NRN; XJis H, —NR1JR2J, —CHR8JR9Jor Ar; R1is H, halogen, OH, an optionally substituted cycloalkyl, aryl, C-linked heteroaryl or heterocyclylalkyl, —NR3JR4J, —O—CO—R5Jor —OR6J; R2is H, or R1and R2together form a carbonyl (=O); R1Jand R2Jare independently an optionally substituted alkyl, cycloalkyl, aryl, or aralkyl; or R1Jand R2Jtogether with the interjacent nitrogen atom represent an optionally substituted heterocyclic group or an amino group derived from an optionally substituted amino acid ester; R3Jis H or an optionally substituted alkyl, alkenyl or alkynyl group; R4Jis an optionally substituted alkyl, alkenyl, alkynyl, cycloalkyl, aryl or aralkyl; or R3Jand R4Jtogether with the interjacent nitrogen atom represent an optionally substituted heterocyclic group or an amino group derived from an optionally substituted amino acid ester; R5Jis an optionally substituted alkyl, alkenyl, alkynyl, cycloalkyl, aryl, aralkyl, heterocyclic or polycyclic group; R6Jis an optionally substituted alkyl, alkenyl, alkynyl, cycloalkyl, aryl, aralkyl, heterocyclic or polycyclic group; RNis H or an optionally substituted alkyl, alkenyl, alkynyl, aralkyl or heterocyclylalkyl group;R8Jis H or an optionally substituted alkyl, alkenyl, alkynyl, aryl or alkoxycarbonyl group; R9Jis a nitro group of an optionally substituted alkyl, alkenyl, alkynyl, aryl, alkanoyl, aroyl, alkoxycarbonyl or aryloxycarbonyl group; or R8Jand R9Jtogether with the interjacent carbon atom represent an optionally substituted cycloalkyl or polycyclic group; and Ar represents an optionally substituted aryl or heteroaryl group.

[0306] In some compounds of Formula I-J, YJis O. In some other compounds of Formula I- J, YJis NRN.

[0307] In some compounds of Formula I-J, when XJis —NR1R2, then R1and R2together form a carbonyl (=O) group, and YJis O.

[0308] In some compounds of Formula I-J, when XJis NRN, then XJis a hydrogen atom and R1and R2together form a carbonyl (=O) group.

[0309] In some compounds of Formula I-J, when XJis H and YJis O, then R2is and R1is not methoxy, ethoxy or 3-carboxypropanoyloxy group.

[0310] In some compounds of Formula I-J, XJrepresents a hydrogen atom or a group — NR1JR2Jor CHR8JR9J. For example, XJis H.

[0311] In some compounds of Formula I-J, R1is halogen. For example, R1is F or Br. bromine.

[0312] In some compounds of Formula I-J, R1is a C3-8 cycloalkyl group, a C6-18 aryl group, a 5- to 10-membered C-linked heteroaryl group or a 5- to 10-membered heterocyclyl-C1-6alkyl group, each group being optionally substituted by one or more substituents selected from the group consisting of halogen atoms, hydroxyl, C1-4alkyl, C2-4alkenyl, C1-4haloalkyl, C1-4alkoxy, amino, C1-4 alkylamino, di(C1-4 alkyl)amino, carboxyl, C6-10 aryl, 5 to 10-membered heterocyclic and C1-4 alkyl- or phenyl-substituted 5- to 10-membered heterocyclic groups. For example, R1is a C6-18 aryl group optionally substituted by one or more substituents selected from the group consisting of halogen atoms, hydroxyl, C1-4alkyl, C2-4alkenyl, C1-4haloalkyl, C1-4alkoxy, C1-4haloalkoxy, amino, C1-4alkylamino, di (C1-4alkyl)amino and carboxyl groups. In some compounds of Formula I-J, R1is a phenyl, naphthyl, anthryl or phenanthryl group, each group being optionally substituted by one or more substituents selected from the group consisting of halogen atoms and hydroxyl, methyl, vinyl, C1-4 alkoxy and carboxyl groups. For example, R1can be a phenyl, fluorophenyl, chlorophenyl, bromophenyl, trimethylphenyl, vinylphenyl, methoxyphenyl, dimethoxyphenyl, trimethoxyphenyl, carboxylphenyl, naphthyl, hydroxynaphthyl methoxynaphthyl anthryl or phenanthryl group In some compounds of

[0313] In some compounds of Formula I-J, R1is —NR3JR4J, where R3Jis H or a C1-6 alkyl group, and R4J is a C1-6 alkyl, C3-8 cycloalkyl, C6-10 aryl or C7-16 aralkyl group, or R3Jand R4Jtogether with the interjacent nitrogen atom represent a 5- to 10-membered heterocyclic group or an amino group derived from a C1-6alkyl ester of an amino acid, each group being optionally substituted by one or more substituents selected from the group consisting of halogen atoms, C1-4alkyl, C1-4haloalkyl, C1-6alkoxycarbonyl, phenyl, halophenyl, C1-4alkylphenyl, C1-4 haloalkylphenyl, C1-4 alkoxyphenyl, benzyl, pyridyl and pyrimidinyl groups. For example, R1can be —NR3JR4J, where RJ3is H or a C1-4 alkyl group and R4Jis a C1-4 alkyl, C3-6 cycloalkyl, phenyl or benzyl group, or R3Jand R4Jtogether with the interjacent nitrogen atom represent a 6- to 10-membered heterocyclic group or an amino group derived from a C1-4alkyl ester of an amino acid, each group being optionally substituted by one or more substituents selected from the group consisting of halogen atoms, C1-4haloalkyl, C1-4alkoxycarbonyl, phenyl, halophenyl, C1-4 alkylphenyl, C1-4 haloalkylphenyl, C1-4 alkoxyphenyl, benzyl, pyridyl and pyrimidinyl groups.

[0314] In some compounds of Formula I-J, R1is a propylamino, cyclopentylamino, cyclohexylamino, phenylamino, fluorophenylamino, chlorophenylamino, bromophenylamino, iodophenylamino, methoxycarbonylphenylamino, biphenylamino, benzylamino, fluorobenzylamino, bis(trifluoromethyl)-benzylamino, phenylethylamino, phenylmethoxycarbonyl-methylamino, diethylamino, morpholinyl, thiomorpholinyl, S,S- dioxothiomorpholinyl (morpholinosulphonyl), indolinyl, tetrahydroisoquinolinyl, phenylpiperazinyl, fluorophenylpiperazinyl, chlorophenylpiperazinyl, methylphenylpiperazinyl, trifluoromethylphenylpiperazinyl, methoxyphenylpiperazinyl, benzylpiperazinyl, pyridylpiperazinyl and pyrimidinylpiperazinyl group. For example, R1is a phenylamino or fluorophenylamino group.

[0315] In some compounds of Formula I-J, R1is —O—CO—R5J, where R5Jis an optionally substituted alkyl, aryl, aralkyl, heterocyclic or polycyclic group. For example, R5Jis a C1-6 alkyl, C6-18 aryl, 5- to 18- membered heterocyclic or C4-26 polycyclic group, each group being optionally substituted by one or more substituents selected form the group consisting of halogen atoms, hydroxyl, C1-4alkyl, C1-4haloalkyl, C1-4alkoxy, C1-4haloalkoxy, oxo, carboxyl and carboxylato groups. In some compounds of Formula I-J, R5Jrepresents a C1-4alkyl, C6-14aryl, 5- to 14- membered heterocyclic or C6-14polycyclic group, each group being optionally substituted by one or more substituents selected from the group consisting of halogen atoms, hydroxyl, C1-4 alkyl, C1-4 haloalkyl and oxo groups.

[0316] In some compounds of Formula I-J, XJis H,YJis O, R2is H, and R1is phenyl, 2- mehtoxyphenyl 4-methoxyphenyl 24-dimethoxyphenyl 246-trimethoxyphenyl, 2-2,4,6-trimethylphenyl, 2-Br-phenyl, 2-Cl-phenyl, 3-Br-phenyl, 3-Cl-phenyl, 4-Br-phenyl, 4-Cl- phenyl, 4-CO2H-phenyl, 2-naphthyl,morpholino, indolinyl, 1,2,3,4-tetrahydroisoquinolinyl, N- methyl-piperazino, 4-vinylphenyl, 9-anthryl, or 9-phenylanthryl.

[0317] In some compounds of Formula I-J, XJis H,YJis O, R2is H, R1is –OC(O)-R5J, and R5Jis isosuinolin-1-yl, anthryl, acridin-9-yl, anthraquinon-2-yl, quinolin-3-yl, quinoxalin-2-yl, 2- hydroxynaphth-1-yl, 1-hydroxynaphth-2-yl, or isoquinolin-4-yl, quinolin-2-yl.

[0318] In some compounds of Formula I-J, XJis H,YJis O, R2is H, R1is –OR6J, and R6Jis 4- methoxyphenyl, 1-naphthyl, 2-naphthyl, benzyl, 2-F-benzyl, 3-F-benzyl, 4-F-benzyl, -CH2-(1- naphthyl), -CH2-(10-anthryl), -CH2-(1-phenanthryl), -CH2-(1-pyryl), 4-quinolinyl, cholest-5-en- 3-yl.

[0319] In some compounds of Formula I-J, XJis H, R1and R2together form a carbonyl (=O), YJis NRN, and RNis 4-F-benzyl, 3-F-benzyl, benzyl, methyl, -CH2CH2(CH3)2, -CH2CH=CH2, - CH2C(O)H, pyrid-2-ylmethyl, thenyl, furfuryl, or -CH2CH2OH.

[0320] In some compounds of Formula I-J, R1and R2together form a carbonyl (=O), YJis O and XJis indolin-1-yl.

[0321] In some compounds of Formula I-J, R1and R2together form a carbonyl (=O), YJis O, and XJis cyclohexyl or admantyl.

[0322] In some compounds of Formula I-J, R1and R2together form a carbonyl (=O), YJis O, and XJis –CHR8JR9, where R8Jis H and R9Jis NO2, -C(O)-phenyl, or R8Jis methyl and R9Jis – CO2H, or R8Jand R9Jare –C(O)OC2H5.

[0323] In some compounds of Formula I-J, R1and R2are H, YJis O, and XJis –CHR8JR9, where R8Jis H and R9Jis NO2.

[0324] In some compounds of Formula I-J, XJis H, YJis O, R2is H and R1is –NR3JR4J, where R3Jis H and R4Jis phenyl, 4-F-phenyl, 4-Cl-phenyl, 4-Br-phenyl, 4-I-phenyl, 4-biphenyl, benzyl, 2-F-benzyl, 3,5-trifluoromethylbenzyl, propyl, -CH(CH3)phenyl, -CH(CO-OCH3)phenyl, 4-(CO-OCH3)phenyl, cyclopentyl, or cyclohexyl.

[0325] In some compounds of Formula I-J, XJis H, YJis O, R2is H and R1is –NR3JR4J, where R3Jand R4Jare ethyl

[0326] In some embodiments of any one of the aspects described herein, the compound of Formula I-J is selected from the group consisting of 10β-fluoro-10-deoxodihydroartemisinin, 10β-(phenyl)dihydroartemisinin, 10α-(4′-fluorobenzylamino)dihydroartemisinin, 10-(2′,4′- dimethoxyphenyl)dihydroartemisinin, 10α-(2′-hydroxy-1′-naphthyl)dihydro artemisinin, 10α- (thiomorpholino)dihydroartemisinin, 10α-(4′-S,S-dioxothiomorpholinyl)dihydroartemisinin, 10- dih d t i i l th t 10β dih d t i i l b t 10 dih d rtemisinylquinolinoxy)]dihydroartemisinin, 10α and β-[(2′-naphthylmethyl)oxy]dihydroartemisinin, 11- azaartemisinin, 11-aza-N-(2-fluorobenzyl)artemisinin, 11-aza-N- (ethoxycarbonylethyl)artemisinin, 9-(N,N-dibenzylaminomethyl)artemisinin, 9- [2,2- di(ethoxycarbonyl)ethyl]-artemisinin, 9-[2-(ethoxycarbonyl)ethyl]artemisinin, 10-desoxo-9-[2- (ethoxycarbonyl)ethyl]-artemisinin, 16-(2′-propyl)artemisinin (9-(2-methylpropyl)artemisinin), 16-(N-1′-indolinyl)artemisinin, 10α-(4′-benzylpiperazin-1′-yl)-10-deoxo-10-dihydroartemisinin, 10α-(2′-furyl)-10-deoxo-10-dihydroartemisinin, 10α-(Pyrrol-2′-yl)-10-deoxo-10- dihydroartemisinin, and 10α-(4′-Benzyl-4′-methylpiperazinium-1′-yl)-10-deoxo-10- dihydroartemisinin iodide salt.

[0327] Compounds of Formula I-J and their synthesis are described, for example, in U.S. Pat. No.6,649,647, content of which is incorporated herein by reference in its entirety.

[0328] In some embodiments of any one of the aspects described herein, the artemisinin derivative is of Formula (I-K):(Formula I-K), wherein: R1is –BK-MK, where: BKis a linking group; and MKis a moiety selected from the group consisting of moieties derived from anti-malarial drugs other than artemisinin and moieties derived from amine compounds, provided that where MKcomprises a quinine the linking group is linked to the quinine via the C9 hydroxy group of the quinine.

[0329] In some compounds of Formula I-K, the anti-malarial drug is a quinoline derivative. For example, the anti-malarial drug is selected from the group consisting of amodiaquine, n- bisethylamodiaquine, chloroquine, mefloquine, piperaquine, primaquine, pamaquine, quinine, isoquine pyronaridine and tafenoquine In some compounds of Formula I-K the anti-malarial oupconsisting of halofantrine, lumefantrine, proguanil (chlorguanide), cycloguanil and pyrimethamine or their pharmacophores.

[0330] In some compounds of Formula I-K, MKis a moiety derived from an amine compound, wherein the the amine compound is selected from the group consisting of 1-amino-4- methylpiperazine, 1 -amino-4-methylpiperazine, 1 (3-aminopropyl)imidazole, 1-aminohydantoin, 1 ,2,4-triazole, 2,4-diamino-6-chloro-pyrimidine, 4-aminomorpholine, 4(2- aminoethyl)morpholine, 4(2-aminomethyl)morpholine, 4-amino-4H-1 ,2,4-triazole, acethydrazide, ethyl 1-piperazine, N,N-dimethylethylenediamine, and N-acetylethylenediamine.

[0331] In some compounds of Formula I-K, R1is –O-C(O)-R2K, where R2Kis an anti- malarial drug comprising a quinolone having a hydroxyl group in its structure, and the carbonyl carbon of R1is linked to the hydroxyl group of the anti-malarial drug.

[0332] In some compounds of Formula I-K, R1is –O-C(O)-R1K, where R1Kis an anti- malarial drug comprising a quinolone having a amine group its structure, and the carbonyl carbon of R1is linked to the amine group of the anti-malarial drug.

[0333] In some embodiments of any one of the aspects described herein, the compound of Formula I-K is selected from the group consisting of:(where R’ is a C2 to C6 hydrocarbylene chain),.

[0334] Compounds of Formula I-K and their synthesis are described, for example, in WO2010 / 032165, content of which is incorporated herein by reference in its entirety.

[0335] In some embodiments of any one of the aspects described herein, the artemisinin derivative is of Formula (I-L):wherein R and R4 are each independently a group selected from the group consisting t i htbranched unsaturated hydrocarbon group, C3-C12cycloalkyl group, cyano group, nitro group, amino group or an amine group substituted with a -C4fluorenyl group, a hydroxy group, a hydroxymethyl group, a trifluoromethyl group, a trifluoromethoxy group, a carboxyl group, a nonylphenyl group, a substituted phenyl group, a naphthyl group, a biphenyl group, or a substituted group. Or an unsubstituted saturated or unsaturated C3-C12 heterocyclic group, wherein the substituent is selected from the group consisting of: halogen, trifluoromethyl, ethynyl, hydroxy, amino, hydroxydecyl, carboxy or C4amine or aldehyde group; q and t are each independently an integer of 1 to 4; R7 is a group selected from the group consisting of one or two at any position on the phenyl ring: hydrogen, halogen, straight or branched fluorenyl, C2-C12 straight or branched unsaturated hydrocarbyl, C3-C12 cycloalkyl, ethynyl, cyano, nitro, amino, hydroxy, hydroxymethyl, trifluoromethyl, trifluoromethoxy, carboxy, nonylphenyl, substituted phenyl, naphthalene Base, biphenyl, or substituted or unsubstituted saturated or unsaturated C3-C12heterocyclyl, benzyl alcohol, substituted benzyl alcohol, hydrazine, hydrazine-dimethyl, hydrazine, hydrazine- diethyl a substituent, wherein the substituent is selected from the group consisting of: halogen, trifluoromethyl, ethynyl, hydroxy, amino, hydroxyindole, carboxy or amine fluorenyl or aldehyde; R8and R9are each independently –W-(D)-E, wherein W is hydrogen, oxygen, hydrazine, halogen, linear or branched alkyl or fluorenylene, C2-C12 linear or branched unsaturated hydrocarbon or alkylene, C3-C12 cyclic hydrocarbon or Cycloalkyl, cyano, nitro, amino, hydroxy, C4hydroxyalkyl, trifluoromethyl, trifluoromethoxy, carboxy, nonylphenyl, substituted phenyl, naphthyl, biphenyl, or a substituted or unsubstituted saturated or unsaturated C3-C12heterocyclyl or heterocyclylene, anthracene, fluorenyl-dimethyl, anthracene, fluorenyl- diethyl, wherein the substituent is selected from the group consisting of Halogen, trifluoromethyl, ethynyl, hydroxy, amino, hydroxyalkyl, carboxy or C4 amine sulfhydryl or aldehyde; D is carbonyl, straight or branched fluorenyl or alkylene, C2-C12linear or branched unsaturated hydrocarbon or alkylene, substituted or unsubstituted saturated or unsaturated C3-Caheterocyclic group or aconsisting of halogen, trifluoromethyl, ethynyl, hydroxy, amino, C4hydroxyalkyl, carboxy or C1-C4amine thiol or aldehyde base; E is a C1-C12linear or branched fluorenyl or alkylene group, a C2-C12linear or branched unsaturated hydrocarbon group or an alkylene group, a substituted or unsubstituted saturated or unsaturated C3-C 2 heterocyclic or heterocyclylene group, wherein the substituent is selected from the group consisting of halogen, trifluoromethyl, ethynyl, hydroxy, amino, C4hydroxyalkyl, carboxy or d-amine fluorenyl or Aldehyde; j, r are each independently an integer from 0 to 5; A is a linking group selected from the group consisting of.

[0336] In some embodiments of any one of the aspects described herein, the compound of Formula I-L is selected from the group consisting of:

[0337] In some embodiments of any one of the aspects described herein, the compound of Formula I-L is selected from the group consisting of:.

[0338] Compounds of Formula I-L and their synthesis are described, for example, in WO2014 / 023081, content of which is incorporated herein by reference in its entirety.

[0339] In some embodiments of any one of the aspects described herein, the artemisinin derivative is of Formula (I-M) or (I-M’):wherein: Ar is phenyl, 3-chlorophenyl, 4-chlorophenyl, 3-bromophenyl, 4-bromophenyl, 3- iodophenyl, 4-iodophenyl, 3-fluorphenyl, 4-fluorophenyl, 4-methylphenyl, 4- methoxyphenyl, 3-CO2H-phenyl, 4-CO2H-phenyl, or 4-SO3H-phenyl.

[0340] Compounds of Formula I-M and I-M’, and their synthesis are described, for example, in Yang et al., Biorog. Med. Chem. Lett., 1995, vol.5 (6), pp.7191-1794, content of which is incorporated herein by reference in its entirety.

[0341] In some embodiments of any one of the aspects described herein, the artemisinin derivative is of Formula (I-N) or (I-N’):.

[0342] Compounds of Formula I-N and I-N’, and their synthesis are described, for example, in Lin et al., J. Med. Chem., 1999, vol.33 (9), pp.2610-2614, content of which is incorporated herein by reference in its entirety.

