Methods of treatment with a chimeric poliovirus in patients with glioblastoma

Abstract

The present invention provides improved, methods to treat glioblastoma, including newly diagnosed glioblastoma (ndGBM) and recurrent glioblastoma (rGBM), in a human comprising administration to the patient of a chimeric poliovirus construct comprising a Sabin type I strain of poliovirus with a human rhinovirus 2 (HRV2) internal ribosome entry site (IRES) in the poliovirus 5' untranslated region between the poliovirus cloverleaf and the poliovirus open reading frame (a "chimeric poliovirus") by cervical perilymphatic subcutaneous injection, convection enhanced delivery (CED), direct intracavitary infusion via an Ommaya reservoir inserted into the surgical cavity, injection into the glioblastoma lesion cavity wall, or a combination thereof As provided herein, the chimeric poliovims is administered in a specifically-timed treatment regime comprising a treatment phases as a first-line treatment preceding the current standard of care glioblastoma therapy of maximum surgical resection, radiation, and temozolomide.

Description

[0001] METHODS OF TREATMENT WITH A CHIMERIC POLIOVIRUS IN PATIENTS WITH GLIOBLASTOMA CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 527,769 filed July 19, 2023, and U.S. Provisional Application No.63 / 529,339 filed July 27, 2023. The entirety of each of these applications is hereby incorporated by reference herein for all purposes. FIELD OF THE INVENTION This invention relates to improved methods for treating gliomas, including newly diagnosed glioblastoma (ndGBM) and recurrent glioblastoma (rGBM), by altering the tumor microenvironment to promote a pro-inflammatory immune response to the tumor via specifically timed administrations of a chimeric poliovirus, including in certain aspects, specifically timed multiple convection enhanced deliveries (CED) and perilymphatic injections of the chimeric poliovirus following surgical resection, for example maximal safe surgical resection. AIA 35 U.S.C.102(c) STATEMENT The disclosure of the subject matter of the present application and the claimed invention were made by or on behalf of parties to a joint research agreement under AIA 35 U.S.C.102(c). The agreement was in effect on or before the effective filing date of the claimed invention, and the claimed invention was made as a result of activities within the scope of the joint research agreement. INCORPORATION BY REFERENCE The contents of the XML file named “21081-034WO1_ST26” which was created on July 11, 2024, and is 9.1 KB in size, are hereby incorporated by reference in their entirety. BACKGROUND OF THE INVENTION Glioblastoma (GBM) is the most common primary central nervous system (CNS) malignancy, affecting approximately 5 per 100,000 individuals in North America (Stupp, R. et al. High-grade malignant glioma: ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up. Ann Oncol.21 Suppl 5:v190–3(2010)). GBM is a fast-growing and highly-aggressive primary brain tumor which has a notably poor prognosis (Holland, E.C. et al. Glioblastoma multiforme: The terminator. Proc Natl Acad Sci.97(12):6242–4(2000)). GBM pathophysiology develops from aberrations in star-shaped astrocytes and oligodendrocytes which develop into tumors. Newly diagnosed GBM (ndGBM) is defined as the development of tumors in the supratentorial brain and in rare occasions found in certain regions of the central nervous system including the cerebellum, brain stem, and spinal cord. Standard first-line treatment for ndGBM includes maximal safe surgical resection followed by concurrent radio-chemotherapy, followed by adjuvant chemotherapy. Surgical resection is generally performed in patients under the age of 70-years-old with tumor(s) accessible to complete removal. If the tumor is poorly accessible, partial surgical debulking or stereotactic biopsy is performed to confirm the diagnosis followed by adjuvant therapy. Radiotherapy (RT) and chemotherapy is administered in two phases, a first phase comprising a 6-week concurrent radio- chemotherapy phase wherein 60 grays (Gy) of radiation is administered in combination with temozolomide administered daily at a dose of 75 mg / m2, and a second phase comprising six, 4- week adjuvant chemotherapeutic treatment cycles wherein temozolomide is administered at a dose of 150-200 mg / m2on days 1-5 of each cycle. The current standard of care produces modest survival benefit. Unfortunately, however, the GBM inevitably recur. rGBM is defined as radiographically confirmed neoplastic progression following standard of care treatment (typically, maximum total resection, followed by concurrent radio-chemotherapy and adjuvant chemotherapy (temozolomide)) for ndGBM participants. Following recurrence, prognosis is poor as therapeutic options are limited and typically default to disease management medications in the form of immunosuppressive corticosteroids and bevacizumab, which have been shown to further shorten life expectancy (Pitter, K. L. et al. Corticosteroids compromise survival in glioblastoma. Brain. 139(Pt 5):1458-1471(2016); Cenciarini, M. et al. Dexamethasone in glioblastoma multiforme therapy: Mechanisms and controversies. Front Mol Neurosci. 12: 65(2019)). As a result, little progress has been achieved in improving OS or PFS in rGBM in the last two decades, with an OS of 6- to 10-months and median OS of approximately 7 months depending on the therapeutic agents, number of recurrences, prior treatment failures, tumor mutations, Karnofsky Performance Scale score, etc. (Sim, H. W. et al. Contemporary management of high-grade gliomas. CNS Oncol.7(1):51-65(2018)). This is further highlighted by the fact that the current therapeutic guidelines for rGBM by the National Comprehensive Cancer Network suggest clinical trials with investigational therapies as their top recommendation for treatment beyond standard of care (Network, N. C. C. NCCN Guidelines for Patients 2021: Brain Cancer – Gliomas. (2021)). Indeed, there are currently over 100 ongoing studies of at least 30 unique experimental therapies alone or in combination with current therapies in rGBM (see: clinicaltrials.gov (Clinicaltrials.gov), under “condition or disease” search: recurrent glioblastoma). In some rGBM participants, resection may be infeasible due to the proximity of the recurrent tumor to eloquent areas of the brain or other safety considerations. However, when resection can be performed, studies have shown a survival advantage, with survival of 12.8 months from surgery of rGBM vs.8.0 months without surgery (Sastry R. A. et al. The impact of surgery on survival after progression of glioblastoma: A retrospective cohort analysis of a contemporary patient population. J Clin Neurosci. 53:41-47 (2018)). Additionally, participants that elect to undergo resection experience improved quality of life, with 80% of operated participants not requiring rehabilitation and 61% remaining independently mobile compared to those rGBM participants who do not undergo resection (Wann, A. et al. Outcomes after second surgery for recurrent glioblastoma: a retrospective case-control study. J Neurooncol.137(2):409-415(2018)). These data and others (McCutcheon, I. E. & Preul, M. C. Historical perspective on surgery and survival with glioblastoma: How far have we come? World Neurosurg. 149:148-168(2021)) are consistent with the notion that resection at time of recurrence currently offers the best opportunity to extend life with both decreased morbidity and mortality with improved quality of life. Overall, these data indicate that there is still significant unmet medical need for patients with all stages of GBM, where the goal of improving therapy ranges from decreasing the frequency of / need for repeat surgical and / or chemotherapeutic intervention, to prolonging survival without adding additional toxicity. Taken together, there is significant interest in the development of novel therapeutic protocols that can safely increase the anti-tumor response for GBM patients whose survival is limited using current standard of care therapeutic approaches. SUMMARY OF THE INVENTION Provided herein is an improved therapeutic protocol for the treatment of glioblastoma (GBM) using specifically timed, multiple high dose administrations of lerapolturev (also known as PVSRIPO), a chimeric poliovirus construct comprising a live attenuated (Sabin) type I vaccine strain of poliovirus with a human rhinovirus 2 (HRV2) internal ribosome entry site (IRES) in the poliovirus 5′ untranslated region between the cloverleaf and the viral open reading frame, to a human having a GBM including newly diagnosed GBM (ndGBM) or recurrent GBM (rGBM), following surgical resection, for example maximal safe surgical resection, of the tumor. The multiple administrations of lerapolturev are delivered to residual infiltrating tumor following surgical resection, for example maximal safe surgical resection, by convection enhanced delivery (CED), or alternatively, delivered into the cavity wall. In some embodiments, the multiple administrations of lerapolturev are delivered by direct injection into the post-resection cavity wall. In alternative embodiments, the multiple administrations of lerapolturev are delivered via intracavitary infusion via an Ommaya reservoir or similar device installed into the post-surgical cavity. In some aspects, the patient is further administered additional, multiple high-dose cervical perilymphatic subcutaneous injections of lerapolturev. It is believed that the specifically timed and alternatively delivered high-dose administration of lerapolturev has profound effects on the immune cells in the tumor microenvironment, i.e., glioma-associated microglia (see Example 3, FIGs. 6B, 7B) and macrophages. Furthermore, results from studies in mouse tumor models show that (non- cytopathogenic) extended viral (v)RNA replication and profound proinflammatory activation also occurs in cells of the resident myeloid compartment in the surrounding normal CNS, i.e. microglia (see Example 4, FIGs. 8A-8C and 9A-9C) and CNS-associated macrophages, and in myeloid compartments of tumor draining lymph nodes and the lymphatic system at large. Collectively, these events trigger robust antitumor, inflammatory responses in the patient, resulting in one or more of : (i) increased inflammatory potential; (ii) increased recruitment of dendritic cells (DC) to the tumor site and to tumor-infiltrated brain; (iii) increased phagocytic activity of (infected) myeloid antigen-presenting cells (APCs) (microglia, macrophages, DCs), leading to enhanced uptake of tumor antigenic material (see Example 5, FIG.10); (iv) increased trafficking of tumor antigen / tumor-infiltrating DCs to tumor-draining (in the case of glioblastoma, cervical) lymph nodes; (v) increased tumor antigen presentation / T cell priming potential of (infected) myeloid APCs; (vi) increased T cell recruiting / engaging potential (see Example 6, FIGs.11A-11C); (vii) increased levels of pro-inflammatory cytokines; (viii) development of an inflammatory gene expression signature including type I interferons (IFNs) and / or markers of T cell signaling; (ix) increased T cell receptor diversity; (x) increased T cell receptor clonality; (xi) dynamic tumor microenvironment marker changes; (xii) increased functionality of antitumor T cells; and, (xiii) increased frequencies of antitumor T cells (see, e.g., FIG.1). The net benefit of this effect on the tumor microenvironment and myeloid compartments in surrounding, tumor-infiltrated brain is an improvement in the patient’s innate immune response to mount immunogenic inflammatory- and cytotoxic T cell responses against the tumor and / or cancer, increasing the likelihood of the patient experiencing longer-term responses compared to current standard of care therapies (see Example 7, FIG.12A-12B). This improvement provides a significant advancement in the state of the art of cancer treatment, and in the treatment of cancers of the brain specifically. Lerapolturev is a genetically recombinant, non-pathogenic “oncolytic” virus capable of direct anti-tumor effects through cytopathogenic and proinflammatory infection of tumor cells. Unlike other oncolytic viruses, however, lerapolturev is also capable of non-lethal infection of pivotal immune effector cells of the myeloid lineage, including tumor associated macrophages (TAMs) and DCs, as well as microglia, macrophages and DCs residing in non-cancerous tissues, all of which naturally express the CD155 poliovirus receptor and, thus, are susceptible to infection. The non-lethal infection of immune effector cells leads to activation of antitumor immune responses via triggering of endogenous inflammatory programs, epitomized by sustained activation of innate type-I IFN signaling pathways. Upregulation of type 1 IFN signaling in the TME leads to the generation of a systemic cytotoxic T lymphocyte (CTL) effector anti-tumor response. In comparison, infection of immune effector cells with other oncolytic viruses (e.g., herpes simplex virus I) impedes the ability of DCs to mount an antiviral immunomodulatory response, due to the highly evolved immune-suppressive and -evasive properties of such virus prototypes proposed as oncolytic agents. As described herein, targeting myeloid APCs in the tumor-microenvironment (TME) of GBM is a promising therapeutic approach, as cells within the TME infected with lerapolturev are capable of mounting a robust type I IFN beta / alpha (IFN-β / α) immunomodulatory response across a wide variety of environmental conditions, indicating the capability of generating a systemic CTL effector anti-tumor response [see Brown, M. C. et al. Cancer immunotherapy with recombinant poliovirus induces IFN-dominant activation of dendritic cells and tumor antigen-specific CTLs. Sci Transl Med. 9(408)(2017) ); Brown, M. C. et al. Viral infection of cells within the tumor microenvironment mediates antitumor immunotherapy via selective TBK1-IRF3 signaling. Nat Communications. 12(1)(2021)] and potent anti-tumor potency in the patient. The resultant response, however, must be sufficient and sustainable. Surprisingly, as disclosed herein, it has been discovered that the response may be sustainable through the further administration of lerapolturev via perilymphatic administration. In one aspect, described herein is a method of treating a human patient having newly diagnosed glioblastoma (ndGBM) following a first surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster at least about two weeks following the first surgical resection of the one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated at least about 1 week following the administration of the polio-vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev into the first surgical resection site on day 1 of the 1-week cycle to treat a residual GBM tumor, and optionally again on day 5 of the 1-week cycle; and (iii) a second treatment phase, wherein a) the patient undergoes a second surgical resection of one or more residual GBM tumors about 5 weeks following the initiation of the first treatment phase, and b) wherein, following the second surgical resection, the patient is further administered an effective amount of lerapolturev into the second surgical resected site. In some embodiments, the lerapolturev administration comprises CED injection. In some embodiments, the lerapolturev administration comprises direct injection of a resection cavity wall. In some embodiments, the lerapolturev administration comprises direct injection via Ommaya reservoir installed in a post-resection cavity. In some embodiments, the method further comprises administering to the patient once weekly for 4 consecutive weeks an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection, wherein the cervical perilymphatic subcutaneous injections are administered following the cessation of the first treatment phase, and before the initiation of the second treatment phase. In some embodiments, the first treatment cycle comprises a single 1-week treatment cycle comprising administering to the patient an effective amount of lerapolturev into the first surgical resection site on day 1 and day 5 of the cycle to treat a residual GBM tumor. In some embodiments, the ndGBM harbors an unmethylated O6- methylguanine-DNA methyltransferase promoter (MGMTp). In some embodiments, the ndGBM harbors a partially methylated O6-methylguanine-DNA methyltransferase promoter (MGMTp). In some embodiments, the ndGBM harbors a methylated O6-methylguanine-DNA methyltransferase promoter (MGMTp). In some embodiments, the residual GBM tumor is a residual tumor with a non-enhancing fluid-attenuated inversion recovery (FLAIR) signal. In some embodiments, the method is administered as a first-line (1L) therapy. In some embodiments, lerapolturev is administered in a dose of between about 1x108TCID50 and 5x108TCID50. In some embodiments, lerapolturev is administered in a dose of about 2x108TCID50. In some embodiments, the patient is further administered temozolomide during the first treatment phase at a standard of care dose. In some embodiments, following the second treatment phase, the patient undergoes radiation treatment. In some embodiments, the patient is further administered an immune checkpoint inhibitor. In another aspect, described herein is a method of treating a human patient having newly diagnosed GBM (ndGBM) following a first surgical resection, for example a maximal safe surgical resection, of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster following the first surgical resection, for example maximal safe surgical resection, of one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated between at least about 1 week and about 6 weeks following the administration of the polio vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev into the surgical resection site on day 1 of the 1-week cycle and optionally again on day 5 of the 1-week cycle; and (iii) an optional second treatment phase, wherein a) the patient undergoes a second surgical resection, for example maximal safe surgical resection, of one or more residual GBM tumors at least about 5-weeks after the initiation of the first treatment phase, and administering to the patient one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev into the surgical resection site on day 1 of the 1-week cycle and optionally again on day 5 of the one-week cycle, wherein lerapolturev administration is selected from CED injection, direct injection of a resection cavity wall, or direct injection via Ommaya reservoir installed in a post-resection cavity. In some embodiments, the first treatment phase is initiated at least about 1 week, for example about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, or about 6 weeks, following the administration of the polio vaccine booster. In some embodiments, the first treatment phase is initiated no more than about 6 weeks following the administration of the polio vaccine booster. In some embodiments, the catheter comprises an Ommaya reservoir. In some embodiments, the catheter comprises a CED catheter. In some embodiments, the surgical resection of one or more GBM tumors is a maximal safe surgical resection. In some embodiments, the surgical resection of one or more GBM tumors is a biopsy. In some embodiments, the lerapolturev administration comprises CED injection. In some embodiments, the lerapolturev administration comprises direct injection of a resection cavity wall. In some embodiments, the lerapolturev administration comprises direct injection via Ommaya reservoir installed in a post-resection cavity. In some embodiments, the method further comprises administering to the patient once weekly for 4 consecutive weeks an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection, wherein the cervical perilymphatic subcutaneous injections are administered following the cessation of the first treatment phase, and before the (optional) initiation of the second treatment phase. In some embodiments, the first treatment cycle comprises a single 1-week treatment cycle comprising administering to the patient an effective amount of lerapolturev into the surgical resection site on day 1 and day 5 of the cycle to treat a residual GBM tumor. In some embodiments, the ndGBM harbors an unmethylated O6-methylguanine-DNA methyltransferase promoter (MGMTp). In some embodiments, the ndGBM harbors a partially methylated O6-methylguanine-DNA methyltransferase promoter (MGMTp). In some embodiments, the ndGBM harbors a methylated O6-methylguanine-DNA methyltransferase promoter (MGMTp). In some embodiments, the residual GBM tumor is non-enhancing and best visualized on fluid-attenuated inversion recovery (FLAIR) MRI sequences. In some embodiments, the method is administered as a first-line (1L) therapy. In some embodiments, lerapolturev is administered in a dose of between about 1x108TCID50and 5x108TCID50. In some embodiments, lerapolturev is administered in a dose of about 2x108TCID50. In some embodiments, the patient is further administered temozolomide during the first treatment phase at a standard of care dose. In some embodiments, following the second treatment phase, the patient undergoes radiation treatment. In some embodiments, the method further comprises administering an anti-cancer therapy selected from a chemotherapeutic agent other than temozolomide, an immune checkpoint inhibitor, antiangiogenic therapy, small molecule inhibitor, investigational product, tumor treating field, or a combination thereof. In some embodiments, the patient is further administered an immune checkpoint inhibitor. In some embodiments, the patient is further administered temozolomide. In one aspect, described herein is a method of treating a human patient having recurrent (rGBM) following a surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster at least about two weeks following the surgical resection of the one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated at least about 1 week following the administration of the polio-vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycle comprising administering to the patient an effective amount of lerapolturev into the surgical resection site on day 1 and day 5 of the 1-week cycle to treat a residual GBM tumor; (iii) a second treatment phase, wherein the second treatment phase comprises administering to the patient once weekly for 4 consecutive weeks an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection, wherein the second treatment phase is administered following the cessation of the first treatment phase, and, (iv) a third treatment phase, wherein the third treatment phase comprises administering to the patient once every three weeks an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection, wherein the third treatment phase is administered following the cessation of the second treatment phase. In some embodiments, the lerapolturev administration comprises CED injection. In some embodiments, the lerapolturev administration comprises direct injection of a resection cavity wall. In some embodiments, the lerapolturev administration comprises direct injection via Ommaya reservoir installed in a post-resection cavity. In some embodiments, the first treatment cycle comprises a single 1-week treatment cycle. In some embodiments, the third treatment phase is administered once every three weeks for at least 6-months. In some embodiments, the third treatment phase is administered once every three weeks for at least 12-months. In some embodiments, the third treatment phase is administered once every three weeks for at least 15- months. In some embodiments, the rGBM harbors an unmethylated O6-methylguanine-DNA methyltransferase promoter (MGMTp). In some embodiments, the ndGBM harbors a partially methylated O6-methylguanine-DNA methyltransferase promoter (MGMTp). In some embodiments, the ndGBM harbors a methylated O6-methylguanine-DNA methyltransferase promoter (MGMTp). In some embodiments, the residual GBM tumor is a residual tumor with a non-enhancing fluid-attenuated inversion recovery (FLAIR) signal. In some embodiments, lerapolturev is administered in a dose of between about 1x108TCID50and 5x108TCID50. In some embodiments, lerapolturev is administered in a dose of about 1x108TCID50. In some embodiments, lerapolturev is administered in a dose of about 2x108TCID50. In some embodiments, the method further comprises administering an anti-cancer therapy selected from radiation therapy, a chemotherapeutic agent, an immune checkpoint inhibitor, antiangiogenic therapy, or a combination thereof. In some embodiments, the patient is further administered an immune checkpoint inhibitor. In some embodiments, the patient is further administered temozolomide. In another aspect, described herein is a method of treating a human patient having recurrent GBM (rGBM) following a first surgical resection, for example a maximal safe surgical resection, of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster following the first surgical resection, for example maximal safe surgical resection, of one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated between at least about 1 week and about 6 weeks following the administration of the polio vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycle comprising administering to the patient an effective amount of lerapolturev into the surgical resection site on day 1 of the 1-week cycle and optionally again on day 5 of the 1-week cycle; and (iii) an optional second treatment phase, wherein a) the patient undergoes a second surgical resection, for example maximal safe surgical resection, of one or more residual GBM tumors at least about 5-weeks after the initiation of the first treatment phase; wherein, following the second surgical resection, for example maximal safe surgical resection, the patient is further administered an effective amount of lerapolturev into the surgical resection site on day 1 of the 1-week cycle and optionally again on day 5 of the 1-week cycle; and, (iv) an optional third treatment phase, wherein the third treatment phase comprises administering to the patient once about every three weeks an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection, wherein the third treatment phase is administered following the cessation of the first treatment phase, and / or the (optional) second treatment phase. In some embodiments, the first treatment phase is initiated at least about 1 week, for example about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, or about 6 weeks, following the administration of the polio vaccine booster. In some embodiments, the first treatment phase is initiated no more than about 6 weeks following the administration of the polio vaccine booster. In some embodiments, the catheter comprises an Ommaya reservoir. In some embodiments, the catheter comprises a CED catheter. In some embodiments, the surgical resection of one or more GBM tumors is a maximal safe surgical resection. In some embodiments, the surgical resection of one or more GBM tumors is a biopsy. In some embodiments, the lerapolturev administration comprises CED injection. In some embodiments, the lerapolturev administration comprises direct injection of a resection cavity wall. In some embodiments, the lerapolturev administration comprises direct injection via Ommaya reservoir installed in a post-resection cavity. In some embodiments, the first treatment cycle comprises a single 1-week treatment cycle. In some embodiments, the third treatment phase is administered once every three weeks for at least 6-months. In some embodiments, the third treatment phase is administered once every three weeks for at least 12-months. In some embodiments, the third treatment phase is administered once every three weeks for at least 15-months. In some embodiments, the residual GBM tumor is non- enhancing and best visualized on fluid-attenuated inversion recovery (FLAIR) MRI sequences. In some embodiments, lerapolturev is administered in a dose of between about 1x108TCID50and 5x108TCID50. In some embodiments, lerapolturev is administered in a dose of about 1x108TCID50. In some embodiments, lerapolturev is administered in a dose of about 2x108TCID50. In some embodiments, the method further comprises administering an anti-cancer therapy selected from radiation therapy, a chemotherapeutic agent, an immune checkpoint inhibitor, antiangiogenic therapy, small molecule inhibitor, investigational product, tumor treating field, or a combination thereof. In some embodiments, the patient is further administered an immune checkpoint inhibitor. In some embodiments, the patient is further administered temozolomide. In an alternative aspect, provided herein is a method of treating a human patient having a solid tumor, wherein the treatment comprises: (i) a first treatment phase comprising one or more treatment cycles comprising administration of an effective amount of lerapolturev via injection into the solid tumor; (ii) a second treatment phase comprising at least one cycle comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each weekly cycle. In some embodiments, the patient undergoes a first surgical resection of one or more tumors prior to the first treatment phase. In some embodiments, the first surgical resection comprises maximal safe surgical resection. In some embodiments, a polio vaccine booster is administered to the human patient prior to the first treatment phase. In some embodiments, the polio vaccine booster is administered to the human patient at least about two weeks following the surgical resection. In some embodiments, the polio vaccine booster is administered to the human patient at least one week prior to the first treatment phase. In some embodiments, the first treatment phase is initiated at least about 1 week, for example about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, or about 6 weeks, following the administration of the polio vaccine booster. In some embodiments, the first treatment phase is initiated no more than about 6 weeks following the administration of the polio vaccine booster. In some embodiments, the first treatment phase is administered to the human patient between at least about one week and about 6 weeks following the administration of the polio vaccine booster. In some embodiments, the patient undergoes an additional surgical resection of one or more residual tumors between the first and second treatment phases. In some embodiments, the second treatment phase is initiated about 1 week following the cessation of the first treatment phase. In some embodiments, the first treatment phase comprises administration of an effective amount of lerapolturev on day 1 and day 5 of a single 1-week treatment cycle. In some embodiments, the first treatment phase comprises administration of an effective amount of lerapolturev on day 1 of two consecutive 1-week treatment cycles. In some embodiments, the second treatment phase comprises at least two or more weekly cycles. In some embodiments, the second treatment phase comprises at least three or weekly cycles. In some embodiments, the second treatment phase comprises at least four or more weekly cycles. In some embodiments, the method further comprises a third treatment phase, wherein the third treatment phase is administered following the cessation of the second treatment phase, and wherein the third treatment phase comprises at least two or more cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle. In some embodiments, the cycle of the third treatment phase is a three-week cycle, a four-week cycle, a five-week cycle, a six-week cycle, a two-month cycle, a three-month cycle, a four-month cycle, or a six-month cycle. In some embodiments, the third treatment phase comprises at least five or more three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle. In some embodiments, the third treatment phase comprises administering three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle, wherein the third treatment phase lasts for at least 6-months. In some embodiments, the third treatment phase comprises administering three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle, wherein the third treatment phase lasts for at least 12-months. In some embodiments, the third treatment phase comprises administering three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle, wherein the third treatment phase lasts for at least 15-months. In some embodiments, the lerapolturev injection into the solid tumor administration route is selected from intratumoral, intranodal, or peritumoral. In some embodiments, the lerapolturev injection into the solid tumor administration route is cavity wall injection. In some embodiments, the perilymphatic administration comprises cervical perilymphatic subcutaneous injection. In some embodiments, the one or more solid tumors comprise a cancer selected from glioblastoma multiforme (GBM), astrocytoma, oligodendroglioma, astro-oligodendroglioma, renal cell carcinoma, prostate cancer, bladder cancer, esophageal cancer, stomach cancer, pancreas cancer, colorectal cancer, liver cancer, gall bladder cancer, breast cancer, medulloblastoma, lung cancer, head and neck squamous cell carcinoma (HNSCC), melanoma, ovarian cancer, or sarcoma. In some embodiments, the solid tumor is a locally advanced, metastatic, or recurrent tumor. In some embodiments, the patient is administered according to the method described herein following evidence of apparent disease progression. In some embodiments, the one or more solid tumors comprise glioblastoma multiforme (GBM). In some embodiments, the GBM is newly-diagnosed GBM (ndGBM). In some embodiments, the GBM is recurrent GBM (rGBM). In some embodiments, the methods described herein are used to treat a human patient with astrocytoma. In some embodiments, the methods described herein are used to treat a human patient with oligodendroglioma. In some embodiments, the methods described herein are used to treat a patient with astro-oligodendroglioma. In some embodiments, the methods described herein are used to treat a human patient with medulloblastoma. In some embodiments, the one or more solid tumors comprise melanoma. In some embodiments, the one or more solid tumors comprise bladder cancer. In some embodiments, the method further comprises an additional cancer therapy selected from a chemotherapy, a radiation, an immune checkpoint inhibitor (ICI), an antiangiogenic therapy, or a combination thereof. In some embodiments, the additional cancer therapy comprises a chemotherapeutic agent. In some embodiments, the additional cancer treatment comprises an immune checkpoint inhibitor (ICI). In some embodiments, the ICI is selected from a programmed cell death -1 (PD-1) inhibitor, a programmed cell death-ligand 1 (PD-L1) inhibitor, a cytotoxic T- lymphocyte-associated protein 4 (CTLA-4) inhibitor, a lymphocyte-activation gene 3 (LAG-3) inhibitor, a T-cell immunoglobulin mucin-3 (TIM-3) inhibitor, a T cell immunoreceptor with Ig and ITIM domains (TIGIT) inhibitor, a V-domain Ig suppressor of T-cell activation (VISTA) inhibitor, a carcinoembryonic antigen cell adhesion molecule (CEACAM) inhibitor, a sialic acid- binding immunoglobulin-like lectin 15 (Siglec-15) inhibitor, a CD47 inhibitor, a CD39 inhibitor, or a B and T lymphocyte attenuator (BTLA) protein inhibitor, a B7-H3 / CD276 inhibitor, an indoleamine 2,3-dioxygenase (IDO) inhibitor, a killer immunoglobin-like receptor (KIR) inhibitor, or a combination thereof. In some embodiments, the ICI is administered at the standard recommended dose and schedule as described on an FDA approved label. In some embodiments, the method is administered as a first-line (1L) therapy. In some embodiments, the method is administered as a second-line (2L) therapy. In some embodiments, the method is administered as a third-line (3L) therapy. In some embodiments, the method further comprises administering a standard of care therapy following the cessation of the additional surgical resection. In some embodiments, lerapolturev is administered in a dose of between about 1x108TCID50and 5x108TCID50. In some embodiments, lerapolturev is administered in a dose of about 1x108TCID50. In some embodiments, lerapolturev is administered in a dose of about 2x108TCID50. In some embodiments, lerapolturev is administered in a dose of about 4x108TCID50. In some embodiments, the patient undergoes a first surgical resection of one or more GBM tumors prior to the first treatment phase. In some embodiments, the first treatment phase is initiated at least about 1 week, for example about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, or about 6 weeks, following the administration of a polio vaccine booster. In some embodiments, the first treatment phase is initiated no more than about 6 weeks following the administration of a polio vaccine booster. In some embodiments, the patient undergoes an additional surgical resection of one or more residual GBM tumors between the first and second treatment phases. In some embodiments, the second treatment phase is initiated about 1 week following the cessation of the first treatment phase. In some embodiments, the first treatment phase comprises administration of an effective amount of lerapolturev on day 1 and day 5 of a single 1-week treatment cycle. In some embodiments, the first treatment phase comprises administration of an effective amount of lerapolturev on day 1 of two consecutive 1-week treatment cycles. In some embodiments, the lerapolturev administration during the first treatment phase comprises convection enhanced delivery (CED). In some embodiments, the lerapolturev administration during the first treatment phase comprises cavity wall injection. In some embodiments, the lerapolturev administration during the first treatment phase comprises direct infusion via an Ommaya reservoir into a surgical cavitary. In some embodiments, the perilymphatic administration comprises cervical perilymphatic subcutaneous injection. In some embodiments, the second treatment phase comprises at least two or more weekly cycles, at least three or more weekly cycles, at least four or more weekly cycles, or more than four weekly cycles. In some embodiments, the method further comprises a third treatment phase, wherein the third treatment phase is administered following the cessation of the second treatment phase, and wherein the third treatment phase comprises at least two or more cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle. In some embodiments, the cycle of the third treatment phase is a three-week cycle. In some embodiments, the third treatment phase lasts at least 6-months, at least 12-months, at least 15- months, or more than 15-months. In some embodiments, the one or more GBM tumors comprise newly diagnosed glioblastoma (ndGBM). In some embodiments, the one or more GBM tumors comprise recurrent glioblastoma (rGBM). In some embodiments, the residual GBM tumor is non- enhancing and best visualized on fluid-attenuated inversion recovery (FLAIR) MRI sequences. In some embodiments, lerapolturev is administered in a dose of between about 1x108TCID50and 5x108TCID50. In some embodiments, lerapolturev is administered in a dose of about 1x108TCID50. In some embodiments, lerapolturev is administered in a dose of about 2x108TCID50. In some embodiments, the method further comprises administering an anti-cancer therapy selected from radiation therapy, a chemotherapeutic agent, an immune checkpoint inhibitor, antiangiogenic therapy, small molecule inhibitor, investigational product, tumor treating field, or a combination thereof. In some embodiments, the patient is further administered an immune checkpoint inhibitor. In some embodiments, the patient is further administered temozolomide. In some embodiments, suitable poliovirus vaccines for administration prior to the initiation of a treatment phase comprise trivalent IPOL® (Sanofi-Pasteur SA). In some embodiments, lerapolturev is further administered in combination with an immune checkpoint inhibitor (ICI). The improved treatment methods described herein block tumor infiltrating immune effector cell immune checkpoint expression downregulation to prevent tumor immune escape, resulting in an extended or prolonged efficacy of an anti-cancer regimen. The administration of an effective amount of lerapolturev and an effective amount of an ICI are capable of synergizing to reverse and / or significantly delay the growth of tumors and / or the development of ICI therapy resistance. Suitable ICIs for use in the methods described herein include, but are not limited to, a programmed cell death-1 (PD-1) inhibitor, a programmed cell death-ligand 1 (PD- L1) inhibitor, a cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) inhibitor, a lymphocyte- activation gene 3 (LAG-3) inhibitor, a T-cell immunoglobulin mucin-3 (TIM-3) inhibitor, a T cell immunoreceptor with Ig and ITIM domains (TIGIT) inhibitor, a programmed cell death-ligand 2 (PD-L2) inhibitor, a V-domain Ig suppressor of T-cell activation (VISTA) inhibitor, a B7- H3 / CD276 inhibitor, an indoleamine 2,3-dioxygenase (IDO) inhibitor, a killer immunoglobulin- like receptor (KIR) inhibitor, a carcinoembryonic antigen cell adhesion molecule (CEACAM) inhibitor against molecules such as CEACAM-1, CEACAM-3, and CEACAM-5, a sialic acid- binding immunoglobulin-like lectin 15 (Siglec-15) inhibitor, a CD47 inhibitor, a CD39 inhibitor, or a B and T lymphocyte attenuator (BTLA) protein inhibitor, or a combination thereof. In some embodiments, the ICI is administered at the standard recommended dose and schedule as described on its FDA approved label. Furthermore, the improved treatment methods described herein provide enhanced therapeutic efficacy through the regulation of T cells and NK cells, including activation of cytotoxic CD8+ T-cell function and maturation into memory CD8+ T-cells. The improved treatment methods described herein that combine administration of a chimeric poliovirus construct at certain doses and interval frequencies in