Antisense oligonucleotides for the treatment of canavan disease

Abstract

The present invention relates to antisense oligonucleotides (oligomers) complementary to NAT8L (N-acetyltransferase 8 like) pre-mRNA which are capable of inhibiting the expression of NAT8L in a cell expressing NAT8L. Inhibition of NAT8L expression is beneficial for the treatment of Canavan disease.

Description

[0001] Contera Pharma A / S September 27, 2024 COP16643PC1 Antisense oligonucleotides for the treatment of Canavan disease Field of the invention The present invention relates to antisense oligonucleotides (oligomers) complementary to NAT8L (N-acetyltransferase 8 like) pre-mRNA which are capable of inhibiting the expression of NAT8L in a cell expressing NAT8L. Inhibition of NAT8L expression is beneficial for the treatment of Canavan disease. Background Canavan disease is a recessively inherited vacuolar leukodystrophy caused by ASPA mutations. ASPA encodes aspartoacylase, an oligodendroglial enzyme required for cleavage of the abundant brain amino acid N-acetyl-l-aspartate (NAA) to acetate and L-aspartate. Canavan disease is a rare and fatal autosomal recessive degenerative disorder that causes progressive damage to nerve cells and pathology of the white matter in the brain. It is one of the most frequent degenerative brain diseases of infancy. Canavan disease belongs to a group of genetic diseases known as leukodystrophies, referring to defects in the development and growth of white matter. Early symptoms of Canavan disease such a hypotonia, macrocephaly, poor head control usually become apparent between the age of 3 and 6 months. The affected infants show delayed developmental milestones (e.g., sitting, standing) and usually never develop the ability to walk. The progressive nature of the disease results in loss of previously acquired abilities and additional symptoms such as seizures and mental retardation also become apparent during infancy. The prognosis for Canavan disease is poor and, in most cases, death occurs before the age of ten. Canavan disease is caused by mutations in the ASPA gene, which encodes aspartoacyclase, an enzyme required for the conversion of the N-acetyl-l-aspartate (NAA) into acetate and L- aspartate. Currently, there are two prevailing hypotheses of the resulting pathological process. The ‘Oligodendroglial starvation’ hypothesis proposes that the lack of functional aspartoacyclase results in a deficiency of NAA-derived acetate required for the biosynthesis of myelin (white matter material) and as a result degeneration of myelin / white matter in patients. The ‘NAA toxicity’ hypothesis in contrary proposes, that the excessive NAA concentration in the brain of patients lacking aspartoacyclase, causes an impaired osmolar homeostasis and as result the astroglial and myelinic vacuolation, which is hallmark of Canavan disease (Pleasure et al., Neurochem Res.2020 Mar;45(3):561-565. doi: 10.1007 / s11064-018-2693-6. Epub 2018 Dec 8. Pathophysiology and Treatment of Canavan Disease.). In support of the ‘NAA toxicity’ Maier et al., 2015 reported that in Aspa deficient mice (Asap nur7 / nur7, Canavan disease model) also deficient for NAA synthase Nat8l (Aspanur7 / nur7 / Nat8l- / -) showed normal myelin content and no axonal degeneration, despite having no detectable NAA. However, survival time was not improved (Maier et al., J Neurosci.2015 Oct 28;35(43):14501- 16. doi: 10.1523 / JNEUROSCI.1056-15.2015. N-Acetylaspartate Synthase Deficiency Corrects the Myelin Phenotype in a Canavan Disease Mouse Model But Does Not Affect Survival Time). Moreover, mice with only one intact Nat8l allele (Aspanur7 / nur7 / Nat8l- / +) accumulated less NAA and developed a less severe disease pathology showed phenotypic improvements and normal lifespan. Similar results have been reported by Sohn et al. (J Neurosci. 2017 Jan 11;37(2):413-421. doi: 10.1523 / JNEUROSCI.2013-16.2016. Suppressing N-Acetyl-l- Aspartate Synthesis Prevents Loss of Neurons in a Murine Model of Canavan Leukodystrophy). Subsequently, Bannerman et al., 2018 showed that knocking down Nat8l expression in Aspanur7 / nur7 using adeno-associated viral vector carrying short hairpin Nat8l inhibitory RNA reduced NAA levels, suppressed the development disease pathology, and improved enhanced motor performance (Bannerman et al., Brain Nat8l Knockdown Suppresses Spongiform Leukodystrophy in an Aspartoacylase-Deficient Canavan Disease Mouse Model Mol Ther. 2018 Mar 7;26(3):793-800. doi: 10.1016 / j.ymthe.2018.01.002. Epub 2018 Jan 10). Furthermore, Hull et al., 2020 showed that antisense oligonucleotides reducing Nat8l expression in Aspanur7 / nur7 likewise reduced levels of NAA, reversed ataxia and reduced the cerebellar and thalamic vacuolation in young-adult Aspanur7 / nur7 mice (Ann Neurol. 2020 Mar;87(3):480-485. doi: 10.1002 / ana.25674. Epub 2020 Jan 22. Antisense Oligonucleotide Reverses Leukodystrophy in Canavan Disease Mice). Altogether these data points towards inhibition NAT8L and lowering of NAA levels as a potentially effective therapeutic concept for treating Canavan disease, a progressive and fatal neurodegenerative disease for which there are currently no effective treatments available. The international patent application PCT / EP2023 / 077175, published as WO 2024 / 068997 A2 describes target regions for the down-regulation of the NAT8L gene. Specifically, target regions were identified which allow for an efficient down-regulation of the gene. Further, the document discloses antisense oligonucleotides which target the NAT8L gene, for example the compounds designated “66_124”, “66_130”, “66_192”. The compounds are however not disclosed in the priority application of WO 2024 / 068997 A2. There remains a need for means and methods for the efficient down-regulation of the NAT8L gene in patients, in particular for oligonucleotides which allow for an efficient down-regulation of the target gene and which have additional advantageous properties, such as a low toxicity in vivo, in vivo pharmacodynamics and low off-targets effects. Brief summary of the present invention The present invention relates to antisense oligonucleotides which downregulate NATL8 expression in a cell. The present invention relates to an antisense oligonucleotide selected from the group of antisense oligonucleotides consisting of TlxEmxTmxGdxTmxCdxTdxGdxTdxAdxTdxAdxTdxTdxEmoElxAl (SEQ ID NO: 1), TlxElxUoxGdxTmxCdxTdxGdxTdxAdxTdxAdxTdxTdxCdxEmxAl (SEQ ID NO: 2), AlxAlxCdxAlxEmxTdxTdxTdxAdxEdxGdxTdxCdxTmxGlxTdxEmxTl (SEQ ID NO: 3), and AmxAmxElxAmoEmxTdxTdxTdxAdxEdxGdxTdxCdxTmoGmxTlxEmxTm (SEQ ID NO: 4), wherein Adx represents 2'deoxyadenosine-3' –phosphorothioate Aox represents 2'-O-methyladenosine-3'-phosphorothioate Amx represents 2'-O-Methoxyethyladenosine-3' -phosphorothioate Alx represents 2'-O-beta-D-oxy LNA adenosine-3' -phosphorothioate Cdx represents 2'deoxycytidine-3' -phosphorothioate Cox represents 2'-O-methylcytidine-3'-phosphorothioate Cmx represents 2'-O-Methoxyethyl-5-methylcytidine-3' -phosphorothioate Clx represents 2'-O-beta-D-oxy LNA -5-methylcytidine-3' -phosphorothioate Edx represents 2'deoxy-5-methylcytidine-3' -phosphorothioate Emx represents 2'-O-Methoxyethyl-5-methylcytidine-3' -phosphorothioate Elx represents 2'-O-beta-D-oxy LNA -5-methylcytidine-3' -phosphorothioate Gdx represents 2'deoxyguanosine-3' -phosphorothioate Gox represents 2'-O-methylguanosine-3'-phosphorothioate Gmx represents 2'-O-Methoxyethylguanosine-3' -phosphorothioate Glx represents 2'-O-beta-D-oxy LNA guanosine-3' -phosphorothioate Tdx represents 2'deoxythymidine-3' -phosphorothioate Tmx represents 2'-O-Methoxyethylthymidine-3' -phosphorothioate Tlx represents 2'-O-beta-D-oxy LNA thymidine-3' -phosphorothioate Uox represents 2'-O-methyluridine-3'-phosphorothioate Ado represents 2'deoxyadenosine-3' -phosphate Aoo represents 2'-O-methyladenosine-3'-phosphate Amo represents 2'-O-Methoxyethyladenosine-3' -phosphate Alo represents 2'-O-beta-D-oxy LNA adenosine-3' -phosphate Cdo represents 2'deoxycytidine-3' -phosphate Coo represents 2'-O-methylcytidine-3'-phosphate Cmo represents 2'-O-Methoxyethyl-5-methylcytidine-3' -phosphate Edo represents 2'deoxy-5-methylcytidine-3' -phosphate Emo represents 2'-O-Methoxyethyl-5-methylcytidine-3' -phosphate Elo represents 2'-O-beta-D-oxy LNA -5-methylcytidine-3' -phosphate Gdo represents 2'deoxyguanosine-3' -phosphate Goo represents 2'-O-methylguanosine-3'-phosphate Gmo represents 2'-O-Methoxyethylguanosine-3' -phosphate Glo represents2'-O-beta-D-oxy LNA guanosine-3' -phosphate Tdo represents 2'deoxythymidine-3' -phosphate Tmo represents 2'-O-Methoxyethylthymidine-3' -phosphate Tlo represents 2'-O-beta-D-oxy LNA thymidine-3' -phosphate Uoo represents 2'-O-methyluridine-3'-phosphate Ad represents 2'deoxyadenosine Ao represents 2'-O-methyladenosine Am represents 2'-O-Methoxyethyladenosine Al represents 2'-O-beta-D-oxy LNA adenosine Cd represents 2'deoxycytidine Co represents 2'-O-methylcytidine Ed represents 2'deoxy-5-methylcytidine Em represents 2'-O-Methoxyethyl-5-methylcytidine El represents 2'-O-beta-D-oxy LNA -5-methylcytidine Gd represents 2'deoxyguanosine Go represents 2'-O-methylguanosine Gm represents 2'-O-Methoxyethylguanosine Gl represents 2'-O-beta-D-oxy LNA guanosine Td represents 2'deoxythymidine Tm represents 2'-O-Methoxyethylthymidine, Tl represents 2'-O-beta-D-oxy LNA thymidine, and Uo represents 2'-O-methyluridine An “x” between two nucleotides represents a phosphorothioate internucleoside linkage, whereas an “o” between two nucleotides represents a phosphodiester linkage. The chemical structures of the four compounds of the present invention are also shown in Figure 1 to 4. Thus, the present invention relates to an antisense oligonucleotide shown in Fig. 1, Fig.2, Fig.3, or Fig.4. The present invention further provides a conjugate comprising the antisense oligonucleotide of the present invention, and at least one conjugate moiety covalently attached to said antisense oligonucleotide. The present invention further provides a pharmaceutical composition comprising the antisense oligonucleotide of the present invention, the conjugate of the present invention, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant. The present invention further provides an in vitro method for decreasing NAT8L expression in a host cell which is expressing NAT8L, said method comprising administering the antisense oligonucleotide of the present invention, the conjugate of the present invention or the pharmaceutical composition of the present invention an effective amount to said cell. The present invention further provides a method for treating Canavan disease comprising administering a pharmaceutically effective amount of the antisense oligonucleotide of the present invention, the conjugate of the present invention or the pharmaceutical composition of the present invention. The present invention also relates to the antisense oligonucleotide of the present invention, the conjugate of the present invention