[0343] In some embodiments of any one of the aspects described herein, the artemisinin derivative is of Formula (I-O) or Formula (I-O’)::,

[0344] Compounds of Formula I-O and I-O’, and their synthesis are described, for example, in Singh et al., J. Med. Chem., 2006, vol.49, pp.7227-7233, content of which is incorporated herein by reference in its entirety.

[0345] In some embodiments of the various aspects described herein, one of the inducers is a flavonoid compound. Generally, flavonoids are of Formula (II-A), (II-B) or (II-C):(Formula II-A),, wherein: R23is H, OH, C1-C6alkyl; C2-C6alkenyl, C2-C6alkynyl, haloalkyl, halogen (e.g., F, Cl, Br or I), cyano (-CN), nitro (-NO2), carboxyl (-CO2H), amino (-NH2), alkyl amino (- NH(C1-C6alkyl), dialkylamino (-N(C1-C6alkyl)(C1-C6alkyl)), or haloalkyl (e.g., CF3); and R25, R26, R27, R28, R22’, R23’, R24’, R25’and R26’are independently H, OH, C1-C6alkoxy, C1- C6alkyl, C2-C6alkenyl, C2-C6alkynyl, halogen (e.g., F, Cl, Br or I), cyano, nitro, carboxyl, amino, alkyl amino, dialkylamino, thio (-SH), thioalkyl (-S(C1-C6alkyl), or haloalkyl (e.g., CF3); or a pharmaceutically acceptable salt thereof.

[0346] In some embodiments, R23is H, OH, C1-C6alkyl or halogen. For example, R23is H, OH, methyl, ethyl propyl, fluoro (F), chloro (Cl), bromo (Br) or iodo (I). In some embodiments, R23is H, OH or methyl. For example, R23is H or OH. Preferably R23is H.

[0347] In some embodiments, R25is H, OH, C1-C6alkoxy, C1-C6alkyl, halogen, haloalkyl, cyano, nitro, amino, alkylamino, dialkylamino,or thio. For example, R25is H, OH, methoxy (OCH3), ethoxy (OCH2CH3), halogen, carboxyl, cyano, amino, CF3, or thio. In some embodiments, R25is H, OH, methoxy, methyl, fluoro, chloro, bromo, iodo, carboxyl, cayno or thio. In some preferred embodiments, R25is H, OH or methoxy.

[0348] In some embodiments, R26is H, OH, C1-C6alkoxy, C1-C6alkyl, halogen, haloalkyl, cyano, nitro, amino, alkylamino, dialkylamino,or thio. For example, R26is H, OH, methoxy (OCH3), ethoxy (OCH2CH3), halogen, carboxyl, cyano, amino, CF3, or thio. In some embodiments, R26is H, OH, methoxy, methyl, fluoro, chloro, bromo, iodo, carboxyl, cayno or thio. In some preferred embodiments, R26is H, OH or methoxy.

[0349] In some embodiments, R27is H, OH, C1-C6alkoxy, C1-C6alkyl, halogen, haloalkyl, cyano, nitro, amino, alkylamino, dialkylamino,or thio. For example, R27is H, OH, methoxy (OCH3), ethoxy (OCH2CH3), halogen, carboxyl, cyano, amino, CF3, or thio. In some embodiments, R27is H, OH, methoxy, methyl, fluoro, chloro, bromo, iodo, carboxyl, cayno or thio. In some preferred embodiments, R27is H, OH or methoxy.

[0350] In some embodiments, R28is H, OH, C1-C6alkoxy, C1-C6alkyl, halogen, haloalkyl, cyano, nitro, amino, alkylamino, dialkylamino,or thio. For example, R28is H, OH, methoxy (OCH3), ethoxy (OCH2CH3), halogen, carboxyl, cyano, amino, CF3, or thio. In some embodiments, R28is H, OH, methoxy, methyl, fluoro, chloro, bromo, iodo, carboxyl, cayno or thio. In some preferred embodiments, R28is H, OH or methoxy.

[0351] In some embodiments, R22’is H, OH, C1-C6alkoxy, C1-C6alkyl, halogen, haloalkyl, cyano, nitro, amino, alkylamino, dialkylamino,or thio. For example, R22’is H, OH, methoxy (OCH3), ethoxy (OCH2CH3), halogen, carboxyl, cyano, amino, CF3, or thio. In some embodiments, R22’is H, OH, methoxy, methyl, fluoro, chloro, bromo, iodo, carboxyl, cayno or thio. In some preferred embodiments, R22’is H, OH or methoxy.

[0352] In some embodiments, R23’is H, OH, C1-C6alkoxy, C1-C6alkyl, halogen, haloalkyl, cyano, nitro, amino, alkylamino, dialkylamino,or thio. For example, R23’is H, OH, methoxy (OCH3), ethoxy (OCH2CH3), halogen, carboxyl, cyano, amino, CF3, or thio. In some embodiments, R23’is H, OH, methoxy, methyl, fluoro, chloro, bromo, iodo, carboxyl, cayno or thio. In some preferred embodiments, R23’is H, OH or methoxy.

[0353] In some embodiments, R24’is H, OH, C1-C6alkoxy, C1-C6alkyl, halogen, haloalkyl, cyano, nitro, amino, alkylamino, dialkylamino,or thio. For example, R24’is H, OH, methoxy (OCH3), ethoxy (OCH2CH3), halogen, carboxyl, cyano, amino, CF3, or thio. In some embodiments, R24’is H, OH, methoxy, methyl, fluoro, chloro, bromo, iodo, carboxyl, cayno or thio. In some preferred embodiments, R24’is H, OH or methoxy.

[0354] In some embodiments, R25’is H, OH, C1-C6alkoxy, C1-C6alkyl, halogen, haloalkyl, cyano, nitro, amino, alkylamino, dialkylamino,or thio. For example, R25’is H, OH, methoxy (OCH3), ethoxy (OCH2CH3), halogen, carboxyl, cyano, amino, CF3, or thio. In some embodiments, R25’is H OH methoxy methyl fluoro chloro bromo iodo carboxyl cayno or thio. In some

[0355] In some embodiments, R26’is H, OH, C1-C6alkoxy, C1-C6alkyl, halogen, haloalkyl, cyano, nitro, amino, alkylamino, dialkylamino,or thio. For example, R26’is H, OH, methoxy (OCH3), ethoxy (OCH2CH3), halogen, carboxyl, cyano, amino, CF3, or thio. In some embodiments, R26’is H, OH, methoxy, methyl, fluoro, chloro, bromo, iodo, carboxyl, cayno or thio. In some preferred embodiments, R26’is H, OH or methoxy.

[0356] In some embodiments, R23is H; and R25, R26, R27, R28, R22’, R23’, R24’, R25’and R26’are independently H, OH, C1-C6alkoxy, halogen, amino, cyano, thio, carboxyl or haloalkyl. For example, R23is H; and R25, R26, R27, R28, R22’, R23’, R24’, R25’and R26’are independently H, OH, C1-C6alkoxy, halogen, amino, cyano, or CF3. In some preferred embodiments, R23is H; and R25, R26, R27, R28, R22’, R23’, R24’, R25’and R26are independently H, OH, or methoxy.

[0357] In some embodiments, all R23, R25, R26, R27, R28, R22’, R23’, R24’, R25’and R26’are H.

[0358] In some embodiments, R23, R26, R27, R28, R22’, R23’, R24’, R25’and R26’are H; and R25is OH.

[0359] In some embodiments, R23, R26, R28, R22’, R23’, R24’, R25’and R26’are H; R25is OH; and R27is OH or methoxy.

[0360] In some embodiments, R23, R26, R27, R22’, R23’, R24’, R25’and R26’are H; and R25and R28are OH.

[0361] In some embodiments, R23, R26, R28, R22’, R23’, R25’and R26’are H; R25and R27are OH; and R24’is OH or methoxy.

[0362] In some embodiments, R23, R26, R28, R23’, R24’, R25’and R26’are H; R25and R22’are OH; and R27is methoxy.

[0363] In some embodiments, R23, R28, R22’, R23’, R24’, R25’and R26’are H; and R25, R26and R27are OH.

[0364] In some embodiments, R23, R28, R22’, R23’, R24’, R25’and R26’are H; R25and R27are OH; and R26is methoxy.

[0365] In some embodiments, R23, R28, R22’, R23’, R24’, R25’and R26’are H; R25and R26are OH; and R27is methoxy.

[0366] In some embodiments, R23, R26, R22’, R23’, R24’, R25’and R26’are H; R25and R27are OH; and R28is OH or methoxy.

[0367] In some embodiments, R23, R25, R26, R28, R22’, R25’and R26’are H; R27and R24’are OH; and R23’is methoxy.

[0368] In some embodiments, R23, R25, R26, R28, R22’, R25’and R26’are H; R27and R24’are methoxy; and R23’is OH.

[0369] I b di R23R26R28R22’R25’d R26’H d R25, R27, R23’and R24’

[0370] In some embodiments, R23, R28, R22’, R25’and R26’are H; and R25, R26, R27, R23’and R24’are OH.

[0371] In some embodiments, R23, R26, R28, R22’, R25’and R26’are H; R25, R27and R24’are OH; and R23’is methoxy.

[0372] In some embodiments, R23, R26, R28, R22’, R25’and R26’are H; R25, R27and R23’are OH; and R24’is methoxy.

[0373] In some embodiments, R23, R26, R28, R22’, R25’and R26’are H; R25, and R23’are OH; and R27and R24’is methoxy.

[0374] In some embodiments, R23, R26, R28, R22’, R25’and R26’are H; R25and R24’are OH; and R27and R23’is methoxy.

[0375] In some embodiments, R23, R26, R28, R23’, R25’and R26’are H; R25, R22’and R24’are OH; and R27is OH or methoxy.

[0376] In some embodiments, R23, R28, R22’, R23', R25’and R26’are H; R25, R27and R24’are OH; and R26is OH or methoxy.

[0377] In some embodiments, R23, R28, R22’, R23', R25’and R26’are H; R25, R26and R24’are OH; and R27is methoxy.

[0378] In some embodiments, R23, R28, R22’, R23', R25’and R26’are H; R25and R27are OH; and R26and R24’are methoxy.

[0379] In some embodiments, R23, R28, R22’, R23', R25’and R26’are H; R25and R24’are OH; and R26and R27are methoxy.

[0380] In some embodiments, R23, R28, R22’, R23', R25’and R26’are H; R25is OH; and R26, R27and R24’are methoxy.

[0381] In some embodiments, R23, R26, R22’, R23', R25’and R26’are H; and R25, R27, R28and R24’are OH.

[0382] In some embodiments, R23, R27, R28, R23', R24’and R25’are H; R25is OH or methoxy; and R26, R22’, and R26’are methoxy.

[0383] In some embodiments, R23, R27, R28, R22', R24’and R26’are H; and R25, R26, R23’, and R25’are methoxy.

[0384] In some embodiments, R23, R28, R22', R23’, R24’, R25’and R26’are H; R25is OH; and R25, R26, R27, and R28are methoxy.

[0385] In some embodiments, R23, R26, R28, R22', and R26’are H; and R25, R27, R23’, R24’and R25'are OH.

[0386] In some embodiments, R23, R26, R28, R22', and R26’are H; R25, R27, and R24’are OH; and 23’d25’h

[0387] In some embodiments, R23, R26, R28, R22', and R26’are H; R25is OH; and R27, R23’, R24’and R25’are methoxy.

[0388] In some embodiments, R23, R28, R22', R25’and R26’are H; R25, R27, R23’and R24’are OH; and R26is methoxy.

[0389] In some embodiments, R23, R28, R22', R25’and R26’are H; R25, R26, R23’and R24’are OH; and R27is methoxy.

[0390] In some embodiments, R23, R28, R22', R25’and R26’are H; R25, R26, R27and R24’are OH; and R23’is methoxy.

[0391] In some embodiments, R23, R28, R22', R25’and R26’are H; R25, R27and R24’are OH; and R26and R23’are methoxy.

[0392] In some embodiments, R23, R28, R22', R25’and R26’are H; R25, R23’and R24’are OH; and R26and R27are methoxy.

[0393] In some embodiments, R23, R28, R22', R25’and R26’are H; R25and R27are OH; and R26,R23’and R24’are methoxy.

[0394] In some embodiments, R23, R28, R22', R25’and R26’are H; R25and R24’are OH; and R26,R27and R23’are methoxy.

[0395] In some embodiments, R23, R28, R22', R23’and R26’are H; R25and R25’are OH; and R26,R27and R24’are methoxy.

[0396] In some embodiments, R23, R28, R22', R23’and R26’are H; and R25, R26, R27, R24’and R25’are methoxy.

[0397] In some embodiments, R23, R26, R22', R25’and R26’are H; R25, R27, R23’and R24’are OH; and R28is OH or methoxy.

[0398] In some embodiments, R23, R26, R24', R25’and R26’are H; R25and R23’are OH; and R27, R28and R22’are methoxy.

[0399] In some embodiments, R23, R22', R23’, R25’and R26’are H; R25and R27are OH; and R26, R28and R24’are methoxy.

[0400] In some embodiments, R23, R22', R23’, R25’and R26’are H; R25and R24’are OH; and R26, R27and R28are methoxy.

[0401] In some embodiments, R23, R22', R23’, R25’and R26’are H; and R25, R26, R27, R28and R24’are methoxy.

[0402] In some embodiments, R23, R26, R25’and R26’are H; R25is OH; and R27, R28, R22', R23’, and R24’are methoxy.

[0403] In some embodiments, R23, R22’, R25’and R26’are H; R25, R27and R24’are OH; and R26, 28d23’h

[0404] In some embodiments, R23, R22’, R25’and R26’are H; R25, R27and R23’are OH; and R26, R28, and R24’are methoxy.

[0405] In some embodiments, R23, R22’, R25’and R26’are H; R25and R27are OH; and R26, R28, R23’and R24’are methoxy.

[0406] In some embodiments, R23, R22’, R25’and R26’are H; R25and R23’are OH; and R26, R27, R28and R24’are methoxy.

[0407] In some embodiments, R23, R22’, R25’and R26’are H; and R25, R26, R27, R28, R23’and R24’are methoxy.

[0408] In some embodiments, R23, R22’and R26’are H; R25, R27and R25’are OH; and R26, R28, R23’and R24’are methoxy.

[0409] Flavonoid compounds are commercially available, for example, from Natland International Corp., Research Triangle Park, North Carolina; MP Biomedicals, Irvine, California; LC Laboratories, Woburn, Mass. Flavonoid compounds can be isolated from plants or seeds, for example, as described in US patent No. 5702752; 5990291 and 6146668. Flavonoid compounds can also be produced by organisms engineered using genetic engineering techniques, such as yeast, as described in Ralston, et al., Plant Physiology 737: 1375-88 (2005).

[0410] In some embodiments of any one of the aspects described herein, the flavonoid compound, e.g., the first or second inducer is of Formula (II-A).

[0411] In some embodiments of any one of the aspects described herein, the flavonoid compound, e.g., the first or second inducer is of Formula (II-B).

[0412] In some embodiments of any one of the aspects described herein, the flavonoid compound, e.g., the first or second inducer is of Formula (II-C).

[0413] Some exemplary flavonoid compounds suitable for use as an inducer include, but are not limited to, flavone, baicalein, chrysin, galangin, (OH)4flavone, 6-hydroxyluteolin, acacetin, acerosin, alnetin, apigenin, apiin, artocarpetin, balcalein, beta-sitosterol, biochamin A, cannaflavin A, cannflavin A, cannflavin B, cannflavin C, catechin, catechin-3-gallate, cerrosillin, chrysoeriol, chrysoeriol, cirsilineol, cirsiliol, cirsimaritin, corymbosin, cupressuflavone, cyanidine, daidzein, datiscetin, delphinidine, digidrokempferol , dihydroquercetin, diosmetin, diosmin, echioidinin, epicatechin, epicatechin-3-gallate, epigallocatechin, epigallocatechin-3-gallate, eriodiktiol, eupatilin, eupatorin, fisetin, fizetin, flavonol, formononetin, fortunelin, gallocatechin, gallocatechin-3-gallate, gardenin D, genistein, genistin, genkwanin, geraldol, geraldone, glycitein, glycitin, gomoeriodiktiol, gossypetin, hesperetin, hinokiflavone, hispidulin, hymenoxin, hypolaetin, isoquercetin, isorhamnetin, isorhamnetin, isoscutellarein, isovitexin, jaceosidin, k f l k f l k f id l idi l t li l t li l idine, mikanin, morin, etin,nodifloretin, norartocarpetin, norwogonin, onopordin, orientin, oroxylin a, pachipodol, pectolinarigenin, pedalitin, peonidin, petunidin, pilloin, pratol, primetin, primuletin, pruentin, quercetagetin, quercetin, ramnazin, rhoifolin, robinetin, rutin, scaposin, scutellarein, serpyllin, sinensetin, sorbifolin, sudachitin, tangeretin, tangeritin, taxifolin, tectochrysin, tithonine, tricetin, tricin, velutin, vitexin, wightin, wogonin, xanthomicrol, zapotin, zapotinin, 6,7,4’-trishydroxy isoflavone, 7,3’4’-trihydroxy isoflavone, and pharmaceutically acceptable salts thereof. In some preferred embodiments, the flavonoid compound is flavone. Vectors

[0414] In some embodiments, the method further comprises administering the exogenous nucleotide sequence to the subject prior to administering the inducer. For administering to a subject, the exogenous nucleotide sequence can be comprised in a vector. The term “vector” is well known in the art, and as used herein, refers to a nucleic acid construct designed for delivery to a host cell or for transfer between different host cells. A vector is suitably used to transport an inserted nucleic acid molecule into a suitable host cell. A vector typically contains all of the necessary elements that permit transcribing the insert nucleic acid molecule, and, preferably, translating the transcript into a polypeptide. A vector typically contains all of the necessary elements such that, once the vector is in a host cell, the vector can replicate independently of, or coincidental with, the host chromosomal DNA; several copies of the vector and its inserted nucleic acid molecule may be generated. Vectors described herein can be episomal vectors (i.e., that do not integrate into the genome of a host cell), or can be vectors that integrate into the host cell genome. A vector can include, but is not limited to, a cloning vector, an expression vector, a plasmid, phage, transposon, cosmid, chromosome, virus, virion, etc.

[0415] As used herein, a vector can be viral or non-viral. Non-viral vectors include but are not limited to plasmid vectors (e.g., pMA-RQ, pUC vectors, bluescript vectors (pBS) and pBR322 or derivatives thereof that are devoid of bacterial sequences (minicircles)) transposons-based vectors (e.g., PiggyBac (PB) vectors or Sleeping Beauty (SB) vectors), etc. Larger vectors such as artificial chromosomes (bacteria (BAC), yeast (YAC), or human (HAC)) may be used to accommodate larger inserts.

[0416] In some embodiments, the vector is a viral vector. As used herein, the term “viral vector” refers to a nucleic acid vector construct that includes at least one element of viral origin and has the capacity to be packaged into a viral vector particle. The viral vector can contain the nucleic acid encoding a polypeptide as described herein in place of non-essential viral genes. The vector and / or particle may be utilized for the purpose of transferring any nucleic acids into cells d toretroviral, lentiviral, adeno-associated viral, adenoviral, herpes viral, hepatitis viral vectors and the like. Typically, but not necessarily, viral vectors are replication-deficient as they have lost the ability to propagate in a given cell since viral genes essential for replication have been eliminated from the viral vector. However, some viral vectors can also be adapted to replicate specifically in a given cell, such as e.g., a cancer cell, and are typically used to trigger the (cancer) cell-specific (onco)lysis. Virosomes are a non-limiting example of a vector that comprises both viral and non- viral elements, in particular they combine liposomes with an inactivated HIV or influenza virus (Yamada et al., 2003). Another example encompasses viral vectors mixed with cationic lipids.