combination with administering an effective amount of an ICI at certain doses and interval frequencies provide anti-tumor potency and measurable reductions in tumor progression. The administration of lerapolturev according to a treatment protocol described herein may provide enhanced anti-tumor efficacy in patients. In some embodiments, the administration of lerapolturev according to a treatment protocol described herein provides improved progression free survival (PFS) and / or overall survival (OS) compared to a patient receiving radiation and / or chemotherapy and / or antiangiogenic therapy alone. In some embodiments, an improvement in PFS is observed. In some embodiments, an improvement in OS is observed. In some embodiments, the methods described herein reduce the recurrence rate of GBM tumor formation. In some embodiments, the methods described herein decrease the need for GBM tumor removal surgeries. In some embodiments, the methods described herein decrease the frequency of GBM tumor recurrence. The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is an image reviewing key mechanisms of action for lerapolturev. Lerapolturev (formerly PVSRIPO) is a modified poliovirus-based therapy designed to safely activate the immune system to treat cancer. Lerapolturev binds to CD155 (poliovirus receptor), a cell surface TIGIT ligand expressed on a variety of solid tumors, as well as antigen presenting cells, including DCs and macrophages. Lerapolturev contributes directly and indirectly in the activation of the immune system to attack the tumor microenvironment via mechanisms which include but are not limited to: (1) infecting, replicating within, translating viral proteins, generating double-stranded viral (v)RNA, instigating an innate antiviral response, then lysing cancer cells, the remnants of which become antigen sources for antigen presenting cells; (2) infecting and activating myeloid APCs leading to tumor antigen presentation, T-cell priming and anticancer immunity, contributing to a systemic immune effect; and, (3) recalling pre-existing polio vaccine-specific memory CD4+T cells that recruit other immune cell subsets and lead to an amplification of the immune response. FIG. 2A-D show exemplary administration schedules of lerapolturev to a human having ndGBM, unmethylated MGMT promoter, according to the methods as provided herein. FIG. 2A is an exemplary lerapolturev administration schedule (Arm A) according to the methods described herein comprising: a first treatment phase comprising a one-week treatment cycle initiated three-weeks following maximal safe GBM resection surgery and at least one-week (but no more than 6 weeks) following the administration of a polio vaccine booster. Lerapolturev is administered on day 1 by convection enhanced delivery (CED) infusion using a catheter. Five weeks following the initial lerapolturev administration, the patient will undergo biopsy if imaging changes are suggestive of tumor progression vs. inflammatory effect. Patients will then initiate radiation therapy without chemotherapy (e.g. without temozolomide). FIG. 2B is an exemplary lerapolturev administration schedule (Arm B) according to the method described herein comprising a first treatment phase comprising a single one-week treatment cycle beginning three-weeks following maximal safe GBM resection surgery at least one-week (but no more than 6 weeks) following the administration of a polio vaccine booster. Lerapolturev is administered on days 1 and 5 by convection enhanced delivery (CED) infusion using a catheter. Five weeks following the initial lerapolturev administration, the patient will undergo biopsy if imaging changes are suggestive of tumor progression vs. inflammatory effect. Patients will then initiate radiation therapy without chemotherapy (e.g. without temozolomide). FIG. 2C is an exemplary lerapolturev administration schedule (Arm C) according to the methods described herein comprising a first treatment phase comprising a one-week treatment cycle initiated three-weeks following maximal safe GBM resection surgery at least one-week (but no more than 6 weeks) following the administration of a polio vaccine booster. Lerapolturev is administered on days 1 and 5 by convection enhanced delivery (CED) infusion using a catheter. Lerapolturev is further administered in a second treatment phase comprising four, one-week treatment cycles wherein the chimeric poliovirus is administered on day 1 of each week by cervical perilymphatic subcutaneous injection. Five weeks following the initial lerapolturev administration, the patient will undergo biopsy if imaging changes are suggestive of tumor progression vs. inflammatory effect. Patients will then initiate radiation therapy without chemotherapy (e.g. without temozolomide). FIG. 2D is an exemplary lerapolturev administration schedule (Arm D) according to the methods described herein comprising a first treatment phase comprising a one-week treatment cycle initiated three-weeks following maximal safe GBM resection surgery and at least one-week (but not more than 6 weeks) following the administration of a polio vaccine booster. Lerapolturev is administered on days 1 and 5 by convection enhanced delivery (CED) infusion using a catheter. At the same time as the CED catheter is inserted in the residual non-enhancing tumor, an Ommaya reservoir is inserted in the previously made resection cavity. Lerapolturev is further administrated in a second treatment phase comprising four, one-week treatment cycles wherein the chimeric poliovirus is administered on day 1 of each week by direct intracavitary infusion via the Ommaya reservoir inserted into the surgical cavity. Five weeks following the initial lerapolturev administration, the patient will undergo biopsy if imaging changes are suggestive of tumor progression vs. inflammatory effect. A patient may receive an additional lerapolturev administration, according to the methods as provided herein, if histopathological analysis suggests tumor recurrence. Patients will then initiate radiation therapy without chemotherapy (e.g. without temozolomide). FIG. 3A-B show exemplary administration schedules of lerapolturev to a human having rGBM according to the methods as provided herein. FIG. 3A is an exemplary lerapolturev administration schedule according to the methods described herein comprising a first treatment phase comprising a one-week treatment cycle initiated three-weeks following maximal safe rGBM resection surgery. At least 1 week prior to lerapolturev administration (but no more than 6 weeks), a polio vaccine booster is administered. Lerapolturev is administered on day 1 and day 5 of the treatment cycle by CED infusion using a catheter. Five weeks following the initial lerapolturev administration, the patient will undergo biopsy if imaging changes are suggestive of tumor progression vs. immune effect. FIG.3B is an exemplary lerapolturev administration schedule comprising a first treatment phase comprising a one-week treatment cycle initiated three-weeks following maximal safe rGBM resection surgery. At least 1 week (but no more than 6 weeks) prior to lerapolturev administration, a polio vaccine booster is administered. Lerapolturev is administered on day 1 and day 5 of the treatment cycle by convection enhanced delivery (CED) infusion using a catheter. A second treatment phase is administered to the patient following the first treatment phase. The second treatment phase comprises four consecutive one-week treatment cycles, wherein lerapolturev is administered via cervical perilymphatic subcutaneous injection on day 1 of each cycle. Following cessation of the second treatment phase, a third treatment phase comprising one or more three- week treatment cycles, wherein lerapolturev is administered via cervical perilymphatic subcutaneous injection on day 1 of each treatment cycle. The treatment can be repeated one or more times. As illustrated, the third treatment phase comprises at least 17 treatment cycles. FIG. 4 is a Schedule of Assessments in the treatment of ndGBM. The Schedule is organized into consecutive phases (Screening, 1stSurgery, Booster, CED Catheter Placement, NeoAdjuvant Therapy, Max Safe Tissue Collection, SoC Therapy) that are tracked over Weeks, Days, and Visits. FIG.5 is a Schedule of Assessments in the treatment of rGBM. The Schedule is organized into consecutive phases (Surgery, Screening, Booster, CED Catheter Placement, NeoAdjuvant Therapy, Max Safe Tissue Collection, SoC Therapy) that are tracked over Weeks, Days, and Visits. FIG.6A is immunohistochemistry (IHC) staining of a cortical section of hCD155-tg mouse brain for pan-microglial marker Iba1 after mock infusion into ipsilateral putamen (reproduced from Yang, Y. et al. Polio virotherapy targets the malignant glioma myeloid infiltrate with diffuse microglia activation engulfing the CNS. Neuro Oncol.25(9):1631-1643(2023 Sep 5)). The imaged ipsilateral cortex section was anatomically distant from the needle track. FIG.6B is IHC staining of a cortical section of hCD155-tg mouse brain for pan-microglial marker Iba1 after PVSRIPO infusion into ipsilateral putamen distant from the needle track (reproduced from Yang, Y. et al. (2023 Sep 5)). Iba1+ / Tmem119- cells are indicated by arrows (◄), likely PVSRIPO-activated meningeal CNS-associated macrophages (CaM). The imaged ipsilateral cortex section was anatomically distant from the needle track. Iba1+ microglia with increased cytoplasm and broad, thickened ramified processes in PVSRIPO-treated brains were evident. FIG. 7A is IHC staining of a cortical section of hCD155-tg mouse brain for microglial- specific marker Tmem119 after mock infusion into ipsilateral putamen (reproduced from Yang, Y. et al. (2023 Sep 5)). The imaged ipsilateral cortex section was anatomically distant from the needle track. FIG. 7B is IHC staining of a cortical section of hCD155-tg mouse brain for microglial- specific marker Tmem119 after PVSRIPO infusion into ipsilateral putamen distant from the needle track (reproduced from Yang, Y. et al. (2023 Sep 5)). Iba1+ / Tmem119- cells are indicated by arrows (◄), likely PVSRIPO-activated meningeal CNS-associated macrophages (CaM). The imaged ipsilateral cortex section was anatomically distant from the needle track. Tmem119+ microglia with increased cytoplasm and broad, thickened ramified processes in PVSRIPO-treated brains were evident. FIG. 8A is a rRT-qPCR assay of PVSRIPO RNA in CD11b+ bead-isolated microglia. Approximately ~93-95% CX3CR1+ / CD11b+ isolation was achieved. Microglia from mouse brain were infected with PVSRIPO in vitro, then total RNA was collected at the indicated times on the x-axis, and was tested by RT-qPCR. Fold change of PVSRIPO RNA over mock, normalized for GAPDH mRNA, is represented on the y-axis (****, p-value ≤ 0.0001). FIG. 8B is rRT-qPCR assay of PVSRIPO RNA in CD11b+ bead-isolated microglia. Approximately ~93-95% CX3CR1+ / CD11b+ isolation was achieved. Microglia from human brain were infected with PVSRIPO in vitro, then total RNA was collected at the indicated times on the x-axis, and was tested by RT-qPCR. Fold change of PVSRIPO RNA over mock, normalized for GAPDH mRNA, is represented on the y-axis (***, p-value ≤ 0.001; ****, p-value ≤ 0.0001). FIG. 8C is an RT-qPCR assay of PVSRIPO vRNA in microglia isolated from CT2A glioma-bearing brains of hCD155-tg mice treated with intratumoral PVSRIPO. Microglia from human brain were isolated from the ipsilateral hemisphere or contralateral hemisphere collected at the indicated times on the x-axis, and tested for vRNA by RT-qPCR. Fold change of PVSRIPO RNA over mock, normalized for GAPDH mRNA, is represented on the y-axis. FIG. 9A is DAPI nuclei staining of human microglia infected with PVSRIPO for the indicated periods (0h, 24h, 48h, 72h, and 96h). FIG. 9B is fluorescence in situ hybridization (FISH) of minus-strand vRNA in human microglia infected with PVSRIPO for the indicated periods (0h, 24h, 48h, 72h, and 96h). FIG.9C is FISH of plus-strand vRNA in human microglia infected with PVSRIPO for the indicated periods. The delayed, protracted appearance of plus-strand vRNA over 48h-96h periods is noted. FIG.10 is a microglia phagocytosis assay illustrating hCD155-tg mouse microglia infected with PVSRIPO (left) or mock (right) and exposed to UV-irradiated (syngeneic), trace-labeled CT2A glioma cells. Phagocytosis was tracked by flow cytometry over time (0h, 24h, 48h, 72h, and 96h), wherein percentages indicate the proportion of trace label-positive events. FIG. 11A is a graph illustrating that tandem repeat intratumor PVSRIPO administration yielded significantly improved survival in CT2A mouse gliomas tumors. PVR transgenic C57BL6 mice were immunized against polio at -45 and -30 days prior to CT2A implantation (as described in Brown, M.C. et al. Intratumor childhood vaccine-specific CD4(+) T-cell recall coordinates antitumor CD8(+) T cells and eosinophils. J Immunother Cancer.11(2023)). Intracranial CT2A gliomas were implanted and treated intratumorally with control solution or with PVSRIPO (as described in Yang, Y. et al. Polio virotherapy targets the malignant glioma myeloid infiltrate with diffuse microglia activation engulfing the CNS. Neuro Oncol.25:1631-1643 (2023)) either once 7 days post implantation or twice at days 7 and 10. PVSRIPO administration is illustrated by arrows underneath the x-axis. Survival is shown; p-value is from Mantel-Cox log-rank test. FIG.11B is a graph illustrating B16 mouse melanoma tumor volume following PVSRIPO therapy. Subcutaneous B16 melanoma tumors were established in PVR transgenic C57BL6 mice and treated with a single dose of mock (left panel) or PVSRIPO (right panel) on days 8 (day 0 post treatment) and 12 (day 4 post-treatment) as shown as shown by arrows underneath the x-axis. Tumor volume of individual mice is shown on the y-axis. FIG.11C is a graph illustrating B16 mouse melanoma tumor volume following PVSRIPO therapy. Subcutaneous B16 melanoma tumors were established in PVR transgenic C57BL6 mice and treated with a double dose of mock (left panel) or PVSRIPO (right panel) on days 8 (day 0 post treatment) and 12 (day 4 post-treatment) as shown by arrows underneath the x-axis. Tumor volume of individual mice is shown on the y-axis. FIG. 12A is a graph illustrating tumor survival of B16 tumors on the y-axis that were treated with single administration of either mock solution by the intratumoral (i.t.) route (Group 1), intranodal (i.n.) route (Group 3), or peritumoral (p.t.) route (Group 5), or single PVSRIPO administration at 3x108TCID by the i.t. route (Group 2), i.n. route (Group 4), or p.t. route (Group 6). Tumor progression was monitored over several days following administration, as represented on the x-axis. FIG.12B is a graph of the probability of survival of tandem repeat intratumoral mock or PVSRIPO administered on days 6 and 10 followed by perilymphatic mock or PVSRIPO administered on days 10, 13, 16, and 19 in mouse CT2A glioma as shown. Dual intratumor and perilymphatic mock administration comprised Group 1; a mock intratumor and PVSRIPO perilymphatic administration schedule comprised Group 2; a PVSRIPO intratumor and mock perilymphatic administration schedule comprised Group 3; dual intratumor and perilymphatic PVSRIPO administration comprised Group 4. Mice were polio-immunized prior to the assay. DETAILED DESCRIPTION OF THE INVENTION The present invention provides methods for treating a human having a ndGBM or rGBM through multiple, high dose administrations of lerapolturev following surgical resection, for example, maximal surgical resection. In some embodiments, the multiple, high dose administration of lerapolturev include administration by cervical perilymphatic subcutaneous injection or direct intracavitary infusion. Terminology Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. Each of the references cited herein are incorporated by reference in its entirety. The terms “a” and “an” do not denote a limitation of quantity, but rather denote the presence of at least one of the referenced item. The term “or” means “and / or”. Recitation of ranges of values are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. The endpoints of all ranges are included within the range and independently combinable. All methods described herein can be performed in a suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of examples, or exemplary language (e.g., “such as”), is intended merely to better illustrate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. Unless defined otherwise, technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which this invention belongs. As used herein, the term “about” means + / - 10%. An “effective amount” as used herein, means an amount which provides a therapeutic or prophylactic benefit. As used herein, the term “immune checkpoint inhibitor (ICI)” refers to therapy targeting immune checkpoint proteins, key regulators of the immune system that when expressed can dampen the immune response to an immunologic stimulus. The term as used herein refers to ICIs targeting individual immune checkpoint proteins as well as ICI combinations devised to simultaneously target multiple immune checkpoint proteins. Some cancers express ligands for the checkpoint inhibitors and can protect themselves from attack by binding to immune checkpoint targets. ICIs block inhibitory checkpoints, restoring immune system function. ICIs include those targeting immune checkpoint proteins such as PD-1, PD-1 Ligand-1 (PD-L1), PD-1 Ligand-2 (PD- L2), CTLA-4, LAG-3, TIM-3, and V-domain Ig suppressor of T-cell activation (VISTA), B7- H3 / CD276, indoleamine 2,3-dioxygenase (IDO), killer immunoglobulin-like receptors (KIRs), carcinoembryonic antigen cell adhesion molecules (CEACAM) such as CEACAM-1, CEACAM- 3, and CEACAM-5, sialic acid-binding immunoglobulin-like lectin 15 (Siglec-15), T cell immunoreceptor with Ig and ITIM domains (TIGIT), and B and T lymphocyte attenuator (BTLA) protein. Immune checkpoint inhibitors are known in the art. As used herein, the term “overall survival (OS)” refers to the time from infusion of a chimeric poliovirus to death from any cause, or last follow-up if participant is alive. The “patient” or “subject” or “participant” treated is typically a human, although it is to be understood the methods described herein are effective with respect to other animals, such as mammals. More particularly, the term patient can include animals used in assays such as those used in preclinical testing including but not limited to mice, rats, monkeys, dogs, pigs, and rabbits; as well as domesticated swine (pigs and hogs), ruminants, equine, poultry, felines, bovines, murines, canines, and the like. The terms “percent identical”, “percent homologous”, or “percent similarity”, and the like, when used in the context of nucleic acid sequences refers to the residues in the two sequences being compared which are the same when aligned for maximum correspondence. The length of sequence identity comparison may be over the full-length of the sequence, or, or alternatively a fragment of at least about 50 to 2500 nucleotides. Similarly, the terms “percent identical,” “percent homologous,” or “percent similarity”, may be readily determined for amino acid sequences, over the full-length of a protein, or a fragment thereof. Suitably, a fragment is at least about 8 amino acids in length and may be up to about 7500 amino acids. Examples of suitable fragments are described herein. Generally, “identity”, “homology” or “similarity” is determined in reference to “aligned” sequences. “Aligned” sequences or “alignments” refer to multiple nucleic acid sequences or protein (amino acids) sequences, often containing corrections for missing or additional bases or amino acids as compared to a reference sequence. Alignments can be performed using any of a variety of publicly or commercially available Multiple Sequence Alignment Programs. Examples of such programs include, “Clustal Omega”, “Clustal W”, “CAP Sequence Assembly”, “MAP”, and “MEME”, which are accessible through Web Servers on the internet. Other sources for such programs are known to those of skill in the art. Alternatively, Vector NTI utilities are also used. There are also a number of algorithms known in the art that can be used to measure nucleotide sequence identity, including those contained in the programs described above. As another example, polynucleotide sequences can be compared using Fasta™, a program in GCG Version 6.1. Fasta™ provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences. For instance, percent sequence identity between nucleic acid sequences can be determined using Fasta™ with its default parameters (a word size of 6 and the NOPAM factor for the scoring matrix) as provided in GCG Version 6.1, herein incorporated by reference. Multiple sequence alignment programs are also available for amino acid sequences, e.g., the “Clustal Omega”, “Clustal X”, “MAP”, “PIMA”, “MSA”, “BLOCKMAKER”, “MEME”, and “Match-Box” programs. Generally, any of these programs are used at default settings, although one of skill in the art can alter these settings as needed. Alternatively, one of skill in the art can utilize another algorithm or computer program which provides at least the level of identity or alignment as that provided by the referenced algorithms and programs. See, e.g., J. D. Thomson et al, Nucl. Acids. Res., “A comprehensive comparison of multiple sequence alignments”, 27(13):2682-2690 (1999). As used herein, the term “progression-free survival (PFS)” refers to the time (i.e., number of months) from treatment group assignment until date of documented radiologic disease progression per Response Assessment in Neuro-Oncology (RANO) or death due to any cause, whichever comes first. As used herein, the term “progressive disease (PD)” refers to a need for additional therapy to manage neurologic symptoms triggered by the GBM in excess of low-dose bevacizumab (5 mg / kg IV every 2 weeks or 5-7.5 mg / kg every 3 weeks). As used herein, the term “response evaluation criteria (RANO)” refers to a guideline that describes a standard approach to GBM measurements and definitions for objective change in tumor size for use in trials (Wen et al. J Clin Oncol.28:1963-1972 (2010)). As used herein, the term “stable disease (SD)” refers to neither PR or PD occurring when evaluating target lesions per RANO. To “treat” a disease as the term is used herein, means to reduce the frequency or severity of at least one sign or symptom of a disease, disorder, or side-effect experienced by a patient (i.e., palliative treatment) or to decrease a cause or effect of the disease, disorder (i.e., disease-modifying treatment), or side effect experienced by a patient as a result of the administration of a therapeutic agent. For live viral products, such as PVSRIPO, dosage is typically expressed in plaque forming units or TCID50. As used herein TCID50 refers to 50% Tissue Culture Infectious Dose. Assays for determining TCID50are well known (see, e.g., Souf, S. Recent advances in diagnostic testing for viral infections. Biosci. Horizons Int. J. Student Res. 9, (2016); Pellet, E. P. et al. Basics of virology. Handb. Clin. Neurol.123, 45-66 (2014); Gelderblom, H. R. Structure and Classification of Viruses. Medical Microbiology. 4thedition, chapter 41, (1996); Reed, L. J.; Muench, H. A Simple Method of Estimating Fifty Per Cent Endpoints. Am. J. Epidemiol. 27, 493-497 (1938); Lei, C. et al. On the Calculation of TCID50 for Quantitation of Virus Infectivity. Virol. Sin.36(1), 141-144 (2021)). The TCID50 is analogous (and often quantitatively similar) to the plaque-forming units (PFU) assay. A particular assay suitable for determining TCID50herein is described in US Patent No.10,954,492, incorporated by reference herein. Another suitable assay for determining TCID50 herein is described in the NIH Biopharmaceutical Development Program (BDP) Standard Operating Procedure (SOP) 22165 TCID50Assay for Poliovirus using Hep-2C Cells. Throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and should not be construed as a limitation on the scope of the invention. The description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range. Chimeric Poliovirus Methods for treating GBM are provided herein comprising administering to a patient, generally a human, an effective amount of a chimeric poliovirus. In one embodiment, the chimeric poliovirus is a modified serotype 1 live attenuated (Sabin) PV vaccine (PV1S) with the cognate internal ribosome entry site (IRES) replaced with that of human rhinovirus type 2 (HRV2), for example lerapolturev, also known as PVSRIPO. The nucleic acid sequence of lerapolturev is provided in Table 1 (SEQ ID NO:1). Lerapolturev is a recombinant rhinovirus / poliovirus chimera developed to treat patients with solid tumor cancers. The foreign IRES of PVSRIPO causes profound attenuation of cytopathogenicity: a failure to recruit host ribosomes, to carry out immediate translation of viral genomes, to counter host innate antiviral defenses, and to produce infectious viral progeny in normal human host cells targeted by poliovirus. This includes neurons, accounting for the ablation of neurovirulence and absence of polio-related neurologic injury associated with extremely high dose intrathalamic administration of PVSRIPO in non-human primates (Dobrikova et al. J Virol. 86(5):2750-9(2012)). It also includes myeloid APCs, such as DCs, macrophages and microglia naturally targeted by poliovirus. PVSRIPO lacks cytopathogenicity in myeloid APCs and causes potent, sustained defensive innate inflammatory reactions upon infection of such cells. These innate inflammatory programs in myeloid APCs constitute part of the mechanistic basis for PVSRIPO immunotherapy (Brown, M. C. et al. Cancer immunotherapy with recombinant poliovirus induces IFN-dominant activation of dendritic cells and tumor antigen-specific CTLs. Sci Transl Med. 9(408)(2017); and Brown, M. C. et al. Viral infection of cells within the tumor microenvironment mediates antitumor immunotherapy via selective TBK1-IRF3 signaling. Nat Communications.12(1)(2021)). Lerapolturev exhibits selective infectivity and inflammatory cytopathogenicity towards CD155-expressing neoplastic cells, which includes malignant cells of virtually all solid tumors (Luo et al. Front Oncol. 11:660273(2021); Takai et al. Nat Rev Mol Cell Biol. 9:603-15(2008); Chandramohan et al. Arch Pathol Lab Med. 141(12):1697-1704(2017); Liu et al. 11(15):5463- 82(2019); Masson et al. Gut.49:236-40(2001); Bevelacqua et al. Oncotarget.3(8):882-92(2012); Carlsten et al. J Immunol.183(8):4921-30(2009); Nishiwada et al. Anticancer Research.35:2287- 98(2015); Sun et al. International Immunopharmacology. 80:106198(2020); Zhang et al. Urol Oncol. 38(2):41(2020)). Among these CD155-expressing solid tumors are malignant gliomas, including both newly diagnosed glioblastoma (ndGBM) and rGBM. Table 1. Lerapolturev / PVSRIPO Sequence SEQ ID NO: Sequence 1 - ttaaaacagctctggggttgtacccaccccagaggcccacgtggcggctagtactccggtattgcggtacccttgtacgcctgttttatactcc c at c t tc gc aa g at cg ta cc ct gg ga tt a a tt c gc ac ac at gg ac tt a tg c tt tt gt ga tt g caacgcaggggtgtactactgcgagtctagaaggaaatactacccagtatccttcgttggcccaacgttccagtacatggaggctaataact attacccagctaggtaccagtcccatatgctcattggccatggattcgcatctccaggggattgtggtggcatactcagatgtcaccacgggg tgatagggatcattactgctggtggagaagggttggttgcatttacagacattagagacttgtatgcctacgaagaagaagccatggaacaa tg ac tc at c tt ga c cc tg gtt cc ac a a g gc aa g tc tc ac cg ca tg ct gc a ga a at ct ac ac ca aa g ac Lerapolturev has tropism towards major components of the tumor and tumor microenvironment (TME), capable of infecting and promoting innate immune stimulation of not only tumor cells, but of CD155-expressing infiltrating monocytes, macrophages, and DCs (Freistadt et al. Virology. 195:798-803(1993)). Malignant cells of virtually all solid tumors, including GBM, exhibit increased CD155 receptor expression (Luo et al. Front Oncol. 11:660273(2021); Takai et al. Nat Rev Mol Cell Biol.9:603-15(2008); Chandramohan et al. Arch Pathol Lab Med.141(12):1697-1704(2017); Liu et al.11(15):5463-82(2019); Masson et al. Gut. 49:236-40(2001); Bevelacqua et al. Oncotarget. 3(8):882-92(2012); Carlsten et al. J Immunol. 183(8):4921-30(2009); Nishiwada et al. Anticancer Research. 35:2287-98(2015); Sun et al. International Immunopharmacology.80:106198(2020); Zhang et al. Urol Oncol.38(2):41(2020)). Recently it was shown that GBM demonstrates significantly upregulated CD155 expression which was found to be associated with poorer survival probability in humans (Luo et al. Front Oncol. 11:660273(2021)). GBMs with high CD155 expression also had significantly increased CD8+ T cell, neutrophil, macrophage, and dendritic cell tumor infiltration when compared with low CD155 expressing tumors (Luo et al. Front Oncol. 11:660273(2021)). Reflecting the natural tropism of poliovirus for myeloid APCs in humans, by virtue of CD155 expression, lerapolturev infects APCs / DCs in treated tumors, leading to the upregulation of antigen presentation (Brown et al. Science Translational Medicine. 9(408)(2017)) and the triggering of Type 1 interferon (IFN) inflammation in the TME (Brown et al. Science Translational Medicine.9(408)(2017); Yang et al. Neuro-Oncology. noad052 (2023); Brown et al. Nature Communications. 12(1)(2021)), mechanisms of lerapolturev that have been directly shown to contribute to antitumor efficacy and antitumor T cell priming in murine tumor models (Brown et al. Nature Communications. 12(1)(2021)). Glioblastoma Types The methods described herein are used to treat a human with glioblastoma. In some embodiments, the glioblastoma is a newly diagnosed glioblastoma (ndGBM). In some embodiments, the glioblastoma is a recurrent glioblastoma (rGBM). In some embodiments, the human is an adult with a low risk of disease recurrence and progression. In some embodiments, the human is an adult with a high risk of disease recurrence and progression. In some embodiments, GBM recurrence or progression is confirmed by methods, for example histological and / or MRI imaging methods, known to persons skilled in the art. In some embodiments, the GBM harbors an unmethylated MGMT promoter. In some embodiment, the GBM harbors a methylated MGMT promoter. In some embodiments, the GBM is non-enhanced and better assessed by magnetic resonance imaging (MRI) using FLAIR sequences. In some embodiments, the glioblastoma is a glioblastoma previously treated with glioblastoma standard of care therapy. In some embodiments, the glioblastoma standard of care therapy comprises radiation therapy and chemotherapy, followed by chemotherapy (e.g. temozolomide). In some embodiments, the glioblastoma is a glioblastoma previously treated with PD-1 and / or PD-L1 inhibitor therapy. In some embodiments, the glioblastoma is a glioblastoma previously treated with antiangiogenic therapy. In some embodiments, the glioblastoma is a glioblastoma previously treated with small molecule inhibitor. In some embodiments, the glioblastoma is a glioblastoma previously treated with an investigational agent. In some embodiments, the glioblastoma is a glioblastoma previously treated with tumor treating field. Promoter MGMT Methylation Status Promoter MGMT methylation status can be determined using methods known to persons skilled in the art as described in Mansouri, A. et al. MGMT promoter methylation status testing to guide therapy for glioblastoma: refining the approach based on emerging evidence and current challenges. Neuro Oncol. 21(2):167-178(2019 Feb) (incorporated herein by reference). These methods include but are not limited to reverse transcriptase PCR (RT-PCR), immunohistochemistry (IHC), methylation-specific PCR (MS-PCR), and pyrosequencing (PSQ). MS-PCR, for example, comprises bisulfite conversion of DNA isolated from formalin-fixed, paraffin-embedded tumor tissue followed by parallel amplification of the eight CpG islands within the MGMT gene promoter, as well as a region of the beta-actin gene (ACTB) as control. Binary “methylated” and “unmethylated” score cutoffs, while effective at dichotomizing overall survival values among the two groups of patients, are less predictive of response to adjuvant chemotherapy (temozolomide) (Malmström, A. et al. Nordic Clinical Brain Tumour Study Group (NCBTSG). Temozolomide versus standard 6-week radiotherapy versus hypofractionated radiotherapy in patients older than 60 years with glioblastoma: the Nordic randomised, phase 3 trial. Lancet Oncol. 13(9):916-926(2012 Sep)). Tiered MGMT methylation score ranges are demonstrated as more predictive of temozolomide response, as patients with high methylation scores correlate with increased clinical benefit from standard of care therapies comprising temozolomide, whereas patients with intermediate to low methylation scores had progressively decreased clinical benefit from the addition of temozolomide (Hegi, M.E. et al. MGMT promoter methylation cutoff with safety margin for selecting glioblastoma patients into trials omitting temozolomide: a pooled analysis of four clinical trials. Clin Cancer Res. 25(6):1809-1816(2019)); Kamson, D.O. & Grossman, S.A. The Role of Temozolomide in Patients With Newly Diagnosed Wild-Type IDH, Unmethylated MGMTp Glioblastoma During the COVID-19 Pandemic. JAMA Oncol.7(5):675- 676(2021)). For example, log2[1,000 × (MGMT+1) / ACTB] values are used to categorize patients into methylated (>1.27), partially methylated (>−0.28, ≤1.27), and truly unmethylated (≤-0.28) (Hegi, M.E. et al. MGMT promoter methylation cutoff with safety margin for selecting glioblastoma patients into trials omitting temozolomide: a pooled analysis of four clinical trials. Clin Cancer Res.25(6):1809-1816(2019)). T2-weighted-Fluid-Attenuated Inversion Recovery (T2 / FLAIR) imaging Magnetic resonance imaging (MRI) of glioblastoma tumors reveals contrast-enhancing (CE) lesions by the use of T1 weighted post contrast sequences, while the extent of non-enhancing disease is better assessed using the Fluid-attenuated inversion recovery (FLAIR) T2 weighted (T2 / FLAIR) sequences. T2 / FLAIR weighted images involve the suppression of T2 signal from cerebrospinal fluid (CSF), giving greater CE signal. These abnormal signaling, non-enhancing residual areas are enriched with malignant tumor cells capable of rapidly proliferating and evolving into CE lesions that threaten survival if left untreated (Choi, Y. et al.. Analysis of heterogeneity of peritumoral T2 hyperintensity in patients with pretreatment glioblastoma: prognostic value of MRI-based radiomics. Eur J Radiol.120:108642(2019); Lundy, P. et al. The role of imaging for the management of newly diagnosed glioblastoma in adults: a systematic review and evidence- based clinical practice guideline update. J Neurooncol.150:95–120(2020); Gatson, N. et al. Early imaging marker of progressing glioblastoma: a window of opportunity. J Neurooncol. 148:629– 40(2020)). In some embodiments, the GBM comprises a contrast-enhancing (CE) by T1 weighted contrasted sequences and non-enhancing disease by fluid-attenuated inversion recovery (FLAIR) sequences. In some embodiments, the GBM tumor is a contrast-enhancing (CED) GBM tumor that is maximally surgically resected. In some embodiments, the residual GBM tumor is a residual tumor with a non-enhancing fluid-attenuated inversion recovery (FLAIR) signal. Previous Exposure to Glioblastoma Treatments In some embodiments, the patient has rGBM and was previously treated with a therapy selected from radiation therapy, a chemotherapeutic agent, an immune checkpoint inhibitor (ICI), antiangiogenic therapy, oncolytic virus, small molecule inhibitor, investigational product, tumor treating field, or a combination thereof. In some embodiments, the patient has rGBM and was previously treated with one or more chemotherapeutic agent. Previously administered chemotherapeutic agents include, but are not limited to, alkylating agents, nitrosoureas, alkyl sulfonates, platinum-based chemotherapeutic drugs, and triazenes. In some embodiments, the chemotherapeutic agent is a platinum-based drug. In some embodiments, the chemotherapeutic agent is one or more platinum-based drug in combination with one or more non-platinum-based drug. In some embodiments, the previously administered one or more chemotherapeutic agent is selected from cyclophosphamide, mechlorethamine, mustine (HN2), uramustine, uracil mustard, melphalan, chlorambucil, ifosfamide, bendamustine, carmustine, lomustine, streptozocin, busulfan, cisplatin, carboplatin, nedaplatin, oxaliplatin, satraplatin, triplatin tetranitrate, procarbazine, altretamine, dacarbazine, mitozolomide, temozolomide, or a combination thereof. In some embodiments, the previously administered one or more chemotherapeutic agent is selected from cisplatin, carboplatin, oxaliplatin, gemcitabine, doxorubicin, docetaxel, methotrexate, vinblastine, cabazitaxel, or a combination thereof. In some embodiments, the platinum-based drug comprises cisplatin. In some embodiments, the platinum-based drug comprises carboplatin. In some embodiments, the platinum-based drug comprises oxaliplatin. In some embodiments, the one or more chemotherapeutic agent is temozolomide. In some embodiments, the patient has rGBM and was previously treated with radiation therapy. In some embodiments, the patient was previously treated with external-beam radiation therapy. In some embodiments, the patient was previously treated with intraoperative radiation therapy. In some embodiments, the patient was previously treated with image guided radiation therapy. In some embodiments, the patient was previously treated with intensity-modulated radiation therapy. In some embodiments, the patient was previously treated with x-ray beam radiation. In some embodiments, the patient has rGBM and was previously treated with radiation therapy in combination with temozolomide. In some embodiments, the patient has rGBM and was previously treated with an immune checkpoint inhibitor (ICI). In some embodiments, the immune checkpoint inhibitor (ICI) is selected from a PD-1 inhibitor or a PD-L1 inhibitor. In some embodiments, the immune checkpoint inhibitor (ICI) is an PD-1 inhibitor. In some embodiments, the PD-1 inhibitor is selected from pembrolizumab or nivolumab. In some embodiments, the PD-1 inhibitor is pembrolizumab. In some embodiments, the PD-1 inhibitor is nivolumab. In some embodiments, the ICI is a PD-L1 inhibitor. In some embodiments, the PD-L1 inhibitor is selected from atezolizumab, durvalumab, or avelumab. In some embodiments, the PD-L1 inhibitor is atezolizumab. In some embodiments, the PD-L1 inhibitor is durvalumab. In some embodiments, the PD-L1 inhibitor is avelumab. In some embodiments, the PD-1 or the PD-L1 inhibitor is combined with another ICI, eg. a LAG-3 inhibitor (opdualag). In some embodiments, the patient has rGBM and was previously treated with a glioblastoma standard of care therapy. In some embodiments, the glioblastoma standard of care therapy comprises radiation therapy and chemotherapy, followed by adjuvant chemotherapy (e.g. temozolomide). Treatment of Newly Diagnosed Glioblastoma In one aspect, described herein is a method of treating a human patient having newly diagnosed glioblastoma (ndGBM) following a first surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster at least about two weeks following the first surgical resection of the one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated about 1 week following the administration of the polio-vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev into the first surgical resection site on day 1 of the 1-week cycle to treat a residual GBM tumor, and optionally again on day 5 of the 1-week cycle; and (iii) a second treatment phase, wherein a) the patient undergoes a second surgical resection of one or more residual GBM tumors about 5 weeks following the initiation of the first treatment phase, and b) wherein, following the second surgical resection, the patient is further administered an effective amount of lerapolturev into the second surgical resected site by cavity wall injection or optionally by convection enhanced delivery (CED). In one aspect, described herein is a method of treating a human patient having newly diagnosed glioblastoma (ndGBM) following a first surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster at least about two weeks following the first surgical resection of the one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated at least about 1 week following the administration of the polio-vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev into the first surgical resection site on day 1 and day 5 of the 1-week cycle to treat a residual GBM tumor,; and (iii) a second treatment phase, wherein a) the patient undergoes a second surgical resection of one or more residual GBM tumors about 5 weeks following the initiation of the first treatment phase, and b) wherein, following the second surgical resection, the patient is further administered an effective amount of lerapolturev into the second surgical resected site by cavity wall injection or optionally by convection enhanced delivery (CED). In one aspect, described herein is a method of treating a human patient having newly diagnosed glioblastoma (ndGBM) following a first surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster at least about two weeks following the first surgical resection of the one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated at least about 1 week following the administration of the polio-vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev into the first surgical resection site on day 1 of the 1-week cycle to treat a residual GBM tumor, and optionally again on day 5 of the 1-week cycle; (iii) a second treatment phase, wherein the second treatment phase is initiated about 1 week following the cessation of the first treatment phase, wherein the second treatment phase comprises administering an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection