Brincidofovir for treatment of multiple sclerosis

Abstract

The invention features methods of treating multiple sclerosis in subjects having reactivated Epstein-Barr virus by administration of brincidofovir.

Description

BRINCIDOFOVIR FOR TREATMENT OF MULTIPLE SCLEROSISSEQUENCE LISTING

[0001] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on September 26, 2024, is named 51007- 029WOl_Sequence_Listing_9_26_24 and is 3,619 bytes in size.GOVERNMENT INTERESTSPARTIES TO A JOINT RESEARCH AGREEMENT

[0002] This invention is a jointly made subject invention under the Public Health Service Cooperative Research and Development Agreement (PHS-CRADA) no. 2022- 0300_NINDS8117 between the National Institute of Neurological Disorders and Stroke (NINDS) at the National Institutes of Health and SymBio Pharmaceuticals Limited. The Government of the United States of America has certain rights in this invention.TECHNICAL FIELD

[0003] The technical field of the present invention relates to the treatment of diseases, including but not limited to multiple sclerosis.BACKGROUND

[0004] Multiple sclerosis (MS) is a chronic inflammatory demyelinating disease of the central nervous system. MS is a global problem, and its prevalence is on the rise. Lancet Neurol. 2019 Mar; 18(3): 269-285. The pathophysiology and etiology of MS is complex, with several environmental, infectious, genetic, nutritional and epigenetic components potentially playing a causative role in onset and disease course. Disease modifying therapy (DMT) has been utilized to delay the progression of MS. Drugs available for DMT include interferons, glatiramer acetate, sphingosine- 1 -phosphate receptor modulators, teriflunomide, cladribine, fumarates, and monoclonal antibodies such as Natalizumab. In addition, there are several ongoing phase III clinical trials investigating BTK inhibitors, a novel class of MS neurotherapeutics. BTK inhibitors include evobrutinib, tolebrutinib, and fenebrutinib. MoeinAmin et al. Neurodegener Dis Manag. 2023 Feb; 13(1): 47-70.

[0005] Epstein-Barr virus (EB V) is a ubiquitous human y-herpesvirus that commonly infect human. EBV causes asymptomatic life-long latent infection, with occasional reactivation. Murata et al., Viruses. 2021 Dec; 13(12): 2344. EBV establishes latent infection in memory B cells, and it can transform resting B cells into lymphoblastoid cell lines (LCLs). While the role of EBV in cancers is established, its role in MS is less clear. Kenney et al., Semin Cancer Biol. 2014 Jun:26:60-8. Using data from US military recruits monitored over a 20-year on more than 10 million young adults, 955 of whom were diagnosed with MS during their period of service, a 32-fold increased risk of MS was observed after infection with EBV in comparison with infection with other viruses. K Bjornevik et al. Science, Jan 13, 2022, Vol. 375, No. 6578,.296-301. T V. Lanz, et al., Nature. Jan 24, 2022; 603, 321-327 suggests that there is a high-affinity molecular mimicry between the EBV transcription factor EBV nuclear antigen 1 (EBNA1) and the central nervous system protein glial cell adhesion molecule (GlialCAM). This structural mimicry contributes to MS development by causing the immune system, which is supposed to eliminate EBV, to mistakenly target and attack GlialCAM in the myelin. EBV infection is also linked to infectious mononucleosis (IM). In a cohort of 150 persons with an acute illness serologically confirmed as EBV infection, common symptoms of IM were experienced by about 75% participants at 1- month follow up visit. T. D Rea, et al., J Am Board Fam Pract 14, 234-242 (2001).

[0006] Some studies, such as therapies targeting the B cells, have reported on how to treat MS. For example, anti-CD20 monoclonal antibodies that selectively binds transmembrane CD20 protein, deplete B cells expressing the protein, and suppress inflammatory disease activity have been investigated for MS treatment. J. Seze et al., Front. Immunol., Vol. 14, March 23, 2023. However, treatment using anti-CD20 monoclonal antibody decreases overall B cells.

[0007] A phase I clinical trial of EBV-specific T cell therapy based on the observed quantitative deficiency of EBV specific T-cell in MS patients and the hypothesis that EBV- specific T cell therapy should kill EBV-infected B cells in the CNS and thus prevent disease progression and lead to clinical improvement, has been reported, where patients were treated with in vitro expanded T cells targeting only EBV-infected B cells. M. P. Pender et al., JCI Insight 5, 2020.SUMMARY OF THE INVENTION

[0008] The prevalence of MS is increasing worldwide, and conventional therapeutic approaches alone have been insufficient.

[0009] The present inventors have conducted intensive research and as a result, surprisingly, it has been shown that brincidofovir (BCV) significantly reduces the survival rate of EBV- infected B cells in MS patients. From this, it was found that BCV can be used to treat MS by significantly reducing the survival rate of EBV-infected B cells in MS patients. In addition, it was found that selective treatment of patients with high MS treatment efficacy when using BCV can be achieved by identifying MS patients with reactivated EBV and administering BCV to them. Specifically, an aspect of the present invention provides a method of treating MS comprising: detecting reactivation of EBV in a subject having MS, specifying the subject having MS with reactivated EBV as a treatment target, and administering a therapeutically effective amount of BCV to the subject having MS with reactivated EBV. With this treatment method, MS can be treated with a novel treatment approach. With this treatment method, patients with a high treatment effect for MS when using BCV can be treated selectively.BRIEF DESCRIPTION OF THE FIGURES

[0010] The present invention may be more readily understood by reference to the following drawings, wherein:[ 00 1 1 ] Figures 1 A- IB provide graphs and images showing the results of the generation and growth of the spontaneous lymphoblastoid B-cell lines (SLCLs) caused by endogenous EBV from MS patients and healthy donor control.

[0012] Figure 2 provides a graph showing the results of the increased EBV viral load in SLCLs from MS active patients.[ 00 1 3 ] Figures 3A-3C provide graphs showing the results of the effect of different concentrations of BCV on cell viability and cell number in the spontaneous lymphoblastoid B-cell lines caused by endogenous EBV (EBV+ SLCLs) and EBV- cell line.

[0014] Figures 4A & 4B provide graphs showing the results of the effects of different concentrations of BCV on EBV viral load in EB V+ SLCLs from both MS patients and healthy donor controls.[ 00 1 5 ] Figures 5A & 5B provide graphs showing the results of examining the expression levels of Zta mRNA, an EBV-related molecule, in the spontaneous lymphoblastoid B cell line that has reactivated EBV.[ 00 1 6 ] Figure 6 A provides graphs showing the results of examining the expression levels of EBNA1 mRNA, an EBV-encoded gene, in PBMCs which EBV was reactivated. Figure 6B shows the results of analyzing the potential of EBV reactivation and the generation of SLCL in PBMCs.DETAILED DESCRIPTION OF THE INVENTIONDefinitions

[0017] The terminology as set forth herein is for description of the embodiments only and should not be construed as limiting of the invention as a whole. As used in the description of the invention and the appended claims, the singular forms “a”, “an”, and “the” are inclusive of their plural forms, unless contraindicated by the context surrounding such.[ 00 1 8 ] The invention is inclusive of the compounds described herein in any of their pharmaceutically acceptable forms, including isomers (e.g., diastereomers and enantiomers), tautomers, salts, solvates, polymorphs, prodrugs, and the like. In particular, if a compound is optically active, the invention specifically includes each of the compound's enantiomers as well as racemic mixtures of the enantiomers. It should be understood that the term "compound" includes any or all of such forms, whether explicitly stated or not (although at times, "salts" are explicitly stated).[ 00 1 9 ] A “subject,” as used herein, can be any animal, and may also be referred to as the patient. Preferably the subject is a mammal, such as a research animal (e.g., a monkey, rabbit, mouse or rat) or a domesticated farm animal (e.g., cow, goat, horse, pig) or pet (e.g., dog, cat). In some embodiments, the subject is a human. The subject may be, for example, a subject who requires treatment for MS, a subject with MS, a subject who has been diagnosed as having developed MS, a subject who is suspected of having developed MS, a subject with reactivated EBV, or a subject who has blood or PBMCs with reactivated EBV.

