Genetically modified non-human animal with human or chimeric trbc

WO2025185669A8PCT designated stage Publication Date: 2025-10-02BIOCYTOGEN PHARMACEUTICALS (BEIJING) CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/080851
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-06
Filing Date
2025-03-05
Publication Date
2025-10-02

AI Technical Summary

Technical Problem

Traditional drug research and development methods using in vitro and in vivo animal models fail to replicate human body environments, leading to high failure rates and discrepancies between animal test results and clinical trials due to differences in tumor microenvironments and immune cell interactions.

Method used

Development of genetically modified non-human animals expressing human or chimeric TRBC proteins, allowing for the creation of animal models that mimic human biological systems, facilitating drug screening and evaluation of anti-TRBC antibodies and drugs targeting TRBC.

Benefits of technology

The animal models provide a powerful tool for studying TRBC function and screening cancer drugs, reducing development costs and time by bridging the gap between animal and human disease states, and enabling effective drug screening and treatment of immune-related diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025080851_02102025_PF_FP_ABST
    Figure CN2025080851_02102025_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure relates to genetically modified non-human animals that express a human or humanized chimeric TRBC, and methods of use thereof.
Need to check novelty before this filing date? Find Prior Art

Description

GENETICALLY MODIFIED NON-HUMAN ANIMAL WITH HUMAN OR CHIMERIC TRBC

[0001] CLAIM OF PRIORITY

[0002] This application claims the benefit of Chinese Patent Application App. No. 202410248565.5, filed on March 5, 2024, and Chinese Patent Application App. No. 202410730249.1, filed on June 6, 2024. The entire contents of the foregoing application are incorporated herein by reference.TECHNICAL FIELD

[0003] This disclosure relates to genetically modified animal expressing human or chimeric (e.g., humanized) TRBC, and methods of use thereof.BACKGROUND

[0004] The traditional drug research and development typically use in vitro screening approaches. However, these screening approaches cannot provide the body environment (such as tumor microenvironment, stromal cells, extracellular matrix components and immune cell interaction, etc. ) , resulting in a higher rate of failure in drug development. In addition, in view of the differences between humans and animals, the test results obtained from the use of conventional experimental animals for in vivo pharmacological test may not reflect the real disease state and the interaction at the targeting sites, resulting in that the results in many clinical trials are significantly different from the animal experimental results.

[0005] Therefore, the development of humanized animal models that are suitable for human antibody screening and evaluation will significantly improve the efficiency of new drug development and reduce the cost for drug research and development.SUMMARY

[0006] This disclosure is related to an animal model with human or chimeric TRBC (e.g., TRBC1) . The animal model can express human or chimeric TRBC (e.g., humanized TRBC) protein in its body. It can be used in the studies on the function of TRBC genes, and can be used in the screening and evaluation of anti-human TRBC antibodies or drugs targeting TRBC. In addition, the animal models prepared by the methods described herein can be used in drug screening, pharmacodynamics studies, treatments for immune-related diseases, and cancer therapy; they can also be used to facilitate the development and design of new drugs. This disclosure provides a powerful tool for studying the function of TRBC protein and a platform for screening cancer drugs.

[0007] This application provides an animal model expressing a human or chimeric TRBC protein. The animal model can express human or chimeric TRBC (e.g., humanized TRBC) protein. It can be used for studying the function of the TRBC gene and for screening and evaluating TRBC pathway modulators (e.g., anti-human TRBC antibodies, oligonucleotide drugs, and / or peptide drugs) . Additionally, the animal model prepared by the methods described herein can be used for drug screening, pharmacodynamic studies, treatment of immune-related diseases, and disease treatment targeting human TRBC sites. This model can also facilitate new drug development and design, saving time and costs. The present disclosure provides a powerful tool for studying the function of TRBC protein and a platform for screening related drugs.

[0008] In one aspect, the present disclosure provides a genetically modified non-human animal, whose genome contains at least one chromosome comprising a nucleotide sequence encoding human or chimeric T cell receptor β chain constant region (TRBC) protein. In some embodiments, the nucleotide sequence encoding human or chimeric TRBC protein includes all or part of the human or chimeric TRBC1 protein, preferably including all or part of the human or chimeric TRBC1 and TRBC2 proteins. In some embodiments, the amino acid sequence encoded by the nucleotide sequence encoding human or chimeric TRBC protein has at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identity with the amino acid sequence of human TRBC1 (SEQ ID NO: 2) or human TRBC2 (SEQ ID NO: 4) . In some embodiments, the nucleotide sequence encoding human or chimeric TRBC protein is regulated by endogenous regulatory elements. In some embodiments, the animal is a mammal, such as a monkey, rodent, mouse, or rat. In some embodiments, the animal is a mouse. In some embodiments, one or more cells of the animal express human or chimeric TRBC protein.

[0009] In one aspect, the present disclosure provides a genetically modified non-human animal, whose genome contains a nucleotide sequence encoding the endogenous TRBC region at the endogenous TRBC locus replaced by the corresponding human TRBC region nucleotide sequence. In some embodiments, the nucleotide sequence encoding the corresponding human TRBC region is operably linked to endogenous TRBC locus regulatory elements, and one or more cells of the animal express a human or humanized TRBC protein. In some embodiments, the nucleotide sequence encoding the corresponding human TRBC region includes all or part of the human TRBC1 gene, preferably including all or part of the human TRBC1 and TRBC2 genes. In some embodiments, the nucleotide sequence encoding the corresponding human TRBC region includes a portion of exon 1, exon 2, and a portion of exon 3 of the human TRBC1 gene, preferably including a portion of exon 1, exon 2, and a portion of exon 3 of the human TRBC1 gene and / or a portion of exon 1, exon 2, and a portion of exon 3 of the human TRBC2 gene. In some embodiments, the nucleotide sequence encoding the corresponding human TRBC region has at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identity with the nucleotide sequence shown in SEQ ID NO: 7. In some embodiments, the nucleotide sequence encoding the endogenous TRBC region includes all or part of the mouse TRBC1 gene, preferably including all or part of the mouse TRBC1 and mouse TRBC2 genes. In some embodiments, the nucleotide sequence encoding the endogenous TRBC region includes a portion of exon 1, exon 2, and a portion of exon 3 of the mouse TRBC1 gene, preferably including a portion of exon 1, exon 2, and part of exon 3 of the mouse TRBC1 gene and / or a portion of exon 1, exon 2, and a portion of exon 3 of the mouse TRBC2 gene. In some embodiments, the modified TRBC gene in the animal genome is homozygous or heterozygous for the endogenous replaced locus.

[0010] In one aspect, the present disclosure provides a non-human animal comprising at least one cell with a nucleotide sequence encoding human or humanized TRBC protein, wherein the humanized TRBC protein includes all or part of the humanized TRBC1 protein, preferably including all or part of the humanized TRBC1 and TRBC2 proteins. In some embodiments, the humanized TRBC protein includes at least 50, 100, or 176 consecutive amino acids of the corresponding human TRBC1 protein region, preferably including at least 50, 100, or 176 consecutive amino acids of the corresponding human TRBC1 protein region and at least 50, 100, or 178 consecutive amino acids of the corresponding human TRBC2 protein region, with the animal expressing human or humanized TRBC protein. In some embodiments, the nucleotide sequence encoding human or humanized TRBC protein is regulated by endogenous regulatory elements. In some embodiments, the nucleotide sequence encoding the corresponding human or humanized TRBC region can be integrated into the animal's endogenous locus. In some embodiments, the human or humanized TRBC protein has at least one mouse TRBC activity and / or human TRBC activity.

[0011] In one aspect, the present disclosure provides a method for constructing a genetically modified non-human animal, wherein at least one cell of the animal has the nucleotide sequence encoding the endogenous TRBC region at the endogenous TRBC locus replaced by the corresponding human TRBC region nucleotide sequence. In some embodiments, the endogenous TRBC protein of the animal is not expressed or is expressed at a lower level compared to wild-type animals. In some embodiments, the nucleotide sequence encoding the corresponding human TRBC region includes all or part of the human TRBC1 gene, preferably including all or part of the human TRBC1 and TRBC2 genes. In some embodiments, the nucleotide sequence encoding the corresponding human TRBC region includes a portion of exon 1, exon 2, and a portion of exon 3 of the human TRBC1 gene, preferably including a portion of exon 1, exon 2, and a portion of exon 3 of the human TRBC1 gene and / or a part of exon 1, exon 2, and part of exon 3 of the human TRBC2 gene. In some embodiments, the amino acid sequence encoded by the nucleotide sequence encoding the corresponding human TRBC region has at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identity with the amino acid sequences shown in SEQ ID NO: 24 and25. In some embodiments, the nucleotide sequence encoding the corresponding human TRBC region has at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identity with the nucleotide sequence shown in SEQ ID NO: 7. In some embodiments, the nucleotide sequence encoding the endogenous TRBC region includes all or part of the mouse TRBC1 gene, preferably including all or part of the mouse TRBC1 and mouse TRBC2 genes. In some embodiments, the nucleotide sequence encoding the endogenous TRBC region includes a portion of exon 1, exon 2, and a portion of exon 3 of the mouse TRBC1 gene, preferably including a portion of exon 1, exon 2, and a portion of exon 3 of the mouse TRBC1 gene and / or a portion of exon 1, exon 2, and a portion of exon 3 of the mouse TRBC2 gene. In some embodiments, the nucleotide sequence encoding the corresponding human TRBC region is operably linked to endogenous regulatory elements. In some embodiments, the animal is a mammal, such as a monkey, rodent, mouse, or rat.

[0012] In one aspect, the present disclosure provides a method for constructing genetically modified non-human animal cells expressing human or chimeric TRBC. The method includes replacing the nucleotide sequence encoding the endogenous TRBC region at the endogenous mouse TRBC locus with the corresponding human TRBC region nucleotide sequence, producing genetically modified non-human animal cells that express human or chimeric TRBC protein. In some embodiments, the nucleotide sequence encoding the corresponding human TRBC region includes all or part of the human TRBC1 gene, preferably including all or part of the human TRBC1 and TRBC2 genes. In some embodiments, the nucleotide sequence encoding the corresponding human TRBC region includes a portion of exon 1, exon 2, and a portion of exon 3 of the human TRBC1 gene, preferably including a portion of exon 1, exon 2, and part of exon 3 of the human TRBC1 gene and / or a portion of exon 1, exon 2, and a portion of exon 3 of the human TRBC2 gene. In some embodiments, the amino acid sequence encoded by the nucleotide sequence encoding the corresponding human TRBC region has at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identity with the amino acid sequences shown in SEQ ID NO: 24 and 25. In some embodiments, the nucleotide sequence encoding the corresponding human TRBC region has at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identity with the nucleotide sequence shown in SEQ ID NO: 7. In some embodiments, the nucleotide sequence encoding the endogenous TRBC region includes all or part of the mouse TRBC1 gene, preferably including all or part of the mouse TRBC1 and mouse TRBC2 genes. In some embodiments, the nucleotide sequence encoding the endogenous TRBC region includes a portion of exon 1, exon 2, and a portion of exon 3 of the mouse TRBC1 gene, preferably including a portion of exon 1, exon 2, and a portion of exon 3 of the mouse TRBC1 gene and / or a portion of exon 1, exon 2, and a portion of exon 3 of the mouse TRBC2 gene. In some embodiments, the nucleotide sequence encoding human or chimeric TRBC protein is operably linked to endogenous regulatory elements. In some embodiments, the non-human animal is a mouse. In some embodiments, the non-human animal also includes other genes encoding human or chimeric proteins, selected from at least one of NKG2D, TFR1, NKP46, ICOS, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4.

[0013] In one aspect, the present disclosure provides a method for determining the efficacy of a therapeutic agent in treating cancer, the method comprising: 1) administering a TRBC therapeutic agent to the non-human animal, wherein the non-human animal has a tumor; 2) determining the inhibitory effect of the therapeutic agent on the tumor. In some embodiments, the therapeutic agent is an anti-TRBC antibody. In some embodiments, the tumor comprises one or more tumor cells injected into the animal. In some embodiments, determining the inhibitory effect of the anti-TRBC antibody on the tumor involves measuring the tumor volume in the animal. In some embodiments, the cancer is glioma, female reproductive system cancer, breast cancer, melanoma, solid tumor, hematologic malignancy, head and neck cancer, liver cancer, or lung cancer.

[0014] In one aspect, the present disclosure provides a method for determining the efficacy of anti-TRBC antibodies and other therapeutic agents in treating cancer, the method comprising: 1) administering a TRBC therapeutic agent and other therapeutic agents to the non-human animal, wherein the non-human animal has a tumor; 2) determining the inhibitory effect on the tumor. In some embodiments, the animal further comprises sequences encoding human or chimeric PD-1, human or chimeric PD-L1, and / or human or chimeric CTLA4. In some embodiments, the other therapeutic agents are anti-PD-1 antibodies, anti-PD-L1 antibodies, or anti-CTLA4 antibodies. In some embodiments, the tumor comprises one or more tumor cells expressing PD-L1. In some embodiments, the tumor comprises one or more tumor cells injected into the animal. In some embodiments, determining the inhibitory effect on the tumor involves measuring the tumor volume in the animal. In some embodiments, the animal has glioma, female reproductive system cancer, breast cancer, melanoma, solid tumor, hematologic malignancy, head and neck cancer, liver cancer, or lung cancer. In some embodiments, the other therapeutic agents are anti-PD-1 antibodies, anti-PD-L1 antibodies, or anti-CTLA4 antibodies.

[0015] In one aspect, the present disclosure provides a method for determining the efficacy of TRBC therapeutic agents in treating immune diseases, the method comprising: 1) administering a TRBC therapeutic agent to the non-human animal, wherein the non-human animal has an immune disease; 2) determining the therapeutic effect of the TRBC therapeutic agent on the immune disease. In some embodiments, the immune disease is systemic lupus erythematosus, asthma, rheumatoid arthritis, or multiple sclerosis.

[0016] In one aspect, the present disclosure provides a method for determining the toxicity of TRBC therapeutic agents, the method comprising: 1) administering a TRBC therapeutic agent to the animal; 2) determining the effect of the TRBC therapeutic agent on the animal. In some embodiments, determining the effect of the TRBC therapeutic agent on the animal involves measuring the animal's body weight, red blood cell count, hematocrit, and / or hemoglobin.

[0017] In one aspect, the present disclosure provides a humanized TRBC protein, which includes all or part of the human TRBC1 protein, preferably including all or part of the human TRBC1 and TRBC2 proteins. In some embodiments, the humanized TRBC protein has at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identity with the amino acid sequences shown in SEQ ID NO: 24 and25.

[0018] In one aspect, the present disclosure provides a humanized TRBC gene, which encodes the humanized protein described herein. In some embodiments, the humanized TRBC gene includes a portion of exon 1, exon 2, and a portion of exon 3 of the human TRBC1 gene, preferably including a portion of exon 1, exon 2, and a portion of exon 3 of the human TRBC1 gene and / or a portion of exon 1, exon 2, and a portion of exon 3 of the human TRBC2 gene. Further preferably, the humanized TRBC gene also includes portion of exon 3 and all of exon 4 of the non-human animal TRBC1 gene. Even more preferably, the humanized TRBC gene also includes portion of exon 3 and all of exon 4 of the non-human animal TRBC1 gene and portion of exon 3 and all of exon 4 of the non-human animal TRBC2 gene. In some embodiments, the nucleotide sequence of the humanized TRBC gene has at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identity with the nucleotide sequences shown in SEQ ID NO: 5, 6, 7, 8, or 9.

[0019] In one aspect, the present disclosure provides a cell comprising the humanized protein and the humanized TRBC gene. In one aspect, the present disclosure provides an animal model comprising the humanized TRBC protein and the humanized TRBC gene.

