New sirna, composition comprising same, and use

Abstract

Provided is an siRNA that inhibits the expression of an RAGE gene, which siRNA comprises a sense strand and an antisense strand. The provided siRNA has good stability and can be used for efficiently and specifically inhibiting the expression of the RAGE gene, thereby providing important clinical value in the treatment of RAGE-related diseases.

Description

A novel siRNA, composition containing the same and use thereof

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to Chinese patent application No. 202311264167.4 filed on September 27, 2023 and Chinese patent application No. 202411319454.5 filed on September 20, 2024, and the entire contents of the above patent applications are incorporated herein by reference in their entirety. Technical Field

[0003] The present invention provides an siRNA for inhibiting the expression of the receptor for advanced glycation end products (RAGE) and a pharmaceutical composition thereof. The siRNA and the pharmaceutical composition provided by the present invention can treat diseases related to RAGE. Technical Background

[0004] The receptor for advanced glycation end products ("RAGE" or "AGER") is a ~43 kDa transmembrane protein of the immunoglobulin superfamily that functions as a proinflammatory pattern recognition receptor. In its full-length membrane-bound form, the receptor has three functional domains: an extracellular ligand-binding domain, a hydrophobic transmembrane domain, and a cytoplasmic domain that mediates ligand-dependent signaling. A second, non-membrane-bound, soluble form of the receptor (sRAGE) contains only the extracellular ligand binding domain; formed by proteolytic cleavage (or by alternative splicing) of full-length membrane-bound RAGE, sRAGE antagonizes RAGE function because it binds ligand but lacks the cytoplasmic signaling domain.

[0005] RAGE is constitutively expressed at high levels in the lung, primarily localized to type 1 alveolar epithelial cells. Other tissues in the body normally express RAGE at low levels, but its expression is upregulated in the presence of RAGE ligands and chronic inflammation. As a pattern recognition receptor, RAGE binds to multiple endogenous ligands, including advanced glycation end products (glycomodified proteins or lipids), high-mobility group box 1 (HMGB1), β-amyloid Aβ, and S100 protein. Different intermediate signaling pathways can be activated by different RAGE ligands (e.g., ERK1 / 2, p38, and JAK / STAT), ultimately leading to the production of reactive oxygen species, sustained activation of NF-κB, and alterations in proinflammatory genes (e.g., interleukins, interferons, TNF-α). Transcription of the gene encoding RAGE itself is promoted by NF-κB, forming a positive feedback loop that perpetuates chronic inflammation.

[0006] RAGE has been implicated in chronic pathological inflammation that contributes to numerous diseases, including: pulmonary diseases (asthma, acute respiratory distress syndrome, idiopathic pulmonary fibrosis, chronic obstructive pulmonary disease, cystic fibrosis, pneumonia, lung cancer, bronchopulmonary dysplasia), cardiovascular diseases (atherosclerosis, myocardial infarction, heart failure, peripheral vascular disease), cancer, diabetes, chronic kidney disease, neurodegenerative diseases, rheumatoid arthritis, nonalcoholic steatohepatitis, injury caused by certain viral infections, including SARS-CoV-2, certain ocular inflammatory conditions, and skeletal muscle atrophy.

[0007] In the field of lung disease, RAGE knockout (KO) mice are completely protected physiologically and histologically from allergic asthma caused by house dust mite allergens or ovalbumin. Similarly, RAGE knockout mice are protected from the effects of acute lung injury and inflammation induced by hyperoxia or lipopolysaccharide. (See, e.g., Oczypok et al., Paediatr Respir Rev., 23: 40-49 (2017); Wang et al., Shock, 50: 472-482 (2018)). Genome-wide association studies (GWAS) have linked the variable gain-of-function RAGE allele (G82S) to increased inflammation, decreased lung function, and asthma risk (see, e.g., Hancock et al., Nat Genet., 42: 45-52 (2010); Repapi et al., Nat Genet., 42: 36-44 (2010)).

[0008] Although RAGE is potentially attractive as a drug target, developing effective and selective RAGE inhibitors has proven to be extremely challenging. A wide range of RAGE ligands interact with multiple binding sites within the antibody-like extracellular domain, rather than binding to discrete domains (see, e.g., Rojas et al., Current Drug Targets, 20: 340-346 (2019)). Therefore, there is a need for RAGE RNAi reagents suitable for use as therapeutic agents for treating RAGE-related diseases and disorders.

[0009] Summary of the Invention

[0010] The present invention provides siRNA that can effectively inhibit the expression of RAGE gene, and thus provides drugs and methods for preventing and / or treating RAGE-related diseases.

[0011] siRNA

[0012] In one aspect, the present invention provides a small interfering RNA (siRNA) for inhibiting the expression of the RAGE gene, wherein the siRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises at least 14 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO:1 to SEQ ID NO:419 by no more than 4 (e.g., 0, 1, 2, 3 or 4) nucleotides, and the sense strand is at least partially complementary to the antisense strand.

[0013] The at least partially complementary means that the two sequences can be completely complementary, or generally have no more than 4, 3, 2 or 1 mismatched base pairings, while retaining the ability to hybridize under relevant conditions. Those skilled in the art can determine the conditions that are most suitable for testing the complementarity of the two sequences based on the final application of the hybridized nucleotides. Such conditions can, for example, be stringent conditions, such as 400mM NaCl, 40mM PIPES pH 6.4, 1mM EDTA, 50°C or 70°C for 12-16 hours, followed by washing. Other conditions, such as physiologically relevant conditions that may be encountered in vivo, can also be applied.

[0014] In some embodiments, the RAGE mRNA refers to an mRNA having a sequence shown in, for example, Genbank: NM_001136.5.

[0015] In some embodiments, the antisense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ from the nucleotide sequence set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 419 by no more than 4 (e.g., 0, 1, 2, 3, or 4) nucleotides. In some embodiments, the antisense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ from the nucleotide sequence set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 419 by no more than 3 (e.g., 0, 1, 2, or 3) nucleotides. In some embodiments, the antisense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ from the nucleotide sequence set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 419 by no more than 2 (e.g., 0, 1, or 2) nucleotides. In some embodiments, the antisense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ by no more than 1 (e.g., 0 or 1) nucleotide from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 419. In some embodiments, the antisense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) of the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 419.

[0016] In some embodiments, the antisense strand comprises at least 14 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 419 by no more than 2 nucleotides.

[0017] In some embodiments, the antisense strand comprises at least 17 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 419 by no more than 4 nucleotides.

[0018] In some embodiments, the antisense strand comprises at least 17 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 419 by no more than 2 (e.g., 0, 1, or 2) nucleotides. In some embodiments, the antisense strand comprises at least 17 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 419 by no more than 1 (e.g., 0 or 1) nucleotides. In some embodiments, the antisense strand comprises at least 17 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 419.

[0019] In some embodiments, the antisense strand is a nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 419.

[0020] In some embodiments, the sense strand has no more than 4 nucleotide mismatches with the antisense strand. The sense strand has no more than 3 nucleotide mismatches with the antisense strand. In some embodiments, the sense strand has no more than 2 nucleotide mismatches with the antisense strand. In some embodiments, the sense strand has no more than 1 nucleotide mismatch with the antisense strand. In some embodiments, the sense strand is fully complementary to the antisense strand.

[0021] In some embodiments, the sense strand and the antisense strand have at least 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides of complementarity. In some embodiments, the sense strand and the antisense strand have 14 to 19 nucleotides of complementarity.

[0022] In some embodiments, the sense strand and the antisense strand are at least 85% (eg, at least 90%, at least 95%, at least 99%) complementary or fully complementary over at least 14 consecutive nucleotides.

[0023] In some embodiments, the sense strand has at least 17, 18, 19, 20, or 21 nucleotides of complementarity with the antisense strand. In some embodiments, the sense strand has 17 to 19 nucleotides of complementarity with the antisense strand.

[0024] In some embodiments, the sense strand and the antisense strand are at least 85% (eg, at least 90%, at least 95%, at least 99%) complementary or fully complementary over at least 17 consecutive nucleotides.

[0025] In some embodiments, the sense strand and the antisense strand form a duplex region of 14 to 30 nucleotide pairs in length, such as 14 to 25 nucleotide pairs, 14 to 23 nucleotide pairs, 14 to 21 nucleotide pairs, 15 to 25 nucleotide pairs, 15 to 23 nucleotide pairs, 15 to 21 nucleotide pairs, 17 to 25 nucleotide pairs, 17 to 23 nucleotide pairs, or 17 to 21 nucleotide pairs, such as 14, 15, 16, 17, 18, 19, 20, or 21 nucleotide pairs. In some embodiments, the sense strand and the antisense strand form a duplex region of 14 to 19 nucleotide pairs in length.

[0026] In some embodiments, the antisense strand is 14 to 30 (e.g., 14 to 29, 14 to 28, 14 to 27, 19 to 30, 19 to 29, 19 to 28, 19 to 27, 19 to 25, 19 to 23, 21 to 25, 21 to 23) nucleotides in length, and the sense strand is 14 to 30 (e.g., 14 to 29, 14 to 28, 14 to 27, 14 to 26, 14 to 25, 14 to 21, 19 to 21) nucleotides in length. In some embodiments, the antisense strand and sense strand are each independently 17 to 30 nucleotides in length.

[0027] In some embodiments, the antisense strand is 19 to 27 nucleotides in length; and the sense strand is 17 to 25 nucleotides in length.

[0028] In some embodiments, the antisense strand is 21 to 23 nucleotides in length; and the sense strand is 19 to 21 nucleotides in length.

[0029] In some embodiments, the antisense strand is 21 nucleotides in length and the sense strand is 19 nucleotides in length.

[0030] In some embodiments, the siRNA comprises blunt ends and / or overhangs.

[0031] In some embodiments, the siRNA comprises one or more single-stranded nucleotide overhangs. For example, an overhang of 1, 2, 3, or 4 nucleotides. In some embodiments, the overhang can be on the sense strand, the antisense strand, or any combination thereof. In some embodiments, the overhang is present on the 5' end, the 3' end, or both ends of the siRNA antisense strand or the sense strand.

[0032] In some embodiments, the 3' end of the antisense strand of the siRNA has a 2-nucleotide overhang. In some embodiments, the 3' end of the sense strand of the siRNA is blunt-ended.

[0033] In some embodiments, the sense strand of the siRNA comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ from the nucleotide sequence shown in any one of SEQ ID NO: 420 to SEQ ID NO: 838 by no more than 4 (e.g., 0, 1, 2, 3, or 4) nucleotides. The at least 14 consecutive nucleotides comprised by the sense and antisense strands of the siRNA form a duplex region. In some embodiments, the sense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ from the nucleotide sequence shown in any one of SEQ ID NO: 420 to SEQ ID NO: 838 by no more than 3 (e.g., 0, 1, 2, or 3) nucleotides. In some embodiments, the sense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ from the nucleotide sequence shown in any one of SEQ ID NO: 420 to SEQ ID NO: 838 by no more than 2 (e.g., 0, 1, or 2) nucleotides. In some embodiments, the sense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ from the nucleotide sequence shown in any one of SEQ ID NO: 420 to SEQ ID NO: 838 by no more than 1 (e.g., 0 or 1) nucleotides. In some embodiments, the sense strand has a region of at least 85% (e.g., at least 90%, at least 95%, at least 99%) complementarity or complete complementarity to the antisense strand within the 14 consecutive nucleotides. In some embodiments, the sense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) of the nucleotide sequence shown in any one of SEQ ID NO: 420 to SEQ ID NO: 838. In some embodiments, the sense strand is the nucleotide sequence shown in any one of SEQ ID NO: 420 to SEQ ID NO: 838.

[0034] In some embodiments, the sense strand comprises at least 14 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO:420 to SEQ ID NO:838 by no more than 2 nucleotides.

[0035] In some embodiments, the sense strand of the siRNA comprises at least 17 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO: 420 to SEQ ID NO: 838 by no more than 4 nucleotides.

[0036] In some embodiments, the sense strand comprises at least 17 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO: 420 to SEQ ID NO: 838 by no more than 2 (e.g., 0, 1, or 2) nucleotides. In some embodiments, the sense strand comprises at least 17 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO: 420 to SEQ ID NO: 838 by no more than 1 (e.g., 0 or 1) nucleotides. In some embodiments, the sense strand has a region of at least 85% (e.g., at least 90%, at least 95%, at least 99%) complementarity or complete complementarity to the antisense strand within the 17 consecutive nucleotides. In some embodiments, the sense strand comprises at least 17 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO: 420 to SEQ ID NO: 838. In some embodiments, the sense strand is the nucleotide sequence shown in any one of SEQ ID NO: 420 to SEQ ID NO: 838.

[0037] In some embodiments, the antisense strand of the siRNA comprises the antisense strand sequence of any one of the double-stranded GPSZRA001 to GPSZRA419 provided in Table 1 or a portion thereof (e.g., at least 14 consecutive nucleotides thereof), and the sense strand of the siRNA comprises the sense strand sequence of the double-stranded GPSZRA001 to GPSZRA419 or a portion thereof (e.g., at least 14 consecutive nucleotides thereof).

[0038] In some embodiments, the antisense strand of the siRNA comprises the antisense strand sequence of any duplex provided in Table 7 or a portion thereof (e.g., at least 14 consecutive nucleotides thereof). Preferably, the sense strand of the siRNA comprises the sense strand sequence of the duplex or a portion thereof (e.g., at least 14 consecutive nucleotides thereof).

[0039] In some embodiments, the antisense strand of the siRNA comprises the antisense strand sequence of any duplex of GPSZRA272, GPSZRA267, GPSZRA271, GPSZRA381, GPSZRA284, GPSZRA266, GPSZRA283, GPSZRA308, GPSZRA360, GPSZRA277, GPSZRA276, GPSZRA288, GPSZRA282, or GPSZRA285, or a portion thereof (e.g., at least 14 consecutive nucleotides thereof) provided in Table 1. Preferably, the sense strand of the siRNA comprises the sense strand sequence of the duplex, or a portion thereof (e.g., at least 14 consecutive nucleotides thereof).

[0040] In some embodiments, the antisense strand of the siRNA comprises GPSZRA286, GPSZRA402, GPSZRA092, GPSZRA307, GPSZRA290, GPSZRA410, GPSZRA274, GPSZRA289, GPSZRA382, GPSZRA409, GPSZRA255, GPSZRA087, GPSZRA379, GPSZRA165, GPSZRA275, GPSZRA408, GPSZRA257, GPSZRA318, GPSZRA281, GPSZRA104, GPSZRA254, GPSZRA103, GPSZRA287, GPSZRA252, GPSZRA410, GPSZRA411, GPSZRA412, GPSZRA413, GPSZRA414, GPSZRA415, GPSZRA416, GPSZRA417, GPSZRA418, GPSZRA419, GPSZRA420, GPSZRA421, GPSZRA422, GPSZRA423, GPSZRA424, GPSZRA425, GPSZRA427, GPSZRA428, GPSZRA429, GPSZRA430, GPSZRA431 Preferably, the sense strand of the siRNA comprises the antisense strand sequence of any duplex of GPSZRA378, GPSZRA239, GPSZRA088, GPSZRA090, GPSZRA085, GPSZRA380, GPSZRA217, GPSZRA269, GPSZRA212, GPSZRA086, GPSZRA084, GPSZRA214, GPSZRA228, GPSZRA105, GPSZRA292, GPSZRA313, GPSZRA304, GPSZRA237, GPSZRA345, GPSZRA233, GPSZRA215, GPSZRA093, GPSZRA333, or GPSZRA270, or a portion thereof (e.g., at least 14 consecutive nucleotides thereof).

[0041] In some embodiments, the siRNA targets a region within nucleotides 1-400 of RAGE mRNA, for example, the sequence shown in SEQ ID NO: 1417. Preferably, the siRNA comprises an antisense strand and / or a sense strand derived from a duplex of any one of GPSZRA001 to GPSZRA118.

[0042] In some embodiments, the siRNA targets a region within nucleotides 351-750 of RAGE mRNA, for example, the sequence shown in SEQ ID NO: 1418. Preferably, the siRNA comprises an antisense strand and / or a sense strand derived from a duplex of any one of GPSZRA090 to GPSZRA251.

[0043] In some embodiments, the siRNA targets a region within nucleotides 701-1100 of RAGE mRNA, for example, the sequence shown in SEQ ID NO: 1419. Preferably, the siRNA comprises an antisense strand and / or a sense strand derived from a duplex of any one of GPSZRA250 to GPSZRA358.

[0044] In some embodiments, the siRNA targets a region within nucleotides 1021-1420 of RAGE mRNA, for example, the sequence shown in SEQ ID NO: 1420. Preferably, the siRNA comprises an antisense strand and / or a sense strand derived from a duplex of any one of GPSZRA359 to GPSZRA419.

[0045] Modification

[0046] The siRNA of the present invention can be modified in nucleoside base structure or in ribose-phosphate backbone structure, reduce the effect of missing the target, and / or increase the biological stability of the molecule, or increase the physical stability of the duplex formed between antisense and sense nucleic acid. Therefore, the siRNA sequence comprising any modification is also encompassed within the scope of the present invention. The siRNA molecule comprising ribonucleoside analogs or derivatives must maintain the ability to form duplexes and allow or mediate the specific degradation of the target RNA via the RISC approach.

[0047] In some embodiments, the siRNA contains at least one modified nucleotide. The modification need not be identical for each of the plurality of modified ribonucleosides in the siRNA.

[0048] In some embodiments, all nucleotides in the sense strand and / or antisense strand of the siRNA are modified nucleotides or nucleotide analogs. In some embodiments, all nucleotides in the sense strand of the siRNA are modified nucleotides or nucleotide analogs, and all nucleotides in the antisense strand of the siRNA are modified nucleotides or nucleotide analogs.

[0049] In some embodiments, the siRNA comprises 2'-modified nucleotides.

[0050] In some embodiments, the modified nucleotide or nucleotide analog is selected from 2'-methoxy nucleotides, 2'-fluoro nucleotides, 5'-(E)-vinyl phosphate modified nucleotides, 2'-deoxyribonucleotides, 2',3'-split ring nucleotide analogs, 2'-fluoroarabinonucleotides, 2'-methoxyethyl nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, 3'-methoxy nucleotides, 2'-allyl modified nucleotides, nucleotides containing thiophosphate groups, nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphate esters, nucleotides containing 5'-phosphate mimetics, diol-modified nucleotides, abasic nucleotides, morpholino nucleotides, locked nucleic acids (LNA), unlocked nucleic acids (UNA) or glycerol nucleotides (GNA), but the present invention is not limited thereto.