[0020] Treat", "treating", and "treatment", etc. , as used herein, refer to any action providing a benefit to a subject having a disease, including improvement in the condition through lessening or suppression of at least one symptom, delay in progression of the disease, etc. Treatment, as used herein, can also include reducing the viral load within cells infected with EBV.

[0021] As used herein, the term “prevention” includes either preventing or decreasing the risk of developing a disease or disorder. This includes prophylactic treatment of those having an enhanced risk of developing a disease or disorder. An elevated risk represents an above- average risk that a subject will develop a particular disease or disorder, which can be determined, for example, through family history or the detection of genes causing a predisposition to develop a particular disease or disorder.

[0022] “Pharmaceutically acceptable” as used herein means that the compound or composition is suitable for administration to a subject for the methods described herein, without unduly deleterious side effects in light of the severity of the disease and necessity of the treatment.

[0023] The terms “therapeutically effective” and “pharmacologically effective” are intended to qualify and / or quantify the amount of each agent which will achieve the goal of decreasing disease severity while avoiding adverse side effects such as those typically associated with alternative therapies. The therapeutically effective amount may be administered in one or more doses. An effective amount, on the other hand, is an amount sufficient to provide a significant chemical effect, which may or may not affect disease severity.Methods of Treatment

[0024] One aspect the invention provides a method of treating multiple sclerosis (MS) in a subject, the method comprising: administering a therapeutically effective amount of brincidofovir (BCV) to the subject. In some embodiments, the subject has MS with reactivated EBV. In some embodiments, the method further comprises detecting reactivated EBV as a treatment target. With these treatment methods, MS can be treated with a novel treatment approach. With these treatment methods, patients with a high treatment effect for MS when using BCV can be treated selectively.

[0025] In some embodiments, the number of cells in which EBV is reactivated in the subject is reduced by the BCV administration step. In some embodiments, the number of B cells inwhich EBV is reactivated in the subject is reduced by the BCV administration step. In some embodiments, the reduction in cell number is caused by a reduction in expression of Zta or EBNA1 due to BCV. In some embodiments, viability of cells in which EBV is reactivated in the subject is reduced by the BCV administration step. In some embodiments, viability of B cells in which EBV is reactivated in the subject is reduced by the BCV administration step. In some embodiments, the reduction in viability is accompanied by a decrease in expression of Zta or EBNA1 due to BCV. In some embodiments, the reduction or decrease is a 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100% reduction or decrease compared to the case where the subject is not treated with BCV. The extent of the reduction or decrease may be within the range of any two of these values.

[0026] In some embodiments, the detecting step includes detecting an antibody against EBV antigen or detecting EBV genomic DNA. Detection of EBV reactivation in an MS patient can be performed, for example, by detecting an antibody to an EBV antigen in a sample (e.g., plasma or PBMC) or EBV genomic DNA. Information on EBV reactivation can be obtained, for example, in Wandinger et al., Neurology. 2000 Jul 25;55(2): 178-84 or Murata et al., Viruses. 2021 Dec; 13(12): 2344. The sample includes, for example, blood sample (e.g. plasma or serum) or PBMC sample. For example, when antibodies to EBV antigen or EBV genomic DNA are detected in the blood sample or PBMC sample, BCV may be administered to the patient who provided the sample. In this way, it is possible to selectively treat patients who are highly likely to respond well to BCV-based treatment for MS. The EBV antigen may be, for example, pl38 (BALF2), p54 (BMRF1), or Zta. The antibody to be, for example, detected may be an antibody that recognizes an early antigen (e.g., pl38 (BALF2) or p54 (BMRF1)). The antibody may be, for example, IgA or IgM, or it may be IgG. The antibody may be detected, for example, by an ELISA assay (enzyme-linked immunosorbent assay) in which the antigen recognized by the antibody is immobilized on a solid phase surface. A method for detecting the antibody in the sample may include, for example, a step of contacting a sample containing the antibody with a solid phase having the antigen, or a step of detecting the antibody bound to the antigen. The antibody bound to the antigen may be, for example, detected by combining it with a labeled secondary antibody. The detecting step may include, for example, a step of contacting a labeled secondary antibody to the antibody bound to the antigen, or a step of detecting enzyme activity. After the contact step, there may be, for example, a washing step. The detecting step may include, for example, a step of collecting a sample from the patient. The detecting step may include, for example, a step of measuring absorbance (e.g., at a wavelength of 450 nm). The detecting step may include, for example, astep of measuring the titer of EBV antigen-specific antibodies. The solid phase may be, for example, a plate (e.g., a microplate). The label may be, for example, an enzyme label. For the detection of enzyme activity, a substrate may be used, and the substrate may be a substrate whose absorbance spectrum changes by reaction. The enzyme may include, for example, peroxidase, alkaline phosphatase, or P-galactosidase. The substrate may include, for example, DAB (3,3'-Diaminobenzidine), BCIP / NBT (5-Bromo-4-chloro-3'-indolylphos-phatase / Nitroblue tetrazolium), or X-Gal (5-Bromo-4-Chloro-3-Indolyl-P-D-Galactoside). pl38 (BALF2) can be the protein indicated by the UniProt primary accession number: P03227. p54(BMRFl) can be the protein indicated by the UniProt primary accession number: P03191. Zta can be the protein indicated by the UniProt primary accession number: P03206. For example, the MS patient has a sample (e.g., plasma), and an absorbance value when the sample is used in the above method may be 0.13 or more compared to an absorbance value when the negative control is used in the above method. The 0.13 or more may be, for example, 0.13, 0.15, 0.17, 0.2, 0.3, 0.4, or 0.5 or more, or may be within the range of any two of those values. For example, when an absorbance value obtained using the sample from the MS patient is 0.13 or more compared to an absorbance value obtained using a negative control, it may be assessed that EBV is reactivated. The EBV genomic DNA to be detected may be, for example, detected by a PCR method (e.g., quantitative PCR) using DNA extracted from the sample (e.g., plasma). Detection of EBV genomic DNA may be performed by detecting EBV- derived genes. Detecting EBV genomic DNA includes detecting a portion of the EBV genomic DNA. The extraction may be, for example, performed using NucliSens Extractor (Organon Teknika, Boxtel, The Netherlands) using a silica-based nucleic acid isolation method from 0.5 to 1.5 mL of plasma. The 0.5 to 1.5 mL may be, for example, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, or 1.5 mL, or may be within the range of any two of those values. The PCR may be performed using, for example, primers or a fluorescent-labeled probe corresponding to the EBNA1 gene (EBNA-1 forward: 5'CCGGTGTGTTCGTATATGGAG3' (SEQ ID NO: 1), EBNA-1 reverse: 5'GGGAGACGACTCAATGGTGTA3' (SEQ ID NO: 2), EBNA-1 probe: 5'TGCCCTTGCTATTCCACAATGTCGTCTT3' (SEQ ID NO: 3) optionally labeled at the 5' or 3' end with VIC or TAMRA. The copy number of EBV genomes in plasma can be calculated, for example, from the calibration curve obtained from DNA extracted from a human Burkitt's lymphoma cell line, Namalwa (with 2 copies of the EBV genome). For example, a sample (e.g., plasma) is obtained from a MS patient, and the gene copy number when the sample is used in the above method may be 10 or more. The 10 or more may be, for example, 10, 20, 30, 40, 50, 100, 1000, 10000, or 100000 or more, or may be within the range of any two of those values. For example, when 10 or more copies of thegene are detected per 1 mL of sample, it may be assessed that EBV is reactivated.