[0020] In one aspect, the disclosure is related to a genetically-modified, non-human animal whose genome comprises at least one chromosome comprising a sequence encoding a human or chimeric TCR β chain (TRBC) .

[0021] In some embodiments, the sequence encoding the human or chimeric TRBC is operably linked to an endogenous regulatory element at the endogenous TRBC gene locus in the at least one chromosome.

[0022] In some embodiments, the TRBC is TRBC1.

[0023] In some embodiments, the sequence encoding a human or chimeric TRBC comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human TRBC1 (SEQ ID NO: 2) .

[0024] In some embodiments, the sequence encoding a human or chimeric TRBC comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to amino acids 3-149 of SEQ ID NO: 2.

[0025] In some embodiments, the sequence encoding a human or chimeric TRBC comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 24.

[0026] In some embodiments, the TRBC is TRBC2.

[0027] In some embodiments, the sequence encoding a human or chimeric TRBC comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human TRBC2 (SEQ ID NO: 4) .

[0028] In some embodiments, the sequence encoding a human or chimeric TRBC comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to amino acids 3-144 of SEQ ID NO: 4.

[0029] In some embodiments, the sequence encoding a human or chimeric TRBC comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 25.

[0030] In some embodiments, the sequence encoding a human or chimeric TRBC comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 7.

[0031] In one aspect, the disclosure is related to a genetically-modified, non-human animal, wherein the genome of the animal comprises a replacement of a sequence encoding a region of endogenous TRBC with a sequence encoding a corresponding region of human TRBC at an endogenous TRBC gene locus.

[0032] In some embodiments, the sequence encoding the corresponding region of human TRBC is operably linked to an endogenous regulatory element at the endogenous TRBC locus, and one or more cells of the animal expresses a human or chimeric TRBC.

[0033] In some embodiments, the animal does not express endogenous TRBC or expresses a decreased level of endogenous TRBC as compared to TRBC expression level in a wild-type animal.

[0034] In some embodiments, the replaced sequence encodes all or a portion of the extracellular region of TRBC.

[0035] In some embodiments, the animal has one or more cells expressing a chimeric TRBC having an extracellular region, a transmembrane region, and a cytoplasmic region, wherein the extracellular region comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100%identical to the extracellular region of human TRBC1 (SEQ ID NO: 2) .

[0036] In some embodiments, the extracellular region of the chimeric TRBC has a sequence that has at least 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 145, 146, 147, 148 or 149 contiguous amino acids that are identical to a contiguous sequence present in the extracellular region of human TRBC (e.g., amino acids 1-149 of SEQ ID NO: 2) .

[0037] In some embodiments, the animal has one or more cells expressing a chimeric TRBC having an extracellular region, a transmembrane region, and a cytoplasmic region, wherein the extracellular region comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100%identical to the extracellular region of human TRBC2 (SEQ ID NO: 4) .

[0038] In some embodiments, the extracellular region of the chimeric TRBC has a sequence that has at least 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 141, 142, 143, or 144 contiguous amino acids that are identical to a contiguous sequence present in the extracellular region of human TRBC (e.g., amino acids 1-144 of SEQ ID NO: 4) .

[0039] In some embodiments, the sequence encoding a region of endogenous TRBC comprises exon 1, exon 2, exon 3, and / or exon 4, or a part thereof, of the endogenous TRBC gene. In some embodiments, the sequence encoding a region of endogenous TRBC comprises a portion of exon 1, exon 2, and a portion of exon 3 of the endogenous TRBC gene.

[0040] In some embodiments, the sequence encoding the corresponding region of human TRBC comprises exon 1, exon 2, exon 3, and / or exon 4, or a part thereof, of a human TRBC gene. In some embodiments, the corresponding region of human TRBC comprises a portion of exon 1, exon 2, and a portion of exon 3 of a human TRBC gene.

[0041] In some embodiments, the animal comprises a replacement of a portion of exon 1, exon 2, and a portion of exon 3 of the endogenous TRBC gene with a portion of exon 1, exon 2, and a portion of exon 3 of a human TRBC gene.

[0042] In some embodiments, the animal is heterozygous with respect to the replacement at the endogenous TRBC gene locus.

[0043] In some embodiments, the animal is homozygous with respect to the replacement at the endogenous TRBC gene locus.

[0044] In one aspect, the disclosure is related to a non-human animal comprising at least one cell comprising a nucleotide sequence encoding a humanized TRBC polypeptide, wherein the humanized TRBC polypeptide comprises at least 50, 100, 142, 147, 149, or 176 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human TRBC, wherein the animal expresses the humanized TRBC polypeptide.

[0045] In some embodiments, the humanized TRBC polypeptide has at least 50, 100, 142, 147, or 149 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of human TRBC extracellular region.

[0046] In some embodiments, the humanized TRBC polypeptide comprises a sequence that is at least 90%, 95%, or 99%identical to amino acids 3-149 of SEQ ID NO: 2 or amino acids 3-144 of SEQ ID NO: 4.

[0047] In some embodiments, the nucleotide sequence is operably linked to an endogenous TRBC regulatory element of the animal.

[0048] In some embodiments, the animal is a mammal, e.g., a monkey, a rodent, a mouse, or a rat. In some embodiments, the animal is a mouse.

[0049] In some embodiments, the animal does not express endogenous TRBC or expresses a decreased level of endogenous TRBC as compared to TRBC expression level in a wild-type animal.

[0050] In some embodiments, the animal has one or more cells expressing human or chimeric TRBC.

[0051] In some embodiments, the chimeric TRBC polypeptide comprises an endogenous TRBC transmembrane region and / or an endogenous TRBC cytoplasmic region.

[0052] In some embodiments, the animal further comprises a sequence encoding an additional human or chimeric protein.

[0053] In some embodiments, the additional human or chimeric protein is selected from the group consisting of NKG2D, TFR1, NKP46, ICOS, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4.

[0054] In one aspect, the disclosure is related to a method for making a genetically-modified, non-human animal, comprising: replacing in at least one cell of the animal, at an endogenous TRBC gene locus, a sequence encoding a region of endogenous TRBC with a sequence encoding a corresponding region of human TRBC.

[0055] In some embodiments, the sequence encoding the corresponding region of human TRBC comprises exon 1, exon 2, exon 3, and / or exon 4, or a part thereof, of a human TRBC gene.

[0056] In some embodiments, the sequence encoding the corresponding region of human TRBC comprises a portion of exon 1, exons 2 and a portion of exon 3 of a human TRBC gene.

[0057] In some embodiments, the sequence encoding the corresponding region of human TRBC encodes amino acids 3-149 of SEQ ID NO: 2.

[0058] In some embodiments, the sequence encoding the corresponding region of human TRBC encodes amino acids 3-144 of SEQ ID NO: 4.

[0059] In some embodiments, the sequence encoding a region of endogenous TRBC comprises exon 1, exon 2, exon 3, and / or exon 4, or a part thereof, of the endogenous TRBC gene.

[0060] In some embodiments, the sequence encoding a region of endogenous TRBC comprises a portion of exon 1, exon 2 and a portion of exon 3 of the endogenous TRBC gene.

[0061] In some embodiments, the animal expresses a humanized TRBC.

[0062] In some embodiments, the animal is a mouse.

[0063] In some embodiments, the animal expresses a humanized TRBC, and the humanized TRBC comprises a human or humanized TRBC extracellular region; and a transmembrane and / or a cytoplasmic region of mouse TRBC.

[0064] In some embodiments, the nucleotide sequence encoding the chimeric TRBC is operably linked to an endogenous TRBC regulatory region, e.g., promoter.

[0065] In some embodiments, the animal or mouse further comprises a sequence encoding an additional human or chimeric protein.

[0066] In some embodiments, the additional human or chimeric protein is is selected from the group consisting of NKG2D, TFR1, NKP46, ICOS, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4.

[0067] In one aspect, the disclosure is related to a method of determining effectiveness of a therapeutic agent for the treatment of cancer, comprising: administering the therapeutic agent to the animal described herein, wherein the animal has a tumor; and determining inhibitory effects of the therapeutic agent to the tumor.

[0068] In some embodiments, the therapeutic agent is an anti-TRBC antibody.

[0069] In some embodiments, the tumor comprises one or more cancer cells that are injected into the animal.

[0070] In some embodiments, determining inhibitory effects of the anti-TRBC antibody to the tumor involves measuring the tumor volume in the animal.

[0071] In some embodiments, the cancer is lung cancer, head and neck cancer, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, bladder cancer, kidney cancer, or a glioma.

[0072] In one aspect, the disclosure is related to a method of determining toxicity of a therapeutic agent comprising: a) administering the therapeutic agent to the animal described herein; and b) determining effects of the therapeutic agent to the animal.

[0073] In some embodiments, the therapeutic agent is an anti-TRBC antibody.

[0074] In some embodiments, determining effects of the therapeutic agent to the animal involves measuring the body weight, red blood cell count, hematocrit, and / or hemoglobin of the animal.

[0075] In one aspect, the disclosure is related to a method of determining the efficacy ofTRBC therapeutic agents in treating immune diseases, the method comprising: 1) administering a TRBC therapeutic agent to the non-human animal, wherein the non-human animal has an immune disease; 2) determining the therapeutic effect of the TRBC therapeutic agent on the immune disease.

[0076] In some embodiments, the immune disease is systemic lupus erythematosus, asthma, rheumatoid arthritis, or multiple sclerosis.

[0077] In one aspect, the disclosure is related to a protein comprising an amino acid sequence, wherein the amino acid sequence is one of the following: an amino acid sequence set forth in SEQ ID NO: 24 or 25; an amino acid sequence that is at least 90%identical to SEQ ID NO: 24 or 25; an amino acid sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 24 or 25; an amino acid sequence that is different from the amino acid sequence set forth in SEQ ID NO: 24 or 25by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid; and an amino acid sequence that comprises a substitution, a deletion and / or insertion of one, two, three, four, five or more amino acids to the amino acid sequence set forth in SEQ ID NO: 24 or 25.

[0078] In one aspect, the disclosure is related to a nucleic acid comprising a nucleotide sequence, wherein the nucleotide sequence is one of the following: a sequence that encodes the protein described herein; SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 26, 27, 28, or 29; a sequence that is at least 90%identical to SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 26, 27, 28, or 29, and a sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 26, 27, 28, or 29.

[0079] In one aspect, the disclosure is related to a cell comprising the protein described herein and / or the nucleic acid described herein.

[0080] In one aspect, the disclosure is related to an animal comprising the protein described herein and / or the nucleic acid described herein.

[0081] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

[0082] Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.DESCRIPTION OF DRAWINGS

[0083] FIG. 1 is a schematic diagram showing mouse and human TRBC1 to TRBC2 gene loci (not to scale) .

[0084] FIG. 2 is a schematic diagram showing an exemplary TRBC1 to TRBC2 gene targeting strategy with an exemplary targeting vector design (not to scale) .

[0085] FIGS. 3A-3B: PCR identification results of TRBC gene humanized mice F1 generation. WT is the wild-type control, M is the Marker, PC is the positive control, and H2O is the water control.

[0086] FIG. 4: RT-PCR identification results of TRBC gene humanized mice F1 generation. + / + represents wild-type mice, H / H represents TRBC gene humanized homozygous mice, and H2O is the water control.

[0087] FIG. 5: Flow cytometry results of leukocyte subpopulation proportions in the spleen.

[0088] FIG. 6: Flow cytometry results of T cell subpopulation proportions in the spleen.

[0089] FIG. 7A: Percentage of CD69+activated T cells (mCD69+) among leukocytes (mCD45+) after 24 hours of stimulation.

[0090] FIG. 7B: Percentage of CD25+activated T cells (mCD25+) among leukocytes (mCD45+) after 24 hours of stimulation.

[0091] FIG. 8A: Mean fluorescence intensity of CD69+activated T cells (mCD69+) after 24 hours of stimulation.

[0092] FIG. 8B: Mean fluorescence intensity of CD25+activated T cells (mCD25+) after 24 hours of stimulation.

[0093] FIG. 9A: Percentage of CD69+activated T cells (mCD69+) among leukocytes (mCD45+) after 42 hours of stimulation.

[0094] FIG. 9B: Percentage of CD25+activated T cells (mCD25+) among leukocytes (mCD45+) after 42 hours of stimulation.

[0095] FIG. 10A: Mean fluorescence intensity of CD69+activated T cells (mCD69+) after 42 hours of stimulation.

[0096] FIG. 10B: Mean fluorescence intensity of CD25+activated T cells (mCD25+) after 42 hours of stimulation.

[0097] FIG. 11: ELISPOT detection results. + / + represents wild-type C57BL / 6 mice, while H / H represents TRBC gene humanized homozygous mice, NC1 and NC2 represent Negative Control, PC1 and PC2 represent Positive Control.

[0098] FIG. 12: Alignment between mouse TRBC1 (SEQ ID NO: 1) and human TRBC1 (SEQ ID NO: 2) .

[0099] FIG. 13: Alignment between mouse TRBC2 (SEQ ID NO: 3) and human TRBC2 (SEQ ID NO: 4) .DETAILED DESCRIPTION

[0100] This disclosure relates to transgenic non-human animal with human or chimeric (e.g., humanized) TRBC, and methods of use thereof.

[0101] Experimental animal models are an indispensable research tool for studying the effects of drug candidates (e.g., anti-TRBC antibodies) . Common experimental animals include mice, rats, guinea pigs, hamsters, rabbits, dogs, monkeys, pigs, fish and so on. However, there are many differences between human and animal genes and protein sequences, and many human proteins cannot bind to the animal’s homologous proteins to produce biological activity, leading to that the results of many clinical trials do not match the results obtained from animal experiments. A large number of clinical studies are in urgent need of better animal models. With the continuous development and maturation of genetic engineering technologies, the use of human cells or genes to replace or substitute an animal’s endogenous similar cells or genes to establish a biological system or disease model closer to human, and establish the humanized experimental animal models (humanized animal model) has provided an important tool for new clinical approaches or means. In this context, the genetically engineered animal model, that is, the use of genetic manipulation techniques, the use of human normal or mutant genes to replace animal homologous genes, can be used to establish the genetically modified animal models that are closer to human gene systems. The humanized animal models have various important applications. For example, due to the presence of human or humanized genes, the animals can express or express in part of the proteins with human functions, so as to greatly reduce the differences in clinical trials between humans and animals, and provide the possibility of drug screening at animal levels.

[0102] TRBC

[0103] The T cell receptor (TCR) comprises a heterodimeric protein complex of two chains, TCRαand TCRβ7. An ancestral duplication of theβ-chain constant gene results in the expression of one of two highly homologous chains [T cell receptorβ-chain constant (TRBC) domains 1 and 2] in a mutually exclusive manner following TCR locus rearrangement. TRBC1 and TRBC2 differ by only four amino acid mutations in the extracellular domain, two of which are easily accessible to a cellular immunotherapy approach. The surrounding sequence is identical between the two isoforms and the folded structure remains largely unchanged.

[0104] Mature T cell lymphomas are aggressive, treatment resistant cancers that are associated with poor prognosis. Clinical application of immunotherapeutic approaches has been limited by a lack of target antigens that discriminate malignant from healthy T cells. Unlike B cell depletion, pan T cell aplasia is prohibitively toxic. The mutually exclusive expression of TRBC1 and TRBC2 allows targeting the malignant T cell population while preserving T cell function. Notably, a two amino acid inversion is the only exposed and antibody-accessible feature differentiating the two isoforms, making the development of therapeutics targeting TRBC1 and TRBC2 challenging.