or the pharmaceutical composition of the present invention for use in treating Canavan disease. The present invention further relates to the use of the antisense oligonucleotide of the present invention, the conjugate of the present invention or the pharmaceutical composition of the present invention, for the manufacture of a medicament for the treatment of Canavan disease. Figures Figure 1: Chemical structure of the compound with ASO ID 66_130 (TlxEmxTmxGdxTmxCdxTdxGdxTdxAdxTdxAdxTdxTdxEmoElxAl, SEQ ID NO: 1). Figure 2: Chemical structure of the compound with ASO ID 66_124 (TlxElxUoxGdxTmxCdxTdxGdxTdxAdxTdxAdxTdxTdxCdxEmxAl, SEQ ID NO: 2). Figure 3: Chemical structure of the compound with ASO ID 66_707 AlxAlxCdxAlxEmxTdxTdxTdxAdxEdxGdxTdxCdxTmxGlxTdxEmxTl (SEQ ID NO: 3). Figure 4: Chemical structure of the compound with ASO ID 66_709 (AmxAmxElxAmoEmxTdxTdxTdxAdxEdxGdxTdxCdxTmoGmxTlxEmxTm, SEQ ID NO: 4). Detailed overview on the present invention Inhibition of NAT8L (N-acetyltransferase 8 like) expression is considered as therapeutic concept for treating Canavan disease. In the studies described in the International patent application PCT / EP2023 / 077175, published as WO 2024 / 068997 A2 (which herewith is incorporated by reference with respect to the entire disclosure content), target regions within the NAT8L pre-mRNA were identified which – when targeted by antisense oligonucleotides – allow for efficient downregulation of the human NAT8L pre-mRNA (or mRNA) in a host cell expressing said pre-mRNA or mRNA. For example, the target region with Target ID 66 was identified (AGATTTTGTTAATCTGGAATATACAGACA GACGTAAAGTGTTTTAGCAAAATGGAAACAAACAGTTGTG, SEQ ID NO: 20, WO 2024 / 068997 A2). In the studies underlying the present invention, selected compounds disclosed in the international patent application as well as newly synthesized compounds binding to this target region were further analyzed. Advantageously, it was shown that oligonucleotides targeting this region advantageously have low off-target effects (see Example 3). Further, they efficiently downregulate expression of the NATL8 gene in a host cell (see Example 1 and Example 2) and, thus, can compounds can be advantageously used in a pharmaceutical composition in the treatment of patients with Canavan disease. The compounds are shown in Figure 1 (ASO ID 66_130), Figure 2 (ASO ID 66_124), Figure 3 (ASO ID 66_707) and Figure 4 (ASO ID 66_709). Some of the tested compounds were also tested for their acute and sub-acute toxicity potential in vivo (see Examples 4 and 5) as well as their pharmacodynamics in a humanized mouse model (see Example 6). Advantageously, it was shown that they were well tolerated and active in vivo. The compounds of the present invention are shown in Table 1. Table 1: Antisense oligonucleotides of the present invention. Targe Targe SEQ Base sequence ASO ID Compound t t ID seque seque nce nce Start End in in SEQ SEQ ID ID NO: NO: 5 5 6553 6569 10 AACACTTTAC 66_707 AlxAlxCdxAlxEmxTdxTdxTdx 3 GTCTGTCT AdxEdxGdxTdxCdxTmxGlxTdx EmxTl 6553 6569 11 AACACTTTAC 66_709 AmxAmxElxAmoEmxTdxTdxT 4 GTCTGTCT dxAdxEdxGdxTdxCdxTmoGmx TlxEmxTm 6543 6559 9 TCTGTCTGTA 66_130 TlxEmxTmxGdxTmxCdxTdxGd 1 TATTCCA xTdxAdxTdxAdxTdxTdxEmoEl xAl 6543 6559 8 TCUGTCTGTA 66_124 TlxElxUoxGdxTmxCdxTdxGdx 2 TATTCCA TdxAdxTdxAdxTdxTdxCdxEmx Al *SEQ ID NO: 5 is the NATL8 pre-mRNA sequence In Table 1, column “compound”, a three letter code or two letter code was used in order to describe the modified nucleotides that are present in the oligonucleotide compounds. Each new nucleotide starts with a capital letter, e.g. the “A” in Adx. Additionally, each of the compounds in Table 1 contains a two letter code in the 3’ end, which does not contain the phosphorothioate group or phosphate. The base and sugar groups of the two letter code is otherwise identical to the three letter code. Table 2 provides a translation of the two or three letter codes to their chemical names. The annotations, typically, also apply to the three or two letter codes of the compounds of the present invention. An x between two nucleotides represents a phosphorothioate internucleoside linkage. An o between two nucleotides represents a phosphodiester linkage. Table 2: Overview on modified nucleotides Three- Nucleotide Two Nucleotide letter letter code code Adx 2'deoxyadenosine-3' -phosphorothioate Ad 2'deoxyadenosine Aox 2'-O-methyladenosine-3'-phosphorothioate Ao 2'-O-methyladenosine Amx 2'-O-Methoxyethyladenosine-3' - Am 2'-O-Methoxyethyladenosine phosphorothioate Alx 2'-O-beta-D-oxy LNA adenosine-3' - Al 2'-O-beta-D-oxy LNA adenosine phosphorothioate Cdx 2'deoxycytidine-3' -phosphorothioate Cd 2'deoxycytidine Cox 2'-O-methylcytidine-3'-phosphorothioate Co 2'-O-methylcytidine Edx 2'deoxy-5-methylcytidine-3' - Ed 2'deoxy-5-methylcytidine phosphorothioate Emx 2'-O-Methoxyethyl-5-methylcytidine-3' - Em 2'-O-Methoxyethyl-5-methylcytidine phosphorothioate Elx 2'-O-beta-D-oxy LNA -5-methylcytidine-3' - El 2'-O-beta-D-oxy LNA -5- phosphorothioate methylcytidine Gdx 2'deoxyguanosine-3' -phosphorothioate Gd 2'deoxyguanosine Gox 2'-O-methylguanosine-3'-phosphorothioate Go 2'-O-methylguanosine Gmx 2'-O-Methoxyethylguanosine-3' - Gm 2'-O-Methoxyethylguanosine phosphorothioate Glx 2'-O-beta-D-oxy LNA guanosine-3' - Gl 2'-O-beta-D-oxy LNA guanosine phosphorothioate Tdx 2'deoxythymidine-3' -phosphorothioate Td 2'deoxythymidine Tmx 2'-O-Methoxyethylthymidine-3' - Tm 2'-O-Methoxyethylthymidine phosphorothioate Tlx 2'-O-beta-D-oxy LNA thymidine-3' - Tl 2'-O-beta-D-oxy LNA thymidine phosphorothioate Uox 2'-O-methyluridine-3'-phosphorothioate Uo 2'-O-methyluridine Ado 2'deoxyadenosine-3' -phosphate Aoo 2'-O-methyladenosine-3'-phosphate Amo 2'-O-Methoxyethyladenosine-3' -phosphate Alo 2'-O-beta-D-oxy LNA adenosine-3' - phosphate Cdo 2'deoxycytidine-3' -phosphate Coo 2'-O-methylcytidine-3'-phosphate Edo 2'deoxy-5-methylcytidine-3' -phosphate Emo 2'-O-Methoxyethyl-5-methylcytidine-3' - phosphate Elo 2'-O-beta-D-oxy LNA -5-methylcytidine-3' - phosphate Gdo 2'deoxyguanosine-3' -phosphate Goo 2'-O-methylguanosine-3'-phosphate Gmo 2'-O-Methoxyethylguanosine-3' -phosphate Glo 2'-O-beta-D-oxy LNA guanosine-3' - phosphate Tdo 2'deoxythymidine-3' -phosphate Tmo 2'-O-Methoxyethylthymidine-3' -phosphate Tlo 2'-O-beta-D-oxy LNA thymidine-3' - phosphate Uoo 2'-O-methyluridine-3'-phosphate Complex Macromolecules, such antisense oligonucleotides according to the present invention with non-natural chemical modifications, can be also depicted in the HELM format (HELM: “Hierarchical Editing Language for Macromolecules”). The HELM format is described in Zhang T, Li H, Xi H, Stanton RV, Rotstein SH. HELM: a hierarchical notation language for complex biomolecule structure representation. J Chem Inf Model. 2012 Oct 22;52(10):2796- 806. doi: 10.1021 / ci3001925. Epub 2012 Sep 26. PMID: 22947017. The document is herewith incorporated by reference in its entirety. Table 3 shows the compounds of the present invention in HELM Annotation Format. In a preferred embodiment, the antisense oligonucleotide is a compound as shown in Table 3. Table 3: Compounds of the present invention - HELM Annotation Format AS SE HELM O Q ID ID 66_ [LR](T)[sP].[LR]([5meC])[sP].[mR](U)[sP].[dR](G)[sP].[MOE](T)[sP].[dR]( 124 2 C)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR](A) [sP].[dR](T)[sP].[dR](T)[sP].[dR](C)[sP].[MOE]([5meC])[sP].[LR](A) 66_ 1 [LR](T)[sP].[MOE]([5meC])[sP].[MOE](T)[sP].[dR](G)[sP].[MOE](T)[sP].[ 130 dR](C)[sP].[dR](T)[sP].[dR](G)[sP].[dR](T)[sP].[dR](A)[sP].[dR](T)[sP].[dR ](A)[sP].[dR](T)[sP].[dR](T)[sP].[MOE]([5meC])P.[LR]([5meC])[sP].[LR](A ) 66_ 3 [LR](A)[sP].[LR](A)[sP].[dR](C)[sP].[LR](A)[sP].[MOE]([5meC])[sP].[dR]( 707 T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR]([5meC])[sP].[dR](G)[sP].[d R](T)[sP].[dR](C)[sP].[MOE](T)[sP].[LR](G)[sP].[dR](T)[sP].[MOE]([5meC ])[sP].[LR](T) 66_ 4 [MOE](A)[sP].[MOE](A)[sP].[LR]([5meC])[sP].[MOE](A)P.[MOE]([5meC] 709 )[sP].[dR](T)[sP].[dR](T)[sP].[dR](T)[sP].[dR](A)[sP].[dR]([5meC])[sP].[dR] (G)[sP].[dR](T)[sP].[dR](C)[sP].[MOE](T)P.[MOE](G)[sP].[LR](T)[sP].[MO E]([5meC])[sP].[MOE](T) Helm Annotation Key for the compounds in Table 3: [LR](G) is a beta-D-oxy-LNA guanine nucleoside, [LR](T) is a beta-D-oxy-LNA thymine nucleoside, [LR](A) is a beta-D-oxy-LNA adenine nucleoside,  [LR]([5meC]) is a beta-D-oxy-LNA 5-methyl cytosine nucleoside, [MOE](G) is a 2'-O-Methoxyethyl guanine nucleoside, [MOE](T) is a 2'-O-Methoxyethyl thymine nucleoside, [MOE](A) is a 2'-O-Methoxyethyl adenine nucleoside,  [MOE]([5meC]) is a 2'-O-Methoxyethyl-5-methyl cytosine nucleoside,  [mR](G) is a 2'-O-methyl RNA guanine nucleoside, [mR](U) is a 2'-O-methyl RNA uracil nucleoside, [mR](A) is a 2'-O-methyl RNA adenine nucleoside, [mR](C) is a 2'-O-methyl RNA cytosine nucleoside, [dR](G) is a DNA guanine nucleoside, [dR](T) is a DNA thymine nucleoside, [dR](A) is a DNA adenine nucleoside, [dR](C) is a DNA cytosine nucleoside, [dR]([5meC]) is a DNA 5-methyl cytosine nucleoside,   [R](G) is a RNA guanine nucleoside, [R](T) is a RNA thymine nucleoside, [R](A) is a RNA adenine nucleoside, [R](C) is a RNA cytosine nucleoside,   [sP] is a phosphorothioate internucleoside linkage  P is a phosphate internucleoside linkage All four compounds of the invention (as shown in Tables 1 and 3, and in Figures 1 to 4) target a region within the 3’UTR of the NAT8L pre-mRNA. In the studies described in the International patent application PCT / EP2023 / 077175, published as WO 2024 / 068997 A2, it was shown that targeting a region with the Target ID 66 (see above) with antisense oligonucleotides allows for efficiently downregulating the expression of the NATL8 gene in cell. In particular, targeting position 6543-6559 or 6553 to 6569 of SEQ ID NO: 5 allows for efficiently downregulating NATL8. The antisense oligonucleotides with ASO IDs 66_124 and 66_130 target position 6543-6559 of SEQ ID NO: 5. The antisense oligonucleotides with ASO IDs 66_707 and 66_709 target position 6553-6569 of SEQ ID NO: 5. The present invention, thus, relates to an antisense oligonucleotide selected from the group of antisense oligonucleotides consisting of TlxEmxTmxGdxTmxCdxTdxGdxTdxAdxTdxAdxTdxTdxEmoElxAl (ASO ID 66_130, SEQ ID NO: 1), TlxElxUoxGdxTmxCdxTdxGdxTdxAdxTdxAdxTdxTdxCdxEmxAl (SEQ ID NO: 2), AlxAlxCdxAlxEmxTdxTdxTdxAdxEdxGdxTdxCdxTmxGlxTdxEmxTl (SEQ ID NO: 3), and AmxAmxElxAmoEmxTdxTdxTdxAdxEdxGdxTdxCdxTmoGmxTlxEmxTm (SEQ ID NO: 4), wherein Adx represents 2'deoxyadenosine-3' –phosphorothioate Aox represents 2'-O-methyladenosine-3'-phosphorothioate Amx represents 2'-O-Methoxyethyladenosine-3' -phosphorothioate Alx represents 2'-O-beta-D-oxy LNA adenosine-3' -phosphorothioate Cdx represents 2'deoxycytidine-3' -phosphorothioate Cox represents 2'-O-methylcytidine-3'-phosphorothioate Cmx represents 2'-O-Methoxyethyl-5-methylcytidine-3' -phosphorothioate Clx represents 2'-O-beta-D-oxy LNA -5-methylcytidine-3' -phosphorothioate Edx represents 2'deoxy-5-methylcytidine-3' -phosphorothioate Emx represents 