[0051] In some embodiments, the modified nucleotides or nucleotide analogs are selected from at least one of 2'-methoxy nucleotides, 2'-fluoro nucleotides, nucleotides comprising thiophosphate groups, locked nucleic acids, and 5'-(E)-vinyl phosphate modified nucleotides or a combination thereof. In some embodiments, the sense strand comprises at least one of 2'-methoxy nucleotides, 2'-fluoro nucleotides, and locked nucleic acids or a combination thereof. In some embodiments, the antisense strand comprises at least one of 2'-methoxy nucleotides, 2'-fluoro nucleotides, and locked nucleic acids or a combination thereof. In some embodiments, the antisense strand comprises at least one of 2'-methoxy nucleotides, 2'-fluoro nucleotides, and 5'-(E)-vinyl phosphate modified nucleotides or a combination thereof. In some embodiments, the sense strand comprises at least one locked nucleic acid. In some embodiments, the sense strand comprises at least one nucleotide comprising a thiophosphate group. In some embodiments, the antisense strand comprises at least one nucleotide comprising a thiophosphate group.

[0052] In some embodiments, the first nucleotide at the 5' end of the antisense strand is a 5'-(E)-vinyl phosphate modified nucleotide. Conventional antisense strands require phosphorylation at the 5' end before they can be loaded with the Ago2 protein to form a RISC complex and exert RNAi activity. By introducing 5'-(E)-vinyl phosphate modification (5'-(E)-Vinylphosphonate, 5'-(E)-VP), the antisense strand is pre-phosphorylated and does not need to be rephosphorylated in vivo. It can be directly loaded to form a RISC complex, thereby improving the antisense strand loading efficiency and enhancing the overall activity of the siRNA.

[0053] In some embodiments, the nucleotides in the sense strand are selected from at least two of 2'-methoxy nucleotides, 2'-fluoro nucleotides or locked nucleic acids, and / or the nucleotides in the antisense strand are selected from 2'-methoxy nucleotides and 2'-fluoro nucleotides; preferably, the first nucleotide at the 5' end of the antisense strand further comprises a 5'-(E)-vinyl phosphate modification.

[0054] In some embodiments, the siRNA of the present invention comprises a modified internucleoside linkage or a modified backbone. Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate, 2'-O methoxyethyl (MOE), 2'-fluoro, alkyl phosphates, phosphorodithioates, alkyl phosphorothioates, phosphoramidates, carbamates, carbonates, phosphotriesters, acetamidates, carboxymethyl esters, and combinations thereof.

[0055] In some embodiments, the modified nucleotide is a nucleotide in which the phosphate group is modified with a phosphorothioate group, that is, a non-bridging oxygen atom in the phosphodiester bond is replaced with a sulfur atom, thereby replacing the phosphodiester bond with a phosphorothioate diester bond.

[0056] In some embodiments, the 5' end and / or 3' end of the sense strand independently comprises one or two phosphorothioate linkages; and / or the 5' end and / or 3' end of the antisense strand independently comprises one or two phosphorothioate linkages. In some embodiments, the 5' end of the sense strand independently comprises one or two phosphorothioate linkages, and the 5' end and / or 3' end of the antisense strand independently comprises one or two phosphorothioate linkages.

[0057] In some embodiments, the sense strand may include one or more blocking residues or moieties, referred to as "blocking residues." A "blocking residue" is a non-nucleotide compound or other moiety that can be incorporated into one or more ends of the nucleotide sequence of the siRNA. In some embodiments, the blocking residue is present at the 5' end, the 3' end, or both the 5' end and the 3' end of the sense strand.

[0058] In some embodiments, an inverted abasic residue (iab) is added as a capping residue. See F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16. In some embodiments, the 5' end and / or 3' end of the sense strand may contain more than one inverted abasic deoxyribose moiety as a capping residue.

[0059] In some embodiments, one or more inverted abasic residues (iab) are added to the 3' end of the sense strand. In some embodiments, one or more inverted abasic residues (iab) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues are included near or at one or more ends of the siRNA sense strand.

[0060] Inverted abasic residues can be linked via phosphate, phosphorothioate, or other internucleoside linkages.

[0061] In some embodiments, the antisense strand of the siRNA is 21 nucleotides in length and comprises the following modification pattern:

[0062] (1) 5'-NmsNfsNmNfNmNfNmNfNmNfNmNmNmNfNmNfNmNfNmsNmsNm-3' (SEQ ID NO: 1409);

[0063] (2) 5'-NmsNfsNmNmNmNfNmNfNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 1410);

[0064] (3) 5'-NmsNfsNmNmNmNfNmNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 1411);

[0065] (4) 5'-VPNmsNfsNmNfNmNfNmNfNmNfNmNmNmNfNmNfNmNfNmsNmsNm-3' (SEQ ID NO: 1423);

[0066] (5) 5'-VPNmsNfsNmNmNmNfNmNfNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 1424); or

[0067] (6) 5'-VPNmsNfsNmNmNmNfNmNmNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 1425);

[0068] Wherein, Nm is a methoxy-modified nucleotide, Nf is a fluorinated nucleotide, VP indicates that the adjacent nucleotide to the right is a 5'-(E)-vinyl phosphate-modified nucleotide, and s is a phosphorothioate linkage. The nucleotides can be selected from C, G, U, or A.

[0069] In some embodiments, the sense strand of the siRNA is 19 nucleotides in length and comprises the following modification pattern:

[0070] (1) 5'-NmsNmNfNmNfNmNfNfNfNmNfNmNfNmNfNmNfNmsNf-3' (SEQ ID NO: 1412);

[0071] (2) 5'-NmsNmNfNmNmNmNfNfNfNmNfNmNfNmNfNmNmNmsNm-3' (SEQ ID NO: 1413);

[0072] (3) 5'-NmsNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmsNm-3' (SEQ ID NO: 1414);

[0073] or

[0074] (5) 5'-NmsNmNmNmNfNmNfNfNfNmNmNmNmNmNmNfNmNmNmsNm-3' (SEQ ID NO: 1416);

[0075] Wherein, Nm is a methoxy-modified nucleotide, Nf is a fluorinated-modified nucleotide, N(LNA) is a locked nucleic acid-modified nucleotide, and s is a phosphorothioate linkage. The nucleotides can be selected from C, G, U, or A.

[0076] In some embodiments, the siRNA comprises a modification pattern selected from the group consisting of: SEQ ID NO: 1409 and SEQ ID NO: 1412; SEQ ID NO: 1409 and SEQ ID NO: 1413; SEQ ID NO: 1409 and SEQ ID NO: 1414; SEQ ID NO: 1409 and SEQ ID NO: 1415; SEQ ID NO: 1409 and SEQ ID NO: 1416; SEQ ID NO: 1410 and SEQ ID NO: 1412; SEQ ID NO: 1410 and SEQ ID NO: 1413; SEQ ID NO: 1410 and SEQ ID NO: 1414; SEQ ID NO: 1410 and SEQ ID NO: 1415; SEQ ID NO: 1410 and SEQ ID NO: 1416; SEQ ID NO: 1411 and SEQ ID NO: 1412; SEQ ID NO: 1411 and SEQ ID NO: 1413; SEQ ID NO: 1410 and SEQ ID NO: 1414; SEQ ID NO:1411 and SEQ ID NO:1414; SEQ ID NO:1411 and SEQ ID NO:1415; SEQ ID NO:1411 and SEQ ID NO:1416; SEQ ID NO:1423 and SEQ ID NO:1412; SEQ ID NO:1423 and SEQ ID NO:1413; SEQ ID SEQ ID NO:1423 and SEQ ID NO:1414; SEQ ID NO:1423 and SEQ ID NO:1415; SEQ ID NO:1423 and SEQ ID NO:1416; SEQ ID NO:1424 and SEQ ID NO:1412; SEQ ID NO:1424 and SEQ ID NO:1413; SEQ ID NO:1424 and SEQ ID NO:1414; SEQ ID NO:1424 and SEQ ID NO:1415; SEQ ID NO:1424 and SEQ ID NO:1416; SEQ ID NO:1425 and SEQ ID NO:1412; SEQ ID NO:1425 and SEQ ID NO:1413; SEQ ID NO:1425 and SEQ ID NO:1414; SEQ ID NO:1425 and SEQ ID NO:1415; SEQ ID NO:1425 and SEQ ID NO:1416.

[0077] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 839-1123, 1426-1438.

[0078] In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1124-1408.

[0079] In some embodiments, the sequences of the sense strand and antisense strand of the siRNA are selected from the sense strand and antisense strand sequences of any duplex of GPSZRA084S1 to GPSZRA402S5-VP provided in Table 4.

[0080] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 882, 1034, and 1037. In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1167, 1319, and 1322. In some embodiments, the sequences of the sense and antisense strands of the siRNA are selected from the sense and antisense strand sequences of any duplex of GPSZRA318S1, GPSZRA281S4, or GPSZRA284S4 provided in Table 4.

[0081] In some embodiments, the antisense strand comprises SEQ ID NOs: 846, 850, 852, 858, 860, 861, 863, 866, 869, 872, 878, 890, 891, 894, 904, 907, 909, 913-915, 920, 923, 924, 926, 935, 939, 946, 947, 951, 961, 964, 971, 97 2, 980, 992, 996, 1004, 1008, 1018, 1021, 1023, 1028, 1029, 1040, 1049, 1053, 1061, 1065, 1075, 1078, 1080, 1085, 1086, 1094, 1097, 1106, 1118. In some embodiments, the sense strand comprises the nucleotide sequence of SEQ ID NO: NOs: 1131, 1135, 1137, 1143, 1145, 1146, 1148, 1151, 1154, 1157, 1163, 1175, 1176, 1179, 1189, 1192, 1194, 1198-1200, 1205, 1208, 1209, 1211, 1220, 1224, 1231, 1232, 1236, 1246 , 1249, 1256, 1257, 1265, 1277, 1281, 1289, 1293, 1303, 1306, 1308, 1313, 1314, 1325, 1334, 1338, 1346, 1350, 1360, 1363, 1365, 1370, 1371, 1379, 1382, 1391, and 1403.In some embodiments, the sequences of the sense and antisense strands of the siRNA are selected from GPSZRA233S2, GPSZRA272S2, GPSZRA284S3, GPSZRA402S5, GPSZRA402S3, GPSZRA314S1, GPSZRA314S3, GPSZRA272S5, GPSZRA314S4, GPSZRA271S3, GPSZRA287S4, GPSZRA287S5, GPSZRA 314S2, GPSZRA314S5, GPSZRA287S2, GPSZRA233S5, GPSZRA402S4, GPSZRA410S2, GPSZRA231S5, G PSZRA231S1, GPSZRA227S2, GPSZRA402S2, GPSZRA272S4, GPSZRA271S4, GPSZRA410S4, GPSZRA2 76S1, GPSZRA318S2, GPSZRA271S2, GPSZRA272S1, GPSZRA285S2, GPSZRA231S4, GPSZRA284S1, GP The sense and antisense strand sequences of any duplex of SZRA318S3, GPSZRA233S1, GPSZRA231S2, GPSZRA231S3, GPSZRA402S1, GPSZRA233S4, GPSZRA284S5, GPSZRA271S5, GPSZRA272S3, GPSZRA284S2, GPSZRA267S2, GPSZRA222S1, GPSZRA318S4, GPSZRA292S1, GPSZRA287S1, GPSZRA410S3, GPSZRA281S2, GPSZRA275S1, GPSZRA227S5, GPSZRA407S1, GPSZRA227S4, GPSZRA281S1, GPSZRA227S3, GPSZRA381S2, or GPSZRA410S1.

[0082] In some embodiments, the antisense strand comprises SEQ ID NOs: 846, 960, 1017, 847, 904, 961, 1018, 1075, 1076, 850, 907, 964, 1021, 1078, 852, 909, 966, 1023, 1080, 913, 970, 1084, 857, 914, 971, 1028, 1085, 1035, 923, 980, 103 7, 1094, 1040, 1097, 930, 878, 935, 992, 1049, 1106, 939, 996, 1053, 1110, 889, 946, 1003, 890, 947, 1004, 1061, 1118, 891, 948, 1062, 894, 951, 1008, 1065. In some embodiments, the sense strand comprises the nucleotide sequence of SEQ ID NO: NOs: 1131, 1245, 1302, 1132, 1189, 1246, 1303, 1360, 1361, 1135, 1192, 1249, 1306, 1363, 113 7. 1194, 1251, 1308, 1365, 1198, 1255, 1369, 1142, 1199, 1256, 1313, 1370, 1320, 1208, 1265, 1 322, 1379, 1325, 1382, 1215, 1163, 1220, 1277, 1334, 1391, 1224, 1281, 1338, 1395, 1174, 1231, 1288, 1175, 1232, 1289, 1346, 1403, 1176, 1233, 1347, 1179, 1236, 1293, 1350.In some embodiments, the sequences of the sense and antisense strands of the siRNA are selected from the group consisting of GPSZRA222S1, GPSZRA222S3, GPSZRA222S4, GPSZRA227S1, GPSZRA227S2, GPSZRA227S3, GPSZRA227S4, GPSZRA227S5, GPSZRA228S5, GPSZRA231S1, GPSZRA231S2, GPSZRA231S3, GPSZRA231 ... 4. GPSZRA231S5, GPSZRA233S1, GPSZRA233S2, GPSZRA233S3, GPSZRA233S4, GPSZRA233S5, GPSZRA267S2, GPSZRA267 S3, GPSZRA267S5, GPSZRA271S1, GPSZRA271S2, GPSZRA271S3, GPSZRA271S4, GPSZRA271S5, GPSZRA282S4, GPSZRA28 4S2, GPSZRA284S3, GPSZRA284S4, GPSZRA284S5, GPSZRA287S4, GPSZRA287S5, GPSZRA301S2, GPSZRA314S1, GPSZRA3 14S2, GPSZRA314S3, GPSZRA314S4, GPSZRA314S5, GPSZRA318S2, GPSZRA318S3, GPSZRA318S4, GPSZRA318S5, GPSZRA The sense and antisense strand sequences of any duplex of GPSZRA407S1, GPSZRA407S2, GPSZRA407S4, GPSZRA410S1, GPSZRA410S2, GPSZRA410S3 or GPSZRA410S4.

[0083] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 846, 960, 1017, 847, 1018, 1075, 1023, 913, 980, 1040, 878, 935, 992, 1049, 1106, 939, 996, 1053, 946, 1003, 890, 947, 1061, 1118, 948, 1062, 894, 951, 1065. In some embodiments, the sense strand comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 1131, 1245, 1302, 1132, 1303, 1360, 1308, 1198, 1265, 1325, 1163, 1220, 1277, 1334, 1391, 1224, 1281, 1338, 1231, 1288, 1175, 1232, 1346, 1403, 1233, 1347, 1179, 1236, 1350. In some embodiments, the sequences of the sense and antisense strands of the siRNA are selected from the group consisting of GPSZRA222S1, GPSZRA222S3, GPSZRA222S4, GPSZRA227S1, GPSZRA227S4, GPSZRA227S5, GPSZRA233S4, GPSZRA267S2, GPSZRA284S3, GPSZRA287S4, GPSZRA314S1, GPSZRA314S2, GPSZRA314S3, GPSZRA314S4, and GPSZRA314S1. The sense and antisense strand sequences of any duplex of GPSZRA4S4, GPSZRA314S5, GPSZRA318S2, GPSZRA318S3, GPSZRA318S4, GPSZRA381S2, GPSZRA381S3, GPSZRA402S1, GPSZRA402S2, GPSZRA402S4, GPSZRA402S5, GPSZRA407S2, GPSZRA407S4, GPSZRA410S1, GPSZRA410S2, or GPSZRA410S4.

[0084] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 846, 960, 1017, 847, 913, 980, 878, 935, 992, 1106, 939, 1061, and 1118. In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1131, 1245, 1302, 1132, 1198, 1265, 1163, 1220, 1277, 1391, 1224, 1346, and 1403. In some embodiments, the sequences of the sense and antisense strands of the siRNA are selected from the sense and antisense strand sequences of any duplex of GPSZRA222S1, GPSZRA222S3, GPSZRA222S4, GPSZRA227S1, GPSZRA267S2, GPSZRA284S3, GPSZRA314S1, GPSZRA314S2, GPSZRA314S3, GPSZRA314S5, GPSZRA318S2, GPSZRA402S4, or GPSZRA402S5 provided in Table 4.

[0085] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1426-1438. In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1131, 1245, 1302, 1132, 1198, 1265, 1163, 1220, 1277, 1391, 1224, 1346, 1403. In some embodiments, the sequences of the sense and antisense strands of the siRNA are selected from the sense and antisense strand sequences of any duplex of GPSZRA222S1-VP, GPSZRA222S3-VP, GPSZRA222S4-VP, GPSZRA227S1-VP, GPSZRA267S2-VP, GPSZRA284S3-VP, GPSZRA314S1-VP, GPSZRA314S2-VP, GPSZRA314S3-VP, GPSZRA314S5-VP, GPSZRA318S2-VP, GPSZRA402S4-VP, and GPSZRA402S5-VP provided in Table 4.

[0086] deliver

[0087] The siRNA of the present invention can be delivered or introduced by any means known in the art (e.g., delivered in vitro or introduced into cells, or delivered in vivo or introduced into patients). For example, to deliver in vivo, the siRNA can be injected into a tissue site, or systemically administered. In vivo delivery can also be carried out by a beta-glucan delivery system. In vitro introduction into cells includes methods known in the art, such as electroporation and lipofection.

[0088] In some embodiments, the delivery method includes, but is not limited to, viral delivery (retrovirus, adenovirus, lentivirus, baculovirus, AAV); liposomes (Lipofectamine, cationic DOTAP, neutral DOPC); nanoparticles (cationic polymers, PEI); bacterial delivery (tkRNAi); chemical modification of siRNA (LNA) to increase stability; lipid nanoparticles (LNP); neutral liposomes (NL); polymer nanoparticles (low molecular weight polymers or high molecular weight polymers); double-stranded RNA binding motifs (dsRBMs); and other delivery systems known in the art to be suitable for nucleic acid or oligonucleotide delivery.