[0105] Preclinical studies showed that targeting T cell receptorβ-chain constant region 1 (TRBC1) can kill cancerous T cells while preserving sufficient healthy T cells to maintain immunity, making TRBC1 an attractive target to treat T cell cancers. However, the first-in-human clinical trial of anti-TRBC1 CAR T cells reported a low response rate and unexplained loss of anti-TRBC1 CAR T cells, likely because CAR T cells are lost due to killing by the patient’s normal T cells, reducing their efficacy. To circumvent this issue, antibody–drug conjugates were developed to kill TRBC1+cancer cells in vitro and cure human T cell cancers in mouse models.

[0106] A detailed review of TRBC and its role in cancer can be found in Ferrari, Mathieu, et al. "Structure-guided engineering of immunotherapies targeting TRBC1 and TRBC2 in T cell malignancies. " Nature Communications 15.1 (2024) : 1583; Nichakawade, Tushar D., et al. "TRBC1-targeting antibody–drug conjugates for the treatment of T cell cancers. " Nature 628.8007 (2024) : 416-423; Ferrari, Mathieu, et al. "Targeting TRBC1 and 2 for the treatment of T cell lymphomas. " Cancer Research 80.16_Supplement (2020) : 2183-2183, each of which is incorporated herein by reference in its entirety.

[0107] In human genomes, the TRBC1 gene locus has 4 exons, exon 1, exon 2, exon 3 and exon 4. The TRBC1 protein also has, from N-terminus to C-terminus, an extracellular region, a transmembrane region, and a cytoplasmic region. The amino acid sequence for human TRBC1 is set forth in SEQ ID NO: 2.

[0108] The human TRBC1 gene (Gene ID: 28639) is located in Chromosome 7 of the human genome, which is located from 142791694 to 142793141 (GRCh38. p14 (GCF_000001405.40) ) . All relevant information for human TRBC1 locus can be found in the NCBI website with Gene ID: 28639, which is incorporated by reference herein in its entirety.

[0109] In mice, TRBC1 gene locus has 4 exons, exon 1, exon 2, exon 3 and exon 4. The mouse TRBC1 protein also has, from N-terminus to C-terminus, an extracellular region, atransmembrane region, and a cytoplasmic region. The amino acid sequence for mouse TRBC1 is set forth in SEQ ID NO: 1.

[0110] The mouse TRBC1 gene (Gene ID: 100125262) is located in Chromosome 6 of the mouse genome, which is located from 41515153 to 41516599 (GRCm39 (GCF_000001635.27) ) . All relevant information for mouse TRBC1 locus can be found in the NCBI website with Gene ID: 100125262, which is incorporated by reference herein in its entirety.

[0111] In human genomes, the TRBC2 gene locus has 4 exons, exon 1, exon 2, exon 3 and exon 4. The TRBC2 protein also has, from N-terminus to C-terminus, an extracellular region, a transmembrane region, and a cytoplasmic region. The amino acid sequence for human TRBC2 is set forth in SEQ ID NO: 4.

[0112] The human TRBC2 gene (Gene ID: 28638) is located in Chromosome 7 of the human genome, which is located from 142801041 to 142802529 (GRCh38. p14 (GCF_000001405.40) ) . All relevant information for human TRBC2 locus can be found in the NCBI website with Gene ID: 28638, which is incorporated by reference herein in its entirety.

[0113] In mice, TRBC2 gene locus has 4 exons, exon 1, exon 2, exon 3 and exon 4. The mouse TRBC2 protein also has, from N-terminus to C-terminus, an extracellular region, a transmembrane region, and a cytoplasmic region. The amino acid sequence for mouse TRBC2 is set forth in SEQ ID NO: 3.

[0114] The mouse TRBC2 gene (Gene ID: 100125263) is located in Chromosome 6 of the mouse genome, which is located from 41523664 to 41525115 (GRCm39 (GCF_000001635.27) ) . All relevant information for mouse TRBC2 locus can be found in the NCBI website with Gene ID: 100125263, which is incorporated by reference herein in its entirety.

[0115] FIG. 12 shows the alignment between human TRBC1 amino acid sequence (SEQ ID NO: 2) and mouse TRBC1 amino acid sequence (SEQ ID NO: 1) . Thus, the corresponding amino acid residue or region between human and mouse TRBC1 can be found in FIG. 12.

[0116] FIG. 13 shows the alignment between human TRBC2 amino acid sequence (SEQ ID NO: 4) and mouse TRBC2 amino acid sequence (SEQ ID NO: 3) . Thus, the corresponding amino acid residue or region between human and mouse TRBC2 can be found in FIG. 13.

[0117] TRBC genes, proteins, and locus of the other species are also known in the art. For example, the gene ID for TRBC1 in Monodelphis domestica (gray short-tailed opossum) is 100652678; the gene ID for TRBC2 in Monodelphis domestica (gray short-tailed opossum) is 100652679. The relevant information for these genes (e.g., intron sequences, exon sequences, amino acid residues of these proteins) can be found, e.g., in NCBI database, which is incorporated by reference herein in its entirety.

[0118] The present disclosure provides human or chimeric (e.g., humanized) TRBC1 / TRBC2 nucleotide sequence and / or amino acid sequences. In some embodiments, the entire sequence of mouse exon 1, exon 2, exon 3 and / or exon 4 are replaced by the corresponding human sequence. In some embodiments, a “region” or “portion” of mouse exon 1, exon 2, exon 3 and / or exon 4 are replaced by the corresponding human sequence. The term “region” or “portion” can refer to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 510, 520, 525, 526, 527, 528, 529, 530, 531, 532, 533, or 534 nucleotides, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 171, 172, 173, 174, 175, 176177 or 178amino acid residues. In some embodiments, the “region” or “portion” can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%identical to exon 1, exon 2, exon 3, and / or exon 4. In some embodiments, a region, a portion, or the entire sequence of mouse exon 1, exon 2, exon 3, and / or exon 4 (e.g., a portion of exon 1, exon 2, and a portion of exon 3) are replaced by a region, a portion, or the entire sequence of the human exon 1, exon 2, exon 3, and / or exon 4 (e.g., a portion of exon 1, exon 2, and a portion of exon 3) . In some embodiments, a “region” or “portion” of the extracellular region, transmembrane region, cytoplasmic region, exon 1, exon 2, exon 3, and / or exon 4 is deleted.

[0119] In some embodiments, the present disclosure is related to a genetically-modified, non-human animal whose genome comprises a chimeric (e.g., humanized) TRBC1 nucleotide sequence. In some embodiments, the chimeric (e.g., humanized) TRBC1 nucleotide sequence encodes a TRBC1 protein comprising an extracellular region, a transmembrane region, and a cytoplasmic region. In some embodiments, the extracellular region comprises a sequence that is at least 80%, 85%, 90%, 95%, or 100%identical to amino acids 1-149 of SEQ ID NO: 2. In some embodiments, the extracellular region comprises all or part of human TRBC extracellular region. In some embodiments, the transmembrane region comprises a sequence that is at least 80%, 85%, 90%, 95%, or 100%identical to amino acids 150-171 of SEQ ID NO: 2. In some embodiments, the transmembrane region comprises all or part of human TRBC transmembrane region. In some embodiments, the cytoplasmic region comprises a sequence that is at least 80%, 85%, 90%, 95%, or 100%identical to amino acids 172-176 of SEQ ID NO: 2. In some embodiments, the cytoplasmic region comprises all or part of human TRBC cytoplasmic region. In some embodiments, the genome of the animal comprises a sequence that is at least 80%, 85%, 90%, 95%, or 100%identical to SEQ ID NO: 24.

[0120] In some embodiments, the present disclosure is related to a genetically-modified, non-human animal whose genome comprises a chimeric (e.g., humanized) TRBC2 nucleotide sequence. In some embodiments, the chimeric (e.g., humanized) TRBC2 nucleotide sequence encodes a TRBC2 protein comprising an extracellular region, a transmembrane region, and a cytoplasmic region. In some embodiments, the extracellular region comprises a sequence that is at least 80%, 85%, 90%, 95%, or 100%identical to amino acids 1-149 of SEQ ID NO: 4. In some embodiments, the extracellular region comprises all or part of human TRBC extracellular region. In some embodiments, the transmembrane region comprises a sequence that is at least 80%, 85%, 90%, 95%, or 100%identical to amino acids 150-171 of SEQ ID NO: 4. In some embodiments, the transmembrane region comprises all or part ofhuman TRBC transmembrane region. In some embodiments, the cytoplasmic region comprises a sequence that is at least 80%, 85%, 90%, 95%, or 100%identical to amino acids 172-178 of SEQ ID NO: 4. In some embodiments, the cytoplasmic region comprises all or part of human TRBC cytoplasmic region. In some embodiments, the genome of the animal comprises a sequence that is at least 80%, 85%, 90%, 95%, or 100%identical to SEQ ID NO: 25.

[0121] In some embodiments, the genetically-modified non-human animal described herein comprises a sequence encoding a human or humanized TRBC1 protein. In some embodiments, the TRBC1 protein comprises, from N-terminus to C-terminus, an extracellular region, a transmembrane region, and a cytoplasmic region. In some embodiments, the humanized TRBC1 protein comprises a human or humanized extracellular region. In some embodiments, the humanized TRBC1 protein comprises an endogenous extracellular region. In some embodiments, the humanized TRBC1 protein comprises a human or humanized transmembrane region. In some embodiments, the humanized TRBC1 protein comprises an endogenous transmembrane region. In some embodiments, the humanized TRBC1 protein comprises a human or humanized cytoplasmic region. In some embodiments, the humanized TRBC1 protein comprises an endogenous cytoplasmic region. In some embodiments, the humanized TRBC1 protein comprises a human or humanized extracellular region, an endogenous transmembrane region, and an endogenous cytoplasmic region. In some embodiments, the humanized TRBC1 protein comprises an endogenous sequence that corresponds to amino acids 146-172 of SEQ ID NO: 1.

[0122] In some embodiments, the genetically-modified non-human animal described herein comprises a sequence encoding a human or humanized TRBC2 protein. In some embodiments, the TRBC2 protein comprises, from N-terminus to C-terminus, an extracellular region, a transmembrane region, and a cytoplasmic region. In some embodiments, the humanized TRBC2 protein comprises a human or humanized extracellular region. In some embodiments, the humanized TRBC2 protein comprises an endogenous extracellular region. In some embodiments, the humanized TRBC2 protein comprises a human or humanized transmembrane region. In some embodiments, the humanized TRBC2 protein comprises an endogenous transmembrane region. In some embodiments, the humanized TRBC2 protein comprises a human or humanized cytoplasmic region. In some embodiments, the humanized TRBC2 protein comprises an endogenous cytoplasmic region. In some embodiments, the humanized TRBC2 protein comprises a human or humanized extracellular region, an endogenous transmembrane region, and an endogenous cytoplasmic region.

[0123] In some embodiments, the genetically-modified non-human animal described herein comprises a human or humanized TRBC gene. In some embodiments, the humanized TRBC gene comprises 4 exons. In some embodiments, the humanized TRBC gene comprises a humanized exon 1, a human exon 2, a humanized exon 3 and a mouse exon 4. In some embodiments, the humanized TRBC gene comprises one or more human or humanized introns. In some embodiments, the humanized TRBC gene comprises one or more endogenous introns. In some embodiments, the humanized TRBC gene comprises human or humanized 5’ UTR. In some embodiments, the humanized TRBC gene comprises human or humanized 3’ UTR. In some embodiments, the humanized TRBC gene comprises endogenous 5’ UTR. In some embodiments, the humanized TRBC gene comprises endogenous 3’ UTR.

[0124] Thus, in some embodiments, the present disclosure also provides a chimeric (e.g., humanized) TRBC nucleotide sequence and / or amino acid sequences. In some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%of the sequence are identical to or derived from mouse TRBC mRNA sequence, mouse TRBC amino acid sequence (e.g., SEQ ID NO: 1 or SEQ ID NO: 3) , or a portion thereof (e.g., a portion exon 1, exon 2 and a portion of exon 3) . In some embodiments, at least 1%, 2%, 3%,4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%of the sequence are identical to or derived from human TRBC mRNA sequence, human TRBC amino acid sequence (e.g., SEQ ID NO: 2 or SEQ ID NO: 4) , or a portion thereof (e.g., a portion of exon 1, exon 2 and a portion of exon 3) .

[0125] In some embodiments, the sequence encoding amino acids 3-145 of mouse TRBC1 (SEQ ID NO: 1) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human TRBC 1 (e.g., amino acids 3-149 of human TRBC 1 (SEQ ID NO: 2) ) .

[0126] In some embodiments, the sequence encoding amino acids 3-140 of mouse TRBC2 (SEQ ID NO: 3) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human TRBC2 (e.g., amino acids 3-144 of human TRBC2 (SEQ ID NO: 4) ) .

[0127] In some embodiments, the nucleic acids as described herein are operably linked to a promotor or regulatory element, e.g., an endogenous mouse TRBC promotor, an inducible promoter, an enhancer, and / or mouse or human regulatory elements.

[0128] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides) that are different from part of or the entire mouse TRBC nucleotide sequence.

[0129] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., a portion of exon 3) that is the same as part of or the entire mouse TRBC nucleotide sequence.

[0130] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., a portion of exon 3) that is different from part of or the entire human TRBC nucleotide sequence.

[0131] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides) that is the same as part of or the entire human TRBC nucleotide sequence.

[0132] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., amino acids 1-163) that is different from part of or the entire mouse TRBC amino acid sequence (e.g., SEQ ID NO: 1 or SEQ ID NO: 3) .

[0133] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., amino acids 164-176) that is the same as part of or the entire mouse TRBC amino acid sequence (e.g., SEQ ID NO: 1) .

[0134] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., amino acids 164-176) that is different from part of or the entire human TRBC amino acid sequence (e.g., SEQ ID NO: 2) .

[0135] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., amino acids 1-163) that is the same as part of or the entire human TRBC amino acid sequence (e.g., SEQ ID NO: 2 or SEQ ID NO: 4) .

[0136] The present disclosure also provides a humanized TRBC mouse amino acid sequence, wherein the amino acid sequence is selected from the group consisting of:

[0137] a) an amino acid sequence shown in SEQ ID NO: 24 or 25;

[0138] b) an amino acid sequence having a homology of at least 90%with or at least 90%identical to the amino acid sequence shown in SEQ ID NO: 24 or 25;

[0139] c) an amino acid sequence encoded by a nucleic acid sequence, wherein the nucleic acid sequence is able to hybridize to a nucleotide sequence encoding the amino acid shown in SEQ ID NO:24 or 25 under a low stringency condition or a strict stringency condition;

[0140] d) an amino acid sequence having a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the amino acid sequence shown in SEQ ID NO: 24 or 25;

[0141] e) an amino acid sequence that is different from the amino acid sequence shown in SEQ ID NO: 24 or 25 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; or

[0142] f) an amino acid sequence that comprises a substitution, a deletion and / or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 24 or 25.

[0143] The present disclosure also provides a humanized TRBC amino acid sequence, wherein the amino acid sequence contains:

[0144] a) all or part of amino acids 1-149 of SEQ ID NO: 2 or 4;

[0145] b) an amino acid sequence have a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%to amino acids 1-149 of SEQ ID NO: 2 or 4;

[0146] c) an amino acid sequence that is different from amino acids 1-149 of SEQ ID NO: 2 or 4 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; or

[0147] d) an amino acid sequence that comprises a substitution, a deletion and / or insertion of one or more amino acids to amino acids 1-149 of SEQ ID NO: 2 or 4.