2'-O-Methoxyethyl-5-methylcytidine-3' -phosphorothioate Elx represents 2'-O-beta-D-oxy LNA -5-methylcytidine-3' -phosphorothioate Gdx represents 2'deoxyguanosine-3' -phosphorothioate Gox represents 2'-O-methylguanosine-3'-phosphorothioate Gmx represents 2'-O-Methoxyethylguanosine-3' -phosphorothioate Glx represents 2'-O-beta-D-oxy LNA guanosine-3' -phosphorothioate Tdx represents 2'deoxythymidine-3' -phosphorothioate Tmx represents 2'-O-Methoxyethylthymidine-3' -phosphorothioate Tlx represents 2'-O-beta-D-oxy LNA thymidine-3' -phosphorothioate Uox represents 2'-O-methyluridine-3'-phosphorothioate Ado represents 2'deoxyadenosine-3' -phosphate Aoo represents 2'-O-methyladenosine-3'-phosphate Amo represents 2'-O-Methoxyethyladenosine-3' -phosphate Alo represents 2'-O-beta-D-oxy LNA adenosine-3' -phosphate Cdo represents 2'deoxycytidine-3' -phosphate Coo represents 2'-O-methylcytidine-3'-phosphate Cmo represents 2'-O-Methoxyethyl-5-methylcytidine-3' -phosphate Edo represents 2'deoxy-5-methylcytidine-3' -phosphate Emo represents 2'-O-Methoxyethyl-5-methylcytidine-3' -phosphate Elo represents 2'-O-beta-D-oxy LNA -5-methylcytidine-3' -phosphate Gdo represents 2'deoxyguanosine-3' -phosphate Goo represents 2'-O-methylguanosine-3'-phosphate Gmo represents 2'-O-Methoxyethylguanosine-3' -phosphate Glo represents2'-O-beta-D-oxy LNA guanosine-3' -phosphate Tdo represents 2'deoxythymidine-3' -phosphate Tmo represents 2'-O-Methoxyethylthymidine-3' -phosphate Tlo represents 2'-O-beta-D-oxy LNA thymidine-3' -phosphate Uoo represents 2'-O-methyluridine-3'-phosphate Ad represents 2'deoxyadenosine Ao represents 2'-O-methyladenosine Am represents 2'-O-Methoxyethyladenosine Al represents 2'-O-beta-D-oxy LNA adenosine Cd represents 2'deoxycytidine Co represents 2'-O-methylcytidine Ed represents 2'deoxy-5-methylcytidine Em represents 2'-O-Methoxyethyl-5-methylcytidine El represents 2'-O-beta-D-oxy LNA -5-methylcytidine Gd represents 2'deoxyguanosine Go represents 2'-O-methylguanosine Gm represents 2'-O-Methoxyethylguanosine Gl represents 2'-O-beta-D-oxy LNA guanosine Td represents 2'deoxythymidine Tm represents 2'-O-Methoxyethylthymidine, Tl represents 2'-O-beta-D-oxy LNA thymidine, and Uo represents 2'-O-methyluridine Further, the present invention relates to an antisense oligonucleotide shown in Fig. 1, Fig. 2, Fig.3, or Fig.4. In a preferred embodiment of the present invention, the antisense oligonucleotide is the antisense oligonucleotide with ASO ID 66_130 (TlxEmxTmxGdxTmxCdxTdxGdxTdxAdxTdxAdxTdxTdxEmoElxAl, SEQ ID NO: 1). The chemical structure of this antisense oligonucleotide is also shown in Fig.1. Thus, the present invention also relates to the antisense oligonucleotide shown in Fig.1. In another preferred embodiment of the present invention, the antisense oligonucleotide is the antisense oligonucleotide with ASO ID 66_124 (TlxElxUoxGdxTmxCdxTdxGdxTdxAdxTdxAdxTdxTdxCdxEmxAl, SEQ ID NO: 2). The chemical structure of this antisense oligonucleotide is also shown in Fig.2. Thus, the present invention also relates to the antisense oligonucleotide shown in Fig.2. In another preferred embodiment of the present invention, the antisense oligonucleotide is the antisense oligonucleotide with ASO ID 66_707 AlxAlxCdxAlxEmxTdxTdxTdxAdxEdxGdxTdxCdxTmxGlxTdxEmxTl (SEQ ID NO: 3). The chemical structure of this antisense oligonucleotide is also shown in Fig.3. Thus, the present invention also relates to the antisense oligonucleotide shown in Fig.3. In another preferred embodiment of the present invention, the antisense oligonucleotide is the antisense oligonucleotide with ASO ID 66_709 (AmxAmxElxAmoEmxTdxTdxTdxAdxEdxGdxTdxCdxTmoGmxTlxEmxTm, SEQ ID NO: 4). The chemical structure of this antisense oligonucleotide is also shown in Fig.4. Thus, the present invention also relates to the antisense oligonucleotide shown in Fig.4. The antisense oligonucleotide of the present invention are also shown in the sequence listing. In an embodiment, the antisense oligonucleotide comprises or consists of a sequence as shown in SEQ ID NO: 1. In another embodiment, the antisense oligonucleotide comprises or consists of a sequence as shown in SEQ ID NO: 2. In yet another embodiment, the antisense oligonucleotide comprises or consists of a sequence as shown in SEQ ID NO: 3. In yet another embodiment, the antisense oligonucleotide comprises or consists of a sequence as shown in SEQ ID NO: 4. The antisense oligonucleotides of the present invention are typically single-stranded oligonucleotides. Further, they have various chemical modifications which typically do not occur in nature. The introduced modifications e.g. increase the stability of the oligonucleotide. The modifications are well known in the art and are e.g. reviewed in Crooke et al. which herewith is incorporated by reference in its entirety (Stanley T Crooke, Xue-Hai Liang, Brenda F Baker, Rosanne M Crooke. Review J Biol Chem. 2021 Jan-Jun;296. antisense technology: A review). which herewith is incorporated by reference in its entirety. For example, some nucleotides contain 2’ modified ribose. Moreover, the oligonucleotides contain modified internucleoside linkages. Specifically, the internucleoside linkages in the oligonucleotide are phosphorothioate internucleoside linkages. Typically, the oligonucleotides as referred to herein are chemically synthesized, for example by solid-phase chemical synthesis. For example, they can be produced by linking individual nucleotide units, e.g. by phophoramidite chemistry. The antisense oligonucleotides of the present invention shall be capable of downregulate NATL8 expression in a cell that expresses the NATL8 gene. Accordingly, they shall be capable of binding the NAT8L gene, in particular to the NAT8L pre-mRNA, when expressed in a cell, thereby down-regulating the expression of NAT8L gene in the cell. In an embodiment, the cell is a human cell is a cell of the central nervous system (CNS). Typically, the cell is a brain cell. The NAT8L (N-acetyltransferase 8 like) gene is well known the art. The NAT8L gene is typically the human NAT8L gene. Information on the gene, such as on the nucleic acid sequence, can be found in the known databases, for example, under NCBI Gene ID: 339983). Alternative names of the gene are FLJ37478, Hcml3, Shati or N-acetylaspartate synthetase gene) The human NAT8L gene encodes a protein having N-acetylaspartate synthetase activity (EC 2.3.1.17). Accordingly, it catalyzes the synthesis of N-acetylaspartate acid (NAA) from L- aspartate and acetyl-CoA. The protein sequence can be assessed in the Uniprot database under the accession number Q8N9F0 (NAT8L_HUMAN). Typically, the human NAT8L protein has an amino acid sequence as shown in SEQ ID NO: 7 (which is encoded by a transcript having a sequence as shown in SEQ ID NO: 6). The NAT8L protein is typically referred to as “N-acetyltransferase 8 like”. Alternative names are N-acetylaspartate synthetase, NAA Synthetase, or aspartate N-acetyltransferase). Typically, the ASO of the present invention targets the human NAT8L pre-mRNA, i.e. downregulates expression of said pre-mRNA. The sequence of the human NAT8L pre-mRNA can be e.g. assessed in the Ensembl database under accession number in ENST00000423729.3. It is encoded by a region on human Chromosome 4: position 2,059,327-2,069,089 on the forward strand (Assembly GRCh38). The sequence of the human pre-mRNA has a sequence as shown in SEQ ID NO: 5. Within the cell, the pre-mRNA is further processed, i.e., by splicing, thereby generating a protein coding mRNA (herein also referred to as transcript). In some embodiments, the antisense oligonucleotide of the present invention may also target the human NAT8L mRNA (if the target region is located within an exon, either coding or in the 3’- or 5’UTR). For example, the antisense oligonucleotide of the present invention may target the human NAT8L mRNA having a sequence as shown in SEQ ID NO: 6. SEQ ID NO: 5 and 6 are RNA sequences. In the sequence listing, they are provided as DNA sequences. It is understood by the skilled person that the target RNA sequences have uracil (U) bases instead of thymidine bases (T). Preferably, the antisense oligonucleotide (or pharmaceutical composition) of the present invention shall be administered to the CNS, in particular to the brain. Accordingly, the ASO is delivered to CNS through intrathecal injection. Thus, the ASO of the present invention or the pharmaceutical composition is, preferably, administered intrathecally. In addition to delivery to the CNS, the ASO can be administered by subcutaneous or intravenous administration either with or without a conjugate in order to reach the peripheral nervous system, which is also negatively affected by the loss of ASPA expression. The antisense oligonucleotides of the present invention can be administered / delivered ‘unassisted’ in saline solution. However, distribution to certain tissues and uptake in cells can be enhanced by conjugates and formulation techniques. Conjugation to ASOs could be, peptides, antibodies and aptamers binding to receptors on target cells or proteins mediating transcytosis e.g. the transferrin receptor. Antisense oligos can also be conjugated to naturally occurring ligands or modifications hereof as exemplified by GalNac conjugation binding with high affinity to asialoglycoprotein receptor 1 (ASGR1, ASPGR) and Alpha-tocopherol conjugation and interaction with transfer protein Alfa-TTP. This could also be small molecules generated through medicinal chemistry with high affinity for known receptors and transporter. Moreover, it could be conjugations to long chained fatty acids that modify the hydrophobicity and protein binding properties of the ASOs, but also could function through their capacity to bind to lipoprotein particles and hence function through the endogenous mechanism for lipid transport and uptake. The term “antisense oligonucleotide” typically also encompasses pharmaceutically acceptable salts of the antisense oligonucleotides. Pharmaceutically acceptable salts are salts which retain the biological effectiveness and properties of the free bases or free acids, which are not biologically or otherwise undesirable. The salts are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, particularly hydrochloric acid, and organic acids such as acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p- toluenesulfonic acid, salicylic acid, N-acetylcystein. In addition, these salts may be prepared from addition of an inorganic base or an organic base to the free acid. Salts derived from an inorganic base include, but are not limited to, the sodium, potassium, lithium, ammonium, calcium, magnesium salts. Salts derived from organic bases include, but are not limited to salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, lysine, arginine, N-ethylpiperidine, piperidine, polyamine resins. The compounds of the present invention can also be present in the form of zwitterions. In some embodiments, the ASOs are provided as sodium salts. The present invention further provides a conjugate comprising the antisense oligonucleotide of the present invention, and at least one conjugate moiety covalently attached to said antisense oligonucleotide. For example, it can be bound to the ASO via a linker, e.g. via one or more linker nucleotides, such as one, two, three or four linker nucleotides (or more). The linker may be cleaved off after administration of the conjugate to the patient. As set forth above, the antisense oligonucleotide of the present invention is preferably delivered or administered to the CNS, in particular to the brain. Accordingly, it is envisaged that the conjugate moiety is a moiety that allows the crossing of the conjugate of the blood brain barrier. For example, the moiety can be and antibody or antigen-binding fragment thereof targeting the transferrin receptor. In addition to conjugation, tissues delivery and cellular uptake of ASOs of the present invention can be enhanced through formulation with nanocarriers that facilitates crossing of biological barriers such as cellular membranes. Various types of nanocarriers have been described with favorable properties for delivery of nucleic acids e.g. lipid nanoparticles (LNPs) as used for BioNTech mRNA vaccines, LNPs functionalizes with peptides, pegylated lipids, cationic lipids, exomes (lipid bilayers) both artificial and natural exosomes such as milk exosomes and spherical nucleic acids and others as described in further details in Roberts et al., 2020 (Thomas C Roberts, Robert Langer, Matthew J A Wood. Review Nat Rev Drug Discov. 