once weekly for four consecutive weeks; and, (iv) a third treatment phase, wherein a) the patient undergoes a second surgical resection of one or more residual GBM tumors about 5 weeks following the initiation of the first treatment phase and about 1 week following the cessation of the second treatment phase, and b) wherein, following the second surgical resection, the patient is further administered an effective amount of lerapolturev into the second surgical resected site by cavity wall injection or optionally by convection enhanced delivery (CED). In some embodiment of the above methods for treating ndGBM, the first treatment phase comprises a single, 1-week cycle. In some embodiments, the first treatment phase comprises one or more treatment cycles, for example, 2, 3, 4, or more than 51-week treatment cycles. In some embodiments, the ndGBM harbors an unmethylated O6-methylguanine-DNA methyltransferase promoter (MGMTp). In some embodiments, the ndGBM harbors a partially methylated O6- methylguanine-DNA methyltransferase promoter (MGMTp). In some embodiments, the ndGBM harbors a methylated O6-methylguanine-DNA methyltransferase promoter (MGMTp). In some embodiments, the residual GBM tumor is a residual tumor with a non-enhancing fluid-attenuated inversion recovery (FLAIR) signal. In some embodiments, the method is administered as a first- line (1L) therapy. In some embodiments, lerapolturev is administered in a dose of between about 1x108TCID50and 5x108TCID50. In some embodiments, lerapolturev is administered in a dose of about 2x108TCID50. In some embodiments, the patient is further administered temozolomide during the first treatment phase at a standard of care dose. In some embodiments, following the second treatment phase, the patient undergoes radiation treatment. In some embodiments, the patient is further administered an immune checkpoint inhibitor. In another aspect, described herein is a method of treating a human patient having newly diagnosed glioblastoma (ndGBM) following maximal safe surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster following maximal safe surgical resection of the one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated at least 1 week (but not more than 6 weeks) following the administration of the polio-vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev on day 1 of the cycle—following placement of the CED catheter into the residual infiltrative disease; via direct injection of the resection cavity wall; or via an Ommaya reservoir installed in the post-resection cavity; and (iii) an optional second treatment phase, wherein a) the patient undergoes a second surgical resection of one or more residual GBM tumors at any interval 5-weeks or after the initiation of the first treatment phase, and b) wherein, following the second surgical resection, the patient is further administered an effective amount of lerapolturev into the surgical resection site on day 1 of the cycle—following placement of the CED catheter into the residual infiltrative disease; via direct injection of the resection cavity wall; or via an Ommaya reservoir installed in the post-resection cavity (whichever is deemed safer per the treating neurosurgeon)—and optionally again on day 5 of the one week cycle. In another aspect, described herein is a method of treating a human patient having newly diagnosed glioblastoma (ndGBM) following maximal safe surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster following maximal safe surgical resection of one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated at least 1 week (but not more than 6 weeks) following the administration of the polio-vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev on day 1 of the cycle—following placement of the CED catheter into the residual infiltrative disease, or via direct injection of the resection cavity wall—and optionally again on day 5 of the one week cycle; and (iii) an optional second treatment phase, wherein a) the patient undergoes a second surgical resection of one or more residual GBM tumors at any interval 5-weeks or after the initiation of the first treatment phase, and b) wherein, following the second surgical resection, the patient is further administered an effective amount of lerapolturev into the surgical resection site on day 1 of the cycle—following placement of the CED catheter into the residual infiltrative disease; via direct injection of the resection cavity wall; or via an Ommaya reservoir installed in the post-resection cavity (whichever is deemed safer per the treating neurosurgeon)—and optionally again on day 5 of the one week cycle. In another aspect, described herein is a method of treating a human patient having newly diagnosed glioblastoma (ndGBM) following maximal safe surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster following maximal safe surgical resection of the one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated at least 1 week (but no more than 6 weeks) following the administration of the polio-vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev on day 1 of the cycle—following placement of the CED catheter into the residual infiltrative disease, or via direct injection of the resection cavity wall—and optionally again on day 5 of the one week cycle; and (iii) a second treatment phase, wherein the second treatment phase is initiated about 1 week following the cessation of the first treatment phase, wherein the second treatment phase comprises administering an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection once weekly for four consecutive weeks; and, (iv) an optional third treatment phase, wherein a) the patient undergoes a second surgical resection of one or more residual GBM tumors at any interval 5-weeks or after the initiation of the first treatment phase, and b) wherein, following the second surgical resection, the patient is further administered an effective amount of lerapolturev into the surgical resection site on day 1 of the cycle—following placement of the CED catheter into the residual infiltrative disease; via direct injection of the resection cavity wall; or via an Ommaya reservoir installed in the post-resection cavity (whichever is deemed safer per the treating neurosurgeon)—and optionally again on day 5 of the one week cycle. In another aspect, described herein is a method of treating a human patient having newly diagnosed glioblastoma (ndGBM) following maximal safe surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster following maximal safe surgical resection of the one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated at least 1 week (but no more than 6 weeks) following the administration of the polio-vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev on day 1 of the cycle—following placement of the CED catheter into the residual infiltrative disease, or via direct injection of the resection cavity wall—and optionally again on day 5 of the one week cycle; and (iii) a second treatment phase, wherein the second treatment phase is initiated about 1 week following the cessation of the first treatment phase, wherein the second treatment phase comprises administering an effective amount of lerapolturev via direct intracavitary infusion via an Ommaya reservoir inserted into the surgical cavity, once weekly for four consecutive weeks, and; (iv) an optional third treatment phase, wherein a) the patient undergoes a second surgical resection of one or more residual GBM tumors at any interval 5-weeks or after the initiation of the first treatment phase, and b) wherein, following the second surgical resection, the patient is further administered an effective amount of lerapolturev into the surgical resection site on day 1 of the cycle—following placement of the CED catheter into the residual infiltrative disease; via direct injection of the resection cavity wall; or via an Ommaya reservoir installed in the post-resection cavity (whichever is deemed safer per the treating neurosurgeon)—and optionally again on day 5 of the one week cycle. In some embodiment of the above methods for treating ndGBM, the first treatment phase comprises a single, 1-week cycle. In some embodiments, the first treatment phase comprises one or more treatment cycles, for example, 2, 3, 4, or more than 51-week treatment cycles. In some embodiments, the ndGBM harbors an unmethylated O6-methylguanine-DNA methyltransferase promoter (MGMTp). In some embodiments, the ndGBM harbors a partially methylated O6- methylguanine-DNA methyltransferase promoter (MGMTp). In some embodiments, the ndGBM harbors a methylated O6-methylguanine-DNA methyltransferase promoter (MGMTp). In some embodiments, the residual GBM tumor is non-enhancing and best visualized on fluid-attenuated inversion recovery (FLAIR) MRI sequences. In some embodiments, the method is administered as a first-line (1L) therapy. In some embodiments, lerapolturev is administered in a dose of between about 1x108TCID50and 5x108TCID50. In some embodiments, lerapolturev is administered in a dose of about 2x108TCID50. In some embodiments, the patient is further administered temozolomide during the first treatment phase at a standard of care dose. In some embodiments, following the second treatment phase, the patient undergoes radiation treatment. In some embodiments, the patient is further administered an immune checkpoint inhibitor. In some alternative embodiments, the ndGBM patient is further administered an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection one or more times once every three weeks following the second surgical resection to further maintain the immune effector cell response. In some embodiments, an effective amount of lerapolturev is administered for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 times. In some alternative embodiments, the ndGBM patient is further administered an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection one or more times once every three weeks, four weeks, five weeks, six weeks, two months, three months, four months, or six months following the second surgical resection to further maintain the immune effector cell response. In some embodiments, an effective amount of lerapolturev is administered for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 times. In some alternative embodiments, the ndGBM patient is further administered an effective amount of lerapolturev via direct intracavitary injection via an Ommaya reservoir inserted into the surgical cavity every three weeks following the second surgical resection to further maintain the immune effector cell response. In some embodiments, an effective amount of lerapolturev is administered for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 times. In some alternative embodiments, the ndGBM patient is further administered an effective amount of lerapolturev via direct intracavitary injection via an Ommaya reservoir inserted into the surgical cavity one or more times once every three weeks, four weeks, five weeks, six weeks, two months, three months, four months, or six months following the second surgical resection to further maintain the immune effector cell response. In some embodiments, an effective amount of lerapolturev is administered for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 times. Treatment of Recurrent Glioblastoma In one aspect, described herein is a method of treating a human patient having recurrent (rGBM) following a surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster at least about two weeks following the surgical resection of the one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated at least about 1 week following the administration of the polio-vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycle comprising administering to the patient an effective amount of lerapolturev into the surgical resection site on day 1 and day 5 of the 1-week cycle to treat a residual GBM tumor; (iii) a second treatment phase, wherein the second treatment phase comprises administering to the patient once weekly for 4 consecutive weeks an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection, wherein the second treatment phase is administered following the cessation of the first treatment phase, and, (iv) a third treatment phase, wherein the third treatment phase comprises administering to the patient once every three weeks an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection, wherein the is administered following the cessation of the second treatment phase. In some embodiments, the first treatment cycle comprises a single 1-week treatment cycle. In some embodiments, the third treatment phase is administered once every three weeks for at least 6-months. In some embodiments, the third treatment phase is administered once every three weeks for at least 12-months. In some embodiments, the third treatment phase is administered once every three weeks for at least 15-months. In some embodiments, the rGBM harbors an unmethylated O6-methylguanine-DNA methyltransferase promoter (MGMTp). In some embodiments, the ndGBM harbors a partially methylated O6-methylguanine-DNA methyltransferase promoter (MGMTp). In some embodiments, the ndGBM harbors a methylated O6-methylguanine-DNA methyltransferase promoter (MGMTp). In some embodiments, the residual GBM tumor is a residual tumor with a non-enhancing fluid-attenuated inversion recovery (FLAIR) signal. In some embodiments, lerapolturev is administered in a dose of between about 1x108TCID50and 5x108TCID50. In some embodiments, lerapolturev is administered in a dose of about 1x108TCID50. In some embodiments, lerapolturev is administered in a dose of about 2x108TCID50. In some embodiments, the method further comprises administering an anti-cancer therapy selected from radiation therapy, a chemotherapeutic agent, an immune checkpoint inhibitor, antiangiogenic therapy, or a combination thereof. In some embodiments, the patient is further administered an immune checkpoint inhibitor. In some embodiments, the patient is further administered temozolomide. In some alternative embodiments, the rGBM patient is administered an effective amount of lerapolturev during the third treatment phase via cervical perilymphatic subcutaneous injection one or more times once every three weeks, four weeks, five weeks, six weeks, two months, three months, four months, or six months to further maintain the immune effector cell response. In some alternative embodiments, the rGBM patient is administered an effective amount of lerapolturev during the third treatment phase via cervical perilymphatic subcutaneous injection one or more times once every three weeks, four weeks, five weeks, six weeks, two months, three months, four months, or six months following the second surgical resection to further maintain the immune effector cell response. In some embodiments, an effective amount of lerapolturev is administered for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 times. In another aspect, described herein is a method of treating a human patient having recurrent (rGBM) following maximal safe surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster following the maximal safe surgical resection of one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated at least 1 week (but not more than 6 weeks) following the administration of the polio-vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev on day 1 of the 1-week cycle —following placement of the CED catheter into the residual infiltrative disease; via direct injection of the resection cavity wall; or via an Ommaya reservoir installed in the post-resection cavity—and optionally again on day 5 of the one week cycle. (iii) a second treatment phase, wherein the second treatment phase comprises administering to the patient once weekly for 4 consecutive weeks an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection, wherein the second treatment phase is administered following the cessation of the first treatment phase, and, (iv) a third treatment phase, wherein the third treatment phase comprises administering to the patient once every three weeks an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection, wherein the is administered following the cessation of the second treatment phase. In some embodiments, the first treatment cycle comprises a single 1-week treatment cycle. In some embodiments, the third treatment phase is administered once every three weeks for at least 6-months. In some embodiments, the third treatment phase is administered once every three weeks for at least 12-months. In some embodiments, the third treatment phase is administered once every three weeks for at least 15-months. In some embodiments, the residual GBM tumor is non- enhancing and best visualized on fluid-attenuated inversion recovery (FLAIR) MRI sequences. In some embodiments, lerapolturev is administered in a dose of between about 1x108TCID50and 5x108TCID50. In some embodiments, lerapolturev is administered in a dose of about 1x108TCID50. In some embodiments, lerapolturev is administered in a dose of about 2x108TCID50. In some embodiments, the method further comprises administering an anti-cancer therapy selected from radiation therapy, a chemotherapeutic agent, an immune checkpoint inhibitor, antiangiogenic therapy, small molecule inhibitor, investigational product, tumor treating field, or a combination thereof. In some embodiments, the patient is further administered an immune checkpoint inhibitor. In some embodiments, the patient is further administered temozolomide. In some alternative embodiments, the rGBM patient is administered an effective amount of lerapolturev during the third treatment phase via cervical perilymphatic subcutaneous injection one or more times once every three weeks, four weeks, five weeks, six weeks, two months, three months, four months, or six months to further maintain the immune effector cell response. In some embodiments, an effective amount of lerapolturev is administered for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 times. Combination Methods In some embodiments, the chimeric poliovirus is administered in combination with one or more anti-cancer therapies. In some embodiments, the anti-cancer therapy is selected from a chemotherapeutic agent, an immunomodulatory intravesical agent, radiation therapy, a therapeutic agent, immune checkpoint inhibitor, anti-angiogenic therapy, oncolytic virus, small molecule inhibitor, investigational product, tumor treating field, or a combination thereof. Treatment of Glioblastoma In an alternative aspect, provided herein is a method of treating a human patient having one or more GBM tumors, wherein the treatment comprises: (i) a first treatment phase comprising one or more treatment cycles comprising administration of an effective amount of lerapolturev to the human patient at least twice total; (ii) a second treatment phase comprising at least two or more weekly cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each weekly cycle. In some embodiments, the patient undergoes a first surgical resection of one or more GBM tumors prior to the first treatment phase. In some embodiments, the first surgical resection comprises maximal safe surgical resection. In some embodiments, a polio vaccine booster is administered to the human patient prior to the first treatment phase. In some embodiments, the polio vaccine booster is administered to the human patient at least about two weeks following the surgical resection. In some embodiments, the polio vaccine booster is administered to the human patient at least one week prior to the first treatment phase. In some embodiments, the first treatment phase is administered to the human patient between at least about one week and about 6 weeks following the administration of the polio vaccine booster. In some embodiments, the patient undergoes an additional surgical resection of one or more residual GBM tumors between the first and second treatment phases. In some embodiments, the second treatment phase is initiated about 1 week following the cessation of the first treatment phase. In some embodiments, the polio vaccine booster comprises a monovalent (type-1) oral polio vaccine. In some embodiments, the polio vaccine booster comprises a bivalent oral polio vaccine. In some embodiments, the polio vaccine booster comprises a trivalent oral polio vaccine. In some embodiments, the polio vaccine booster is the IPOL polio vaccine. In some embodiments, the first treatment phase comprises administration of an effective amount of lerapolturev on day 1 and day 5 of a single 1-week treatment cycle. In some embodiments, the first treatment phase comprises administration of an effective amount of lerapolturev on day 1 of two consecutive 1-week treatment cycles. In some embodiments, the second treatment phase comprises at least two or more weekly cycles. In some embodiments, the second treatment phase comprises at least three or weekly cycles. In some embodiments, the second treatment phase comprises at least four or more weekly cycles. In some embodiments, the method further comprises a third treatment phase, wherein the third treatment phase is administered following the cessation of the second treatment phase, and wherein the third treatment phase comprises at least two or more cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle. In some embodiments, the cycle of the third treatment phase is a three-week cycle, a four-week cycle, a five-week cycle, a six-week cycle, a two-month cycle, a three-month cycle, a four-month cycle, or a six-month cycle. In some embodiments, the third treatment phase comprises at least five or more three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle. In some embodiments, the third treatment phase comprises administering three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle, wherein the third treatment phase lasts for at least 6-months. In some embodiments, the third treatment phase comprises administering three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle, wherein the third treatment phase lasts for at least 12-months. In some embodiments, the third treatment phase comprises administering three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle, wherein the third treatment phase lasts for at least 15-months. In some embodiments, the lerapolturev administration during the first treatment phase comprises convection enhanced delivery (CED). In some embodiments, the lerapolturev administration during the first treatment phase comprises cavity wall injection. In some embodiments, the lerapolturev administration during the first treatment phase comprises direct infusion via an Ommaya reservoir into a surgical cavitary. In some embodiments, the perilymphatic administration comprises cervical perilymphatic subcutaneous injection. In some embodiments, the one or more GBM tumors comprise newly diagnosed glioblastoma (ndGBM). In some embodiments, the ndGBM harbors an unmethylated O6- methylguanine-DNA methyltransferase promoter (MGMTp). In some embodiments, the one or more GBM tumors comprise recurrent glioblastoma (rGBM). In some embodiments, the one or more residual GBM tumors are residual tumors with a non-enhancing fluid-attenuated inversion recovery (FLAIR) signal. In some embodiments, the method further comprises an additional GBM cancer therapy selected from a chemotherapy, a radiation, an immune checkpoint inhibitor (ICI), an antiangiogenic therapy, or a combination thereof. In some embodiments, the additional GBM cancer therapy comprises radiation therapy. In some embodiments, the additional GBM cancer therapy comprises a chemotherapeutic agent. In some embodiments, the chemotherapeutic agent is selected from temozolomide, carmustine, lomustine, nimustine, fotemustine, etoposide, dasatinib, temsirolimus, erlotinib, sorafenib, Panobinostat, vorinostat, or a combination thereof. In some embodiments, the chemotherapeutic agent is temozolomide. In some embodiments, the additional GBM cancer treatment comprises an immune checkpoint inhibitor (ICI). In some embodiments, the ICI is selected from a programmed cell death -1 (PD-1) inhibitor, a programmed cell death-ligand 1 (PD-L1) inhibitor, a cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) inhibitor, a lymphocyte-activation gene 3 (LAG-3) inhibitor, a T-cell immunoglobulin mucin-3 (TIM-3) inhibitor, a T cell immunoreceptor with Ig and ITIM domains (TIGIT) inhibitor, a V- domain Ig suppressor of T-cell activation (VISTA) inhibitor, a carcinoembryonic antigen cell adhesion molecule (CEACAM) inhibitor, a sialic acid-binding immunoglobulin-like lectin 15 (Siglec-15) inhibitor, a CD47 inhibitor, a CD39 inhibitor, or a B and T lymphocyte attenuator (BTLA) protein inhibitor, a B7-H3 / CD276 inhibitor, an indoleamine 2,3-dioxygenase (IDO) inhibitor, a killer immunoglobin-like receptor (KIR) inhibitor, or a combination thereof. In some embodiments, the ICI is administered at the standard recommended dose and schedule as described on an FDA approved label. In some embodiments, the additional GBM cancer treatment comprises administering an antiangiogenic therapy. In some embodiments, the antiangiogenic therapy is bevacizumab. In some embodiments, the method further comprises administering a GBM standard of care therapy following the cessation of the additional surgical resection. In some embodiments, the GBM standard of care therapy comprises administering to the human an effective amount of radiotherapy and an effective amount of temozolomide. In some embodiments, the method is administered as a first-line (1L) therapy. In some embodiments, the method is administered as a second-line (2L) therapy. In some embodiments, the method is administered as a third-line (3L) therapy. In some embodiments, lerapolturev is administered in a dose of between about 1x108TCID50 and 5x108TCID50. In some embodiments, lerapolturev is administered in a dose of about 1x108TCID50. In some embodiments, lerapolturev is administered in a dose of about 2x108TCID50. In some embodiments, lerapolturev is administered in a dose of about 4x108TCID50. In some embodiments, the treatment results in an improvement in progression free survival (PFS) in comparison to the predicted PFS in humans administered radiotherapy and / or temozolomide without a chimeric poliovirus. In some embodiments, the treatment results in an improvement in overall survival (OS) in comparison to the predicted OS in humans administered radiotherapy and / or temozolomide without a chimeric poliovirus. In some embodiments, the treatment results in an improvement in progression free survival (PFS) and / or overall survival (OS) in humans compared to the predicted PFS and / or OS in humans administered radiotherapy and / or temozolomide without a chimeric poliovirus. In some embodiments, the treatment results in enhanced anti-tumor efficacy in humans compared to humans administered radiotherapy and / or temozolomide without a chimeric poliovirus. Treatment of Solid Tumors In one aspect, provided herein is a method of treating a human patient having one or more solid tumors, wherein the treatment comprises: (i) a first treatment phase comprising one or more treatment cycles comprising administration of an effective amount of lerapolturev via injection into the solid tumor; (ii) a second treatment phase comprising at least one cycle comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each weekly cycle. In some embodiments, the patient undergoes a first surgical resection of one or more tumors prior to the first treatment phase. In some embodiments, the first surgical resection comprises maximal safe surgical resection. In some embodiments, a polio vaccine booster is administered to the human patient prior to the first treatment phase. In some embodiments, the polio vaccine booster is administered to the human patient at least about two weeks following the surgical resection. In some embodiments, the polio vaccine booster is administered to the human patient at least one week prior to the first treatment phase. In some embodiments, the first treatment phase is administered to the human patient between at least about one week and about 6 weeks following the administration of the polio vaccine booster. In some embodiments, the patient undergoes an additional surgical resection of one or more residual tumors between the first and second treatment phases. In some embodiments, the second treatment phase is initiated about 1 week following the cessation of the first treatment phase. In some embodiments, the first treatment phase comprises administration of an effective amount of lerapolturev on day 1 and day 5 of a single 1-week treatment cycle. In some embodiments, the first treatment phase comprises administration of an effective amount of lerapolturev on day 1 of two consecutive 1-week treatment cycles. In some embodiments, the second treatment phase comprises at least two or more weekly cycles. In some embodiments, the second treatment phase comprises at least three or weekly cycles. In some embodiments, the second treatment phase comprises at least four or more weekly cycles. In some embodiments, the method further comprises a third treatment phase, wherein the third treatment phase is administered following the cessation of the second treatment phase, and wherein the third treatment phase comprises at least two or more cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle. In some embodiments, the cycle of the third treatment phase is a three-week cycle, a four-week cycle, a five-week cycle, a six-week cycle, a two-month cycle, a three-month cycle, a four-month cycle, or a six-month cycle. In some embodiments, the third treatment phase comprises at least five or more three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle. In some embodiments, the third treatment phase comprises administering three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle, wherein the third treatment phase lasts for at least 6-months. In some embodiments, the third treatment phase comprises administering three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle, wherein the third treatment phase lasts for at least 12-months. In some embodiments, the third treatment phase comprises administering three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle, wherein the third treatment phase lasts for at least 15-months. In some embodiments, the lerapolturev injection into the solid tumor administration route is selected from intratumoral, intranodal, or peritumoral. In some embodiments, the lerapolturev injection into the solid tumor administration route is cavity wall injection. In some embodiments, the perilymphatic administration comprises cervical perilymphatic subcutaneous injection. In some embodiments, the one or more solid tumors comprise a cancer selected from glioblastoma multiforme (GBM), astrocytoma, oligodendroglioma, astro-oligodendroglioma, renal cell carcinoma, prostate cancer, bladder cancer, esophageal cancer, stomach cancer, pancreas cancer, colorectal cancer, liver cancer, gall bladder cancer, breast cancer, medulloblastoma, lung cancer, head and neck squamous cell carcinoma (HNSCC), melanoma, ovarian cancer, or sarcoma. In some embodiments, the solid tumor is a locally advanced, metastatic, or recurrent tumor. In some embodiments, the patient is administered according to the method described herein following evidence of apparent disease progression. In some embodiments, the one or more solid tumors comprise glioblastoma multiforme (GBM). In some embodiments, the GBM is newly-diagnosed GBM (ndGBM). In some embodiments, the GBM is recurrent GBM (rGBM). In some embodiments, the methods described herein are used to treat a human patient with astrocytoma. In some embodiments, the methods described herein are used to treat a human patient with oligodendroglioma. In some embodiments, the methods described herein are used to treat a patient with astro-oligodendroglioma. In some embodiments, the methods described herein are used to treat a human patient with medulloblastoma. In some embodiments, the one or more solid tumors comprise melanoma. In some embodiments, the melanoma is a PD-1 refractory melanoma. In some embodiments, the melanoma is an advanced PD-1 refractory melanoma. In some embodiments, the melanoma is a PD-L1 refractory melanoma. In some embodiments, the melanoma is PD-1 / -PD-L1 inhibitor refractory Stage 0-II Melanoma. In some embodiments, the melanoma is resectable Stage 0-II Melanoma. In some embodiments, the melanoma is resectable metastatic Stage III-IV Melanoma. In some embodiments, the melanoma is unresectable metastatic Stage III-IV Melanoma. In some embodiments, the melanoma is an PD-1 / PD-L1 inhibitor refractory unresectable metastatic Stage III-IV Melanoma. In some embodiments, the melanoma is PD-1 / PD-L1 inhibitor refractory resectable, metastatic Stage III-IV Melanoma. In some embodiments, the melanoma is refractory unresectable, metastatic Stage III-IV Melanoma. In some embodiments, the melanoma is a melanoma previously treated with PD-1 inhibitor and / or PD-L1 inhibitor therapy. In some embodiments, the melanoma is a BRAF (B-Raf Proto-Oncogene, Serine / Threonine Kinase)- mutant melanoma. In some embodiments, the melanoma is a NRAS (NRAS Proto-Oncogene, GTPase)-mutant melanoma. In some embodiments, the melanoma is a KIT-mutant melanoma. In some embodiments, the melanoma is a GNAQ (Guanine Nucleotide Binding Protein (G Protein), Q Polypeptide)-mutant melanoma. In some embodiments, the melanoma is a GNA11 (G Protein Subunit Alpha 11)-mutant melanoma. In some embodiments, the melanoma is a MEK (Mitogen- Activated Protein Kinase Kinase 1)-mutant melanoma. In some embodiments, the one or more solid tumors comprise bladder cancer. In some embodiments, the bladder cancer is a resectable cisplatin-ineligible / refusal muscle invasive bladder cancer (MIBC). In some embodiments, the bladder cancer is a locally advanced or metastatic bladder cancer that has not progressed with first-line platinum-containing chemotherapy. In some embodiments, the bladder cancer is a Bacillus-Calmette-Guerin (BCG)- unresponsive, high-risk, non-muscle invasive bladder cancer (NMIBC) with carcinoma in situ (CIS) with or without papillary tumors who are ineligible for or have elected not to undergo cystectomy. In some embodiments, the bladder cancer is a carcinoma in situ (CIS) of the urinary bladder. In some embodiments, the bladder cancer is a primary or recurrent stage Ta and / or T1 papillary bladder cancer tumors following transurethral resection (TUR). In some embodiments, the human patient is an adult with a low risk of developing NMIBC. In some embodiments, the human patient is an adult with a high risk of developing NMIBC. In some embodiments, the methods described herein are used to treat a human patient with prostate cancer. In some embodiments, the methods described herein are used to treat a human patient with renal cell carcinoma. In some embodiments, the methods described herein are used to treat a human patient with esophageal cancer. In some embodiments, the esophageal cancer is a high-grade dysplasia in Barrett esophagus in patients who do not undergo esophagectomy. In some embodiments, the esophageal cancer is a low-grade dysplasia in Barrett esophagus in patients who do not undergo esophagectomy. In some embodiments, the methods described herein are used to treat a human patient with stomach cancer. In some embodiments, the methods described herein are used to treat a human patient with colorectal cancer. In some embodiments, the colorectal cancer is a colorectal cancer previously treated with fluoropyrimidine-, oxaliplatin- and irinotecan-based chemotherapy, an anti-VEGF therapy, and, if RAS wild-type, an anti-EGFR therapy. In some embodiments, the colorectal cancer is a metastatic colorectal cancer previously treated with fluoropyrimidine- and / or oxaliplatin-based chemotherapy. In some embodiments, the methods described herein are used to treat a human patient with liver cancer. In some embodiments, the methods described herein are used to treat a human patient with gall bladder cancer. In some embodiments, the methods described herein are used to treat a human patient with breast cancer. In some embodiments, the breast cancer is a triple negative breast cancer (TNBC). In some embodiments, the methods described herein are used to treat a human patient with lung cancer. In some embodiments, the methods described herein are used to treat a patient with head and neck squamous cell carcinoma (HNSCC). In some embodiments, the HNSCC is a metastatic or unresectable, recurrent HNSCC with PD-L1+ tumors [Combined Positive Score (CPS) ≥1] as determined by an FDA-approved test. In some embodiments, the HNSCC is a locally advanced resectable Stage II-Iva HNSCC. In some embodiments, the methods described herein are used to treat a patient with ovarian cancer. In some embodiments, the ovarian cancer is a platinum-resistant ovarian cancer. In some embodiments, the methods described herein are used to treat a patient with sarcoma. In some embodiments, the method further comprises an additional cancer therapy selected from a chemotherapy, a radiation, an immune checkpoint inhibitor (ICI), an antiangiogenic therapy, or a combination thereof. In some embodiments, the additional cancer therapy comprises a chemotherapeutic agent. In some embodiments, the additional cancer treatment comprises an immune checkpoint inhibitor (ICI). In some embodiments, the ICI is selected from a programmed cell death -1 (PD- 1) inhibitor, a programmed cell death-ligand 1 (PD-L1) inhibitor, a cytotoxic T-lymphocyte- associated protein 4 (CTLA-4) inhibitor, a lymphocyte-activation gene 3 (LAG-3) inhibitor, a T- cell immunoglobulin mucin-3 (TIM-3) inhibitor, a T cell immunoreceptor with Ig and ITIM domains (TIGIT) inhibitor, a V-domain Ig suppressor of T-cell activation (VISTA) inhibitor, a carcinoembryonic antigen cell adhesion molecule (CEACAM) inhibitor, a sialic acid-binding immunoglobulin-like lectin 15 (Siglec-15) inhibitor, a CD47 inhibitor, a CD39 inhibitor, or a B and T lymphocyte attenuator (BTLA) protein inhibitor, a B7-H3 / CD276 inhibitor, an indoleamine 2,3-dioxygenase (IDO) inhibitor, a killer immunoglobin-like receptor (KIR) inhibitor, or a combination thereof. In some embodiments, the ICI administered is a PD-1 inhibitor. In some embodiments, the PD-1 inhibitor is selected from nivolumab, pembrolizumab, pidilizumab, AMP- 224, sasanlimab, spartalizumab, cemiplimab, retifanlimab, tislelizumab, camrelizumab, CS1003, or dostarlimab. In some embodiments, the PD-1 inhibitor is pembrolizumab. In some embodiments, the ICI administered is a PD-L1 inhibitor. In some embodiments, the PD-L1 inhibitor is selected from atezolizumab, durvalumab, avelumab, envafolimab, BMS-936559, lodapolimab, cosibelimab, sugemalimab, adebrelimab, CBT-502, or BGB-A333. In some embodiments, the ICI administered is a CTLA-4 inhibitor. In some embodiments, the CTLA-4 inhibitor is selected from ipilimumab or tremelimumab. In some embodiments, the ICI administered is a LAG-3 inhibitor. In some embodiments, the LAG-3 inhibitor is selected from relatlimab, GSK2831781, eftilagimod alpha, leramilimab, MK-4280, REGN3767, TSR-033, BI754111, Sym022, tebotelimab, FS118, LAG-526, favezelimab, CB213, SNA-03, INCAGN02385, RO7247669, IBI323, EMB-02, or AVA-0017. In some embodiments, the TIM- 3 inhibitor is selected from TSR-022, MBG453, Sym023, INCAGN2390, LY3321367, BMS- 986258, SHR-1702, RO7121661, sabatolimab, cobolimab, RG7769, MAS-825, BGBA425, AZD7789, TQB2618, or NB002. In some embodiments, the ICI administered is a TIGIT inhibitor. In some embodiments, the TIGIT inhibitor is selected from MK-7684, etigilimab / OMP-313 M32, tiragolumab / MTIG7192A / RG-6058, BMS-986207, AB-154, ASP-8374, Vibostolimab, AZD2936, ASP8374, Domvanalimab, IBI939, Ociperlimab, EOS884448, SEA-TGT, COM902, MPH-313, M6223, HLX53, JS006, mAb-7, SHR-1708, BAT6005, GS02, RXI-804, NB6253, ENUM009, CASC-674, AJUD008, or AGEN1777. In some embodiments, the ICI is opdualag. In some embodiments, the ICI is administered at the standard recommended dose and schedule as described on an FDA approved label. In some embodiments, the method is administered as a first-line (1L) therapy. In some embodiments, the method is administered as a second-line (2L) therapy. In some embodiments, the method is administered as a third-line (3L) therapy. In some embodiments, the method further comprises administering a standard of care therapy following the cessation of the additional surgical resection. In some embodiments, lerapolturev is administered in a dose of between about 1x108TCID50 and 5x108TCID50. In some embodiments, lerapolturev is administered in a dose of about 1x108TCID50. In some embodiments, lerapolturev is administered in a dose of about 2x108TCID50. In some embodiments, lerapolturev is administered in a dose of about 4x108TCID50. Chemotherapeutic Agents In some embodiments, the methods described herein further include the administration of an effective amount of a chemotherapeutic agent. Previously administered chemotherapeutic agents include, but are not limited to, alkylating agents, nitrosoureas, alkyl sulfonates, platinum- based chemotherapeutic drugs, and triazenes. In some embodiments, the chemotherapeutic agent is a platinum-based drug. In some embodiments, the chemotherapeutic agent is one or more platinum-based drug in combination with one or more non-platinum-based drug. In some embodiments, the previously administered one or more chemotherapeutic agent is selected from cyclophosphamide, mechlorethamine, mustine (HN2), uramustine, uracil mustard, melphalan, chlorambucil, ifosfamide, bendamustine, carmustine, lomustine, streptozocin, busulfan, cisplatin, carboplatin, nedaplatin, oxaliplatin, satraplatin, triplatin tetranitrate, procarbazine, altretamine, dacarbazine, mitozolomide, temozolomide, or a combination thereof. In some embodiments, the platinum-based drug