[0417] In some embodiments, the viral vector is an adeno-associated viral (AAV) vector. In some preferred embodiments the AAV has a serotype suitable for liver transduction. In some embodiments, the AAV is selected from the group consisting of: AAV1, AAV2, AAV3, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV8, AAV9, AAV10, AAV11, AAV12, AAV2i8, AAVrh10, AAVrh74, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, or chimeras thereof or derivatives thereof. See, e.g., BERNARD N. FIELDS et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers). A number of relatively new AAV serotypes and clades have been identified (see, e.g., Gao et al., (2004) J. Virology 78:6381-6388; Moris et al., (2004) Virology 33-:375- 383); and also Table 1 as disclosed in U.S. Provisional Application 62,937,556, filed on November 19, 2019, and Table 1 and Table 2 in International Applications WO2020 / 102645 and WO2020 / 102667, each of which is incorporated herein in their entirety.

[0418] In some embodiments, the vector is recombinant, e.g., it comprises sequences originating from at least two different sources. In some embodiments of any of the aspects, the vector comprises sequences originating from at least two different species. In some embodiments of any of the aspects, the vector comprises sequences originating from at least two different genes, e.g., it comprises a nucleic acid encoding an expression product which is operably linked to at least one non-native (e.g., heterologous) genetic control element (e.g., a promoter, suppressor, activator, enhancer, response element, or the like). Vectors and Virions

[0419] In some embodiments of any of the aspects, the rAAV vector (also referred to as a rAAV virion) as disclosed herein comprises a capsid protein, and a rAAV genome in the capsid protein. A rAAV capsid of the rAAV virion can be any of those listed in Table 2 herein, or in Table 1 as disclosed in International Applications WO2020 / 102645, and WO2020 / 102667, each of which are incorporated herein in their entirety by reference. In some embodiments of any of the aspects, the rAAV described herein comprises AAV capsid proteins that can be polyploid (also referred to VP3capsid proteins from more than one AAV serotypes in a single AAV virion as described in International Application Nos PCT / US2018 / 022725, PCT / US2018 / 044632, and US Patent No. 10,550,405; all of which are incorporated here by reference in their entireties. In some embodiments of any of the aspects, rAAV comprises at least one capsid protein of VP1, VP2, and VP3 selected from AAV serotypes listed in Table A. Table A: AAV Serotypes and exemplary Published corresponding capsid sequenceAAVhu.l6 (AAV33.8) (See SEQ ID NO: 51 in AAVhu.17 (See SEQ ID NO: 83 in US20150315612)US20150315612) AAVhu.l7 (AAV33.12) (See SEQ ID NO: 4 in AAVhu.172.1 (See SEQ ID NO: 171 in US20150315612) US20150315612) AAVhu.172.2 (See SEQ ID NO: 172 in AAVhu.173.4 (See SEQ ID NO: 173 in US20150315612) US20150315612) AAVhu.173.8 (See SEQ ID NO: 175 in AAVhu.18 (See SEQ ID NO: 52 in US20150315612) US20150315612) AAVhu.18 (See SEQ ID NO: 149 in AAVhu.19 (See SEQ ID NO: 62 in US20150315612) US20150315612) AAVhu.19 (See SEQ ID NO: 133 in AAVhu.2 (See SEQ ID NO: 48 in US20150315612) US20150315612) AAVhu.2 (See SEQ ID NO: 143 in AAVhu.20 (See SEQ ID NO: 63 in US20150315612) US20150315612) AAVhu.20 (See SEQ ID NO: 134 in AAVhu.21 (See SEQ ID NO: 65 in US20150315612) US20150315612) AAVhu.21 (See SEQ ID NO: 135 in AAVhu.22 (See SEQ ID NO: 67 in US20150315612) US20150315612) AAVhu.22239 (See SEQ ID NO: 138 in AAVhu.23 (See SEQ ID NO: 60 in US20150315612) US20150315612) AAVhu.23.2 (See SEQ ID NO: 137 in AAVhu.24 (See SEQ ID NO: 66 in US20150315612) US20150315612) AAVhu.24 (See SEQ ID NO: 136 in AAVhu.25 (See SEQ ID NO: 49 inUS20150315612) US20150315612) AAVhu.25 (See SEQ ID NO: 146 in AAVhu.26 (See SEQ ID NO: 17 in US20150315612) US20150159173 and SEQ ID NO: 61 in US20150315612) AAVhu.26 (See SEQ ID NO: 33 in US20150159173), US20150315612 SEQ AAVhu.27 (See SEQ ID NO: 64 in US20150315612) AAVhu.27 (See SEQ ID NO: 140 in AAVhu.28 (See SEQ ID NO: 68 in US20150315612) US20150315612) AAVhu.28 (See SEQ ID NO: 130 in AAVhu.29 (See SEQ ID NO: 69 in US20150315612) US20150315612) AAVhu.29 (See SEQ ID NO: 42 in US20150159173 and SEQ ID NO: 132 in US20150315612) AAVhu.29 (See SEQ ID NO: 225 in AAVhu.29R (See SEQ ID NO: in US20150315612) US20150159173 AAVhu.3 (See SEQ ID NO: 44 in AAVhu.3 (See SEQ ID NO: 145 in US20150315612) US20150315612) AAVhu.30 (See SEQ ID NO: 70 in AAVhu.30 (See SEQ ID NO: 131 in US20150315612) US20150315612) AAVhu.31 (See SEQ ID NO: 1 in AAVhu.31 (See SEQ ID NO: 121 in US20150315612) US20150315612) AAVhu.32 (See SEQ ID NO: 2 in AAVhu.32 (See SEQ ID NO: 122 in US20150315612) US20150315612) AAVhu.33 (See SEQ ID NO: 75 in AAVhu.33 (See SEQ ID NO: 124 in US20150315612) US20150315612)AAV42.10 (See SEQ ID NO: 106 in AAVrh.21 (AAV42.10) (See SEQ ID NO: 35 US20030138772) in US20030138772) AAV42.11 (See SEQ ID NO: 108 in AAVrh.22 (AAV42.11) (See SEQ ID NO: 37 US20030138772) in US20030138772) AAV42.12 (See SEQ ID NO: 113 in AAVrh.23 (AAV42.12) (See SEQ ID NO: 58 US20030138772) in US20030138772) AAV42.13 (See SEQ ID NO: 86 in AAVrh.24 (AAV42.13) (See SEQ ID NO: 31 US20030138772) in US20030138772) AAV42.15 (See SEQ ID NO: 84 in AAVrh.25 (AAV42.15) (See SEQ ID NO: 28 US20030138772) in US20030138772) AAVrh.2R (See SEQ ID NO: in AAVrh.31 (AAV223.1) (See SEQ ID NO: 48 US20150159173 in US20030138772) AAVC1 (See SEQ ID NO: 60 in AAVrh.32 (AAVC1) (See SEQ ID NO: 19 in US20030138772) 446 US20030138772)AAVrh.54 (See SEQ ID NO: 49 in US20150159173 and SEQ ID NO: 116 in US20150315612) AAVrh.55 (See SEQ ID NO: 37 in AAVrh.55 (AAV4-19) (See SEQ ID NO: 117 US20150315612) in US20150315612) AAVrh.56 (See SEQ ID NO: 54 in AAVrh.56 (See SEQ ID NO: 152 in US20150315612) US20150315612)AAVrh.60 (See SEQ ID NO: 31 in AAVrh.60 (See SEQ ID NO: 120 in US20150315612) US20150315612)BAAV (bovine AAV) (See SEQ ID NO: 10 in BAAV (bovine AAV) (See SEQ ID NO: 4 in US9193769) US9193769) BAAV (bovine AAV) (See SEQ ID NO: 2 in BAAV (bovine AAV) (See SEQ ID NO: 6 in US9193769) US9193769) BAAV (bovine AAV) (See SEQ ID NO: 1 in BAAV (bovine AAV) (See SEQ ID NO: 5 in US9193769) US9193769)BAAV (bovine AAV) (See SEQ ID NO: 3 in BAAV (bovine AAV) (See SEQ ID NO: 11 US9193769) in US9193769) BAAV (bovine AAV) (See SEQ ID NO: 5 in BAAV (bovine AAV) (See SEQ ID NO: 6 in US7427396) US7427396) BAAV (bovine AAV) (See SEQ ID NO: 7 in BAAV (bovine AAV) (See SEQ ID NO: 9 in US9193769) US9193769) BNP61 AAV (See SEQ ID NO: 1 in BNP61 AAV (See SEQ ID NO: 2 in US20150238550) US20150238550) BNP62 AAV (See SEQ ID NO: 3 in BNP63 AAV (See SEQ ID NO: 4 in US20150238550) US20150238550) caprine AAV (See SEQ ID NO: 3 in caprine AAV (See SEQ ID NO: 4 in US7427396) US7427396) true type AAV (ttAAV) (See SEQ ID NO: 2 in AAAV (Avian AAV) (See SEQ ID NO: 12 WO2015121501) in US9238800) AAAV (Avian AAV) (See SEQ ID NO: 2 in AAAV (Avian AAV) (See SEQ ID NO: 6 in US9238800) US9238800) AAAV (Avian AAV) (See SEQ ID NO: 4 in AAAV (Avian AAV) (See SEQ ID NO: 8 in US9238800) US9238800) AAAV (Avian AAV) (See SEQ ID NO: 14 in AAAV (Avian AAV) (See SEQ ID NO: 10 US9238800) in US9238800) AAAV (Avian AAV) (See SEQ ID NO: 15 in AAAV (Avian AAV) (See SEQ ID NO: 5 in US9238800) US9238800) AAAV (Avian AAV) (See SEQ ID NO: 9 in AAAV (Avian AAV) (See SEQ ID NO: 3 in US9238800)US9238800) AAAV (Avian AAV) (See SEQ ID NO: 7 in AAAV (Avian AAV) (See SEQ ID NO: 11 US9238800) in US9238800) AAAV (Avian AAV) (See SEQ ID NO: in AAAV (Avian AAV) (See SEQ ID NO: 1 in US9238800) US9238800) AAV Shuffle 100-1 (See SEQ ID NO: 23 in AAV Shuffle 100-1 (See SEQ ID NO: 11 in US20160017295) US20160017295) AAV Shuffle 100-2 (See SEQ ID NO: 37 in AAV Shuffle 100-2 (See SEQ ID NO: 29 in US20160017295) US20160017295) AAV Shuffle 100-3 (See SEQ ID NO: 24 in AAV Shuffle 100-3 (See SEQ ID NO: 12 in US20160017295) US20160017295) AAV Shuffle 100-7 (See SEQ ID NO: 25 in AAV Shuffle 100-7 (See SEQ ID NO: 13 in US20160017295) US20160017295) AAV Shuffle 10-2 (See SEQ ID NO: 34 in AAV Shuffle 10-2 (See SEQ ID NO: 26 in US20160017295) US20160017295) AAV Shuffle 10-6 (See SEQ ID NO: 35 in AAV Shuffle 10-6 (See SEQ ID NO: 27 in US20160017295) US20160017295) AAV Shuffle 10-8 (See SEQ ID NO: 36 in AAV Shuffle 10-8 (See SEQ ID NO: 28 in US20160017295) US20160017295) AAV SM 100-10 (See SEQ ID NO: 41 in AAV SM 100-10 (See SEQ ID NO: 33 in US20160017295) US20160017295) AAV SM 100-3 (See SEQ ID NO: 40 in AAV SM 100-3 (See SEQ ID NO: 32 in US20160017295) US20160017295) AAV SM 10-1 (See SEQ ID NO: 38 in AAV SM 10-1 (See SEQ ID NO: 30 in US20160017295) US20160017295) AAV SM 10-2 (See SEQ ID NO: 10 in AAV SM 10-2 (See SEQ ID NO: 22 in US20160017295) US20160017295)AAV CKd-8 (See SEQ ID NO: 138 in AAV CKd-B 1 (See SEQ ID NO: 73 in US8734809) US8734809) AAV CKd-B 1 (See SEQ ID NO: 147 in AAV CKd-B2 (See SEQ ID NO: 74 in US8734809) US8734809)AAV CLv-L4 (See SEQ ID NO: 65 in AAV CLv-L5 (See SEQ ID NO: 16 in WO2016065001) WO2016065001) AAV CLv-L5 (See SEQ ID NO: 66 in AAV CLv-L6 (See SEQ ID NO: 17 in WO2016065001) WO2016065001)AAV CLv-L6 (See SEQ ID NO: 67 in AAV CLv-Ml (See SEQ ID NO: 21 in WO2016065001) WO2016065001) AAV CLv-Ml (See SEQ ID NO: 71 in AAV CLv-Mll (See SEQ ID NO: 22 WO2016065001) WO2016065001) AAV CLv-Ml 1 (See SEQ ID NO: 72 in AAV CLv-M2 (See SEQ ID NO: 23 WO2016065001) WO2016065001) AAV CLv-M2 (See SEQ ID NO: 73 in AAV CLv-M5 (See SEQ ID NO: 24 WO2016065001) WO2016065001) AAV CLv-M5 (See SEQ ID NO: 74 in AAV CLv-M6 (See SEQ ID NO: 25 WO2016065001) WO2016065001) AAV CLv-M6 (See SEQ ID NO: 75 in AAV CLv-M7 (See SEQ ID NO: 26 WO2016065001) WO2016065001) AAV CLv-M7 (See SEQ ID NO: 76 in AAV CLv-M8 (See SEQ ID NO: 27 WO2016065001) WO2016065001) AAV CLv-M8 (See SEQ ID NO: 77 in AAV CLv-M9 (See SEQ ID NO: 28 WO2016065001) WO2016065001) AAV CLv-M9 (See SEQ ID NO: 78 in AAV CLv-Rl (See SEQ ID NO: 30 WO2016065001) US8734809) AAV CLv-Rl (See SEQ ID NO: 104 in AAV CLv-R2 (See SEQ ID NO: 31 US8734809) US8734809) AAV CLv-R2 (See SEQ ID NO: 105 in AAV CLv-R3 (See SEQ ID NO: 32 US8734809) US8734809) AAV CLv-R3 (See SEQ ID NO: 106 in AAV CLv-R4 (See SEQ ID NO: 33 US8734809) US8734809) AAV CLv-R4 (See SEQ ID NO: 107 in AAV CLv-R5 (See SEQ ID NO: 34 US8734809) US8734809) AAV CLv-R5 (See SEQ ID NO: 108 in AAV CLv-R6 (See SEQ ID NO: 35 US8734809) US8734809)AAV CLv-R6 (See SEQ ID NO: 109 in AAV CLv-R7 (See SEQ ID NO: 110 in US8734809); AAV CLv-R7802 (see SEQ ID US8734809) NO: 36 in US8734809) AAV CLv-R8 (See SEQ ID NO: 37 in AAV CLv-R8 (See SEQ ID NO: 111 in US8734809) US8734809) AAV CLv-R9 (See SEQ ID NO: 38 in AAV CLv-R9 (See SEQ ID NO: 112 in US8734809) US8734809) AAV CSp-1 (See SEQ ID NO: 45 in AAV CSp-1 (See SEQ ID NO: 119 i US8734809) US8734809) AAV CSp-10 (See SEQ ID NO: 46 in AAV CSp-10 (See SEQ ID NO: 120 US8734809) US8734809) AAV CSp-11 (See SEQ ID NO: 47 in AAV CSp-11 (See SEQ ID NO: 121 US8734809) US8734809) AAV CSp-2 (See SEQ ID NO: 48 in AAV CSp-2 (See SEQ ID NO: 122 i US8734809) US8734809) AAV CSp-3 (See SEQ ID NO: 49 in AAV CSp-3 (See SEQ ID NO: 123 i US8734809) US8734809) AAV CSp-4 (See SEQ ID NO: 50 in AAV CSp-4 (See SEQ ID NO: 124 i US8734809) US8734809)AAV5 (See SEQ ID NO: 50 in WO2016065001) AAV5 (See SEQ ID NO: 100 inAAVF9 / HSC9 (See SEQ ID NO: 10 in AAVF9 / HSC9882 (see SEQ ID NO: 29 in WO2016049230) WO2016049230)

[0420] In some embodiments of any of the aspects, the AAV vector (also referred to as a rAAV virion) as disclosed herein comprises a capsid protein from any of those disclosed in WO2019 / 241324, which is incorporated herein in its entirety by reference. In some embodiments of any of the aspects, the rAAV vector comprises a liver specific capsid, e.g., a liver specific capsid selected from XL32 and XL32.1, as disclosed in WO2019 / 241324, which is incorporated herein in its entirety by reference. In some embodiments of any of the aspects, the rAAV vector is a AAVXL32 or AAVXL32.1 as disclosed in WO2019 / 241324, which is incorporated herein in its entirety by reference.

[0421] Exemplary chimeric or variant capsid proteins that can be used as the AAV capsid in the rAAV vector described herein can be selected from Table 2 from WO 2021 / 102107; which is incorporated herein by reference herein in its entirety or can be used with any combination with wild type capsid proteins and / or other chimeric or variant capsid proteins now known or later identified and each is incorporated herein. In some embodiments of any of the aspects, the rAAV vector encompassed for use is a chimeric vector, e.g., as disclosed in 9,012,224 and US 7,892,809, which are incorporated herein in their entireties by reference.

[0422] In some embodiments of any of the aspects, the rAAV vector is a haploid rAAV vector, as disclosed in US application US2018 / 0371496 and PCT / US18 / 22725, or polyploid rAAV vector, e.g., as disclosed in PCT / US2018 / 044632 filed on 7 / 31 / 2018 and in US application 16 / 151,110, each of which are incorporated herein in their entirety by reference. In some embodiments of any of the aspects, the rAAV vector is a rAAV3 vector, as disclosed in 9,012,224 and WO 2017 / 106236 which are incorporated herein in their entirety by reference.

[0423] In some embodiments of any of the aspects, the rAAV is a AAVXL32 or AAVXL32.1 AAV vector as disclosed in WO2019 / 241324, which is incorporated herein in its entirety by reference. In some embodiments of any of the aspects, the rAAV vector comprises a capsiddisclosed in WO2019241324A1, or International Patent application PCT / US2019 / 036676, which are incorporated herein in their entireties by reference. In some embodiments of any of the aspects, the AAV vector is a AAV8 vector or a rational haploid comprising an AAV8 capsid protein. In some embodiments of any of the aspects, the recombinant AAV vector is a chimeric AAV vector, haploid AAV vector, a hybrid AAV vector or polyploid AAV vector. In some embodiments of any of the aspects, the recombinant AAV vector is a rational haploid vector, a mosaic AAV vector, a chemically modified AAV vector, or a AAV vector from any AAV serotypes, for example, from any AAV serotype disclosed in Table 1 as disclosed in International Applications WO2020 / 102645, and WO2020 / 102667, each of which are incorporated by reference herein in their entirety.

[0424] In some embodiments of any of the aspects, an rAAV vector is an AAV3b capsid. AAV3b capsids encompassed for use are described in 2017 / 106236, and 9,012,224 and 7,892,809, and International application PCT / US19 / 61653, filed Nov 15, 2019, and International Applications WO2020 / 102645, and WO2020 / 102667, each of which are incorporated herein by reference in their entirety. In addition, AAV3b capsids of the AAV vector for use according to the methods as disclosed herein are disclosed in International Patent Applications WO 2020 / 102645 and WO2021102107, which are incorporated herein in its entirety by reference herein.

[0425] In some embodiments of any of the aspects, the AAV3b capsid comprises SEQ ID NO: 44 as disclosed in International Patent Applications WO 2020 / 102645 and WO2021102107, each of which are incorporated by reference herein it its entirety. In some embodiments of any of the aspects, the AAV capsid can be a modified AAV capsid that is derived in whole or in part from the AAV capsid set forth in SEQ ID NO: 44 as disclosed in International Patent Applications WO 2020 / 102645 and WO2021102107. In In some embodiments of any of the aspects, the amino acids from an AAV3b capsid as set forth in SEQ ID NO: 44 as disclosed in International Patent Applications WO 2020 / 102645 and WO2021102107 can be, or are substituted with amino acids from another capsid of a different AAV serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype, and can include either naturally occurring or partially or completely synthetic amino acids.