2020 Oct;19(10):673-694. Advances in oligonucleotide drug delivery). The present invention further provides an in vitro method for decreasing NAT8L expression in a host cell which is expressing NAT8L, said method comprising administering the antisense oligonucleotide of the present invention, the conjugate of the present invention or the pharmaceutical composition of the present invention an effective amount to said cell. The present invention further provides a pharmaceutical composition comprising the antisense oligonucleotide of the present invention, the conjugate of the present invention, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant. Typically, a pharmaceutical composition comprises the antisense oligonucleotide or the conjugate of the present invention together with a pharmaceutically acceptable carrier and / or, in particular, a pharmaceutically acceptable excipient. The term "pharmaceutically acceptable", as used herein, refers to the non-toxicity of a material which, in certain exemplary embodiments, does not interact with the action of the oligonucleotide or the conjugate present in the pharmaceutical composition. The term “carrier”, as used herein, refers to an organic or inorganic component, of a natural or synthetic nature, in which the active component is combined in order to facilitate, enhance or enable application. The term “excipient”, as used herein, is intended to include all substances which may be present in a pharmaceutical composition and which are not active ingredients, such as salts, binders (e.g., lactose, dextrose, sucrose, trehalose, sorbitol, mannitol), fillers, lubricants, thickeners, surface active agents, preservatives, emulsifiers or buffer substances. The form of the pharmaceutical composition, the route of administration, the dosage and the regimen naturally depend upon the condition to be treated, the severity of the illness, the age, weight, and gender of the patient, etc. In an embodiment, the pharmaceutical composition can be formulated for intrathecal administration. Thus, the antisense oligonucleotide or conjugate of the present invention is preferably administered by intrathecal administration, a route of administration for drugs via an injection into the spinal canal. Thereby, it reaches the cerebrospinal fluid and the brain. The present invention further relates to the antisense oligonucleotide according to the present invention, the conjugate according to the present invention, or the pharmaceutical composition according to the present invention for use in medicine. Accordingly, the present invention relates to the antisense oligonucleotide according to the present invention, the conjugate according to the present invention, or the pharmaceutical composition according to the present invention for use treating Canavan disease. Further, the present invention relates to the use of the antisense oligonucleotide according to the present invention, the conjugate according to the present invention, or the pharmaceutical composition according to the present invention for the manufacture of a medicament for treating Canavan disease. Canavan disease, also referred to as Canavan–van Bogaert–Bertrand disease is a degenerative disease that is associated with a progressive damage to nerve cells and loss of white matter in the brain. The disease is inherited in an autosomal recessive manner. It is caused by mutations the ASPA gene which codes for the enzyme aspartoacylase. Decreased aspartoacylase activity prevents the normal breakdown of N-acetyl aspartate. Accordingly, the present invention relates to the antisense oligonucleotide according to the present invention, the conjugate according to the present invention, or the pharmaceutical composition according to the present invention for use in treating Canavan disease. Further, the present invention relates to the use of the antisense oligonucleotide according to the present invention, the conjugate according to the present invention, or the pharmaceutical composition according to the present invention for the manufacture of a medicament for treating Canavan disease. Further, the present invention relates to a method of treating Canavan disease, comprising administering pharmaceutically effective amount of the antisense oligonucleotide according to the present invention, the conjugate according to the present invention, or the pharmaceutical composition according to the present invention to a subject suffering from Canavan disease. The term “treating” or “treatment”, as used herein, refers to the administration of a compound or composition or a combination of compounds or compositions to a subject in order to: ameliorate Canavan disease. Thus, the term encompasses both the amelioration of one or more symptoms of the Canavan disease or prevention of the worsening of one or more symptoms, i.e. prophylaxis. The amelioration of symptoms also includes the reduction of one or more symptoms. Thus, the term, preferably, refers to the reduction of one or more symptoms of the disease. In other words, the treatment is typically a disease modifying treatment that reduces one or more symptoms of Canavan disease. In an embodiment, the development of disease pathology is inhibited. It will therefore be recognized that treatment as referred to herein may, in some embodiments, be prophylactic or disease modifying. It is to be understood that the treatment does not allow a complete cure of Canavan disease. Canavan disease is known to decrease the life expectancy. Thus, the term “treatment” also includes increasing the life expectancy of a subject (as compared to an untreated subject). In order to allow for the treatment of Canavan disease, it is to be understood that a pharmaceutically effective amount of the antisense oligonucleotide is administered to the patient. In accordance with the present invention, the subject to be treated is a subject suffering from Canavan disease. However, the patient might not yet show symptoms of Canavan disease at the time of the treatment. Typically, the subject shows symptoms of Canavan disease. Symptoms of Canavan disease are well known in the art and include (but are not limited to) one or more of lack of motor development, macrocephaly, lack of head control and abnormal muscle tone. Preferably, the subject has been diagnosed through genetic testing to suffer from Canavan disease. Typically, the disease is diagnosed at the infant age. Also typically, the diagnosis involves genetic testing and / or the detection of increased levels of N-acetylaspartic acid (NAA) in the urine. The terms “subject” and “patient” are used interchangeably herein. The “subject” or “patient” may be a vertebrate. The term includes both humans and other animals, particularly mammals, and other organisms. In some embodiments, the subject is a mammal. In some embodiments, the subject is a primate. Preferably, the subject is a human subject suffering from Canavan disease. All patents, patent applications, and publications or public disclosures referred to or cited herein are incorporated by reference in their entirety. The invention will be further described with reference to the examples described herein; however, it is to be understood that the invention is not limited to such examples. Examples Short introduction NAT8L targeting ASOs were tested in vitro in human cells either HEK293 cells or human glutamatergic-enriched cortical neurons derived from induced pluripotent stem cells (iPSC derived glutaneurons) to evaluated and confirm activity. This is exemplified in examples 1 and 2. Upon evaluation of the activity, selectivity profiles of the ASOs on the human transcriptome were established using RNAseq on RNA from human iPSC derived neurons treated with ASOs. ASOs engaging few off-target mRNAs are preferable. This is exemplified in example 3. Besides good in vitro activity and in vitro selectivity, in vivo tolerability and in vivo activity in mice were evaluated enabling the identification of ASOs with properties suited for therapeutics. Two different tolerability read-outs were evaluated, namely neurobehavioral signs following intracerebroventricular dosing (acute neurotoxicity) as well as weight gain up till 6 weeks post dose. These measures were compared to saline treated animals and ASOs with acceptable profiles on these two parameters were evaluated for their ability to reduce human NAT8L mRNA in an humanized mouse model. Oligonucleotide synthesis Oligonucleotide synthesis is generally known in the art and can be acquired from multiple different providers. In the listed in vitro experiments (example 1, 2 and 3) all oligonucleotides were acquired from Biosearch Technologies (Lystrup, Denmark). In brief, after cleavage from the solid support the oligonucleotides are cartridge purified using ammonium acetate; Dissolved to 750µM in PBS and purity determined by LC / MS (≥ 80%). In the listed in vivo experiments (example 4, 5 and 6) the oligonucleotides were acquired from WuXi Apptec (China). After cleavage from the solid support the oligonucleotides were HPLC- purified to >90% purity (LC-TOF / MS) and lyophylized as sodium salt followed by formulation in sterile 0,9 % sodiumchloride. Endotoxin test were performed (Kinetic turbidimetric or chromogenic LAL assay) to ensure endotoxin levels <1.0 EU / mg. Overview on antisense oligonucleotide compounds used in the Examples section can be found in Table A1.