comprises cisplatin. In some embodiments, the platinum-based drug comprises carboplatin. In some embodiments, the platinum-based drug comprises oxaliplatin. In some embodiments, the one or more chemotherapeutic agent is temozolomide. Temozolomide (TEMODAR®) In some embodiments, the methods described herein further include the administration of an effective amount of temozolomide (TEMODAR®). In some embodiments, an effective amount of temozolomide is administered at the standard recommended dose and schedule as described on an FDA approved label. In some embodiments, an effective amount of temozolomide is administered in combination with an effective amount of radiation therapy. In some embodiments, the temozolomide is administered at a dose according to the body surface area (BSA) of the human in need thererof. In some embodiments, the temozolomide is administered at a dose of between about 50 mg / m2to about 200 mg / m2. In some embodiments, the temozolomide is administered at a dose of about 50 mg / m2, about 75 mg / m2, about 100 mg / m2, about 125 mg / m2, about 150 mg / m2, about 175 mg / m2, and about 200 mg / m2. In some embodiments, the temozolomide is administered at a dose of about 75 mg / m2. In some embodiments, the temozolomide is administered at a dose of about 100 mg / m2. In some embodiments, the temozolomide is administered at a dose of about 150 mg / m2. In some embodiments, the temozolomide is administered at a dose of about 200 mg / m2. In some embodiments, the temozolomide is administered in a chemotherapeutic first treatment phase. In some embodiments, the chemotherapeutic first treatment phase comprises one or more chemotherapeutic treatment cycle. In some embodiments, the one or more chemotherapeutic treatment cycle lasts a period selected from about 1-week, about 2-weeks, about 3-weeks, about 4-weeks, about 6-weeks, or about 7-weeks. In some embodiments, the one or more chemotherapeutic treatment cycle lasts a period of about 6-weeks. In some embodiments, the temozolomide is administered once daily for 6-weeks in combination with radiation therapy. In some embodiments, the temozolomide is administered once daily for 6-weeks in combination with radiation therapy in combination with radiation therapy, wherein the radiation therapy is administered at a dose of about 60 Gy in 30 fractions. In some embodiments, an effective amount of temozolomide is administered as an intravenous infusion. In some embodiments, an effective amount of temozolomide is administered as an intravenous infusion over a period of between about 30-minutes to about 120-minutes. In some embodiments, an effective amount of temozolomide is administered as an intravenous infusion over a period of about 30-minutes, about 60-minutes, about 90-minutes, and about 120-minutes. In some embodiments, an effective amount of temozolomide is administered as an intravenous infusion over a period of about 90-minutes. In some embodiments, an effective amount of temozolomide is administered as an oral capsule formulation. In some embodiments, the human has newly diagnosed glioblastoma. In some embodiments, the human has recurrent glioblastoma. In some embodiments, the human has diffuse midline glioma. In some embodiments, the human has diffuse hemispheric glioma. In some embodiments, the human has refractory anaplastic astrocytoma. In some embodiments, the human has diffuse astrocytoma. In some embodiments, the human has oligodendroglioma. In some embodiments, an effective amount of the temozolomide is administered in a chemotherapeutic second treatment phase. In some embodiments, the chemotherapeutic second treatment phase comprises one or more chemotherapeutic treatment cycles. In some embodiments, the one or more chemotherapeutic treatment cycle lasts a period selected from about 1-week, about 2-weeks, about 3-weeks, about 4-weeks, or about 6-weeks. In some embodiments, the one or more chemotherapeutic treatment cycle lasts a period of about 4-weeks. In some embodiments, the one or more chemotherapeutic treatment cycle is repeated two or more times. In some embodiments, the one or more chemotherapeutic treatment cycle is repeated at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, or at least 11 times. In some embodiments, the one or more chemotherapeutic treatment cycle is repeated 6 times. In some embodiments, an effective amount of temozolomide is administered on Days 1-5 of a 4-week chemotherapeutic treatment cycle. In some embodiments, an effective amount of temozolomide is administered on Days 1-5 of a 4-week chemotherapeutic treatment cycle, wherein the chemotherapeutic treatment cycle is repeated 6 times. In some embodiments, an effective amount of temozolomide is administered as an intravenous infusion. In some embodiments, an effective amount of temozolomide is administered as an intravenous infusion over a period of between about 30-minutes to about 120-minutes. In some embodiments, an effective amount of temozolomide is administered as an intravenous infusion over a period of about 30-minutes, about 60-minutes, about 90-minutes, and about 120-minutes. In some embodiments, an effective amount of temozolomide is administered as an intravenous infusion over a period of about 90-minutes. In some embodiments, an effective amount of temozolomide is administered as an oral capsule formulation. In some embodiments, the human has newly diagnosed glioblastoma. In some embodiments, the human has recurrent glioblastoma. In some embodiments, the human has diffuse midline glioma. In some embodiments, the human has diffuse hemispheric glioma. In some embodiments, the human has refractory anaplastic astrocytoma. In some embodiments, the human has diffuse astrocytoma. In some embodiments, the human has oligodendroglioma. Radiation Therapy In some embodiments, the chimeric poliovirus is administered as described herein in combination with radiation therapy. In some embodiments, the radiation therapy is external-beam radiation therapy. In some embodiments, the radiation therapy is intraoperative radiation therapy. In some embodiments, the radiation therapy is image guided radiation therapy. In some embodiments, the radiation therapy is intensity-modulated radiation therapy. In some embodiments, the radiation therapy is x-ray beam radiation. In some embodiments, the radiation therapy is administered at the standard recommended dose and schedule as described on an FDA approved label. In some embodiments, the radiation therapy is initiated about 1-week, about 2-weeks, about 3-weeks, about 4-weeks, about 6-weeks following the last surgical resection administration to the human. In some embodiments, the radiation therapy is initiated about 3-weeks following the last surgical resection administration to the human. In some embodiments, the radiation therapy is initiated about 4-weeks following the last surgical resection administration to the human. In some embodiments, the radiation therapy is initiated about 5-weeks following the last surgical resection administration to the human. In some embodiments, the radiation therapy is administered between about 1.5 Gy to about 3.0 Gy daily fractions. In some embodiments, the radiation therapy is administered at about 1.5 Gy, about 1.6 Gy, about 1.7 Gy, about 1.8 Gy, about 1.9 Gy, about 2.0 Gy, about 2.1 Gy, about 2.2 Gy, about 2.3 Gy, about 2.4 Gy, about 2.5 Gy, about 2.6 Gy, about 2.7 Gy, about 2.8 Gy, about 2.9 Gy, and about 3.0 Gy daily fractions. In some embodiments, the radiation therapy is administered between about 50 Gy to about 60 Gy. In some embodiments, the radiation therapy is administered at about 50 Gy, about 51 Gy, about 52 Gy, about 53 Gy, about 54 Gy, about 55 Gy, about 56 Gy, about 57 Gy, about 58 Gy, about 59, and about 60 Gy. In some embodiments, radiation therapy is administered in combination with an effective amount of a chemotherapeutic agent. In some embodiments, the chemotherapeutic agent is selected from temozolomide, lomustine, carmustine, nimustine, fotemustine, procarbazine, or vincristine. In some embodiments, the radiation therapy is administered in combination with an effective amount of an antiangiogenic agent. In some embodiments, the antiangiogenic agent is an anti-VEGF antibody. In some embodiments, the anti- VEGF antibody is bevacizumab. Surgery Surgical resection has been shown to improve OS (Ringel, F. et al. Clinical benefit from resection of recurrent glioblastomas: results of a multicenter study including 503 patients with recurrent glioblastomas undergoing surgical resection. Neuro Oncol.18(1):96-1042016(2016)) as well as functional outcomes (Wann, A. et al. Outcomes after second surgery for recurrent glioblastoma: a retrospective case-control study. J Neurooncol. 137(2):409-415(2018)) in the setting of GBM recurrence. In some embodiments, a chimeric poliovirus is infused into the glioblastoma tumor lesion cavity wall during the surgical resection. Simultaneous surgical tumor resection and therapeutic agent injection has been previously demonstrated to further potentiate immune responses clinically with repeated injections of a chimeric poliovirus into melanoma lesions (Beasley, G. M. et al. Phase I trial of intratumoral PVSRIPO in patients with unresectable, treatment-refractory melanoma. J Immunother Cancer. 9(4)(2021)). In some embodiments, the methods described herein comprise administering a biopsy. In some embodiments, a chimeric poliovirus is administered by convection enhanced delivery (CED) infusion during the biopsy. In some embodiments, a chimeric poliovirus is administered by direct intracavitary infusion via an Ommaya reservoir inserted in the resection cavity. In some embodiments, the methods described herein further comprise administering surgical resection following cessation of the first treatment phase or the second treatment phase or the third treatment phase. Immune Checkpoint Inhibitors In some embodiments, the methods described herein further include the administration of an effective amount of an immune checkpoint inhibitor (ICI) to a human with glioblastoma. Suitable ICIs for use in the methods described herein include, but are not limited to, a programmed cell death -1 (PD-1) inhibitor, a programmed cell death-ligand 1 (PD-L1) inhibitor, a cytotoxic T- lymphocyte-associated protein 4 (CTLA-4) inhibitor, a lymphocyte-activation gene 3 (LAG-3) inhibitor, a T-cell immunoglobulin mucin-3 (TIM-3) inhibitor, or a T cell immunoreceptor with Ig and ITIM domains (TIGIT) program death-ligand 2 (PD-L2), a V-domain Ig suppressor of T-cell activation (VISTA), B7-H3 / CD276, indoleamine 2,3-dioxygenase (IDO), killer immunoglobulin- like receptors (KIRs), carcinoembryonic antigen cell adhesion molecules (CEACAM) such as CEACAM-1, CEACAM-3, and CEACAM-5, sialic acid-binding immunoglobulin-like lectin 15 (Siglec-15), a CD47 inhibitor, a CD39 inhibitor, or a B and T lymphocyte attenuator (BTLA) protein inhibitor, or a combination thereof. In some embodiments, the ICI is administered at the standard recommended dose and schedule as described on an FDA approved label. PD-1 inhibitors In some embodiments, the administered ICI is a PD-1 inhibitor that blocks the interaction of PD-1 and PD-L1 by binding to the PD-1 receptor, and in turn inhibits immune suppression. In some embodiments, the immune checkpoint inhibitor is a PD-1 immune checkpoint inhibitor selected from nivolumab (Opdivo®), pembrolizumab (Keytruda®), pidilizumab (Medivation), AMP-224 (Amplimmune); sasanlimab (PF-06801591; Pfizer), spartalizumab (PDR001; Novartis), cemiplimab (Libtayo®; REGN2810; Regeneron), retifanlimab (MGA012; MacroGenics), tislelizumab (BGB-A317; BeiGene), camrelizumab (SHR-1210; Jiangsu Hengrui Medicine Company and Incyte Corporation), CS1003 (Cstone Pharmaceuticals), and dostarlimab (TSR-042; Tesaro). In some embodiments, the PD-1 inhibitor is nivolumab (Opdivo®) administered in an effective amount. In some embodiments, nivolumab is administered at 240 mg every 2 weeks or 480 mg every 4 weeks. In some embodiments, the PD-1 inhibitor is pembrolizumab (Keytruda®) administered in an effective amount. In some embodiments, pembrolizumab is administered at 200 mg every 3 weeks or 400 mg every 6 weeks. In some embodiments, the PD-1 inhibitor is cemiplimab (Libtayo®) administered in an effective amount. In some embodiments, cemiplimab is administered at 350 mg as an intravenous infusion over 30 minutes every 3 weeks. In some embodiments, a combined PD-1 + LAG-3 inhibitor (Opdualag®) is administered in an effective amount. PD-L1 inhibitors In some embodiments, the ICI is a PD-L1 inhibitor that blocks the interaction of PD-1 and PD-L1 by binding to the PD-L1 receptor, and in turn inhibits immune suppression. PD-L1 inhibitors include, atezolizumab (Tecentriq®, Genentech), durvalumab (Imfinzi®, AstraZeneca); avelumab (Bavencio®; Merck), envafolimab (KN035; Alphamab), BMS-936559 (Bristol-Myers Squibb), lodapolimab (LY3300054; Eli Lilly), cosibelimab (CK-301; Checkpoint Therapeutics), sugemalimab (CS-1001; Cstone Pharmaceuticals), adebrelimab (SHR-1316; Jiangsu HengRui Medicine), CBT-502 (CBT Pharma), and BGB-A333 (BeiGene). In some embodiments, the ICI is the PD-L1 immune checkpoint inhibitor atezolizumab (Tecentriq®) administered in an effective amount. In some embodiments, atezolizumab is administered at 840 mg every 2 weeks, 1200 mg every 3 weeks, or 1680 mg every 4 weeks. In some embodiments, atezolizumab is administered prior to chemotherapy. In another aspect of this embodiment, the immune checkpoint inhibitor is durvalumab (Imfinzi®) administered in an effective amount. In some embodiments, durvalumab is administered at 10 mg / kg every 2 weeks or 1500 mg every 4 weeks for patients that weigh more than 30 kg and 10 mg / kg every 2 weeks for patients who weigh less than 30 kg. In another aspect of this embodiment, the immune checkpoint inhibitor is avelumab (Bavencio®) administered in an effective amount. In some embodiments, avelumab is administered at 800 mg every 2 weeks. In yet another aspect of the embodiment, the immune checkpoint inhibitor is KN035 (Alphamab) administered in an effective amount. An additional example of a PD-L1 immune checkpoint inhibitor is BMS-936559 (Bristol- Myers Squibb). T cell immunoreceptor with immunoglobulin and ITIM domain (TIGIT) Inhibitors In some embodiments, the ICI is a T cell immunoreceptor with immunoglobulin and ITIM domain (TIGIT). TIGIT is a promising new target for cancer immunotherapy. TIGIT is upregulated by immune cells, including activated T cells, natural killer cells, and regulatory T cells. TIGIT binds to two ligands, CD155 (PVR) and CD112 (PVRL2, nectin-2), that are expressed by tumor cells and antigen-presenting cells in the tumor microenvironment (Stanietsky et al., The interaction of TIGIT with PVR and PVRL2 inhibits human NK cell cytotoxicity. Proc Natl Acad Sci U S A 2009; 106: 17858–63). TIGIT (also called WUCAM, Vstm3, VSIG9) is a receptor of the Ig superfamily, which plays a critical role in limiting adaptive and innate immunity (Boles et al., A novel molecular interaction for the adhesion of follicular CD4 T cells to follicular DC. Eur J Immunol 2009; 39:695–703). TIGIT participates in a complex regulatory network involving multiple inhibitory receptors (e.g., CD96 / TACTILE, CD112R / PVRIG), one competing costimulatory receptor (DNAM-1 / CD226), and multiple ligands (e.g., CD155 (PVR / NECL-5), CD112 (Nectin- 2 / PVRL2) (Levin et al., Vstm3 is a member of the CD28 family and an important modulator of T- cell function. Eur J Immunol 2011; 41: 902–15; Bottino et al., Identification of PVR (CD155) and nectin-2 (CD112) as cell surface ligands for the human DNAM-1 (CD226) activating molecule. J Exp Med 2003; 198: 557–67; Seth et al., The murine pan T cell marker CD96 is an adhesion receptor for CD155 and nectin-1. Biochem Biophys Res Commun 2007; 364: 959–65; Zhu et al., Identification of CD112R as a novel checkpoint for human T cells. J Exp Med 2016; 213: 167– 76). TIGIT is expressed by activated CD8+ T and CD4+ T cells, natural killer (NK) cells, regulatory T cells (Tregs), and follicular T helper cells in humans (Joller et al., Cutting edge: TIGIT has T cell-intrinsic inhibitory functions. J Immunol 2011; 186: 1338–42; Wu et al., Follicular regulatory T cells repress cytokine production by follicular helper T cells and optimize IgG responses in mice. Eur J Immunol 2016; 46: 1152–61). In sharp contrast with DNAM-1 / CD226, TIGIT is weakly expressed by naive T cells. In cancer, TIGIT is co-expressed with PD-1 on tumor antigen-specific CD8+ T cells and CD8+ tumor-infiltrating lymphocytes (TILs) in mice and humans (Chauvin et al., Tigit and PD-1 impair tumor antigen-specific CD8⁺ T cells in melanoma patients. J Clin Invest 2015; 125: 2046–58; Johnston et al., The immunoreceptor TIGIT regulates antitumor and antiviral CD8(+) T cell effector function. Cancer Cell 2014; 26 :923–37). It is also co-expressed with other inhibitory receptors, such as T cell immunoglobulin and mucin domain- containing molecule-3 (TIM-3) and lymphocyte activation gene 3 (LAG-3), on exhausted CD8+ T cell subsets in tumors (Chauvin et al., Tigit and PD-1 impair tumor antigen-specific CD8⁺ T cells in melanoma patients. J Clin Invest 2015; 125: 2046–58; Johnston et al., The immunoreceptor TIGIT regulates antitumor and antiviral CD8(+) T cell effector function. Cancer Cell 2014; 26 :923–37). Further, TIGIT is highly expressed by Tregs in peripheral blood mononuclear cells of healthy donors and patients with cancer and further upregulated in the TME (Joller et al., Treg cells expressing the coinhibitory molecule TIGIT selectively inhibit proinflammatory Th1 and Th17 cell responses. Immunity 2014; 40: 569–81; Zhang et al., Genome-Wide DNA methylation analysis identifies hypomethylated genes regulated by FOXP3 in human regulatory T cells. Blood 2013; 122: 2823–36). In some embodiments, the ICI is a TIGIT inhibitor that blocks the interaction of TIGIT and CD155 by binding to the TIGIT receptor, and in turn inhibits immune suppression. TIGIT inhibitors include, but are not limited to, Etigilimab (OMP‐313M32; Oncomed Pharmaceuticals); Tiragolumab (MTIG7192A; RG6058; Roche / Genentech); Vibostolimab (MK‐7684; Merck); BMS‐986207 (Bristol-Myers Squibb); AZD2936 (AstraZeneca); ASP8374 (Astellas / Potenza Therapeutics); Domvanalimab (AB154; Arcus Biosciences); IBI939 (Innovent Biologics); Ociperlimab (BGB-A1217; BeiGene); EOS884448 (iTeos Therapeutics); SEA-TGT (Seattle Genetics); COM902 (Compugen); MPH-313 (Mereo Biopharma); M6223 (EMD Serono); HLX53 (Shanghai Henlius Biotech); JS006 (Junshi Bio); mAb-7 (Stanwei Biotech); SHR-1708 (Hengrui Medicine); BAT6005 (Bio-Thera Solutions); GS02 (Suzhou Zelgen / Qilu Pharma); RXI-804 (Rxi Pharmaceuticals); NB6253 (Northern Biologics); ENUM009 (Enumreal Biomedical); CASC-674 (Cascadian Therapeutics); AJUD008 (AJUD Biopharma); and AGEN1777 (Agenus, Bristol- Myers Squibb)). T-cell immunoglobulin and mucin domain 3 (TIM-3) inhibitors In some embodiments, the ICI is a T-cell immunoglobulin and mucin domain 3 (TIM-3) inhibitor. TIM-3 is an immunoglobulin (Ig) and mucin domain-containing cell surface molecule that was originally discovered as a cell surface marker specific to interferon (IFN-γ) producing CD4+T helper 1 (Th1) and CD8+T cytotoxic 1 (Tc1) cells (Monney et al., Th1-specific cell surface protein Tim-3 regulates macrophage activation and severity of an autoimmune disease. Nature 2002; 415: 536–41). Tim-3 is coregulated and co-expressed along with other immune checkpoint receptors (PD-1, Lag-3, and TIGIT) on CD4+and CD8+T cells (Chihara et al., First treatment and transcriptional regulation of the co-inhibitory gene module in T cells. Nature 2018; 558: 454–9; DeLong et al., Il-27 and TCR stimulation promote T cell expression of multiple inhibitory receptors. ImmunoHorizons 2019; 3: 13–25). In cancer, Tim-3 expression specifically marks the most dysfunctional or terminally exhausted subset of CD8+T cells (Fourcade et al., Upregulation of Tim-3 and PD-1 expression is associated with tumor antigen–specific CD8+ T cell dysfunction in melanoma patients. J Exp Med 2010; 207: 2175–86; Sakuishi et al., Targeting Tim-3 and PD-1 pathways to reverse T cell exhaustion and restore anti-tumor immunity. J Exp Med 2010; 207: 2187–94). Four ligands for Tim-3 have been identified: galectin-9, phosphatidylserine (PtdSer), high-mobility group protein B1 (HMGB1), and CEACAM-1. In some embodiments, the ICI is a TIM-3 inhibitor that blocks the interaction of TIM-3 and galectin-9, phosphatidylserine (PtdSer), high-mobility group protein B1 (HMGB1), and / or CEACAM-1 by binding to the TIM-3 receptor, and in turn inhibits immune suppression. TIM-3 inhibitors include, but are not limited to, Sabatolimab (MGB453; Novartis Pharmaceuticals); Cobolimab (TSR-022; Tesaro / GSK); RG7769 (Genentech); MAS-825 (Novartis); Sym023 (Symphogen A / S); BGBA425 (BeiGene); R07121661 (Hoffmann-La Roche); LY3321367 (Eli Lilly and Company); INCAGN02390 (Incyte Corporation); BMS-986258 (ONO7807, Bristol- Myers Squibb); AZD7789 (AstraZeneca); TQB2618 (Chia Tai Tianqing Pharmaceutical Group Co., Ltd.); and NB002 (Neologics Bioscience). Lymphocyte activation gene-3 (LAG-3) inhibitors In some embodiments, the ICI is a LAG-3 inhibitor. LAG‐3 (CD223) is encoded by the LAG‐3 gene. LAG‐3 is a member of the immunoglobulin superfamily (IgSF) and exerts a wide variety of biologic impacts on T cell function (Triebel et al., LAG‐3, a novel lymphocyte activation gene closely related to CD4. J Exp Med 1990; 171: 1393–405). LAG‐3 is expressed on cell membranes of natural killer cells (NK), B cells, tumor‐infiltrating lymphocytes (TIL), a subset of T cells, and dendritic cells (DC) (Triebel et al., LAG‐3, a novel lymphocyte activation gene closely related to CD4. J Exp Med 1990; 171: 1393–405); Kisielow et al., Expression of lymphocyte activation gene 3 (LAG‐3) on B cells is induced by T cells. Eur J Immunol 2005; 35: 2081–8; Grosso et al., LAG‐3 regulates CD8+ T cell accumulation and effector function in murine self‐ and tumor‐tolerance systems. J Clin Invest 2007; 117: 3383–92; Workman et al., LAG‐3 regulates plasmacytoid dendritic cell homeostasis. J Immunol 2009; 182: 1885–91; Andreae et al., Maturation and activation of dendritic cells induced by lymphocyte activation gene‐3 (CD223). J Immunol 2002; 168: 3874–80). The LAG‐3 protein binds a nonholomorphic region of major histocompatibility complex 2 (MHC class II) with greater affinity than CD 4 (Baixeras et al., Characterization of the lymphocyte activation gene 3‐encoded protein. A new ligand for human leukocyte antigen class II antigens. J Exp Med 1992; 176: 327–37). LAG‐3 is one of the various immune‐checkpoint receptors that are coordinately upregulated on both regulatory T cells (Tregs) and anergic T cells, and the simultaneous blockade of these receptors can result in an enhanced reversal of this anergic state relative to the blockade of one receptor alone (Grosso et al., Functionally distinct LAG‐3 and PD‐1 subsets on activated and chronically stimulated CD8 T cells. J Immunol 2009; 182: 6659–69). The LAG‐3 / MHC class II molecule interaction leads to the downregulation of CD4+Ag‐specific T cell clone proliferation and cytokine secretion (Huard et al., T cell major histocompatibility complex class II molecules down‐regulate CD4+T cell clone responses following LAG‐3 binding. Eur J Immunol 1996; 26: 1180–6). In some embodiments, the ICI is a LAG-3 inhibitor that blocks the interaction of LAG-3 with major histocompatibility complex 2 (MHC class II) by binding to the LAG-3 receptor, and in turn inhibits immune suppression. LAG-3 inhibitors include, but are not limited to, relatlimab (BMS 986016 / Ono 4482; Bristol-Myers Squibb); tebotelimab (MGD013; Macrogenics); LAG525 (Immutep, Novartis); TSR-033 (Tesaro, GlaxoSmithKline); Eftilagimod alpha (IMP321, Immutep); REGN3767 (Regeneron); INCAGN02385 (Incyte); RO7247669 (Hoffman-LaRoche); Favezelimab (Merck Sharp & Dohme); CB213 (Crescendo Biologics); FS118 (F-star Therapeutics); SYM022 (Symphogen); GSK2831781 (GlaxoSmithKline); IBI323 (Innovent Biologics (Suzhou) Co. Ltd.); EMB-02 (Shanghai EpimAb Biotherapeutics Co., Ltd.); SNA03 (Microbio Group); and AVA021 (Avacta). Additional Immune Checkpoint Inhibitors or Combinations Thereof In some embodiments, the human is administered a B7-H3 / CD276 immune checkpoint inhibitor such as enoblituzumab (MGA217, Macrogenics) MGD009 (Macrogenics), 131I- 8H9 / omburtamab (Y-mabs), and I-8H9 / omburtamab (Y-mabs), an indoleamine 2,3-dioxygenase (IDO) immune checkpoint inhibitor such as Indoximod and INCB024360, a killer immunoglobulin-like receptors (KIRs) immune checkpoint inhibitor such as Lirilumab (BMS- 986015), a carcinoembryonic antigen cell adhesion molecule (CEACAM) inhibitor (e.g., CEACAM-1, -3 and / or -5). Exemplary anti-CEACAM-1 antibodies are described in WO 2010 / 125571, WO 2013 / 082366 and WO 2014 / 022332, e.g., a monoclonal antibody 34B1, 26H7, and 5F4; or a recombinant form thereof, as described in, e.g., US 2004 / 0047858, U.S. Pat. No. 7,132,255 and WO 99 / 052552. In other embodiments, the anti-CEACAM antibody binds to CEACAM-5 as described in, e.g., Zheng et al. PLoS One. 2010 September 2; 5(9). pii: e12529 (DOI:10:1371 / journal.pone.0021146), or cross-reacts with CEACAM-1 and CEACAM-5 as described in, e.g., WO 2013 / 054331 and US 2014 / 0271618. In some embodiments, the ICI is directed to CD47, including, but not limited to, Hu5F9- G4 (Stanford University / Forty Seven), TI-061 (Arch Oncology), TTI-622 (Trillum Therapeutics), TTI-621 (Trillum Therapeutics), SRF231 (Surface Oncology), SHR-1603 (Hengrui), OSE-172 (Boehringer Ingelheim / OSE Immunotherapeutics), NI-1701 (Novimmune TG Therapeutics), IBI188 (Innovent Biologics); CC-95251 (Celgene), CC-90002 (Celgene / Inibrx), AO-176 (Arch Oncology), ALX148 (ALX Oncology), IMM01 (ImmuneOnco Biopharma), IMM2504 (ImmuneOnco Biopharma), IMM2502 (ImmuneOnco Biopharma), IMM03 (ImmuneOnco Biopharma), IMC-002 (ImmuneOncia Therapeutics), IBI322 (Innovent Biologics), HMBD-004B (Hummingbird Bioscience), HMBD-004A (Hummingbird Bioscience), HLX24 (Henlius), FSI- 189 (Forty Seven), DSP107 (KAHR Medical), CTX-5861 (Compass Therapeutics), BAT6004 (Bio-Thera), AUR-105 (Aurigene), AUR-104 (Aurigene), ANTI-CD47 (Biocad), ABP-500 (Abpro), ABP-160 (Abpro), TJC4 (I-MAB Biopharma), TJC4-CK (I-MAB Biopharma), SY102 (Saiyuan), SL-172154 (Shattuck Labs), PSTx-23 (Paradigm Shift Therapeutics), PDL1 / CD47BsAb (Hanmi Pharmaceuticals), NI-1801 (Novimmune), MBT-001 (Morphiex), LYN00301 (LynkCell), and BH-29xx (Beijing Hanmi). In some embodiments, the ICI is an inhibitor directed to CD39, including, but not limited to TTX-030 (Tizona Therapeutics), IPH5201 (Innate Pharma / AstraZeneca), SRF-617 (Surface Oncology), ES002 (Elpisciences), 9-8B (Igenica), and an antisense oligonucleotide (Secarna). In some embodiments, the ICI is directed to B and T lymphocyte attenuator molecule (BTLA), for example as described in Zhang et al., Monoclonal antibodies to B and T lymphocyte attenuator (BTLA) have no effect on in vitro B cell proliferation and act to inhibit in vitro T cell proliferation when presented in a cis, but not trans, format relative to the activating stimulus, Clin Exp Immunol.2011 Jan; 163(1):77–87, and TAB004 / JS004 (Junshi Biosciences). In some embodiments, the ICI is a sialic acid-binding immunoglobulin-like lectin 15 (Siglec-15) inhibitor, including, but not limited to, NC318 (an anti-Siglec-15 mAb). In some embodiments, combined or dual targeting ICIs are targeted, including, but not limited to, Opdualag (PD1 and LAG3 dual inhibtion). Antiangiogenic Therapy In some embodiments, the methods described herein further comprise the administration of an effective amount of one or more antiangiogenic therapy. Suitable one or more antiangiogenic therapy for use in the methods described herein include, but are not limited to, axitinib (Inlyta®), bevacizumab (Avastin®), cabozantinib (Cometriq®), everolimus (Afinitor®), lenalidomide (Revlimid®), lenvatinib mesylate (Lenvima®), pazopanib (Votrient®), ramucirumab (Cyramza®), regorafenib (Stivarga®), sorafenib (Nexavar®), sunitinib (Sutent®), rhalidomide (Synovir, Thalomid®), vandetanib (Caprelsa®), ziv-aflibercept (Zaltrap®), or a combination thereof. In some embodiments, the one or more antiangiogenic therapy comprises bevacizumab. Pharmaceutical Compositions and Dosage Forms The pharmaceutical composition comprising the chimeric poliovirus is administered in a therapeutically effective amount by any desired mode of administration, but can be administered as a cervical perilymphatic subcutaneous injection into the anatomical region that harbors glioma / CNS-draining deep cervical lymph nodes, via convection enhanced delivery (CED) via a catheter into the contrast-enhancing portion of glioblastoma, or via CED into residual, infiltrating (non-enhancing) GBM tumor that is best visualized on fluid-attenuated inversion recovery (FLAIR) MRI sequences, via direct intracavitary infusion via an Ommaya reservoir inserted into the surgical cavity, or alternatively, via direct injection along the tumor lesion surgical cavity wall. Convection Enhanced Delivery (CED) In some embodiments, methods described herein comprise administering a chimeric poliovirus by convection enhanced delivery (CED) in a specifically-timed therapeutic regimen. Administration via convection enhanced delivery (CED) is generally known in the art. Cervical Perilymphatic Subcutaneous Injection In some embodiments, methods described herein comprise administering a chimeric poliovirus by cervical perilymphatic subcutaneous injection in a specifically-timed therapeutic regimen. Administration via cervical perilymphatic subcutaneous injection is generally known in the art. Cervical perilymphatic subcutaneous injection is generally performed by a healthcare provider (M.D. or Physician Assistant) specifically trained for this type of procedure. A suspension comprising for example a chimeric poliovirus (e.g. 0.5 mL suspension comprising lerapolturev) is subsequently administered by perilymphatic subcutaneous injection. Direct Intracavitary Injection via an Ommaya Catheter In some embodiments, methods described herein comprise administering a chimeric poliovirus by direct intracavitary injection via an Ommaya reservoir inserted into the surgical cavity created at the time of maximal safe tumor resection performed prior to lerapolturev infusion in a specifically-timed therapeutic regimen. Ommaya reservoirs are known in the art. Generally, an “Ommaya reservoir” is a catheter system that can be used for the delivery of drugs. Generally, an Ommaya reservoir comprises a reservoir implanted under the scalp of a patient, connected to a catheter that reaches the surgical resection site. Drugs or therapeutic agents injected into the reservoir can generally thereby be transduced into the wall or cavity of the surgical resection site. Injection into Glioblastoma Lesion Cavity Wall In some embodiments, methods described herein comprise administering a chimeric poliovirus by injection into a glioblastoma lesion cavity wall in a specifically-timed therapeutic regimen. In some embodiments, a chimeric poliovirus is to be administered by intracranial injection into the wall of the human tumor resection cavity during surgical resection. In some embodiments, about 40 injections of 100 μL will be administered, for a total delivery of about 4 mL. Additional Administration Types In alternative embodiments, methods described herein further comprise administering a chimeric poliovirus—by perilymphatic or intralymphatic injection, via convection enhanced delivery (CED) via a catheter into the primary tumor or into residual tumor that is best visualized on fluid-attenuated inversion recovery (FLAIR) MRI sequences, via direct intracavitary infusion via an Ommaya catheter inserted into the surgical cavity, or via direct injection along the tumor lesion surgical cavity wall—in between treatment phases. Administration via intratumoral injection can involve introducing the formulations of the disclosure into one or more tumor lesions of a patient through a needle or a catheter, propelled by a sterile syringe or some other mechanical device such as a continuous infusion system. A formulation provided by the disclosure can be administered using a syringe, injector, pump, or any other device recognized in the art for parenteral administration. In some embodiments, when the chimeric poliovirus is lerapolturev, lerapolturev is formulated in 50 mM sodium phosphate in 0.9% sodium chloride, pH 7.4 with 0.2% human serum albumin (HSA) in phosphate buffered saline (PBS). Lerapolturev can be provided in sterile, single use glass vials with a flip off top containing approximately 0.5 mL of stock lerapolturev (for example, about 2.0 x 108to about 1.0 x 1010TCID50). Improved Patient Outcomes In some embodiments, the methods described herein provide enhanced objective response rate (ORR) in the patients receiving the treatment. ORR is generally defined as the proportion of patients achieving a complete response (CR) or partial response (PR) per RECIST 1.1. Examples of an objective response (OR) includes a complete response (CR), which is the disappearance of all signs of the tumor in response to treatment and a partial response (PR), which is a decrease in the size of a tumor in response to treatment. In some embodiments, the OR is a CR. In some embodiments, the OR is a PR. The ORR is an important parameter to demonstrate the efficacy of a treatment and it serves as a primary or secondary endpoint in clinical trials. Methods of assessing ORR are well known in the art and include, for example RANO, mRANO, iRANO or any new future updates (Wen et al. J Clin Oncol.28:1963-1972 (2010); Ellingson et al. Neurotherapeutics. 14:307-320 (2017); Okada et al. Lancet Oncol.16(15):e534-e542 (2015)). In some embodiments, the methods described herein provide one or more clinical benefit in the human receiving the treatment. In some embodiments, the methods described herein provide enhanced clinical benefit rate (CBR) in the patients receiving the treatment. CBR is generally defined as the proportion of patients with CR (confirmed by repeated imaging at least 4 weeks after the original CR was identified), PR (confirmed by repeated imaging at least 4 weeks after the original PR was identified), or SD (confirmed by repeated imaging at least 4 weeks after the original SD was identified) per RANO. In some embodiments the methods described herein provide lengthened duration of response (DOR) in the patients receiving the treatment. DOR is generally defined as the time from OR (per RANO) until unequivocal disease progression or death, whichever occurs first. In some embodiments, the methods described herein provide lengthened progression-free survival (PFS) in the patients receiving the treatment. PFS is generally defined as the time (measured in number of months) from the date of assigning patient ID number until date of documented radiologic disease progression per RANO or death due to any cause, whichever come first. In some embodiments, the methods described herein provide enhanced overall survival (OS) in the patients receiving the treatment. OS is generally defined as the time (measured in number of months) from the date of assigning patient ID number until death due to any cause. In some embodiments, the methods described herein provide alterations from baseline in immune function markers in biofluid samples and / or tissue, as data permits, in the patients receiving the treatment. In some embodiments, the methods described herein provide alterations from baseline in tumor biomarkers in tumor samples, as data permits, in the patients receiving the treatment. In some embodiments the methods described herein provide alterations in genetic markers in tumor biopsies and / or blood samples that correlate with response in the patients receiving the treatment. In some embodiments, the methods described herein provide alterations in cytologic markers in tumor biopsies and / or blood samples that correlate with response in the patients receiving the treatment. In some embodiments, the methods described herein provide alterations in histologic markers in tumor biopsies and / or blood samples that correlate with response in the patients receiving the treatment. In some embodiments, the methods described herein provide alterations in molecular markers in tumor biopsies and / or blood samples that correlate with response in the patients receiving the treatment. In some embodiments, the methods described herein provide reduced recurrence rate of glioblastoma tumor formation. In some embodiments, the methods described herein provide decreased need for glioblastoma tumor resection surgeries. In some embodiments, the methods described herein provide decreased frequency of glioblastoma tumor resection surgeries. In some embodiments, the methods described herein provide lengthened relapse-free survival (RFS). EMBODIMENTS 1. A method of treating a human patient having newly diagnosed glioblastoma (ndGBM) following a first surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster at least about two weeks following the first surgical resection of the one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated at least about 1 week following the administration of the polio-vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev into the first surgical resection site on day 1 of the 1-week cycle to treat a residual GBM tumor, and optionally again on day 5 of the 1- week cycle; and (iii) a second treatment phase, wherein a) the patient undergoes a second surgical resection of one or more residual GBM tumors about 5 weeks following the initiation of the first treatment phase, and b) wherein, following the second surgical resection, the patient is further administered an effective amount of lerapolturev into the second surgical resected site by cavity wall injection or optionally by convection enhanced delivery (CED). 2. The method of embodiment 1, further comprising administering to the patient once weekly for 4 consecutive weeks an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection, wherein the cervical perilymphatic subcutaneous injections are administered following the cessation of the first treatment phase, and before the initiation of the second treatment phase. 3. A method of treating a human patient having newly diagnosed glioblastoma (ndGBM) following a first surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster at least about two weeks following the first surgical resection of the one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated at least about 1 week following the administration of the polio-vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev into the first surgical resection site on day 1 and day 5 of the 1-week cycle to treat a residual GBM tumor; and (iii) a second treatment phase, wherein a) the patient undergoes a second surgical resection of one or more residual GBM tumors about 5 weeks following the initiation of the first treatment phase, and b) wherein, following the second surgical resection, the patient is further administered an effective amount of lerapolturev into the second surgical resected site by cavity wall injection or optionally by convection enhanced delivery (CED). 4. A method of treating a human patient having newly diagnosed glioblastoma (ndGBM) following a first surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster at least about two weeks following the first surgical resection of the one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated at least about 1 week following the administration of the polio-vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev into the first surgical resection site on day 1 of the 1-week cycle to treat a residual GBM tumor, and optionally again on day 5 of the 1- week cycle; (iii) a second treatment phase, wherein the second treatment phase is initiated about 1 week following the cessation of the first treatment phase, wherein the second treatment phase comprises administering an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection once weekly for four consecutive weeks; and (iv) a third treatment phase, wherein a) the patient undergoes a second surgical resection of one or more residual GBM tumors about 5 weeks following the initiation of the first treatment phase and about 1 week following the cessation of the second treatment phase, and b) wherein, following the second surgical resection, the patient is further administered an effective amount of lerapolturev into the second surgical resected site by cavity wall injection or optionally by convection enhanced delivery (CED). 5. The method of embodiments 1-4, wherein the first treatment phase comprises a single, 1- week cycle. 6. The method of embodiments 1-4, wherein the first treatment phase comprises two or more treatment cycles. 7. The method of embodiments 1-6, wherein the ndGBM patient is further administered an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection one or more times once every three weeks, four weeks, five weeks, six weeks, two months, three months, four months, or six months following the second surgical resection. 8. The method of embodiments 1-6, wherein the ndGBM patient is further administered an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection one or more times once every three weeks following the second surgical resection. 9. The method of embodiments 1-8, wherein the residual GBM tumor is a residual tumor with a non-enhancing fluid-attenuated inversion recovery (FLAIR) signal. 10. The method of embodiments 1-9, wherein the ndGBM harbors an unmethylated O6- methylguanine-DNA methyltransferase promoter (MGMTp). 11. The method of any of embodiments 1-10, further comprising administering an additional glioblastoma cancer therapy selected from a chemotherapy, a radiation, an immune checkpoint inhibitor (ICI), an antiangiogenic therapy, or a combination thereof. 