[0089] Conjugate

[0090] In one aspect, the present invention provides a conjugate comprising at least one siRNA of the present invention and a pharmaceutically acceptable targeting molecule. The conjugate of the present invention is obtained by coupling the siRNA of the present invention to a pharmaceutically acceptable targeting molecule, the conjugate comprising a pharmaceutically acceptable targeting molecule and an optional linker. The siRNA can be non-covalently coupled to the targeting molecule, or covalently coupled to the targeting molecule.

[0091] The pharmaceutically acceptable targeting molecule can be a targeting molecule conventionally used in the field of siRNA administration, which typically enhances the pharmacokinetic or biodistribution properties of the siRNA to which it is attached, and improves the cell-specific (or organ-specific) distribution and cell-specific (or organ-specific) uptake of the siRNA. Representative targeting molecules include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies or antibody fragments, antibody mimics, and the like. In some embodiments, the targeting molecules include but are not limited to one or more of the following targeting molecules or their derivatives: integrin family; lipophilic molecules, such as cholesterol, bile acid, vitamins (such as vitamin E), lipid molecules of different chain lengths; polymers, such as polyethylene glycol; polypeptides, such as membrane-permeable peptides; aptamers; antibodies; quantum dots; carbohydrates, such as lactose, polylactose, mannose, galactose, N-acetylgalactosamine (GalNAc); folic acid (folate); or receptor ligands expressed by hepatic parenchymal cells, such as asialoglycoproteins, asialosugar residues, lipoproteins (such as high-density lipoproteins, low-density lipoproteins, etc.), glucagon, neurotransmitters (such as adrenaline), growth factors, transferrin, etc.

[0092] The linker can be a linker conventionally used in the field of siRNA administration, including but not limited to one or more of the following linkers or their derivatives: amide linker portion, amino linker portion, carbonyl linker portion, carbamate linker portion, urea linker portion, ether linker portion, disulfide linker portion, succinylamino linker portion, etc.

[0093] In some embodiments, the targeting molecule can be directly or indirectly connected to the siRNA of the present invention via a joint / linking group. In some embodiments, the targeting molecule is connected to the siRNA via an unstable, cleavable or reversible bond or joint. In some embodiments, the targeting molecule is connected to at least one end of the sense strand and / or antisense strand of the siRNA. In some embodiments, the targeting molecule is connected to the 5' end and / or 3' end of the sense strand. In some embodiments, the targeting molecule is connected to the 5' end and / or 3' end of the antisense strand.

[0094] Pharmaceutical composition

[0095] In one aspect, the present invention provides pharmaceutical compositions comprising at least one siRNA of the present invention.

[0096] In some embodiments, the pharmaceutical composition contains one siRNA as described above.

[0097] In other embodiments, the pharmaceutical composition contains at least two of the siRNAs described above (for example, but not limited to, two, three, four, five, six, seven, eight, nine, ten or more) as active ingredients. Preferably, the at least two siRNAs each target a different target sequence in the RAGE gene, so that it is expected that they will act simultaneously against different target sequences and bring about a synergistic effect. Here, the so-called "different target sequences" means that there is no overlap between the target sequences, or the number of consecutive nucleotides overlapping between the target sequences is less than 5 (for example, the number of consecutive nucleotides overlapping is 4, 3, 2, 1, or 0). In this case, the at least two siRNAs described above can be present in any different ratios. Preferably, the at least two siRNAs described above can be present in a molar ratio of 1:100 to 100:1; more preferably, the at least two siRNAs described above can be present in a molar ratio of 1:10 to 10:1, 1:5 to 5:1, or 1:2 to 2:1. In some embodiments, the at least two aforementioned siRNAs are present in the same molar ratio.

[0098] In other embodiments, the pharmaceutical composition comprises at least one siRNA of the present invention and further comprises at least one siRNA targeting another target (e.g., a gene other than RAGE). In this case, the siRNA of the present invention and the siRNA targeting the other target can be present in any different ratio, for example, in a molar ratio of 1:100 to 100:1, for example, in a molar ratio of 1:10 to 10:1, 1:5 to 5:1, or 1:2 to 2:1, for example, in the same molar ratio.

[0099] In some embodiments, the pharmaceutical composition comprises an effective amount of siRNA. An "effective amount" refers to an amount of siRNA effective to produce the desired pharmacological, therapeutic, or preventive result. For example, if a given clinical treatment is considered effective when there is at least a 10% reduction in a measurable parameter associated with a disease or condition, then the therapeutically effective amount of the drug for treating that disease or condition is the amount required to achieve at least a 10% reduction in that parameter. For example, a therapeutically effective amount of an siRNA targeting RAGE can reduce RAGE mRNA levels by at least 10%.

[0100] In some embodiments, in the pharmaceutical composition described in any of the above embodiments, the siRNA can be linked to a targeting molecule to form a conjugate. Therefore, in some embodiments, the pharmaceutical composition comprises a conjugate of the present invention.

[0101] In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier and / or excipient.

[0102] In some embodiments, the pharmaceutically acceptable carrier and / or excipient is a delivery vehicle. A delivery vehicle is a substance that improves the delivery of nucleic acids or oligonucleotides to cells or tissues. Such substances can be any delivery vehicle known in the art that is suitable for nucleic acid or oligonucleotide delivery, including but not limited to: viruses (retroviruses, adenoviruses, lentiviruses, baculoviruses, AAVs); liposomes (Lipofectamine, cationic DOTAP, neutral DOPC); nanoparticles (cationic polymers, PEI); bacteria (tkRNAi); lipid nanoparticles (LNPs); neutral liposomes (NLs); polymer nanoparticles (low molecular weight polymers or high molecular weight polymers); double-stranded RNA binding motifs (dsRBMs), etc.

[0103] In some embodiments, the siRNA can be packaged by the delivery vehicle.

[0104] In some embodiments, the siRNA can be directly or indirectly connected to the delivery vector via a joint / connecting group. In some embodiments, the delivery vector is connected to the siRNA via an unstable, cleavable or reversible bond or joint. In some embodiments, the delivery vector is connected to at least one end of the sense strand and / or antisense strand of the siRNA. In some embodiments, the delivery vector is connected to the 5' end and / or 3' end of the sense strand. In some embodiments, the delivery vector is connected to the 5' end and / or 3' end of the antisense strand.

[0105] In some embodiments, the pharmaceutical composition comprises one siRNA provided by the present invention, and the siRNA is encapsulated by the delivery vector. The one siRNA can be encapsulated in the same delivery vector or in different delivery vectors.

[0106] In other embodiments, the pharmaceutical composition comprises at least two siRNAs provided by the present invention (for example, but not limited to, two, three, four, five, six, seven, eight, nine, ten or more), wherein the siRNAs are packaged by the delivery vehicle. The at least two siRNAs can be packaged in the same delivery vehicle or in different delivery vehicles. Preferably, the at least two siRNAs each target a different target sequence in the RAGE gene.

[0107] In other embodiments, the pharmaceutical composition comprises at least one siRNA provided by the present invention and an siRNA targeting another target (e.g., a gene other than RAGE), wherein the siRNA is encapsulated by the delivery vehicle. The siRNA provided by the present invention and the siRNA targeting another target (e.g., a gene other than RAGE) can be encapsulated in the same delivery vehicle or in different delivery vehicles.

[0108] In some embodiments, the pharmaceutical composition of the present invention is formulated into a dosage form compatible with its intended route of administration, for example, it can be administered locally (such as direct injection or implantation), systemically, or subcutaneously, intravenously, intraperitoneally, or parenterally, including intracranial (such as intraventricular, intrameningeal, or intrathecal), intramuscularly, transdermally, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration.

[0109] In some embodiments, the pharmaceutical composition is administered by suction, intranasal administration, intratracheal administration or oropharyngeal inhalation. The active ingredient of the required amount can be mixed in a suitable solvent and then aseptically filtered to prepare a preparation suitable for inhalation administration. Generally, the preparation for inhalation administration is a sterile solution under physiological pH and has low viscosity. Salt can be added to the preparation to balance tension. In some cases, a surfactant or cosolvent can be added to increase the solubility of the active ingredient and improve aerosol properties. In some cases, an excipient can be added to control viscosity to ensure the size and distribution of the atomized droplets.

[0110] In other embodiments, the pharmaceutical composition can be administered by injection, such as intravenous, intramuscular, subcutaneous, intradermal, intraarticular, intraocular, intraperitoneal or topical administration. Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the temporary preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, or phosphate buffered saline (PBS) and the like. The pharmaceutical composition should remain stable under production and storage conditions and should prevent contamination by microorganisms such as bacteria and fungi. For example, a sterile injection solution can be prepared by the following method: the active ingredient of the required dose is mixed in an appropriate solvent, and optionally, other desired ingredients (including but not limited to, pH regulators, surfactants, adjuvants, ionic strength enhancers, diluents, agents for maintaining osmotic pressure, agents for delayed absorption, preservatives, or any combination thereof) are mixed at the same time, followed by filtration sterilization. In addition, the sterile injection solution can be prepared as a sterile lyophilized powder (for example, by vacuum drying or freeze drying) for easy storage and use.

[0111] The siRNA of the present invention can be formulated in dosage unit form for ease of administration. Dosage unit form refers to physically discrete units suitable as unitary dosages for the subject to be treated; each unit contains a predetermined quantity of active ingredient calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.

[0112] In the present invention, the dosage regimen can be adjusted to obtain the optimal desired response (e.g., therapeutic or preventive response). For example, the drug can be administered as a single dose, multiple doses can be administered over a period of time, or the dosage can be proportionally reduced or increased depending on the urgency of the treatment situation.

[0113] application

[0114] Inhibits RAGE expression

[0115] The siRNA of the present invention can be used to inhibit the expression of RAGE in vitro and / or in vivo. The RAGE mRNA refers to an mRNA having a sequence shown in, for example, Genbank: NM_001136.5.

[0116] In one aspect, the present invention provides a method for inhibiting RAGE expression in a cell, comprising introducing into the cell an siRNA, conjugate, or pharmaceutical composition of the present invention. In some embodiments, the method is performed in vitro. The siRNA of the present invention can be introduced by any nucleic acid delivery method known in the art, such as electroporation or lipofection.

[0117] The term "inhibiting the expression of RAGE" refers to at least partial suppression of RAGE gene expression, which can be manifested as a decrease in the amount of detectable RAGE mRNA. For example, the degree of inhibition can be expressed as: (mRNA in control cells) - (mRNA in treated cells) / (mRNA in control cells) * 100%. Alternatively, the degree of inhibition can be given as a decrease in a parameter functionally associated with RAGE gene expression, such as the amount of protein encoded by the RAGE gene. In principle, RAGE gene silencing can be measured in any cell expressing RAGE (constitutively or genetically engineered) and by any suitable assay. Measurements can be made at multiple time points, before, during, and after administration of the siRNA, to determine the effect of the siRNA. The level or expression of RAGE can be measured by evaluating mRNA (e.g., by Northern blot or PCR) or protein (e.g., by Western blot). For example, the effect of the siRNA on RAGE expression can be determined by measuring the transcription rate of the RAGE gene (e.g., by RT-PCR). For example, the effect of siRNA on RAGE expression can be determined by measuring the expression level of a reporter gene (eg, luciferase) fused to the RAGE gene.

[0118] In some embodiments, the expression of the RAGE gene is suppressed by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45% or 50% by administering the siRNA of the present invention. In some embodiments, the expression of the RAGE gene is suppressed by at least about 60%, 70% or 80% by administering the siRNA of the present invention. In some embodiments, the expression of the RAGE gene is suppressed by at least about 85% by administering the siRNA of the present invention. In some embodiments, the expression of the RAGE gene is suppressed by at least about 90% by administering the siRNA of the present invention. In some embodiments, the expression of the RAGE gene is suppressed by at least about 95% by administering the siRNA of the present invention. In some embodiments, the expression of the RAGE gene is suppressed by at least about 96%, 97%, 98%, 99% or 100% by administering the siRNA of the present invention.

[0119] In some embodiments, the siRNA, the conjugate, or the pharmaceutical composition is used alone or in combination with another pharmaceutically active agent (eg, siRNA targeting a different target sequence in the RAGE gene or siRNA targeting other targets).

[0120] In some embodiments, a single siRNA provided herein is used. The siRNA is optionally packaged in a delivery vehicle. In some embodiments, the single siRNA is packaged in the same delivery vehicle. In other embodiments, the single siRNA is packaged in separate delivery vehicles.

[0121] In other embodiments, at least two siRNAs provided herein (for example, but not limited to, two, three, four, five, six, seven, eight, nine, ten or more) are used, preferably each of the at least two siRNAs targets a different target sequence in the RAGE gene. The at least two siRNAs are optionally packaged by a delivery vehicle. In some embodiments, the at least two siRNAs are packaged in the same delivery vehicle. In other embodiments, the at least two siRNAs are packaged in different delivery vehicles.

[0122] In other embodiments, at least one siRNA provided by the present invention and siRNA targeting other targets (e.g., other genes other than RAGE) are used. The siRNA provided by the present invention and siRNA targeting other targets (e.g., other genes other than RAGE) are optionally packaged by a delivery vector. In some embodiments, the siRNA provided by the present invention and siRNA targeting other targets (e.g., other genes other than RAGE) are packaged in the same delivery vector. In other embodiments, the siRNA provided by the present invention and siRNA targeting other targets (e.g., other genes other than RAGE) are respectively packaged in different delivery vectors.

[0123] Treatment of RAGE-related diseases

[0124] The siRNAs of the present invention can be used to treat diseases or conditions that would benefit from reduced levels or inhibition of RAGE expression.

[0125] In one aspect, the present invention provides a method for preventing and / or treating a disease associated with RAGE in a subject, the method comprising administering to a subject in need thereof an effective amount of an siRNA, conjugate, or pharmaceutical composition of the present invention. The present invention also relates to the use of the siRNA or pharmaceutical composition of the present invention in the preparation of a medicament for treating and / or preventing a disease associated with RAGE.

[0126] In some embodiments, the RAGE-related disease involves RAGE overexpression. RAGE overexpression refers to RAGE levels (e.g., RAGE levels in the subject's plasma or tissue, and preferably in damaged tissue) that are higher than normal RAGE levels (e.g., corresponding levels in healthy controls).

[0127] In some embodiments, the RAGE-associated disease would benefit from reduced RAGE levels or inhibition of expression.

[0128] In some embodiments, the RAGE-associated disease is a respiratory disease, such as cystic fibrosis, pneumonia, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, respiratory tract infection, primary ciliary dyskinesia, or lung cancer cystic fibrosis.

[0129] In some embodiments, the respiratory disease is chronic obstructive pulmonary disease (COPD).

[0130] In some embodiments, the RAGE-associated disease is a neurological disease, such as Alzheimer's disease or stroke.

[0131] In some embodiments, the RAGE-related disease is a urological disease, such as diabetic nephropathy.

[0132] In some embodiments, if RAGE expression is elevated for a particular disease, treatment with an siRNA of the invention can reduce the level or expression of RAGE to a level that is within the normal range considered for individuals without such a disorder.

[0133] In some embodiments, the RAGE-related disease involves inflammation, such as chronic inflammation. In some embodiments, the RAGE-related disease is an inflammatory disease. In some embodiments, the RAGE-related disease would benefit from the inhibition of inflammation. In some embodiments, the siRNA of the present invention inhibits or reduces the expression of RAGE and thereby inhibits or reduces the RAGE-mediated signaling pathway, thereby reducing or inhibiting the inflammatory response.

[0134] In some embodiments, the disease associated with RAGE is an inflammatory respiratory disease. In some embodiments, the disease associated with RAGE is an inflammatory nervous system disease. In some embodiments, the disease associated with RAGE is an inflammatory urological disease. In some embodiments, the disease associated with RAGE is a diabetic complication, such as diabetic nephropathy, arteriosclerosis, or retinopathy.

[0135] In some embodiments, the subject is a mammal, such as a human.

[0136] In some embodiments, the siRNA, the conjugate or the pharmaceutical composition is used alone or in combination with another pharmaceutically active agent (e.g., siRNA targeting a different target sequence in the RAGE gene or siRNA targeting other targets), for example, administered simultaneously or sequentially.

[0137] In some embodiments, a single siRNA provided herein is used. The siRNA is optionally packaged in a delivery vehicle. In some embodiments, the single siRNA is packaged in the same delivery vehicle. In other embodiments, the single siRNA is packaged in separate delivery vehicles.

[0138] In other embodiments, at least two siRNAs provided herein (for example, but not limited to, two, three, four, five, six, seven, eight, nine, ten or more) are used, preferably each of the at least two siRNAs targets a different target sequence in the RAGE gene. The at least two siRNAs are optionally packaged by a delivery vehicle. In some embodiments, the at least two siRNAs are packaged in the same delivery vehicle. In other embodiments, the at least two siRNAs are packaged in different delivery vehicles.

[0139] In other embodiments, at least one siRNA provided by the present invention and siRNA targeting other targets (e.g., other genes other than RAGE) are used. The siRNA provided by the present invention and siRNA targeting other targets (e.g., other genes other than RAGE) are optionally packaged by a delivery vector. In some embodiments, the siRNA provided by the present invention and siRNA targeting other targets (e.g., other genes other than RAGE) are packaged in the same delivery vector. In other embodiments, the siRNA provided by the present invention and siRNA targeting other targets (e.g., other genes other than RAGE) are respectively packaged in different delivery vectors.

[0140] Definition of terms

[0141] In the present invention, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. At the same time, in order to better understand the present invention, the definitions and explanations of relevant terms are provided below.

[0142] As used herein, the mRNA sequence of the receptor for advanced glycation end products (RAGE) is well known to those skilled in the art, for example, see the mRNA sequence shown in Genbank Accession No. NM_001136.5. Furthermore, unless otherwise specified, the term "target gene" as used herein refers to a gene that can transcribe the aforementioned RAGE mRNA, the term "target mRNA" refers to the aforementioned RAGE mRNA, and the term "inhibiting a RAGE gene" refers to inhibiting the expression of RAGE.

[0143] In this article, the capital letters C, G, U, A, and T represent the base composition of the nucleotide, including modified or unmodified nucleotides; the lowercase letter m indicates that the nucleotide adjacent to the left of the letter m is a methoxy-modified nucleotide; the lowercase letter f indicates that the nucleotide adjacent to the left of the letter f is a fluorine-modified nucleotide; (LNA) indicates that the nucleotide adjacent to the left of the (LNA) is a locked nucleic acid-modified nucleotide; the lowercase letter s indicates that the two nucleotides adjacent to the left and right of the letter s are connected by a thiophosphate group; the capital letter VP indicates that the nucleotide adjacent to the right of the VP is a 5'-(E)-vinyl phosphate-modified nucleotide.