[0002] Table A1: Overview on compounds used in the Examples section Target Target sequenc sequenc e e SEQ Target Sequence ASO ID 3L sequence (see Table 2 for explanations) Start in End in ID No ID SEQ ID SEQ ID NO: 1 NO: 1 66_124 6543 6559 8 TCUGTCTGTATATTCCA TlxElxUoxGdxTmxCdxTdxGdxTdxAdxTdxAdxTdxTdxCdxEmxAl 66 * 66_130 6543 6559 9 TCTGTCTGTATATTCCA TlxEmxTmxGdxTmxCdxTdxGdxTdxAdxTdxAdxTdxTdxEmoElxAl 66 * 66_707 6553 6569 10 AACACTTTACGTCTGTCT AlxAlxCdxAlxEmxTdxTdxTdxAdxEdxGdxTdxCdxTmxGlxTdxEmxTl 66 * 66_709 6553 6569 11 AACACTTTACGTCTGTCT AmxAmxElxAmoEmxTdxTdxTdxAdxEdxGdxTdxCdxTmoGmxTlxEmxTm 66 * 6553 6569 12 AACACTTTACGTCTGTCT 66_153 AlxAlxCdxAlxEmxTdxTdxTdxAdxCdxGdxTdxCdxTmxGlxTdxEmxTl 66 6553 6569 13 AACACTTTACGTCTGTCT 66_629 AmxAmxElxAmoEmxTdxTdxTdxAdxCdxGdxTdxCdxTmoGmxTlxEmxTm 66 6553 6569 14 AACACTTTACGTCTGTCT 66_619 AmxAmoElxAmoEmxTdxTdxTdxAdxCdxGdxTdxCdxTmoGmxTloEmxTm 66 6577 6594 15 AACTGTTTGTTTCCATTT 29_85 AlxAlxCdxTlxGdxTmxTdxTdxGdxTdxTdxTdxCdxCdxAdxTdxTlxTl 29 6577 6594 16 AACTGTTTGTTTCCAUTT 29_79 AlxAlxCoxTlxGdxTdxTdxTdxGdxTdxTdxTdxCdxCdxAdxUoxTlxTl 29 6579 6596 17 ACAACTGTTTGTTTCCAT 66_545 AloElxAdxAoxCdxTdxGdxTdxTdxTdxGdxTdxTlxTdxElxCoxAloTl 66 6579 659618ACAACTGTTTGTTTCCAT 29_124 AlxElxAdxAoxCdxTdxGdxTdxTdxTdxGdxTdxTlxTdxElxCoxAlxTl296543 6559 19 TCTGTCTGTATATTCCA 66_123 TlxElxTdxGdxTlxCdxTdxGdxTdxAdxTdxAdxTdxTdxCdxElxAl 66 *Compounds of the present invention **An overview on the annotation can be found in Table 2. The compounds 66_707 and 66_709 correspond to compounds 66_153 and 66_629, respectively, except that one cysteine residue is methylated in compounds 66_707 and 66_709. Thus, they are essentially identical. The residue which is methylated in Compounds 66_707 and 66_709 is