[0148] The present disclosure also relates to a TRBC nucleic acid (e.g., DNA or RNA) sequence, wherein the nucleic acid sequence can be selected from the group consisting of:

[0149] a) a nucleic acid sequence as shown in SEQ ID NO: 5, 6, 7, 8, 9, 10, or 11, or a nucleic acid sequence encoding a homologous TRBC amino acid sequence of a humanized mouse TRBC;

[0150] b) a nucleic acid sequence that is able to hybridize to the nucleotide sequence as shown in SEQ ID NO: 5, 6, 7, 8, 9, 10, or 11 under a low stringency condition or a strict stringency condition;

[0151] c) a nucleic acid sequence that has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the nucleotide sequence as shown in SEQ ID NO: 5, 6, 7, 8, 9, 10, or 11;

[0152] d) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90%with or at least 90%identical to the amino acid sequence shown in SEQ ID NO: 24 or 25;

[0153] e) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%with, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the amino acid sequence shown in SEQ ID NO: 24 or 25;

[0154] f) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence is different from the amino acid sequence shown in SEQ ID NO: 24 or 25 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; and / or

[0155] g) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence comprises a substitution, a deletion and / or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 24 or 25.

[0156] The disclosure also provides an amino acid sequence that has a homology of at least 90%with, or at least 90%identical to the sequence shown in SEQ ID NO: 24 or 25, and has protein activity. In some embodiments, the homology with the sequence shown in SEQ ID NO: 24 or 25 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing homology is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

[0157] In some embodiments, the percentage identity with the sequence shown in SEQ ID NO: 24 or 25 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing percentage identity is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

[0158] In some embodiments, the percentage identity with the sequence shown in SEQ ID NO: 5, 6, 7, 8, 9, 10, or 11 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing percentage identity is at least about 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

[0159] The disclosure also provides a nucleic acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical to any nucleotide sequence as described herein, and an amino acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical to any amino acid sequence as described herein. In some embodiments, the disclosure relates to nucleotide sequences encoding any peptides that are described herein, or any amino acid sequences that are encoded by any nucleotide sequences as described herein.

[0160] In some embodiments, the amino acid sequence (i) comprises an amino acid sequence; or (ii) consists of an amino acid sequence, wherein the amino acid sequence is any one of the sequences as described herein.

[0161] In some embodiments, the nucleic acid sequence (i) comprises a nucleic acid sequence; or (ii) consists of a nucleic acid sequence, wherein the nucleic acid sequence is any one of the sequences as described herein.

[0162] To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes) . The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. For example, the comparison of sequences and determination of percent identity between two sequences can be accomplished using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.

[0163] The percentage of residues conserved with similar physicochemical properties (percent homology) , e.g. leucine and isoleucine, can also be used to measure sequence similarity. Families of amino acid residues having similar physicochemical properties have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine) , acidic side chains (e.g., aspartic acid, glutamic acid) , uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine) , nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan) , beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine) . The homology percentage, in many cases, is higher than the identity percentage.

[0164] Cells, tissues, and animals (e.g., mouse) are also provided that comprise the nucleotide sequences as described herein, as well as cells, tissues, and animals (e.g., mouse) that express human or chimeric (e.g., humanized) TRBC from an endogenous non-human TRBC locus.

[0165] Genetically modified animals

[0166] As used herein, the term “genetically-modified non-human animal” refers to a non-human animal having exogenous DNA in at least one chromosome of the animal's genome. In some embodiments, at least one or more cells, e.g., at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%of cells of the genetically-modified non-human animal have the exogenous DNA in its genome. The cell having exogenous DNA can be various kinds of cells, e.g., an endogenous cell, a somatic cell, an immune cell, a T cell, a B cell, an antigen presenting cell, a macrophage, a dendritic cell, a germ cell, a blastocyst, or an endogenous tumor cell. In some embodiments, genetically-modified non-human animals are provided that comprise a modified endogenous TRBC locus that comprises an exogenous sequence (e.g., a human sequence) , e.g., a replacement of one or more non-human sequences with one or more human sequences. The animals are generally able to pass the modification to progeny, i.e., through germline transmission.

[0167] As used herein, the term “chimeric gene” or “chimeric nucleic acid” refers to a gene or a nucleic acid, wherein two or more portions of the gene or the nucleic acid are from different species, or at least one of the sequences of the gene or the nucleic acid does not correspond to the wild-type nucleic acid in the animal. In some embodiments, the chimeric gene or chimeric nucleic acid has at least one portion of the sequence that is derived from two or more different sources, e.g., sequences encoding different proteins or sequences encoding the same (or homologous) protein of two or more different species. In some embodiments, the chimeric gene or the chimeric nucleic acid is a humanized gene or humanized nucleic acid.

[0168] As used herein, the term “chimeric protein” or “chimeric polypeptide” refers to a protein or a polypeptide, wherein two or more portions of the protein or the polypeptide are from different species, or at least one of the sequences of the protein or the polypeptide does not correspond to wild-type amino acid sequence in the animal. In some embodiments, the chimeric protein or the chimeric polypeptide has at least one portion of the sequence that is derived from two or more different sources, e.g., same (or homologous) proteins of different species. In some embodiments, the chimeric protein or the chimeric polypeptide is a humanized protein or a humanized polypeptide.

[0169] As used herein, the term “humanized protein” or “humanized polypeptide” refers to a protein or a polypeptide, wherein at least a portion of the protein or the polypeptide is from the human protein or human polypeptide. In some embodiments, the humanized protein or polypeptide is a human protein or polypeptide.

[0170] As used herein, the term “humanized nucleic acid” refers to a nucleic acid, wherein at least a portion of the nucleic acid is from the human. In some embodiments, the entire nucleic acid of the humanized nucleic acid is from human. In some embodiments, the humanized nucleic acid is a humanized exon. A humanized exon can be e.g., a human exon or a chimeric exon.

[0171] In some embodiments, the chimeric gene or the chimeric nucleic acid is a humanized TRBC gene or a humanized TRBC nucleic acid. In some embodiments, at least one or more portions of the gene or the nucleic acid is from the human TRBC gene, at least one or more portions of the gene or the nucleic acid is from a non-human TRBC gene. In some embodiments, the gene or the nucleic acid comprises a sequence that encodes an TRBC protein. The encoded TRBC protein is functional or has at least one activity of the human TRBC protein or the non-human TRBC protein.

[0172] In some embodiments, the chimeric protein or the chimeric polypeptide is a humanized TRBC protein or a humanized TRBC polypeptide. In some embodiments, at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a human TRBC protein, and at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a non-human TRBC protein. The humanized TRBC protein or the humanized TRBC polypeptide is functional or has at least one activity of the human TRBC protein or the non-human TRBC protein.

[0173] In some embodiments, the extracellular region is human or humanized. In some embodiments, the cytoplasmic region is human or humanized. In some embodiments, the transmembrane region is human or humanized. In some embodiments, both the transmembrane and cytoplasmic regions are endogenous.

[0174] The genetically modified non-human animal can be various animals, e.g., a mouse, rat, rabbit, pig, bovine (e.g., cow, bull, buffalo) , deer, sheep, goat, chicken, cat, dog, ferret, primate (e.g., marmoset, rhesus monkey) . For the non-human animals where suitable genetically modifiable embryonic stem (ES) cells are not readily available, other methods are employed to make a non-human animal comprising the genetic modification. Such methods include, e.g., modifying a non-ES cell genome (e.g., a fibroblast or an induced pluripotent cell) and employing nuclear transfer to transfer the modified genome to a suitable cell, e.g., an oocyte, and gestating the modified cell (e.g., the modified oocyte) in a non-human animal under suitable conditions to form an embryo. These methods are known in the art, and are described, e.g., in A. Nagy, et al., “Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition) , ” Cold Spring Harbor Laboratory Press, 2003, which is incorporated by reference herein in its entirety.

[0175] In one aspect, the animal is a mammal, e.g., of the superfamily Dipodoidea or Muroidea. In some embodiments, the genetically modified animal is a rodent. The rodent can be selected from a mouse, a rat, and a hamster. In some embodiments, the genetically modified animal is from a family selected from Calomyscidae (e.g., mouse-like hamsters) , Cricetidae (e.g., hamster, New World rats and mice, voles) , Muridae (true mice and rats, gerbils, spiny mice, crested rats) , Nesomyidae (climbing mice, rock mice, with-tailed rats, Malagasy rats and mice) , Platacanthomyidae (e.g., spiny dormice) , and Spalacidae (e.g., mole rates, bamboo rats, and zokors) . In some embodiments, the genetically modified rodent is selected from a true mouse or rat (family Muridae) , a gerbil, a spiny mouse, and a crested rat. In some embodiments, the non-human animal is a mouse.

[0176] In some embodiments, the animal is a mouse of a C57BL strain selected from C57BL / A, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL / 10Cr, and C57BL / Ola. In some embodiments, the mouse is a 129 strain selected from the group consisting of a strain that is 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1 / SV, 129S1 / SvIm) , 129S2, 129S4, 129S5, 129S9 / SvEvH, 129S6 (129 / SvEvTac) , 129S7, 129S8, 129T1, 129T2. These mice are described, e.g., in Festing et al., Revised nomenclature for strain 129 mice, Mammalian Genome 10: 836 (1999) ; Auerbach et al., Establishment and Chimera Analysis of 129 / SvEv-and C57BL / 6-Derived Mouse Embryonic Stem Cell Lines (2000) , both of which are incorporated herein by reference in the entirety. In some embodiments, the genetically modified mouse is a mix of the 129 strain and the C57BL / 6 strain. In some embodiments, the mouse is a mix of the 129 strains, or a mix of the BL / 6 strains. In some embodiments, the mouse is a BALB strain, e.g., BALB / c strain. In some embodiments, the mouse is a mix of a BALB strain and another strain. In some embodiments, the mouse is from a hybrid line (e.g., 50%BALB / c-50%12954 / Sv; or 50%C57BL / 6-50%129) . In some embodiments, the non-human animal is a rodent. In some embodiments, the non-human animal is a mouse having a BALB / c, A, A / He, A / J, A / WySN, AKR, AKR / A, AKR / J, AKR / N, TA1, TA2, RF, SWR, C3H, C57BR, SJL, C57L, DBA / 2, KM, NIH, ICR, CFW, FACA, C57BL / A, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL (C57BL / 10Cr and C57BL / Ola) , C58, CBA / Br, CBA / Ca, CBA / J, CBA / st, or CBA / H background.

[0177] In some embodiments, the animal is a rat. The rat can be selected from a Wistar rat, an LEA strain, a Sprague Dawley strain, a Fischer strain, F344, F6, and Dark Agouti. In some embodiments, the rat strain is a mix of two or more strains selected from the group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6, and Dark Agouti.

[0178] The animal can have one or more other genetic modifications, and / or other modifications, that are suitable for the particular purpose for which the humanized TRBC animal is made. For example, suitable mice for maintaining a xenograft (e.g., a human cancer or tumor) , can have one or more modifications that compromise, inactivate, or destroy the immune system of the non-human animal in whole or in part. Compromise, inactivation, or destruction of the immune system of the non-human animal can include, for example, destruction of hematopoietic cells and / or immune cells by chemical means (e.g., administering a toxin) , physical means (e.g., irradiating the animal) , and / or genetic modification (e.g., knocking out one or more genes) . Non-limiting examples of such mice include, e.g., NOD mice, SCID mice, NOD / SCID mice, IL2Rγknockout mice, NOD / SCID / γcnull mice (Ito, M. et al., NOD / SCID / γcnull mouse: an excellent recipient mouse model for engraftment of human cells, Blood 100 (9) : 3175-3182, 2002) , nude mice, and Ragl and / or Rag2 knockout mice. These mice can optionally be irradiated, or otherwise treated to destroy one or more immune cell type. Thus, in various embodiments, a genetically modified mouse is provided that can include a humanization of at least a portion of an endogenous non-human TRBC locus, and further comprises a modification that compromises, inactivates, or destroys the immune system (or one or more cell types of the immune system) of the non-human animal in whole or in part. In some embodiments, modification is, e.g., selected from the group consisting of a modification that results in NOD mice, SCID mice, NOD / SCID mice, IL-2Rγ knockout mice, NOD / SCID / γcnull mice, nude mice, Ragl and / or Rag2 knockout mice, NOD-Prkdcscid IL-2rγnull mice, NOD-Rag 1- / --IL2rg- / - (NRG) mice, Rag 2- / --IL2rg- / - (RG) mice, and a combination thereof. These genetically modified animals are described, e.g., in US20150106961, which is incorporated herein by reference in its entirety. In some embodiments, the mouse can include a replacement of all or part of TRBC coding sequence with human TRBC coding sequence.

[0179] Genetically modified non-human animals can comprise a modification at an endogenous non-human TRBC locus. In some embodiments, the modification can comprise a human nucleic acid sequence encoding at least a portion of a mature TRBC protein (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99%identical to the mature TRBC protein sequence) . Although genetically modified cells are also provided that can comprise the modifications described herein (e.g., ES cells, somatic cells) , in many embodiments, the genetically modified non-human animals comprise the modification of the endogenous TRBC locus in the germline of the animal.

[0180] Genetically modified animals can express a human TRBC and / or a chimeric (e.g., humanized) TRBC from endogenous mouse loci, wherein the endogenous mouse TRBC gene has been replaced with a human TRBC gene and / or a nucleotide sequence that encodes a region of human TRBC sequence or an amino acid sequence that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70&, 80%, 90%, 95%, 96%, 97%, 98%, or 99%identical to the human TRBC sequence. In various embodiments, an endogenous non-human TRBC locus is modified in whole or in part to comprise human nucleic acid sequence encoding at least one protein-coding sequence of a mature TRBC protein.

[0181] In some embodiments, the genetically modified mice can express the human TRBC and / or chimeric TRBC (e.g., humanized TRBC) from endogenous loci that are under control of mouse promoters and / or mouse regulatory elements. The replacement (s) at the endogenous mouse loci provide non-human animals that express human TRBC or chimeric TRBC (e.g., humanized TRBC) in appropriate cell types and in a manner that does not result in the potential pathologies observed in some other transgenic mice known in the art. The human TRBC or the chimeric TRBC (e.g., humanized TRBC) expressed in animal can maintain one or more functions of the wild-type mouse or human TRBC in the animal. For example, the expressed TRBC can mediate proper cell signaling events. Furthermore, in some embodiments, the animal does not express endogenous TRBC. In some embodiments, the animal expresses a decreased level of endogenous TRBC as compared to TRBC expression level in a wild-type animal. As used herein, the term “endogenous TRBC” refers to TRBC protein that is expressed from an endogenous TRBC nucleotide sequence of the non-human animal (e.g., mouse) before any genetic modification.

[0182] The genome of the animal can comprise a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human TRBC1 (SEQ ID NO: 2) or human TRBC2 (SEQ ID NO: 4) . In some embodiments, the genome comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 24 or 25.

[0183] The genome of the genetically modified animal can comprise a replacement at an endogenous TRBC gene locus of a sequence encoding a region of endogenous TRBC with a sequence encoding a corresponding region of human TRBC. In some embodiments, the sequence that is replaced is any sequence within the endogenous TRBC gene locus, e.g., exon 1, exon 2, exon 3, 5'-UTR, 3'-UTR, intron 1, intron 2, or any combination thereof. In some embodiments, the sequence that is replaced is within the regulatory region of the endogenous TRBC gene. In some embodiments, the sequence that is replaced is a portion of exon 1, exon 2 and a portion of exon 3 of an endogenous mouse TRBC gene locus.

[0184] The genetically modified animal can have one or more cells expressing a human or chimeric TRBC (e.g., humanized TRBC) having, from N-terminus to C-terminus, an extracellular region, a transmembrane region, and a cytoplasmic region. In some embodiments, the extracellular region comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, 99%identical to the extracellular region of human TRBC. In some embodiments, the extracellular region of the humanized TRBC has a sequence that has at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 141, 142, 143, 144, 145, 146, 147, 148, or 149 amino acids (e.g., contiguously or non-contiguously) that are identical to the extracellular region of human TRBC (e.g., amino acids 3-149 of SEQ ID NO: 2 or amino acids 3-144 of EQ ID NO: 4) . Because human TRBC and non-human TRBC (e.g., mouse TRBC) sequences, in many cases, are different, antibodies that bind to human TRBC will not necessarily have the same binding affinity with non-human TRBC or have the same effects to non-human TRBC. Therefore, the genetically modified animal having a human or a humanized extracellular region can be used to better evaluate the effects of anti-human TRBC antibodies in an animal model.