[0144] As used herein, the term "modified nucleotide" refers to a nucleotide or nucleotide analog that independently has a modified ribose moiety, a modified internucleoside bond, or a modified base. Thus, the term "modified nucleotide" encompasses substitutions, additions, or removals (e.g., using functional groups or atoms) of internucleoside bonds, ribose moieties, or bases. A "nucleotide analog" refers to a group that can replace a nucleotide in a nucleic acid but has a structure different from that of an adenine ribonucleotide, a guanine ribonucleotide, a cytosine ribonucleotide, a uracil ribonucleotide, or a thymine deoxyribonucleotide. Such as an isonucleotide, a bridged nucleic acid (BNA), or an acyclic nucleotide. Modifications suitable for use in the present invention include all types of modifications disclosed herein or known in the art. As an example, a modified nucleotide can include a nucleotide or nucleotide analog formed by replacing the hydroxyl group at the 2' position of the ribose group of the nucleotide with another group, or a nucleotide in which the base on the nucleotide is a modified base, or a nucleotide modified with a 5'-phosphate analog.

[0145] The structures of the following exemplary modified nucleotides are provided herein:

[0146] The structure of the fluorinated nucleotide is shown below:

[0147] The structure of a methoxy-modified nucleotide is shown below:

[0148] The nucleotide structure of the locked nucleic acid modification is shown below:

[0149] The structure of a 5'-(E)-vinyl phosphate-modified nucleotide is shown below:

[0150] As used herein, the term "siRNA" refers to an RNA molecule that is capable of sequence-specifically inducing RNAi, is composed of a sense strand and an antisense strand, and has a partially or completely complementary double-stranded structure. In the siRNA of the present invention, the length of the complementary double-stranded structure can be 14 to 30 base pairs, for example, 14, 15, 16, 17, 18, 19, 20, or 21 base pairs, for example, 14 to 19 base pairs. In some embodiments of the present invention, the siRNA may also contain modified nucleotides as needed, and the modified nucleotides do not significantly weaken or lose the function of the siRNA in inhibiting RAGE gene expression. Currently, there are many methods available in the art for modifying siRNA, including, for example, backbone modifications (such as phosphate group modifications), ribose group modifications, and base modifications (Watts, JK, GF Deleavey, and MJ Damha, Chemically modified siRNA: tools and applications. Drug Discov Today, 2008. 13(19-20): p. 842-55).

[0151] The term "antisense strand" includes a region that is substantially complementary to the target sequence. The term "sense strand," as used herein, refers to a strand that is substantially complementary to a region of the antisense strand. The term "region of complementarity" refers to a region on the antisense strand that is substantially complementary to RAGE mRNA or a region on the sense strand that is substantially complementary to the antisense strand. When the region of complementarity is not completely complementary to the target sequence, mismatches can occur in the interior or terminal regions of the molecule. Typically, the most tolerated mismatches are in the terminal regions, for example, within 5, 4, 3, 2, or 1 nucleotides of the 5' and / or 3' termini.

[0152] As used herein, unless otherwise specified, the term "complementary" refers to the ability of an oligonucleotide of a first sequence to hybridize with an oligonucleotide of a second sequence under certain conditions and form a double-stranded structure. "At least partially complementary" means that the two sequences can be completely complementary, or generally have no more than 6, 5, 4, 3, 2, or 1 mismatched base pairings, while retaining the ability to hybridize under relevant conditions. In addition, when two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs should not be considered mismatches for the purpose of determining complementarity. As used herein, when the above hybridization ability requirements are met, "complementary" sequences may also include or be completely formed from non-Watson-Crick base pairs and / or base pairs formed from non-natural and modified nucleotides. Such non-Watson-Crick base pairs include, but are not limited to, G:U wobble base pairing or Hoogstein base pairing. Correspondingly, in this document, unless otherwise specified, "mismatch" means that the bases at corresponding positions in the siRNA duplex molecule are not paired in a complementary form.

[0153] Those skilled in the art will be able to determine the most appropriate conditions for testing the complementarity of two sequences based on the intended use of the hybridized nucleotides. Such conditions may, for example, be stringent conditions, such as 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours, followed by washing. Other conditions, such as physiologically relevant conditions encountered in vivo, may also be used.

[0154] As used herein, unless otherwise specified, "nucleotide sequence differences" refer to changes in the base type of the nucleotides at the same or corresponding positions compared to the original nucleotide sequence. For example, if one nucleotide base in the original nucleotide sequence is A, and the nucleotide base at the same or corresponding position is changed to U, C, G, or dT, dC, dG, etc., a nucleotide sequence difference is considered to exist at that position. It should be noted that if the nucleotides at the same or corresponding positions differ only in the presence or type of modification compared to the original nucleotide sequence, a nucleotide sequence difference is not considered to exist at that position.

[0155] In this article, if not otherwise specified, the term "pharmaceutically acceptable carrier and / or excipient" refers to a carrier, delivery vehicle, diluent, adjuvant and / or the salt / ester / hydrate thereof formed, etc., which are usually chemically or physically compatible with other ingredients (such as siRNA of the present invention) constituting a certain pharmaceutical dosage form, and are physiologically compatible with the subject. "Pharmaceutically acceptable carrier and / or excipient" does not play or is not intended to play a therapeutic effect at the expected dose. Such ingredients can play the following roles: a) help the processing of the drug delivery system during manufacturing, b) protect, support or enhance the stability, bioavailability or patient acceptability of the active ingredient, c) assist product identification, and / or d) enhance the overall safety, effectiveness, delivery, etc. of the active ingredient during storage and use. For example, the siRNA of the present invention can be wrapped by a delivery vehicle. "Pharmaceutically acceptable carriers and / or excipients" include, but are not limited to, viruses, liposomes, nanoparticles, bacteria, lipid nanoparticles (LNPs), neutral liposomes (NLs), polymer nanoparticles, double-stranded RNA binding motifs (dsRBMs), pH adjusters, surfactants, adjuvants, ionic strength enhancers, diluents, agents for maintaining osmotic pressure, agents for delaying absorption, and preservatives. For example, viruses include, but are not limited to, retroviruses, adenoviruses, lentiviruses, baculoviruses, and AAVs. Liposomes include, but are not limited to, lipofectamine, cationic DOTAP, and neutral DOPC. Nanoparticles include, but are not limited to, cationic polymers and PEI. Bacteria include, but are not limited to, tkRNAi. Polymeric nanoparticles include, but are not limited to, low molecular weight polymers or high molecular weight polymers. For example, pH adjusters include, but are not limited to, phosphate buffers. Surfactants include, but are not limited to, cationic, anionic, or nonionic surfactants, such as Tween-80. Ionic strength enhancers include, but are not limited to, sodium chloride. Preservatives include, but are not limited to, various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, and the like. Agents that maintain osmotic pressure include, but are not limited to, sugars, NaCl, and the like. Agents that delay absorption include, but are not limited to, monostearate and gelatin. Diluents include, but are not limited to, water, aqueous buffers (e.g., buffered saline), alcohols, and polyols (e.g., glycerol).

[0156] As used herein, unless otherwise specified, the term "inhibit" refers to the down-regulation of target gene expression due to siRNA-mediated degradation of target gene mRNA. "Down-regulation" refers to a decrease in target gene expression by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% or more, or even 100%, relative to the absence of siRNA treatment. A 100% decrease in target gene expression refers to the absence of detectable target gene expression.

[0157] As used herein, the term "overhang" or "nucleotide overhang" refers to at least one unpaired nucleotide protruding from the siRNA duplex structure. For example, when the 3' end of one strand of the siRNA extends beyond the 5' end of the other strand (or vice versa), an overhang is present. The siRNA may comprise an overhang of at least one nucleotide, or the overhang may comprise at least 2nt, at least 3nt, at least 4nt, at least 5nt or more. The overhang may comprise nucleotide / nucleoside analogs, or be composed of nucleotide / nucleoside analogs comprising deoxyribonucleotides / nucleosides. The overhang may be on the sense strand, the antisense strand, or any combination thereof. The nucleotides of the overhang may be present on the 5' end, the 3' end, or both ends of the antisense strand or the sense strand of the siRNA. Accordingly, the term "blunt end" refers to the absence of a nucleotide overhang.

[0158] As used herein, the term "prevention" refers to a method implemented to prevent or delay the occurrence of a disease, condition, or symptom in a subject; and the term "treatment" refers to a method implemented to obtain a beneficial or desired clinical outcome. For the purposes of the present invention, beneficial or desired clinical outcomes include, but are not limited to, alleviation of symptoms, reduction in the extent of the disease, stabilization (i.e., no longer worsening) of the state of the disease, delaying or slowing the progression of the disease, improvement or alleviation of the state of the disease, and relief of symptoms (whether partial or complete), whether detectable or undetectable. In addition, "treatment" may also refer to prolonging survival compared to the expected survival if not receiving treatment.

[0159] As used herein, the term "effective amount" refers to an amount sufficient to achieve, or at least partially achieve, a desired effect. For example, a prophylactic effective amount is an amount sufficient to prevent, arrest, or delay the onset of a disease; a therapeutic effective amount is an amount sufficient to cure or at least partially arrest the disease and its complications in a patient already suffering from the disease. Determining such an effective amount is well within the capabilities of those skilled in the art. For example, an effective amount for therapeutic use will depend on the severity of the disease being treated, the overall state of the patient's own immune system, the patient's general condition such as age, weight, and sex, the method of administration of the drug, and any other concurrently administered treatments.

[0160] Advantageous Effects of the Invention

[0161] The siRNA of the present invention can effectively inhibit RAGE gene expression in vitro and / or in vivo, inhibit or reduce RAGE-mediated signaling pathways, and has good stability. Therefore, the siRNA of the present invention can be used to inhibit inflammatory responses and treat diseases or conditions that benefit from reduced RAGE levels or suppressed expression, and has important clinical value in the treatment of RAGE-related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0162] Figure 1A-1G: Gel testing results of RNase stability of modified siRNA.

[0163] Figure 2A-2F: Gel running results of modified siRNA serum stability.

[0164] Figure 3A-3G: Stability of modified siRNA human lung S9 gel run results.

[0165] Figure 4A-4C: Gel testing results of VP-modified siRNA RNase stability.

[0166] FIG5A-FIG5C: Gel running results of serum stability of VP-modified siRNA.

[0167] Figure 6A-6C: Gel running results of VP-modified siRNA human lung S9 stability.

[0168] FIG. 7A-FIG . 7I : Cytotoxicity of VP-modified siRNA against A549 RAGE LV.

[0169] FIG8A-FIG8I : Cytotoxicity of VP-modified siRNA against BEAS-2B RAGE LV.

[0170] Figures 9A-9K: The results of VP-modified siRNA stimulating human PBMC to secrete cytokines (TNF-α, IFN-α, IL-1β, IL-2, IL-4, IL-5, IL-6, IL-10, IL-12P70, IL-17, IFN-γ).

[0171] Below in conjunction with embodiment, embodiment of the present invention is described in detail, but those skilled in the art will understand that the following examples are only used to illustrate the present invention, rather than to limit the scope of the invention. According to the following detailed description of preferred embodiments, various objects and advantages of the present invention will become implementable to those skilled in the art. DETAILED DESCRIPTION

[0172] The invention will now be described in the following non-limiting examples.

[0173] Those skilled in the art will appreciate that the examples are provided to illustrate the present invention by way of example and are not intended to limit the scope of the invention. The experimental methods in the examples are conventional methods unless otherwise specified. Where specific conditions are not specified in the examples, the experiments were carried out according to conventional conditions or the conditions recommended by the manufacturer. Where the manufacturer of the reagents or instruments is not specified, they are all commercially available conventional products.

[0174] It is known to those skilled in the art that the siRNA of the present invention can be obtained by conventional siRNA preparation methods in the art (e.g., solid phase synthesis and liquid phase synthesis), wherein both solid phase synthesis and liquid phase synthesis are commercially available. It is also clear to those skilled in the art that modified nucleotide groups can be introduced into the siRNA of the present invention by using nucleotide monomers with corresponding modifications. Methods for preparing nucleotide monomers with corresponding modifications are well known to those skilled in the art, and commercial monomers are also available on the market.

[0175] Preparation Example 1: Synthesis of unmodified siRNA

[0176] This preparation example provides an siRNA for inhibiting RAGE expression. The nucleotide sequence of the siRNA is designed based on the target mRNA, as shown in Table 1.

[0177] Table 1: siRNA sequences

[0178] Preparation Example 2: Synthesis of modified siRNA

[0179] This preparation example provides a modified siRNA for inhibiting RAGE expression. The modification pattern of the siRNA is shown in Table 2, the overall modification combination of the siRNA is shown in Table 3, and the modified siRNA sequence is shown in Table 4.

[0180] Modification instructions:

[0181] In Tables 2-4, Nm represents a methoxy-modified nucleotide, Nf represents a fluorinated nucleotide, N(LNA) represents a locked nucleic acid-modified nucleotide, VP represents a 5'-(E)-vinyl phosphate-modified nucleotide, and s represents a phosphorothioate linkage. The sequence name suffixes S1, S2, S3, S4, S5, S1-VP, S2-VP, S3-VP, S4-VP, and S5-VP in Table 3 represent different modification methods, which are described as follows:

[0182] S1 represents the sense strand modification pattern SEQ ID NO: 1412 + the antisense strand modification pattern SEQ ID NO: 1409. The sense strand includes the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and positions 18 and 19 are linked by phosphorothioate groups; the nucleotides at positions 1, 2, 4, 6, 10, 12, 14, 16, and 18 are methoxy-modified nucleotides; and the nucleotides at positions 3, 5, 7, 8, 9, 11, 13, 15, 17, and 19 are fluorinated modified nucleotides; the antisense strand includes the following chemical modifications: Modification: From the 5' end to the 3' end, the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 are linked by phosphorothioate groups, the nucleotides at positions 1, 3, 5, 7, 9, 11, 12, 13, 15, 17, 19, 20, and 21 are methoxy-modified nucleotides, and the nucleotides at positions 2, 4, 6, 8, 10, 14, 16, and 18 are fluorine-modified nucleotides.

[0183] S2 represents the sense strand modification pattern SEQ ID NO: 1413 + the antisense strand modification pattern SEQ ID NO: 1410. The sense strand includes the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and positions 18 and 19 are linked by thiophosphate groups; the nucleotides at positions 1, 2, 4, 5, 6, 10, 12, 14, 16, 17, 18, and 19 are methoxy-modified nucleotides; and the nucleotides at positions 3, 7, 8, 9, 11, 13, and 15 are fluorinated modified nucleotides; the antisense strand includes the following chemical modifications: Modification: From the 5' end to the 3' end, the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 are linked by phosphorothioate groups, the nucleotides at positions 1, 3, 4, 5, 7, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, and the nucleotides at positions 2, 6, 8, 14, and 16 are fluorinated-modified nucleotides.

[0184] S3 represents the sense strand modification pattern SEQ ID NO: 1414 + the antisense strand modification pattern SEQ ID NO: 1411. The sense strand comprises the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and positions 18 and 19 are linked by phosphorothioate groups; the nucleotides at positions 1, 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 are methoxy-modified nucleotides; and the nucleotides at positions 7, 8, and 9 are fluorinated nucleotides; the antisense strand comprises the following chemical modifications: Modification: From the 5' end to the 3' end, the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 are linked by phosphorothioate groups, the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, and the nucleotides at positions 2, 6, 14, and 16 are fluorinated-modified nucleotides.

[0185] S4 represents the sense strand modification pattern SEQ ID NO: 1415 + the antisense strand modification pattern SEQ ID NO: 1410. The sense strand includes the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and positions 18 and 19 are linked by phosphorothioate groups; the nucleotide at position 1 is a locked nucleic acid-modified nucleotide; the nucleotides at positions 2, 4, 5, 6, 10, 12, 14, 16, 17, 18, and 19 are methoxy-modified nucleotides; and the nucleotides at positions 3, 7, 8, 9, 11, 13, and 15 are fluorinated nucleotides; the antisense strand includes the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and at positions 18 and 19 are linked by phosphorothioate groups; the nucleotide at position 1 is a locked nucleic acid-modified nucleotide; The chain includes the following chemical modifications: in the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 are linked by thiophosphate groups, the nucleotides at positions 1, 3, 4, 5, 7, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, and the nucleotides at positions 2, 6, 8, 14, and 16 are fluorine-modified nucleotides.

[0186] S5 represents the sense strand modification pattern SEQ ID NO: 1416 + the antisense strand modification pattern SEQ ID NO: 1410. The sense strand comprises the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and positions 18 and 19 are linked by phosphorothioate groups; the nucleotides at positions 1, 2, 3, 4, 6, 10, 11, 12, 13, 14, 16, 17, 18, and 19 are methoxy-modified nucleotides; and the nucleotides at positions 5, 7, 8, 9, and 15 are fluorinated modified nucleotides; the antisense strand comprises the following chemical modifications: Modification: From the 5' end to the 3' end, the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 are linked by phosphorothioate groups, the nucleotides at positions 1, 3, 4, 5, 7, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, and the nucleotides at positions 2, 6, 8, 14, and 16 are fluorinated-modified nucleotides.

[0187] S1-VP represents the sense strand modification pattern SEQ ID NO: 1412 + the antisense strand modification pattern SEQ ID NO: 1423. The sense strand comprises the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and 18 and 19 are linked by phosphorothioate groups; the nucleotides at positions 1, 2, 4, 6, 10, 12, 14, 16, and 18 are methoxy-modified nucleotides; and the nucleotides at positions 3, 5, 7, 8, 9, 11, 13, 15, 17, and 19 are fluorinated nucleotides; the antisense strand comprises the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and 18 and 19 are linked by phosphorothioate groups; The nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups, the nucleotides at positions 1, 3, 5, 7, 9, 11, 12, 13, 15, 17, 19, 20, and 21 are methoxy-modified nucleotides, the nucleotides at positions 2, 4, 6, 8, 10, 14, 16, and 18 are fluorine-modified nucleotides, and the nucleotide at position 1 also includes a 5'-(E)-vinyl phosphate modification.