[0027] In some embodiments, the treatment method further comprises diagnosing whether the subject has MS, and specifying the subject having MS as a candidate for treatment, wherein the specified subject is tested for reactivation of EBV. The subject having MS with reactivated EBV does not include, for example, a subject diagnosed as being in a latent infection state of EBV. The subject having MS with reactivated EBV may include, for example, a subject diagnosed as being in a lytic infection state of EBV. The treatment method may further include, for example, a step of administering an antiviral agent to the subject. The treatment method may further include, for example, a step of administering an additional MS treatment to the subject.

[0028] In some embodiments, the MS is relap sing-remitting multiple sclerosis (RRMS), primary progressive multiple sclerosis (PPMS), or secondary progressive multiple sclerosis (SPMS). In some embodiments, the identifying step includes identifying the subject for administration of the drug. In some embodiments, the identifying step includes selecting the subject.

[0029] An embodiment of the invention provides a method of inhibiting Epstein-Barr Virus (EBV) or reducing EBV viral load in non-cancerous B-cells infected with EBV in a subject comprising administering a therapeutically effective amount of brincidofovir (BCV) to the subject. With this anti-EBV method, EBV viral load in non-cancerous B-cells infected with EBV can be inhibited, reduced, or suppressed by a novel therapeutic approach.

[0030] Epstein-Barr virus (EBV) is a ubiquitous human y-herpesvirus. EBV infection causes non- cancerous or cancerous diseases. Examples of the non-cancerous diseases caused by EBV infection include infectious mononucleosis (IM), “Prospective study of the natural history of infectious mononucleosis caused by Epstein-Barr virus,” T. D Rea, et al., J Am Board Fam Pract 14, 234- 242 (2001); and multiple sclerosis (MS), "Longitudinal analysis reveals high prevalence of Epstein-Barr virus associated with multiple sclerosis " K Bjornevik et al., Science, Jan 13, 2022, Vol. 375, No. 6578, .296-301. In some embodiments, the non- cancerous disease is caused by B- cells infected by EBV.

[0031] The term “infected with EBV” refers to cells or a subject in which EBV virus particles have been detected. Methods of detecting EBV infection are described in greater detail herein regarding diagnostic methods. Reducing EBV viral load refers to decreasing the number ofEBV virus particles in cells or in a subject. Reducing the viral load can include reducing the viral load by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or in some cases even by 100%.

[0032] Brincidofovir (BCV) includes a compound having the structure represented by the following formula. BCV may also be denoted by the IUPAC name of [(2S)-l-(4-amino-2- oxopyrimidin-l-yl)-3-hydroxypropan-2-yl]oxymethyl-(3-hexadecoxypropoxy)phosphinic acid. Known salt forms of BCV include sodium BCV and ammonium BCV. The term BCV may include the form of a salt of BCV or a solvate thereof having the formula:

[0033] B-cells, are also known as B lymphocytes, which are the effectors of immunity and provide defense from pathogens. Non-cancerous B-cells are also known as non-malignant B- cells. Abnormal B-cell recognition of self-antigen is related to autoimmune diseases. Examples of abnormal B-cell related autoimmune diseases include multiple sclerosis (MS). “B-lymphocyte contributions to human autoimmune disease.” Yanaba K, el al., Immunol Rev. 2008 Jun;223: 284- 99.

[0034] In some embodiments, B-cells infected with EBV have caused an autoimmune disease in the subject, such as MS or a non-MS autoimmune disease. Examples of non-MS autoimmune diseases include ME / CSF (Myalgic | Encephalomyelitis / Chronic fatigue syndrome). In some embodiments, the B-cells (cancerous or non-cancerous) are derived from an individual with multiple sclerosis (MS). In other embodiments, the B-cells (cancerous or non-cancerous) are derived from an individual without MS.

[0035] An embodiment of the present invention provides a method for treatment of non- cancerous diseases that are associated with EBV infection, comprising the step of administering to a subject a therapeutically effective amount of BCV. With this treatment method, non-cancerous diseases that are associated with EBV infection can be treated by a novel therapeutic approach. In some embodiments, the non-cancerous disease associated with EBV infection is MS. In further embodiments, the non-cancerous disease associated with EBV infection is IM. In yet further embodiments, the non-cancerous disease associated withEBV infection may be both MS and IM.

[0036] The above treatment method may include a diagnostic step. For example, it can include a step of identifying a subject with a non-cancerous disease associated with EBV infection as a target for treatment. Other diagnostic steps can include identifying a subject having MS, a subject not having MS, or a subject having an autoimmune disease caused by B-cells infected with EBV. In some embodiments, the presence of EBV in the subject is detected before the administration of BCV.

[0037] In some embodiments, an additional antiviral agent (i.e., drug for inhibiting viral replication) is administered to the subject. Examples of antiviral agents include acyclovir, desciclovir, ganciclovir, interferon-alfa, interferon-gamma, adenine arabinoside, valacyclovir, valganciclovir, tenofovir, and phosphonoacetic acid.

[0038] The above prevention method may include, for example, a step of identifying a subject with a risk of a non-cancerous disease associated with EBV infection as a target for prevention, a step of administering to a subject a therapeutically effective amount of BCV, a step of inhibiting or suppressing EBV viral load in the subject, or a step of preventing the non-cancerous disease associated with EBV infection in the subject. Examples of a subject who may be identified include a patient with a risk of MS, a patient with a risk of autoimmune diseases caused by B-cells infected with EBV, a patient with a risk of IM, and a patient with a risk of MS afflicted with IM.

[0039] An embodiment of the present invention provides a method for prevention of non- cancerous diseases that are associated with EBV infection, comprising the step of administering to a subject a therapeutically effective amount of BCV. With this prevention method, non- cancerous diseases that are associated with EBV infection can be prevented by a novel therapeutic approach. In some embodiments, the non-cancerous disease is MS. In some embodiments, the non-cancerous disease is ME / CSF (Myalgic Encephalomyelitis / Chronic fatigue syndrome). In further embodiments, the non- cancerous disease may be IM. In yet further embodiments, the non-cancerous disease may be more than one non-cancerous disease, such as both MS and IM. Note that it may also be useful to prevent MS from developing in a subject who has previously had IM.

[0040] Another aspect of the invention provides a method of treating or preventing multiple sclerosis (MS) in a subject comprising administering a therapeutically effective amount ofBCV to the subject. In some embodiments, the method is used to treat MS, and in other embodiments the method is used to prevent MS. Methods of prevention may include, for example, the step of identifying risk of MS in a subject. In some embodiments, the MS is prevented in a subject who has or has previously developed IM. In some embodiments, the subject has reactivated EBV.