[0185] In some embodiments, the transmembrane comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, 99%identical to the transmembrane region of endogenous TRBC (e.g., amino acids 146-167 of SEQ ID NO: 1 or amino acids 146-167 of SEQ ID NO: 3) . In some embodiments, the transmembrane region of the humanized TRBC has a sequence that has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or22 amino acids (contiguously or non-contiguously) that are identical to the transmembrane region of human TRBC (e.g., human TRBC1) . In some embodiments, the cytoplasmic comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, 99%identical to the cytoplasmic of endogenous TRBC (e.g., amino acids 168-172 of SEQ ID NO: 1 or amino acids 168-172 of SEQ ID NO: 3) . In some embodiments, the cytoplasmic region of the humanized TRBC has a sequence that has at least 1, 2, 3, 4, 5 amino acids (contiguously or non-contiguously) that are identical to the cytoplasmic region of endogenous TRBC (e.g., mouse TRBC) .

[0186] In some embodiments, the entire transmembrane region and the entire cytoplasmic region of the humanized TRBC described herein are derived from endogenous sequence.

[0187] In some embodiments, the genome of the genetically modified animal comprises a sequence encoding an amino acid sequence that corresponds to a portion or the entire sequence of exon 1, exon 2, exon 3, and / or exon 4 of human TRBC; a portion or the entire sequence of the extracellular region; or a portion or the entire sequence of amino acids 3-149 of SEQ ID NO: 2.

[0188] In some embodiments, the genome of the genetically modified animal comprises a portion of exon 1, exon 2 and a portion of exon 3 of human TRBC gene. In some embodiments, the portion of exon 3 includes at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides.

[0189] In some embodiments, the non-human animal can have, at an endogenous TRBC gene locus, a nucleotide sequence encoding a chimeric human / non-human TRBC polypeptide, wherein a human portion of the chimeric human / non-human TRBC polypeptide comprises all or a portion of the human TRBC extracellular region, and wherein the animal expresses a functional TRBC on a surface of a cell of the animal. The human portion of the chimeric human / non-human TRBC polypeptide can comprise an amino acid sequence encoded by a portion of exon 1, exon 2 and a portion of exon 3 of human TRBC. In some embodiments, the human portion of the chimeric human / non-human TRBC polypeptide can comprise a sequence that is at least 80%, 85%, 90%, 95%, or 99%identical to amino acids 3-149 of SEQ ID NO: 2.

[0190] In some embodiments, the non-human portion of the chimeric human / non-human TRBC polypeptide comprises the entire transmembrane region and / or the entire cytoplasmic region of an endogenous non-human TRBC polypeptide.

[0191] Furthermore, the genetically modified animal can be heterozygous with respect to the replacement at the endogenous TRBC locus, or homozygous with respect to the replacement at the endogenous TRBC locus.

[0192] In some embodiments, the humanized TRBC locus lacks a human TRBC 5'-UTR. In some embodiment, the humanized TRBC locus comprises an endogenous (e.g., mouse) 5'-UTR. In some embodiments, the humanization comprises an endogenous (e.g., mouse) 3'-UTR. In appropriate cases, it may be reasonable to presume that the mouse and human TRBC genes appear to be similarly regulated based on the similarity of their 5'-flanking sequence. As shown in the present disclosure, humanized TRBC mice that comprise a replacement at an endogenous mouse TRBC locus, which retain mouse regulatory elements but comprise a humanization of TRBC encoding sequence, do not exhibit pathologies. Both genetically modified mice that are heterozygous or homozygous for humanized TRBC are grossly normal.

[0193] The present disclosure further relates to a non-human mammal generated through the method mentioned above. In some embodiments, the genome thereof contains human gene (s) .

[0194] In some embodiments, the non-human mammal is a rodent, and preferably, the non-human mammal is a mouse.

[0195] In some embodiments, the non-human mammal expresses a protein encoded by a humanized TRBC gene.

[0196] In addition, the present disclosure also relates to a tumor bearing non-human mammal model, characterized in that the non-human mammal model is obtained through the methods as described herein. In some embodiments, the non-human mammal is a rodent (e.g., a mouse) .

[0197] The present disclosure further relates to a cell or cell line, or a primary cell culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; the tissue, organ or a culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; and the tumor tissue derived from the non-human mammal or an offspring thereof when it bears a tumor, or the tumor bearing non-human mammal.

[0198] The present disclosure also provides non-human mammals produced by any of the methods described herein. In some embodiments, a non-human mammal is provided; and the genetically modified animal contains the DNA encoding human or humanized TRBC in the genome of the animal.

[0199] In some embodiments, the non-human mammal comprises the genetic construct as described herein. In some embodiments, a non-human mammal expressing human or humanized TRBC is provided. In some embodiments, tissue-specific expression of human or humanized TRBC protein is provided.

[0200] In some embodiments, the expression of human or humanized TRBC in a genetically modified animal is controllable, as by the addition of a specific inducer or repressor substance. In some embodiments, the specific inducer is selected from Tet-Off System / Tet-On System, or Tamoxifen System.

[0201] Non-human mammals can be any non-human animal known in the art and which can be used in the methods as described herein. Preferred non-human mammals are mammals, (e.g., rodents) . In some embodiments, the non-human mammal is a mouse.

[0202] Genetic, molecular and behavioral analyses for the non-human mammals described above can performed. The present disclosure also relates to the progeny produced by the non-human mammal provided by the present disclosure mated with the same or other genotypes.

[0203] The present disclosure also provides a cell line or primary cell culture derived from the non-human mammal or a progeny thereof. A model based on cell culture can be prepared, for example, by the following methods. Cell cultures can be obtained by way of isolation from a non-human mammal, alternatively cells can be obtained from the cell culture established using the same constructs and the standard cell transfection techniques. The integration of genetic constructs containing DNA sequences encoding human TRBC protein can be detected by a variety of methods.

[0204] There are many analytical methods that can be used to detect exogenous DNA, including methods at the level of nucleic acid (including the mRNA quantification approaches using reverse transcriptase polymerase chain reaction (RT-PCR) or Southern blotting, and in situ hybridization) and methods at the protein level (including histochemistry, immunoblot analysis and in vitro binding studies) . In addition, the expression level of the gene of interest can be quantified by ELISA techniques well known to those skilled in the art. Many standard analysis methods can be used to complete quantitative measurements. For example, transcription levels can be measured using RT-PCR and hybridization methods including RNase protection, Southern blot analysis, RNA dot analysis (RNAdot) analysis. Immunohistochemical staining, flow cytometry, Western blot analysis can also be used to assess the presence of human or humanized TRBC protein.

[0205] In another aspect, the disclosure also provides a genetically-modified, non-human animal whose genome comprise a disruption in the animal's endogenous TRBC gene, wherein the disruption of the endogenous TRBC gene comprises deletion of exon 1, exon 2, exon 3, exon 4, or part thereof of the endogenous TRBC gene.

[0206] In some embodiments, the disruption of the endogenous TRBC gene comprises deletion of one or more exons or part of exons selected from the group consisting of exon 1, exon 2, exon 3, and exon 4 of the endogenous TRBC gene.

[0207] In some embodiments, the disruption of the endogenous TRBC gene further comprises deletion of one or more introns or part of introns selected from the group consisting of intron 1 and intron 2 of the endogenous TRBC gene.

[0208] Vectors

[0209] The present disclosure relates to a targeting vector, comprising: a) a DNA fragment homologous to the 5' end of a region to be altered (5' arm) , which is selected from the TRBC gene genomic DNAs in the length of 100 to 10,000 nucleotides; b) a desired / donor DNA sequence encoding a donor region; and c) a second DNA fragment homologous to the 3' end of the region to be altered (3' arm) , which is selected from the TRBC gene genomic DNAs in the length of 100 to 10,000 nucleotides.

[0210] In some embodiments, a) the DNA fragment homologous to the 5' end of a conversion region to be altered (5' arm) is selected from the nucleotide sequences that have at least 90%homology to the NCBI accession number NC_000072.7; c) the DNA fragment homologous to the 3' end of the region to be altered (3' arm) is selected from the nucleotide sequences that have at least 90%homology to the NCBI accession number NC_000072.7.

[0211] In some embodiments, a) the DNA fragment homologous to the 5' end of a region to be altered (5' arm) is selected from the nucleotides from the position 41511487 to the position 41515159 of the NCBI accession number NC_000072.7 (e.g., SEQ ID NO: 5) ; c) the DNA fragment homologous to the 3' end of the region to be altered (3' arm) is selected from the nucleotides from the position 41525761 to the position 41529797 of the NCBI accession number NC_000072.7 (e.g., SEQ ID NO: 6) .

[0212] In some embodiments, the length of the donor sequence in the targeting vector can be more than about 5 kb, about 6 kb, about 7 kb, about 8 kb, about 8.5 kb, about 9 kb, about 9.5 kb, or about 10 kb.

[0213] In some embodiments, the region to be altered is exon 1, exon 2, exon 3 and / or exon 4 of TRBC gene (e.g., a portion of exon 1, exon 2 and a portion of exon 3 of mouse TRBC gene) .

[0214] The targeting vector can further include one or more selectable markers, e.g., positive or negative selectable markers. In some embodiments, the positive selectable marker is a Neo gene or Neo cassette. In some embodiments, the negative selectable marker is a DTA gene.

[0215] In some embodiments, the sequence of the 5' arm is shown in SEQ ID NO: 5; and the sequence of the 3' arm is shown in SEQ ID NO: 6.

[0216] In some embodiments, the donor sequence is derived from human. For example, the desired / donor DNA sequence in the targeting vector is a part or entirety of the nucleotide sequence of a human TRBC, preferably exon 1, exon 2, exon 3, and / or exon 4 of the human TRBC. In some embodiments, the nucleotide sequence of the humanized TRBC encodes the entire or the part of human TRBC1 protein (SEQ ID NO: 2) or human TRBC2 protein (SEQ ID NO: 4) .

[0217] The disclosure also provides vectors for constructing a humanized animal model or a knock-out model. In some embodiments, the vectors comprise a sgRNA sequence, wherein the sgRNA sequence targets TRBC gene, and the sgRNA is unique on the target sequence of the gene to be altered, and meets the sequence arrangement rule of 5'-NNN (20) -NGG3' or 5'-CCN-N (20) -3' ; and in some embodiments, the targeting site of the sgRNA in the mouse TRBC gene is located on any one of exons 1-4, introns 1-3, upstream of exon 1, or downstream of exon 4 of the mouse TRBC gene.

[0218] In some embodiments, the disclosure relates to a plasmid construct (e.g., pT7-sgRNA) including the sgRNA sequence, and / or a cell including the construct.

[0219] The disclosure also relates to a cell comprising the targeting vectors as described above.

[0220] In addition, the present disclosure further relates to a non-human mammalian cell, having any one of the foregoing targeting vectors, and one or more in vitro transcripts of the construct as described herein. In some embodiments, the cell includes Cas9 mRNA or an in vitro transcript thereof.

[0221] In some embodiments, the genes in the cell are heterozygous. In some embodiments, the genes in the cell are homozygous.

[0222] In some embodiments, the non-human mammalian cell is a mouse cell. In some embodiments, the cell is a fertilized egg cell. In some embodiments, the cell is an embryonic stem cell.

[0223] Methods of making genetically modified animals

[0224] Genetically modified animals can be made by several techniques that are known in the art, including, e.g., nonhomologous end-joining (NHEJ) , homologous recombination (HR) , zinc finger nucleases (ZFNs) , transcription activator-like effector-based nucleases (TALEN) , and the clustered regularly interspaced short palindromic repeats (CRISPR) -Cas system. In some embodiments, homologous recombination is used. In some embodiments, CRISPR-Cas9 genome editing is used to generate genetically modified animals. Many of these genome editing techniques are known in the art, and is described, e.g., in Yin et al., “Delivery technologies for genome editing, ” Nature Reviews Drug Discovery 16.6 (2017) : 387-399, which is incorporated by reference in its entirety. Many other methods are also provided and can be used in genome editing, e.g., micro-injecting a genetically modified nucleus into an enucleated oocyte, and fusing an enucleated oocyte with another genetically modified cell.

[0225] Thus, in some embodiments, the disclosure provides replacing in at least one cell of the animal, at an endogenous TRBC gene locus, a sequence encoding a region of an endogenous TRBC with a sequence encoding a corresponding region of human or chimeric TRBC. In some embodiments, the replacement occurs in a germ cell, a somatic cell, a blastocyst, or a fibroblast, etc. The nucleus of a somatic cell or the fibroblast can be inserted into an enucleated oocyte.

[0226] In some embodiments, the targeting strategies involve a vector comprising a 5' homologous ann, a human TRBC gene fragment, and a 3' homologous ann. The process can involve replacing endogenous TRBC sequence with human sequence by homologous recombination. In some embodiments, the cleavage at the upstream and the downstream of the target site (e.g., by zinc finger nucleases, TALEN or CRISPR) can result in DNA double strands break, and the homologous recombination is used to replace endogenous TRBC sequence with human TRBC sequence.

[0227] In some embodiments, the methods for making a genetically modified, humanized animal, can include the step of replacing at an endogenous TRBC locus (or site) , a nucleic acid sequence encoding a region of endogenous TRBC with a sequence encoding a corresponding region of human TRBC. The sequence can include a region (e.g., a part or the entire region) of exon 1, exon 2, exon 3, and / or exon 4 of a human TRBC gene. In some embodiments, the sequence includes a portion of exon 1, exon 2 and a portion of exon 3 of a human TRBC gene. In some embodiments, the region includes the extracellular region of human TRBC (e.g., amino acids 3-149 of SEQ ID NO: 2 or amino acids 3-144 of SEQ ID NO: 4) . In some embodiments, the endogenous TRBC locus is exon 1, exon 2, exon 3, and / or exon 4 of mouse TRBC. In some embodiments, the replaced sequence includes a portion of exon 1, exon 2 and a portion of exon 3 of mouse TRBC gene.

[0228] In some embodiments, the methods of modifying a TRBC locus ora mouse to express a chimeric human / mouse TRBC peptide can include the steps of replacing at the endogenous mouse TRBC locus a nucleotide sequence encoding a mouse TRBC with a nucleotide sequence encoding a human TRBC, thereby generating a sequence encoding a chimeric human / mouse TRBC.

[0229] The present disclosure further provides a method for establishing a TRBC gene humanized animal model, involving the following steps:

[0230] (a) providing the cell (e.g. a fertilized egg cell) based on the methods described herein;

[0231] (b) culturing the cell in a liquid culture medium;

[0232] (c) transplanting the cultured cell to the fallopian tube or uterus of the recipient female non-human mammal, allowing the cell to develop in the uterus of the female non-human mammal;

[0233] (d) identifying the germline transmission in the offspring genetically modified humanized non-human mammal of the pregnant female in step (c) .

[0234] In some embodiments, the non-human mammal in the foregoing method is a mouse (e.g., a C57BL / 6 mouse) .

[0235] In some embodiments, the non-human mammal in step (c) is a female with pseudopregnancy (or false pregnancy) .

[0236] In some embodiments, the fertilized eggs for the methods described above are C57BL / 6 fertilized eggs. Other fertilized eggs that can also be used in the methods as described herein include, but are not limited to, FVB / N fertilized eggs, BALB / c fertilized eggs, DBA / 1 fertilized eggs and DBA / 2 fertilized eggs.