[0188] S2-VP represents the sense strand modification pattern SEQ ID NO: 1413 + the antisense strand modification pattern SEQ ID NO: 1424. The sense strand comprises the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and positions 18 and 19 are linked by phosphorothioate groups; the nucleotides at positions 1, 2, 4, 5, 6, 10, 12, 14, 16, 17, 18, and 19 are methoxy-modified nucleotides; and the nucleotides at positions 3, 7, 8, 9, 11, 13, and 15 are fluorinated nucleotides; the antisense strand comprises the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and at positions 18 and 19 are linked by phosphorothioate groups; The nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups, the nucleotides at positions 1, 3, 4, 5, 7, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, the nucleotides at positions 2, 6, 8, 14, and 16 are fluorine-modified nucleotides, and the nucleotide at position 1 also includes a 5'-(E)-vinyl phosphate modification.

[0189] S3-VP represents the sense strand modification pattern SEQ ID NO: 1414 + the antisense strand modification pattern SEQ ID NO: 1425. The sense strand comprises the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and positions 18 and 19 are linked by phosphorothioate groups; the nucleotides at positions 1, 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 are methoxy-modified nucleotides; and the nucleotides at positions 7, 8, and 9 are fluorinated nucleotides; the antisense strand comprises the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and at positions 18 and 19 are linked by phosphorothioate groups; The nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups, the nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, the nucleotides at positions 2, 6, 14, and 16 are fluorine-modified nucleotides, and the nucleotide at position 1 also includes a 5'-(E)-vinyl phosphate modification.

[0190] S4-VP represents the sense strand modification pattern SEQ ID NO: 1415 + the antisense strand modification pattern SEQ ID NO: 1424. The sense strand comprises the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and positions 18 and 19 are linked by thiophosphate groups, the nucleotide at position 1 is a locked nucleic acid modified nucleotide, the nucleotides at positions 2, 4, 5, 6, 10, 12, 14, 16, 17, 18, and 19 are methoxy modified nucleotides, and the nucleotides at positions 3, 7, 8, 9, 11, 13, and 15 are fluorinated modified nucleotides; the antisense strand comprises the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and at positions 18 and 19 are linked by thiophosphate groups, the nucleotide at position 1 is a locked nucleic acid modified nucleotide, the nucleotides at positions 2, 4, 5, 6, 10, 12, 14, 16, 17, 18, and 19 are methoxy modified nucleotides, and the nucleotides at positions 3, 7, 8, 9, 11, 13, and 15 are fluorinated modified nucleotides; In the direction from the ' end to the 3' end, the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 are linked by thiophosphate groups, the nucleotides at positions 1, 3, 4, 5, 7, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, the nucleotides at positions 2, 6, 8, 14, and 16 are fluorine-modified nucleotides, and the nucleotide at position 1 also includes a 5'-(E)-vinyl phosphate modification.

[0191] S5-VP represents the sense strand modification pattern of SEQ ID NO: 1416 + the antisense strand modification pattern of SEQ ID NO: 1424. The sense strand comprises the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and positions 18 and 19 are linked by phosphorothioate groups, the nucleotides at positions 1, 2, 3, 4, 6, 10, 11, 12, 13, 14, 16, 17, 18, and 19 are methoxy-modified nucleotides, and the nucleotides at positions 5, 7, 8, 9, and 15 are fluorinated modified nucleotides; the antisense strand comprises the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and at positions 18 and 19 are linked by phosphorothioate groups, the nucleotides at positions 1, 2, 3, 4, 6, 10, 11, 12, 13, 14, 16, 17, 18, and 19 are methoxy-modified nucleotides, and the nucleotides at positions 5, 7, 8, 9, and 15 are fluorinated modified nucleotides. The nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups, the nucleotides at positions 1, 3, 4, 5, 7, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, the nucleotides at positions 2, 6, 8, 14, and 16 are fluorine-modified nucleotides, and the nucleotide at position 1 also includes a 5'-(E)-vinyl phosphate modification.

[0192] Table 2: Modification patterns of siRNA

[0193] Table 3: Modification patterns of siRNA - overall

[0194] Table 4: Modified siRNA sequences

[0195] The following examples relate to the detection of siRNA biological activity. The experimental methods in the examples, unless otherwise specified, are conventional methods. Where specific conditions are not specified in the examples, the experiments were conducted according to conventional conditions or those recommended by the manufacturer. Reagents and instruments used, where the manufacturer is not specified, are commercially available conventional products. The experimental cells used in the following examples were 293T cells purchased from the Chinese Academy of Sciences Cell Bank.

[0196] Example 1: On-target activity detection of unmodified siRNA for RAGE inhibition

[0197] This example provides an on-target activity detection experiment for unmodified siRNA for inhibiting RAGE. The psiCHECK2 vector is used to construct a plasmid vector for detection. The psiCHECK2 vector is a plasmid vector that can monitor changes in the expression of a target gene fused to a reporter gene. The vector uses Renilla luciferase as the primary reporter gene. The target fragment is cloned into the multiple cloning site downstream of the translation stop codon of Renilla luciferase. The RNAi process against the target gene triggered by the synthetic siRNA leads to the cleavage and subsequent degradation of the fusion mRNA. By detecting changes in Renilla luciferase activity, it can be determined whether the siRNA and the target gene fragment have a targeting relationship. The experimental process is as follows:

[0198] (1) Construction of detection plasmid RAGE-psiCHECK2

[0199] Using psiCHECK TM -2(Promega TM ) plasmid construction detection plasmid, the detection plasmid contains the following insert sequence, the insert sequence is derived from the mRNA sequence shown in Genbank accession number NM_001136.5, a single copy of the insert sequence is cloned into psiCHECK TM -2 plasmid Xho I / Not I site, to obtain the detection plasmids GPRAGE-1-psiCHECK2, GPRAGE-2-psiCHECK2, GPRAGE-3-psiCHECK2 and GPRAGE-4-psiCHECK2;

[0200] The inserted sequence of GPRAGE-1-psiCHECK2 is RAGE mRNA1: 5’-agacagagccaggaccctggaagg aagcaggatggctgccggaacagcagttggagcctgggtgctggtcctcagtctgtggggggcagtagtaggtgctcaaaacatcacagcccggattggcgagccactggtgctgaagtgtaagggggcccccaagaaaccaccccagcggctggaatggaaactgaacacaggccggacagaagcttggaaggtcctgtctccccagggaggaggcccctgggacagtgtggctcgtgtccttcccaacggctccctcttccttccggctgtcgggatccaggatgaggggattttccggtgccaggcaatgaacaggaatggaaaggagaccaagtccaactaccgagtccgtgtctaccagattcctgggaag-3’ (SEQ ID NO:1417);

[0201] The inserted sequence of GPRAGE-2-psiCHECK2 is RAGE mRNA2: 5’-aggagaccaagtccaactaccgagt ccgtgtctaccagattcctgggaagccagaaattgtagattctgcctctgaactcacggctggtgttcccaataaggtggggacatgtgtgtcagagggaagctaccctgcagggactcttagctggcacttggatgggaagcccctggtgcctaatgagaagggagtatctgtgaaggaacagaccaggagacaccctgagacagggctcttcacactgcagtcggagctaatggtgaccccagcccggggaggagatccccgtcccaccttctcctgtagcttcagcccaggccttccccgacaccgggccttgcgcacagcccccatccagccccgtgtctgggagcctgtgcctctggaggaggtccaatt-3’ (SEQ ID NO:1418);

[0202] The inserted sequence of GPRAGE-3-psiCHECK2 is RAGE mRNA3: 5’-cccatccagccccgtgtctgggagc ctgtgcctctggaggaggtccaattggtggtggagccagaaggtggagcagtagctcctggtggaaccgtaaccctgacctgtgaagtccctgcccagccctctcctcaaatccactggatgaaggatggtgtgcccttgccccttccccccagccctgtgctgatcctccctgagatagggcctcaggaccagggaacctacagctgtgtggccacccattccagccacgggccccaggaaagccgtgctgtcagcatcagcatcatcgaaccaggcgaggaggggccaactgcaggctctgtgggaggatcagggctgggaactctagccctggccctggggatcctgggaggcctggggacagccgccctgc-3’(SEQ ID NO:1419);

[0203] The inserted sequence of GPRAGE-4-psiCHECK2 is RAGE mRNA4: 5’-aggctctgtgggaggatcagggctg ggaactctagccctggccctggggatcctgggaggcctggggacagccgccctgctcattggggtcatcttgtggcaaaggcggcaacgccgaggagaggagaggaaggccccagaaaaccaggaggaagaggaggagcgtgcagaactgaatcagtcggaggaacctgaggcaggcgagagtagtactggagggccttgaggggcccacagacagatcccatccatcagctcccttttctttttcccttgaactgttctggcctcagaccaactctctcctgtataatctctctcctgtataaccccaccttgccaagctttcttctacaaccagagccccccacaatgatgattaaacacctgacacatcttg-3’(SEQ ID NO:1420);

[0204] The above-mentioned synthesized siRNA sequences were grouped and tested, as shown in Table 5. GPSZRA001-GPSZRA118 used the detection plasmid GPSZRA-1-psiCHECK2, GPSZRA090-GPSZRA251 used the detection plasmid GPSZRA-2-psiCHECK2, GPSZRA250-GPSZRA358 used the detection plasmid GPSZRA-3-psiCHECK2, and GPSZRA359-GPSZRA419 used the detection plasmid GPSZRA-4-psiCHECK2.

[0205] Table 5: siRNA grouping experiment

[0206] (2) Cell culture and transfection

[0207] In a 96-well plate, 12.5 μl of Opti-MEM containing 20 ng of GPSZRA-1-psiCHECK2 detection plasmid (using the corresponding detection plasmid according to the siRNA) and 32.5 μl of Opti-MEM plus 0.3 μl of Lipofectamine 2000 (purchased from Invitrogen, catalog number 11668-019) were added to each well of siRNA and incubated at room temperature for 15 minutes. Then, 50 μl of DMEM complete medium containing 1×104 293T cells (purchased from Transgen Biotech, catalog number FI101-01) was added to each well of the above mixture and cultured at 37°C for 24 hours for subsequent dual-luciferase assays. The experimental concentration was performed at a final siRNA concentration of 1 nM.

[0208] (3) Dual luciferase assay

[0209] The 5× lysis buffer in the dual-luciferase assay kit (purchased from Promega, catalog number E2940) was diluted with water to 1× lysis buffer. Cells were cultured in step 2, the supernatant was discarded, and each well was diluted and washed twice with PBS buffer (purchased from Hyclone, catalog number SH30256.01). 50 μL / well of 1× lysis buffer was added to each cell plate and lysed at room temperature for 20 minutes to obtain a lysed cell plate. 30 μL / well of lysate from the lysed cell plate was aspirated and added to an opaque 96-well assay plate. The dual-luciferase assay kit was used to prepare two substrates according to the instructions. The two substrates were added to new 96-well plates, and 30 μL / well of substrate 1 and substrate 2 were added respectively. After each addition of substrate, the assay was performed using a multi-function microplate reader to obtain numerical results for firefly luciferase and Renilla luciferase, respectively.

[0210] Renilla luciferase was detected using a microplate reader. The luminescence ratio of each well on the microplate was calculated as Renilla / Firefly. The luminescence ratio of each test or control group was the average of the luminescence ratios of three culture wells. The luminescence ratio of each test group was normalized using the luminescence ratio of the control group as a benchmark to obtain the ratio R (luminescence ratio (test) / luminescence ratio (control). This ratio represents the expression level of the Renilla reporter gene, i.e., the relative residual activity. The inhibition rate of siRNA is (1-R) ​​× 100%.

[0211] The on-target activity results are shown in Table 6 below, which show that these duplexes have inhibitory activity against RAGE expression.

[0212] Table 6: On-target activity detection of unmodified siRNA

[0213] MOCK is a blank control group containing only transfection reagent and plasmid; NC1 is a negative control siRNA, and its sequence information is shown in Table 7 below:

[0214] Table 7: NC1 sequence

[0215] Conclusion: The candidate naked sequences ranked high in terms of psiCHECK single-concentration efficacy, and the sequences that entered the next round of screening had a silencing efficiency greater than 75%, totaling 198 sequences.

[0216] Example 2: On-target activity detection of unmodified siRNA for inhibiting RAGE

[0217] The sequences with the highest inhibitory rates in Example 1 were tested for on-target activity at final siRNA concentrations of 0.01 nM, 0.1 nM, and 1 nM. The assay method used was the same as in Example 1, differing only in the final siRNA concentration. The results are shown in Table 7 below, demonstrating that these duplexes exhibited significant inhibitory activity against RAGE expression at various concentrations.

[0218] Table 8: On-target activity detection of unmodified siRNA at different concentrations

[0219] MOCK is a blank control group in which only transfection reagent and plasmid were added; NC1 is a negative control siRNA, and the sequence information is shown in Table 7 of Example 1.

[0220] Conclusion: The candidate naked sequences ranked high in the three concentrations of psiCHECK; sequences with silencing efficiencies greater than 30% at 0.01 nM, 75% at 0.1 nM, and 85% at 1 nM were retained, and a total of 57 sequences entered the next round.

[0221] Example 3: On-target activity detection of modified siRNA for inhibiting RAGE

[0222] The sequences with high inhibitory rates from Examples 1 and 2 were chemically modified in siRNA. The specific sequences are shown in Table 3. On-target activity was tested at final siRNA concentrations of 0.1 nM and 1 nM. The experimental method used was the same as that used in Example 1, except that the siRNA was different. The test results are shown in Table 9 below, demonstrating that the chemically modified duplexes exhibited significant inhibitory activity against RAGE expression at various concentrations.

[0223] Table 9: On-target activity detection of modified siRNA at different concentrations

[0224] MOCK is a blank control group in which only transfection reagent and plasmid were added; NC1 is a negative control siRNA, and the sequence information is shown in Table 19.

[0225] Conclusion: Each candidate sequence has a better effect than other modification combinations except itself; sequences with silencing efficiency greater than 60% at 0.1nM and greater than 80% at 1nM were retained for the next round, totaling 102 sequences.

[0226] Example 4: Verification of the inhibitory effect of siRNA on the target gene RAGE at the cellular level

[0227] 4.1 Single concentration test

[0228] Principle: siRNA is transfected into selected cell lines, where it interferes with and silences the target RAGE mRNA. Relative quantification is used to determine the relative expression of the RAEG target protein gene in the cells. The activity of each sequence in silencing the endogenously expressed RAGE target protein gene mRNA is analyzed.

[0229] Experimental purpose: To verify the inhibitory effect of siRNA on the target gene RAGE at the cellular level and retain the sequence with better effect.

[0230] The experimental steps are as follows:

[0231] 1. Cell Transfection

[0232] (1) Experimental reagents, as shown in Table 10.

[0233] Table 10: Experimental reagents used in the experiment

[0234] (2) Preparation before the experiment

[0235] Nanodrop was used to detect the purity and concentration of siRNA to ensure that the purity and concentration of siRNA met the requirements for subsequent screening.

[0236] (3) Cell preparation

[0237] A549 cells were obtained from the Chinese Academy of Sciences Cell Bank, and BEAS-2B cells were purchased from ProBio. A549 RAGE LV or BEAS-2B RAGE LV cells cultured in 10 cm dishes were trypsinized 48 hours after passage. A549 RAGE LV cells were resuspended in complete medium and plated at 2.8 × 10 5 / mL, BEAS-2B RAGE LV cells were expressed at 2.4×10 5 / mL, 50 μL / well, inoculated into 96-well plates for subsequent experiments.

[0238] (4) Cell transfection

[0239] The siRNA concentration was set at 1 nM; a three-concentration gradient was established: 1 nM, 0.1 nM, and IC50 concentrations were set at 10 nM, 1 nM, 0.3 nM, 0.1 nM, 0.03 nM, 0.01 nM, 0.003 nM, and 0.001 nM. The transfection reagent, lipofectamine RNAiMAX, was used at a dosage of 0.25 μL / well. After accounting for losses, the transfection complex was prepared by diluting the siRNA and lipofectamine RNAiMAX transfection reagent in 25 μL of opti-MEM per well. After incubation for 5 minutes, the two components were mixed and allowed to stand for 20 minutes.

[0240] After the resting time, the transfection complex was added to the corresponding wells at 50 μL / well, so that the final volume of each well was 100 μL.

[0241] About 12 hours after transfection, the transfection complex was discarded, 100 μl of complete culture medium was added to each well, and the cells were placed in an incubator for continued culture.

[0242] 48 h after transfection, remove the transfected 96-well plate, discard the supernatant, add 100 μL of Buffer CRL to each well, mix thoroughly, and let it stand at room temperature for 5 min.

[0243] (5) RNA extraction

[0244] 1) Plate loading

[0245] Second plate: Add lysed sample to each well, then add 400 μL of isopropanol, mix thoroughly by pipetting, and then add 20 μL of magnetic beads (use a pipette to mix the beads to avoid clumping, which reduces the adsorption efficiency of the beads).

[0246] Plate 3: Add 900 μL of Buffer CRW 0 to each well;

[0247] First plate: Add 200 μL DNase I reaction solution to each well;

[0248] Fourth plate: add 900 μL Buffer CRW 0 to each well;

[0249] Fifth plate: Add 900 μL of Buffer CRW 1 to each well;

[0250] Plate 6: Add 100 μL of DEPC water to each well.

[0251] 2) Computer program, as shown in Table 11.

[0252] Table 11: Magnetic bead-based automated extraction procedure

[0253] 3) Temporarily store RNA at 4°C and use in PCR within one day. (For long-term storage, store at -80°C.)

[0254] 2. qRT-PCR Detection

[0255] GAPDH was used as an internal reference for relative expression analysis.

[0256] (1) The primers used in the qRT-PCR assay are shown in Table 12, and the experimental reagents are shown in Table 13.

[0257] Table 12: Primers used in qRT-PCR assays

[0258] Table 13: Reagents used and their sources

[0259] (2) gDNA removal: The reaction system is shown in Table 14.

[0260] Table 14: Reaction system

[0261] 20 μL of the reaction solution was placed at 37°C for 15 min to remove genomic DNA, and then 2 μL of EDTA was added.

[0262] (3) PCR reaction system, as shown in Table 15

[0263] Table 15: PCR reaction system

[0264] (4) PCR reaction procedure, as shown in Table 16.

[0265] Table 16: PCR reaction program

[0266] The experimental results are as follows:

[0267] Table 17: Comparison of candidate sequences and different modifications

[0268] Summary of all sequences:

[0269] Table 18: Summary results of all sequences

[0270] MOCK is a blank control group in which only transfection reagent and plasmid were added; NC5 is a negative control siRNA, and the sequence information is shown in Table 4; BLANK: no substance was added.