12. The method of embodiment 11, wherein the additional glioblastoma cancer treatment comprises administering radiation therapy. 13. The method of embodiment 11 or 12, wherein the additional glioblastoma cancer treatment comprises a chemotherapeutic agent. 14. The method of embodiment 13, wherein the chemotherapeutic agent is selected from temozolomide, carmustine, lomustine, nimustine, fotemustine, etoposide, dasatinib, temsirolimus, erlotinib, sorafenib, Panobinostat, vorinostat, or a combination thereof. 15. The method of embodiment 14, wherein the chemotherapeutic agent is temozolomide. 16. The method of embodiments 11-15, wherein the additional glioblastoma cancer treatment comprises an immune checkpoint inhibitor (ICI). 17. The method of embodiment 16, wherein the ICI is selected from a programmed cell death -1 (PD-1) inhibitor, a programmed cell death-ligand 1 (PD-L1) inhibitor, a cytotoxic T- lymphocyte-associated protein 4 (CTLA-4) inhibitor, a lymphocyte-activation gene 3 (LAG-3) inhibitor, a T-cell immunoglobulin mucin-3 (TIM-3) inhibitor, a T cell immunoreceptor with Ig and ITIM domains (TIGIT) inhibitor, a V-domain Ig suppressor of T-cell activation (VISTA) inhibitor, a carcinoembryonic antigen cell adhesion molecule (CEACAM) inhibitor, a sialic acid- binding immunoglobulin-like lectin 15 (Siglec-15) inhibitor, a CD47 inhibitor, a CD39 inhibitor, or a B and T lymphocyte attenuator (BTLA) protein inhibitor, a B7-H3 / CD276 inhibitor, an indoleamine 2,3-dioxygenase (IDO) inhibitor, a killer immunoglobin-like receptor (KIR) inhibitor, or a combination thereof. 18. The method of embodiment 16 or 17, wherein the ICI is administered at the standard recommended dose and schedule as described on an FDA approved label. 19. The method of embodiments 11-18, wherein the additional glioblastoma cancer treatment comprises administering an antiangiogenic therapy. 20. The method of embodiment 19, wherein the antiangiogenic therapy is bevacizumab. 21. The method of embodiments 1-20, the method is administered as a first-line (1L) therapy. 22. The method of embodiments 1-21, wherein the method further comprises administering a glioblastoma standard of care therapy following the cessation of the second surgical resection. 23. The method of embodiment 22, wherein the glioblastoma standard of care therapy comprises administering to the human an effective amount of radiotherapy and an effective amount of temozolomide. 24. The method of embodiments 1-23, wherein lerapolturev is administered in a dose of between about 1x108TCID50 and 5x108TCID50. 25. The method of embodiment 24, wherein lerapolturev is administered in a dose of about 1x108TCID50. 26. The method of embodiment 24, wherein lerapolturev is administered in a dose of about 2x108TCID50. 27. The method of embodiment 24, wherein lerapolturev is administered in a dose of about 4x108TCID50. 28. A method of treating a human patient having recurrent (rGBM) following a surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster at least about two weeks following the surgical resection of the one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated at least about 1 week following the administration of the polio-vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycle comprising administering to the patient an effective amount of lerapolturev into the surgical resection site on day 1 and day 5 of the 1-week cycle to treat a residual GBM tumor; (iii) a second treatment phase, wherein the second treatment phase comprises administering to the patient once weekly for 4 consecutive weeks an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection, wherein the second treatment phase is administered following the cessation of the first treatment phase, and (iv) a third treatment phase, wherein the third treatment phase comprises administering to the patient once every three weeks an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection, wherein the is lerapolturev administered following the cessation of the second treatment phase. 29. The method of embodiment 28, wherein the first treatment phase comprises a single, 1- week cycle. 30. The method of embodiment 28, wherein the first treatment phase comprises two or more treatment cycles. 31. The method of embodiments 28-30, wherein the third treatment phase is administered once every three weeks for at least 6-months. 32. The method of embodiments 28-30, wherein the third treatment phase is administered once every three weeks for at least 12-months. 33. The method of embodiments 28-30, wherein the third treatment phase is administered once every three weeks for at least 15-months. 34. The method of embodiments 28-33, wherein the ndGBM patient is further administered an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection one or more times once every three weeks following the second surgical resection. 35. The method of embodiments 28-34, wherein the residual GBM tumor is a residual tumor with a non-enhancing fluid-attenuated inversion recovery (FLAIR) signal. 36. The method of embodiments 28-35, wherein the ndGBM harbors an unmethylated O6- methylguanine-DNA methyltransferase promoter (MGMTp). 37. The method of any of embodiments 1-36, wherein the method further comprises administering the chimeric poliovirus in combination with an additional glioblastoma cancer therapy selected from a chemotherapy, a radiation, an immune checkpoint inhibitor (ICI), an antiangiogenic therapy, or a combination thereof. 38. The method of embodiment 37, wherein the additional glioblastoma cancer treatment comprises administering radiation therapy. 39. The method of embodiment 37, wherein the additional glioblastoma cancer treatment comprises a chemotherapeutic agent. 40. The method of embodiment 39, wherein the chemotherapeutic agent is selected from temozolomide, carmustine, lomustine, nimustine, fotemustine, etoposide, dasatinib, temsirolimus, erlotinib, sorafenib, Panobinostat, vorinostat, or a combination thereof. 41. The method of embodiment 40, wherein the chemotherapeutic agent is temozolomide. 42. The method of embodiment 37, wherein the additional glioblastoma cancer treatment comprises an immune checkpoint inhibitor (ICI). 43. The method of embodiment 42, wherein the ICI is selected from a programmed cell death -1 (PD-1) inhibitor, a programmed cell death-ligand 1 (PD-L1) inhibitor, a cytotoxic T- lymphocyte-associated protein 4 (CTLA-4) inhibitor, a lymphocyte-activation gene 3 (LAG-3) inhibitor, a T-cell immunoglobulin mucin-3 (TIM-3) inhibitor, a T cell immunoreceptor with Ig and ITIM domains (TIGIT) inhibitor, a V-domain Ig suppressor of T-cell activation (VISTA) inhibitor, a carcinoembryonic antigen cell adhesion molecule (CEACAM) inhibitor, a sialic acid- binding immunoglobulin-like lectin 15 (Siglec-15) inhibitor, a CD47 inhibitor, a CD39 inhibitor, or a B and T lymphocyte attenuator (BTLA) protein inhibitor, a B7-H3 / CD276 inhibitor, an indoleamine 2,3-dioxygenase (IDO) inhibitor, a killer immunoglobin-like receptor (KIR) inhibitor, or a combination thereof. 44. The method of embodiment 42 or 43, wherein the ICI is administered at the standard recommended dose and schedule as described on an FDA approved label. 45. The method of embodiment 37, wherein the additional glioblastoma cancer treatment comprises administering an antiangiogenic therapy. 46. The method of embodiment 45, wherein the antiangiogenic therapy is bevacizumab. 47. The method of embodiments 1-46, the method is administered as a second-line (2L) therapy. 48. The method of embodiments 1-46, the method is administered as a third-line (3L) therapy. 49. The method of embodiments 28-48, wherein the method further comprises administering a glioblastoma standard of care therapy. 50. The method of embodiment 49, wherein the glioblastoma standard of care therapy comprises administering to the human an effective amount of radiotherapy and an effective amount of temozolomide. 51. The method of embodiments 28-50, wherein lerapolturev is administered in a dose of between about 1x108TCID50and 5x108TCID50. 52. The method of embodiment 51, wherein lerapolturev is administered in a dose of about 1x108TCID50. 53. The method of embodiment 51, wherein lerapolturev is administered in a dose of about 2x108TCID50. 54. The method of embodiment 51, wherein lerapolturev is administered in a dose of about 4x108TCID50. 55. A method of treating a human patient having newly diagnosed glioblastoma (ndGBM) following a first maximal safe surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster following the first maximal safe surgical resection of one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated between at least about 1 week and about 6 weeks following the administration of the polio vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev into a surgical resection site on day 1 of the 1-week cycle and optionally again on day 5 of the one week cycle; and (iii) an optional second treatment phase, wherein a) the patient undergoes a second maximal safe surgical resection of one or more residual GBM tumors at least about 5-weeks after the initiation of the first treatment phase; b) wherein, following the second surgical resection, the patient is further administered an effective amount of lerapolturev into the surgical resection site on day 1 of the 1-week cycle and optionally again on day 5 of the 1-week cycle. 56. The method of embodiment 55, further comprising administering to the patient once weekly for 4 consecutive weeks an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection, wherein the cervical perilymphatic subcutaneous injections are administered following the cessation of the first treatment phase. 57. The method of embodiment 55, further comprising administering to the patient once weekly for 4 consecutive weeks an effective amount of lerapolturev via direct intracavitary infusion via an Ommaya catheter into the surgical cavity, wherein the direct intracavitary infusions are administered following the cessation of the first treatment phase. 58. A method of treating a human patient having newly diagnosed glioblastoma (ndGBM) following a first maximal safe surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster following the first maximal safe surgical resection of one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated between at least about 1 week and about 6 weeks following the administration of the polio vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev into the first surgical resection site on day 1 and day 5 of the 1-week cycle, wherein lerapolturev administration is selected from CED injection, direct injection of a resection cavity wall, or direct injection via Ommaya reservoir installed in a post-resection cavity; and (iii) an optional second treatment phase, wherein a) the patient undergoes a second maximal safe surgical resection of one or more residual GBM tumors at least about 5-weeks after the initiation of the first treatment phase, and b) wherein, following the second maximal safe surgical resection, the patient is further administered an effective amount of lerapolturev into the surgical resection site on day 1 of the 1-week cycle and optionally again on day 5 of the 1-week cycle, wherein lerapolturev administration is selected from CED injection, direct injection of a resection cavity wall, or direct injection via Ommaya reservoir installed in a post-resection cavity. 59. A method of treating a human patient having newly diagnosed glioblastoma (ndGBM) following a first maximal safe surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster following the first maximal safe surgical resection of one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated between at least about 1 week and about 6 weeks following the administration of the polio vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev on day 1 of the 1-week cycle and optionally again on day 5 of the 1-week cycle, wherein lerapolturev administration is selected from CED injection, direct injection of a resection cavity wall, or direct injection via Ommaya reservoir installed in a post-resection cavity; (iii) a second treatment phase, wherein the second treatment phase is initiated at least about 1 week following the cessation of the first treatment phase, wherein the second treatment phase comprises administering an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection once weekly for four consecutive weeks; and (iv) an optional third treatment phase, wherein a) the patient undergoes a second surgical resection of one or more residual GBM tumors at any interval 5-weeks or after the initiation of the first treatment phase, and b) administering to the patient an effective amount of lerapolturev into the surgical resection site on day 1 of the 1-week cycle and optionally again on day 5 of the one week cycle, wherein lerapolturev administration is selected from CED injection, direct injection of a resection cavity wall, or direct injection via Ommaya reservoir installed in a post-resection cavity. 60. A method of treating a human patient having newly diagnosed glioblastoma (ndGBM) following a first maximal safe surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster following the first maximal safe surgical resection of one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated between at least about 1 week and about 6 weeks following the administration of the polio vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev on day 1 of the 1-week cycle and optionally again on day 5 of the 1-week cycle, wherein lerapolturev administration is selected from CED injection, direct injection of a resection cavity wall, or direct injection via Ommaya reservoir installed in a post-resection cavity; (iii) a second treatment phase, wherein the second treatment phase is initiated at least about 1 week following the cessation of the first treatment phase, wherein the second treatment phase comprises administering an effective amount of lerapolturev via direct intracavitary infusion via an Ommaya reservoir once weekly for four consecutive weeks; and (iv) an optional third treatment phase, wherein a) the patient undergoes a second maximal safesurgical resection of one or more residual GBM tumors at least about 5-weeks after the initiation of the first treatment phase; b) wherein, following the second maximal safe surgical resection, the patient is administered an effective amount of lerapolturev into the surgical resection site on day 1 of the 1-week cycle and optionally again on day 5 of the 1-week cycle. 61. The method of embodiments 55-60, wherein the first treatment phase comprises a single, 1-week cycle. 62. The method of embodiments 55-60, wherein the first treatment phase comprises two or more treatment cycles. 63. The method of embodiments 55-62, wherein the ndGBM patient is further administered an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection one or more times once every three weeks, four weeks, five weeks, six weeks, two months, three months, four months, or six months following the second surgical resection. 64. The method of embodiments 55-62, wherein the ndGBM patient is further administered an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection one or more times once every three weeks following an optional second surgical resection. 65. The method of embodiments 55-64, wherein the residual GBM tumor is a non-enhancing and best visualized on fluid-attenuated inversion recovery (FLAIR) MRI sequences. 66. The method of embodiments 55-64, wherein the ndGBM harbors an unmethylated O6- methylguanine-DNA methyltransferase promoter (MGMTp). 67. The method of embodiments 55-64, wherein the ndGBM harbors a partially methylated O6-methylguanine-DNA methyltransferase promoter (MGMTp). 68. The method of embodiments 55-64, wherein the ndGBM harbors a methylated O6- methylguanine-DNA methyltransferase promoter (MGMTp). 69. The method of any of embodiments 55-68, wherein the method further comprises administering the chimeric poliovirus in combination with an additional glioblastoma cancer therapy selected from a chemotherapy, a radiation, an immune checkpoint inhibitor (ICI), an antiangiogenic therapy, small molecule inhibitor, investigational product, tumor treating field, or a combination thereof. 70. The method of embodiment 69, wherein the additional glioblastoma cancer treatment comprises administering radiation therapy. 71. The method of embodiment 69 or 70, wherein the additional glioblastoma cancer treatment comprises a chemotherapeutic agent. 72. The method of embodiment 71, wherein the chemotherapeutic agent is selected from temozolomide, carmustine, lomustine, nimustine, fotemustine, etoposide, dasatinib, temsirolimus, erlotinib, sorafenib, Panobinostat, vorinostat, or a combination thereof. 73. The method of embodiment 71, wherein the chemotherapeutic agent is temozolomide. 74. The method of embodiments 69-73, wherein the additional glioblastoma cancer treatment comprises an immune checkpoint inhibitor (ICI). 75. The method of embodiment 74, wherein the ICI is selected from a programmed cell death -1 (PD-1) inhibitor, a programmed cell death-ligand 1 (PD-L1) inhibitor, a cytotoxic T- lymphocyte-associated protein 4 (CTLA-4) inhibitor, a lymphocyte-activation gene 3 (LAG-3) inhibitor, a T-cell immunoglobulin mucin-3 (TIM-3) inhibitor, a T cell immunoreceptor with Ig and ITIM domains (TIGIT) inhibitor, a V-domain Ig suppressor of T-cell activation (VISTA) inhibitor, a carcinoembryonic antigen cell adhesion molecule (CEACAM) inhibitor, a sialic acid- binding immunoglobulin-like lectin 15 (Siglec-15) inhibitor, a CD47 inhibitor, a CD39 inhibitor, or a B and T lymphocyte attenuator (BTLA) protein inhibitor, a B7-H3 / CD276 inhibitor, an indoleamine 2,3-dioxygenase (IDO) inhibitor, a killer immunoglobin-like receptor (KIR) inhibitor, or a combination thereof. 76. The method of embodiment 74 or 75, wherein the ICI is administered at the standard recommended dose and schedule as described on an FDA approved label. 77. The method of embodiments 69-76, wherein the additional glioblastoma cancer treatment comprises administering an antiangiogenic therapy. 78. The method of embodiment 77, wherein the antiangiogenic therapy is bevacizumab. 79. The method of embodiments 55-78, where the method is administered as a first-line (1L) therapy. 80. The method of embodiments 55-79, wherein the method further comprises administering a glioblastoma standard of care therapy following the cessation of the second surgical resection. 81. The method of embodiment 80, wherein the glioblastoma standard of care therapy comprises administering to the human an effective amount of radiotherapy and an effective amount of temozolomide. 82. The method of embodiments 55-81, wherein lerapolturev is administered in a dose of between about 1x108TCID50 and 5x108TCID50. 83. The method of embodiment 82, wherein lerapolturev is administered in a dose of about 1x108TCID50. 84. The method of embodiment 82, wherein lerapolturev is administered in a dose of about 2x108TCID50. 85. The method of embodiment 82, wherein lerapolturev is administered in a dose of about 4x108TCID50. 86. A method of treating a human patient having recurrent GBM (rGBM) following a first maximal safe surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster following the first maximal safe surgical resection of one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated between at least about 1 week and about 6 weeks following the administration of the polio vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev into the surgical resection site on day 1 and day 5 of the 1-week cycle, wherein lerapolturev administration is selected from CED injection, direct injection of a resection cavity wall, or direct injection via Ommaya reservoir installed in a post-resection cavity; (iii) a second treatment phase, wherein the second treatment phase comprises administering to the patient once weekly for 4 consecutive weeks an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection, wherein the second treatment phase is administered following the cessation of the first treatment phase, and (iv) a third treatment phase, wherein the third treatment phase comprises administering to the patient once every three weeks an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection, wherein lerapolturev is administered following the cessation of the second treatment phase. 87. The method of embodiment 86, wherein the first treatment phase comprises a single, 1- week cycle. 88. The method of embodiment 86, wherein the first treatment phase comprises two or more treatment cycles. 89. The method of embodiments 86-88, wherein the third treatment phase is administered once every three weeks for at least 6-months. 90. The method of embodiments 86-88, wherein the third treatment phase is administered once every three weeks for at least 12-months. 91. The method of embodiments 86-88, wherein the third treatment phase is administered once every three weeks for at least 15-months. 92. The method of embodiments 86-91, wherein the rGBM patient is further administered an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection one or more times once every three weeks following the second surgical resection. 93. The method of embodiments 86-91, wherein the residual GBM tumor is non-enhancing and best visualized on fluid-attenuated inversion recovery (FLAIR) MRI sequences. 94. The method of any of embodiments 86-93, wherein the method further comprises administering the chimeric poliovirus in combination with an additional glioblastoma cancer therapy selected from a chemotherapy, a radiation, an immune checkpoint inhibitor (ICI), an antiangiogenic therapy, small molecule inhibitor, investigational product, tumor treating field, or a combination thereof. 95. The method of embodiment 94, wherein the additional glioblastoma cancer treatment comprises administering radiation therapy. 96. The method of embodiment 94, wherein the additional glioblastoma cancer treatment comprises a chemotherapeutic agent. 97. The method of embodiment 96, wherein the chemotherapeutic agent is selected from temozolomide, carmustine, lomustine, nimustine, fotemustine, etoposide, dasatinib, temsirolimus, erlotinib, sorafenib, Panobinostat, vorinostat, or a combination thereof. 98. The method of embodiment 97, wherein the chemotherapeutic agent is temozolomide. 99. The method of embodiment 94, wherein the additional glioblastoma cancer treatment comprises an immune checkpoint inhibitor (ICI). 100. The method of embodiment 99, wherein the ICI is selected from a programmed cell death -1 (PD-1) inhibitor, a programmed cell death-ligand 1 (PD-L1) inhibitor, a cytotoxic T- lymphocyte-associated protein 4 (CTLA-4) inhibitor, a lymphocyte-activation gene 3 (LAG-3) inhibitor, a T-cell immunoglobulin mucin-3 (TIM-3) inhibitor, a T cell immunoreceptor with Ig and ITIM domains (TIGIT) inhibitor, a V-domain Ig suppressor of T-cell activation (VISTA) inhibitor, a carcinoembryonic antigen cell adhesion molecule (CEACAM) inhibitor, a sialic acid- binding immunoglobulin-like lectin 15 (Siglec-15) inhibitor, a CD47 inhibitor, a CD39 inhibitor, or a B and T lymphocyte attenuator (BTLA) protein inhibitor, a B7-H3 / CD276 inhibitor, an indoleamine 2,3-dioxygenase (IDO) inhibitor, a killer immunoglobin-like receptor (KIR) inhibitor, or a combination thereof. 101. The method of embodiment 99 or 100, wherein the ICI is administered at the standard recommended dose and schedule as described on an FDA approved label. 102. The method of embodiment 94, wherein the additional glioblastoma cancer treatment comprises administering an antiangiogenic therapy. 103. The method of embodiment 102, wherein the antiangiogenic therapy is bevacizumab. 104. The method of embodiments 55-103, the method is administered as a second-line (2L) therapy. 105. The method of embodiments 55-103, the method is administered as a third-line (3L) therapy. 106. The method of embodiments 86-105, wherein the method further comprises administering a glioblastoma standard of care therapy. 107. The method of embodiment 106, wherein the glioblastoma standard of care therapy comprises administering to the human an effective amount of radiotherapy and an effective amount of temozolomide. 108. The method of embodiments 86-107, wherein lerapolturev is administered in a dose of between about 1x108TCID50 and 5x108TCID50. 109. The method of embodiment 108, wherein lerapolturev is administered in a dose of about 1x108TCID50. 110. The method of embodiment 108, wherein lerapolturev is administered in a dose of about 2x108TCID50. 111. The method of embodiment 108, wherein lerapolturev is administered in a dose of about 4x108TCID50. 112. A method of treating a human patient having one or more solid tumors, wherein the treatment comprises: (i) a first treatment phase comprising one or more treatment cycles comprising administration of an effective amount of lerapolturev via injection into the solid tumor; (ii) a second treatment phase comprising at least one cycle comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each weekly cycle. 113. The method of embodiment 112, wherein, prior to the first treatment phase, the patient undergoes a first surgical resection of one or more tumors. 114. The method of embodiment 113, wherein the first surgical resection comprises maximal safe surgical resection. 115. The method of embodiments 112-114, wherein, prior to the first treatment phase, a polio vaccine booster is administered to the human patient. 116. The method of embodiment 115, wherein the polio vaccine booster is administered to the human patient at least about two weeks following the surgical resection. 117. The method of embodiment 115 or 116, wherein the polio vaccine booster is administered to the human patient at least one week prior to the first treatment phase. 118. The method of embodiments 115-117, wherein the first treatment phase is administered to the human patient between at least about one week and about 6 weeks following the administration of the polio vaccine booster. 119. The method of embodiments 112-118, wherein, between the first and second treatment phases, the patient undergoes an additional surgical resection of one or more residual tumors. 120. The method of embodiments 112-119, wherein the second treatment phase is initiated about 1 week following the cessation of the first treatment phase. 121. The method of embodiments 112-120, wherein the first treatment phase comprises administration of an effective amount of lerapolturev on day 1 and day 5 of a single 1-week treatment cycle. 122. The method of embodiments 112-120, wherein the first treatment phase comprises administration of an effective amount of lerapolturev on day 1 of two consecutive 1-week treatment cycles. 123. The method of embodiments 112-122, wherein the second treatment phase comprises at least two or more weekly cycles. 124. The method of embodiments 112-122, wherein the second treatment phase comprises at least three or weekly cycles. 125. The method of embodiments 112-122, wherein the second treatment phase comprises at least four or more weekly cycles. 126. The method of embodiments 112-125, further comprising a third treatment phase, wherein the third treatment phase is administered following the cessation of the second treatment phase, and wherein the third treatment phase comprises at least two or more cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle. 127. The method of embodiment 126, wherein the cycle of the third treatment phase is a three- week cycle, a four-week cycle, a five-week cycle, a six-week cycle, a two-month cycle, a three-month cycle, a four-month cycle, or a six-month cycle. 128. The method of embodiment 126 or 127, wherein the third treatment phase comprises at least five or more three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle. 129. The method of embodiments 126-128, wherein the third treatment phase comprises administering three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle, wherein the third treatment phase lasts for at least 6-months. 130. The method of embodiments 126-128, wherein the third treatment phase comprises administering three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle, wherein the third treatment phase lasts for at least 12-months. 131. The method of embodiments 126-128, wherein the third treatment phase comprises administering three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle, wherein the third treatment phase lasts for at least 15-months. 132. The method of embodiments 112-131, wherein the lerapolturev injection into the solid tumor administration route is selected from intratumoral, intranodal, or peritumoral. 133. The method of embodiments 112-131, wherein the lerapolturev injection into the solid tumor administration route is cavity wall injection. 134. The method of embodiments 112-133, wherein the perilymphatic administration comprises cervical perilymphatic subcutaneous injection. 135. The method of embodiments 112-134, wherein the one or more solid tumors comprise a cancer selected from glioblastoma multiforme (GBM), astrocytoma, oligodendroglioma, astro-oligodendroglioma, renal cell carcinoma, prostate cancer, bladder cancer, esophageal cancer, stomach cancer, pancreas cancer, colorectal cancer, liver cancer, gall bladder cancer, breast cancer, medulloblastoma, lung cancer, head and neck squamous cell carcinoma (HNSCC), melanoma, ovarian cancer, or sarcoma. 136. The method of embodiments 112-134, wherein the one or more solid tumors comprise glioblastoma multiforme (GBM). 137. The method of embodiment 136, wherein the GBM is newly-diagnosed GBM (ndGBM). 138. The method of embodiment 136, wherein the GBM is recurrent GBM (rGBM). 139. The method of embodiments 112-134, wherein the one or more solid tumors comprise melanoma. 140. The method of embodiments 112-134, wherein the one or more solid tumors comprise bladder cancer. 141. The method of embodiments 112-140, further comprising an additional cancer therapy selected from a chemotherapy, a radiation, an immune checkpoint inhibitor (ICI), an antiangiogenic therapy, or a combination thereof. 142. The method of embodiment 141, wherein the additional cancer therapy comprises a chemotherapeutic agent. 143. The method of embodiment 141, wherein the additional cancer treatment comprises an immune checkpoint inhibitor (ICI). 144. The method of embodiment 143, wherein the ICI is selected from a programmed cell death -1 (PD-1) inhibitor, a programmed cell death-ligand 1 (PD-L1) inhibitor, a cytotoxic T- lymphocyte-associated protein 4 (CTLA-4) inhibitor, a lymphocyte-activation gene 3 (LAG-3) inhibitor, a T-cell immunoglobulin mucin-3 (TIM-3) inhibitor, a T cell immunoreceptor with Ig and ITIM domains (TIGIT) inhibitor, a V-domain Ig suppressor of T-cell activation (VISTA) inhibitor, a carcinoembryonic antigen cell adhesion molecule (CEACAM) inhibitor, a sialic acid-binding immunoglobulin-like lectin 15 (Siglec-15) inhibitor, a CD47 inhibitor, a CD39 inhibitor, or a B and T lymphocyte attenuator (BTLA) protein inhibitor, a B7-H3 / CD276 inhibitor, an indoleamine 2,3-dioxygenase (IDO) inhibitor, a killer immunoglobin-like receptor (KIR) inhibitor, or a combination thereof. 145. The method of embodiment 143 or 144, wherein the ICI is administered at the standard recommended dose and schedule as described on an FDA approved label. 146. The method of embodiments 112-145, the method is administered as a first-line (1L) therapy. 147. The method of embodiments 112-145, the method is administered as a second-line (2L) therapy. 148. The method of embodiments 112-145, the method is administered as a third-line (3L) therapy. 149. The method of embodiments 112-148, further comprising administering a standard of care therapy following the cessation of the additional surgical resection. 150. The method of embodiments 112-149, wherein lerapolturev is administered in a dose of between about 1x108TCID50 and 5x108TCID50. 151. The method of embodiment 150, wherein lerapolturev is administered in a dose of about 1x108TCID50. 152. The method of embodiment 150, wherein lerapolturev is administered in a dose of about 2x108TCID50. 153. The method of embodiment 150, wherein lerapolturev is administered in a dose of about 4x108TCID50. 154. A method of treating a human patient having one or more GBM tumors, wherein the treatment comprises: (i) a first treatment phase comprising one or more treatment cycles comprising administration of an effective amount of lerapolturev to the human patient at least twice total; (ii) a second treatment phase comprising at least two or more weekly cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each weekly cycle. 155. The method of embodiment 154, wherein, prior to the first treatment phase, the patient undergoes a first surgical resection of one or more GBM tumors. 156. The method of embodiment 155, wherein the first surgical resection comprises maximal safe surgical resection. 157. The method of embodiments 154-156, wherein, prior to the first treatment phase, a polio vaccine booster is administered to the human patient. 158. The method of embodiment 157, wherein the polio vaccine booster is administered to the human patient at least about two weeks following the surgical resection. 159. The method of embodiment 157 or 158, wherein the polio vaccine booster is administered to the human patient at least one week prior to the first treatment phase. 160. The method of embodiments 157-159, wherein the first treatment phase is administered to the human patient between at least about one week and about 6 weeks following the administration of the polio vaccine booster. 161. The method of embodiments 154-160, wherein, between the first and second treatment phases, the patient undergoes an additional surgical resection of one or more residual GBM tumors. 162. The method of embodiments 154-161, wherein the second treatment phase is initiated about 1 week following the cessation of the first treatment phase. 163. The method of embodiments 154-162, wherein the first treatment phase comprises administration of an effective amount of lerapolturev on day 1 and day 5 of a single 1-week treatment cycle. 164. The method of embodiments 154-162, wherein the first treatment phase comprises administration of an effective amount of lerapolturev on day 1 of two consecutive 1-week treatment cycles. 165. The method of embodiments 154-164, wherein the second treatment phase comprises at least two or more weekly cycles. 166. The method of embodiments 154-164, wherein the second treatment phase comprises at least three or weekly cycles. 167. The method of embodiments 154-164, wherein the second treatment phase comprises at least four or more weekly cycles. 168. The method of embodiments 154-167, further comprising a third treatment phase, wherein the third treatment phase is administered following the cessation of the second treatment phase, and wherein the third treatment phase comprises at least two or more cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle. 169. The method of embodiment 168, wherein the cycle of the third treatment phase is a three- week cycle, a four-week cycle, a five-week cycle, a six-week cycle, a two-month cycle, a three-month cycle, a four-month cycle, or a six-month cycle. 170. The method of embodiment 168 or 169, wherein the third treatment phase comprises at least five or more three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle. 171. The method of embodiments 168-170, wherein the third treatment phase comprises administering three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle, wherein the third treatment phase lasts for at least 6-months. 172. The method of embodiments 168-170, wherein the third treatment phase comprises administering three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle, wherein the third treatment phase lasts for at least 12-months. 173. The method of embodiments 168-170, wherein the third treatment phase comprises administering three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle, wherein the third treatment phase lasts for at least 15-months. 174. The method of embodiments 154-173, wherein the lerapolturev administration during the first treatment phase comprises convection enhanced delivery (CED). 175. The method of embodiments 154-173, wherein the lerapolturev administration during the first treatment phase comprises cavity wall injection. 176. The method of embodiments 154-175, wherein the lerapolturev administration during the first treatment phase comprises direct infusion via an Ommaya reservoir into a surgical cavitary. 177. The method of embodiments 154-176, wherein the perilymphatic administration comprises cervical perilymphatic subcutaneous injection. 178. The method of embodiments 154-177, wherein the one or more GBM tumors comprise newly diagnosed glioblastoma (ndGBM). 179. The method of embodiment 178, wherein the ndGBM harbors an unmethylated O6- methylguanine-DNA methyltransferase promoter (MGMTp). 180. The method of embodiments 154-177, wherein the one or more GBM tumors comprise recurrent glioblastoma (rGBM). 181. The method of embodiments 154-180, wherein the one or more residual GBM tumors are residual tumors with a non-enhancing fluid-attenuated inversion recovery (FLAIR) signal. 182. The method of embodiments 154-181, further comprising an additional GBM cancer therapy selected from a chemotherapy, a radiation, an immune checkpoint inhibitor (ICI), an antiangiogenic therapy, or a combination thereof. 183. The method of embodiment 182, wherein the additional GBM cancer therapy comprises radiation therapy. 184. The method of embodiment 182, wherein the additional GBM cancer therapy comprises a chemotherapeutic agent. 185. The method of embodiment 184, wherein the chemotherapeutic agent is selected from temozolomide, carmustine, lomustine, nimustine, fotemustine, etoposide, dasatinib, temsirolimus, erlotinib, sorafenib, Panobinostat, vorinostat, or a combination thereof. 186. The method of embodiment 184, wherein the chemotherapeutic agent is temozolomide. 187. The method of embodiment 182, wherein the additional GBM cancer treatment comprises an immune checkpoint inhibitor (ICI). 188. The method of embodiment 187, wherein the ICI is selected from a programmed cell death -1 (PD-1) inhibitor, a programmed cell death-ligand 1 (PD-L1) inhibitor, a cytotoxic T- lymphocyte-associated protein 4 (CTLA-4) inhibitor, a lymphocyte-activation gene 3 (LAG-3) inhibitor, a T-cell immunoglobulin mucin-3 (TIM-3) inhibitor, a T cell immunoreceptor with Ig and ITIM domains (TIGIT) inhibitor, a V-domain Ig suppressor of T-cell activation (VISTA) inhibitor, a carcinoembryonic antigen cell adhesion molecule (CEACAM) inhibitor, a sialic acid-binding immunoglobulin-like lectin 15 (Siglec-15) inhibitor, a CD47 inhibitor, a CD39 inhibitor, or a B and T lymphocyte attenuator (BTLA) protein inhibitor, a B7-H3 / CD276 inhibitor, an indoleamine 2,3-dioxygenase (IDO) inhibitor, a killer immunoglobin-like receptor (KIR) inhibitor, or a combination thereof. 189. The method of embodiment 187or 188, wherein the ICI is administered at the standard recommended dose and schedule as described on an FDA approved label. 190. The method of embodiment 182, wherein the additional GBM cancer treatment comprises administering an antiangiogenic therapy. 191. The method of embodiment 190, wherein the antiangiogenic therapy is bevacizumab. 192. The method of embodiments 154-191, the method is administered as a first-line (1L) therapy. 193. The method of embodiments 154-191, the method is administered as a second-line (2L) therapy. 194. The method of embodiments 154-191, the method is administered as a third-line (3L) therapy. 195. The method of embodiments 154-194, further comprising administering a GBM standard of care therapy following the cessation of the additional surgical resection. 196. The method of embodiment 195, wherein the GBM standard of care therapy comprises administering to the human an effective amount of radiotherapy and an effective amount of temozolomide. 197. The method of embodiments 154-196, wherein lerapolturev is administered in a dose of between about 1x108TCID50 and 5x108TCID50. 198. The method of embodiment 197, wherein lerapolturev is administered in a dose of about 1x108TCID50. 199. The method of embodiment 197, wherein lerapolturev is administered in a dose of about 2x108TCID50. 200. The method of embodiment 197, wherein lerapolturev is administered in a dose of about 4x108TCID50. 201. The method of embodiments 1-200, wherein the polio vaccine booster comprises a monovalent (type-1) oral polio vaccine. 202. The method of embodiments 1-200, wherein the polio vaccine booster comprises a bivalent oral polio vaccine. 203. The method of embodiments 1-200, wherein the polio vaccine booster comprises a trivalent oral polio vaccine. 204. The method of embodiments 1-200, wherein the polio vaccine booster is the IPOL polio vaccine. 205. The method of embodiments 1-204, wherein the treatment results in an improvement in progression free survival (PFS) in comparison to the predicted PFS in humans administered radiotherapy and / or temozolomide without a chimeric poliovirus. 206. The method of embodiments 1-205, wherein the treatment results in an improvement in overall survival (OS) in comparison to the predicted OS in humans administered radiotherapy and / or temozolomide without a chimeric poliovirus. 207. The method of embodiments 1-206, wherein the treatment results in an improvement in progression free survival (PFS) and / or overall survival (OS) in humans compared to the predicted PFS and / or OS in humans administered radiotherapy and / or temozolomide without a chimeric poliovirus. 208. The method of embodiments 1-207, wherein the treatment results in enhanced anti-tumor efficacy in humans compared to humans administered radiotherapy and / or temozolomide without a chimeric poliovirus.