[0237] Fertilized eggs can come from any non-human animal, e.g., any non-human animal as described herein. In some embodiments, the fertilized egg cells are derived from rodents. The genetic construct can be introduced into a fertilized egg by microinjection of DNA. For example, by way of culturing a fertilized egg after microinjection, a cultured fertilized egg can be transferred to a false pregnant non-human animal, which then gives birth of a non-human mammal, so as to generate the non-human mammal mentioned in the methods described above.

[0238] In some embodiments, methods of making the genetically modified animal comprises modifying the coding frame of the non-human animal's TRBC gene, e.g., by inserting a nucleotide sequence (e.g., DNA or cDNA sequence) encoding human or humanized TRBC protein, e.g., immediately after the endogenous regulatory element of the non-human animal's TRBC gene. For example, one or more functional region sequences of the non-human animal's TRBC gene can be knocked out, or inserted with a sequence, such that the non-human animal cannot express or expresses a decreased level of endogenous TRBC protein. In some embodiments, the coding frame of the modified non-human animal's TRBC gene can be all or part of the nucleotide sequence from exon 1 to exon 3 of the non-human animal's TRBC gene.

[0239] In some embodiments, methods of making the genetically modified animal comprises inserting a nucleotide sequence encoding human or humanized TRBC protein and / or an auxiliary sequence after the endogenous regulatory element of the non-human animal's TRBC gene. In some embodiments, the auxiliary sequence can be a stop codon, such that the TRBC gene humanized animal model can express human or humanized TRBC protein in vivo, but does not express non-human animal's TRBC protein. In some embodiments, the auxiliary sequence includes WPRE (WHP Posttranscriptional Response Element) , loxP, and / or polyA.

[0240] In some embodiments, the method for making the genetically modified animal comprises:

[0241] (1) providing a plasmid comprising a human TRBC gene fragment, flanked by a 5' homologous arm and a 3' homologous arm, wherein the 5' and 3' homologous arms target an endogenous TRBC gene;

[0242] (2) providing one or more small guide RNAs (sgRNAs) that target the endogenous TRBC gene;

[0243] (3) modifying genome of a fertilized egg or an embryonic stem cell by using the plasmid of step (1) , the sgRNAs of step (2) , and Cas9;

[0244] (4) transplanting the fertilized egg obtained in step (3) into the oviduct of a pseudopregnant female mouse or transplanting the embryonic stem cell obtained in step (3) into a blastocyst which is then transplanted into the oviduct of a pseudopregnant female mouse to produce a child mouse that functionally expresses a humanized TRBC protein; and

[0245] (5) mating the child mouse obtained in step (2) to obtain a homozygote mouse,

[0246] In some embodiments, the fertilized egg is modified by CRISPR with sgRNAs that target a 5'-terminal targeting site and a 3'-terminal targeting site.

[0247] In some embodiments, the sequence encoding the humanized TRBC protein is operably linked to an endogenous regulatory element at the endogenous TRBC gene locus.

[0248] In some embodiments, the genetically-modified animal does not express an endogenous TRBC protein.

[0249] In some embodiments, the method for making the genetically modified animal comprises:

[0250] (1) providing a plasmid comprising a human or chimeric TRBC gene fragment, flanked by a 5' homologous arm and a 3' homologous arm, wherein the 5' and 3' homologous arms target an endogenous TRBC gene;

[0251] (2) providing one or more small guide RNAs (sgRNAs) that target the endogenous TRBC gene; and

[0252] (3) modifying genome of a fertilized egg or an embryonic stem cell by inserting the human or chimeric TRBC gene fragment into the genome.

[0253] Methods of using genetically modified animals

[0254] Replacement of non-human genes in a non-human animal with homologous or orthologous human genes or human sequences, at the endogenous non-human locus and under control of endogenous promoters and / or regulatory elements, can result in a non-human animal with qualities and characteristics that may be substantially different from a typical knockout-plus-transgene animal. In the typical knockout-plus-transgene animal, an endogenous locus is removed or damaged and a fully human transgene is inserted into the animal's genome and presumably integrates at random into the genome. Typically, the location of the integrated transgene is unknown; expression of the human protein is measured by transcription of the human gene and / or protein assay and / or functional assay. Inclusion in the human transgene of upstream and / or downstream human sequences are apparently presumed to be sufficient to provide suitable support for expression and / or regulation of the transgene.

[0255] In some cases, the transgene with human regulatory elements expresses in a manner that is unphysiological or otherwise unsatisfactory, and can be actually detrimental to the animal. The disclosure demonstrates that a replacement with human sequence at an endogenous locus under control of endogenous regulatory elements provides a physiologically appropriate expression pattern and level that results in a useful humanized animal whose physiology with respect to the replaced gene are meaningful and appropriate in the context of the humanized animal's physiology.

[0256] Genetically modified animals that express human or humanized TRBC protein, e.g., in a physiologically appropriate manner, provide a variety of uses that include, but are not limited to, developing therapeutics for human diseases and disorders, and assessing the toxicity and / or the efficacy of these human therapeutics in the animal models.

[0257] In various aspects, genetically modified animals are provided that express human or humanized TRBC, which are useful for testing whether an therapeutic agent can bind to human TRBC. The genetically modified animals can be, e.g., an animal model of a human disease, e.g., the disease is induced genetically (a knock-in or knockout) . In various embodiments, the genetically modified non-human animals further comprise an impaired immune system, e.g., a non-human animal genetically modified to sustain or maintain a human xenograft, e.g., a human solid tumor (e.g., breast cancer) or a blood cell tumor (e.g., a lymphocyte tumor, a B or T cell tumor) .

[0258] In some embodiments, the genetically modified animals can be used for: A) product development related to TRBC-associated immune processes in human cells; B) model systems related to TRBC in pharmacology, immunology, microbiology, and medical research; C) the production and use of animal experimental disease models for TRBC-related pathogenesis research and / or for developing diagnostic strategies and / or therapeutic strategies; D) in vivo study of screening, pharmacodynamic testing, efficacy evaluation, validation, or assessment of human TRBC pathway modulators; E) studying the function of the TRBC gene, researching drugs targeting human TRBC sites, and studying drugs related to TRBC-associated tumors, inflammation, and immune-related diseases.

[0259] The present invention provides a non-human animal expressing human or humanized TRBC protein, which can be used for screening human TRBC-specific modulators. In some embodiments, the non-human animal is a model for human diseases, such as genetically induced diseases (knock-in or knock-out) . In various embodiments, the genetically modified non-human animal also has a compromised immune system, such as genetically modified human tissue xenografts, including human solid tumors (e.g., breast cancer) or hematologic malignancies (e.g., lymphocytic tumors, B or T cell tumors) .

[0260] In some embodiments, the genetically modified animals can be used for determining effectiveness of a therapeutic agent (e.g., an anti-TRBC antibody or a TRBC-targeting drug) for the treatment of cancer. In some embodiments, the methods involve administering the therapeutic agent (e.g., an anti-human TRBC antibody or a TRBC-targeting drug) to the animal as described herein, wherein the animal has a cancer or tumor; and determining inhibitory effects of the therapeutic agent to the cancer or tumor. The inhibitory effects that can be determined include, e.g., a decrease of tumor size or tumor volume, a decrease of tumor growth, a reduction of the increase rate of tumor volume in a subject (e.g., as compared to the rate of increase in tumor volume in the same subject prior to treatment or in another subject without such treatment) , a decrease in the risk of developing a metastasis or the risk of developing one or more additional metastasis, an increase of survival rate, and an increase of life expectancy, etc. The tumor volume in a subject can be determined by various methods, e.g., as determined by direct measurement, MRI or CT. In addition, a delicate balance is required for these antibodies, as TRBC is also expressed on many other cells. Thus, it is important that the humanized TRBC functions in a largely similar way as compared to the endogenous TRBC, so that the results in the humanized animals can be used to predict the efficacy or toxicity of these therapeutic agents in human. In some embodiments, the anti-TRBC antibody can directly target cancer cells or tumor-associated cells expressing TRBC, e.g., by inducing complement mediated cytotoxicity (CMC) or antibody dependent cellular cytotoxicity (ADCC) to kill the cancer cells.

[0261] In some embodiments, the tumor comprises one or more cancer cells (e.g., human or mouse cancer cells) that are injected into the animal.

[0262] In some embodiments, the methods as described herein are also designed to determine the effects of the therapeutic agent (e.g., anti-TRBC antibodies) on TRBC, e.g., whether the agent can bind to human TRBC, whether the agent can deplete TRBC-expressing cells, and / or whether the agent can induce complement mediated cytotoxicity (CMC) or antibody dependent cellular cytotoxicity (ADCC) . In some embodiments, the genetically modified animals can be used for determining the effective dosage of a therapeutic agent for treating a disease in the subject, e.g., cancer.

[0263] The inhibitory effects on tumors can also be determined by methods known in the art, e.g., measuring the tumor volume in the animal, and / or determining tumor (volume) inhibition rate (TGITV) . The tumor growth inhibition rate can be calculated using the formula TGITV (%) = (1–TVt / TVc) x100, where TVt and TVc are the mean tumor volume (or weight) of treated and control groups.

[0264] In some embodiments, the therapeutic agent (e.g., an anti-TRBC antibody or a TRBC-targeting drug) is designed for treating various cancers. As used herein, the term “cancer” refers to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. The term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness. The term “tumor” as used herein refers to cancerous cells, e.g., a mass of cancerous cells. Cancers that can be treated or diagnosed using the methods described herein include malignancies of the various organ systems, such as affecting lung, breast, thyroid, lymphoid, gastrointestinal, and genito-urinary tract, as well as adenocarcinomas which include malignancies such as most colon cancers, renal-cell carcinoma, prostate cancer and / or testicular tumors, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus. In some embodiments, the agents described herein are designed for treating or diagnosing a carcinoma in a subject. The term “carcinoma” is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas, gastrointestinal system carcinomas, genitourinary system carcinomas, testicular carcinomas, breast carcinomas, prostatic carcinomas, endocrine system carcinomas, and melanomas. In some embodiments, the cancer is renal carcinoma or melanoma. Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon and ovary. The term also includes carcinosarcomas, e.g., which include malignant tumors composed of carcinomatous and sarcomatous tissues. An “adenocarcinoma” refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures. The term “sarcoma” is art recognized and refers to malignant tumors of mesenchymal derivation.

[0265] In some embodiments, the cancer described herein is lymphoma, non-small cell lung cancer, cervical cancer, leukemia, ovarian cancer, nasopharyngeal cancer, breast cancer, endometrial cancer, colon cancer, rectal cancer, gastric cancer, bladder cancer, glioma, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver and bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myeloproliferation abnormal syndromes, and sarcomas. In some embodiments, the leukemia is selected from acute lymphocytic (lymphoblastic) leukemia, acute myeloid leukemia, myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma, plasma cell leukemia, and chronic myelogenous leukemia. In some embodiments, the lymphoma is selected from Hodgkin’s lymphoma and non-Hodgkin’s lymphoma, including B-cell lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone B-cell lymphoma, T-cell lymphoma, and Waldenstrom macroglobulinemia. In some embodiments, the sarcoma is selected from the group consisting of osteosarcoma, Ewing sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, and chondrosarcoma. In a specific embodiment, the tumor is breast cancer, ovarian cancer, endometrial cancer, melanoma, kidney cancer, lung cancer, or liver cancer. In some embodiments, the cancer is glioma, female reproductive system cancer, breast cancer, melanoma, solid tumor, hematologic malignancy, head and neck cancer, liver cancer, or lung cancer. In some embodiments, the cancer is Head and neck squamous cell carcinoma.

[0266] The present disclosure also provides methods of determining toxicity of an antibody (e.g., anti-TRBC antibody) . The methods involve administering the antibody to the animal as described herein. The animal is then evaluated for its weight change, red blood cell count, hematocrit, and / or hemoglobin. In some embodiments, the antibody can decrease the red blood cells (RBC) , hematocrit, or hemoglobin by more than 20%, 30%, 40%, or 50%. In some embodiments, the animals can have a weight that is at least 5%, 10%, 20%, 30%, or 40% smaller than the weight of the control group (e.g., average weight of the animals that are not treated with the antibody) .

[0267] The present disclosure also relates to the use of the animal model generated through the methods as described herein in the development of a product related to an immunization processes of human cells, the manufacturing of a human antibody, or the model system for a research in pharmacology, immunology, microbiology and medicine.

[0268] In some embodiments, the genetically modified non-human animal can be used to determine the efficacy of therapeutic agents (e.g., anti-TRBC antibodies) in treating various immune diseases. In some embodiments, the immune diseases include but are not limited to GVHD (graft-versus-host disease) , psoriasis, allergies, asthma, myocarditis, nephritis, hepatitis (preferably non-alcoholic steatohepatitis) , systemic lupus erythematosus, rheumatoid arthritis, scleroderma, hyperthyroidism, idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, ulcerative colitis, autoimmune liver disease, diabetes, pain, or neurological disorders. In some embodiments, the immune diseases are systemic lupus erythematosus, asthma, rheumatoid arthritis, or multiple sclerosis.

[0269] In some embodiments, the genetically modified non-human animal can be used to determine the efficacy of therapeutic agents (e.g., anti-TRBC antibodies) in treating various inflammatory infections. In some embodiments, the inflammation includes acute inflammation as well as chronic inflammation. Specifically, it includes but is not limited to degenerative inflammation, exudative inflammation (serous inflammation, fibrinous inflammation, purulent inflammation, hemorrhagic inflammation, necrotizing inflammation, catarrhal inflammation) , proliferative inflammation, and specific inflammation (tuberculosis, syphilis, leprosy, lymphogranuloma, etc. ) . In some embodiments, the inflammation is inflammatory bowel disease (IBD) .

[0270] In some embodiments, the disclosure provides the use of the animal model generated through the methods as described herein in the production and utilization of an animal experimental disease model of an immunization processes involving human cells, the study on a pathogen, or the development of a new diagnostic strategy and / or a therapeutic strategy.

[0271] The disclosure also relates to the use of the animal model generated through the methods as described herein in the screening, verifying, evaluating or studying the TRBC gene function, human TRBC antibodies, drugs for human TRBC targeting sites, the drugs or efficacies for human TRBC targeting sites, the drugs for antitumor drugs.

[0272] In some embodiments, the disclosure provides a method to verify in vivo efficacy of TCR-T, CAR-T, and / or other immunotherapies (e.g., T-cell adoptive transfer therapies) . For example, the methods include transplanting human tumor cells into the animal described herein, and applying human CAR-T to the animal with human tumor cells. Effectiveness of the CAR-T therapy can be determined and evaluated. In some embodiments, the animal is selected from the TRBC humanized non-human animal prepared by the methods described herein, the TRBC humanized non-human animal described herein, the double-or multi-humanized non-human animal generated by the methods described herein (or progeny thereof) , a non-human animal expressing the human or humanized TRBC protein, or the tumor-bearing or inflammatory animal models described herein. In some embodiments, the TCR-T, CAR-T, and / or other immunotherapies can treat the TRBC-associated diseases described herein. In some embodiments, the TCR-T, CAR-T, and / or other immunotherapies provides an evaluation method for treating the TRBC-associated diseases described herein.

[0273] Genetically modified animal model with two or more human or chimeric genes

[0274] The present disclosure further relates to methods for generating genetically modified animal model with two or more human or chimeric genes. The animal can comprise a human or chimeric TRBC gene and a sequence encoding an additional human or chimeric protein.