[0003] indicated in the above table in bold. The cysteine residue was methylated in order to reduce side effects (see Kariko et al., Immunity. 2005 Aug;23(2):165-75. doi: 10.1016 / j.immuni.2005.06.008.)

[0004] Example 1. Determination of ASO knock down activity on the human NAT8L mRNA by concentration response curve experiments. Potency expressed as EC50 values of NAT8L targeting ASOs in HEK293 cells. The HEK293 cells were maintained and expanded as recommended by the supplier. The cells were grown to 70-80% confluency, the cells are then trypsinized and resuspended in growth media. Viable cells are counted using trypan blue and Vi-CELL automatic cell counter (Beckman Coulter). The appropriate number of cells are diluted in complete growth media, mixed by gentle pipetting, added to reagent reservoirs, and distributed into 96-well plates using a multichannel pipette in a total volume of 190 µl / well. Sterile PBS is added to the moats of the 96-well culture plates (Nunc™ Edge™ 96-Well, Nunclon Delta-Treated, Flat-Bottom Microplates) to reduce evaporation and potential plate effect. After 24 h of incubation the NAT8L ASOs are added directly to the growth media from a 20-Fold stock dilution in PBS reaching a final ASO concentration of 0.01; 0.0316; 1; 0.316; 1.0; 3.16; 10 or 31.6 µM. Table A2 summarizes the most important parameters relating to the cellular work. Table A2: Information on HEK293 cells Cell Line Provider Culturing Seeding density Incubation Incubation conditions (cells / well) prior to ASO time with addition ASO HEK293 ATCC 5% CO22,500 cells / well in 190 24 h 120 h and 95% µl of media: DMEM + humidity 10% FBS + Sodium at 37 °C. pyruvate In addition to the ASOs designed to target NAT8L each plate also included wells with PBS controls (untreated ctrls). After 120 hours, cells were harvested by gently aspirating the growth media, addition of 125µl RLT buffer and RNA was extracted using the RNeasy 96, QIAcube HT kit (Qiagen #74171) according to the manufactures instructions and eluted in 75 µl of water. Before qPCR based expression analysis, 10 µl of the RNA containing eluate is transferred to a new plate and diluted 10-fold in RNAse free water, then heat chocked at 90°C for 40 s and placed on ice. The diluted and heat shocked RNA is used as input template for the qPCR, using qScript™ XLT One-Step RT-qPCR ToughMix® (cat# 95134-500) from QuantaBio and qPCR assays from Integrated DNA technologies (IDT). Gene of Interest (GOI) assay for NAT8L: Hs.PT.58.39061553; Probe HEX with ZEN / IBFQ double quencher and endogen normalizer assay for ATXN3: Hs.PT.58.39355049; Probe FAM with ZEN / IBFQ double quencher. The qPCR reaction was run in 384 wells using a QuantStudio 7 Flex (applied biosystems by Thermo Fisher Scientific). Quantities of NAT8L mRNA was calculated applying the ddCT method and using the median of all the PBS treated wells within the same plate as the ‘untreated control’. Incubating the cells with different concentrations of ASO (0.01; 0.0316; 1; 0.316; 1.0; 3.16; 10; 31.6 µM) allowed the generation of concentration response curves and calculation of EC50 values. Concentration response curves were generated using the GraphPad prism software version9 using the “log(inhibitor) vs. response -- Variable slope (four parameters)” fit with bottom constrained to >0 and top=100. EC50 values representing half-maximal effective concentration are shown in Table A3. Table A3: Expression levels of human NAT8L in HEK293 cells shown as %untreated control (%UTC) and as EC50 Values ASO HEK2 HEK2 HEK2 HEK2 HEK2 HEK2 HEK2 HEK2 EC50 ID 93 93 93 93 93 93 93 93 [M] 0.01u 0.032u 0.1uM 0.316u 1uM 3.16u 10uM 31.6u M M %UT M %UT M %UT M %UT %UT C %UT C %UT C %UT C C C C C 66_1 142.3 83.3 52.6 46.8 22.9 13.3 2.1 0.3 2,79E- 24 07 66_1 89.4 105.7 63.9 54.1 37.8 30.1 3.7 0.4 4,62E- 30 07 66_1 93.9 77.0 56.0 35.2 11.8 10.3 1.0 0.5 1,50E- 53 07 66_7 83.2 89.5 54.3 36.1 21.8 8.6 6.3 0.6 1,63E- 07 07 66_6 80.8 91.7 63.0 46.9 33.8 14.4 8.7 3.3 2,50E- 29 07 66_7 87.3 97.0 40.6 44.2 24.2 18.6 24.2 2.2 1,26E- 09 07 In conclusion, the concentration response experiments showed that highly potent compounds have been identified and that the introduction of a 5-methyl cytosine in ASO ID 66_707 and 66_709 gives rise to ASO with similar activity as the non-5-methlyated version as seen from the equally potent ASOs comparing 66_707 to 66_153 and comparing 66_709 to 66_629. Example 2. Testing in vitro efficacy and potency of antisense oligonucleotides targeting NAT8L in iPSC derived human neurons at multiple test concentrations. The activity of preferred ASOs were tested in iPSC derived human neurons to confirm activity and potency in a relevant cellular model. The iPSC derived neurons were maintained as recommended by the supplier (Fuji film, 01279). 96-well cell culture plates (Nunc™ Edge™ 96-Well, Nunclon Delta-Treated, Flat-Bottom Microplates) were coated with sterile 0.07% polyethylenimide for 1 hour, washed with PBS and water and coated with 0.01 mg / ml of laminin for 1 hour. The laminin solution was removed with no further washing of the culture plates and iPSC derived neurons were thawed and seated at a density of 80,000 neurons pr well as described in Fuji films: iCell GlutaNeurons User's Guide in a total volume of 190µl / well plates using a multichannel pipette. After 24 and 96 hours of incubation, half of the media was changed.96 hours after seeding NAT8L ASOs, are added directly to the growth media from a 20-Fold stock dilution in PBS reaching a final ASO concentration of either 1, 5 or 25 µM. Table A4 summarizes the most important parameters relating to the cellular work. Table A4: Information on iPSC derived neurons Incubation Incubation Culturing Seeding density prior to IPSC Provider time with conditions (cells / well) ASO ASO addition 80,000 cells / well in Gluta 5% CO2 and 190 µl of media as neurons Fujifilm 95% humidity at 96 h 96 h described by the (01279) 37 °C. provider Neurons were harvested after 96 hours treatment with ASO by gently aspirating the growth media, addition of 125µl RLT buffer and RNA was extracted using the RNeasy 96, QIAcube HT kit (Qiagen #74171) according to the manufactures instructions and eluted in 75 µl of water. qPCR experiments were carried out and data calculated as described in Example 1. The expression level of NAT8L following ASO treatment (Table A5) is thus shown as percent of the PBS-treated wells (%UTC). As for example 1, concentration response curves were generated using the GraphPad prism software version9 using the “log(inhibitor) vs. response -- Variable slope (four parameters)” fit with bottom constrained to >0 and top=100. EC50 values representing half-maximal effective concentration are shown in Table A5. Table A5: Expression levels of human NAT8L in iPSC derived neurons expressed as %Untreated Control (%UTC) and as EC50 Value (M). ASO ID Gluta neurons Gluta neurons Gluta neurons EC50 1uM 5uM 25uM [M] %UTC %UTC %UTC 66_124 20.2 5.1 0.5 1.72E-07 66_130 36.5 7.8 1.5 5.12E-07 66_707 41.1 15.8 2.5 6.76E-07 66_629 71.2 38.4 13.3 3.37E-06 66_709 65.7 51.7 17.7 3.54E-06 Evaluation of ASO in vitro activity in HEK293 cells and iPSC derived neurons shows good activity for all ASOs leading to significant reduction of NAT8L mRNA. Example 3: Off-target effects of selected gapmers in vitro Modified antisense oligonucleotides complementary to human NAT8L pre-mRNA were designed and tested for their transcriptome-wide off-target effects in human neurons by unassisted uptake. The ASO were tested at three different concentrations (1, 5, and 25 µM) and compared to PBS-treated controls in a series of experiments under similar conditions as described in examples 2. For each concentration typically three replicates were done. Libraries were prepared for RNA sequencing using standard poly-dT enrichment of isolated RNA, followed by mRNA fragmentation, strand-specific random-primed cDNA synthesis, and adapter ligation. Adapter-specific PCR amplification followed by paired-end read sequencing on an Illumina NovaSeq 6000 resulted in approximately 70 million paired end reads (2 x 150 bp) per sample (Eurofins Genomic). Reads were trimmed and mapped to the human genome (build GRCh38) using CLC Genomics workbench (version 23.0.5). Gene expression levels were estimated as counts of reads mapping to each gene divided by gene length as TPM (Transcripts Per Kilobase Million) values. For selected genes, concentration-response curves (CRCs) of RNA levels (as percent of PBS) after treatment with ASO at three different concentrations were analyzed by nonlinear least- squares fitting of a two-parameter logistic function (fitting parameters were slope and half- maximal effective concentration, EC50). Genes were selected for CRC analysis if they (1) showed significant and at least 25% reduction in RNA levels between PBS-treated samples and samples treated with 25µM ASO (by empirical Bayes-moderated t-statistics with a false discovery rate, FDR, below 5%), (2) showed general concentration-dependent reductions by ASO treatment (by one-sided multiple regression analysis, treating the concentrations of ASO at 0 (PBS), 1, 5 or 25 µM as the ordinal independent variable, and controlling the FDR below 5% from the resulting t-statistic for the linear trend), and (3) were not identified in 1 and 2 across multiple different ASOs with different nucleobase sequence. Those genes identified in 1 and 2 as significantly affected across ASOs with different nucleobase sequences were judged to be involved in a general transcriptional program responding to ASO treatment in human neurons. Only exception being NAT8L, which all ASOs target. Consequently, genes for which CRCs were fitted and EC50s estimated were exclusively seen for individual ASOs or for groups of ASOs with identical or near-identical nucleobase sequence. Such genes could therefore be hybridization-based off-targets or genes affected downstream of perturbing such off-targets. For each ASO, EC50 ratios between potential off-targets and the on-target (NAT8L) were calculated, grouped, and counted as shown in Table A6 below. The weaker the effect on the off-target compared to the on-target, the larger the EC50 ratio. Table A6. Number of potential off-targets stratified by their EC50 relative to NAT8L. Potential off-targets with EC50 values no more than 10-fold weaker than the NAT8L EC50 are shown in the ‘<10’ column, those with EC50 values between 10- and 20-fold weaker in the ’10 to 20’ column, and so forth. EC50 ratio range ASO ID <10 10 to 20 20 to 30 30 to 40 40 to 50 50 to 100 >100 66_153* 0 0 0 1 1 0 1 66_153* 0 0 0 1 0 9 19 66_124 1 2 0 3 0 7 6 66_130 1 3 3 2 4 1 2 66_629 3 2 1 1 2 0 0 29_85 4 3 4 3 1 23 18 29_79 4 3 3 1 1 11 17 66_545* 4 5 6 7 4 5 1 66_545* 8 4 4 4 2 7 8 29_124 84 2 0 2 0 1 1 *Evaluated in two independent experiments The number of reduced unintended genes varies for the different ASO IDs. For ASO IDs 29_85, 29_75, 66_545 and 29_124, at least 4 off-target transcripts with less the 10-fold difference in EC50 were identified and these ASOs do also have a higher number in the other EC50 ratio ranges compared to ASO IDs 66_153, 66_124, 66_130 and 66_629 showing that these ASOs are not very selective. Contrary, ASO IDs 66_153, 66_124, 66_130 and 66_629 show a low number of off-target effects, though these ASOs process selectivity properties suited for a pharmaceutical product. In vivo characterization of selected ASOs To test in vivo properties such as the acute toxicity potential of the NAT8L targeting ASOs, subacute tolerability out to 6 weeks or pharmacodynamics in a humanized mice model, mice were dosed intra cerebroventricular (ICV) and the above mentioned were measured as described below in example 4, 5 and 6. Example 4 – In vivo acute toxicity in mice of ASOs targeting NAT8L. Experimental mice: In vivo acute tolerability of the antisense oligonucleotides were tested in mice, with 5-6 mice per ASO group. Mice at 8-10 weeks of age were housed in European IVC cages type IIL with TAPVEI aspen bedding (Tapvei Eatonis Oü, Estonia). The cages were enriched with nesting material, wooden sticks and hiding material. The light cycle was 12-hour dark and 12-hour light. Diet was pelleted complete diet (Altromin 1324, Brogaarden), and municipal drinking water. Diet and water were administered ad libitum. All animals were inspected on daily basis for their general health condition. Any clinical signs or behavioral abnormalities was recorded. Humane endpoints and premature termination: Any animal showing clinical signs of moderate pain or moderate distress, or any degree of suffering was handled as appropriate, as discontinuation of the administration of test articles or euthanizing of the animal. Animals exhibiting clinical signs were humanely euthanized if they exceeded the limits of the study specific humane endpoints according to the European and Danish legislation on animals in experimentation. Administration by ICV injection: Pre-dosing analgesia was given at least 30 min before dosing was initiated; all animals received preventive pain treatment with Meloxicam (2 mg / kg SC). The mice were anesthetized with isoflurane before dosing. For injection, the G23 needle was mounted on a stand so it precisely penetrated 3.9 mm through the mouse's skull. The dose volume of 5 μL was injected over 30 seconds and the animal was then placed back in its cage and clinically observed according to the instructions below. Following dosing, the animals were observed closely. The assessment was performed according to a scoring scheme where a score of 0 to 4 was given for the following five parameters: activity level (increased or decreased activity, respectively), motor function, posture / presentation, and muscle tremors / cramps as outlined in Table A7. Scoring was performed before dose, 30 min and 60 min after dosing. A score <6 indicates that the ASO are acutely well tolerated.