[0426] In some embodiments of any of the aspects, an AAV capsid can be an AAV3b265D capsid. In this particular embodiment, an AAV3b265D capsid comprises a modification in the amino acid sequence of the two-fold axis loop of an AAV3b capsid via replacement of amino acid G265 of the AAV3b capsid with D265. In some embodiments of any of the aspects, an AAV3b265D capsid comprises SEQ ID NO: 46 as set forth in International Patent Applications WO 2020 / 102645 and WO2021102107, each of which is incorporated by reference herein in its entirety. However, the modified virus capsids of the invention are not limited to AAV capsids setforth in SEQ ID NO: 46 as set forth in International Patent Applications WO 2020 / 102645 and WO2021102107. In some embodiments of any of the aspects, the amino acids from AAV3b265D as set forth in SEQ ID NO. 46 can be, or are substituted with amino acids from a capsid from an AAV of a different serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype, and can include either naturally occurring or partially or completely synthetic amino acids.

[0427] In some embodiments of any of the aspects, an rAAV vector is an AAV3b265D549A capsid. In this particular embodiment, an AAV3b265D549A capsid comprises a modification in the amino acid sequence of the two-fold axis loop of an AAV3b capsid via replacement of amino acid G265 of the AAV3b capsid with D265 and replacement of amino acid T549 of the AAV3b capsid with A549. In some embodiments of any of the aspects, an AAV3b265D549A capsid comprises SEQ ID NO: 50 as disclosed in International Patent Applications WO 2020 / 102645 and WO2021102107, each of which is incorporated by reference herein in its entirety. However, the modified virus capsids of the invention are not limited to AAV capsids set forth in SEQ ID NO: 50 as disclosed in International Patent Applications WO 2020 / 102645 and WO2021102107. In some embodiments of any of the aspects, the amino acids from AAV3b265D549A as set forth in SEQ ID NO: 50 as disclosed in International Patent Applications WO 2020 / 102645 and WO2021102107 can be, or are substituted with amino acids from a capsid from an AAV of a different serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype, and can include either naturally occurring or partially or completely synthetic amino acids. In some embodiments of any of the aspects, the amino acids from AAV3bSASTG (i.e., a AAV3b capsid comprising Q263A / T265 mutations) can be, or are substituted with amino acids from a capsid from an AAV of a different serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype, and can include either naturally occurring or partially or completely synthetic amino acids.

[0428] In another embodiment, an rAAV vector is an AAV3b549A capsid. In this particular embodiment, an AAV3b549A capsid comprises a modification in the amino acid sequence of the two-fold axis loop of an AAV3b capsid via replacement of amino acid T549 of the AAV3b capsid with A549. In some embodiments, an AAV3b549A capsid comprises SEQ ID NO: 52 as disclosed in International Patent Applications WO 2020 / 102645 and WO2021102107, each of which is incorporated by reference herein in its entirety. However, the modified virus capsids of the invention are not limited to AAV capsids set forth in SEQ ID NO: 52 as disclosed in International Patent Applications WO 2020 / 102645 and WO2021102107. In some embodiments of any of the aspects, the amino acids from AAV3b549A as set forth in SEQ ID NO: 52 as disclosed in International Patent Applications WO 2020 / 102645 and WO2021102107can be, or are substitutedwith amino acids from a capsid from an AAV of a different serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype, and can include either naturally occurring or partially or completely synthetic amino acids.

[0429] In another embodiment, an rAAV vector is an AAV3bQ263Y capsid. In this particular embodiment, an AAV3bQ263Y capsid comprises a modification in the amino acid sequence of the two-fold axis loop of an AAV3b capsid via replacement of amino acid Q263 of the AAV3b capsid with Y263. In some embodiments of any of the aspects, an AAV3b549A capsid comprises SEQ ID NO: 54 as disclosed in International Patent Applications WO 2020 / 102645 and WO2021102107, each of which is incorporated by reference herein in its entirety. However, the modified virus capsids of the invention are not limited to AAV capsids set forth in SEQ ID NO: 54 as disclosed in International Patent Applications WO 2020 / 102645 and WO2021102107. In some embodiments of any of the aspects, the amino acids from AAV3bQ263Y as set forth in SEQ ID NO: 54 as disclosed in International Patent Applications WO 2020 / 102645 and WO2021102107 can be, or are substituted with amino acids from a capsid from an AAV of a different serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype, and can include either naturally occurring or partially or completely synthetic amino acids.

[0430] In another embodiment, an rAAV vector is AAV3bSASTG serotype or comprises a AAV3bSASTG capsid. In this particular embodiment, an AAV3bSASTG capsid comprises a modification in the amino acid sequence to comprise a SASTG mutation, in particular, the AAV3b capsid was modified to resemble AAV2 Q263A / T265 subvariant by introducing these modifications at similar positions in the AAV3b capsid (as disclosed in Messina EL, et al., Adeno- associated viral vectors based on serotype 3b use components of the fibroblast growth factor receptor signaling complex for efficient transduction. Hum. Gene Ther. 2012 Oct: 23(10):1031-4, Piacentino III, Valentino, et al. "X-linked inhibitor of apoptosis protein-mediated attenuation of apoptosis, using a novel cardiac-enhanced adeno-associated viral vector." Human gene therapy 23.6 (2012): 635-646 , which are both incorporated herein in their entirety by reference). Accordingly, in some embodiments of any of the aspects, an rAAV vector is AAV3bSASTG serotype or comprises a AAV3bSASTG capsid comprising a AAV3b Q263A / T265 capsid. In some embodiments of any of the asepcts, the amino acids from AAV3bSASTG can be, or are substituted with amino acids from a capsid from an AAV of a different serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype, and can include either naturally occurring or partially or completely synthetic amino acids.

[0431] One can target desired tissues using the appropriate capsids. For example, the central nervous system using AAV9 or a rhesus capsid or a rational haploid using at least one of a AAV9 or Rhesus viral protein. One can target the muscle using myo AAV, see, e.g., WO2019 / 2071323and WO2022 / 020616, which are each incorporated herein in their entirety by reference.

[0432] In order to facilitate their introduction into a cell, an rAAV vector genome useful in the invention can comprise one or more recombinant nucleic acid constructs that include (1) a heterologous sequence to be expressed (e.g., a polynucleotide as described herein) and (2) viral sequence elements that facilitate integration and expression of the heterologous gene. The viral sequence elements may include those sequences of an AAV vector genome that are required in cis for replication and packaging (e.g., functional ITRs) of the DNA into an AAV capsid. In some embodiments of any of the aspects, such an rAAV vector genome may also contain marker or reporter genes. In some embodiments of any of the aspects, an rAAV vector genome can have one or more of the AAV3b wild-type (WT) cis genes replaced or deleted in whole or in part, but retain functional flanking ITR sequences.

[0433] In some embodiments, the vector is an expression vector. As used herein, the term “expression vector” refers to a vector that directs expression of an RNA or polypeptide from sequences linked to transcriptional regulatory sequences on the vector. The sequences expressed will often, but not necessarily, be heterologous to the cell. An expression vector may comprise additional elements, for example, the expression vector may have two replication systems, thus allowing it to be maintained in two organisms, for example in human cells for expression and in a prokaryotic host for cloning and amplification. Examples of eukaryotic expression vectors include, but are not limited to, pW-LNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; pSVK3, pBPV, pMSG and pSVL available from Amersham Pharmacia Biotech; and pCMVDsRed2-express, pIRES2-DsRed2, pDsRed2-Mito, pCMV-EGFP available from Clontech. Many other vectors are well-known and commercially available. For mammalian cells adenoviral vectors, the pSV and the pCMV series of vectors are particularly well-known non-limiting examples. There are many well-known yeast expression vectors including, without limitation, yeast integrative plasmids (YIp) and yeast replicative plasmids (YRp). For plants the Ti plasmid of agrobacterium is an exemplary expression vector, and plant viruses also provide suitable expression vectors, e.g., tobacco mosaic virus (TMV), potato virus X, and cowpea mosaic virus.

[0434] In some embodiments, the expression vector is a plasmid. Such a plasmid can include a variety of other functional nucleic acid sequences, such as one or more selectable markers, one or more origins of replication, polycloning sites and the like.

[0435] In some embodiments, the method comprises administering the exogenous nucleotide sequence (e.g., a vector comprising the exogenous nucleotide sequence) systemically. Systemic administration can be enteral (e.g., oral, sublingual, and rectal) or parenteral (e.g., injection). Preferred routes of injection for the exogenous nucleotide sequence (e.g., a vector comprising theexogenous nucleotide sequence) include intravenous, intramuscular, subcutaneous, intra-arterial, intra-articular, intrathecal, and intradermal injections.

[0436] In some embodiments exogenous nucleotide sequence (e.g., a vector comprising the exogenous nucleotide sequence) can be administered concurrently or sequentially with one or more additional therapeutic agents or with one or more saturating agents designed to prevent clearance of the vectors by the reticular endothelial system.

[0437] Where the vector is an AAV vector, the dosage of the vector can be from 1x109gc / kg to 1x1015gc / kg or more, suitably from 5x109gc / kg to 1x1013gc / kg, suitably from 5x1010gc / kg to 5x1012gc / kg. In some embodiments, where the vector is an AAV vector, the dosage of the vector can be from 1x1010gc / kg to 1x1015gc / kg or more, suitably from 1x1012gc / kg to 1x1014gc / kg, suitably from 5x1012gc / kg to 5x1013gc / kg. In some embodiments, the dosage of the vector can be from 1x1010gc / kg to 1x1015gc / kg. In some embodiments, the dosage of the vector can be from 1x1012gc / kg to 1x1014gc / kg. In some embodiments, the dosage of the vector can be from 5x1012gc / kg to 5x1013gc / kg. In some embodiments, the dose of AAV vector administered to a subject is at least about 1.0E9 gc / kg, at least about 1.0E10 gc / kg, at least about 1.0E11 gc / kg, at least about 1.0E12gc / kg, about 1.1E12 gc / kg, about 1.2E12 gc / kg, about 1.3E12 gc / kg, about 1.4E12 gc / kg, about 1.5E12 gc / kg, about 1.6E12 gc / kg, about 1.7E12 gc / kg, about 1.8E12 gc / kg, about 1.9E12 gc / kg, about 2.0E12 gc / kg, about 3.0E12 gc / kg, about 4.0E12 gc / kg, about 5.0E12 gc / kg, about 6.0E12 gc / kg, about 7.0E12 gc / kg, about 8.0E12 gc / kg, about 9.0E12 gc / kg, about 1.0E13 gc / kg, about 1.2E13 gc / kg, about 1.2E13 gc / kg, about 1.2E13 gc / kg, about 1.3E13 gc / kg, about 1.4E13 gc / kg, about 1.5E13 gc / kg, about 1.6E13 gc / kg, about 1.7E13 gc / kg, about 1.8E13 gc / kg, about 1.9E13 gc / kg, about 2.0E13 gc / kg, about 3.0E13 gc / kg, about 4.0E13 gc / kg, about 5.0E13 gc / kg, about 6E13gc / kg, about 7E13gc / kg, about 8E13 gc / kg, about 9E13 gc / kg, about 1.0E14 gc / kg, about 1.2E14 gc / kg, about 1.2E14 gc / kg, about 1.2E14 gc / kg, about 1.3E14 gc / kg, about 1.4E14 gc / kg, about 1.5E14 gc / kg, about 1.6E14 gc / kg, about 1.7E14 gc / kg, about 1.8E14 gc / kg, about 1.9E14 gc / kg, about 2.0E14 gc / kg, about 3.0E14 gc / kg, about 4.0E14 gc / kg, about 5.0E14 gc / kg, about 6E14gc / kg, about 7E14gc / kg, about 8E14 gc / kg, about 9E14 gc / kg, about 1.0E15 gc / kg, about 1.2E15 gc / kg, about 1.2E15 gc / kg, about 1.2E15 gc / kg, about 1.3E15 gc / kg, about 1.4E15 gc / kg, about 1.5E15 gc / kg, about 1.6E15 gc / kg, about 1.7E15 gc / kg, about 1.8E15 gc / kg, about 1.9E15 gc / kg, about 2.0E15 gc / kg, about 3.0E15 gc / kg, about 4.0E15 gc / kg, about 5.0E15 gc / kg, about 6E15gc / kg, about 7E15gc / kg, about 8E15 gc / kg, about 9E15 gc / kg, about 1.0E16 gc / kg, about 1.2E16 gc / kg, about 1.2E16 gc / kg, about 1.2E16 gc / kg, about 1.3E16 gc / kg, about 1.4E16 gc / kg, about 1.5E16 gc / kg, about 1.6E16 gc / kg, about 1.7E16 gc / kg, about 1.8E16 gc / kg, about 1.9E16 gc / kg, about 2.0E16 gc / kg, about 3.0E16 gc / kg, about 4.0E16 gc / kg, about 5.0E16 gc / kg, about 6E16gc / kg, about 7E16gc / kg, about 8E16 gc / kg, or about 9E16 gc / kg. In someembodiments, exemplary doses for AAV vector are titers of between 1.2E12 and 4.0E12 gc / kg, for example, least about 1.0E12 gc / kg, about 1.1E12 gc / kg, about 1.2E12 gc / kg, about 1.3E12 gc / kg, about 1.4E12 gc / kg, about 1.5E12 gc / kg, about 1.6E12 gc / kg, about 1.7E12 gc / kg, about 1.8E12 gc / kg, about 1.9E12 gc / kg, about 2.0E12 gc / kg, about 2.1E12 gc / kg, about 2.2E12 gc / kg, about 2.3E12 gc / kg, about 2.4E12 gc / kg, about 2.5E12 gc / kg, about 2.6E12 gc / kg, about 2.7E12 gc / kg, about 2.8E12 gc / kg, about 2.9E12 gc / kg, about 3.0E12 gc / kg, about 3.1E12 gc / kg, about 3.2E12 gc / kg, about 3.3E12 gc / kg, about 3.4E12 gc / kg, about 3.5E12 gc / kg, about 3.6E12 gc / kg, about 3.7E12 gc / kg, about 3.8E12 gc / kg, about 3.9E12 gc / kg, about 4.0E12 gc / kg.

[0438] In some embodiments, exemplary doses for AAV vector are titers of between 1E13 gc / kg and 1E15 gc / kg, example, about 1e13 gc / kg, about 3e13 gc / kg, about 5e13 gc / kg, about 6e13 gc / kg, about 8e13 gc / kg, about 9e13 gc / kg, about 1e14 gc / kg, about 3e14 gc / kg, about 6e14 gc / kg, about 9e14 or about 1e15gc / kg.

[0439] In some embodiments, where the vector is an AAV vector, the dosage of the vector can be within the range of 1.0E9 vg / kg to 5.0E12vg / kg. In some embodiments, the dose of AAV vector administered to a subject is at least about 1.0E9 vg / kg, at least about 1.0E10 vg / kg, at least about 1.0E11 vg / kg, at least about 1.0E12vg / kg, about 1.1E12 vg / kg, about 1.2E12 vg / kg, about 1.3E12 vg / kg, about 1.4E12 vg / kg, about 1.5E12 vg / kg, about 1.6E12 vg / kg, about 1.7E12 vg / kg, about 1.8E12 vg / kg, about 1.9E12 vg / kg, about 2.0E12 vg / kg, about 3.0E12 vg / kg, about 4.0E12 vg / kg, about 5.0E12 vg / kg, about 6.0E12 vg / kg, about 7.0E12 vg / kg, about 8.0E12 vg / kg, about 9.0E12 vg / kg, about 1.0E13 vg / kg, about 1.2E13 vg / kg, about 1.2E13 vg / kg, about 1.2E13 vg / kg, about 1.3E13 vg / kg, about 1.4E13 vg / kg, about 1.5E13 vg / kg, about 1.6E13 vg / kg, about 1.7E13 vg / kg, about 1.8E13 vg / kg, about 1.9E13 vg / kg, about 2.0E13 vg / kg, about 3.0E13 vg / kg, about 4.0E13 vg / kg, about 5.0E13 vg / kg, about 6E13vg / kg, about 7E13vg / kg, about 8E13 vg / kg, about 9E13 vg / kg, about 1.0E14 vg / kg, about 1.2E14 vg / kg, about 1.2E14 vg / kg, about 1.2E14 vg / kg, about 1.3E14 vg / kg, about 1.4E14 vg / kg, about 1.5E14 vg / kg, about 1.6E14 vg / kg, about 1.7E14 vg / kg, about 1.8E14 vg / kg, about 1.9E14 vg / kg, about 2.0E14 vg / kg, about 3.0E14 vg / kg, about 4.0E14 vg / kg, about 5.0E14 vg / kg, about 6E14vg / kg, about 7E14vg / kg, about 8E14 vg / kg, about 9E14 vg / kg, about 1.0E15 vg / kg, about 1.2E15 vg / kg, about 1.2E15 vg / kg, about 1.2E15 vg / kg, about 1.3E15 vg / kg, about 1.4E15 vg / kg, about 1.5E15 vg / kg, about 1.6E15 vg / kg, about 1.7E15 vg / kg, about 1.8E15 vg / kg, about 1.9E15 vg / kg, about 2.0E15 vg / kg, about 3.0E15 vg / kg, about 4.0E15 vg / kg, about 5.0E15 vg / kg, about 6E15vg / kg, about 7E15vg / kg, about 8E15 vg / kg, about 9E15 vg / kg, about 1.0E16 vg / kg, about 1.2E16 vg / kg, about 1.2E16 vg / kg, about 1.2E16 vg / kg, about 1.3E16 vg / kg, about 1.4E16 vg / kg, about 1.5E16 vg / kg, about 1.6E16 vg / kg, about 1.7E16 vg / kg, about 1.8E16 vg / kg, about 1.9E16 vg / kg, about 2.0E16 vg / kg, about 3.0E16 vg / kg, about 4.0E16 vg / kg, about 5.0E16 vg / kg, about 6E16vg / kg, about 7E16vg / kg, about 8E16 vg / kg, or about 9E16vg / kg. In some embodiments, exemplary doses for AAV vector are titers of between 1.2E12 and 4.0E12 vg / kg, for example, least about 1.0E12 vg / kg, about 1.1E12 vg / kg, about 1.2E12 vg / kg, about 1.3E12 vg / kg, about 1.4E12 vg / kg, about 1.5E12 vg / kg, about 1.6E12 vg / kg, about 1.7E12 vg / kg, about 1.8E12 vg / kg, about 1.9E12 vg / kg, about 2.0E12 vg / kg, about 2.1E12 vg / kg, about 2.2E12 vg / kg, about 2.3E12 vg / kg, about 2.4E12 vg / kg, about 2.5E12 vg / kg, about 2.6E12 vg / kg, about 2.7E12 vg / kg, about 2.8E12 vg / kg, about 2.9E12 vg / kg, about 3.0E12 vg / kg, about 3.1E12 vg / kg, about 3.2E12 vg / kg, about 3.3E12 vg / kg, about 3.4E12 vg / kg, about 3.5E12 vg / kg, about 3.6E12 vg / kg, about 3.7E12 vg / kg, about 3.8E12 vg / kg, about 3.9E12 vg / kg, about 4.0E12 vg / kg.

[0440] In some embodiments, exemplary doses for AAV vector are titers of between 1E13 vg / kg and 1E15 vg / kg, example, about 1e13 vg / kg, about 3e13 vg / kg, about 5e13 vg / kg, about 6e13 vg / kg, about 8e13 vg / kg, about 9e13 vg / kg, about 1e14 vg / kg, about 3e14 vg / kg, about 6e14 vg / kg, about 9e14 or about 1e15vg / kg.