[0041] Multiple sclerosis is a disease of the central nervous system characterized by inflammation, blood-brain barrier breakdown, demyelination, lesion formation and axonal damage. Guan Y, el al., “The role of Epstein-Barr virus in multiple sclerosis: from molecular pathophysiology to in vivo imaging,” Neural Regen Res. 2019 Mar;14(3):373-386. Infectious mononucleosis (IM), is known to increases the risk of developing MS. A diagnosis of MS often relies on ruling out other conditions that might produce similar signs and symptoms. Examples of tests that may be recommended include blood test, spinal tap, MRI, and evoked potential test. The therapeutic effect on MS may be evaluated by monitoring the MS signs or symptoms. Examples of MS include relapsing remitting multiple sclerosis and progressive multiple sclerosis.

[0042] In some embodiments, additional treatment for MS is provided to the subject. Examples of additional treatment for MS includes administration of interferon, anti-CD20 antibodies (e.g., ofatumumab, ocrelixumab, rituximab, obinutuzumab, ibritumomab), glatiramer acetate, fingolimod, teriflunomide, mitoxantrone, siponimod, cladribine, oxanimod, ponesimod, natalizumab, alemtuzumab, ocrelizumab and ofatumumab. and / or dimethyl fumarate.

[0043] Another aspect of the invention provides a method of treating or preventing infectious mononucleosis in a subject comprising administering a therapeutically effective amount of BCV to the subject. The method can include the step of diagnosing the subject with infectious mononucleosis. Infectious mononucleosis (IM, mono), also known as glandular fever, is an infection usually caused by the EBV. Most people are infected by the virus as children, when the disease produces few or no symptoms. In young adults, the disease often results in fever, sore throat, enlarged lymph nodes in the neck, and fatigue.Diagnostic Methods

[0044] The treatment methods described herein may include a diagnostic step.

[0045] An embodiment of the present invention provides a method of predictingsusceptibility to BCV in MS, comprising testing for reactivation of EBV in a sample from a MS subject. This method can be used to predict or identify a subject with high or low susceptibility to BCV by utilizing reactivation of EBV as an indicator. Therefore, this method can be used to implement more appropriate BCV treatment. For example, if a subject's EBV is reactivated and it is predicted that the subject will be highly susceptible, it may be chosen to administer BCV. For example, if a subject's EBV is not reactivated and it is predicted that the subject will be less susceptible, it may be chosen not to administer BCV.

[0046] An embodiment of the present invention provides a method of determining a subject with MS to be administered BCV, comprising testing for reactivation of EBV in a sample from the subject. Utilizing this method provides more appropriate BCV treatment. From another perspective, an embodiment of the present invention provides a method of diagnosing whether a subject having MS is a subject highly susceptible to BCV, comprising testing for reactivation of EBV in a sample from the MS subject. From another perspective, an embodiment of the present invention provides a method of predicting the efficacy of BCV in a MS subject, comprising testing for reactivation of EBV in a sample from the MS subject. From another perspective, an embodiment of the present invention provides a method of selecting an MS subject who is expected to show a therapeutic effect of BCV, comprising testing for reactivation of EBV in a sample from the MS subject. From another perspective, an embodiment of the present invention provides a method of obtaining an indicator for determining whether to implement a treatment method using BCV, comprising testing for reactivation of EBV in a sample from the MS subject. For example, the method may include (a) obtaining a sample from a subject, or (b) detecting reactivation of EBV by contacting a sample with a reagent for detecting reactivation of EBV. For example, the method may include an auxiliary method. The auxiliary may include assisting in the consideration or determination of a treatment target, a treatment method, or a diagnostic method. For example, the method may be carried out in vitro, ex vivo, or in vivo, depending on the purpose.

[0047] An embodiment of the present invention provides a method of detecting reactivation of EBV from a sample of an MS subject susceptible to BCV, comprising (a) obtaining a sample from the subject or (b) detecting an antibody against EBV antigen or EBV genomic DNA in the sample, thereby detecting reactivation of EBV in the sample. This method can be used to detect reactivation of EBV in the sample of an MS subject susceptible to BCV. For example, by detecting reactivation of EBV, it is possible to treat the subject while anticipating that BCV will have a positive therapeutic effect.

[0048] For example the methods can include the step of (i) identifying a subject with reactivated EBV as a target for BCV treatment, (ii) administering BCV to a subject with reactivated EBV, (iii) identifying a subject with non-cancerous B-cells infected with EBV as a target for anti-EBV treatment, (iv) identifying a subject with non-cancerous B-cells infected with EBV with MS or without MS as a target for anti-EBV treatment, (v) identifying a subject with non-cancerous B-cells infected EBV without MS but with autoimmune diseases as a target for anti-EBV treatment, (vi) detecting EBV in non-cancerous B-cells in the subject, (vii) detecting whether or not the subject is infected with EBV in non-cancerous B-cells, or (viii) detecting EBV in the non-cancerous B-cells collected. If one or more of these diagnostic steps are included in the method, it can be useful for identifying a particular population in order to provide increased therapeutic efficacy. When two or more of the above steps are employed, any order is acceptable. The order can be determined according to the desired method. These steps may be performed before or after the step of administering to a subject a therapeutically effective amount of BCV. The detection may be carried out using the gene level, the mRNA level, the protein level, or gene translocation as an indicator.

[0049] Examples of the subject in the above diagnostic methods include a patient suffering from MS. Examples of the subject include a patient without suffering from MS. Examples of the subject include a patient without suffering from MS but from autoimmune diseases caused by B-cells infected with EBV. Examples of the subject include a patient suffering from IM. Examples of the subject include a patient suffering from MS who has previously been afflicted with IM.

[0050] An embodiment of the present invention provides a method of identifying a subject to be treated with a therapeutically effective amount of BCV, comprising the step of detecting the need for treatment or prevention with a therapeutically effective amount of BCV. Here, some examples of the subject include a patient suffering from MS, a patient with a risk of MS, a patient suffering from autoimmune diseases caused by B-cells infected with EBV, a patient with a risk of autoimmune diseases caused by B-cells infected with EBV, a patient suffering from IM, a patient having an increased risk of developing IM, a patient suffering from both MS and IM, or a patient with a risk of MS who was previously afflicted with IM.

[0051] The methods can include the steps of providing a biological sample from the subject. Biological samples include, but are not limited to bodily fluids such as saliva, urine and blood- related samples (e.g., whole blood, serum, plasma, peripheral blood lymphocytes (PBMC)and other blood-derived samples), urine, cerebral spinal fluid, bronchoalveolar lavage, and the like. Another example of a biological sample is a cell sample or a tissue sample. The levels of an indicator in a biological sample taken from the subject can be assessed either quantitatively or qualitatively, and can be determined either in vivo or in vitro. In some embodiments, the biological sample comprises blood, plasma, or serum.

[0052] The biological sample can be provided by immediately obtaining a biological sample from the subject, or a biological sample can be provided that was previously obtained. A biological sample may be fresh or stored (e.g., blood or blood fraction stored in a blood bank). Samples can be stored for varying amounts of time, such as being stored for an hour, a day, a week, a month, more than a month, years and decades of storage. The biological sample may be a bodily fluid expressly obtained for use in the methods of this invention or can be a bodily fluid obtained for another purpose which can be subsampled for the assays of this invention.