[0271] Note: NC1 is a meaningless, naked sequence that serves as a negative reference for naked sequences in psiCHECK experiments and is also used in subsequent psiCHECK modified sequence screening. NC5 is a modified, meaningless sequence. Given that all screened sequences in the cell line contain modifications, NC5 is used as a negative reference for all cell-based experiments. See Table 19 for the sequences of NC1 and NC5.

[0272] Table 19: NC series sequence

[0273] Conclusion: Sequences with A549 RAGE LV silencing efficiency greater than 90% and BEAS-2B RAGE LV silencing efficiency greater than 80% were selected to enter the next round: GPSZRA222S1, GPSZRA222S3, GPSZRA222S4, GPSZRA227S1, GPSZRA227S2, GPSZRA227S3, GPSZRA227S4, GPSZRA227S5, GPSZRA228S5, GPSZRA231S1, GPSZRA231S2, GPSZRA231S3, GPSZRA231S4, GPSZRA2 31S5, GPSZRA233S1, GPSZRA233S2, GPSZRA233S3, GPSZRA233S4, GPSZRA233S5, GPSZRA267S2, GPSZRA267S3, GPS ZRA267S5, GPSZRA271S1, GPSZRA271S2, GPSZRA271S3, GPSZRA271S4, GPSZRA271S5, GPSZRA282S4, GPSZRA284S2 , GPSZRA284S3, GPSZRA284S4, GPSZRA284S5, GPSZRA287S4, GPSZRA287S5, GPSZRA301S2, GPSZRA314S1, GPSZRA 314S2, GPSZRA314S3, GPSZRA314S4, GPSZRA314S5, GPSZRA318S2, GPSZRA318S3, GPSZRA318S4, GPSZRA318S5, GP SZRA381S1, GPSZRA381S2, GPSZRA381S3, GPSZRA402S1, GPSZRA402S2, GPSZRA402S3, GPSZRA402S4, GPSZRA402S5, GPSZRA407S1, GPSZRA407S2, GPSZRA407S4, GPSZRA410S1, GPSZRA410S2, GPSZRA410S3, GPSZRA410S4, a total of 59 items.

[0274] 4.2 Second concentration test

[0275] The 59 sequences screened in 4.1 were subjected to the next round of screening. The experimental steps were the same as 4.1, except that the screening was performed at two concentrations, 0.1 nM and 1 nM.

[0276] The experimental results are shown in Table 19.

[0277] Table 19: Summary results of two-concentration test sequence

[0278] MOCK is a blank control group in which only transfection reagent and plasmid were added; NC5 is a negative control siRNA, sequence information of which is shown in Table 19; BLANK: no substance was added.

[0279] Conclusion: The top 50% of sequences ranked in potency at these concentrations advanced to the next round: GPSZRA222S1, GPSZRA222S3, GPSZRA222S4, GPSZRA227S1, GPSZRA227S4, GPSZRA227S5, GPSZRA233S4, GPSZRA267S2, GPSZRA284S3, GPSZRA287S4, GPSZRA314S1, GPSZRA314S2, GPSZRA314S3, GPSZRA314S4, GPSZRA314S5, GPSZRA314 S5, GPSZRA318S2, GPSZRA318S3, GPSZRA318S4, GPSZRA381S2, GPSZRA381S3, GPSZRA402S1, GPSZRA402S2, GPSZRA402S4, GPSZRA402S5, GPSZRA407S2, GPSZRA407S4, GPSZRA410S1, GPSZRA410S2, GPSZRA410S4, a total of 29 items.

[0280] Example 5: IC50 test

[0281] Conduct cell line IC50 tests and determine the final candidate sequences based on the absolute IC50 values.

[0282] Experimental principle: Using GraphPad software, set the X-axis to log (concentration) and the Y-axis to inhibition rate, and use "nonlinear regression" to fit the IC50 curve. The curve equation is "Y = Bottom + (Top - Bottom) / (1 + 10 ((LogIC50 - X) * HillSlope))". In the formula, Bottom is the minimum inhibition rate, Top is the maximum inhibition rate, HillSlope is the slope of the curve, and LogIC50 is the logarithm of IC50 (half-inhibitory concentration).

[0283] Experimental purpose: Conduct IC50 test on cell lines and determine the final candidate sequence based on the absolute IC50 value.

[0284] The test results are shown in Tables 20 and 21.

[0285] Table 20: Naked sequences of siRNA sequences involved in IC50 tests

[0286] Table 21: IC50 results

[0287] Results: The sequences with IC50 values ​​less than 30 in A549 RAGE LV or less than 65 in BEAS-2B RAGE LV were selected and retained: GPSZRA222S1, GPSZRA222S3, GPSZRA222S4, GPSZRA227S1, GPSZRA267S2, GPSZRA284S3, GPSZRA314S1, GPSZRA314S2, GPSZRA314S3, GPSZRA314S5, GPSZRA318S2, GPSZRA402S4, GPSZRA402S5, a total of 13 sequences.

[0288] Example 6: Stability Test

[0289] Experimental Principle: After entering the human body, siRNA travels through the bloodstream and various tissues and organs before ultimately entering cells to exert its silencing effect. During this transport process, numerous environmental factors can affect siRNA stability, such as human serum and ubiquitous RNases, as well as the presence of various tissue metabolites and enzymes. This stability directly impacts siRNA activity in vivo. This experiment examines siRNA stability by simulating three in vitro environments: RNase, serum, and tissue metabolic enzymes (S9).

[0290] Experimental purpose: To test the stability of candidate sequences in RNase, human serum, and Human Lung S9 in vitro.

[0291] Experimental steps:

[0292] (1) Preparation of RNase A solution: Take the solutions and reagents in Table 22 in sequence and add pure water to 10 mL to obtain a 10 mg / mL stock solution. Store at 4°C until ready for use.

[0293] Table 22: RNase A solution preparation

[0294] 5 μL siRNA (10 μM) was aspirated, 1 μL RNase A (0.1 mg / ml) and 4 μL water were added, and 6 tubes were prepared for each group. The tubes were treated in a 37°C water bath at different reaction times of 1 min, 15 min, 30 min, 60 min, 120 min, and 240 min (the actual time gradient is subject to the experimental results chart). After treatment, the tubes were quickly frozen with liquid nitrogen and stored at -80°C.

[0295] (2) Serum stability

[0296] The reaction system was prepared as shown in Table 23. Five tubes were prepared for each group and treated in a 37°C water bath for different reaction times of 1 min, 3 h, 6 h, 24 h, and 48 h (the actual time gradient is subject to the experimental results diagram). After treatment, the tubes were quickly frozen with liquid nitrogen and stored at -80°C.

[0297] Table 23: Serum stability addition status table

[0298] (3)S9 stability

[0299] 5 μL siRNA (10 μM) was aspirated, 1 μL Human Lung S9 (5 mg / mL) and 4 μL incubation solution (125 mM Tris·HCl, 7.5 mM MgCl2, 2.5 mM EDTA, the formula is shown in Table 24 below) were added. Six tubes were prepared for each group and treated in a 37°C water bath for different reaction times of 1 h, 3 h, 6 h, 24 h, 48 h, and 72 h (the actual time gradient is subject to the experimental results figure). After treatment, the cells were quickly frozen with liquid nitrogen and stored at -80°C.

[0300] Table 24: S9 incubation solution formula (100 mL)

[0301] (4) siRNA gel analysis

[0302] Use a 20% PAGE gel and run at 200 V and 400 A for 55 minutes, then take photos and analyze. Serum samples were diluted with DEPC water according to the ratios listed above before loading.

[0303] (5) Experimental results

[0304] 1) The results of the RNase assay are shown in Figures 1A-1G and Table 25.

[0305] Table 25: Grayscale results of RNase stability gel run

[0306] The number plus UM indicates the unmodified sequence.

[0307] 2) Serum stability. The experimental results are shown in Figures 2A-2F and Table 26.

[0308] Table 26: Grayscale results of serum stability gel run

[0309] The number plus UM indicates the unmodified sequence.

[0310] 3) S9 stability. The experimental results are shown in Figures 3A-3G and Table 27.

[0311] Table 27: S9 stability run grayscale results

[0312] The number plus UM indicates the unmodified sequence.

[0313] Conclusion: The stability of siRNA is indicated by the decrease in grayscale over time. The slower the grayscale decreases, the more stable the siRNA. The results showed that GPSZRA222S1, GPSZRA222S3, GPSZRA222S4, GPSZRA227S1, GPSZRA267S2, GPSZRA284S3, GPSZRA314S1, GPSZRA314S2, GPSZRA314S3, GPSZRA314S5, GPSZRA318S2, GPSZRA402S4, and GPSZRA402S5, a total of 13 test sequences, showed good stability in vitro against RNase, serum, and S9 compared to their corresponding unmodified sequences.

[0314] Example 7: IC50 test after adding VP modification

[0315] In order to further enhance the inhibitory activity of siRNA, we modified the siRNA obtained in Example 6 with VP and tested the IC50 of the modified siRNA.

[0316] The experimental steps and methods are shown in Example 5.

[0317] The experimental results are shown in Tables 28 and 29.

[0318] Table 28: Naked siRNA sequences used in this experiment

[0319] Table 29: siRNA inhibitory activity after VP modification

[0320] Results: After VP modification, the inhibitory activity of siRNA was significantly enhanced.

[0321] Example 8: ELISA test to verify the in vitro inhibitory effect of siRNA on RAGE protein

[0322] Experimental principle: The expression of target protein is positively correlated with its mRNA level. The ELISA kit is used to detect the intracellular and extracellular protein expression of RAGE after cell transfection with siRNA, which directly reflects its in vitro efficacy.

[0323] Experimental purpose: To verify the in vitro inhibitory effect of siRNA sequence on RAGE protein. The supernatant contains sRAGE (RAGE protein free outside the cell) and the cell lysate contains fRAGE (RAGE protein located on the cell membrane).

[0324] Experimental steps:

[0325] (1) Experimental reagents are shown in Table 30

[0326] Table 30: Experimental reagents used in ELISA

[0327] (2) Sample preparation

[0328] Supernatant: 48 hours after cell transfection, directly aspirate the supernatant and freeze it in a -80℃ refrigerator.

[0329] Lysis buffer: 48 hours after transfection, cells were washed twice with 100 μL PBS and 100 μL M-PER lysis buffer (containing 1× Halt TM Protease Inhibitor Cocktail), pipette five times, and store in a -80℃ freezer.

[0330] (3) Preparation of relevant solutions for the experiment

[0331] Wash Buffer: Return the Wash Buffer concentrate to room temperature, mix gently until the crystals dissolve, and dilute the Wash Buffer concentrate 1:25 with deionized or distilled water.

[0332] Substrate Solution: Color Reagents A and B should be mixed in equal volumes within 15 minutes of use. Protect from light.

[0333] Standard preparation: After the standard powder in the kit returns to room temperature, refer to the labeled bottle and reconstitute it with deionized or distilled water. Mix gently and dissolve it fully for 15 minutes before use. This reconstitution produces a 50,000 pg / mL stock solution, which should be stored at 4°C.

[0334] Transfer 900 μL of calibrator diluent RD5-5 to the 5000 pg / mL tube. Transfer 500 μL of calibrator diluent to the remaining tubes. Add 100 μL of the standard stock solution to the 5000 pg / mL tube and mix thoroughly. Then, add 500 μL to the 2500 pg / mL tube and mix thoroughly. Repeat this step to obtain standard solutions of 5000 pg / mL, 2500 pg / mL, 1250 pg / mL, 625 pg / mL, 313 pg / mL, 156 pg / mL, and 78 pg / mL.

[0335] (4) Detection experiment process

[0336] 1) Remove the multi-month microplate strips from the well plate, return them to the foil bag containing the desiccant, and reseal.

[0337] 2) Add 100 μL of assay diluent RD1-60 to each well.

[0338] 3) Dilute the sample to be tested with diluent RD5-5 according to the specified dilution ratio. Add 50 μL of the standard, control, or sample to each well according to the layout. Cover with the provided adhesive strips. Incubate at room temperature for 2 hours.

[0339] 4) Aspirate and wash each well, 4 times with 400 μL per well. After the final wash, invert the plate and blot dry with a clean paper towel.

[0340] 5) Add 200 μL of Human RAGE Conjugate to each well. Cover with a new gel strip. Incubate at room temperature for 2 hours.

[0341] 6) Repeat the above steps for washing.

[0342] 7) Add 200 μL of substrate solution to each well and incubate at room temperature for 30 minutes, avoiding direct light.

[0343] 8) Add 50 μL of stop solution to each well, gently shake the plate to mix the liquid, and then test immediately.

[0344] 9) Immediately measure the absorbance of each well using a microplate reader set at a wavelength of 450 nm.

[0345] 10) Immediately measure the absorbance of each well using a microplate reader set at a wavelength of 570 nm.

[0346] The experimental results are shown in Tables 31 to 34.

[0347] Table 31: Inhibition rate of siRNA on A549 RAGE LV supernatant

[0348] Table 32: Inhibition rate of siRNA on A549 RAGE LV lysate

[0349] Table 33: Inhibition rate of siRNA on BEAS-2B RAGE LV supernatant

[0350] Table 34: Inhibition rate of siRNA on BEAS-2B RAGE LV lysate

[0351] Results: The modified siRNA of the present application has a very strong inhibitory effect on both sRAGE and fRAGE proteins.

[0352] Summary: The inhibition data of the screening sequences with superior activity are summarized in Table 35.

[0353] Table 35: Summary of inhibitory data for screening sequences with superior activity

[0354] Results: As shown in Table 35, GPSZRA222S1, GPSZRA222S3, GPSZRA222S4, GPSZRA227S1, GPSZRA267S2, GPSZRA284S3, GPSZRA314S1, GPSZRA314S2, GPSZRA314S3, GPSZRA314S5, GPSZRA318S2, GPSZRA402S4, GPSZRA402S5, a total of 13 sequences, and the corresponding 13 VP modifications (GPSZRA222S1-VP, GPSZRA222S3-VP, GPSZRA222S4-VP, G The on-target activity of siRNAs directed against the corresponding naked sequences (GPSZRA222, GPSZRA267, GPSZRA284, GPSZRA314, GPSZRA318, GPSZRA402) was excellent in inhibiting the target gene RAGE in A549 RAGE LV cells and BEAS-2B RAGE LV cells, and the activity was further enhanced with increasing modifications.

[0355] Example 9: Stability Test

[0356] The purpose of this experiment is to test the stability of siRNA modified with VP. The experimental steps are shown in Example 6.

[0357] Experimental results:

[0358] (1) RNase stability. The experimental results are shown in Figures 4A-4C and Table 36.

[0359] Table 36: Grayscale results of RNase stability gel run

[0360] Sequences plus UM indicate unmodified siRNA sequences.

[0361] (2) Serum stability. The experimental results are shown in Figures 5A-5C and Table 37.

[0362] Table 37: Grayscale results of serum stability gel run

[0363] Sequences plus UM indicate unmodified siRNA sequences.

[0364] (3) The results of the S9 stability experiment are shown in Figures 6A-6C and Table 38.

[0365] Table 38: S9 stability run grayscale results

[0366] Sequences plus UM indicate unmodified siRNA sequences.

[0367] Conclusion: siRNA stability is indicated by the decrease in grayscale over time; the slower the grayscale decreases, the more stable the siRNA. The results show that siRNA sequences with different modification patterns still have excellent RNase stability, serum stability, and human lung S9 stability after further addition of VP modification.

[0368] Example 10: Cytotoxicity

[0369] Principle: The CCK-8 assay is a method for measuring cell proliferation and cytotoxicity. It utilizes dehydrogenases within mitochondria to reduce WST-8 in the CCK-8 reagent to a colored formazan product. The dehydrogenase content is measured by measuring the OD at 450 nm, indirectly measuring cell proliferation activity at that time. The CCK-8 assay after siRNA transfection can assess whether the siRNA has cytotoxic effects on cells.

[0370] Experimental purpose: To test the cytotoxicity of modified siRNA to A549 RAGE LV (A549 cells overexpressing RAGE) or BEAS-2B RAGE LV (BEAS-2B cells overexpressing RAGE) cells.

[0371] The CCK8 cell proliferation curve was used to verify whether the sequence pair had cytotoxicity.

[0372] Experimental steps:

[0373] (1) Experimental reagents

[0374] Table 39: Sources of experimental reagents used

[0375] (2) Cell preparation

[0376] A549 RAGE LV (A549 cells overexpressing RAGE) or BEAS-2BRAGE LV (BEAS-2B cells overexpressing RAGE) cells cultured in 10 cm culture dishes were routinely trypsinized 48 h after passage. The cells were resuspended in complete medium and then plated at the corresponding cell number of 1.4 × 10 4 / hole or 1.2×10 4 / well, 50 μL / well was inoculated into a 96-well plate (transfection complex was added after cells were plated into the cell plate), and 100 μL PBS was added to the peripheral wells to prevent the edge wells from being affected for subsequent experiments.

[0377] (3) Cell transfection

[0378] A total of 9 sequences were included, with NC1, MOCK, BLANK, and complete culture medium serving as controls. The MOCK group received only the interfering reagent without any other sequences; the BLANK group received only cells. NC1 is a negative control siRNA; see Table 7 in Example 1 for sequence information.

[0379] A siRNA concentration gradient was established for transfection: 10nM, 1nM, 0.1nM, and 0.01nM. The transfection reagent, lipofectamine RNAiMAX, was used at a dosage of 0.25μL / well. After accounting for losses, the transfection complex was prepared by diluting the siRNA and lipofectamine RNAiMAX transfection reagent in 25μL of opti-MEM per well. After incubation for 5 minutes, the two components were mixed and allowed to stand for 20 minutes.

[0380] After the resting time, the transfection complex was added to the corresponding wells at 50 μL / well, so that the final volume of each well was 100 μL.

[0381] About 6 hours after transfection, the transfection complex was discarded by aspiration and the reading at 0 hours was measured.

[0382] At other time points, 100 μL of complete culture medium was added to each well and the cells were placed in the incubator and cultured for 1 h.

[0383] (4) Cell testing

[0384] After 24 and 48 hours, the cell plates were removed and a mixture of 10 μl of CCK-8 solution and 90 μl of blank culture medium was added to each well. The CCK8 reading of the blank wells of each 96-well plate with complete culture medium was used as the background.

[0385] After the culture plate was incubated in an incubator for 4 hours, the absorbance at 450 nm was measured using a microplate reader.