[0002] EXAMPLES The claimed invention is further described by way of the following non-limiting examples. Further aspects and embodiments of the present invention will be apparent to those of ordinary skill in the art, in view of the above disclosure and following experimental exemplification, included by way of illustration and not limitation, and with reference to the attached figures. Example 1. Neoadjuvant Lerapolturev for Resectable Newly Diagnosed Glioblastoma (ndGBM) Study Design An open-label, quadruple-arm, randomized study characterizing the safety, tolerability and efficacy of neoadjuvant lerapolturev delivered via convection enhanced delivery (CED) infusion and optionally including cervical perilymphatic subcutaneous injection or direct intracavitary injection via an Ommaya catheter in participants with newly diagnosed glioblastoma (ndGBM) was designed. Approximately 48 eligible participants, 18 years of age or older, are enrolled and treated with lerapolturev administered once by convection enhanced delivery (CED) infusion during a first treatment phase (Arm A) versus lerapolturev administered twice by convection enhanced delivery (CED) infusion during a first treatment phase (Arm B), versus neoadjuvant lerapolturev administered by convection enhanced delivery (CED) infusion twice during a first treatment phase and four times by cervical perilymphatic subcutaneous injection during a second treatment phase (Arm C), versus neoadjuvant lerapolturev administered by convection enhanced delivery (CED) infusion twice during a first treatment phase and four times by direct intracavitary infusion via an Ommaya catheter into the surgical cavity during a second treatment phase (Arm D), each arm followed by simultaneous tissue collection (either surgical resection or biopsy) as long as imaging changes are suspicious for tumor progression vs. immune effect. A diagnosis of tumor progression or recurrence may trigger repeat treatment with lerapolturev in this study by infusion into the cavity wall or by convection enhanced delivery (CED) infusion. The maximum planned duration of follow-up in this study is up to 24 months (104 weeks). The study occurs in the following periods as outlined in the Schedule of Assessments (FIG.4). Participants reaching 24 months on this study may be offered participation in a longer-term follow-up / lerapolturev retreatment protocol or other mechanisms. A single booster immunization of trivalent inactivated IPOL® (Sanofi-Pasteur SA; obtained via site) are administered according to the following: ≥ 1 week but ≤ 3 weeks of the initial lerapolturev infusion. Participants are treated with a prophylactic antibiotic prior to catheter insertion per the site’s neurosurgical standard practice. The biopsy needle and catheter are placed by the trained operating surgeon with stereotactic guidance using a MRI-compatible stereotactic head frame or a similar frameless device, and an Food and Drug Administration (FDA) cleared stereotaxic guidance system guided by a pre- operative MRI. After biopsy(ies), a catheter is implanted in the operating room using sterile techniques, which may occur under general anesthesia at the discretion of the treating neurosurgeon, at the same site or a different site from that used for the biopsy. The catheter is tunneled beneath the scalp for a distance of at least 5 cm to aid in the prevention of infection. The catheter is placed within or through the progressive tumor (enhancing or residual non- enhancing after maximal safe resection of the enhancing portion), at a safe distance relative to eloquent brain function, with the tip of the catheter being placed: o Within the enhancing portion or in the non-enhancing target lesion (i.e., infiltrative disease) o ≥ 0.5 cm from ventricles o ≥ 1 cm deep into the brain o ≥ 0.5 cm from the corpus callosum In addition, for Arm D only, the insertion of the CED catheter will be followed by the insertion of an Ommaya catheter within the surgical cavity created at the time of maximal safe tumor resection. A CT scan is used to confirm catheter placement criteria post-operatively. If anesthesia is utilized in the catheter placement procedure, use should be discontinued once there is CT scan confirmation of appropriate catheter placement. At the time of lerapolturev infusion (Arm A, Arm B, Arm C, and Arm D), emergency drugs, including epinephrine and diphenhydramine are available and the neurologic status, oxygen saturation, and cardiac rhythm of the participant is monitored. Drug infusion occurs in the neuro- intensive care unit (ICU) or neuro step down unit so that all other emergency facilities are available. Platelet count is confirmed prior to lerapolturev infusion as well as at time of catheter removal and remains consistent with inclusion criteria. Administration of Lerapolturev Lerapolturev is formulated in 50 mM sodium phosphate in 0.9% sodium chloride, pH 7.4 with 0.2% human serum albumin (HSA) in phosphate buffered saline (PBS). The lerapolturev infusate solution will be delivered at a final dose of 2 x 108TCID50 to the participant. In brief, the stock lerapolturev will be diluted with 0.2% HSA in PBS (diluent), mixed via gentle inversion and presented in a 10 mL Infusion Syringe such that when 3.0 mL is infused, a total dose of 2 x 108TCID50 is administered to the participant. Convection Enhanced Delivery (CED) Infusion The first Lerapolturev infusion will occur on the same day or the day after catheter placement to allow flexibility due to the longer infusion (approximately 6 h) and complexity of scheduling the necessary components for the infusion (e.g., operating room time, surgeon, support team, pharmacy time, radiology appointments). However, under extenuating circumstances (e.g., unavoidable scheduling issues, delayed diagnosis from biopsy, issues with investigational product or other critical supplies), the time from catheter placement to lerapolturev infusion may be extended up to 72 h post-placement. This timeframe is in keeping with other agents delivered safely via CED via similar procedures for even longer periods of time, which was not associated with increased risk of infection (Kunwar, S. et al. Phase III randomized trial of CED of IL13- PE38QQR vs Gliadel wafers for recurrent glioblastoma. Neuro Oncol. 12(8):871-881(2010); Hagel, S. et al. External ventricular drain infections: risk factors and outcome. Interdiscip Perspect Infect Dis.2014:708531(2014)). Patients will be observed in the hospital overnight after the 1st infusion. If the patient is doing well per the neurosurgical and neuro-oncology team, patient may be discharged the next day (e.g., Tuesday morning if infusion occurred on Monday) and asked to remain close to the hospital (i.e., at home if local [within about 30 miles] or in a nearby hotel) until their 2nd infusion. The catheter will remain securely in place with a sterile dressing. On the evening prior to their 2nd infusion (e.g., on Thursday evening if infusion occurred on Monday), patients will be admitted directly to the Neurosciences Step Down unit or Neurosciences Intensive Care unit. At the completion of the 2nd infusion, the CED catheter will be removed, and a CT scan will be obtained afterward for safety (i.e., to check for any bleeding). The patient will be observed in the hospital for a minimum of 6 h following CED catheter removal. Cervical Perilymphatic Subcutaneous Injection Cervical perilymphatic subcutaneous injections of lerapolturev (Arm C) will occur in the interventional suite. Patients will be prepped for aseptic administration of lerapolturev with a sterile field. The area selected for needle insertion will be cleaned with betadine and let to dry. Lerapolturev will be injected 1.5 cm inferior to the mastoid tip (below the insertion of the sternocleidomastoid on the mastoid process ipsilateral to the intracranial tumor. Under CT fluoroscopy guidance or ultrasound guidance, a 25 gauge or smaller needle will be inserted using a single insertion point into the selected area. A new needle will be used at any time the needle is completely removed. Once the needle is in place, lerapolturev will be slowly injected, pulling the needle back without exiting the injection site, until the full dose is evenly and completely dispersed. The needle will be removed slowly to avoid leakage of lerapolturev. Following the injection, pressure will be applied at the injection site for at least 30 seconds. The injection site and surrounding area will be cleaned with sterile water and covered per interventional practice. Direct Intracavitary Injection via an Ommaya Catheter Direct intracavitary injection of lerapolturev (Arm D) via an Ommaya catheter inserted into the surgical cavity created at the time of maximal safe tumor resection will occur in the interventional suite. Patients will be prepped for aseptic administration of lerapolturev with a sterile field and the area selected for needle insertion will be cleaned with betadine and let to dry. Lerapolturev will be injected directly into the reservoir portion of the Ommaya catheter. A new needle will be used at any time the needle is completely removed. Once the needle is in place, lerapolturev will be slowly injected until the full dose is completely infused. The needle will be removed slowly to avoid leakage of lerapolturev. Following the injection, pressure will be applied at the injection site for at least 30 seconds. The injection site and surrounding area will be cleaned with sterile water and covered per interventional practice. Tissue Collection via biopsy The participant’s most recent imaging as well as all other recent, relevant information and on-study clinical data is considered prior to preparation for tissue biopsy. If imaging changes are suggestive of tumor progression vs. immune effect, a biopsy will be scheduled. Prior to biopsy, or near-total tumor resection, the participant will have the assessments below completed. Tissue biopsy should proceed if the participant has been determined to be clinically stable (hemodynamically, metabolically and neurologically per recent laboratory and imaging assessments) and can and should receive further treatment. Tissue biopsy occurs per SOC and consistent with RANO criteria. Standard of Care Therapy - Radiation Standard of care radiation therapy is conducted following completion of the interventions as per Arms A-D. Post-therapy short-term follow-up is conducted on the study participant weekly. Assessments and treatment occur as reflected in FIG. 4. MRI of the brain with and without gadolinium contrast is performed approximately every 9-12 weeks per SOC until through a maximum of 104 weeks (24 months). Participants with confirmed progression meeting the key safety and infusion related eligibility criteria may be eligible for retreatment with lerapolturev > 6 months after their last treatment. Example 2. Neoadjuvant Lerapolturev for recurrent Glioblastoma (rGBM) Study Design An open-label, double-arm, randomized study characterizing the safety, tolerability and efficacy of neoadjuvant lerapolturev delivered via convection enhanced delivery (CED) infusion and optionally including cervical perilymphatic subcutaneous injection in participants with recurrent glioblastoma (rGBM) was designed. Approximately 46 eligible participants, 18 years of age or older, are enrolled and treated with lerapolturev. For Arm A and Arm B, lerapolturev is administered by convection enhanced delivery (CED) infusion twice, 4-days apart, on day 1 and day 5 of a single, one week cycle during a first treatment phase. For Arm B, lerapolturev is further administered by cervical perilymphatic subcutaneous injection once a week for four weeks during a second treatment phase and then once every three weeks during a third treatment phase. The maximum planned duration of follow-up in this study is up to 24 months (104 weeks). The study occurs in the following periods as outlined in the Schedule of Assessments (FIG.5)). Participants reaching 24 months on this study may be offered participation in a longer-term follow-up / lerapolturev retreatment protocol or other mechanisms. Following maximal safe surgical resection, a single booster immunization of trivalent inactivated IPOL® (Sanofi-Pasteur SA; obtained via site) are administered according to the following: ≥ 1 week but ≤ 6 weeks of the initial lerapolturev infusion. Participants are treated with a prophylactic antibiotic prior to catheter insertion per the site’s neurosurgical standard practice. A catheter is implanted in the operating room using sterile techniques, which may occur under general anesthesia at the discretion of the treating neurosurgeon. The catheter is tunneled beneath the scalp for a distance of at least 5 cm to aid in the prevention of infection. The catheter is placed within or through the progressive tumor (enhancing or residual non-enhancing after maximal safe resection of the enhancing component), at a safe distance relative to eloquent brain function, with the tip of the catheter being placed: o Within the enhancing portion or in the non-enhancing target lesion (i.e., infiltrative disease) o ≥ 0.5 cm from ventricles o ≥ 1 cm deep into the brain o ≥ 0.5 cm from the corpus callosum A CT scan is used to confirm catheter placement criteria post-operatively. If anesthesia is utilized in the catheter placement procedure, use should be discontinued once there is CT scan confirmation of appropriate catheter placement. At the time of lerapolturev infusion (Arm A and Arm B), emergency drugs, including epinephrine and diphenhydramine are available and the neurologic status, oxygen saturation, and cardiac rhythm of the participant is monitored. Drug infusion occurs in the neuro-intensive care unit (ICU) or neuro step down unit so that all other emergency facilities are available. Platelet count is confirmed prior to lerapolturev infusion as well as at time of catheter removal. Administration of Lerapolturev Lerapolturev is formulated in 50 mM sodium phosphate in 0.9% sodium chloride, pH 7.4 with 0.2% human serum albumin (HSA) in phosphate buffered saline (PBS). It is provided in sterile, single use glass vials with a green flip off top and each vial contains approximately 1.0 mL of stock lerapolturev (approximately 3.3 x 10^8 TCID50). The diluent for lerapolturev is sterile. The lerapolturev infusate solution will be delivered at a final dose of 2 x 108TCID50to the participants. In brief, the stock lerapolturev will be diluted with 0.2% HSA in PBS (diluent), mixed via gentle inversion and presented in a 10 mL Infusion Syringe such that when 3.0 mL is infused, a total dose of 2 x 108TCID50is administered to the participant. The infusion syringe specified in the IPHP is loaded into an FDA cleared infusion pump (eg, Medfusion®3500 syringe infusion pump, Alaris™ Syringe Module Syringe Infusion Pump). Participants will receive lerapolturev infusate by means of CED over a period of approximately 6 h, at a rate of 0.5 mL / h through the tubing and catheter embedded into the participant’s tumor or tumor-infiltrated non-enhancing brain and affixed to the scalp. Convection Enhanced Delivery (CED) Infusion The first Lerapolturev infusion will occur on the same day or the day after catheter placement to allow flexibility due to the longer infusion (approximately 6 h) and complexity of scheduling the necessary components for the infusion (e.g., operating room time, surgeon, support team, pharmacy time, radiology appointments). However, under extenuating circumstances (e.g., unavoidable scheduling issues, delayed diagnosis from biopsy, issues with investigational product or other critical supplies), the time from catheter placement to lerapolturev infusion may be extended up to 72 h post-placement. This timeframe is in keeping with other agents delivered safely via CED via similar procedures for even longer periods of time, which was not associated with increased risk of infection (Kunwar, S. et al. Phase III randomized trial of CED of IL13- PE38QQR vs Gliadel wafers for recurrent glioblastoma. Neuro Oncol. 12(8):871-881(2010); Hagel, S. et al. External ventricular drain infections: risk factors and outcome. Interdiscip Perspect Infect Dis.2014:708531(2014)). Patients will be observed in the hospital overnight after the 1st infusion. If the patient is doing well per the neurosurgical and neuro-oncology team, patient may be discharged the next day (e.g., Tuesday morning if infusion occurred on Monday) and asked to remain close to the hospital (i.e., at home if local [within about 30 miles] or in a nearby hotel) until their 2nd infusion. The catheter will remain securely in place with a sterile dressing. On the evening prior to their 2nd infusion (e.g., on Thursday evening if infusion occurred on Monday), patients will be admitted directly to the Neurosciences Step Down unit or Neurosciences Intensive Care unit. At the completion of the 2nd infusion, the CED catheter will be removed, and a CT scan will be obtained afterward for safety (i.e., to check for any bleeding). The patient will be observed in the hospital for a minimum of 6 h following CED catheter removal. Cervical Perilymphatic Subcutaneous Injection Cervical perilymphatic subcutaneous injections of lerapolturev (Arm C) will occur in the interventional suite. Patients will be prepped for aseptic administration of lerapolturev with a sterile field. The area selected for needle insertion will be cleaned with betadine and let to dry. Lerapolturev will be injected 1.5 cm inferior to the mastoid tip (below the insertion of the sternocleidomastoid on the mastoid process ipsilateral to the intracranial tumor. Under CT fluoroscopy guidance or ultrasound guidance, a 25 gauge or smaller needle will be inserted using a single insertion point into the selected area. A new needle will be used at any time the needle is completely removed. Once the needle is in place, lerapolturev will be slowly injected, pulling the needle back without exiting the injection site, until the full dose is evenly and completely dispersed. The needle will be removed slowly to avoid leakage of lerapolturev. Following the injection, pressure will be applied at the injection site for at least 30 seconds. The injection site and surrounding area will be cleaned with sterile water and covered per interventional practice. Post-Therapy Follow-Up Post-therapy short-term follow-up is conducted on the study participant weekly. Assessments and treatment occur as reflected in FIG. 5. MRI of the brain with and without gadolinium contrast is performed approximately every 9-12 weeks per SOC until through a maximum of 104 weeks (24 months). Participants with confirmed progression meeting the key safety and infusion related eligibility criteria may be eligible for retreatment with lerapolturev > 6 months after their last treatment. Example 3. PVSRIPO Infection of Microglia Mechanistic studies of laboratory-grade Lerapolturev (PVSRIPO) performed in fully innate competent models suggest an innate imprint role of PVSRIPO (Dobrikov, M.I. et al. PKR Binds Enterovirus IRESs, Displaces Host Translation Factors, and Impairs Viral Translation to Enable Innate Antiviral Signaling. mBio. 13:e0085422 (2022); Dobrikov, M.I. et al. Early enterovirus translation deficits extend vRNA replication and elicit sustained MDA5-directed innate signaling. mBio. e0191523(2023); Yang, Y. et al. Polio Virotherapy Targets the Malignant Glioma Myeloid Infiltrate with Diffuse Microglia Activation Engulfing the CNS. Neuro Oncol (2023)). To document the innate immune response of PVSRIPO in a clinically relevant context, microglia isolated from hCD155-tg mouse and human (epilepsy surgery) brain tissue were infected with PVSRIPO or mock control and investigated for microglial activation. This experiment is reproduced from Yang, Y. et al. Polio Virotherapy Targets the Malignant Glioma Myeloid Infiltrate with Diffuse Microglia Activation Engulfing the CNS. Neuro Oncol (2023)). At the sample collection interval defined by the specific study, mice were euthanized, and brains were harvested for fixation in 10% formalin (Fisher Chemical) for 1-2 days and transferred to 70% ethanol for dehydration. All slides in this study were coronal sections (7 μm for histology; 20 μm for RNAseq) of the tumor implantation site. Using the needle track and anterior commissure as landmarks ensured that all sections were at the center and the largest diameter for comparison among samples. Hematoxylin and eosin (H&E) staining followed a standard protocol at the Duke Pathology core facility. Sections were deparaffinized in xylene twice (10 min) and gradually rehydrated in 100%, 90%, 70% ethanol (5 min each). Sections were left in dH2O (5 min), dipped in hematoxylin (1 min), washed in tap water (5 min), dipped in Eosin Y (1% alcoholic; 0.5 min), gradually dehydrated twice in 95% (5 min) and 100% ethanol (5 min), cleared with xylene twice (10 min), and mounted with Sub-X Mounting Medium (Leica). IHC was done on the Roche Ventana Discovery XT platform; FFPE sections were submitted for automated staining with Omni-map anti-Rabbit horseradish peroxidase-3,3’-diaminobenzidine (HRP-DAB). Slides were deparaffinized and subjected to IHC with primary antibodies anti-Iba1 (Novus, Cat. # NB100- 1028) or anti-Tmem119 (Cell Signaling, Cat. # 80821) diluted in 0.1% BSA, followed by appropriate HRP-conjugated secondary antibodies, DAB staining, and hematoxylin and bluing agent counterstain. After staining, slides were washed in running soap water, dehydrated with a series of graded ethanol, cleaned with Sub-X, and mounted in Sub-X Mounting Medium (Leica) and then imaged. Global microglia activation was evident after PVSRIPO inoculation in non-tumor bearing hCD155-tg mouse brains stained with the pan-microglial marker Iba1 (FIG.6B) and the microglia- specific marker Tmem119 (FIG.7B). The microglial response was distinguished by its widespread intensity, signified by the profuse proliferation of microglia. See for example, the increased cytoplasmic area and thickened ramified processes of Iba+ and / or Tmem119+ microglia throughout the section images. In stark contrast, microglia typically exhibit localized activation in response to viral infection of the CNS which is centered around damaged glia / neurons (Chhatbar, C. & Prinz, M. The roles of microglia in viral encephalitis: from sensome to therapeutic targeting. Cell Mol Immunol.18:250-258(2021)). Notably, no microglia activation was observed in either of the Iba1- or Tmem119-stained mock controls (FIG.6A, 7A). While not wishing to be bound by any particular theory, it is believed that PVSRIPO profoundly activates microglia on a global level in the CNS via robust and sustained replication of PVSRIPO vRNA in microglial cells directly infected with PVSRIPO, rather than a ‘classic’ response to viral CNS damage. Example 4. Sustained Viral PVSRIPO RNA Replication in Microglia To document the replication of PVSRIPO in a clinically relevant context, microglia that were bead-isolated from hCD155-tg mouse and human brain tissue were infected with PVSRIPO or mock control and investigated for PVSRIPO vRNA levels. RT-qPCR of total RNA from PVSRIPO-infected, CD11b+ bead-isolated microglia from hCD155-tg mouse or human brain tissue revealed the presence of vRNA replication (FIG.8A-8B). RT-qPCR of total RNA from bead-isolated microglia from hCD155-tg mice treated with intracerebral PVSRIPO inoculation as in FIG. 6B and 7B, indicated microglia targeting by PVSRIPO in vivo (FIG.8C). Following the observation of profound PVSRIPO vRNA in isolated microglial cells as determined by RT-qPCR, immunofluorescence imaging of microglia was conducted to confirm PVSRIPO vRNA replication in situ. FISH co-staining of minus- and plus-strand PVSRIPO RNA in human microglia (CD11b+:bead-isolated from epilepsy surgery brain tissue) revealed an intriguing pattern of vRNA replication (FIG. 9A-9C). At 24 hours post-inoculation (hpi), the predominant signal was minus-strand vRNA, which is the initial product of active vRNA replication (FIG.9B). In comparison, there was protracted, slow emergence of plus-strand RNA copies over time (48h, 72h, and 96h panels of FIG.9C). While not wishing to be bound by any particular theory, these findings suggest that microglia—akin to myeloid cells—are susceptible to PVSRIPO and harbor ongoing, non- cytopathogenic vRNA replication. These data also explain the widespread, profound proinflammatory microglia response to PVSRIPO in mouse gliomas (Yang, Y. et al. Polio Virotherapy Targets the Malignant Glioma Myeloid Infiltrate with Diffuse Microglia Activation Engulfing the CNS. Neuro Oncol (2023)). Example 5. PVSRIPO Induces Profound Activation of Microglia To assess the effects of PVSRIPO-induced microglia activation, glioma cell phagocytosis assays were analyzed. hCD155-tg mouse microglia were infected with either mock solution or with PVSRIPO. Following this, the mice were ‘fed’ UV-irradiated, trace-labeled CT2A mouse glioma cells and phagocytosis was monitored by flow cytometry. PVSRIPO induced robust phagocytic activity which resulted in approximately 46% of microglia in the sample acquiring trace signal from engulfed CT2A cells at 72hpi (FIG.10). While not wishing to be bound by any particular theory, these collective data indicate that PVSRIPO directly infects non-malignant microglia in the tumor microenvironment (TME) to induce inflammatory phenotypes and phagocytosis of tumor cell material, a phenomenon which is known to potentiate cancer immune surveillance, supporting the targeting of normal brain tissue, for example non-enhancing disease, that is infiltrated with malignant cells using virotherapy agents. Example 6. Augmented Antitumor Effects of Multi-Dose PVSRIPO Intratumor Virotherapy Thus, to assess whether reinforcing innate inflammation engages newly infiltrating innate and adaptive immune cells to bolster the antitumor efficacy of polio virotherapy, murine models were immunized against polio prior to tumor implantation then administered PVSRIPO therapy or mock control. Briefly, PVR transgenic C57BL6 mice were immunized against polio at -45 and -30 days prior to CT2A implantation. Intracranial CT2A gliomas were implanted and then treated intratumorally with either single dosing at day 7 or doublet dosing at days 7 and 10 post- implantation of mock control or PVSRIPO. While mice administered a single dosing of PVSRIPO at day 7 post-implantation exhibited a trend toward increased survival compared to the control condition, murine gliomas that received periodically spaced doublet demonstrated significantly increased survival (p=0.0002) (FIG.11A). In an independent experiment, subcutaneous B16 melanoma tumors were established in PVR transgenic mice and treated with either a single- or double-dose of mock or PVSRIPO on days 8 (day 0 post-treatment) and 12 (day 4 post-treatment) (FIG.11B-11C). Treatment of murine melanomas with periodically spaced doublet dosing of PVSRIPO profoundly augmented antitumor efficacy (FIG.11C). While not wishing to be bound by any particular theory, these findings suggest that doublet intratumoral dosing of PVSRIPO potently recalls antitumor effects of polio recall by engaging type I dominant innate inflammation that culminates in the engagement of antitumor T cell immunity. Example 7. Augmented Antitumor Effects of Multi-Dose PVSRIPO Peri-Lymphatic Virotherapy Poliovirus exhibits natural lymphotropism (Bodian, D. Emerging concept of poliomyelitis infection. Science. 122:105-108(1955)) and immune activation in tumor draining lymph nodes (TDLNs) from mouse tumor models treated with PVSRIPO (Brown, M.C. et al. Viral infection of cells within the tumor microenvironment mediates antitumor immunotherapy via selective TBK1- IRF3 signaling. Nat Commun 12:1858(2021)). To determine if direct TDLN targeting contributes to therapy, intranodal injections compared to intratumoral or perinodal (which due to the proximity to the tumor is equivalent to “peritumoral”) routes of PVSRIPO into inguinal lymph node were assessed in mice harboring flank B16 melanomas. While intratumoral PVSRIPO administration exhibited the strongest antitumor effect, either intranodal (guided by Evans blue LN staining) or perinodal injections alone mediated antitumor effects (FIG. 12A). This suggests that cervical peri-lymphatic injections (CPLI) of PVSRIPO is a viable treatment option. In view of this, CPLI of PVSRIPO with and without intratumoral PVSRIPO treatment were also tested in CT2A glioma. For mice receiving tandem repeat intratumoral PVSRIPO, the dose for each injection was deliberately lowered from 5x107to a suboptimal 1x107TCID to allow for the effects of periodically spaced perilymphatic inoculation (with 5x107) to manifest. The combination of intratumor doublet PVSRIPO administrations with repeated, periodically spaced CPLI PVSRIPO led to an unexpectedly improved survival of the CT2A glioma murine models (FIG.12B). Although lowering the intratumoral doses 5-fold diminished antitumor efficacy, the addition of CPLI PVSRIPO surprisingly recovered the durable remission rate to levels comparable to those observed in the setting of full-dose tandem repeat intratumoral PVSRIPO injection (compare FIGs.11A and 12B). These data demonstrate that in relevant murine models, iterative intratumor and perilymphatic dosing synergistically improves the antitumor efficacy of polio virotherapy and supports the critical role for TDLNs in supporting dendritic cell mediated antitumor T cell priming and, importantly, that cervical peri-lymphatic injections are a viable and unexpected clinical method to sustain antitumor T cell immunity originally engaged by intratumor PVSRIPO therapy.