[0053] In some embodiments, the indicator is a polynucleotide, while in other embodiments, the indicator is a polypeptide. The level of indicator in a subject can be measured using an analytic device. The analytic device used to measure the levels of indicator can be either a portable or a stationary device. In addition to including equipment used for detecting indicators, the analytic device can also include additional equipment to provide purification (i.e., physical separation) of analytes prior to analysis.

[0054] Polypeptide indicators may be determined by any of a variety of standard or novel recently developed protein analytic methods known in the art. These methods include absorbance, gel electrophoresis (e.g., SDS-PAGE gel purification), a protein immunoblot (e.g., western blot), chromatography (e.g., size exclusion chromatography, ion exchange chromatography, and affinity chromatography), precipitation, ultracentrifugation, an immunoassay, such as an enzyme-linked immunosorbent assays (ELISA), and other common techniques known to one of ordinary skill in the art. Novel recently developed assays include bead based immunofluorescence assays that can quantitatively measure different proteins in the same well with high sensitivity.

[0055] Polynucleotide indicators may be determined by any of a variety of standard analytic methods known in the art. In one embodiment of the invention, the expression level of an indicator gene (which is a polynucleotide) is determined by nucleic acid amplification of said gene using gene specific primer pairs, and quantifying the amplification results. In some embodiments, the nucleic acid amplification method used is real-time polymerase chainreaction (PCR) analysis.

[0056] Methods of the invention also include the step of comparing the amount of the at least one indicator to a control level of the indicator. When more than one indicator is being evaluated, the indicator levels are compared with the control levels for the appropriate corresponding indicators; e.g., the level of EBV in the biological sample is compared with the control level of EBV. The control levels may be already available in the literature, they may be determined by evaluating biomarker levels in a pool of relatively healthy subjects, or they may be determined in an individual prior to the development of a disease or disorder.

[0057] A detailed example is provided illustrating the detection of EBV virus gene expression. Detection of EBV may be present before or after the administration of BCV. The term "positive" includes positive gene expression. The term "positive" may include increased gene expression in a subject when compared to healthy or previously confirmed negative individuals. Whether a subject or a subject’ s sample is EBV-positive / negative may be detected, for example, by collecting cerebrospinal fluid, or SLCL caused by endogenous EBV derived from the subject and measuring gene expression of EBV in the sample. The gene expression may be measured, for example, by PCR, Droplet Digital PCR (dd PCR), RT-PCR, DNA chip, EBER hybridization, or immunostaining. In this case, a sample collected from the subject is compared with a sample collected from a healthy or previously confirmed negative person, and when the gene expression of EBV is significantly increased in the sample collected from the subject, it may be judged as EBV-positive. In addition, whether a subject or a subject’s sample is EBV-positive / negative may be detected, for example, by collecting spontaneous lymphoblastoid cell lines (SLCL) caused by endogenous EBV of the subject and immuno staining for EBV. In this case, a sample collected from the subject is compared with a sample collected from a healthy or previously confirmed negative person, and when the staining intensity of EBV is significantly increased in the sample collected from the subject, it may be judged as EBV-positive. The above-mentioned increase in gene expression or staining intensity includes, for example, a 1.5-, 2,5-, 5-, 10-, 25-, 50-, 100-, 250-, or 500-fold increase (or more) relative to the corresponding control, or within the range of any two of these values.Formulation and Administration

[0058] The present invention provides methods comprising administration a therapeutically effective amount of BCV in a pharmaceutical composition. Examples of pharmaceuticalcompositions include those for oral, intravenous, intramuscular, subcutaneous, transdermal, or intraperitoneal administration, or any other route known to those skilled in the art, and generally involves providing the BCV formulated together with a pharmaceutically acceptable carrier. The dosage form should be effective for therapeutic use and may be, for example, a solid preparation (e.g., a tablet(s)), a liquid preparation (e.g., oral suspension), or an injection (e.g., an intravenous injection). An embodiment of the present invention provides a pharmaceutical composition comprising BCV for use in any of the above methods. The methods include, for example, a method of treating MS comprising: detecting reactivation of EBV in a subject having MS, specifying the subject having MS with reactivated EBV as a treatment target, and administering a therapeutically effective amount of BCV to the subject having MS with reactivated EBV. An embodiment of the present invention provides a use of BCV for production of the pharmaceutical composition described above.

[0059] The dose, dosing interval, and administration method of a therapeutically effective amount of BCV may be selected. The amount of BCV that is administered and the dosage regimen for treating a disease condition with the compounds and / or compositions of this invention depends on a variety of factors, including the age, weight, sex, and medical condition of the subject, the severity of the disease, the route and frequency of administration, and the particular compound employed, the location of the unwanted proliferating cells, as well as the pharmacokinetic properties of the individual treated, and thus may vary widely. The dose may be, for example, from 0.01 to 200 mg / kg body weight per administration, or from 0.05 to 10 mg / kg body weight. The dosing interval, for example, may be 1 or 2 doses for 1 to 28 days, for 1 to 4 weeks, or from 1 to 4 months. More specifically, 20 to 80 mg / day intravenous injection may be included. Also included is 20 to 80 mg / day intravenous injection twice a week. At the time of the therapy, the BCV dose may include 10 to 40 mg or 10 to 20 mg / day intravenous injection. Also included is 10 to 40 mg / day or 10 to 20 mg / day intravenous injection twice a week. The "range of 10 to 80 mg" may mean, for instance, 10, 20, 30, 40, 50, 60, 70, or 80 mg or a number between any two thereof.

[0060] When preparing BCV for oral administration, the pharmaceutical composition may be in the form of, for example, a tablet, capsule, suspension or liquid. The pharmaceutical composition is preferably made in the form of a dosage unit containing a particular amount of the active ingredient. Examples of such dosage units are capsules, tablets, powders, granules or a suspension, with conventional additives such as lactose, mannitol, corn starch or potato starch; with binders such as crystalline cellulose, cellulose derivatives, acacia, corn starch orgelatins; with disintegrators such as corn starch, potato starch or sodium carboxymethyl- cellulose; and with lubricants such as talc or magnesium stearate. The active ingredient may also be administered by injection as a composition wherein, for example, saline, dextrose or water may be used as a suitable carrier.

[0061] For intravenous, intramuscular, subcutaneous, or intraperitoneal administration, the compound may be combined with a sterile aqueous solution which is preferably isotonic with the blood of the recipient. Such formulations may be prepared by dissolving solid active ingredient in water containing physiologically compatible substances such as sodium chloride, glycine, and the like, and having a buffered pH compatible with physiological conditions to produce an aqueous solution, and rendering said solution sterile. The formulations may be present in unit or multi- dose containers such as sealed ampoules or vials.

[0062] Formulations suitable for parenteral administration conveniently comprise a sterile aqueous preparation of the active compound which is preferably made isotonic. Preparations for injections may also be formulated by suspending or emulsifying the compounds in nonaqueous solvent, such as vegetable oil, synthetic aliphatic acid glycerides, esters of higher aliphatic acids or propylene glycol.

[0063] The BCV can also be provided as a pharmaceutically acceptable salt. The phrase “pharmaceutically acceptable salts” connotes salts commonly used to form alkali metal salts and to form addition salts of free acids or free bases. The nature of the salt is not critical, provided that it is pharmaceutically acceptable. Suitable pharmaceutically acceptable acid addition salts of the compounds may be prepared from an inorganic acid or from an organic acid.