[0005] Table A7: Outline of the scale to evaluate acute neurotoxicity in mice following intracerebroventricular dosing. Category Score 0 Score 1 Score 2 Score 3 Score 4 Hyperactivity, Normal · Very slightly increased · Increased home cage · Moderately increased · Marked stereotypies and home cage exploration exploration (incl. e.g. home cage activity. hyperactivity. home cage behavior or rearing compared to digging, burying) · Detectable · Marked stereotypies. controls · Increased grooming stereotypies (eg. circling, repetitive behaviours) Decreased vigilance, Normal · Some reduction in · Drowsiness · Stupor (reduced · Coma (does not exploration, and exploratory activity · Slightly reduced responsiveness, respond to stimulation responsiveness · Responds normally to response to touch or decreased corneal e.g. pinch), no corneal stimulation. handling. reflex) reflex Motor Normal · Mild changes to gait or · Reduced grip strength · Highly reduced grip · Severe ataxia (e.g. coordination and grip strength (falls (falls in less than 5 sec) strength (falls in less crawling; fails to grip strength between 5-10 sec) · Mild ataxia (e.g. slow than 2 sec) bar) · No falls, normal righting response; · Ataxia (e.g. · No ability to right righting response swaying) staggering, falling; impaired walking) Posture, Normal · Slightly abnormal · Moderately abnormal · Markedly abnormal appearance and · Very slightly abnormal posture (e.g. hunched, posture (e.g. ventral posture (e.g. lateral breathing posture (subtle). extended, low posture, recumbency) recumbency) tail position eg. Straub · Shallow breathing · Facial paralysis (e.g. tail) drooling, protruding · Piloerection or unkept tongue) · Laboured breathing

[0006] coat · Ptosis Tremor, hyper- Normal · Detectable tremor · Hyper-responsive to · Few or partial · Repeated or reactivity, stimuli (e.g. noise) seizures, rearing & continuous seizure convulsion · Marked tremor falling as a part of (running, bouncing, convulsing tonic and / or clonic)

[0007] Average neurobehavioral scoring at 1 hour post dose for a 50 µg dose or 100 µg dose is summarized in Table A8. If the mice had to be euthanized before 1 hour post dosing, they got a score of 20. All ASOs tested for acute tolerability were well tolerated as seen in Table A8 below. Table A8: Acute neurotoxicity in mice evaluated 1 h after ICV dosing of ASOs ASO Acute neurotox Acute neurotox ID 50µg 100µg 66_124 0.7 4.8 66_130 0.0 4.2 66_153 4.0 66_629 1.0 Example 5 – Sub acute tolerability in mice. As a measure of tolerability, the mice dosed ICV with the ASOs as described in example 4 were weighted twice a week and the weight gain relative to the day of dosing (day0) was calculated for each mouse before an average were calculated for each dosing group to get a tolerability measure for each ASO. A single dose of 50µg of ASO ID 66_123 did lead to significant weight loss and euthanization of the mice 2 weeks after dosing. This tolerability concern was clearly improved by ASO ID 66_124 and ASO ID 66_130, where treatment with 50 µg ASO ICV did not impact weight gain in the mice out to 42 days after dosing as seen in Table A9. A single dose of 100µg of ASO ID 66_153 and ASO ID 66_629 were well tolerated in the mice following an ICV dosing as seen from the clear weight gain out to 28 days as seen in Table A9.