Claims

CLAIMS What is claimed is:

1. A method of treating a human patient having newly diagnosed glioblastoma (ndGBM) following a first surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster at least about two weeks following the first surgical resection of the one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated at least about 1 week following the administration of the polio-vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev into the first surgical resection site on day 1 of the 1-week cycle to treat a residual GBM tumor, and optionally again on day 5 of the 1- week cycle; and (iii) a second treatment phase, wherein a) the patient undergoes a second surgical resection of one or more residual GBM tumors about 5 weeks following the initiation of the first treatment phase, and b) wherein, following the second surgical resection, the patient is further administered an effective amount of lerapolturev into the second surgical resected site by cavity wall injection or optionally by convection enhanced delivery (CED).

2. The method of claim 1, further comprising administering to the patient once weekly for 4 consecutive weeks an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection, wherein the cervical perilymphatic subcutaneous injections are administered following the cessation of the first treatment phase, and before the initiation of the second treatment phase.

3. A method of treating a human patient having newly diagnosed glioblastoma (ndGBM) following a first surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster at least about two weeks following the first surgical resection of the one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated at least about 1 week following the administration of the polio-vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to thepatient an effective amount of lerapolturev into the first surgical resection site on day 1 and day 5 of the 1-week cycle to treat a residual GBM tumor; and (iii) a second treatment phase, wherein a) the patient undergoes a second surgical resection of one or more residual GBM tumors about 5 weeks following the initiation of the first treatment phase, and b) wherein, following the second surgical resection, the patient is further administered an effective amount of lerapolturev into the second surgical resected site by cavity wall injection or optionally by convection enhanced delivery (CED).

4. A method of treating a human patient having newly diagnosed glioblastoma (ndGBM) following a first surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster at least about two weeks following the first surgical resection of the one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated at least about 1 week following the administration of the polio-vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev into the first surgical resection site on day 1 of the 1-week cycle to treat a residual GBM tumor, and optionally again on day 5 of the 1- week cycle; (iii) a second treatment phase, wherein the second treatment phase is initiated about 1 week following the cessation of the first treatment phase, wherein the second treatment phase comprises administering an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection once weekly for four consecutive weeks; and (iv) a third treatment phase, wherein a) the patient undergoes a second surgical resection of one or more residual GBM tumors about 5 weeks following the initiation of the first treatment phase and about 1 week following the cessation of the second treatment phase, and b) wherein, following the second surgical resection, the patient is further administered an effective amount of lerapolturev into the second surgical resected site by cavity wall injection or optionally by convection enhanced delivery (CED).

5. The method of claims 1-4, wherein the first treatment phase comprises a single, 1-week cycle.

6. The method of claims 1-4, wherein the first treatment phase comprises two or more treatment cycles.

7. The method of claims 1-6, wherein the ndGBM patient is further administered an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection one or more times once every three weeks, four weeks, five weeks, six weeks, two months, three months, four months, or six months following the second surgical resection.

8. The method of claims 1-6, wherein the ndGBM patient is further administered an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection one or more times once every three weeks following the second surgical resection.

9. The method of claims 1-8, wherein the residual GBM tumor is a residual tumor with a non- enhancing fluid-attenuated inversion recovery (FLAIR) signal.

10. The method of claims 1-9, wherein the ndGBM harbors an unmethylated O6- methylguanine-DNA methyltransferase promoter (MGMTp).

11. The method of any of claims 1-10, further comprising administering an additional glioblastoma cancer therapy selected from a chemotherapy, a radiation, an immune checkpoint inhibitor (ICI), an antiangiogenic therapy, or a combination thereof.

12. The method of claim 11, wherein the additional glioblastoma cancer treatment comprises administering radiation therapy.

13. The method of claim 11 or 12, wherein the additional glioblastoma cancer treatment comprises a chemotherapeutic agent.

14. The method of claim 13, wherein the chemotherapeutic agent is selected from temozolomide, carmustine, lomustine, nimustine, fotemustine, etoposide, dasatinib, temsirolimus, erlotinib, sorafenib, Panobinostat, vorinostat, or a combination thereof.

15. The method of claim 14, wherein the chemotherapeutic agent is temozolomide.

16. The method of claims 11-15, wherein the additional glioblastoma cancer treatment comprises an immune checkpoint inhibitor (ICI).

17. The method of claim 16, wherein the ICI is selected from a programmed cell death -1 (PD- 1) inhibitor, a programmed cell death-ligand 1 (PD-L1) inhibitor, a cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) inhibitor, a lymphocyte-activation gene 3 (LAG-3) inhibitor, a T- cell immunoglobulin mucin-3 (TIM-3) inhibitor, a T cell immunoreceptor with Ig and ITIM domains (TIGIT) inhibitor, a V-domain Ig suppressor of T-cell activation (VISTA) inhibitor, a carcinoembryonic antigen cell adhesion molecule (CEACAM) inhibitor, a sialic acid-binding immunoglobulin-like lectin 15 (Siglec-15) inhibitor, a CD47 inhibitor, a CD39 inhibitor, or a B and T lymphocyte attenuator (BTLA) protein inhibitor, a B7-H3 / CD276 inhibitor, an indoleamine 2,3-dioxygenase (IDO) inhibitor, a killer immunoglobin-like receptor (KIR) inhibitor, or a combination thereof.

18. The method of claim 16 or 17, wherein the ICI is administered at the standard recommended dose and schedule as described on an FDA approved label.

19. The method of claims 11-18, wherein the additional glioblastoma cancer treatment comprises administering an antiangiogenic therapy.

20. The method of claim 19, wherein the antiangiogenic therapy is bevacizumab.

21. The method of claims 1-20, the method is administered as a first-line (1L) therapy.

22. The method of claims 1-21, wherein the method further comprises administering a glioblastoma standard of care therapy following the cessation of the second surgical resection.

23. The method of claim 22, wherein the glioblastoma standard of care therapy comprises administering to the human an effective amount of radiotherapy and an effective amount of temozolomide.

24. The method of claims 1-23, wherein lerapolturev is administered in a dose of between about 1x108TCID50 and 5x108TCID50.

25. The method of claim 24, wherein lerapolturev is administered in a dose of about 1x108TCID50.

26. The method of claim 24, wherein lerapolturev is administered in a dose of about 2x108TCID50.

27. The method of claim 24, wherein lerapolturev is administered in a dose of about 4x108TCID50.

28. A method of treating a human patient having recurrent (rGBM) following a surgical resection of one or more GBM tumors, wherein the treatment comprises:(i) administering a polio vaccine booster at least about two weeks following the surgical resection of the one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated at least about 1 week following the administration of the polio-vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycle comprising administering to the patient an effective amount of lerapolturev into the surgical resection site on day 1 and day 5 of the 1-week cycle to treat a residual GBM tumor; (iii) a second treatment phase, wherein the second treatment phase comprises administering to the patient once weekly for 4 consecutive weeks an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection, wherein the second treatment phase is administered following the cessation of the first treatment phase, and (iv) a third treatment phase, wherein the third treatment phase comprises administering to the patient once every three weeks an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection, wherein the is lerapolturev administered following the cessation of the second treatment phase.

29. The method of claim 28, wherein the first treatment phase comprises a single, 1-week cycle.

30. The method of claim 28, wherein the first treatment phase comprises two or more treatment cycles.

31. The method of claims 28-30, wherein the third treatment phase is administered once every three weeks for at least 6-months.

32. The method of claims 28-30, wherein the third treatment phase is administered once every three weeks for at least 12-months.

33. The method of claims 28-30, wherein the third treatment phase is administered once every three weeks for at least 15-months.

34. The method of claims 28-33, wherein the ndGBM patient is further administered an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection one or more times once every three weeks following the second surgical resection.

35. The method of claims 28-34, wherein the residual GBM tumor is a residual tumor with a non-enhancing fluid-attenuated inversion recovery (FLAIR) signal.

36. The method of claims 28-35, wherein the ndGBM harbors an unmethylated O6- methylguanine-DNA methyltransferase promoter (MGMTp).