[0064] The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.EXAMPLESExample 1: Generation of Spontaneous Endogenous EBV Lvmphoblastoid B cell lines LCLs

[0065] Fourteen healthy controls (HC), seven MS patients with stable disease (“Stable Multiple Sclerosis’VSMS), and eight MS patients with active disease (“Active Multiple Sclerosis” / AMS) were enrolled in this study. AMS was defined as the presence of at least one cerebral enhancing lesion (CEL) at the time of blood collection; patients with stable disease (SMS) had no CEL at the time of sampling. Peripheral blood mononuclear cells (PBMCs) from HC donors and MS patients were isolated from whole blood by ficoll-hypaque density centrifugation and cryopreserved in freezing media containing 20% DMSO. SLCLs were generated by spontaneous expansion from PBMCs in the presence of cyclosporin A to eliminate T cells. Briefly, PBMCs were thawed in growth medium [RPML1640 medium (Gibco, Gaithersburg, MD) with 10% fetal bovine serum (FBS; Gibco, Gaithersburg, MD), 1% gentamicin (50 mg / ml; Quality Biological, Gaithersburg, MD), and 1% L-Glutamine (200 mM; Quality Biological, Gaithersburg, MD)] and then plated in 96-well round bottom plates at a density of lxl06 / well in a total volume of 200 pl. Once per week, 100 pl medium was removed and replaced with fresh growth medium. After 3 weeks, a final concentration of 2pg / mL of cyclosporin A (Sigma-Aldrich, St. Louis, MO) was added to each well (Fig. 1A). Three to six weeks later, clusters of B-lymphoblastoid cells (i.e., SLCLs) emerged (Fig. 1A) and were transitioned into progressively larger tissue culture wells until they were robust and numerous enough to be cultured in T25 flasks. Once established, SLCLs were maintained in growth medium and incubated at 37 °C under a 5% CO2 humidified atmosphere.

[0066] Fig. 1 A-B show the results. The spontaneous lymphoblastoid B cell lines (SLCLs) caused by endogenous EBV were generated and grown from MS patients and healthy donor control. (A). SLCLs were generated from PBMCs isolated from MS patients and healthy controls by extended culture of PBMCs without addition of exogenous, lab strain EBV. Three weeks after ex vivo culture, cyclosporin A was added to eliminate residual T -cells. (B). 29 individuals were enrolled, including 14 healthy controls, and 15 MS patients (7 SMS, 8 AMS). From these individuals, SLCLs were propagated from 2 (14%) of healthy controls (HCs), from 3 (43%) MS patients during stable disease (SMS) and 4 (50%) MS patients during active disease (AMS). HC=healthy control; AMS=MS (active); SMS=MS (stable).Example 2; EBV COPY Number Per Cell

[0067] To quantify EBV viral load, DNA was isolated from SLCLs, LCLs (B95.8 transformed LCLs; one from an MS patient, one from a HC), and BJABS (EBV negative control cell line) using a DNeasy blood and tissue kit (Qiagen, Hilden, Germany). PCR was used to quantify EBV viral load using a standard curve generated with Namalwa cells (two copies of EBV per cell).

[0068] Fig. 2 shows the result. It was shown that EBV viral load was increased in SLCLs from MS active patients. As determined by qPCR, EBV DNA copy number per cell, was higher in SLCLs derived from patients with active MS than in SLCLs derived from healthy controls or patients with stable disease. MS patients during active disease (AMS). HC=healthy control; AMS=MS (active); SMS=MS (stable).Example 3: Effect of Different Concentrations of BCV on spontaneous lymphoblastoid B- cell lines caused by endogenous EBV

[0069] Two different cell concentrations (5 x 103and 1 x 104cells / well) of the spontaneous lymphoblastoid B-cell lines caused by endogenous EBV (EBV+ SLCLs) and a control EBV- Ramos cell line were treated with a range of doses (0-4 pM) of BCV over several days. To assess the cell viability, the Cell Titer-Gio® Cell luminescent Cell Viability Assay (Promega, Madison, WI) was used as per kit instructions. Briefly, Cell Titer-Gio® substrate and buffer were combined and 100 pl of this mixture (1:1 ratio of Cell Titer-Gio®: cell mixture) was added to each well and mixed. The plates were then incubated for 20 minutes (for cell lysis to occur), and luminescence was measured on a CLARIOstarplus (BMG Labtech, Ortenberg, Germany) multilabel plate reader to determine cell viability; the generation of a luminescent signal is proportional to the amount of ATP present.

[0070] Fig. 3 A-C show the result. It was shown that no clear decrease on cell viability or cell number was observed in EBV - cell line (A), however, there was a significant decrease on those parameters in both EBV+ SLCLs from healthy donor controls (B) and MS patients (C) after BCV treatment at different concentrations on day 7.

[0071] The results above show that BCV significantly reduces the survival rate of EBV+ SLCLs from MS patients. This indicates that BCV can be used to treat MS by significantly reducing the survival rate of EBV+ SLCLs from MS patients.Example 4: Effect of BCV on EBV viral load bv ddPCR

[0072] Two different cell concentrations (5 x 103and 1 x 104cells / well) of the spontaneous lymphoblastoid B-cell lines caused by endogenous EBV (EBV+ SLCLs) were treated with a range of doses (0-4 pM) of BCV over several days. To quantify the EBV virus load, DNA was extracted at three, five and seven days post-BCV treatment and measured by dd PCR assay using primers specific for the EBV BamHI W region.

[0073] Fig. 4A-B show the results. It was shown that BCV reduced on EBV viral load in EBV+ SLCLs from both MS patients (B) and healthy donor controls (A) in a dose dependent manner. BCV was shown to be effective at concentration as low as 62.5 nM. Efficacy of BCV was more robust in MS-derived SLCLs in spite of its higher basal EBV copy number than HC- derived cells.Example 5: Effect of BCV on EBV-reactivated B cell

[0074] Spontaneous lymphoblastoid B cell lines (SLCLs) were prepared and cultured from healthy doner controls (HCs) and MS patients with active disease, in the same way as described in Example 1. After treating the SLCLs with BCV at each concentration (0, 62.5, 125, 250 nM) for 5 days, RNA was extracted and RT-qPCR was performed on Zta, an EBV- derived gene expressed in the lytic cycle. The same treatment was performed after treating the SLCLs in the presence of NaB (sodium butyrate, 5 pM) and TPA (12-0- tetradecanoylphorbol-13-acetate, 50 ng / mL), which induce EBV reactivation.

[0075] Figure 5A-B show the results. It was shown that the expression level of Zta mRNA increases due to EBV reactivation (refer to the fifth bar from the left in Figures 5A-B). Furthermore, it was shown that BCV treatment significantly reduces the increased Zta mRNA expression level (refer to the sixth to eighth bars from the left in Figures 5A-B). In Figure 5B, a significant decrease of about 74% was observed.

[0076] The results above show that BCV significantly reduces the reactivation of EBV. This indicates that selective treatment of patients with high MS treatment efficacy when using BCV can be achieved by identifying MS patients with reactivated EBV and administering BCV to them. Compared to the administration of BCV to random MS patients, the administration of BCV to MS patients with a high likelihood of EBV reactivation is expected to have a higher likelihood of showing a therapeutic effect for MS.Example 6: Effect of BCV on EBV-reactivated B cell in PBMCs

[0077] Based on our observations on the reactivation of EBV from Spontaneous lymphoblastoid B cell lines from MS patients and controls containing the endogenous EBV from the donor (Example 5), we extended these results to human PBMCs.