[0441] In some embodiments, where the vector is an AAV vector, the dosage of the vector can be within the range of 1.0E9 vg to 5.0E12vg. In some embodiments, the dose of AAV vector administered to a subject is at least about 1.0E9 vg, at least about 1.0E10 vg, at least about 1.0E11 vg, at least about 1.0E12vg, about 1.1E12 vg, about 1.2E12 vg, about 1.3E12 vg, about 1.4E12 vg, about 1.5E12 vg, about 1.6E12 vg, about 1.7E12 vg, about 1.8E12 vg, about 1.9E12 vg, about 2.0E12 vg, about 3.0E12 vg, about 4.0E12 vg, about 5.0E12 vg, about 6.0E12 vg, about 7.0E12 vg, about 8.0E12 vg, about 9.0E12 vg, about 1.0E13 vg, about 1.2E13 vg, about 1.2E13 vg, about 1.2E13 vg, about 1.3E13 vg, about 1.4E13 vg, about 1.5E13 vg, about 1.6E13 vg, about 1.7E13 vg, about 1.8E13 vg, about 1.9E13 vg, about 2.0E13 vg, about 3.0E13 vg, about 4.0E13 vg, about 5.0E13 vg, about 6E13vg, about 7E13vg, about 8E13 vg, about 9E13 vg, about 1.0E14 vg, about 1.2E14 vg, about 1.2E14 vg, about 1.2E14 vg, about 1.3E14 vg, about 1.4E14 vg, about 1.5E14 vg, about 1.6E14 vg, about 1.7E14 vg, about 1.8E14 vg, about 1.9E14 vg, about 2.0E14 vg, about 3.0E14 vg, about 4.0E14 vg, about 5.0E14 vg, about 6E14vg, about 7E14vg, about 8E14 vg, about 9E14 vg, about 1.0E15 vg, about 1.2E15 vg, about 1.2E15 vg, about 1.2E15 vg, about 1.3E15 vg, about 1.4E15 vg, about 1.5E15 vg, about 1.6E15 vg, about 1.7E15 vg, about 1.8E15 vg, about 1.9E15 vg, about 2.0E15 vg, about 3.0E15 vg, about 4.0E15 vg, about 5.0E15 vg, about 6E15vg, about 7E15vg, about 8E15 vg, about 9E15 vg, about 1.0E16 vg, about 1.2E16 vg, about 1.2E16 vg, about 1.2E16 vg, about 1.3E16 vg, about 1.4E16 vg, about 1.5E16 vg, about 1.6E16 vg, about 1.7E16 vg, about 1.8E16 vg, about 1.9E16 vg, about 2.0E16 vg, about 3.0E16 vg, about 4.0E16 vg, about 5.0E16 vg, about 6E16vg, about 7E16vg, about 8E16 vg, or about 9E16 vg. In some embodiments, exemplary doses for AAV vector are titers of between 1.2E12 and 4.0E12 vg, for example, least about 1.0E12 vg, about 1.1E12 vg, about 1.2E12 vg, about 1.3E12 vg, about 1.4E12 vg, about 1.5E12 vg, about 1.6E12 vg, about 1.7E12 vg, about 1.8E12 vg, about 1.9E12 vg, about2.0E12 vg, about 2.1E12 vg, about 2.2E12 vg, about 2.3E12 vg, about 2.4E12 vg, about 2.5E12 vg, about 2.6E12 vg, about 2.7E12 vg, about 2.8E12 vg, about 2.9E12 vg, about 3.0E12 vg, about 3.1E12 vg, about 3.2E12 vg, about 3.3E12 vg, about 3.4E12 vg, about 3.5E12 vg, about 3.6E12 vg, about 3.7E12 vg, about 3.8E12 vg, about 3.9E12 vg, about 4.0E12 vg.

[0442] In some embodiments, exemplary doses for AAV vector are titers of between 1E13 vg and 1E15 vg, example, about 1e13 vg, about 3e13 vg, about 5e13 vg, about 6e13 vg, about 8e13 vg, about 9e13 vg, about 1e14 vg, about 3e14 vg, about 6e14 vg, about 9e14 or about 1e15vg.

[0443] Gene therapy protocols for therapeutic gene expression in target cells in vitro and in vivo, are well-known in the art and will not be discussed in detail here. Briefly, they include intramuscular injection, interstitial injection, instillation in airways, application to endothelium, intra-hepatic parenchyme, and intravenous or intra-arterial administration (e.g., intra-hepatic artery, intra- hepatic vein) of plasmid DNA vectors (naked or in liposomes) or viral vectors. Various devices have been developed for enhancing the availability of DNA to the target cell. While a simple approach is to contact the target cell physically with catheters or implantable materials containing the relevant vector, more complex approaches can use jet injection devices and suchlike. Gene transfer into mammalian liver cells has been performed using both ex vivo and in vivo procedures. The ex vivo approach typically requires harvesting of the cells, in vitro transduction with suitable expression vectors, followed by reintroduction of the transduced cells into the subject. In vivo gene transfer has been achieved by injecting DNA or viral vectors into the liver parenchyma, hepatic artery, or portal vein. Expression level

[0444] In some embodiments, the method further comprises a step of determining the expression level after administering the inducer. The step of determining the expression level can comprise determining the amount of the product expressed in the subject and / or assessing the response of a subject to the expression product. Standard laboratory techniques can be used to determine the amount of the expression product.

[0445] After determining the expression lever, if a higher amount of the therapeutic product in the subject is desired, the method comprises increasing the amount of inducer administered to the subject at a subsequent administration of the inducer and / or administering a more potent inducer at a subsequent administration of the inducer. Alternately, if a lower amount of the therapeutic product in the subject is desired, the method comprises stopping administering the inducer, lowering the amount of inducer administered to the subject and / or administering a less potent inducer at a subsequent administration of the inducer.

[0446] Without wishing to be bound by a theory, duration of the expression can be adjusted by using inducers with an appropriate in-vivo half-life. If expression for a period of a few days or less is required, inducers with a short in vivo half-life can be used. As used herein, the term “in vivo half-life” refers to the time taken for the serum concentration of an inducer to reduce by 50%, in vivo, for example due to degradation of the inducer and / or clearance or sequestration of the inducer by natural mechanisms. The term "short in vivo half-life" as used herein refers to in vivo half-life less than about 24, less than about 18 hours, less than about 12 hours, less than about 11, less than about 10 hours, less than about 9 hours, less than about 8 hours, less than about 7 hours, less than about 6 hours, less than about 5 hours, less than about 4 hour, or less than about 3 hours. Accordingly, in some embodiments, the inducer has an in vivo half-life of less than less than about 24, less than about 18 hours, less than about 12 hours, less than about 11, less than about 10 hours, less than about 9 hours, less than about 8 hours, less than about 7 hours, less than about 6 hours, less than about 5 hours, less than about 4 hour, or less than about 3 hours.

[0447] In some embodiments, the inducer has an in vivo half-life of at least one day. For example, the inducer has an in vivo half-life of from about one day to about a month. In some embodiments, the inducer has an in vivo half-life of about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 15 days, about 16 days, about 17 days, about 18 days, about 19 days, about 20 days, about 21 days, about 22 days, about 23 days, about 24 days, about 25 days, about 26 days, about 27 days or about 28 days.

[0448] Expression in the liver is of particular interest as it is involved in a wide range of essential functions in the body, including the synthesis of many proteins involved in metabolism, haemostasis, and protection against infection. Given that many diseases are linked to disruption of gene expression in the liver, there is a significant interest in developing gene therapy strategies that allow expression of a transgene in the liver to produce a therapeutic expression product. Diseases associated with aberrant gene expression include, but are not limited to, haemophilia (including haemophilia A or B), familial hypercholesterolemia, ornithine transcarbamylase deficiency, phenylketonuria, ornithine transcarbamylase deficiency, glycogen storage disease, a1 -antitrypsin deficiency, hereditary hemochromatosis, tyrosinemia type 1 , argininosuccinic aciduria, hepatitis virus infection, non-viral hepatitis, liver cancer, genetic cholestasis, Wilson’s disease, and various other liver diseases (such as non-alcoholic fatty liver disease (NAFLD), and alcohol-related liver disease (ARLD). Use for the treatment of haemophilia A or B represent preferred embodiments of the various aspects of the invention.

[0449] The method suitably comprises expressing a therapeutically effective amount of the therapeutic product from the gene in the liver of said subject. The therapeutic product may have atherapeutic effect in the liver or in another location in the subject. For example, the therapeutic product may be released into the blood stream. Pharmaceutical compositions

[0450] For administration to a subject, the inducer can be provided in pharmaceutically acceptable compositions. These pharmaceutically acceptable compositions comprise an inducer, formulated together with one or more pharmaceutically acceptable carriers (additives) and / or diluents. As described in detail below, the pharmaceutical compositions described herein can be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), gavages, lozenges, dragees, capsules, pills, tablets (e.g., those targeted for buccal, sublingual, and systemic absorption), boluses, powders, granules, pastes for application to the tongue; (2) parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; (3) topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin; (4) intravaginally or intrarectally, for example, as a pessary, cream or foam; (5) sublingually; (6) ocularly; (7) transdermally; (8) transmucosally; or (9) nasally. Additionally, compounds can be implanted into a patient or injected using a drug delivery system. See, for example, Urquhart, et al., Ann. Rev. Pharmacol. Toxicol. 24: 199-236 (1984); Lewis, ed. “Controlled Release of Pesticides and Pharmaceuticals” (Plenum Press, New York, 1981); U.S. Pat. No.3,773,919; and U.S. Pat. No.353,270,960, content of all of which is herein incorporated by reference.

[0451] As used here, the term “pharmaceutically acceptable” refers to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0452] As used here, the term “pharmaceutically-acceptable carrier” means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2)starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, methylcellulose, ethyl cellulose, microcrystalline cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol (PEG); (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and / or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; (22) C2-C12 alcohols, such as ethanol; and (23) other non-toxic compatible substances employed in pharmaceutical formulations. Wetting agents, coloring agents, release agents, coating agents, sweetening agents, flavoring agents, perfuming agents, preservative and antioxidants can also be present in the formulation. The terms such as “excipient”, “carrier”, “pharmaceutically acceptable carrier” or the like are used interchangeably herein.

[0453] Examples of solid carriers include starch, sugar, bentonite, silica, and other commonly used carriers. Further non-limiting examples of carriers and diluents which can be used in the formulations comprising a NR4A inhibitor include saline, syrup, dextrose, and water.

[0454] Pharmaceutically-acceptable antioxidants include, but are not limited to, (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lectithin, propyl gallate, alpha- tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acids, and the like.

[0455] The inducer can be formulated in a gelatin capsule, in tablet form, dragee, syrup, suspension, topical cream, suppository, injectable solution, or kits for the preparation of syrups, suspension, topical cream, suppository or injectable solution just prior to use. Also, compounds can be included in composites, which facilitate its slow release into the blood stream, e.g., silicon disc, polymer beads.

[0456] The formulations can conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. Techniques, excipients and formulations generally are found in, e.g., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. 1985, 17th edition, Nema et al., PDA J. Pharm. Sci. Tech. 1997 51:166-171. Methods to make invention formulations include the step of bringing into association or contactingan ActRIIB compound with one or more excipients or carriers. In general, the formulations are prepared by uniformly and intimately bringing into association one or more compounds with liquid excipients or finely divided solid excipients or both, and then, if appropriate, shaping the product.

[0457] The preparative procedure may include the sterilization of the pharmaceutical preparations. The compounds may be mixed with auxiliary agents such as lubricants, preservatives, stabilizers, salts for influencing osmotic pressure, etc., which do not react deleteriously with the compounds.

[0458] Examples of injectable forms include solutions, suspensions and emulsions. Injectable forms also include sterile powders for extemporaneous preparation of injectible solutions, suspensions or emulsions. The inducer can be injected in association with a pharmaceutical carrier such as normal saline, physiological saline, bacteriostatic water, CremophorTMEL (BASF, Parsippany, N.J.), phosphate buffered saline (PBS), Ringer's solution, dextrose solution, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), vegetable oils, and suitable mixtures thereof, and other aqueous carriers known in the art. Appropriate non-aqueous carriers may also be used and examples include fixed oils and ethyl oleate. In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin. A suitable carrier is 5% dextrose in saline. Frequently, it is desirable to include additives in the carrier such as buffers and preservatives or other substances to enhance isotonicity and chemical stability.

[0459] Conventional dosage forms generally provide rapid or immediate drug release from the formulation. Depending on the pharmacology and pharmacokinetics of the drug, use of conventional dosage forms can lead to wide fluctuations in the concentrations of the drug in a patient's blood and other tissues. These fluctuations can impact a number of parameters, such as dose frequency, onset of action, duration of efficacy, maintenance of therapeutic blood levels, toxicity, side effects, and the like. Advantageously, controlled-release formulations can be used to control a drug's onset of action, duration of action, plasma levels within the therapeutic window,and peak blood levels. In particular, controlled- or extended-release dosage forms or formulations can be used to ensure that the maximum effectiveness of a drug is achieved while minimizing potential adverse effects and safety concerns, which ...

Claims

CLAIMSWhat is claimed is:

1. A method of regulating expression of a transgene in a primate subject, the method comprising:(a) administering to the subject at a first time point a first inducer, wherein the primate subject comprises at least one cell comprising an exogenous nucleotide sequence comprising an inducible promoter operably linked to a transgene, wherein the inducible promoter comprises a PBREM enhancer, wherein the first inducer is artemisinin or a derivative thereof or a flavonoid compound, and wherein the inducer is administered in an amount that is sufficient to express a measurable level of the transgene in the subject; and(b) administering to the subject at least at a second time point a second inducer to continue expression of the transgene at a predetermined level for a predetermined time or to modulate expression of the transgene to a predetermined level, and wherein the second inducer is artemisinin; derivative of artemisinin; a flavonoid compound, e.g. flavone, chrysin, baicalein, or galangin; l,4-Bis[2-(3,5- dichloropyridyloxy)]benzene (TCPOBOP); phenobarbital (PB); 6-(4Chlorophenyl)imidazo[2,l-b][l,3]thiazole-5-carbaldehyde-O-(3,4- dichlorobenzyljoxime (CITCO); Acetaminophen; Buprenorphine; Phenytoin; Carbamazepine; Valproic Acid; Chlorpromazine; Efavirenz; Nevirapine; Rilpivirine; Etravirine; Diazepam; Cyclophosphamid; Ifosfamide; Cerivastatin; Simvastatin; lovastatin; substituted sulphonamides; Thiazolidin-4-one; Estradiol; Estrone and analogues; 17a-ethinyl-3;17B-estradiol (EE2); Dehydroepiandrost erone (DHEA); 513- pregnane-3, 20-dione; Di ethylstilbestrol; Gingko biloba extract; Galangin; chrysin; baicalein; Diallyl sulphide; Ellagic acid; Resveratrol; Squalestatin-1; Bilobalide; Triclocarban; Triclosan; Dichlorodiphenyltrichloroethane (DDT); Dieldrin; Methoxychlor; Metofluthrin; Permethrin; Pyrethrins; Sulfoxaflor; Diethylhexyl phthalate (DEHP); Cyproconazole; Fluconazole; Propiconazole; FL81; Tri-p- methylphenyl phosphate (TMPP); UM104; or UM145.

2. The method of claim 1, wherein the expression of the transgene increases for a predetermined time after each administration.

3. The method of claim 1 or 2, wherein the first and second inducer are the same.

4. The method of claim 3, wherein the first and second inducer are artemisinin, a derivative of artemisinin, or a flavonoid compound.

5. The method of claim 3, wherein the first inducer and second inducer are artemisinin.

6. The method of claim 3, wherein the first inducer and second inducer are a derivative of artemisinin.

7. The method of claim 3, wherein the first inducer and second inducer are a flavonoid compound, optionally, the flavonoid compound is flavone.

8. The method of any one of claims 1-2, wherein the first and second inducer are different.

9. The method of claim 8, wherein the first inducer is artemisinin, and the second inducer is an artemisinin derivative or a flavonoid compound.

10. The method of claims 8, wherein the first inducer is a first artemisinin derivative, and the second inducer is artemisinin, a second artemisinin derivative, or a flavonoid compound.

11. The method of claim 8, wherein the first inducer is a flavonoid compound and the second inducer is artemisinin or a derivative of artemisinin.

12. The method of any one of claims 1-11, wherein the artemisinin derivative is a compound of Formula (I), (I-A), (I-B), (I-C), (I-D), (I-E), (I-F), (I-G), (I-H), (I-I), (I- J), (I-K), (I-L), (I-M), (I-M’), (I-N), (I-N’), (I-O) or (I-O’).

13. The method of any one of claims 1-12, wherein the artemisinin derivative is artesunate, dihydroartemisinin (DHA), artesunate, or artemether, optionally, the artemisinin derivative is artesunate, or dihydroartemisinin, more optionally, the artemisinin derivative is artesunate.

14. The method of any one of claims 1-13, wherein the flavonoid compound is flavone, baicalein, chrysin, galangin, (OH)4 flavone, 6-hydroxyluteolin, acacetin, acerosin, alnetin, apigenin, apiin, artocarpetin, baicalein, beta-sitosterol, biochamin A, cannaflavin A, cannflavin A, cannflavin B, cannflavin C, catechin, catechin-3 -gallate, cerrosillin, chrysoeriol, chrysoeriol, cirsilineol, cirsiliol, cirsimaritin, corymbosin, cupressuflavone, cyanidine, daidzein, datiscetin, delphinidine, digidrokempferol , dihydroquercetin, diosmetin, diosmin, echioidinin, epicatechin, epicatechin-3 -gallate, epigallocatechin, epigallocatechin-3 -gallate, eriodiktiol, eupatilin, eupatorin, fisetin, fizetin, flavonol, formononetin, fortunelin, gallocatechin, gallocatechin-3 -gallate, gardenin D, genistein, genistin, genkwanin, geraldol, geraldone, glycitein, glycitin, gomoeriodiktiol, gossypetin, hesperetin, hinokiflavone, hispidulin, hymenoxin, hypolaetin, isoquercetin, isorhamnetin, isorhamnetin, isoscutellarein, isovitexin, jaceosidin, kaempferol, kaempferol, kampferide, largonidin, luteolin, luteolin, malvidine, mikanin, morin, myricetin, myricetin, naringenin, negletein, neodiosmin, nepetin, nevadensin, nobiletin, nodifloretin, norartocarpetin, norwogonin, onopordin, orientin, oroxylin a, pachipodol, pectolinarigenin, pedalitin, peonidin, petunidin, pilloin, pratol, primetin, primuletin, pruentin, quercetagetin, quercetin,ramnazin, rhoifolin, robinetin, rutin, scaposin, scutellarein, serpyllin, sinensetin, sorbifolin, sudachitin, tangeretin, tangeritin, taxifolin, tectochrysin, tithonine, tricetin, tricin, velutin, vitexin, wightin, wogonin, xanthomicrol, zapotin, zapotinin, 6,7,4’-trishydroxy isoflavone, or 7,3’4’-trihydroxy isoflavone; optionally, the flavonoid compound is flavone.

15. The method of any one of claims 1-14, wherein the first and second inducer are administered at about the same amount.

16. The method of claim 15, wherein the first inducer and the second inducer are administered at different amounts.

17. The method of claim 16, wherein the second inducer is administered at a lower amount relative to the amount of the first inducer.

18. The method of claim 17, wherein the second inducer is administered in amount about 1 / 2, 1 / 3, 1 / 4, 1 / 5, 1 / 6, 1 / 7, 1 / 8, 1 / 9, 1 / 10, 1 / 15, 1 / 20, 1 / 25, 1 / 30, 1 / 35, 1 / 40, 1 / 45, 1 / 50, 1 / 55, 1 / 60, 1 / 65, 1 / 70, 1 / 75, 1 / 80, 1 / 85, 1 / 90, 1 / 95, 1 / 100, 1 / 125, 1 / 150, 1 / 175, 1 / 200, 1 / 500, 1 / 1000 or even less of the amount of first the inducer.

19. The method of claim 18, wherein the second inducer is administered in amount about 1 / 2, 1 / 4, 1 / 5, 1 / 8, 1 / 10, 1 / 20, 1 / 40, 1 / 80 or less of the amount of the first inducer.

20. The method of claim 16, wherein the second inducer is administered at a higher amount relative to the amount of the first inducer.

21. The method of claim 20, wherein the amount of inducer administered at the second time point is at least about 25%, 50%, about 75%, about 1-fold, about 1.2-folds, about 1.25- folds, about 1.3-folds, about 1.5-folds, about 1.75-folds, about 2-folds, about 2.25-folds, about 2.5-folds, about 2.5-folds, about 2.75-folds, about 3-folds, 4-fold, 5-fold, 6-folds, 7- fold, 8-fold, 9-folds, 10-folds or higher than the amount of the first inducer.