[0008] Table A9: Weight gain expressed as % average weight relative to day0 in wild type mice out to 42 days after a single ICV dose of 50µg or 100µg Average Weight (% of saline weight Day day0) ASO ID 0 1 3 7 10 14 17 21 24 28 31 35 38 42 Saline 100.0 99.5 99.8 101.6 101.6 103.7 105.9 106.9 108.8 110.6 113.1 114.2 112.9 114.9 66_123 100.0 100.3 98.2 92.0 82.8 84.1 66_130 100.0 98.4 97.2 100.5 100.3 100.7 100.6 103.2 103.2 105.1 107.9 107.7 106.0 106.1 66_124 100.0 98.5 98.8 97.7 98.2 99.4 98.6 101.4 100.3 104.0 105.5 105.9 105.3 106.2 Day 0 1 3 7 10 13 16 20 23 28 Saline 100.0 99.7 102.5 103.3 104.7 108.9 108.4 110.1 108.5 112.4 66_629 100.0 99.4 100.2 103.2 102.1 105.8 106.7 108.6 109.3 110.5 Day 0 1 3 7 9 14 16 21 23 28 66_153 100.0 99.3 101.0 102.1 102.5 104.8 107.5 109.5 110.4 111.6

[0009] Example 6 – Single dose in vivo efficacy test in heterozygous humanized mice To evaluate the efficacy of a single dose, the most preferred ASOs were dosed ICV to a mouse model containing the human version of NAT8L, a humanized mice model. In vivo efficacy in the CNS was evaluated 1 week after dosing by necropsy and harvest of brain tissues. Mice were dosed and handled as described in Example 4. At necropsy 7 days after dosing mice were sacrificed by cervical dislocation. Brain tissue was sampled from hippocampus and cortex and dissected tissue was snap frozen in Precellys tube (CK14, 2 mL, Cat.no. P000912-LYSK0-A) by submerging in liquid nitrogen. The tissue was stored at -80°C until RNA purification. At the day of RNA extraction, the tissue sample (30-80 mg) was homogenized in 280 µL RLT buffer (Qiagen No.: 79216) using a Precellys 24 tissue homogenizer. The RNA was then extracted using TRIzol (ThermoFisher, Cat.no.15596023) in combination with a Qiacube (Qiagen) for automated RNA extraction. After extraction RNA concentrations were normalized to 2 ng / µl. The diluted RNA was used as input template for the qPCR, using TaqPath™ 1-Step RT- qPCR Master Mix, CG (ThermoFisher cat. No. A15299) and qPCR assays from Integrated DNA technologies (IDT) using Hs.PT.58.39061553 for human NAT8L and Ppia- Mm.PT.39a.2gs as endogenous normalizer. The qPCR reaction was run in singleplex on a Quantstudio 6 qPCR machine (ThermoFisher). The expression level of human NAT8L was calculated using the ddCt approach and normalized to the average level of NAT8L expression in samples from saline treated mice. A single 100µg dose of ASO ID 66_124, 66_130, 66_153 and 66_629 administered intracerebroventricular show significant reduction of human NAT8L relative to mouse ppia as endogenous control in the brain regions cortex and hippocampus of the humanized mice as seen in Table A10: Table A10: Levels of human NAT8L mRNA (normalized to mouse ppia) after ASO treatment (1-week) expressed as % of saline treated mice. Knock down Knock down ASO Cortex Hippocampus ID %saline %saline 66_124 23.2 20.7 66_130 37.0 29.9 66_153 40.8 24.3 66_629 47.3 35.5 Altogether, the examples show that ASO ID 66_124, 66_130, 66_153 and 66_629 can effectively reduce human NAT8L mRNA in HEK cells and in iPSC derived neurons, engage few off-target genes, are acutely and sub-acutely well-tolerated in mice after a single ICV dose as shown by neurobehavioral scorings as well as weight gain and showed good activity as seen as knock down of NAT8L across brain regions. Thus, ASO ID 66_124, 66_130, 66_153 and 66_629 all possess properties suited for a pharmaceutical product. For ASO ID Nos: 66_707 and 66_709 it was shown that they efficiently reduce human NAT8L mRNA in HEK cells. Since they, in principle, correspond to ASO ID 66_629 and 66_153, they are expected to have low off-target effects as well. Further, they are expected to be well tolerated in vivo.

Claims

Contera Pharma A / S September 27, 2024 COP16643PC1 Claims 1. An antisense oligonucleotide selected from the group of antisense oligonucleotides consisting of a) AlxAlxCdxAlxEmxTdxTdxTdxAdxEdxGdxTdxCdxTmxGlxTdxEmxTl (SEQ ID NO: 3, ASO ID 66_707), b) TlxEmxTmxGdxTmxCdxTdxGdxTdxAdxTdxAdxTdxTdxEmoElxAl (SEQ ID NO: 1, ASO ID 66_130), c) TlxElxUoxGdxTmxCdxTdxGdxTdxAdxTdxAdxTdxTdxCdxEmxAl (SEQ ID NO: 2, ASO ID 66_124), and d) AmxAmxElxAmoEmxTdxTdxTdxAdxEdxGdxTdxCdxTmoGmxTlxEmxTm (SEQ ID NO: 4, ASO ID 66_709), wherein Adx represents 2'deoxyadenosine-3' –phosphorothioate Aox represents 2'-O-methyladenosine-3'-phosphorothioate Amx represents 2'-O-Methoxyethyladenosine-3' -phosphorothioate Alx represents 2'-O-beta-D-oxy LNA adenosine-3' -phosphorothioate Cdx represents 2'deoxycytidine-3' -phosphorothioate Cox represents 2'-O-methylcytidine-3'-phosphorothioate Cmx represents 2'-O-Methoxyethyl-5-methylcytidine-3' -phosphorothioate Clx represents 2'-O-beta-D-oxy LNA -5-methylcytidine-3' -phosphorothioate Edx represents 2'deoxy-5-methylcytidine-3' -phosphorothioate Emx represents 2'-O-Methoxyethyl-5-methylcytidine-3' -phosphorothioate Elx represents 2'-O-beta-D-oxy LNA -5-methylcytidine-3' -phosphorothioate Gdx represents 2'deoxyguanosine-3' -phosphorothioate Gox represents 2'-O-methylguanosine-3'-phosphorothioate Gmx represents 2'-O-Methoxyethylguanosine-3' -phosphorothioate Glx represents 2'-O-beta-D-oxy LNA guanosine-3' -phosphorothioate Tdx represents 2'deoxythymidine-3' -phosphorothioate Tmx represents 2'-O-Methoxyethylthymidine-3' -phosphorothioate Tlx represents 2'-O-beta-D-oxy LNA thymidine-3' -phosphorothioate Uox represents 2'-O-methyluridine-3'-phosphorothioate Ado represents 2'deoxyadenosine-3' -phosphate Aoo represents 2'-O-methyladenosine-3'-phosphate Amo represents 2'-O-Methoxyethyladenosine-3' -phosphate Alo represents 2'-O-beta-D-oxy LNA adenosine-3' -phosphate Cdo represents 2'deoxycytidine-3' -phosphate Coo represents 2'-O-methylcytidine-3'-phosphateCmo represents 2'-O-Methoxyethyl-5-methylcytidine-3' -phosphate Edo represents 2'deoxy-5-methylcytidine-3' -phosphate Emo represents 2'-O-Methoxyethyl-5-methylcytidine-3' -phosphate Elo represents 2'-O-beta-D-oxy LNA -5-methylcytidine-3' -phosphate Gdo represents 2'deoxyguanosine-3' -phosphate Goo represents 2'-O-methylguanosine-3'-phosphate Gmo represents 2'-O-Methoxyethylguanosine-3' -phosphate Glo represents 2'-O-beta-D-oxy LNA guanosine-3' -phosphate Tdo represents 2'deoxythymidine-3' -phosphate Tmo represents 2'-O-Methoxyethylthymidine-3' -phosphate Tlo represents 2'-O-beta-D-oxy LNA thymidine-3' -phosphate Uoo represents 2'-O-methyluridine-3'-phosphate Ad represents 2'deoxyadenosine' Ao represents 2'-O-methyladenosine Am represents 2'-O-Methoxyethyladenosine Al represents 2'-O-beta-D-oxy LNA adenosine Cd represents 2'deoxycytidine Co represents 2'-O-methylcytidine Ed represents 2'deoxy-5-methylcytidine Em represents 2'-O-Methoxyethyl-5-methylcytidine El represents 2'-O-beta-D-oxy LNA -5-methylcytidine Gd represents 2'deoxyguanosine Go represents 2'-O-methylguanosine Gm represents 2'-O-Methoxyethylguanosine Gl represents 2'-O-beta-D-oxy LNA guanosine Td represents 2'deoxythymidine Tm represents 2'-O-Methoxyethylthymidine, Tl represents 2'-O-beta-D-oxy LNA thymidine, and Uo represents 2'-O-methyluridine.

2. An antisense oligonucleotide shown in Fig.1, Fig.2, Fig.3, or Fig.

4.

3. A conjugate comprising the antisense oligonucleotide of claim 1 or 2, and at least one conjugate moiety covalently attached to said antisense oligonucleotide.

4. A pharmaceutical composition comprising the antisense oligonucleotide of claim 1 or 2, the conjugate of any one of claims 3, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

5. An in vitro method for decreasing NAT8L expression in a host cell which is expressing NAT8L, said method comprising administering the antisense oligonucleotide of claim1 or 2, the conjugate of claim 3 or the pharmaceutical composition of claim 4 an effective amount to said cell.

6. A method for treating Canavan disease comprising administering a pharmaceutically effective amount of the antisense oligonucleotide of claim 1 or 2, the conjugate of claim 3 or the pharmaceutical composition of claim 4.

7. The antisense oligonucleotide the antisense oligonucleotide of claim 1 or 2, the conjugate of claim 3 or the pharmaceutical composition of claim 4 for use in treating Canavan disease.

8. Use of the antisense oligonucleotide of claim 1 or 2, the conjugate of claim 3 or the pharmaceutical composition of claim 4, for the manufacture of a medicament for the treatment of Canavan disease.