[0386] Experimental results:

[0387] (1) Cytotoxicity of modified siRNA to A549 RAGE LV. The experimental results are shown in Figures 7A-7I and Table 40.

[0388] Table 40: Cytotoxicity of modified siRNA against A549 RAGE LV

[0389] The MOCK group was treated with only the interfering reagent without any other sequence; the BLANK group was treated with cells alone. NC5 was a negative control siRNA, and its sequence information is shown in Table 19 of Example 4.

[0390] (2) Cytotoxicity of modified siRNA against BEAS-2B RAGE LV. The experimental results are shown in Figures 8A-8I and Table 41.

[0391] Table 41: Cytotoxicity of modified siRNA against BEAS-2B RAGE LV

[0392] The MOCK group was treated with only the interfering reagent without any other sequence; the BLANK group was treated with cells alone. NC5 was a negative control siRNA, and its sequence information is shown in Table 19 of Example 4.

[0393] Conclusion: The toxicity of a total of 9 sequences, including GPSZRA314S1-VP, GPSZRA314S2-VP, GPSZRA314S3-VP, GPSZRA314S5-VP, GPSZRA402S4-VP, GPSZRA402S5-VP, GPSZRA222S3-VP, GPSZRA222S4-VP, and GPSZRA318S2-VP, to A549 RAGE LV and BEAS-2B RAGE LV cells had no significant difference from that of BLANK, MOCK, and negative references, and therefore had no cytotoxicity to these cells.

[0394] Example 11: Immunotoxicity

[0395] Principle: PBMCs are a mixture of various immune cells, key components of both the innate and adaptive immune systems. When stimulated by external pathogens, PBMCs induce a series of immune responses, ultimately producing interferons and cytokines. By co-incubating siRNA with PBMCs and measuring the expression of representative downstream cytokines and interferons, the siRNA's immunotoxicity can be determined.

[0396] Experimental purpose: Sequence transfection into PBMC cells, detection of downstream immune response-related molecules, and verification of whether the sequence has immunotoxicity.

[0397] In this experiment, PHA is used as a phytohemagglutinin, which can be used as a positive drug to stimulate immune cells to produce an immune response and induce the expression of cytokines; Poly IC is a double-stranded RNA analog that can induce the expression of interferon and verification factors; Donor is the donor of PBMC cells, and Donor1, Donor2, and Donor3 represent three different healthy people. This experiment first isolates PBMCs from the donors, and then transfects the PBMC cells with modified siRNA to detect downstream immune response-related molecules and verify whether the sequence has immunotoxicity.

[0398] Experimental steps:

[0399] (1) Experimental reagents, see Table 42.

[0400] Table 42: Sources of experimental reagents

[0401] (2) Cell preparation

[0402] Isolation of PBMC cells:

[0403] Prepare three donor blood samples. Take three 15 mL centrifuge tubes (marked with serial numbers), pour the blood into (about 2 mL), add 2 mL of PBS, and mix thoroughly by inversion.

[0404] Prepare three more 15 mL centrifuge tubes, add 3 mL of blood cell separation solution, slowly transfer the mixed blood sample into the tube with a gun, and centrifuge in a low-temperature centrifuge with parameters of 2000 rpm, 20 min, 4°C, acceleration 9, and deceleration 6;

[0405] Prepare three more 15 mL centrifuge tubes, add 4 mL of PBS, aspirate 2 mL of the membrane between the upper yellow layer and the middle white layer after centrifugation (this is the cell), and centrifuge in a low-temperature centrifuge with parameters of 1500 rpm, 10 min, 4°C, acceleration 9, and deceleration 9;

[0406] Discard the supernatant, add 2 mL of PBS to wash, without resuspending the pellet, and centrifuge again using the same parameters as above;

[0407] Discard the supernatant, add 300 μL 1640 to resuspend, take three 1.5 mL EP tubes, add 180 μL PBS, take 20 μL of cell suspension and mix well (dilute 10 times), and count with a cell counter;

[0408] Then 2×10 6 cell / mL, and 50 μL / well was inoculated into a 96-well plate for subsequent transfection experiments.

[0409] (3) Cell transfection

[0410] There are 7 sequences in total, and PHA, Poly IC, Inclisiran, MOCK, and complete culture medium are used as controls. The MOCK group is the group that only adds interfering reagents without any sequences.

[0411] Final siRNA concentration: 100 nM; final poly IC concentration: 2 μg / ml.

[0412] Preparation of siRNA diluent: Take 1 μL of 10 μM siRNA stock solution and add 12.5 μL of DNA diluent B and mix well;

[0413] Preparation of Poly IC diluent: Take 1 μL of 0.2 μg / μL Poly IC solution and add 12.5 μL DNA diluent B and mix well;

[0414] Preparation of GenePORTER2 dilution: 1.75 μL GenePORTER2 dissolved in 7 μL opti-MEM;

[0415] Preparation of transfection complex: Mix siRNA dilution or Poly IC dilution with GenePORTER2 dilution respectively and incubate at room temperature for 5-10 minutes;

[0416] When the incubation time is up, add 22.25 μL / well of the transfection complex to the corresponding wells, add the corresponding siRNA, and then supplement with culture medium to make the final volume of each well 100 μL;

[0417] Note: PHA does not require transfection reagent. Directly take 15 μL and mix with the cell suspension, and add culture medium to a final volume of 100 μL.

[0418] About 48 h after transfection, the cell supernatant was collected for subsequent immunogenicity detection experiments.

[0419] (4) Immunogenicity testing

[0420] Place 2 mL of calibrant into a centrifuge tube and mark it as the highest concentration;

[0421] Add 2 mL of sample diluent and let stand at room temperature for 15 min (use within 4 h);

[0422] Use a pipette to gently pipette for 30 seconds, avoiding violent shaking and avoiding air bubbles;

[0423] Take 11 sample tubes, label them as 1:2, 1:4, 1:8, 1:16, 1:32, 1:64, 1:128, 1:256, 1:512, 1:1024, 1:2048, and add 300 μL of sample diluent to each tube (use within 4 hours);

[0424] Take 300 μL of the highest concentration and add it to the 1:2 tube, pipette and mix thoroughly, take 300 μL of the 1:2 tube and add it to the 1:4 tube, and so on, up to the 1:2048 tube;

[0425] Calculate the total number of samples (33 samples, 11 calibrators, and 1 negative control) and the amount of capture microsphere mixture required (25 μL / portion) based on the total number of samples;

[0426] The capture microsphere mixture was pipetted for 30 seconds, the required amount of capture microsphere mixture was aspirated, and the mixture was centrifuged at 200g for 5 minutes at a low speed. The supernatant was carefully aspirated, and an equal volume of microsphere buffer was added. After pipetting, the mixture was incubated in the dark for 15-30 minutes.

[0427] Add 25 μL of fluorescence detection reagent to each experimental tube;

[0428] Add 25 μL of the serially diluted calibrator to the calibrator tube and 25 μL of the sample to be tested to the sample tube, and vortex to mix.

[0429] After incubation, the capture microsphere mixture was pipetted for 30 s, 25 μL was added to each experimental tube, and shaken;

[0430] After operation, incubate at room temperature in the dark for 2.5-3h;

[0431] Add 1 mL of washing solution to each experimental tube and centrifuge at 200 g for 5 minutes. Pour out the liquid in the tube and absorb the remaining liquid at the tube mouth with paper.

[0432] Add 200 μL of washing solution to each experimental tube, place it away from light, and wait for detection;

[0433] The experimental tubes were loaded onto the machine in the order of calibrators (from small to large concentrations), negative controls (25 μL microspheres + 300 μL washing solution), and experimental samples. Each experimental tube was vortexed for 3-5 seconds and then immediately loaded onto the machine for testing.

[0434] The experimental results are shown in Figures 9A to 9K and Tables 43 and 44 below. Compared with the MOCK group, PHA activated cytokines TNF-α, interferon IFN-α, IL-1β, IL-2, IL-4, IL-5, IL-6, IL-10, IL-12P70, IL-17, and IFN-γ, while the test sequence did not lead to significant upregulation of these cytokines.

[0435] Tables 43 and 44 summarize the experimental results by calculating the average of the three donor values.

[0436] Table 43: Cellular immune response induced by modified siRNA

[0437] As shown in Table 43, compared with the MOCK group, the secretion of IFN-α, IL-1β, IL-2, IL-4, IL-5, and IL-6 was increased by stimulation of PHA or Poly IC, while the siRNA treatment group had no significant effect.

[0438] Table 44: Cellular immune response induced by modified siRNA

[0439] As shown in Table 44, compared with the MOCK group, the secretion of IL-10, IL-12P70, IL-17, IFN-γ, and TNF-α was increased by PHA stimulation, while the siRNA treatment group did not lead to increased secretion of these factors.

[0440] Conclusion: GPSZRA314S1-VP, GPSZRA314S2-VP, GPSZRA314S3-VP, GPSZRA314S5-VP, GPSZRA402S4-VP, and GPSZRA402S5-VP, a total of 6 sequences, have no immunotoxicity.

[0441] Example 12: PSICHECK off-target testing

[0442] Experimental Principle: In some cases, siRNA may downregulate non-target genes whose 3'-untranslated regions of certain transcripts are complementary to the guide strand seed region (nucleotides 2-8). This off-target effect, whose regulatory mechanism is similar to the target silencing mechanism of miRNA, is referred to as miRNA-like off-target. Furthermore, other types of siRNA off-target effects may be due to the loading of the sense strand within the RNA-induced silencing complex, i.e., sense strand off-target. To simultaneously investigate the risk of miRNA-like off-target, sense strand off-target, and sense strand seed region off-target, we designed three off-target plasmids: GSSM (antisense seed region off-target plasmid), PSCM (sense strand off-target plasmid), and PSSM (sense seed region off-target plasmid), as well as a positive target plasmid (GPSZRA). These plasmids were co-transfected with siRNA into 293T cells and the presence of off-target risk was assessed by the silencing efficiency.

[0443] Experimental purpose: To evaluate the off-target risks of candidate sequences and VP modifications in vitro using the psiCHECK system, including the off-target risks of the antisense strand seed region, the sense strand off-target risk, and the sense strand seed region off-target risk.

[0444] Experimental steps:

[0445] (1) Experimental reagents are shown in Table 45.

[0446] Table 45: Experimental reagents used in the experiment

[0447] (2) Cell preparation

[0448] The conventionally cultured 293T cells were digested with trypsin and resuspended in complete medium to adjust the cell concentration to 1×10 6 / mL for subsequent experiments.

[0449] (3) Cell transfection

[0450] 1) Dilution of transfection reagent

[0451] Based on the actual number of wells to be transfected and taking into account losses, dilute the transfection reagent with Opti-MEM and add it to a 96-well plate (transfection reagent + RNA plate) using a dispenser so that each well contains 130 μL Opti-MEM and 1.2 μL Lipofectamine 2000 transfection reagent. This is the transfection reagent dilution plate.

[0452] 2) Dilution of siRNA (RNA oligo)

[0453] Dissolve siRNA: Add 1OD to 250μL DEPC water. The siRNA concentration is now 10μM and can be stored at -20°C until ready for use. Prepare siRNA according to the desired siRNA concentration. For example, if 10nM siRNA is required, pipette 4μL of 10μM siRNA into 196μL opti-MEM water for a 200nM siRNA concentration. Dilute the 200nM siRNA to 20nM. Add 20μL / well of the prepared siRNA to a 96-well plate (transfection reagent + RNA plate) according to the siRNA distribution on the plate.

[0454] 3) Plasmid dilution

[0455] According to the distribution of siRNA on the well plate, take the corresponding plasmid, dilute it with Opti-MEM according to the number of wells and taking into account loss, mix it thoroughly, and then add it to a 96-well plate (arranged according to the well position of the corresponding siRNA) so that each well contains 80ng of plasmid in 50μL Opti-MEM. This is the plasmid dilution plate.

[0456] 4) Transfection

[0457] Use a dispenser to dispense plasmids according to the "plasmid plate" and pipette 50 μL of plasmid into each well and add it to the corresponding "transfection reagent + RNA plate" to obtain 200 μL / well of transfection complex. Let it stand for about 20 minutes. Using the fully automated liquid handling system to run the program, pipette 50 μL / well of the transfection reagent complex (containing 200 μL / well of transfection complex) and add it to three cell replicate plates. Then add 50 μL of the cells in 6.1 to each well and place them in the incubator.

[0458] 5) Cell lysis assay

[0459] Remove the cell plate from the CO2 incubator and discard 20 μL of the original cell culture medium using a liquid handling station.

[0460] Add L in the kit to a new 96-well plate, run the program on the fully automatic liquid workstation, and complete the addition of 75 μL / well of Incubate the plate with Luciferase Reagent at room temperature for 20 minutes. Run the program on an automated liquid handling system and transfer 75 μL of the lysate to a white plate. Detect Firefly luciferase using a microplate reader and read the Firefly fluorescence using a multi-function microplate reader.

[0461] Use the fully automated liquid handling station to run the program, i.e. add 75 μL of Stop& Reagent. Detect Renilla luciferase using a microplate reader.

[0462] The results are shown in Tables 46 to 49 below.

[0463] Table 46: siRNA sequence positive target plasmid (GPSZRA) inhibition efficiency

[0464] Table 47: Off-target plasmid inhibition efficiency of the antisense strand seed region of siRNA sequences

[0465] Table 48: SiRNA sequence sense strand off-target plasmid inhibition efficiency

[0466] Table 49: Off-target plasmid inhibition efficiency of the siRNA sequence sense strand seed region

[0467] Conclusion: The modified siRNA has a very high on-target rate and an acceptable off-target rate, making it suitable as a candidate molecule for drugs.

[0468] Example 13: In vivo activity detection

[0469] This experiment was designed to test the efficiency of siRNA in knocking out RAGE mRNA and protein in mice.

[0470] In vivo activity assay in RAGE humanized (CDS region) homozygous / RAGE humanized (CDS+3'UTR region) heterozygous mice

[0471] (1) In vivo administration: Commercial RAGE homozygous / heterozygous mice. In the in vivo experiment, each group consisted of 3-4 male mice, 6-8 weeks old. 3 mg / kg of candidate siRNA molecules were delivered to the lungs via a nebulizer needle airway administration, with a nebulization volume of 50 μl each time. Mice were anesthetized and killed after 11 or 15 days of treatment. The alveolar lavage fluid (BALF) was first collected with pre-chilled PBS, and the supernatant was centrifuged to measure the RAGE protein expression level. After perfusion, lung tissue was obtained and frozen for detection of RAGE expression at the mRNA and protein levels.

[0472] (2) RNA expression detection: After removing the lung tissue from the body, quickly freeze it in liquid nitrogen and then store it in a -80℃ freezer for long-term storage. Use a disposable blade to cut the fresh or ultra-low temperature frozen sample into 20-40mg blocks and add them to a 1.5ml sterilized tube, and quickly place it in liquid nitrogen. Add the prepared tissue lysis buffer according to the instructions of TaKaRa MiniBEST Universal RNA Extraction Kit (Takara: 9767), and add magnetic beads to homogenize on a tissue homogenizer. After homogenization, perform the subsequent RNA extraction steps according to the instructions. Use One Step PrimeScript TM Gene expression was detected using an RT-PCR Kit (Takara: RR064A). Real-time PCR was performed using the ABIQS5 Real-Time PCR System using the ΔΔCt method. Three replicate wells were used for each mouse lung tissue sample. The results of the in vivo duplex activity assay are shown in Tables 50-54 below.

[0473] TRiM delivery is the name given to the siRNA delivery system developed by Arrowhead. siRNA has a large molecular weight and strong hydrophilicity, making it difficult to penetrate into cells. In order to deliver siRNA to specific tissue cells, a specific small molecule target head is coupled to the end of the positive strand of the siRNA through a linker with a specific structure. The small molecule target head can specifically bind to a specific receptor (integrin αvβ6) on the target tissue cells, mediate the internalization of the siRNA coupled with the small molecule target head, enter the cell, and further initiate the RNA interference process to exert the drug effect.

[0474] (3) Protein expression detection: After anesthesia, mice were perfused with pre-cooled PBS to obtain alveolar lavage fluid. The samples were centrifuged at 12000 rpm for 15 min at 4°C, and the supernatant was collected for protein quantification (Pierce TMBCA Protein Assay Kits (Thermo-23225). The obtained lung tissue was cut into small pieces, 30-50 mg / tube was weighed on a balance, and the pieces were washed twice with pre-cooled PBS. RIPA (containing PMSF) lysis buffer was added, and magnetic beads were added and vortexed 3 times. Then, the pieces were centrifuged at 4°C and 14000g for 5 minutes to precipitate tissue or cell fragments. The supernatant was transferred as total tissue protein, aliquoted and stored at -80°C. Human RAGE ELISA KIT (R&D-DRG00) was used to detect RAGE protein expression. Two replicate wells were used for each mouse lung tissue sample. The results of the in vivo activity test of the duplex are shown in Tables 50 to 54 below.

[0475] Table 50: Knockdown of RAGE mRNA and protein activity in RAGE humanized (CDS region) homozygous mice 15 days after aerosolized airway administration of GPSZRA314S1-VP, GPSZRA314S2-VP, GPSZRA314S3-VP (TRiM delivery)

[0476] Table 51: Knockdown of RAGE mRNA and protein activity in mice homozygous for humanized RAGE (CDS region) 15 days after aerosolized airway administration of 314S5-VP (TRiM delivery)

[0477] Table 52: GPSZRA222S4-VP, GPSZRA318S2-VP (TRiM delivery) knockdown of RAGE mRNA and protein activity in RAGE humanized (CDS region) homozygous mice 15 days after aerosolized airway administration

[0478] Table 53: GPSZRA233S4-VP, GPSZRA222S3-VP (TRiM delivery) knockdown of RAGE mRNA and protein activity in RAGE humanized (CDS region) homozygous mice 15 days after aerosolized airway administration

[0479] Table 54: Knockdown of RAGE mRNA and protein activity in RAGE humanized (CDS + 3'UTR region) heterozygous mice 11 days after aerosolized airway administration of 402S4-VP (TRiM delivery)

[0480] Results: This in vivo experiment showed that VP-modified siRNA could effectively reduce RAGE mRNA and protein expression in mice.

[0481] Example 14: In vivo activity detection in cynomolgus monkeys

[0482] This experiment was designed to test the efficiency of siRNA in knocking down RAGE protein in cynomolgus monkeys.