22. The method of any one of claims 1-21, wherein the first and second inducer are administered independently at a dose from about 0.5 mg / kg to about 150mg / kg.

23. The method of any one of claims 1-22, wherein the first inducer is administered at a dose from about 1 mg / kg to about 100 mg / kg.

24. The method of any one of claims 1-23, wherein the first inducer is administered at a dose of about 80mg / kg, about 70mg / kg, about 60mg / kg, about 50mg / kg, about 40mg / kg, about 30mg / kg, about 20mg / kg, about lOmg / kg, about 6mg / kg, about 5mg / kg, or about 1 mg / kg.

25. The method of any one of claims 1-24, wherein the second inducer is administered at a dose from about 1 mg / kg to about 100 mg / kg.

26. The method of any one of claims 1-25, wherein the second inducer is administered at a dose of 80mg / kg, about 70mg / kg, about 60mg / kg, about 50mg / kg, about 40mg / kg, about 30mg / kg, about 20mg / kg, about lOmg / kg, about 6mg / kg, about 5mg / kg, or about 1 mg / kg.

27. The method of any one of claims 1-16, wherein the first inducer is administered at a dose of about 80 mg / kg or less and the second inducer is administered at a dose of about 20mg / kg or less at the second or subsequent time point.

28. The method of any one of claims 1-16, wherein the first inducer is administered at a dose of about 40 mg / kg and the second inducer is administered at a dose of about 80mg / kg or less at the second or subsequent time point.

29. The method of any one of claims 1-16, wherein the first inducer is administered at a dose of about 20mg / kg and the second inducer is administered at a dose of about 80 mg / kg, 40mg / kg, 20mg / kg, 10 mg / kg, 6 mg / kg or 1 mg / kg at the second or subsequent time point.

30. The method of any one of claims 1-16, wherein the first inducer is administered at a dose of about 10 mg / kg and the second inducer is administered at a dose of about 80mg / kg or less at the second or subsequent time point.

31. The method of any one of claims 1-16, wherein the first inducer is administered at a dose of about 6 mg / kg and the second inducer is administered at a dose of about 80mg / kg or less at the second or subsequent time point.

32. The method of any one of claims 1-16, wherein the first inducer is administered at a dose of about 1 mg / kg and the second inducer is administered at a dose of about 80mg / kg or less at the second or subsequent time point.

33. The method of any one of claims 1-16, wherein the second inducer is administered at a dose of about 80 mg / kg and the first inducer is administered at a dose of about 80 mg / kg or less.

34. The method of any one of claims 1-16, wherein the second inducer is administered at a dose of about 40 mg / kg and the first inducer is administered at a dose of about 80 mg / kg or less.

35. The method of any one of claims 1-16, wherein the second inducer is administered at a dose of about 20 mg / kg and the first inducer is administered at a dose of about 80 mg / kg or less.

36. The method of any one of claims 1-16, wherein the second inducer is administered at a dose of about 10 mg / kg and the first inducer is administered at a dose of about 80 mg / kg or less.

37. The method of any one of claims 1-16, wherein the second inducer is administered at a dose of about 6 mg / kg and the first inducer is administered at a dose of about 80 mg / kg or less.

38. The method of any one of claims 1-16, wherein the second inducer is administered at a dose of about 1 mg / kg and the first inducer is administered at a dose of about 80 mg / kg or less.

39. The method of any one of claims 1-38, wherein the expression of the transgene goes down to a background expression level within one week of administering the inducer.

40. The method of any one of claims 1-39, wherein the second inducer is administered when it is determined that the level of expression of the transgene is decreased to 75% or less of the level of expression of the transgene attained after induction with the first inducer.

41. The method of any one of any one of claims 1-40, wherein the second inducer is administered when it is determined that the level of expression of the transgene is decreased to 50% or less of the level of expression of the transgene after the first inducer.

42. The method of any one of claims 1-41, wherein the second inducer is administered when it is determined that the level of expression of the transgene is decreased to 25% or less of the level of expression of the transgene after the first inducer.

43. The method of any one of claims 1-42, wherein the second inducer is administered when it is determined that the level of expression of the transgene is decreased to a background level of expression of the transgene.

44. The method of any one of claims 1-43, further comprising: (c) administering to the subject at least at a second time point a second inducer to continue expression of the transgene at a predetermined level for a predetermined time or to modulate expression of the transgene to a predetermined level, optionally, a third inducer wherein the third inducer is same or different from the first and / or second inducer; and (d) optionally, repeating step (c) a one or more times, and where the inducer at each administration is same or different from the inducer at immediate prior administration.

45. The method of any one of claims 1-44, wherein the time between administrations is at least 12 hours, at least 24 hours, 48 hours, 72 hours, 1 week, 10 days, 2 weeks, 3 weeks, or 4 weeks.

46. The method of any one of claims 1-45, wherein the time between administrations is at least 24 hours, 48 hours, or 72 hours.

47. The method of any one of claims 1-46, wherein the time between administrations is no more than 2 months, 3 months, 4 months, 5 months, or 6 months.

48. The method of any one of claims 1-47, wherein the time between administrations is no more than 2 months.

49. The method of any one of claims 1-48, wherein the time between administrations is 1-2 days, 3-4 days, 5-7 days, 5-10 days, 7-10 days, 7-14 days, 10-14 days, 10-20 days, 14-21 days, 14-28 days, 21-28 days, or 21-34 days.

50. The method of any one of claims 1-159, wherein the time between administrations is about a day, e.g., about 24 hours.

51. The method of any one of claims 1-50, wherein the method further comprises a step of determining the expression level of the transgene after administering the inducer.

52. The method of any one of claim 1-51, wherein the method further comprises a step of determining the expression level of the transgene prior to administering the inducer.

53. The method of any one of claims 1-52, wherein the method further comprising administering the exogenous nucleotide sequence to the subject prior to administering the first or second inducer.

54. The method of any one of claims 1-53, wherein the method is a method of therapy, optionally, the method of therapy is a method of gene therapy.

55. The method of any one of claims 1-54, wherein the exogenous nucleotide sequence comprising the inducible promoter operably linked to a transgene is a viral vector.

56. The method of any one of claims 1-55, wherein the exogenous nucleotide sequence comprising the inducible promoter operably linked to a transgene is adeno-associated viral (AAV), lentiviral, adenoviral, herpes viral, or hepatitis viral vector.

57. The method of any one of claims 1-56, wherein the exogenous nucleotide sequence comprising the inducible promoter operably linked to a transgene is an AAV vector, e.g., an AAV gene therapy vector.

58. The method of any one of claims 1-57, wherein the inducers independently of other administrations are administered orally or intraperitoneally.

59. The method of any one of claims 1-58, wherein at least one of the inducers is administered orally.

60. The method of claim 59, wherein the second inducer is administered orally.

61. The method of claim 59, wherein the first inducer is administered orally.

62. The method of any one of claims 1-58, wherein at least one of the inducersis administered intraperitoneally.

63. The method of claim 62, wherein the second inducer is administered intraperitoneally.

64. The method of claim 62, wherein the first inducer is administered intraperitoneally.

65. The method of any one of claim 1-64, wherein the first induction increases the transgene expression level to a maximum at about 24 hrs and declines thereafter, and wherein the second induction and / or successive inductions has similar induction profile as seen with the first induction, for at least about 1 month, or at least about 2 months, or at least about 3 months, or at least about 5 months, or at least about six months, or longer.

66. The method of claim 65, wherein the transgene expression level at about 24 hrs after the first induction, or second induction, or successive inductions is at least about 200-fold higher than that of prior to administering the inducer for the first time, or, the second time, or, any number of successive administrations.

67. The method of claim 65, wherein the first induction, the second induction, and / or, the successive inductions are not complete until about 160 hours after administering the inducer.

68. The method of claim 65, wherein dose of the inducer in successive administrations is reduced from its prior administration.

69. The method of claim 65, wherein dose of the inducer in successive administrations remains same.

70. The method of claim 65, wherein the dose of the inducer ranges from about Img / kg to about 80mg / kg.

71. The method of claim 65, wherein the inducers are administered orally.

72. The method of claim 65, wherein the inducers are administered intraperitoneally.

73. A method of regulating expression of a transgene in a primate subject, the method comprising: administering an inducer to a primate subject, wherein the inducer is artemisinin, an artemisinin derivative or a flavonoid compound, wherein the primate subject comprises at least one cell comprising an exogenous nucleotide sequence comprising an inducible promoter operably linked to a transgene, wherein the inducible promoter comprises a PBREM enhancer, wherein the inducer is administered in an amount that is sufficient to express a measurable level of the transgene in the subject.

74. The method of claim 73, wherein the method comprises administering a plurality of doses of the inducer.

75. The method of claim 74, wherein the time between administrations is at least 12 hours, at least 24 hours, 48 hours, 72 hours, 1 week, 10 days, 2 weeks, 3 weeks, or 4 weeks.

76. The method of any one of claims 74-75, wherein the time between administrations is at least 24 hours, 48 hours, or 72 hours.

77. The method of any one of claims 74-76, wherein the time between administrations is no more than 2 months, 3 months, 4 months, 5 months, or 6 months.

78. The method of any one of claims 74-77, wherein the time between administrations is no more than 2 months.

79. The method of any one of claims 74-78, wherein the time between administrations is 1-3 days, 5-7 days, 5-10 days, 7-10 days, 7-14 days, 10-14 days, 10-20 days, 14-21 days, 14- 28 days, 21-28 days, or 21-34 days.

80. The method of any one of claims 74-79, wherein the time between administrations is about 1 day.

81. The method of any one of claims 74-80, wherein the transgene expression level at about 24 hrs after an induction is at least about 200-fold higher than that of prior to administering the inducer for the first time or any number of prior administrations.

82. The method of any one of claims 74-81, wherein an induction is not complete until about 160 hours after administering the inducer.

83. The method of any one of claims 74-82, wherein the transgene expression level increases to a maximum at about 24 hrs after the first administration and declines thereafter and a second induction, and / or successive inductions, has similar induction profile as seen with the first induction, for at least about 1 month, or at least about 2 months, or at least about 3 months, or at least about 5 months, or at least about six months, or longer,84. The method of any one of claims 74-83, wherein dose in successive administrations is reduced from a prior administration.

85. The method of any one of claims 74-84, wherein dose in successive administrations remains same.

86. The method of any one of claims 73-85, wherein the inducer is artemisinin or an artemisinin derivative.

87. The method of claim 86, wherein the artemisinin derivative is a compound of Formula (I), (I-A), (I-B), (I-C), (I-D), (I-E), (I-F), (I-G), (I-H), (I-I), (I- J), (I-K), (I-L), (I-M), (I-M’), (I- N), (I-N’), (I-O) or (I-O’).

88. The method of claim 86, wherein the derivative of artemisinin is artesunate, dihydroartemisinin, artesunate, or artemether.

89. The method of claim 88, wherein the derivative of artemisinin is artesunate, or dihydroartemisinin.

90. The method of claim 73-85, wherein the inducer is a flavonoid compound.

91. The method of claim 90, wherein the flavonoid compound is flavone, baicalein, chrysin, galangin, (OH)4 flavone, 6-hydroxyluteolin, acacetin, acerosin, alnetin, apigenin, apiin, artocarpetin, baicalein, beta-sitosterol, biochamin A, cannaflavin A, cannflavin A, cannflavin B, cannflavin C, catechin, catechin-3 -gallate, cerrosillin, chrysoeriol, chrysoeriol, cirsilineol, cirsiliol, cirsimaritin, corymbosin, cupressuflavone, cyanidine, daidzein, datiscetin, delphinidine, digidrokempferol , dihydroquercetin, diosmetin, diosmin, echioidinin, epicatechin, epicatechin-3 -gallate, epigallocatechin, epigallocatechin-3 -gallate, eriodiktiol, eupatilin, eupatorin, fisetin, fizetin, flavonol, formononetin, fortunelin, gallocatechin, gallocatechin-3 -gallate, gardenin D, genistein, genistin, genkwanin, geraldol, geraldone, glycitein, glycitin, gomoeriodiktiol, gossypetin, hesperetin, hinokiflavone, hispidulin, hymenoxin, hypolaetin, isoquercetin, isorhamnetin, isorhamnetin, isoscutellarein, isovitexin, jaceosidin, kaempferol, kaempferol, kampferide, largonidin, luteolin, luteolin, malvidine, mikanin, morin, myricetin, myricetin, naringenin, negletein, neodiosmin, nepetin, nevadensin, nobiletin, nodifloretin, norartocarpetin, norwogonin, onopordin, orientin, oroxylin a, pachipodol, pectolinarigenin, pedalitin, peonidin, petunidin, pilloin, pratol, primetin, primuletin, pruentin, quercetagetin, quercetin, ramnazin, rhoifolin, robinetin, rutin, scaposin, scutellarein, serpyllin, sinensetin, sorbifolin, sudachitin, tangeretin, tangeritin, taxifolin, tectochrysin, tithonine, tricetin, tricin, velutin, vitexin, wightin, wogonin, xanthomicrol, zapotin, zapotinin, 6,7,4’-trishydroxy isoflavone, or 7,3’4’-trihydroxy isoflavone; optionally, the flavonoid compound is flavone.

92. The method of any one of claims 73-91, wherein each dose is independently from about 0.5 mg / kg to about 150mg / kg.

93. The method of any one of claims 73-92, wherein each dose is independently from about 1 mg / kg to about 100 mg / kg.

94. The method of any one of claims 73-93, wherein each dose is independently from about 1 mg / kg to about 80 mg / kg.

95. The method of any one of claims 73-94, wherein each dose is independently from about 1 mg / kg to about 40 mg / kg.

96. The method of any one of claims 73-95, wherein each dose is independently from about 1 mg / kg to about 20 mg / kg.

97. The method of any one of claims 73-96, wherein each dose is independently from about 1 mg / kg to about 10 mg / kg.

98. The method of any one of claims 73-94, wherein each dose is independently about 80mg / kg, about 70mg / kg, about 60mg / kg, about 50mg / kg, about 40mg / kg, about 30mg / kg, about 20mg / kg, about lOmg / kg, about 6mg / kg, about 5mg / kg, or about 1 mg / kg.

99. The method of any one of claims 73-98, wherein the method further comprises administering the exogenous nucleotide sequence to the subject prior to administering the inducer for the first time.

100. The method of any one of claims 73-99, wherein a second inducer or, subsequent inducer is administered to the primate subject following the prior administration of an inducer to the primate subject, and optionally, the inducer of the prior administration is administered in an amount that is sufficient to express a measurable level of the transgene in the subject.

101. The method of claim 100, wherein the inducer of the prior administration is different from the second or subsequent inducer administered to the subject.

102. The method of claim 101, wherein the inducer of the prior administration is same as the second or, subsequent inducer administered to the subject but at a different dose.

103. The method of any one of claims 73-102, wherein the method is a method of therapy, optionally, the method of therapy is a method of gene therapy.

104. The method of any one of claims 73-103, wherein the exogenous nucleotide sequence comprising the inducible promoter operably linked to a transgene is a viral vector.

105. The method of any one of claims 73-104, wherein the exogenous nucleotide sequence comprising an inducible promoter operably linked to a transgene is adeno-associated viral (AAV), lentiviral, adenoviral, herpes viral, or hepatitis viral vector.

106. The method of any one of claims 73-105, wherein the exogenous nucleotide sequence comprising an inducible promoter operably linked to a transgene is an AAV vector, e.g., an AAV gene therapy vector.

107. The method of any one of claims 73-106, wherein each administration independently of other administrations is oral administration or intraperitoneal administration.

108. The method of any one of claims 73-107, wherein each administration is oral administration.

109. The method of any one of claims 73-107, wherein each administration is intraperitoneal administration.

110. The method of any one of claims 1-109, wherein the transgene encodes an antibody or antigen binding portion an antibody, a coagulation factor, a cytokine, a hormone, a growth factor, a virus protein, a cell receptor ligand, a chimeric antigen receptor (CAR) or a CRISPR-Cas nuclease.