[0275] In some embodiments, the additional human or chimeric protein can be CD3e molecule, epsilon (CD3E) , CD28, CD226, IL2, IL4, IL6, programmed cell death protein 1 (PD-1) , tumor necrosis factor receptor superfamily member 9 (4-1BB) , CD40, programmed cell death ligand 1 (PD-L1) , lymphocyte-activation gene 3 (LAG3) , tumor necrosis factor alpha (TNF-α) , T cell immunoreceptor with Ig and ITIM domains (TIGIT) , cytotoxic T-lymphocyte-associated protein 4(CTLA4) , tumor necrosis factor receptor superfamily, member 4 (OX40) , T-cell immunoglobulin and mucin-domain containing-3 (TIM3) , CD73, B And T Lymphocyte Associated (BTLA) , CD27, CD47, CD154, Glucocorticoid-Induced TNFR-Related Protein (GITR) , and / or Signal regulatory proteinα (SIRPα) . In some embodiments, the additional human or chimeric protein can be NKG2D, TFR1, NKP46, ICOS, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4.

[0276] The methods of generating genetically modified animal model with two or more human or chimeric genes (e.g., humanized genes) can include the following steps:

[0277] (a) using the methods of introducing human TRBC gene or chimeric TRBC gene as described herein to obtain a genetically modified non-human animal;

[0278] (b) mating the genetically modified non-human animal with another genetically modified non-human animal, and then screening the progeny to obtain a genetically modified non-human animal with two or more human or chimeric genes.

[0279] In some embodiments, in step (b) of the method, the genetically modified animal can be mated with a genetically modified non-human animal with human or chimeric NKG2D, TFR1, NKP46, ICOS, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and / or CTLA4. Some of these genetically modified non-human animals are described, e.g., in PCT / CN2018 / 120713, PCT / CN2018 / 091846, PCT / CN2019 / 110819, PCT / CN / 2019 / 126045, PCT / CN2017 / 090320, PCT / CN2017 / 099577, PCT / CN2017 / 099575, PCT / CN2017 / 099576, PCT / CN2017 / 099574, PCT / CN2017 / 110435, PCT / CN2017 / 120388, PCT / CN2017 / 117984, PCT / CN2018 / 091845, and PCT / CN2019 / 119793; each of which is incorporated herein by reference in its entirety.

[0280] In some embodiments, the TRBC humanization is directly performed on a genetically modified animal having a human or chimeric NKG2D, TFR1, NKP46, ICOS, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and / or CTLA4 gene.

[0281] As these proteins may involve different mechanisms, a combination therapy that targets two or more of these proteins thereof may be a more effective treatment. In fact, many related clinical trials are in progress and have shown a good effect. The genetically modified animal model with two or more human or humanized genes can be used for determining effectiveness of a combination therapy that targets two or more of these proteins, e.g., an anti-TRBC antibody and an additional therapeutic agent for the treatment of cancer. The methods include administering the anti-TRBC antibody and the additional therapeutic agent to the animal, wherein the animal has a tumor; and determining the inhibitory effects of the combined treatment to the tumor. In some embodiments, the additional therapeutic agent is an antibody that specifically binds to NKG2D, TFR1, NKP46, ICOS, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and / or CTLA4. In some embodiments, the additional therapeutic agent is an anti-CTLA4 antibody (e.g., ipilimumab) , an anti-PD-1 antibody (e.g., nivolumab) , or an anti-PD-L1 antibody.

[0282] In some embodiments, the animal further comprises a sequence encoding a human or humanized PD-1, a sequence encoding a human or humanized PD-L1, or a sequence encoding a human or humanized CTLA-4. In some embodiments, the additional therapeutic agent is an anti-PD-1 antibody (e.g., nivolumab, pembrolizumab) , an anti-PD-L1 antibody, or an anti-CTLA-4 antibody. In some embodiments, the tumor comprises one or more tumor cells that express CD80, CD86, PD-L1, and / or PD-L2.

[0283] In some embodiments, the combination treatment is designed for treating various cancers as described herein, e.g., glioma, female reproductive system cancer, breast cancer, melanoma, solid tumor, hematologic malignancy, head and neck cancer, liver cancer, or lung cancer.

[0284] In some embodiments, the methods described herein can be used to evaluate the combination treatment with some other methods. The methods of treating a cancer that can be used alone or in combination with methods described herein, include, e.g., treating the subject with chemotherapy, e.g., campothecin, doxorubicin, cisplatin, carboplatin, procarbazine, mechlorethamine, cyclophosphamide, adriamycin, ifosfamide, melphalan, chlorambucil, bisulfan, nitrosurea, dactinomycin, daunorubicin, bleomycin, plicomycin, mitomycin, etoposide, verampil, podophyllotoxin, tamoxifen, taxol, transplatinum, 5-flurouracil, vincristin, vinblastin, and / or methotrexate. Alternatively or in addition, the methods can include performing surgery on the subject to remove at least a portion of the cancer, e.g., to remove a portion of or all of a tumor (s) , from the patient.

[0285] EXAMPLES

[0286] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

[0287] In each of the following examples, equipment and materials were obtained from the companies indicated below.

[0288] C57BL / 6 mice and Flp transgenic mice were purchased from the National Rodent Laboratory Animal Seed Center of the National Institutes for Food and Drug Control, China;

[0289] Brilliant Violet 510TM anti-mouse CD45 was purchased from Biolegend, catalog number 103138;

[0290] FITC anti-Mouse CD19 was purchased from Biolegend, catalog number 115506;

[0291] V450 Rat Anti-mouse CD3 Molecular Complex was purchased from Biolegend, catalog number 561389;

[0292] Brilliant Violet 711TM anti-mouse NK-1.1 Antibody was purchased from Biolegend, catalog number 108745;

[0293] Purified anti-human TCR Cβ1 Antibody was purchased from Biolegend, catalog number 383502;

[0294] Mouse Pan T Cell Isolation Kit II was purchased from Miltenyi Biotec, catalog number 130-095-130;

[0295] Anti-mouse CD3E antibody was purchased from BioXcell, catalog number BE0001-1;

[0296] Anti-mouse CD28 antibody was purchased from BioXcell, catalog number BE0015-1;

[0297] Human TRBC1 antibody was purchased from Biolegend, catalog number 383502;

[0298] Anti-mouse CD69 antibody was purchased from Biolegend, catalog number 104514;

[0299] Anti-mouse CD25 antibody was purchased from Biolegend, catalog number 102008;

[0300] Human CD3E antibody was purchased from BioXcell, catalog number BE0001-2;

[0301] Human CD69 antibody was purchased from Biolegend, catalog number 310912;

[0302] Human CD25 antibody was purchased from Biolegend, catalog number 302610.

[0303] Example1: Humanized TRBC Gene Mice

[0304] A nucleotide sequence encoding the human TRBC protein was introduced into the endogenous TRBC locus of mice, so that the mice express human or humanized TRBC protein. Specifically, using gene editing technology, under the control of mouse TRBC gene regulatory elements, a partial nucleotide sequence of the human TRBC1 gene (approximately 1.1 Kb, including a portion of exon 1, exon 2 and a portion of exon 3) and a partial nucleotide sequence of the human TRBC2 gene (approximately 1.1 Kb, including a portion of exon 1, exon 2, and a portion of exon 3) were used to replace the partial sequences of the mouse TRBC1 gene (approximately 1.1 Kb, including a portion of exon 1, exon 2, and a portion of exon 3) and the partial nucleotide sequence of the mouse TRBC2 gene (approximately 1.1 Kb, including a portion of exon 1, exon 2, and a portion of exon 3) , resulting in a humanized TRBC locus and achieving humanization of the mouse TRBC gene.

[0305] A targeting vector was constructed. FIG. 2shows the exemplary targeting vector design (not to scale) . The targeting vector contains homologous arm sequences upstream and downstream of the mouse TRBC gene, as well as a segment A (SEQ ID NO: 7) containing human TRBC fragments. Specifically, the upstream 5' homologous arm sequence (SEQ ID NO: 5)is identical to the nucleotide sequence from position 41511487 to 41515159 of NCBI accession number NC_000072.7, and the downstream 3' homologous arm sequence (SEQ ID NO: 6) is identical to the nucleotide sequence from position 41525761 to 41529797 of NCBI accession number NC_000072.7. The upstream connection of the human TRBC1 fragment sequence with the mouse sequence is designed as: 5’ -CAGACCATTCGTACTCTCTTTACTTTCCAGAGGATCTG GGTGTTCCCACCCGAGGTCGCTGTGTTTGAG-3’ (SEQ ID NO: 8) , where the "G" in the sequence "ATCTG" is the last nucleotide of the mouse sequence, and the first "A" in the sequence "AACAA" is the first nucleotide of the human sequence. The downstream connection of the human TRBC1 fragment sequence with the mouse sequence is designed as: 5’ -AGGGGTCCTGTCTGCCACCATCCTCT ATCCTGCTAGGGAAAGCCACCCTGTATGCTGT-3’ (SEQ ID NO: 28) , where the last "G" in the sequence is the last nucleotide of the human TRBC1 fragment sequence, and the first "A" in the sequence "ATCCT" is the first nucleotide of the mouse sequence. The upstream connection of the human TRBC2 fragment sequence with the mouse sequence is designed as: 5’ -CCTCTCTTTACTTTCCAGAGG AAAAACGTGTTCCCACCCAAGGTCGCTGTGTTT-3’ (SEQ ID NO: 29) , where the "G" in the sequence is the last nucleotide of the mouse sequence, and the first "A" in the sequence "AAAAAC" is the first nucleotide of the human sequence.

[0306] The downstream connection of the human TRBC2 fragment sequence with the mouse is designed as: 5’ -CTTGTCAACAGAGTCTTACCAGCAAGGGGTCCTGTCTGCC CCTCTATGAGATCCTACTGGGGAAGGCCACCCT-3’ (SEQ ID NO: 9) , where the last "C" in the sequence "CTGCC" is the last nucleotide of the human sequence, and the first "A" in the sequence "ACCAT" is the first nucleotide of the mouse sequence.

[0307] The targeting vector also includes a resistance gene for positive clone selection, namely the neomycin phosphotransferase coding sequence (Neo) , and two Frt site-specific recombination sites arranged in the same direction on both sides of the resistance gene, forming a Neo cassette. The connection of the 5' end of the Neo cassette with the mouse TRBC gene is designed as: 5’ -CTCCAGGACTCTGTCTCACAGAACCAGGCTCTAGGTGG TGTCGACGGTATCGATAAGCTTGATATCGAATTCCGAAGTTCCTAT-3’ (SEQ ID NO: 10) , where the last "G" in the sequence "GGTGG" is the last nucleotide of the mouse TRBC gene, and the first "A" in the sequence "AATAT" is the first nucleotide of the Neo cassette. The connection of the3' end of the Neo cassette with the mouse TRBC gene is designed as: 5’ -CTATTCTCTAGAAAGTATAGGAACTTCATCAGTCAGGTACATAATGGTGGATCC TAGAAGAGATTAAGGCATTACCCATGAAATGTCAC-3’ (SEQ ID NO: 11) , where the last "C" in the sequence "GATCC" is the last nucleotide of the Neo cassette, and the first "G" in the sequence "GGGTC" is the first nucleotide of the mouse TRBC gene. The humanized mice express the humanized TRBC1mRNA sequence as shown in SEQ ID NO: 26 and the humanized TRBC2 mRNA sequence as shown in SEQ ID NO: 27. The humanized mice express the humanized TRBC1 protein sequence as shown in SEQ ID NO: 24and the humanized TRBC2 protein sequence as shown in SEQ ID NO: 25.

[0308] The construction of the targeting vector was carried out using conventional methods, such as enzyme digestion and ligation. After preliminary verification of the constructed targeting vector by enzyme digestion, the targeting vector was sent to a sequencing company for sequencing. The targeting vector with the correct sequence was then electroporated into the embryonic stem cells of C57BL / 6 mice. The obtained cells were screened using the positive clone selection marker gene (Neo) to select the correct positive clone cells. The selected positive clone cells (black mice) were introduced into isolated blastocysts (white mice) . The resulting chimeric blastocysts were briefly cultured in a culture medium and then transplanted into the fallopian tubes of recipient female mice (white mice) to produce F0 generation chimeric mice (black and white) . The F0 generation chimeric mice were backcrossed with wild-type mice to obtain F1 generation mice, and the F1 heterozygous mice were interbreded to obtain F2 homozygous mice. Positive mice were also mated with Flp tool mice to remove the positive clone selection marker gene, and then interbred to obtain TRBC gene humanized homozygous mice.

[0309] The genotypes of F1 generation mouse somatic cells were assessed using PCR, with primers shown in the table below. The identification results of exemplary F1 generation mice are shown in FIGS. 3A-3B (unlabeled results in the figure are irrelevant) . All six mice numbered F1-1 to F1-6 were positive.

[0310] Table 1: F1 Generation Genotype PCR Detection Primer Sequences and Recombinant Fragment Sizes

[0311] mRNA expression in humanized TRBC gene mice was assessed using RT-PCR. Specifically, one C57BL / 6 mouse (+ / +) and one humanized TRBC gene homozygous mouse (H / H) prepared in this example were selected. After euthanasia by cervical dislocation, spleen tissues were collected, and RT-PCR detection was performed using the primer sequences shown in the table below. The detection results are shown in FIG. 4. As can be seen from the figure, only mouse TRBC1 mRNA and TRBC2 mRNA were detected in the C57BL / 6 mouse, while only human TRBC1 mRNA and TRBC2 mRNA were detected in the humanized TRBC gene homozygous mouse.

[0312] Table 2: RT-PCR Primer Sequences and Target Fragment Sizes

[0313] The expression of humanized TRBC1 protein in humanized TRBC gene mice was assessed using flow cytometry. Specifically, one C57BL / 6 mouse (+ / +) and one humanized TRBC gene homozygous mouse (H / H) prepared in this example were selected. After euthanasia by cervical dislocation, spleen tissues were collected, spleen cells were isolated, and flow cytometry was performed after staining in vitro with anti-CD45 antibody Brilliant Violet 510TM anti-mouse CD45 (mCD45) , anti-CD19 antibody FITC anti-Mouse CD19 (mCD19) , anti-CD3 antibody V450 Rat Anti-mouse CD3 Molecular Complex (mCD3) , Brilliant Violet 711TM anti-mouse NK-1.1 Antibody, and anti-human TRBC antibody Purified anti-human TCR Cβ1 Antibody (hTRBC) .

[0314] The detection results are shown in the table below. The expression of humanized TRBC1 protein can be detected in the spleen T cells of humanized TRBC gene homozygous mice, while no human or humanized TRBC1 protein was detected in the C57BL / 6 mice (+ / +) . This indicates that the humanized TRBC gene homozygous mice constructed using the method described in this application can normally express humanized TRBC1 protein.

[0315] Table 3: Flow Cytometry Detection Results

[0316] Furthermore, flow cytometry was used to perform immunophenotyping on the spleen tissues of C57BL / 6 wild-type mice and TRBC gene humanized homozygous mice (H / H) . The results of leukocyte subtypes and T cell subtypes in the spleen are shown in FIG. 5 and FIG. 6, respectively. As can be seen from the figures, the leukocyte subtypes in the spleen of TRBC gene humanized homozygous mice, including B cells, T cells, NK cells, neutrophils, dendritic cells (DCs) , macrophages, and monocytes, are basically consistent with those of C57BL / 6 wild-type mice (FIG. 5) . The percentages of T cell subtypes, including CD4+ T cells, CD8+ T cells, and Tregs, are also basically consistent with those of C57BL / 6 wild-type mice (FIG. 6) . This indicates that the construction of TRBC gene humanized mice was successful.