[0078] Figure 6A shows the results. When human PBMCs were tested, EBNA1 mRNA was not detected at time 0. Upon incubation with 5uM NaB and 50ng / ml TPA for 7 days in vitro, it was shown that the expression level of EBNA1 mRNA increases due to EBV reactivation. Furthermore, it was shown that BCV treatment reduces the increased EBNA1 mRNA expression level in a dose dependent manner. In addition, when a larger group of patients and control PMBCs were analyzed, for reactivation of EBV by this method, from a total of 23 individuals, 9 reactivated (39%) (Figure 6B). Of the PBMCs from those individuals that reactivated EBV, all (100%) were able to generate SLCLs; from those individuals who were not able to reactivate EBV, none were able to generate SLCLs. This highly statistically significant observation (p<.0001) indicates that compared to the administration of BCV to random MS patients, the administration of BCV to MS patients with a high likelihood of EBV reactivation is expected to have a higher likelihood of showing a therapeutic effect for MS.Example 7: BCV Marmoset Antiviral Study

[0079] This non-terminal study will investigate the safety and efficacy of an anti-viral therapeutic in a marmoset model of y-herpesvirus infection. Marmosets can spontaneously be infected with an Epstein-Barr virus-related herpesvirus, Callitrichine herpesvirus 3 (CalHV- 3). This viral infection is typically clinically asymptomatic and based on previous work by our lab, we expect approximately 20% of marmosets in the National Institute of Neurological Disorders and Stroke (NINDS) colony to be positive for this virus. Our laboratory developed droplet digital (dd) PCR assay will be used to quantify viral loads in samples such as blood and saliva. BCV is an anti-viral that is currently developed for adenovirus infection via IV administration. In vitro work shows potential efficacy against a wide variety of DNA viruses, including herpesviruses. EBV, a common herpesvirus, has been increasingly associated with chronic neurodegenerative diseases such as multiple sclerosis (MS). Showing the safety of alternate routes of administration such as SC (Subcutaneous injection) and efficacy of the therapeutic in a nonhuman primate model of y-herpesvirus infection will aid in the development of human clinical trials in multiple sclerosis (MS) patients and ultimately the approval of this anti-viral in treatment of human MS and other EBV-related diseases.

[0080] The common marmoset Callithrix jacchus is a New World monkey that is increasingly utilized in biomedical research. The marmoset has many distinct advantages as a laboratory animal. It is a primate similar in size to a rat (300-600 g as an adult), and with a larger brain. Due to its size, the marmoset has both practical and husbandry advantages over macaques. Herpesviruses in general are species specific, with rodents being resistant to infection with human relevant herpesviruses. The complex pathogenesis and life cycle of y- herpes viruses in general, including lytic and latent phases, also makes studying these viruses in animal models more challenging. Marmosets have a naturally occurring persistent herpesvirus infection, Callitrichine herpesvirus 3 (CalHV-3), similar to (EBV), providing a spontaneous translational model of y- herpesvirus infection, y-herpesviruses in nonhuman primate, as compared to other species such as rodents, have highly similar genomics and characteristics to human infection. This allows for improved translatability of results from nonhuman primate models of y-herpesviruses to humans.

[0081] A total of 12 animals will be used in this pilot study, including both males and females, of 12 months of age or older. Based on our previous experience, groups of at least 2 animals are sufficient to provide data for pre-clinical nonhuman primate studies and to inform subsequent study development. These animals will be broken down into the following groups:

[0082] 2 control animals (CalHV-3 positive, no BCV treatment)

[0083] 1 animal IV vehicle once per week

[0084] 1 animal SC vehicle once per week

[0085] 2 animals in Group 2 (CalHV-3 positive, IV CDV treatment) 20 mg / kg once a week

[0086] 2 animals in Group 4 (CalHV-3 positive, SC BCV treatment dose #2) 1 mg / kg once a week

[0087] 2 animals in Group 5 (CalHV-3 positive, SC BCV treatment dose #3) 2 mg / kg once a week

[0088] 2 animals in Group 5 (CalHV-3 positive, SC BCV treatment dose #3) 4 mg / kg once a week

[0089] 2 animals in Group 5 (CalHV-3 positive, SC BCV treatment dose #3) 4 mg / kgtwice a week

[0090] Drug will be administered for up to 6 months. Animals will be followed post drug administration for up to 6 months after the completion of administration.

[0091] Animals will be anesthetized no more than once a week for no longer than periods of 15 minutes for drug administration and sample collection (saliva and blood for monitoring of viral levels). Animals will not be fasted prior to anesthesia due to the quick nature of the procedure.

[0092] Adverse effects of drug administration are not expected, and euthanasia is not expected or planned for the course of this study. Should adverse effects occur that are unresponsive to supportive treatment and / or veterinary staff recommend euthanasia, euthanasia will be performed by perfusion as outlined below.PROCEDURES

[0093] 1. Animal Identification

[0094] A unique name and number are used to identify all marmosets. Each will have a cage tag with this information, as well as a chart which details all experimental procedures and treatments. The animal ID number will be tattooed on the inner right thigh, or an implantable microchip will be placed.

[0095] 2. Handling

[0096] For all procedures, unless otherwise noted, the animals will be caught from their cages into a catch container, and subsequently gently removed from this catch container by an investigator wearing insulated, lined [leather] gloves. The animals will be gently held just under their arms with one hand, and the other hand will support their back. From this position, the animals will be administered anesthetics via an isoflurane facemask or intramuscular injection for further experimental procedures.

[0097] 3. Anesthesia

[0098] Anesthesia will be administered no more than once a week for BCV administration and sample collection (blood and saliva) for no longer than 15 minutes. Anesthesia may include injectable (see below) and / or inhalant isoflurane anesthesia. The animals will becaught from the transport kennel with insulated lined (leather) gloves and held gently around the thorax just under their arms, without restricting their breathing. Marmosets may be administered atropine sulfate + / ketamine intramuscularly then placed on the procedure table where inhalational anesthetics are delivered through a facemask. The NHP is connected via a non-rebreathing tube to a 40% oxygen / 60% nitrogen (oxygen-enhanced air) gas mixture containing isoflurane, with the anesthesia vaporizer set between 1.5 and 2.5%. Once the procedures are completed, the anesthesia will be discontinued. Capnography, pulse oximetry, and temperature will be monitored until the animal shows voluntary movement. It will then be placed back into the padded transport cage, with covered warm discs to maintain body temperature. The marmoset will be monitored until it is stably moving about the cage and appears alert. The marmoset will then be brought back to its housing room and released to its home cage. The clinical health status, manipulations performed, notes, and anesthesia logs will be recorded in the animal’s health records.