111. The method of claim 110, wherein the transgene encodes an antibody or an antigen binding portion thereof, optionally the antibody is an anti-PDl antibody, anti-HER2 antibody, anti- PCSK9 antibody, anti-VEGFR2 antibody, anti-IL17 antibody, anti-A03-42 antibody, anti- Sema3A antibody, anti-4-lBB (CD137) antibody, anti-5'-nucleotidase antibody, anti-5T4antibody, anti-activin receptor-like kinase 1 antibody, anti-ACVR2B antibody, anti- adenocarcinoma antigen antibody, anti-amyloid antibody, anti-Ang-2 antibody, anti- angiopoietin 2 antibody, anti-angiopoietin 2 antibody, anti-angiopoietin 3 antibody, anti- anthrax toxin antibody, anti-AOC3 (VAP-1) antibody, anti-AXL antibody, anti-BAFF-R antibody, anti-B-cell activating factor (BAFF) antibody, anti-B-cell maturation antigen (BCMA) antibody, anti-B-lymphoma cell antibody, anti-C242 antigen antibody, anti-C5 antibody, anti-C5a receptor (C5a) antibody, anti-CA-125 antibody, anti-calcitonin antibody, anti-calcitonin gene-related peptide alpha antibody, anti-calcitonin gene-related peptide beta antibody, anti-calcitonin gene-related peptide receptor (CGRP) antibody, anti- CanAg (a glycoform of MUC1) antibody, anti-carbonic anhydrase 9 (CA-IX) antibody, anti-Carcinoembryonic antigen (CEA) antibody, anti-Carcinoembryonic antigen (CEA)- related antigen antibody, anti-cardiac myosin antibody, anti-CCLl l antibody, anti-CCR2 antibody, anti-CCR4 antibody, anti-CCR5 antibody, anti-CCR5 antibody, anti-CDl l antibody, antibody, anti-CD123 antibody, anti-CD125 antibody, anti-CD134 antibody, anti-CD134 antibody, anti-CD147 antibody, anti-CD15 antibody, anti-CD152 antibody, anti-CD154 antibody, anti-CD18 antibody, anti-CD19 antibody, anti-CD2 antibody, anti- CD20 antibody, anti-CD20 antibody, anti-CD20 antibody, anti-CD200 antibody, anti- CD22 antibody, anti-CD23 antibody, anti-CD25 antibody, anti-CD27 antibody, anti- CD276 antibody, anti-CD278 antibody, antibody, anti-CD279 antibody, anti-CD28 antibody, anti-CD3 antibody, anti-CD3 antibody, anti-CD3 antibody, anti-CD3 antibody, anti-CD3 antibody, anti-CD30 antibody, anti-CD319 antibody, anti-CD33 antibody, anti- CD37 antibody, anti-CD38 antibody, anti-CD3E antibody, anti-CD3E antibody, anti-CD4 antibody, anti-CD40 antibody, anti-CD41 antibody, anti-CD44 antibody, anti-CD45 antibody, anti-CD5 antibody, anti-CD51 antibody, anti-CD52 antibody, anti-CD56 antibody, anti-CD6 antibody, anti-CD70 antibody, anti-CD74 antibody, anti-CD79B antibody, anti-CD80 antibody, anti-CEACAM5 antibody, anti-Claudin 18 Isoform 2 antibody, anti-clumping factor A antibody, anti-cMet antibody, anti-c-Met antibody, anti- coagulation factor III antibody, anti-complement C5a antibody, anti-complement component Is (Cis) antibody, anti-Complement factor D (CFD) antibody, anti-connective tissue growth factor (CTGF) antibody, anti-CSFl antibody, antibody, anti-CSFIR antibody, anti-CSF2 antibody, anti-CTLA-4 antibody, anti-CXCLIO (IP-10) antibody, anti- CXCR4 (CD 184) antibody, anti-dabigatran antibody, anti-dendritic cell-associated lectin 2 antibody, anti-DLL3 antibody, anti-DLL4 antibody, anti-DPP4 antibody, anti-DR5 antibody, anti-EGFL7 antibody, anti-EGFR antibody, anti-EGFR antibody, anti-EGFR antibody, anti-EGFR extracellular domain III antibody, anti-endoglin antibody, anti-endotoxin antibody, anti-EpCAM antibody, anti-EPHA3 antibody, anti-ephrin receptor A3 antibody, anti-episialin antibody, anti-ERBBl antibody, anti-ERBB3 (HER3) antibody, anti-FAP (gene) (FAP) antibody, anti-FCGRT antibody, anti-FGF 23 antibody, anti- FGFR2 antibody, anti-FGFR2 antibody, anti-fibrin II antibody, anti-fibronectin extra domain-B antibody, anti-folate hydrolase antibody, anti-folate receptor 1 antibody, anti- folate receptor alpha antibody, anti-Frizzled receptor antibody, anti-FVIX antibody, anti- FVX antibody, anti-GD2 ganglioside antibody, anti-GD3 ganglioside antibody, anti-GDF- 8 antibody, anti-gelatinase B antibody, anti-glucagon receptor (GCGR) antibody, anti- Glutamate carboxypeptidase II antibody, anti-glypican 3 antibody, anti-GMCSF antibody, anti-GPNMB antibody, anti-GPRC5D antibody, antibody, anti-growth differentiation factor 8 antibody, anti-GUCY2C antibody, anti -Hepatocyte growth factor (HGF) antibody, anti-HERl antibody, anti-HERl antibody, anti-HERl antibody, anti-HER2 / neu antibody, anti-HGFR antibody, anti-histone complex antibody, anti-HLA-DR antibody, anti-Hsp90 antibody, anti -human scatter factor receptor kinase antibody, anti-ICAM-1 (CD54) antibody, anti-IFN receptor antibody, anti-IFN-a antibody, anti-IFN-a / p receptor antibody, anti-IFN-y antibody, anti-IgE antibody, anti-IgE Fc region antibody, anti-IGF-1 receptor (CD221) antibody, anti-IGF-2 antibody, anti-IGHE antibody, anti-IL-1 antibody, anti-IL- 12 antibody, anti-IL-13 antibody, anti-IL-17A antibody, anti-IL-17AF antibody, anti-IL- 17F antibody, anti-IL-la antibody, anti-IL-ip antibody, anti -IL-2 antibody, anti -IL-20 antibody, anti-IL-22 antibody, anti-IL-23 antibody, anti-IL-23 antibody, anti-IL-23 antibody, anti-IL-23 antibody, anti-IL-23 antibody, anti-IL-23A antibody, anti-IL-3 receptor antibody, anti-IL-31 receptor A antibody, anti-IL-4 antibody, anti-IL-4Ra antibody, anti-IL-5 antibody, anti-IL-6 antibody, anti-IL-6 receptor antibody, anti-IL-9 antibody, anti-inducible T-cell co-stimulatory ligand (ICOSL) antibody, anti-integrin a4 antibody, anti-integrin P7 antibody, anti-integrin a4 P7 antibody, anti-integrin a4 P7 antibody, anti-integrin a5pi antibody, anti-integrin allbp3 antibody, anti-integrin avP3 antibody, anti-Interleukin 36 receptor (IL1RL2 / IL1RAP) antibody, anti-ITGA2 (CD49b) antibody, anti-ITGB2 (CD18) antibody, anti-kallikrein antibody, anti-KIR2D antibody, anti-LAG3 antibody, anti-Lewis-Y antigen antibody, anti-LFA-1 (CD 11 a) antibody, anti- LINGO-1 antibody, anti-lipoteichoic acid antibody, anti-LIV-1 antibody, anti-L0XL2 antibody, anti-LRRC15 antibody, anti-L-selectin (CD62L) antibody, anti-lymphotoxin alpha (LTA) antibody, anti-LYPD3 antibody, anti -macrophage colony stimulating factor (MCSF) antibody, anti -macrophage migration inhibitory factor (MIF) antibody, anti- MASP-2 antibody, anti-MCP-1 antibody, anti-melanoma cell adhesion molecule (MCAM) antibody, anti-mesothelin antibody, anti-MS4Al antibody, antibody, anti-MSTIRantibody, anti-MUCl antibody, anti-MUC5AC antibody, anti-mucosal addressin cell adhesion molecule antibody, anti-myelin-associated glycoprotein antibody, anti-myostatin antibody, anti-NCA-90 (granulocyte antigen) antibody, anti-nectin-4 antibody, anti-nerve growth factor (NGF) antibody, anti-NGNA ganglioside antibody, anti-NKG2A antibody, anti-NOGO-A antibody, anti-Notch 1 antibody, anti-Notch receptor antibody, anti-NRPl antibody, anti-OX-40 antibody, anti-oxLDL antibody, anti-PCDCl antibody, anti-PCDPl antibody, anti-PDGFRA antibody, anti-PDGFRB antibody, anti-PD-Ll antibody, anti- phosphate-sodium co-transporter antibody, anti-phosphatidylserine antibody, anti-PTK7 antibody, anti-RANKL antibody, anti-repulsive guidance molecule A (RGMA) antibody, anti-RHD (gene) (RHD) antibody, anti-Rhesus factor antibody, anti-Rhesus factor antibody, anti-root plate-specific spondin 3 antibody, anti-RORl antibody, anti-RTN4 antibody, anti-sclerostin antibody, anti-sclerostin (SOST) antibody, anti-SDCl antibody, anti-selectin P antibody, anti-serum amyloid A protein antibody, anti-serum amyloid P component antibody, anti-SLAMF7 antibody, anti-SLITRK6 antibody, anti-SOST antibody, anti-sphingosine-1 -phosphate antibody, anti-STEAPl antibody, anti-TAG-72 antibody, anti-TAG-72 antibody, anti-tau protein antibody, anti-T-cell receptor antibody, anti-TEMl antibody, anti-tenascin C antibody, anti-TGF-P antibody, anti-TGF-pi antibody, anti-TGF-P2 antibody, anti-thymic stromal lymphopoietin (TSLP) antibody, anti- TIGIT antibody, anti-tissue factor pathway inhibitor (TFPI) antibody, anti-TNF antibody, anti-TNF antibody, anti-TNF-a antibody, anti-TNF-a antibody, anti-TRAIL-Rl antibody, anti-TRAIL-R2 antibody, anti-TROP-2 antibody, anti-tumor antigen CTAA16.88 antibody, anti-tumor necrosis factor receptor (TNFR) antibody, anti-tumor necrosis factor related activation protein (TRAP) antibody, anti-Tumor-associated glycoprotein 72 (TAG- 72) antibody, anti-TWEAK receptor antibody, anti-TYRPl (glycoprotein 75) antibody, anti-vascular endothelial growth factor A (VEGFA) antibody, anti-VEGFA antibody, anti- VEGFR-1 antibody, anti-vimentin antibody, anti -VISTA (protein) (VSIR) antibody, anti- VWF antibody, anti-a-fetoprotein antibody, anti-A-synuclein antibody or anti-P-amyloid antibody, optionally the antibody is selected from the group consisting of an anti-TNFα, anti-PDl antibody, anti-HER2 antibody, anti-PCSK9 antibody, anti-VEGFR2 antibody, anti-IL17 antibody, anti-Ap3-42 antibody, and anti-Sema3A antibody.

112. The method of claim 110, wherein the transgene encodes an antibody or an antigen binding portion thereof, and wherein the antibody is selected from the group consisting 3F8, Abagovomab, Abciximab, Abituzumab, Abrezekimab, Abrilumab, Actoxumab, Adalimumab, Adecatumumab, Aducanumab, Afasevikumab, Afelimomab, Alacizumab pegol, Alemtuzumab, Alirocumab, Altumomab pentetate, Amatuximab, Amivantamab,Anatumomab mafenatox, Andecaliximab, Anetumab ravtansine, Anifrolumab, Ansuvimab, Anrukinzumab, (IMA-638), Apolizumab, Aprutumab ixadotin, Arcitumomab, Ascrinvacumab, Aselizumab, Atezolizumab, Atidortoxumab, Atinumab, Atoltivimab, Atoltivimab / maftivimab / odesivimab, Atorolimumab, Avelumab, Azintuxizumab vedotin, Bamlanivimab, Bapineuzumab, Basiliximab, Bavituximab, BCD- 100, Bebtelovimab, Bectumomab, Bedinvetmab, Begelomab, Belantamab mafodotin, Belimumab, Bemarituzumab, Benralizumab, Berlimatoxumab, Bermekimab, Bersanlimab, Bertilimumab, Besilesomab, Bevacizumab, Bezlotoxumab, Biciromab, Bimagrumab, Bimekizumab, Birtamimab, Bivatuzumab, Bleselumab, Blinatumomab, Blontuvetmab, Blosozumab, Bococizumab, Brazikumab, Brentuximab vedotin, Briakinumab, Brodalumab, Brolucizumab, Brontictuzumab, Burosumab, Cabiralizumab, Camidanlumab tesirine, Camrelizumab, Canakinumab, Cantuzumab mertansine, Cantuzumab ravtansine, Caplacizumab, Casirivimab, Capromab, Carlumab, , Carotuximab, Catumaxomab, cBR96- doxorubicin immunoconjugate, Cedelizumab, Cemiplimab, Cergutuzumab amunaleukin, Certolizumab pegol, Cetrelimab, Cetuximab, Cibisatamab, Cilgavimab, Cirmtuzumab, Citatuzumab bogatox, Cixutumumab, Clazakizumab, Clenoliximab, Clivatuzumab tetraxetan, Codrituzumab, Cofetuzumab pelidotin, Coltuximab ravtansine, Conatumumab, Concizumab, Cosfroviximab, Crenezumab, Crizanlizumab, Crotedumab, CR6261, Cusatuzumab, Dacetuzumab, Daclizumab, Dalotuzumab, Dapirolizumab pegol, Daratumumab, Dectrekumab, Demcizumab, Denintuzumab mafodotin, Denosumab, Depatuxizumab mafodotin, Derlotuximab biotin, Detumomab, Dezamizumab, Dinutuximab, Dinutuximab beta, Diridavumab, Domagrozumab, Donanemab, Dorlimomab aritox, Dostarlimab, Drozitumab, DS-8201, Duligotuzumab, Dupilumab, Durvalumab, Dusigitumab, Duvortuxizumab, Ecromeximab, Eculizumab, Edobacomab, Edrecolomab, Efalizumab, Efungumab, Eldelumab, Elezanumab, Elgemtumab, Elotuzumab, Elsilimomab, Emactuzumab, Emapalumab, Emibetuzumab, Emicizumab, Enapotamab vedotin, Enavatuzumab, Enfortumab vedotin, Enlimomab pegol, Enoblituzumab, Enokizumab, Enoticumab, Ensituximab, Epcoritamab, Epitumomab cituxetan, Epratuzumab, Eptinezumab, Erenumab, Erlizumab, Ertumaxomab, Etaracizumab, Etesevimab, Etigilimab, Etrolizumab, Evinacumab, Evolocumab, Exbivirumab, Fanolesomab, Faralimomab, Faricimab, Farletuzumab, Fasinumab, FBTA05, Felvizumab, Fezakinumab, Fibatuzumab, Ficlatuzumab, Figitumumab, Firivumab, Flanvotumab, Fletikumab, Flotetuzumab, Fontolizumab, Foralumab, Foravirumab, Fremanezumab, Fresolimumab, Frovocimab, Frunevetmab, Fulranumab, Futuximab, Galcanezumab, Galiximab, Gancotamab, Ganitumab, Gantenerumab,Gatipotuzumab, Gavilimomab, Gedivumab, Gemtuzumab ozogamicin, Gevokizumab, Gilvetmab, Gimsilumab, Girentuximab, Glembatumumab vedotin, Glofitamab, Golimumab, Gomiliximab, Gosuranemab, Guselkumab, lanalumab, Ibalizumab, Sintilimab, Ibritumomab tiuxetan, Icrucumab, Idarucizumab, Ifabotuzumab, Igovomab, Iladatuzumab vedotin, Imalumab, Imaprelimab, Imciromab, Imdevimab, Imgatuzumab, Inclacumab, Indatuximab ravtansine, Indusatumab vedotin, Inebilizumab, Infliximab, Intetumumab, Inolimomab, Inotuzumab ozogamicin, Ipilimumab, lomab-B, Iratumumab, Isatuximab, Iscalimab, Istiratumab, Itolizumab, Ixekizumab, Keliximab, Labetuzumab, Lacnotuzumab, Ladiratuzumab vedotin, Lampalizumab, Lanadelumab, Landogrozumab, Laprituximab emtansine, Larcaviximab, Lebrikizumab, Lecanemab, Lemalesomab, Lendalizumab, Lenvervimab, Lenzilumab, Lerdelimumab, Leronlimab, Lesofavumab, Letolizumab, Lexatumumab, Libivirumab, Lifastuzumab vedotin, Ligelizumab, Loncastuximab tesirine, Losatuxizumab vedotin, Lilotomab satetraxetan, Lintuzumab, Lirilumab, Lodelcizumab, Lokivetmab, Lorvotuzumab mertansine, Lucatumumab, Lulizumab pegol, Lumiliximab, Lumretuzumab, Lupartumab, Lupartumab amadotin, Lutikizumab, Maftivimab, Mapatumumab, Margetuximab, Marstacimab, Maslimomab, Mavrilimumab, Matuzumab, Mepolizumab, Metelimumab, Milatuzumab, Minretumomab, Mirikizumab, Mirvetuximab soravtansine, Mitumomab, Modotuximab, Mogamulizumab, Monalizumab, Morolimumab, Mosunetuzumab, Motavizumab, Moxetumomab pasudotox, Muromonab-CD3, Nacolomab tafenatox, Namilumab, Naptumomab estafenatox, Naratuximab emtansine, Namatumab, Natalizumab, Navicixizumab, Navivumab, Naxitamab, Nebacumab, Necitumumab, Nemolizumab, NEODOO 1, Nerelimomab, Nesvacumab, Netakimab, Nimotuzumab, Nirsevimab, Nivolumab, Nofetumomab merpentan, Obiltoxaximab, Obinutuzumab, Ocaratuzumab, Ocrelizumab, Odesivimab, Odulimomab, Ofatumumab, Olaratumab, Oleclumab, Olendalizumab, Olokizumab, Omalizumab, Omburtamab, OMS721, Onartuzumab, Ontuxizumab, Onvatilimab, Opicinumab, Oportuzumab monatox, Oregovomab, Orticumab, Otelixizumab, Otilimab, Otlertuzumab, Oxelumab, Ozanezumab, Ozoralizumab, Pagibaximab, Palivizumab, Pamrevlumab, Panitumumab, Pankomab, Panobacumab, Parsatuzumab, Pascolizumab, Pasotuxizumab, Pateclizumab, Patritumab, PDR001, Pembrolizumab, Pemtumomab, Perakizumab, Pertuzumab, Pexelizumab, Pidilizumab, Pinatuzumab vedotin, Pintumomab, Placulumab, Pozelimab, Prezalumab, Plozalizumab, Pogalizumab, Polatuzumab vedotin, Ponezumab, Porgaviximab, Prasinezumab, Prezalizumab, Priliximab, Pritoxaximab, Pritumumab, PRO 140, Quilizumab, Racotumomab, Radretumab, Rafivirumab, Ralpancizumab, Ramucirumab, Ranevetmab, Ranibizumab, Raxibacumab, Ravagalimab,Ravulizumab, Refanezumab, Regavirumab, Regdanvimab, Relatlimab, Remtolumab, Reslizumab, Retifanlimab, Rilotumumab, Rinucumab, Risankizumab, Rituximab, Rivabazumab pegol, Robatumumab, Rmab, Roledumab, Romilkimab, Romosozumab, Rontalizumab, Rosmantuzumab, Rovalpituzumab tesirine, Rovelizumab, Rozanolixizumab, Ruplizumab, SA237, Sacituzumab govitecan, Samalizumab, Samrotamab vedotin, Sarilumab, Satralizumab, Satumomab pendetide, Secukinumab, Selicrelumab, Seribantumab, Setoxaximab, Setrusumab, Sevirumab, Sibrotuzumab, SGN- CD19A, SHP647, Sifalimumab, Siltuximab, Simtuzumab, Siplizumab, Sirtratumab vedotin, Sirukumab, Sofituzumab vedotin, Solanezumab, Solitomab, Sonepcizumab[104], Sontuzumab, Sotrovimab, Spartalizumab, Spesolimab[107], Stamulumab, Sulesomab, Suptavumab, Sutimlimab, Suvizumab, Suvratoxumab, Tabalumab, Tacatuzumab tetraxetan, Tadocizumab, Tafasitamab, Talacotuzumab, Talizumab, Talquetamab, Tamtuvetmab, Tanezumab, Taplitumomab paptox, Tarextumab, Tavolimab, Teclistamab, Tefibazumab, Telimomab aritox, Telisotuzumab, Telisotuzumab vedotin, Tenatumomab, Teneliximab, Teplizumab, Tepoditamab, Teprotumumab, Tesidolumab, Tetulomab, Tezepelumab, TGN1412, Tibulizumab, Tildrakizumab, Tigatuzumab, Timigutuzumab, Timolumab, tiragolumab, Tiragotumab, Tislelizumab, Tisotumab vedotin, Tixagevimab, TNX-650, Tocilizumab, Tomuzotuximab, Toralizumab, Tosatoxumab, Tositumomab, Tovetumab, Tralokinumab[115], Trastuzumab, Trastuzumab duocarmazine, Trastuzumab emtansine, TRBS07[117], Tregalizumab, Tremelimumab[118], Trevogrumab, Tucotuzumab celmoleukin, Tuvirumab, Ublituximab[120], Ulocuplumab, Urelumab, Urtoxazumab, Ustekinumab, Utomilumab, Vadastuximab talirine, Vanalimab, Vandortuzumab vedotin, Vantictumab, Vanucizumab, Vapaliximab, Varisacumab, Varlilumab, Vatelizumab, Vedolizumab, Veltuzumab, Vepalimomab, Vesencumab, Vilobelimab, Visilizumab, Vobarilizumab, Volociximab, Vonlerolizumab, Vopratelimab, Vorsetuzumab mafodotin, Votumumab, Vunakizumab, Xentuzumab, XMAB-5574, Zalutumumab, Zanolimumab, Zatuximab, Zenocutuzumab, Ziralimumab, Zolbetuximab, and Zolimomab aritox.

113. The method of claim 110, wherein the transgene encodes a coagulation factor, optionally the coagulation factor is Factor VIII, Factor IX, Factor VII, Factor X, or Factor XI, preferably the coagulation factor is Factor VIII or Factor IX.

114. The method of claim 110, wherein the transgene encodes a hormone, optionally the hormone is selected from the group consisting of selected from erythropoietin (EPO), parathyroid hormone (PTH), adiponectin , adrenaline (or epinephrine), adrenocorticotropic hormone (ACTH or corticotropin), adropin, aldosterone, amylin (or islet amyloidpolypeptide), androstenedione, angiotensin, angiotensinogen, antidiuretic hormone (or vasopressin), anti-mullerian hormone (or mullerian-inhibiting factor / hormone), arginine vasopressin), atrial natriuretic peptide (ANP or atriopeptin), brain natriuretic peptide, calcitonin, calcitriol, cholecystokinin (CCK), corticotropin-releasing hormone, cortisol, cortistatin, dehydroepiandrosterone, dihydrotestosterone, dopamine, endothelin, enkephalin, estradiol, estriol, estrone, follicle-stimulating hormone (FSH), galanin, gastric inhibitory polypeptide, gastrin, ghrelin, glucagon, glucagon-like peptide- 1, gonadotropin- releasing hormone, growth hormone, growth hormone-releasing hormone, guanylin, hepcidin, human chorionic gonadotropin, human placental lactogen, inhibin, insulin, insulin-like growth factor (or somatomedin), leptin, leukotrienes, lipotropin, luteinizing hormone (LH), melanocyte stimulating hormone (MSH), melatonin, motilin, noradrenaline (or norepinephrine), orexin, osteocalcin, oxytocin (or pitocin), pancreatic polypeptide, pituitary adenylate cyclase-activating peptide, progesterone, prolactin (or leuteotropic hormone), prolactin-releasing hormone, prostacyclin, prostaglandins, relaxin, renin, secretin, somatostatin (or growth hormone-inhibiting hormone or growth hormone releaseinhibiting hormone or somatotropin release-inhibiting factor or somatotropin releaseinhibiting hormone), testosterone, thrombopoietin, thromboxane, thyroid-stimulating hormone (TSH or thyrotropin), thyrotropin-releasing hormone (TRH), thyroxine, triiodothyronine, uroguanylin, vasoactive intestinal peptide (VIP), or vasopressin, more optionally, the hormone is erythropoietin (EPO) and parathyroid hormone (PTH).