[0483] Experimental methods:

[0484] (1) Animal enrollment: A physical examination of the coat, limbs, mouth, and nose of one randomly selected male and one female cynomolgus macaque was performed, along with a check of basic physiological functions. If no abnormalities were found after the examination, the animal was placed in a cage and a two-week animal acclimatization period began.

[0485] (2) In vivo administration: Two cynomolgus monkeys were fasted for at least 3 hours before administration. After anesthetizing the animals with Zota (5 mg / kg), endotracheal intubation was performed. The animals were kept in a supine position, and the spray tip of a high-pressure sprayer was passed through the endotracheal tube into the trachea. The test siRNA molecules were sprayed into the trachea at a dose of 1.2 mg / kg. After administration, the animals were kept in a semi-recumbent position and returned to the cage after waking up.

[0486] siRNA was also delivered using TRiM, as described in Example 13.

[0487] (3) BALF sample collection: Before BALF sample collection, the animals must fast for more than 3 hours. After anesthetizing the animals with Zotazone (5 mg / kg), 5 mL of saline was injected into the right lower lung using a bronchoscope. The animal's posture was gently changed to allow the saline to lavage the bronchi, and then the injected saline was aspirated as much as possible. The BALF supernatant and cells were separated by centrifugation (2000 × g, 4°C, 5 minutes). The supernatant was the BALF sample and stored at -80°C. The cells were discarded. The end time of tracheal administration was Day 0 (D0), 0h. The BALF collection time points were before D0 administration, D7, D14, D21, D28, D35, D42, D49, and D56. All samples were frozen at -80°C.

[0488] (4) BALF sample protein expression detection: BALF supernatant was tested for RAGE protein expression using Monkey RAGE ELISA KIT (Aimeng Youning Cat No: LV50407M). Two replicate wells were performed for each monkey sample. Two monkeys, one male and one female, were enrolled. RAGE expression in the female monkey's BALF was too low to be detected by the kit. Subsequently, only RAGE protein knockdown was tested in the male monkey's BALF. The results of the duplex in vivo activity test are shown in Table 55 below.

[0489] Table 55: Inhibition of RAGE protein activity in monkeys at different time points after aerosolized airway administration of 402S4-VP (TRiM delivery)

[0490] Results: This in vivo experiment showed that VP-modified GPSZRA402S4-VP could effectively reduce the expression of RAGE protein in monkeys.

[0491] Although the specific embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and variations may be made to the details based on all the teachings disclosed, and that such modifications are within the scope of protection of the present invention. The full scope of the present invention is given by the appended claims and any equivalents thereof.

Claims

1. A small interfering RNA (siRNA) for the expression of the receptor for advanced glycation end products (RAGE) gene, wherein the siRNA comprises a sense strand and an antisense strand, wherein: The antisense strand comprises at least 14 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 419 by no more than 4 (e.g., 0, 1, 2, 3 or 4) nucleotides, and the sense strand is at least partially complementary to the antisense strand.

2. The siRNA according to claim 1, wherein The antisense strand comprises at least 17 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 419 by no more than 2 (eg, 0, 1 or 2) nucleotides.

3. The siRNA according to claim 1 or 2, wherein The sense strand comprises at least 14 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO:420 to SEQ ID NO:838 by no more than 4 (e.g., 0, 1, 2, 3 or 4) nucleotides; Preferably, the sense strand has a region of at least 85% complementarity with the antisense strand within the 14 consecutive nucleotides; Preferably, the sense strand comprises at least 17 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO:420 to SEQ ID NO:838 by no more than 2 (eg, 0, 1 or 2) nucleotides.

4. The siRNA according to any one of claims 1 to 3, wherein The siRNA comprises a blunt end and / or an overhang of 1-4 nucleotides; Preferably, the siRNA comprises an overhang of 1 or 2 nucleotides; Preferably, the overhang is present at the 5' end and / or the 3' end of the antisense strand and / or the sense strand; Preferably, the 3' end of the antisense strand of the siRNA comprises an overhang of 2 nucleotides.

5. The siRNA according to any one of claims 1 to 4, wherein The length of the antisense strand and the sense strand is independently 14 to 30 nucleotides; preferably, the length of the antisense strand and the sense strand is independently 17 to 30 nucleotides; preferably, the length of the antisense strand is 19 to 27 nucleotides; preferably, the length of the sense strand is 17 to 25 nucleotides.

6. The siRNA according to any one of claims 1 to 4, wherein The antisense strand is 21 to 23 nucleotides in length, and the sense strand is 19 to 21 nucleotides in length.

7. The siRNA according to any one of claims 1 to 6, wherein The sense strand has no more than 4 (e.g., 0, 1, 2, 3, or 4) nucleotide mismatches with the antisense strand; Preferably, the sense strand has no more than 2 (eg, 0, 1 or 2) nucleotide mismatches with the antisense strand.

8. The siRNA according to any one of claims 1 to 7, wherein The sequences of the sense strand and antisense strand of the siRNA are selected from the sense strand and antisense strand sequences of any duplex of GPSZRA001 to GPSZRA419 provided in Table 1; Preferably, the sequences of the sense strand and antisense strand of the siRNA are selected from the sense strand and antisense strand sequences of any duplex provided in Table 7.

9. The siRNA according to any one of claims 1 to 8, wherein The siRNA contains at least one modified nucleotide.

10. The siRNA according to claim 9, wherein All nucleotides in the sense strand and / or antisense strand of the siRNA are modified nucleotides or nucleotide analogs; Preferably, all nucleotides in the sense strand of the siRNA are modified nucleotides or nucleotide analogs, and all nucleotides in the antisense strand of the siRNA are modified nucleotides or nucleotide analogs.

11. The siRNA according to claim 9 or 10, wherein The modified nucleotide or nucleotide analog is selected from 2'-methoxy nucleotides, 2'-fluoro nucleotides, 5'-(E)-vinyl phosphate modified nucleotides, 2'-deoxyribonucleotides, 2',3'-split ring nucleotide analogs, 2'-fluoroarabino nucleotides, 2'-methoxyethyl nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, 3'-methoxy nucleotides, 2'-allyl modified nucleotides, nucleotides containing thiophosphate groups, nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphate esters, nucleotides containing 5'-phosphate mimetics, diol-modified nucleotides, abasic nucleotides, morpholino nucleotides, locked nucleic acids, unlocked nucleic acids or glycerol nucleotides.

12. The siRNA according to any one of claims 9 to 11, wherein The nucleotides in the sense strand of the siRNA are selected from at least two of 2'-methoxy nucleotides, 2'-fluoro nucleotides or locked nucleic acids; and / or the nucleotides in the antisense strand of the siRNA are selected from 2'-methoxy nucleotides and 2'-fluoro nucleotides; preferably, the first nucleotide of the antisense strand further comprises a 5'-(E)-vinyl phosphate modification.

13. The siRNA according to any one of claims 9 to 12, wherein The sense strand and / or antisense strand of the siRNA comprises a modified internucleoside linkage; Preferably, the 5' end and / or 3' end of the sense strand independently comprises 1 or 2 phosphorothioate linkages; and / or the 5' end and / or 3' end of the antisense strand independently comprises 1 or 2 phosphorothioate linkages.

14. The siRNA according to any one of claims 9 to 13, wherein The antisense strand of the siRNA comprises the following modification pattern: (1) 5'-NmsNfsNmNfNmNfNmNfNmNfNmNmNmNfNmNfNmNfNmsNmsNm-3' (SEQ ID NO: 1409); (2) 5'-NmsNfsNmNmNmNfNmNfNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 1410); (3) 5'-NmsNfsNmNmNmNfNmNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 1411); (4) 5'-VPNmsNfsNmNfNmNfNmNfNmNfNmNmNmNfNmNfNmNfNmsNmsNm-3' (SEQ ID NO: 1423); (5) 5'-VPNmsNfsNmNmNmNfNmNfNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 1424); or (6) 5'-VPNmsNfsNmNmNmNfNmNmNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 1425); Among them, Nm is a methoxy-modified nucleotide, Nf is a fluorinated-modified nucleotide, VP is a 5'-(E)-vinyl phosphate-modified nucleotide, and s is a phosphorothioate linkage.

15. The siRNA according to any one of claims 9 to 14, wherein The sense strand of the siRNA comprises the following modification pattern: (1) 5'-NmsNmNfNmNfNmNfNfNfNmNfNmNfNmNfNmNfNmsNf-3' (SEQ ID NO: 1412); (2) 5'-NmsNmNfNmNmNmNfNfNfNmNfNmNfNmNfNmNmNmsNm-3' (SEQ ID NO: 1413); (3) 5'-NmsNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmsNm-3' (SEQ ID NO: 1414); or (5)5'-NmsNmNmNmNfNmNfNfNfNmNmNmNmNmNmNfNmNmNmsNm-3' (SEQ ID NO: 1416); Among them, Nm is a methoxy-modified nucleotide, Nf is a fluorinated-modified nucleotide, N(LNA) is a locked nucleic acid-modified nucleotide, and s is a phosphorothioate linkage.

16. The siRNA according to any one of claims 9 to 15, wherein The antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 839-1123, 1426-1438.

17. The siRNA according to any one of claims 9 to 16, wherein The positive strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1124-1408.

18. The siRNA according to any one of claims 9 to 17, wherein The sequences of the sense strand and antisense strand of the siRNA are selected from the sense strand and antisense strand sequences of any duplex of GPSZRA084S1 to GPSZRA402S5-VP provided in Table 4; Preferably, the antisense strand comprises a member selected from the group consisting of SEQ ID NOs: 846, 960, 1017, 847, 904, 961, 1018, 1075, 1076, 850, 907, 964, 1021, 1078, 852, 909, 966, 1023, 1080, 913, 970, 1084, 857, 914, 971, 1028, 1085, 1035, 923, 980, 103 7, the nucleotide sequence shown in any one of 1094, 1040, 1097, 930, 878, 935, 992, 1049, 1106, 939, 996, 1053, 1110, 889, 946, 1003, 890, 947, 1004, 1061, 1118, 891, 948, 1062, 894, 951, 1008, and 1065; Preferably, the sense strand comprises a member selected from the group consisting of SEQ ID NOs: 1131, 1245, 1302, 1132, 1189, 1246, 1303, 1360, 1361, 1135, 1192, 1249, 1306, 1363, 1137, 1194, 1251, 1308, 1365, 1198, 1255, 1369, 1142, 1199, 1256, 1313, 1370, 1320, 1208, 1265, 1 the nucleotide sequence represented by any one of 322, 1379, 1325, 1382, 1215, 1163, 1220, 1277, 1334, 1391, 1224, 1281, 1338, 1395, 1174, 1231, 1288, 1175, 1232, 1289, 1346, 1403, 1176, 1233, 1347, 1179, 1236, 1293, and 1350; More preferably, the sequences of the sense strand and the antisense strand of the siRNA are selected from GPSZRA222S1, GPSZRA222S3, GPSZRA222S4, GPSZRA227S1, GPSZRA227S2, GPSZRA227S3, GPSZRA227S4, GPSZRA227S5, GPSZRA228S5, GPSZRA231S1, GPSZRA231S2, GPSZRA231S3, GPSZRA231S4, G PSZRA231S5, GPSZRA233S1, GPSZRA233S2, GPSZRA233S3, GPSZRA233S4, GPSZRA233S5, GPSZRA267S2, GPSZRA267S3 , GPSZRA267S5, GPSZRA271S1, GPSZRA271S2, GPSZRA271S3, GPSZRA271S4, GPSZRA271S5, GPSZRA282S4, GPSZRA284S 2. GPSZRA284S3, GPSZRA284S4, GPSZRA284S5, GPSZRA287S4, GPSZRA287S5, GPSZRA301S2, GPSZRA314S1, GPSZRA31 4S2, GPSZRA314S3, GPSZRA314S4, GPSZRA314S5, GPSZRA318S2, GPSZRA318S3, GPSZRA318S4, GPSZRA318S5, GPSZRA3 The sense and antisense strand sequences of any duplex of GPSZRA407S1, GPSZRA407S2, GPSZRA407S4, GPSZRA410S1, GPSZRA410S2, GPSZRA410S3 or GPSZRA410S4.

19. The siRNA according to any one of claims 9 to 17, wherein The antisense strand comprises a nucleotide sequence selected from any one of SEQ ID NOs: 846, 960, 1017, 847, 1018, 1075, 1023, 913, 980, 1040, 878, 935, 992, 1049, 1106, 939, 996, 1053, 946, 1003, 890, 947, 1061, 1118, 948, 1062, 894, 951, and 1065; Preferably, the sense strand comprises a nucleotide sequence selected from any one of SEQ ID NOs: 1131, 1245, 1302, 1132, 1303, 1360, 1308, 1198, 1265, 1325, 1163, 1220, 1277, 1334, 1391, 1224, 1281, 1338, 1231, 1288, 1175, 1232, 1346, 1403, 1233, 1347, 1179, 1236, 1350; More preferably, the sequences of the sense strand and the antisense strand of the siRNA are selected from GPSZRA222S1, GPSZRA222S3, GPSZRA222S4, GPSZRA227S1, GPSZRA227S4, GPSZRA227S5, GPSZRA233S4, GPSZRA267S2, GPSZRA284S3, GPSZRA287S4, GPSZRA314S1, GPSZRA314S2, GPSZRA314S3, GPSZRA314S4 provided in Table 4 4. The sense and antisense strand sequences of any duplex of GPSZRA314S5, GPSZRA318S2, GPSZRA318S3, GPSZRA318S4, GPSZRA381S2, GPSZRA381S3, GPSZRA402S1, GPSZRA402S2, GPSZRA402S4, GPSZRA402S5, GPSZRA407S2, GPSZRA407S4, GPSZRA410S1, GPSZRA410S2 or GPSZRA410S4.

20. The siRNA according to any one of claims 9 to 17, wherein The antisense strand comprises a nucleotide sequence selected from any one of SEQ ID NOs: 846, 960, 1017, 847, 913, 980, 878, 935, 992, 1106, 939, 1061, and 1118; Preferably, the sense strand comprises a nucleotide sequence selected from any one of SEQ ID NOs: 1131, 1245, 1302, 1132, 1198, 1265, 1163, 1220, 1277, 1391, 1224, 1346, and 1403; More preferably, the sequences of the sense strand and antisense strand of the siRNA are selected from the sense strand and antisense strand sequences of any double-stranded complex of GPSZRA222S1, GPSZRA222S3, GPSZRA222S4, GPSZRA227S1, GPSZRA267S2, GPSZRA284S3, GPSZRA314S1, GPSZRA314S2, GPSZRA314S3, GPSZRA314S5, GPSZRA318S2, GPSZRA402S4 or GPSZRA402S5 provided in Table 4.

21. The siRNA according to any one of claims 9 to 17, wherein The antisense strand comprises a nucleotide sequence selected from any one of SEQ ID NOs: 1426-1438; Preferably, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 1131, 1245, 1302, 1132, 1198, 1265, 1163, 1220, 1277, 1391, 1224, 1346, 1403; More preferably, the sequences of the sense strand and antisense strand of the siRNA are selected from the sense strand and antisense strand sequences of any double-stranded complex of GPSZRA222S1-VP, GPSZRA222S3-VP, GPSZRA222S4-VP, GPSZRA227S1-VP, GPSZRA267S2-VP, GPSZRA284S3-VP, GPSZRA314S1-VP, GPSZRA314S2-VP, GPSZRA314S3-VP, GPSZRA314S5-VP, GPSZRA318S2-VP, GPSZRA402S4-VP, and GPSZRA402S5-VP provided in Table 4.

22. A conjugate, wherein The conjugate comprises the siRNA according to any one of claims 1 to 21 and a pharmaceutically acceptable targeting molecule.

23. A pharmaceutical composition, wherein: The pharmaceutical composition comprises the siRNA according to any one of claims 1 to 21 or the conjugate according to claim 22, and a pharmaceutically acceptable carrier and / or excipient.

24. The pharmaceutical composition according to claim 23, wherein The pharmaceutically acceptable carrier is a delivery carrier; preferably, the siRNA is encapsulated by the delivery carrier.

25. Use of the siRNA according to any one of claims 1 to 21, the conjugate according to claim 22 and / or the pharmaceutical composition according to claim 23 or 24 in the preparation of a medicament for treating and / or preventing a disease associated with RAGE; Preferably, the siRNA, the conjugate or the pharmaceutical composition is used alone or in combination with another pharmaceutically active agent (eg, siRNA targeting a different target sequence in the RAGE gene or siRNA targeting other targets).

26. The use according to claim 25, wherein The RAGE-related disease is a respiratory disease, such as cystic fibrosis, pneumonia, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, respiratory tract infection, primary ciliary dyskinesia or lung cancer cystic fibrosis; preferably, the respiratory disease is asthma or chronic obstructive pulmonary disease (COPD).

27. The use according to claim 25, wherein The RAGE-related disease is a neurological disease, such as Alzheimer's disease or stroke.

28. The use according to claim 25, wherein The disease associated with RAGE is a urological disease, such as diabetic nephropathy.

29. The use according to claim 25, wherein The RAGE-related disease is an inflammatory disease or involves inflammation.

30. A method for inhibiting RAGE expression in a cell, the method comprising: Introducing the siRNA according to any one of claims 1 to 18, the conjugate according to claim 22, and / or the pharmaceutical composition according to claim 23 or 24 into a cell; Preferably, the siRNA, the conjugate or the pharmaceutical composition is used alone or in combination with another pharmaceutically active agent (eg, siRNA targeting a different target sequence in the RAGE gene or siRNA targeting other targets).

31. A method for preventing and / or treating a disease associated with RAGE in a subject, the method comprising administering to a subject in need thereof an effective amount of the siRNA of any one of claims 1 to 22, the conjugate of claim 22, and / or the pharmaceutical composition of claim 23 or 24; Preferably, the RAGE-associated disease is a respiratory disease, such as cystic fibrosis, pneumonia, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, respiratory tract infection, primary ciliary dyskinesia, or lung cancer cystic fibrosis; Preferably, the respiratory disease is chronic obstructive pulmonary disease (COPD). Preferably, the RAGE-related disease is a nervous system disease, such as Alzheimer's disease or stroke; Preferably, the RAGE-related disease is a urological disease, such as diabetic nephropathy; Preferably, the RAGE-related disease is an inflammatory disease or involves inflammation; Preferably, the subject is a mammal, such as a human; Preferably, the siRNA, the conjugate or the pharmaceutical composition is used alone or in combination with another pharmaceutically active agent (eg, siRNA targeting a different target sequence in the RAGE gene or siRNA targeting other targets).

Images