[0099] 4. Injections[ 0 1 00 ] Marmosets may receive the following injections:[ 0 1 0 1 ] a. Injectable Anesthetic Agents: pharmaceutical grade Ketamine (10 mg / kg) and atropine (0.04 mg / kg) may be administered IM at time of sedation. Atropine is to be given 5 minutes prior to the primary anesthetic. Due to the short time needed for anesthesia in some cases, induction may opt to forgo ketamine for solely isoflurane gas mask induction. Sedation by atropine, isoflurane, + / -ketamine will be utilized in all procedures requiring sedation- blood collection, saliva collection, some forms of drug administration (see below).[ 0 1 02 ] b. Lactated Ringer’s solution (LRS): Up to 6mL of LRS will be administered subcutaneously for additional fluid support if needed for animal clinical support at the time of experimental procedures or between procedures.[ 0 1 03 ] c. Brincidofovir (BCV) doses, route, frequency, concentration of drug[ 0 1 04 ] BCV IV formulation (10 mg / mL) will be diluted with sterile 5% dextrose for each dosing level at as follows at every administration.[ 0 1 05 ] 4 mg / kg dose: Diluted formulation at 1.6 mg / mL will be administered at 2.5 mL / kg[ 0 1 06 ] 2 mg / kg dose: Diluted formulation at 0.8 mg / mL will be administered at 2.5 mL / kg

[0107] 1 mg / kg dose: Diluted formulation at 0.4 mg / mL will be administered at 2.5 mL / kg

[0108] d. Cidofovir (CDV) dose, route, frequency, concentration of drug

[0109] CDV solution will be made by following procedure. CDV will be formulated in PBS 16 mg / mL. Test article formulations will be adjusted to pH 7.2 to 7.4 with IN sodium hydroxide and / or dilute hydrochloric acid, as necessary. Dose formulations will be sterile- filtered using a Millipore Stericup-GV filtration system, 0.22-um Durapore polyvinylidene fluoride (PVDF) membrane or equivalent. Aseptic procedures will be used post-filtration. CDV can be purchased from a chemical vendor (such as AdoQ). CDV solution can be also obtained as Vistide (75 mg / mL solution) if NIH can be accustomed to sourcing approved drugs for animal studies. It will be diluted with sterile saline. Prepared formulation should be kept in a refrigerator and protected from light. Formulations will be allowed to equilibrate to approximate room temperature for at least 30 minutes prior to dose administration.

[0110] CDV formulation at 16 mg / mL will be administered 1.25 mL / kg for 20 mg / kg dose.

[0111] e. Drug vehicle for controls- Vehicle for CDV will be PBS or Saline. Vehicle of BCV will be 5% dextrose.

[0112] 5. Blood collection

[0113] Blood will be collected on anesthetized marmosets from the femoral vein or tail vein at frequencies of no more than once a week. Collected blood volumes will not exceed 1 % of a marmoset’s body weight over the course of one month. If an animal begins to show clinical illness (weakness, pallor, etc.), the amount of blood drawn may be reduced as judged appropriate, in consult with veterinary staff.

[0114] 6. Saliva collection

[0115] Saliva will be collected on anesthetized marmosets using sterile cotton swabs at frequencies of no more than once a week.

[0116] 7. Clinical monitoring

[0117] Animals will be monitored at least once a week by personnel for adverse effects associated with BCV administration, including weight loss, diarrhea, lethargy, inappetence,etc. If adverse effects are noted, monitoring will be performed as needed or directed by veterinary staff.[ 0 1 1 8 ] Personnel and primate technicians will record body weights weekly. If animals lose weight, additional nutritional and hydration supplementation will be provided. If an animal is determined to be losing weight or is uninterested in eating, to ensure proper support and supplementation are provided, body temperature can be monitored and recorded by personnel and primate technicians. If body weight loss is > 20%, we will promptly seek a veterinary consult. If following this veterinary consult euthanasia is deemed appropriate, then this recommendation will be followed.[ 0 1 1 9 ] Veterinarians will be consulted if other adverse effects are noted (diarrhea, etc.), and veterinary recommendations will be followed for subsequent support and treatment. If euthanasia is deemed appropriate, then this recommendation will be followed. This is a nonterminal study and euthanasia of study animals is not expected.[ 0 1 20 ] The complete disclosure of all patents, patent applications, and publications, and electronically available materials cited herein are incorporated by reference. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. In particular, while various theories are presented describing possible mechanisms through with the compounds are effective, the compounds are effective regardless of the particular mechanism employed and the inventors are therefore not bound by theories described herein. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims.

[0121] Some embodiments of the invention are within the scope of the following numbered paragraphs.1. A method of treating multiple sclerosis in a subject having reactivated Epstein-Barr virus, the method comprising administering a therapeutically effective amount of brincidofovir (BCV) to the subject.2. The method of paragraph 1, wherein the number of cells in which Epstein-Barr virus is reactivated in the subject is reduced by the BCV administration step.3. The method of paragraph 1 or 2, wherein the number of B cells in which Epstein-Barr virus is reactivated in the subject is reduced by the BCV administration step.4. The method of paragraph 3, wherein the reduction in the number of B cells is caused by a reduction in expression of Zta or EBNA1 due to BCV.5. The method of any one of paragraphs 1 to 4, further comprising a step of detecting reactivation of Epstein-Barr virus in said subject.6. The method of paragraph 5, wherein the detecting step includes detecting an antibody against Epstein-Barr virus antigen or detecting Epstein-Barr virus genomic DNA in a sample from said subject.7. The method of any one of paragraphs 1 to 6, further comprising diagnosing whether the subject has multiple sclerosis, and specifying the subject having multiple sclerosis as a candidate for treatment, wherein the specified subject is tested for reactivation of Epstein- Barr virus.8. The method of any one of paragraphs 1 to 7, wherein the subject having multiple sclerosis with reactivated EB V is not a subject diagnosed as being in a latent infection state of Epstein- Barr virus.9. The method of any one of paragraphs 1 to 8, wherein the multiple sclerosis is relapsingremitting multiple sclerosis, primary progressive multiple sclerosis, or secondary progressive multiple sclerosis.10. The method of any one of paragraphs 1 to 9, further comprising administering an antiviral agent to the subject.Other embodiments are within the scope of the claims.

Claims

CLAIMSWhat is claimed is:

1. A method of treating multiple sclerosis in a subject having reactivated Epstein-Barr virus, the method comprising administering a therapeutically effective amount of brincidofovir (BCV) to the subject.

2. The method of claim 1, wherein the number of cells in which Epstein-Barr virus is reactivated in the subject is reduced by the BCV administration step.

3. The method of claim 1, wherein the number of B cells in which Epstein-Barr virus is reactivated in the subject is reduced by the BCV administration step.

4. The method of claim 3, wherein the reduction in the number of B cells is caused by a reduction in expression of Zta or EBNA1 due to BCV.

5. The method of claim 1, further comprising a step of detecting reactivation of Epstein-Barr virus in said subject.

6. The method of claim 5, wherein the detecting step includes detecting an antibody against Epstein-Barr virus antigen or detecting Epstein-Barr virus genomic DNA in a sample from said subject.

7. The method of claim 1, further comprising diagnosing whether the subject has multiple sclerosis, and specifying the subject having multiple sclerosis as a candidate for treatment, wherein the specified subject is tested for reactivation of Epstein-Barr virus.

8. The method of claim 1, wherein the subject having multiple sclerosis with reactivated EBV is not a subject diagnosed as being in a latent infection state of Epstein-Barr virus.

9. The method of claim 1, wherein the multiple sclerosis is relapsing-remitting multiple sclerosis, primary progressive multiple sclerosis, or secondary progressive multiple sclerosis.

10. The method of claim 1, further comprising administering an antiviral agent to the subject.

Images