115. The method of claim 110, wherein the transgene encodes a growth factor, optionally, the growth factor is tumor necrosis factor-alpha (TNF-a), adrenomedullin (AM), angiopoietin (Ang), autocrine motility factor, bone morphogenetic protein (BMP), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), colony-stimulating factor (e.g., macrophage colony-stimulating factor (M-CSF), granulocyte colony-stimulating factor (G- CSF), or granulocyte macrophage colony-stimulating factor (GM-CSF)), epidermal growth factor (EGF), ephrin (e.g., ephrin Al, ephrin A2, ephrin A3, ephrin A4, ephrin A5, ephrin Bl, ephrin B2, or ephrin B3), erythropoietin (EPO), fibroblast growth factor (e.g., FGF1, FGF2, FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9, FGF10, FGF11, FGF12, FGF13, FGF14, FGF15, FGF16, FGF17, FGF18, FGF19, FGF20, FGF21, FGF22 or FGF23), glial cell line-derived neurotrophic factor (GDNF), neurturin, persephin, artemin, growth differentiation factor-9 (GDF9), hepatocyte growth factor (HGF), hepatoma- derived growth factor (HDGF), insulin-like growth factor (e.g., IGF-1 or IGF-2), interleukin (e.g., IL-1, IL-2, IL-3, IL-4, IL-5, IL-6 or IL-7), keratinocyte growth factor (KGF), migration-stimulating factor (MSF), macrophage-stimulating protein (MSP),myostatin (GDF-8), neuregulin (e.g., NRG1, NRG3, NRG3 or NRG4), neurotrophin (e.g., brain-derived neurotrophic factor (BDNF), nerve growth factor (NGF), neurotrophin-3 (NT-3) or neurotrophin-4 (NT-4)), placental growth factor (PGF), platelet-derived growth factor (PDGF), renalase (RNLS), T-cell growth factor (TCGF), thrombopoietin (TPO), transforming growth factor (e.g., TGF-a or TGF-0), or vascular endothelial growth factor (VEGF).

116. The method of claim 110, the transgene encodes a CRISPR-Cas nuclease, optionally selected from the group consisting of Cas9, Cast 2, Cas Phi, CasX, and CasRx.

117. The method of claim 110, wherein the transgene encodes a cytokine, optionally, the cytokine is interleukin-la (IL-la), interleukin-1 / 3 (IL-1 / 3), interleukin-2 (IL-2), interleukin- 4 (IL-4), interleukin-5 (IL-5), interleukin-6 (IL-6), interleukin-7 (IL-7), interleukin-8 (IL- 8 / CXCL8), interleukin- 10 (IL- 10), interleukin- 12 (IL- 12), interleukin- 13 (IL- 13), interleukin- 15 (IL-15), interleukin- 17 (IL-17), interleukin- 18 (IL-18), interleukin-37 (IL- 37), interleukin-38 (IL-38), tumor necrosis factor-a (TNF-a), interferon-a (INF-a), interferon-b (INF-b), interferon-y (INF-y), granulocyte- monocyte colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), monocyte chemoattractant protein- 1 (MCP-1 / CCL2), macrophage inflammatory protein Let (MCP- 1 / CCL3), macrophage inflammatory protein-1 / 3, RANTES (CCL5), Eotaxin (CCL11), variable endothelial growth factor (VEGF), endothelial growth factor (EGF), or fibroblast growth factor (FGF). In some embodiments, the transgene encodes IL-2. In some embodiments, the transgene encodes IL-37. In some embodiments, the transgene encodes IL-38.

118. The method of claim 110, wherein the transgene encodes a virus protein, optionally selected from the group consisting of viral envelop protein, viral nucleocapsid protein, viral membrane protein, REP, CAP, REV, VSV-G and RD114119. The method of any one of clams 1-110, wherein the transgene is detrimental to the cell or to the subject when constitutively expressed.

120. The method of any one of claims 1-119, wherein the subject is a non-human primate.

121. The method of any one of claims 1-120, wherein the subject is a human.

122. The method of any one of claims 1-121, wherein the cell comprising the cell comprising the exogenous nucleotide sequence is a liver cell.

123. A first and at least a second inducer for use in a method of regulating expression of a transgene in a primate subject, the method comprising:(a) administering to the subject at a first time point a first inducer, wherein the primate subject comprises at least one cell comprising an exogenous nucleotide sequence comprising an inducible promoter operably linked to a transgene, wherein the inducible promoter comprises a PBREM enhancer, wherein the first inducer is artemisinin, a derivative of artemisinin or a flavonoid compound, and wherein the first dose comprises an amount of the inducer that is sufficient to express a measurable level of the transgene in the subject; and(b) administering to the subject at least at a second time point a second inducer to continue expression of the transgene at a predetermined level for a predetermined time or to modulate expression of the transgene to a predetermined level, and wherein the second inducer is artemisinin; derivative of artemisinin; a flavonoid compound, e.g. flavone, chrysin, baicalein, or galangin; l,4-Bis[2-(3,5- dichloropyridyloxy)]benzene (TCPOBOP); phenobarbital (PB); 6-(4Chlorophenyl)imidazo[2,l-b][l,3]thiazole-5-carbaldehyde-O-(3,4- dichlorobenzyljoxime (CITCO); Acetaminophen; Buprenorphine; Phenytoin; Carbamazepine; Valproic Acid; Chlorpromazine; Efavirenz; Nevirapine; Rilpivirine; Etravirine; Diazepam; Cyclophosphamid; Ifosfamide; Cerivastatin; Simvastatin; lovastatin; substituted sulphonamides; Thiazolidin-4-one; Estradiol; Estrone and analogues; 17a-ethinyl-3;17fi-estradiol (EE2); Dehydroepiandrost erone (DHEA); 513- pregnane-3, 20-dione; Di ethylstilbestrol; Gingko biloba extract; Galangin; chrysin; baicalein; Diallyl sulphide; Ellagic acid; Resveratrol; Squalestatin-1; Bilobalide; Triclocarban; Triclosan; Dichlorodiphenyltrichloroethane (DDT); Dieldrin; Methoxychlor; Metofluthrin; Permethrin; Pyrethrins; Sulfoxaflor; Diethylhexyl phthalate (DEHP); Cyproconazole; Fluconazole; Propiconazole; FL81; Tri-p- methylphenyl phosphate (TMPP); UM104; or UM145.

124. The first and at least a second inducer for use according to claim 123, wherein the method is according to any one of claims 1 to 122.

125. The first and at least a second inducer for use according to claim 123 or 124, which is a method of therapy, suitably a method of gene therapy.

126. The first and at least a second inducer for use according to any one of claims 123-125, wherein the exogenous nucleotide sequence comprising an inducible promoter operably linked to a transgene is an AAV gene therapy vector.

127. Artemisinin or a derivative of artemisinin, for use as an inducer in a method of regulating expression of a transgene in a primate subject, wherein the primate subject comprises atleast one cell comprising an exogenous nucleotide sequence comprising an inducible promoter operably linked to a transgene, wherein the inducible promoter comprises a PBREM enhancer, wherein the inducer is administered to the subject at a dose which comprises an amount of the inducer that is sufficient to express a therapeutically effective level of the transgene in the subject.

128. Artemisinin or a derivative of artemisinin for use according to claim 127, wherein the method is a method of therapy, suitably a method of gene therapy.

129. Artemisinin or a derivative of artemisinin for use according to claim 127 or 128, wherein the artemisinin derivative is a compound as defined in claim 2, optionally wherein the artemisinin derivative is of Formula (I), (I- A), (I-B), (I-C), (I-D), (I-E), (I-F), (I-G), (I-H), (I-I), (I- J), (I-K), (I-L), (I-M), (I-M’), (I-N), (I-N’), (I-O) or (I-O’).

130. Artemisinin or a derivative of artemisinin for use according to any one of claims 127-129, wherein the derivative of artemisinin is artesunate, dihydroartemisinin, artesunate, or artemether.

131. Artemisinin or a derivative of artemisinin for use according to any one of claims 127-130, wherein artemisinin or a derivative of artemisinin is administered to the primate subject following the prior administration of an inducer to the primate subject.

132. Artemisinin or a derivative of artemisinin for use according to claim 131, wherein the inducer of the prior administration was a different inducer, or wherein the inducer of the prior administration was the same inducer but at a different dose.

133. Artemisinin or a derivative of artemisinin for use according to any one of claims 127-132, wherein the exogenous nucleotide sequence comprising an inducible promoter operably linked to a transgene is an AAV gene therapy vector.

134. Artemisinin or a derivative of artemisinin for use according to any one of claims 127 to 133, wherein the method comprises prior administration of the exogenous nucleotide sequence to the subject prior to administering the inducer.

135. Artemisinin or a derivative of artemisinin for use according to any one of claims 127-134, wherein the artemisinin or a derivative of artemisinin is administered at a dose of from about 0. Img / kg to 80mg / kg, from about 0. Img / kg to about 70mg / kg, from about 0. Img / kg to about 60mg / kg, from about 0. Img / kg to about 50mg / kg, from about 0. Img / kg to about 40mg / kg, from about 0. Img / kg to about 30mg / kg, from about 0. Img / kg to about 20mg / kg, from about 0. Img / kg to about lOmg / kg, from about 0. Img / kg to about 6mg / kg, from about 0. Img / kg to about 5mg / kg, or from about 0. Img / kg to about Img / kg.

136. Artemisinin or a derivative of artemisinin for use according to any one of claims 127-135, wherein the inducer comprising artemisinin or a derivative of artemisinin is administered orally, optionally wherein the composition comprises artesunate.

137. A flavonoid compound, for use as an inducer in a method of regulating expression of a transgene in a primate subject, wherein the primate subject comprises at least one cell comprising an exogenous nucleotide sequence comprising an inducible promoter operably linked to a transgene, wherein the inducible promoter comprises a PBREM enhnacer, wherein the inducer is administered to the subject at a dose which comprises an amount of the inducer that is sufficient to express a therapeutically effective level of the transgene in the subject.

138. Flavonoid compound for use according to claim 137, wherein the method is a method of therapy, suitably a method of gene therapy.

139. Flavonoid compound for use according to claim 137 or 138, wherein the flavonoid compound is flavone, baicalein, chrysin, galangin, (OH)4 flavone, 6-hydroxyluteolin, acacetin, acerosin, alnetin, apigenin, apiin, artocarpetin, baicalein, beta-sitosterol, biochamin A, cannaflavin A, cannflavin A, cannflavin B, cannflavin C, catechin, catechin- 3 -gallate, cerrosillin, chrysoeriol, chrysoeriol, cirsilineol, cirsiliol, cirsimaritin, corymbosin, cupressuflavone, cyanidine, daidzein, datiscetin, delphinidine, digidrokempferol , dihydroquercetin, diosmetin, diosmin, echioidinin, epicatechin, epicatechin-3 -gallate, epigallocatechin, epigallocatechin-3 -gallate, eriodiktiol, eupatilin, eupatorin, fisetin, fizetin, flavonol, formononetin, fortunelin, gallocatechin, gallocatechin- 3 -gallate, gardenin D, genistein, genistin, genkwanin, geraldol, geraldone, glycitein, glycitin, gomoeriodiktiol, gossypetin, hesperetin, hinokiflavone, hispidulin, hymenoxin, hypolaetin, isoquercetin, isorhamnetin, isorhamnetin, isoscutellarein, isovitexin, jaceosidin, kaempferol, kaempferol, kampferide, largonidin, luteolin, luteolin, malvidine, mikanin, morin, myricetin, myricetin, naringenin, negletein, neodiosmin, nepetin, nevadensin, nobiletin, nodifloretin, norartocarpetin, norwogonin, onopordin, orientin, oroxylin a, pachipodol, pectolinarigenin, pedalitin, peonidin, petunidin, pilloin, pratol, primetin, primuletin, pruentin, quercetagetin, quercetin, ramnazin, rhoifolin, robinetin, rutin, scaposin, scutellarein, serpyllin, sinensetin, sorbifolin, sudachitin, tangeretin, tangeritin, taxifolin, tectochrysin, tithonine, tricetin, tricin, velutin, vitexin, wightin, wogonin, xanthomicrol, zapotin, zapotinin, 6,7,4’-trishydroxy isoflavone, or 7,3’4’- trihydroxy isoflavone.

140. Flavonoid compound for use according to any one of claims 137-139, wherein the flavonoid compound is flavone141. Flavonoid compound for use according to any one of claims 137-140, wherein the flaovonoid compound is administered to the primate subject following the prior administration of an inducer to the primate subject.

142. Flavonoid compound for use according to claim 141, wherein the inducer of the prior administration was a different inducer, or wherein the inducer of the prior administration was the same inducer but at a different dose.

143. Flavonoid compound for use according to any one of claims 137-142, wherein the exogenous nucleotide sequence comprising an inducible promoter operably linked to a transgene is an AAV gene therapy vector.

144. Flavonoid compound for use according to any one of claims 137-143, wherein the method comprises prior administration of the exogenous nucleotide sequence to the subject prior to administering the inducer.

145. Flavonoid compound for use according to any one of claims 137-144, wherein the flavonoid compound is administered at a dose of from about O.lmg / kg to 80mg / kg, from about O.lmg / kg to about 70mg / kg, from about O.lmg / kg to about 60mg / kg, from about 0. Img / kg to about 50mg / kg, from about 0. Img / kg to about 40mg / kg, from about 0. Img / kg to about 30mg / kg, from about O.lmg / kg to about 20mg / kg, from about O.lmg / kg to about lOmg / kg, from about 0. Img / kg to about 6mg / kg, from about 0. Img / kg to about 5mg / kg, or from about O.lmg / kg to about Img / kg.

146. Flavonoid compound for use according to any one of claims 137-145, wherein the flavonoid compound is administered orally.

147. Flavonoid compound for use according to any one of claims 137-145, wherein the flavonoid compound is administered intraperitoneally.

148. A method of regulating expression of a transgene in the liver of a subject, the method comprising: administering to the subject at least a first time point a dose of a first inducer; administering to the subject at least a second time point a second dose of a second inducer, wherein the second inducer can be the same as or different than the first inducer; and administering to the subject at least a third time point a third dose of a third inducer, wherein the third inducer can be the same as or different than the first inducer and the second inducer; wherein the subject comprises at least one liver cell comprising an exogenous nucleotide sequence comprising a synthetic inducible promoter operably linked to a transgene; wherein the synthetic inducible promoter comprises at least one PBREM enhancer; andwherein the transgene is detrimental to the liver cell or to the subject when constitutively expressed.

149. The method of claim 148, wherein the first inducer is selected from the group consisting of artemisinin; derivative of artemisinin; a flavonoid compound, e.g. flavone, chrysin, baicalein, or galangin; l,4-Bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP); phenobarbital (PB); 6-(4Chlorophenyl)imidazo[2, 1 -b] [ 1 ,3 ]thiazole-5-carbaldehyde-O- (3,4-dichlorobenzyl)oxime (CITCO); Acetaminophen; Buprenorphine; Phenytoin; Carbamazepine; Valproic Acid; Chlorpromazine; Efavirenz; Nevirapine; Rilpivirine; Etravirine; Diazepam; Cyclophosphamid; Ifosfamide; Cerivastatin; Simvastatin; lovastatin; substituted sulphonamides; Thiazolidin-4-one; Estradiol; Estrone and analogues; l 7a-ethinyl-3; l 7B-estradiol (EE2); Dehydroepiandrost erone (DHEA); 513- pregnane-3, 20-dione; Diethylstilbestrol; Gingko biloba extract; Galangin; chrysin; baicalein; Diallyl sulphide; Ellagic acid; Resveratrol; Squalestatin-1; Bilobalide; Triclocarban; Triclosan; Dichlorodiphenyltrichloroethane (DDT); Dieldrin; Methoxychlor; Metofluthrin; Permethrin; Pyrethrins; Sulfoxaflor; Diethylhexyl phthalate (DEHP); Cyproconazole; Fluconazole; Propiconazole; FL81; Tri-p-methylphenyl phosphate (TMPP); UM104; or UM145.

150. The method of claim 148 or 149, wherein the second inducer is selected from the group consisting of artemisinin; derivative of artemisinin; a flavonoid compound, e.g. flavone, chrysin, baicalein, or galangin; l,4-Bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP); phenobarbital (PB); 6- (4Chlorophenyl)imidazo[2,l-b][l,3]thiazole-5-carbaldehyde-O-(3,4-dichlorobenzyl)oxime (CITCO); Acetaminophen; Buprenorphine; Phenytoin; Carbamazepine; Valproic Acid; Chlorpromazine; Efavirenz; Nevirapine; Rilpivirine; Etravirine; Diazepam; Cyclophosphamid; Ifosfamide; Cerivastatin; Simvastatin; lovastatin; substituted sulphonamides; Thiazolidin-4-one; Estradiol; Estrone and analogues; 17a-ethinyl-3;17B-estradiol (EE2); Dehydroepiandrost erone (DHEA); 5B-pregnane-3, 20-dione; Diethylstilbestrol; Gingko biloba extract; Galangin; chrysin; baicalein; Diallyl sulphide; Ellagic acid; Resveratrol; Squalestatin-1; Bilobalide; Triclocarban; Triclosan; Dichlorodiphenyltrichloroethane (DDT); Dieldrin; Methoxychlor; Metofluthrin; Permethrin; Pyrethrins; Sulfoxaflor; Diethylhexyl phthalate (DEHP); Cyproconazole; Fluconazole; Propiconazole; FL81; Tri-p-methylphenyl phosphate (TMPP); UM104; orUM145.

151. The method of any one of claims 148-150, wherein the third inducer is selected from the group consisting of artemisinin; derivative of artemisinin; a flavonoid compound, e.g. flavone, chrysin, baicalein, or galangin; l,4-Bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP); phenobarbital (PB); 6-(4Chlorophenyl)imidazo[2, 1 -b] [ 1 ,3 ]thiazole-5-carbaldehyde-O- (3,4-dichlorobenzyl)oxime (CITCO); Acetaminophen; Buprenorphine; Phenytoin; Carbamazepine; Valproic Acid; Chlorpromazine; Efavirenz; Nevirapine; Rilpivirine;Etravirine; Diazepam; Cyclophosphamid; Ifosfamide; Cerivastatin; Simvastatin; lovastatin; substituted sulphonamides; Thiazolidin-4-one; Estradiol; Estrone and analogues; I 7a-ethinyl-3; l 7b-estradiol (EE2); Dehydroepiandrost erone (DHEA); 513- pregnane-3, 20-dione; Diethylstilbestrol; Gingko biloba extract; Galangin; chrysin; baicalein; Diallyl sulphide; Ellagic acid; Resveratrol; Squalestatin-1; Bilobalide; Triclocarban; Triclosan; Dichlorodiphenyltrichloroethane (DDT); Dieldrin; Methoxychlor; Metofluthrin; Permethrin; Pyrethrins; Sulfoxaflor; Diethylhexyl phthalate (DEHP); Cyproconazole; Fluconazole; Propiconazole; FL81; Tri-p-methylphenyl phosphate (TMPP); UM104; or UM145.

152. The method of any one of claims 1-151, wherein the first inducer is artemisinin, or a derivative thereof.

153. The method of any one of claims 1-151, wherein first inducer is a flavonoid compound.

154. The method of any one of claims 1-153, wherein the second inducer or third inducer is artemisinin or, derivative thereof.

155. The method of any one of claims 1-153, wherein the second inducer is flavonoid compound.

Images