37. The method of any of claims 1-36, wherein the method further comprises administering the chimeric poliovirus in combination with an additional glioblastoma cancer therapy selected from a chemotherapy, a radiation, an immune checkpoint inhibitor (ICI), an antiangiogenic therapy, or a combination thereof.

38. The method of claim 37, wherein the additional glioblastoma cancer treatment comprises administering radiation therapy.

39. The method of claim 37, wherein the additional glioblastoma cancer treatment comprises a chemotherapeutic agent.

40. The method of claim 39, wherein the chemotherapeutic agent is selected from temozolomide, carmustine, lomustine, nimustine, fotemustine, etoposide, dasatinib, temsirolimus, erlotinib, sorafenib, Panobinostat, vorinostat, or a combination thereof.

41. The method of claim 40, wherein the chemotherapeutic agent is temozolomide.

42. The method of claim 37, wherein the additional glioblastoma cancer treatment comprises an immune checkpoint inhibitor (ICI).

43. The method of claim 42, wherein the ICI is selected from a programmed cell death -1 (PD- 1) inhibitor, a programmed cell death-ligand 1 (PD-L1) inhibitor, a cytotoxic T-lymphocyte- associated protein 4 (CTLA-4) inhibitor, a lymphocyte-activation gene 3 (LAG-3) inhibitor, a T- cell immunoglobulin mucin-3 (TIM-3) inhibitor, a T cell immunoreceptor with Ig and ITIM domains (TIGIT) inhibitor, a V-domain Ig suppressor of T-cell activation (VISTA) inhibitor, a carcinoembryonic antigen cell adhesion molecule (CEACAM) inhibitor, a sialic acid-binding immunoglobulin-like lectin 15 (Siglec-15) inhibitor, a CD47 inhibitor, a CD39 inhibitor, or a B and T lymphocyte attenuator (BTLA) protein inhibitor, a B7-H3 / CD276 inhibitor, an indoleamine 2,3-dioxygenase (IDO) inhibitor, a killer immunoglobin-like receptor (KIR) inhibitor, or a combination thereof.

44. The method of claim 42 or 43, wherein the ICI is administered at the standard recommended dose and schedule as described on an FDA approved label.

45. The method of claim 37, wherein the additional glioblastoma cancer treatment comprises administering an antiangiogenic therapy.

46. The method of claim 45, wherein the antiangiogenic therapy is bevacizumab.

47. The method of claims 1-46, the method is administered as a second-line (2L) therapy.

48. The method of claims 1-46, the method is administered as a third-line (3L) therapy.

49. The method of claims 28-48, wherein the method further comprises administering a glioblastoma standard of care therapy.

50. The method of claim 49, wherein the glioblastoma standard of care therapy comprises administering to the human an effective amount of radiotherapy and an effective amount of temozolomide.

51. The method of claims 28-50, wherein lerapolturev is administered in a dose of between about 1x108TCID50and 5x108TCID50.

52. The method of claim 51, wherein lerapolturev is administered in a dose of about 1x108TCID50.

53. The method of claim 51, wherein lerapolturev is administered in a dose of about 2x108TCID50.

54. The method of claim 51, wherein lerapolturev is administered in a dose of about 4x108TCID50.

55. A method of treating a human patient having newly diagnosed glioblastoma (ndGBM) following a first maximal safe surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster following the first maximal safe surgical resection of one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated between at least about 1 week and about 6 weeks following the administration of the polio vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev into a surgical resection site on day 1 of the 1-week cycle and optionally again on day 5 of the one week cycle; and (iii) an optional second treatment phase, whereinc) the patient undergoes a second maximal safe surgical resection of one or more residual GBM tumors at least about 5-weeks after the initiation of the first treatment phase; d) wherein, following the second surgical resection, the patient is further administered an effective amount of lerapolturev into the surgical resection site on day 1 of the 1-week cycle and optionally again on day 5 of the 1-week cycle.

56. The method of claim 55, further comprising administering to the patient once weekly for 4 consecutive weeks an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection, wherein the cervical perilymphatic subcutaneous injections are administered following the cessation of the first treatment phase.

57. The method of claim 55, further comprising administering to the patient once weekly for 4 consecutive weeks an effective amount of lerapolturev via direct intracavitary infusion via an Ommaya catheter into the surgical cavity, wherein the direct intracavitary infusions are administered following the cessation of the first treatment phase.

58. A method of treating a human patient having newly diagnosed glioblastoma (ndGBM) following a first maximal safe surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster following the first maximal safe surgical resection of one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated between at least about 1 week and about 6 weeks following the administration of the polio vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev into the first surgical resection site on day 1 and day 5 of the 1-week cycle, wherein lerapolturev administration is selected from CED injection, direct injection of a resection cavity wall, or direct injection via Ommaya reservoir installed in a post-resection cavity; and (iii) an optional second treatment phase, wherein c) the patient undergoes a second maximal safe surgical resection of one or more residual GBM tumors at least about 5-weeks after the initiation of the first treatment phase, andd) wherein, following the second maximal safe surgical resection, the patient is further administered an effective amount of lerapolturev into the surgical resection site on day 1 of the 1-week cycle and optionally again on day 5 of the 1-week cycle, wherein lerapolturev administration is selected from CED injection, direct injection of a resection cavity wall, or direct injection via Ommaya reservoir installed in a post-resection cavity.

59. A method of treating a human patient having newly diagnosed glioblastoma (ndGBM) following a first maximal safe surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster following the first maximal safe surgical resection of one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated between at least about 1 week and about 6 weeks following the administration of the polio vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev on day 1 of the 1-week cycle and optionally again on day 5 of the 1-week cycle, wherein lerapolturev administration is selected from CED injection, direct injection of a resection cavity wall, or direct injection via Ommaya reservoir installed in a post-resection cavity; (iii) a second treatment phase, wherein the second treatment phase is initiated at least about 1 week following the cessation of the first treatment phase, wherein the second treatment phase comprises administering an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection once weekly for four consecutive weeks; and (iv) an optional third treatment phase, wherein c) the patient undergoes a second surgical resection of one or more residual GBM tumors at any interval 5-weeks or after the initiation of the first treatment phase, and d) administering to the patient an effective amount of lerapolturev into the surgical resection site on day 1 of the 1-week cycle and optionally again on day 5 of the one week cycle, wherein lerapolturev administration is selected from CEDinjection, direct injection of a resection cavity wall, or direct injection via Ommaya reservoir installed in a post-resection cavity.

60. A method of treating a human patient having newly diagnosed glioblastoma (ndGBM) following a first maximal safe surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster following the first maximal safe surgical resection of one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated between at least about 1 week and about 6 weeks following the administration of the polio vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev on day 1 of the 1-week cycle and optionally again on day 5 of the 1-week cycle, wherein lerapolturev administration is selected from CED injection, direct injection of a resection cavity wall, or direct injection via Ommaya reservoir installed in a post-resection cavity; (iii) a second treatment phase, wherein the second treatment phase is initiated at least about 1 week following the cessation of the first treatment phase, wherein the second treatment phase comprises administering an effective amount of lerapolturev via direct intracavitary infusion via an Ommaya reservoir once weekly for four consecutive weeks; and (iv) an optional third treatment phase, wherein c) the patient undergoes a second maximal safesurgical resection of one or more residual GBM tumors at least about 5-weeks after the initiation of the first treatment phase; d) wherein, following the second maximal safe surgical resection, the patient is administered an effective amount of lerapolturev into the surgical resection site on day 1 of the 1-week cycle and optionally again on day 5 of the 1-week cycle.

61. The method of claims 55-60, wherein the first treatment phase comprises a single, 1-week cycle.

62. The method of claims 55-60, wherein the first treatment phase comprises two or more treatment cycles.

63. The method of claims 55-62, wherein the ndGBM patient is further administered an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection one or more times once every three weeks, four weeks, five weeks, six weeks, two months, three months, four months, or six months following the second surgical resection.

64. The method of claims 55-62, wherein the ndGBM patient is further administered an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection one or more times once every three weeks following an optional second surgical resection.

65. The method of claims 55-64, wherein the residual GBM tumor is a non-enhancing and best visualized on fluid-attenuated inversion recovery (FLAIR) MRI sequences.

66. The method of claims 55-64, wherein the ndGBM harbors an unmethylated O6- methylguanine-DNA methyltransferase promoter (MGMTp).

67. The method of claims 55-64, wherein the ndGBM harbors a partially methylated O6- methylguanine-DNA methyltransferase promoter (MGMTp).

68. The method of claims 55-64, wherein the ndGBM harbors a methylated O6- methylguanine-DNA methyltransferase promoter (MGMTp).

69. The method of any of claims 55-68, wherein the method further comprises administering the chimeric poliovirus in combination with an additional glioblastoma cancer therapy selected from a chemotherapy, a radiation, an immune checkpoint inhibitor (ICI), an antiangiogenic therapy, small molecule inhibitor, investigational product, tumor treating field, or a combination thereof.

70. The method of claim 69, wherein the additional glioblastoma cancer treatment comprises administering radiation therapy.

71. The method of claim 69 or 70, wherein the additional glioblastoma cancer treatment comprises a chemotherapeutic agent.

72. The method of claim 71, wherein the chemotherapeutic agent is selected from temozolomide, carmustine, lomustine, nimustine, fotemustine, etoposide, dasatinib, temsirolimus, erlotinib, sorafenib, Panobinostat, vorinostat, or a combination thereof.

73. The method of claim 71, wherein the chemotherapeutic agent is temozolomide.

74. The method of claims 69-73, wherein the additional glioblastoma cancer treatment comprises an immune checkpoint inhibitor (ICI).

75. The method of claim 74, wherein the ICI is selected from a programmed cell death -1 (PD- 1) inhibitor, a programmed cell death-ligand 1 (PD-L1) inhibitor, a cytotoxic T-lymphocyte- associated protein 4 (CTLA-4) inhibitor, a lymphocyte-activation gene 3 (LAG-3) inhibitor, a T- cell immunoglobulin mucin-3 (TIM-3) inhibitor, a T cell immunoreceptor with Ig and ITIM domains (TIGIT) inhibitor, a V-domain Ig suppressor of T-cell activation (VISTA) inhibitor, a carcinoembryonic antigen cell adhesion molecule (CEACAM) inhibitor, a sialic acid-binding immunoglobulin-like lectin 15 (Siglec-15) inhibitor, a CD47 inhibitor, a CD39 inhibitor, or a B and T lymphocyte attenuator (BTLA) protein inhibitor, a B7-H3 / CD276 inhibitor, an indoleamine 2,3-dioxygenase (IDO) inhibitor, a killer immunoglobin-like receptor (KIR) inhibitor, or a combination thereof.

76. The method of claim 74 or 75, wherein the ICI is administered at the standard recommended dose and schedule as described on an FDA approved label.

77. The method of claims 69-76, wherein the additional glioblastoma cancer treatment comprises administering an antiangiogenic therapy.

78. The method of claim 77, wherein the antiangiogenic therapy is bevacizumab.

79. The method of claims 55-78, where the method is administered as a first-line (1L) therapy.

80. The method of claims 55-79, wherein the method further comprises administering a glioblastoma standard of care therapy following the cessation of the second surgical resection.

81. The method of claim 80, wherein the glioblastoma standard of care therapy comprises administering to the human an effective amount of radiotherapy and an effective amount of temozolomide.

82. The method of claims 55-81, wherein lerapolturev is administered in a dose of between about 1x108TCID50and 5x108TCID50.

83. The method of claim 82, wherein lerapolturev is administered in a dose of about 1x108TCID50.

84. The method of claim 82, wherein lerapolturev is administered in a dose of about 2x108TCID50.

85. The method of claim 82, wherein lerapolturev is administered in a dose of about 4x108TCID50.

86. A method of treating a human patient having recurrent GBM (rGBM) following a first maximal safe surgical resection of one or more GBM tumors, wherein the treatment comprises: (i) administering a polio vaccine booster following the first maximal safe surgical resection of one or more GBM tumors; (ii) a first treatment phase, wherein the first treatment phase is initiated between at least about 1 week and about 6 weeks following the administration of the polio vaccine booster, wherein the first treatment phase comprises one or more 1-week treatment cycles comprising administering to the patient an effective amount of lerapolturev into the surgical resection site on day 1 and day 5 of the 1-week cycle, wherein lerapolturev administration is selected from CED injection, direct injection of a resection cavity wall, or direct injection via Ommaya reservoir installed in a post-resection cavity; (iii) a second treatment phase, wherein the second treatment phase comprises administering to the patient once weekly for 4 consecutive weeks an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection, wherein the second treatment phase is administered following the cessation of the first treatment phase, and (iv) a third treatment phase, wherein the third treatment phase comprises administering to the patient once every three weeks an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection, wherein lerapolturev is administered following the cessation of the second treatment phase.

87. The method of claim 86, wherein the first treatment phase comprises a single, 1-week cycle.

88. The method of claim 86, wherein the first treatment phase comprises two or more treatment cycles.

89. The method of claims 86-88, wherein the third treatment phase is administered once every three weeks for at least 6-months.

90. The method of claims 86-88, wherein the third treatment phase is administered once every three weeks for at least 12-months.

91. The method of claims 86-88, wherein the third treatment phase is administered once every three weeks for at least 15-months.

92. The method of claims 86-91, wherein the rGBM patient is further administered an effective amount of lerapolturev via cervical perilymphatic subcutaneous injection one or more times once every three weeks following the second surgical resection.

93. The method of claims 86-91, wherein the residual GBM tumor is non-enhancing and best visualized on fluid-attenuated inversion recovery (FLAIR) MRI sequences.

94. The method of any of claims 86-93, wherein the method further comprises administering the chimeric poliovirus in combination with an additional glioblastoma cancer therapy selected from a chemotherapy, a radiation, an immune checkpoint inhibitor (ICI), an antiangiogenic therapy, small molecule inhibitor, investigational product, tumor treating field, or a combination thereof.

95. The method of claim 94, wherein the additional glioblastoma cancer treatment comprises administering radiation therapy.

96. The method of claim 94, wherein the additional glioblastoma cancer treatment comprises a chemotherapeutic agent.

97. The method of claim 96, wherein the chemotherapeutic agent is selected from temozolomide, carmustine, lomustine, nimustine, fotemustine, etoposide, dasatinib, temsirolimus, erlotinib, sorafenib, Panobinostat, vorinostat, or a combination thereof.

98. The method of claim 97, wherein the chemotherapeutic agent is temozolomide.

99. The method of claim 94, wherein the additional glioblastoma cancer treatment comprises an immune checkpoint inhibitor (ICI).

100. The method of claim 99, wherein the ICI is selected from a programmed cell death -1 (PD- 1) inhibitor, a programmed cell death-ligand 1 (PD-L1) inhibitor, a cytotoxic T-lymphocyte- associated protein 4 (CTLA-4) inhibitor, a lymphocyte-activation gene 3 (LAG-3) inhibitor, a T- cell immunoglobulin mucin-3 (TIM-3) inhibitor, a T cell immunoreceptor with Ig and ITIM domains (TIGIT) inhibitor, a V-domain Ig suppressor of T-cell activation (VISTA) inhibitor, a carcinoembryonic antigen cell adhesion molecule (CEACAM) inhibitor, a sialic acid-binding immunoglobulin-like lectin 15 (Siglec-15) inhibitor, a CD47 inhibitor, a CD39 inhibitor, or a B and T lymphocyte attenuator (BTLA) protein inhibitor, a B7-H3 / CD276 inhibitor, an indoleamine 2,3-dioxygenase (IDO) inhibitor, a killer immunoglobin-like receptor (KIR) inhibitor, or a combination thereof.

101. The method of claim 99 or 100, wherein the ICI is administered at the standard recommended dose and schedule as described on an FDA approved label.

102. The method of claim 94, wherein the additional glioblastoma cancer treatment comprises administering an antiangiogenic therapy.

103. The method of claim 102, wherein the antiangiogenic therapy is bevacizumab.

104. The method of claims 55-103, the method is administered as a second-line (2L) therapy.

105. The method of claims 55-103, the method is administered as a third-line (3L) therapy.

106. The method of claims 86-105, wherein the method further comprises administering a glioblastoma standard of care therapy.

107. The method of claim 106, wherein the glioblastoma standard of care therapy comprises administering to the human an effective amount of radiotherapy and an effective amount of temozolomide.

108. The method of claims 86-107, wherein lerapolturev is administered in a dose of between about 1x108TCID50 and 5x108TCID50.

109. The method of claim 108, wherein lerapolturev is administered in a dose of about 1x108TCID50.

110. The method of claim 108, wherein lerapolturev is administered in a dose of about 2x108TCID50.

111. The method of claim 108, wherein lerapolturev is administered in a dose of about 4x108TCID50.

112. A method of treating a human patient having one or more solid tumors, wherein the treatment comprises: (i) a first treatment phase comprising one or more treatment cycles comprising administration of an effective amount of lerapolturev via injection into the solid tumor; (ii) a second treatment phase comprising at least one cycle comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each weekly cycle.

113. The method of claim 112, wherein, prior to the first treatment phase, the patient undergoes a first surgical resection of one or more tumors.

114. The method of claim 113, wherein the first surgical resection comprises maximal safe surgical resection.

115. The method of claims 112-114, wherein, prior to the first treatment phase, a polio vaccine booster is administered to the human patient.

116. The method of claim 115, wherein the polio vaccine booster is administered to the human patient at least about two weeks following the surgical resection.

117. The method of claim 115 or 116, wherein the polio vaccine booster is administered to the human patient at least one week prior to the first treatment phase.

118. The method of claims 115-117, wherein the first treatment phase is administered to the human patient between at least about one week and about 6 weeks following the administration of the polio vaccine booster.

119. The method of claims 112-118, wherein, between the first and second treatment phases, the patient undergoes an additional surgical resection of one or more residual tumors.

120. The method of claims 112-119, wherein the second treatment phase is initiated about 1 week following the cessation of the first treatment phase.

121. The method of claims 112-120, wherein the first treatment phase comprises administration of an effective amount of lerapolturev on day 1 and day 5 of a single 1-week treatment cycle.

122. The method of claims 112-120, wherein the first treatment phase comprises administration of an effective amount of lerapolturev on day 1 of two consecutive 1-week treatment cycles.

123. The method of claims 112-122, wherein the second treatment phase comprises at least two or more weekly cycles.

124. The method of claims 112-122, wherein the second treatment phase comprises at least three or weekly cycles.

125. The method of claims 112-122, wherein the second treatment phase comprises at least four or more weekly cycles.

126. The method of claims 112-125, further comprising a third treatment phase, wherein the third treatment phase is administered following the cessation of the second treatment phase, and wherein the third treatment phase comprises at least two or more cycles comprisingperilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle.

127. The method of claim 126, wherein the cycle of the third treatment phase is a three-week cycle, a four-week cycle, a five-week cycle, a six-week cycle, a two-month cycle, a three- month cycle, a four-month cycle, or a six-month cycle.

128. The method of claim 126 or 127, wherein the third treatment phase comprises at least five or more three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle.

129. The method of claims 126-128, wherein the third treatment phase comprises administering three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle, wherein the third treatment phase lasts for at least 6-months.

130. The method of claims 126-128, wherein the third treatment phase comprises administering three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle, wherein the third treatment phase lasts for at least 12-months.

131. The method of claims 126-128, wherein the third treatment phase comprises administering three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle, wherein the third treatment phase lasts for at least 15-months.

132. The method of claims 112-131, wherein the lerapolturev injection into the solid tumor administration route is selected from intratumoral, intranodal, or peritumoral.

133. The method of claims 112-131, wherein the lerapolturev injection into the solid tumor administration route is cavity wall injection.

134. The method of claims 112-133, wherein the perilymphatic administration comprises cervical perilymphatic subcutaneous injection.

135. The method of claims 112-134, wherein the one or more solid tumors comprise a cancer selected from glioblastoma multiforme (GBM), astrocytoma, oligodendroglioma, astro- oligodendroglioma, renal cell carcinoma, prostate cancer, bladder cancer, esophageal cancer, stomach cancer, pancreas cancer, colorectal cancer, liver cancer, gall bladdercancer, breast cancer, medulloblastoma, lung cancer, head and neck squamous cell carcinoma (HNSCC), melanoma, ovarian cancer, or sarcoma.

136. The method of claims 112-134, wherein the one or more solid tumors comprise glioblastoma multiforme (GBM).

137. The method of claim 136, wherein the GBM is newly-diagnosed GBM (ndGBM).

138. The method of claim 136, wherein the GBM is recurrent GBM (rGBM).

139. The method of claims 112-134, wherein the one or more solid tumors comprise melanoma.

140. The method of claims 112-134, wherein the one or more solid tumors comprise bladder cancer.

141. The method of claims 112-140, further comprising an additional cancer therapy selected from a chemotherapy, a radiation, an immune checkpoint inhibitor (ICI), an antiangiogenic therapy, or a combination thereof.

142. The method of claim 141, wherein the additional cancer therapy comprises a chemotherapeutic agent.

143. The method of claim 141, wherein the additional cancer treatment comprises an immune checkpoint inhibitor (ICI).

144. The method of claim 143, wherein the ICI is selected from a programmed cell death -1 (PD-1) inhibitor, a programmed cell death-ligand 1 (PD-L1) inhibitor, a cytotoxic T- lymphocyte-associated protein 4 (CTLA-4) inhibitor, a lymphocyte-activation gene 3 (LAG-3) inhibitor, a T-cell immunoglobulin mucin-3 (TIM-3) inhibitor, a T cell immunoreceptor with Ig and ITIM domains (TIGIT) inhibitor, a V-domain Ig suppressor of T-cell activation (VISTA) inhibitor, a carcinoembryonic antigen cell adhesion molecule (CEACAM) inhibitor, a sialic acid-binding immunoglobulin-like lectin 15 (Siglec-15) inhibitor, a CD47 inhibitor, a CD39 inhibitor, or a B and T lymphocyte attenuator (BTLA) protein inhibitor, a B7-H3 / CD276 inhibitor, an indoleamine 2,3-dioxygenase (IDO) inhibitor, a killer immunoglobin-like receptor (KIR) inhibitor, or a combination thereof.

145. The method of claim 143 or 144, wherein the ICI is administered at the standard recommended dose and schedule as described on an FDA approved label.

146. The method of claims 112-145, the method is administered as a first-line (1L) therapy.

147. The method of claims 112-145, the method is administered as a second-line (2L) therapy.

148. The method of claims 112-145, the method is administered as a third-line (3L) therapy.

149. The method of claims 112-148, further comprising administering a standard of care therapy following the cessation of the additional surgical resection.

150. The method of claims 112-149, wherein lerapolturev is administered in a dose of between about 1x108TCID50 and 5x108TCID50.

151. The method of claim 150, wherein lerapolturev is administered in a dose of about 1x108TCID50.

152. The method of claim 150, wherein lerapolturev is administered in a dose of about 2x108TCID50.

153. The method of claim 150, wherein lerapolturev is administered in a dose of about 4x108TCID50.

154. A method of treating a human patient having one or more GBM tumors, wherein the treatment comprises: (i) a first treatment phase comprising one or more treatment cycles comprising administration of an effective amount of lerapolturev to the human patient at least twice total; (ii) a second treatment phase comprising at least two or more weekly cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each weekly cycle.

155. The method of claim 154, wherein, prior to the first treatment phase, the patient undergoes a first surgical resection of one or more GBM tumors.

156. The method of claim 155, wherein the first surgical resection comprises maximal safe surgical resection.

157. The method of claims 154-156, wherein, prior to the first treatment phase, a polio vaccine booster is administered to the human patient.

158. The method of claim 157, wherein the polio vaccine booster is administered to the human patient at least about two weeks following the surgical resection.

159. The method of claim 157 or 158, wherein the polio vaccine booster is administered to the human patient at least one week prior to the first treatment phase.

160. The method of claims 157-159, wherein the first treatment phase is administered to the human patient between at least about one week and about 6 weeks following the administration of the polio vaccine booster.

161. The method of claims 154-160, wherein, between the first and second treatment phases, the patient undergoes an additional surgical resection of one or more residual GBM tumors.

162. The method of claims 154-161, wherein the second treatment phase is initiated about 1 week following the cessation of the first treatment phase.

163. The method of claims 154-162, wherein the first treatment phase comprises administration of an effective amount of lerapolturev on day 1 and day 5 of a single 1-week treatment cycle.

164. The method of claims 154-162, wherein the first treatment phase comprises administration of an effective amount of lerapolturev on day 1 of two consecutive 1-week treatment cycles.

165. The method of claims 154-164, wherein the second treatment phase comprises at least two or more weekly cycles.

166. The method of claims 154-164, wherein the second treatment phase comprises at least three or weekly cycles.

167. The method of claims 154-164, wherein the second treatment phase comprises at least four or more weekly cycles.

168. The method of claims 154-167, further comprising a third treatment phase, wherein the third treatment phase is administered following the cessation of the second treatment phase, and wherein the third treatment phase comprises at least two or more cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle.

169. The method of claim 168, wherein the cycle of the third treatment phase is a three-week cycle, a four-week cycle, a five-week cycle, a six-week cycle, a two-month cycle, a three- month cycle, a four-month cycle, or a six-month cycle.

170. The method of claim 168 or 169, wherein the third treatment phase comprises at least five or more three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle.

171. The method of claims 168-170, wherein the third treatment phase comprises administering three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle, wherein the third treatment phase lasts for at least 6-months.

172. The method of claims 168-170, wherein the third treatment phase comprises administering three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle, wherein the third treatment phase lasts for at least 12-months.

173. The method of claims 168-170, wherein the third treatment phase comprises administering three-week cycles comprising perilymphatic administration of an effective amount of lerapolturev to the human patient on day 1 of each cycle, wherein the third treatment phase lasts for at least 15-months.

174. The method of claims 154-173, wherein the lerapolturev administration during the first treatment phase comprises convection enhanced delivery (CED).

175. The method of claims 154-173, wherein the lerapolturev administration during the first treatment phase comprises cavity wall injection.

176. The method of claims 154-175, wherein the lerapolturev administration during the first treatment phase comprises direct infusion via an Ommaya reservoir into a surgical cavitary.

177. The method of claims 154-176, wherein the perilymphatic administration comprises cervical perilymphatic subcutaneous injection.

178. The method of claims 154-177, wherein the one or more GBM tumors comprise newly diagnosed glioblastoma (ndGBM).

179. The method of claim 178, wherein the ndGBM harbors an unmethylated O6- methylguanine-DNA methyltransferase promoter (MGMTp).

180. The method of claims 154-177, wherein the one or more GBM tumors comprise recurrent glioblastoma (rGBM).

181. The method of claims 154-180, wherein the one or more residual GBM tumors are residual tumors with a non-enhancing fluid-attenuated inversion recovery (FLAIR) signal.

182. The method of claims 154-181, further comprising an additional GBM cancer therapy selected from a chemotherapy, a radiation, an immune checkpoint inhibitor (ICI), an antiangiogenic therapy, or a combination thereof.

183. The method of claim 182, wherein the additional GBM cancer therapy comprises radiation therapy.

184. The method of claim 182, wherein the additional GBM cancer therapy comprises a chemotherapeutic agent.

185. The method of claim 184, wherein the chemotherapeutic agent is selected from temozolomide, carmustine, lomustine, nimustine, fotemustine, etoposide, dasatinib, temsirolimus, erlotinib, sorafenib, Panobinostat, vorinostat, or a combination thereof.

186. The method of claim 184, wherein the chemotherapeutic agent is temozolomide.

187. The method of claim 182, wherein the additional GBM cancer treatment comprises an immune checkpoint inhibitor (ICI).

188. The method of claim 187, wherein the ICI is selected from a programmed cell death -1 (PD-1) inhibitor, a programmed cell death-ligand 1 (PD-L1) inhibitor, a cytotoxic T- lymphocyte-associated protein 4 (CTLA-4) inhibitor, a lymphocyte-activation gene 3 (LAG-3) inhibitor, a T-cell immunoglobulin mucin-3 (TIM-3) inhibitor, a T cell immunoreceptor with Ig and ITIM domains (TIGIT) inhibitor, a V-domain Ig suppressor of T-cell activation (VISTA) inhibitor, a carcinoembryonic antigen cell adhesion molecule (CEACAM) inhibitor, a sialic acid-binding immunoglobulin-like lectin 15 (Siglec-15) inhibitor, a CD47 inhibitor, a CD39 inhibitor, or a B and T lymphocyte attenuator (BTLA) protein inhibitor, a B7-H3 / CD276 inhibitor, an indoleamine 2,3-dioxygenase (IDO) inhibitor, a killer immunoglobin-like receptor (KIR) inhibitor, or a combination thereof.

189. The method of claim 187or 188, wherein the ICI is administered at the standard recommended dose and schedule as described on an FDA approved label.

190. The method of claim 182, wherein the additional GBM cancer treatment comprises administering an antiangiogenic therapy.

191. The method of claim 190, wherein the antiangiogenic therapy is bevacizumab.

192. The method of claims 154-191, the method is administered as a first-line (1L) therapy.

193. The method of claims 154-191, the method is administered as a second-line (2L) therapy.

194. The method of claims 154-191, the method is administered as a third-line (3L) therapy.

195. The method of claims 154-194, further comprising administering a GBM standard of care therapy following the cessation of the additional surgical resection.

196. The method of claim 195, wherein the GBM standard of care therapy comprises administering to the human an effective amount of radiotherapy and an effective amount of temozolomide.

197. The method of claims 154-196, wherein lerapolturev is administered in a dose of between about 1x108TCID50 and 5x108TCID50.

198. The method of claim 197, wherein lerapolturev is administered in a dose of about 1x108TCID50.

199. The method of claim 197, wherein lerapolturev is administered in a dose of about 2x108TCID50.

200. The method of claim 197, wherein lerapolturev is administered in a dose of about 4x108TCID50.

201. The method of claims 1-200, wherein the polio vaccine booster comprises a monovalent (type-1) oral polio vaccine.

202. The method of claims 1-200, wherein the polio vaccine booster comprises a bivalent oral polio vaccine.

203. The method of claims 1-200, wherein the polio vaccine booster comprises a trivalent oral polio vaccine.

204. The method of claims 1-200, wherein the polio vaccine booster is the IPOL polio vaccine.

205. The method of claims 1-204, wherein the treatment results in an improvement in progression free survival (PFS) in comparison to the predicted PFS in humans administered radiotherapy and / or temozolomide without a chimeric poliovirus.

206. The method of claims 1-205, wherein the treatment results in an improvement in overall survival (OS) in comparison to the predicted OS in humans administered radiotherapy and / or temozolomide without a chimeric poliovirus.

207. The method of claims 1-206, wherein the treatment results in an improvement in progression free survival (PFS) and / or overall survival (OS) in humans compared to the predictedPFS and / or OS in humans administered radiotherapy and / or temozolomide without a chimeric poliovirus.

208. The method of claims 1-207, wherein the treatment results in enhanced anti-tumor efficacy in humans compared to humans administered radiotherapy and / or temozolomide without a chimeric poliovirus.

Images