[0317] To confirm that T cells in mice can be normally activated, three 6-week-old wild-type C57BL / 6 mice (+ / +) and three 6-week-old TRBC gene humanized homozygous mice (H / H) (n=3) were selected. After euthanasia by cervical dislocation, spleen cells were collected. Pan T cells were purified using the Mouse Pan T Cell Isolation Kit II, and different doses of anti-mouse CD3E antibody (mCD3E) , anti-mouse CD28 antibody (mCD28) , and / or anti-human TRBC antibody (hTRBC) were added to stimulate the T cells (specific T cell stimulation protocols are shown in the table below) . After 24 and 42 hours of stimulation, T cell activation was detected using FACS. Specifically, anti-mouse CD69 antibody and anti-mouse CD25 antibody were used for staining during FACS detection, and the percentages and mean fluorescence intensities of CD69+ activated T cells (mCD69+) and CD25+ activated T cells (mCD25+) among leukocytes (mCD45+) were calculated.

[0318] Table 4: T cell Stimulation Protocols

[0319] The results (FIGS. 57-7B, 8A-8B) show that the anti-mCD3E antibody can activate T cells derived from wild-type C57BL / 6 mice (+ / +) and TRBC gene humanized homozygous mice (H / H) (G2) . The addition of anti-mouse CD28 antibody stimulation can increase the proportion of activated T cells (G5) . However, the anti-human TRBC1 antibody can only activate T cells derived from TRBC gene humanized homozygous mice (H / H) , and the higher the dose of anti-human TRBC1 antibody, the higher the activation proportion (G3, G4) . The addition of anti-mouse CD28 antibody stimulation can further increase the proportion of activated T cells (G6, G7) . Additionally, extending the stimulation time (FIGS. 9A-9B, 10A-10B) enhances the activation of T cells in all groups. This indicates that the humanized TRBC1 protein expressed in TRBC gene humanized homozygous mice can correctly form a complex with the mouse TCRα chain and mouse CD3, and can effectively transmit signals to activate T cells.

[0320] OVA peptide257–264 is a restricted epitope peptide of ovalbumin (OVA) presented by the MHC class I molecule H-2Kb. The amino acid sequence of OVA peptide257–264is SIINFEKL (SEQ ID NO: 30) . When TRBC1 and TRBC2 proteins function normally, after stimulation with OVA peptide257–264, the MHC class I molecule H-2Kb presents the antigen to T cells, activating intracellular signaling pathways, and inducing IFN-γ secretion.

[0321] Three 8-9 week-old female wild-type C57BL / 6 mice (+ / +) and three 8-9 week-old female TRBC gene humanized homozygous mice (H / H) were randomly selected. On days 0 and 7, all mice were immunized by intraperitoneal injection with 0.5 mg OVA peptide257–264 (Sigma, A5503-25MG) and 50 μg poly (I: C) (InvivoGen, tlrl-pic) . On day 14, all mice were euthanized, and spleen tissues were collected to obtain splenocytes for enzyme-linked immunospot (ELISPOT) assay. Specifically, spleen tissues from wild-type C57BL / 6 mice (+ / +) and TRBC gene humanized homozygous mice (H / H) were ground using a 40 μm cell strainer to obtain splenocytes, which were diluted to different concentrations and placed in a 96-well plate. According to the table below, the splenocytes were divided into negative control groups (NC1 and NC2) , treatment groups (G1, G2, G3, G4, G5, G6, G7, and G8) , and positive control groups (PC1 and PC2) , with different stimuli added to each group. Specifically, the treatment groups were given different concentrations of the OVA peptide257–264 and poly (I: C) mixture, the negative control groups were given an equal volume of medium, and the positive control groups were given an equal volume of Cell Activation Cocktail without Brefeldin A (Biolegend, 423302) . The splenocytes and stimuli were co-incubated at 37℃ with 5%CO2 for 24 hours, and IFN-γ was detected using an ELISA reader. The number of spot-forming units (one spot-forming unit represents one active IFN-γ-secreting T cell) was counted, and the results are shown in FIG. 11.

[0322] Table 5: ELISPOT Splenocyte Grouping

[0323] As shown in FIG. 11, there is no significant difference in the number of spot-forming units between TRBC gene humanized homozygous mice (H / H) and wild-type C57BL / 6 mice (+ / +) , indicating that TRBC gene humanized homozygous mice (H / H) have normal T cell immunogenicity similar to wild-type C57BL / 6 mice (+ / +) .

[0324] Example 2. In vivo efficacy verification

[0325] The TRBC humanized mice produced using this method can be used to evaluate the efficacy of human TRBC-targeting modulators in diseases. For example, TRBC humanized homozygous mice are subcutaneously inoculated with MC38 cells. When the tumor volume grows to approximately 100 mm3, the mice are divided into control and treatment groups based on tumor volume. The treatment group is randomly administered a drug targeting human TRBC, while the control group is injected with an equal volume of saline. Tumor volume and mouse body weight are measured regularly. By comparing changes in mouse body weight and tumor size, the in vivo safety and efficacy of the compound can be effectively evaluated.

[0326] Example 3: Preparation of Double-Gene or Multi-Gene Humanized Mice

[0327] The method described herein and the TRBC gene humanized mice prepared by this method can also be used to prepare double-gene or multi-gene humanized mice. For example, in Example 1, the embryonic stem cells used for microinjection can be selected from mice containing at least one gene modification such as NKG2D, TFR1, NKP46, ICOS, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4. Alternatively, based on the humanized TRBC mice, double-humanized or multi-humanized mouse models can be obtained using isolated mouse ES embryonic stem cells and gene recombination targeting technology. Additionally, TRBC homozygous or heterozygous mice obtained by this method can be mated with other gene-modified mice. By screening their offspring according to Mendelian inheritance laws, there is a certain probability of obtaining multi-gene mice with humanized TRBC genes and other gene modifications. Interbreeding these heterozygous mice can result in double-gene or multi-gene modified homozygous mice.

[0328] OTHER EMBODIMENTS

[0329] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1.A genetically-modified, non-human animal whose genome comprises at least one chromosome comprising a sequence encoding a human or chimeric TCR β chain (TRBC) .2.The animal of claim 1, wherein the sequence encoding the human or chimeric TRBC is operably linked to an endogenous regulatory element at the endogenous TRBC gene locus in the at least one chromosome.3.The animal of claim 1 or 2, wherein the TRBC is TRBC1.4.The animal of any one of claim 1-3, wherein the sequence encoding a human or chimeric TRBC comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human TRBC1 (SEQ ID NO: 2) .5.The animal of any one of claims 1-4, wherein the sequence encoding a human or chimeric TRBC comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to amino acids 1-149 of SEQ ID NO: 2 or amino acids 3-149 of SEQ ID NO: 2.6.The animal of any one of claims 1-5, wherein the sequence encoding a human or chimeric TRBC comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 24.7.The animal of claim 1 or 2, wherein the TRBC is TRBC2.8.The animal of claim 1, 2, or 7, wherein the sequence encoding a human or chimeric TRBC comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human TRBC2 (SEQ ID NO: 4) .9.The animal of any one of claims 1, 2, 7 and 8, wherein the sequence encoding a human or chimeric TRBC comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to amino acids 1-144 of SEQ ID NO: 4 or amino acids 3-144 of SEQ ID NO: 4.10.The animal of any one of claims 1, 2, and 7-9, wherein the sequence encoding a human or chimeric TRBC comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 25.11.The animal of any one of claims 1-10, wherein the sequence encoding a human or chimeric TRBC comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 7.12.A genetically-modified, non-human animal, wherein the genome of the animal comprises a replacement of a sequence encoding a region of endogenous TRBC with a sequence encoding a corresponding region of human TRBC at an endogenous TRBC gene locus.13.The animal of claim 12, wherein the sequence encoding the corresponding region of human TRBC is operably linked to an endogenous regulatory element at the endogenous TRBC locus, and one or more cells of the animal expresses a human or chimeric TRBC.14.The animal of claim 12 or 13, wherein the animal does not express endogenous TRBC or expresses a decreased level of endogenous TRBC as compared to TRBC expression level in a wild-type animal.15.The animal of any one of claims 12-14, wherein the replaced sequence encodes all or a portion of the extracellular region of TRBC.16.The animal of any one of claims 12-15, wherein the animal has one or more cells expressing a chimeric TRBC having an extracellular region, a transmembrane region, and a cytoplasmic region, wherein the extracellular region comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100%identical to the extracellular region of human TRBC1 (SEQ ID NO: 2) .17.The animal of claim 16, wherein the extracellular region of the chimeric TRBC has a sequence that has at least 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 145, 146, 147, 148 or 149 contiguous amino acids that are identical to a contiguous sequence present in the extracellular region of human TRBC (e.g., amino acids 1-149 of SEQ ID NO: 2) .18.The animal of any one of claims 12-15, wherein the animal has one or more cells expressing a chimeric TRBC having an extracellular region, a transmembrane region, and a cytoplasmic region, wherein the extracellular region comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100%identical to the extracellular region of human TRBC2 (SEQ ID NO: 4) .19.The animal of claim 18, wherein the extracellular region of the chimeric TRBC has a sequence that has at least 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 141, 142, 143, or 144 contiguous amino acids that are identical to a contiguous sequence present in the extracellular region of human TRBC (e.g., amino acids 1-144 of SEQ ID NO: 4) .20.The animal of any one of claims 12-19, wherein the sequence encoding a region of endogenous TRBC comprises exon 1, exon 2, exon 3, and / or exon 4, or a part thereof, of the endogenous TRBC gene; preferably, the sequence encoding a region of endogenous TRBC comprises a portion of exon 1, exon 2, and a portion of exon 3 of the endogenous TRBC gene.21.The animal of any one of claims 12-20, wherein the sequence encoding the corresponding region of human TRBC comprises exon 1, exon 2, exon 3, and / or exon 4, or a part thereof, of a human TRBC gene; preferably, the corresponding region of human TRBC comprises a portion of exon 1, exon 2, and a portion of exon 3 of a human TRBC gene.22.The animal of any one of claims 1-21, wherein the animal is heterozygous with respect to the replacement at the endogenous TRBC gene locus.23.The animal of any one of claims 1-21, wherein the animal is homozygous with respect to the replacement at the endogenous TRBC gene locus.24.A non-human animal comprising at least one cell comprising a nucleotide sequence encoding a humanized TRBC polypeptide, wherein the humanized TRBC polypeptide comprises at least 50, 100, 142, 147, 149, or 176 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human TRBC, wherein the animal expresses the humanized TRBC polypeptide.25.The animal of claim 24, wherein the humanized TRBC polypeptide has at least 50, 100, 142, 147, or 149 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of human TRBC extracellular region.26.The animal of any one of claims 24-25, wherein the humanized TRBC polypeptide comprises a sequence that is at least 90%, 95%, or 99%identical to amino acids 3-149 of SEQ ID NO: 2 or amino acids 3-144 of SEQ ID NO: 4.27.The animal of any one of claims 24-26, wherein the nucleotide sequence is operably linked to an endogenous TRBC regulatory element of the animal.28.The animal of any one of claims 1-27, wherein the animal is a mammal, e.g., a monkey, a rodent, a mouse, or a rat.29.The animal of any one of claims 1-28, wherein the animal is a mouse.30.The animal of any one of claims 1-29, wherein the animal does not express endogenous TRBC or expresses a decreased level of endogenous TRBC as compared to TRBC expression level in a wild-type animal.31.The animal of any one of claims 1-30, wherein the animal has one or more cells expressing human or chimeric TRBC.32.The animal of any one of claims 31, wherein the chimeric TRBC polypeptide comprises an endogenous TRBC transmembrane region and / or an endogenous TRBC cytoplasmic region.33.The animal of any one of claims 1-32, wherein the animal further comprises a sequence encoding an additional human or chimeric protein.34.The animal of claim 33, wherein the additional human or chimeric protein is selected from the group consisting of Natural Killer Group 2D (NKG2D) , Transferrin Receptor 1 (TFR1) , Natural cytotoxicity triggering receptor 1 (NKP46) , Inducible T-cell Costimulator (ICOS) , Lymphocyte-activation gene 3 (LAG3) , tumor necrosis factor receptor superfamily member 9 (4-1BB) , Cluster of differentiation 40 (CD40) , T cell immunoreceptor with Ig and ITIM domains (TIGIT) , Cluster of differentiation 27 (CD27) , Cluster of differentiation 28 (CD28) , Cluster of Differentiation 276 (B7H3) , Cluster of differentiation 252 (OX40) , Programmed cell death protein 1 (PD-1) , Programmed death-ligand 1 (PD-L1) , and Cytotoxic T-lymphocyte associated protein 4 (CTLA4) .35.A method for making a genetically-modified, non-human animal, comprising:replacing in at least one cell of the animal, at an endogenous TRBC gene locus, a sequence encoding a region of endogenous TRBC with a sequence encoding a corresponding region of human TRBC.36.The method of claim 35, wherein the sequence encoding the corresponding region of human TRBC comprises exon 1, exon 2, exon 3, and / or exon 4, or a part thereof, of a human TRBC gene.37.The method of claim 35 or 36, wherein the sequence encoding the corresponding region of human TRBC comprises a portion of exon 1, exons 2 and a portion of exon 3 of a human TRBC gene.38.The method of any one of claims 35-37, wherein the sequence encoding the corresponding region of human TRBC encodes amino acids 3-149 of SEQ ID NO: 2.39.The method of any one of claims 35-37, wherein the sequence encoding the corresponding region of human TRBC encodes amino acids 3-144 of SEQ ID NO: 4.40.The method of any one of claims 35-39, wherein the sequence encoding a region of endogenous TRBC comprises exon 1, exon 2, exon 3, and / or exon 4, or a part thereof, of the endogenous TRBC gene.41.The method of any one of claims 35-40, wherein the sequence encoding a region of endogenous TRBC comprises a portion of exon 1, exon 2 and a portion of exon 3 of the endogenous TRBC gene.42.The method of any one of claims 35-41, wherein the animal expresses a humanized TRBC.43.The method of any one of claims 35-42, wherein the animal is a mouse.44.The method of any one of claims 35-43, wherein the animal expresses a humanized TRBC, and the humanized TRBC comprises a human or humanized TRBC extracellular region; and a transmembrane and / or a cytoplasmic region of mouse TRBC.45.The method of any one of 35-44, wherein the nucleotide sequence encoding the chimeric TRBC is operably linked to an endogenous TRBC regulatory region, e.g., promoter.46.The method of any one of claims 35-45, wherein the animal or mouse further comprises a sequence encoding an additional human or chimeric protein.47.The method of claim 46, wherein the additional human or chimeric protein is is selected from the group consisting of NKG2D, TFR1, NKP46, ICOS, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4.48.A method of determining effectiveness of a therapeutic agent for the treatment of cancer, comprising:a) administering the therapeutic agent to the animal of any one of claims 1-34, wherein the animal has a tumor; andb) determining inhibitory effects of the therapeutic agent to the tumor.49.The method of claim 48, wherein the therapeutic agent is an anti-TRBC antibody.50.The method of claim 48 or 49, wherein the tumor comprises one or more cancer cells that are injected into the animal.51.The method of any one of claims 48-50, wherein determining inhibitory effects of the anti-TRBC antibody to the tumor involves measuring the tumor volume in the animal.52.The method of any one of claims 48-51, wherein the cancer is lung cancer, head and neck cancer, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, bladder cancer, kidney cancer, or a glioma.53.A method of determining toxicity of a therapeutic agent comprising:a) administering the therapeutic agent to the animal of any one of claims 1-34; andb) determining effects of the therapeutic agent to the animal.54.The method of claim 53, wherein the therapeutic agent is an anti-TRBC antibody.55.The method of claim 53 or 54, wherein determining effects of the therapeutic agent to the animal involves measuring the body weight, red blood cell count, hematocrit, and / or hemoglobin of the animal.56.A method of determining the efficacy of TRBC therapeutic agents in treating immune diseases, the method comprising: 1) administering a TRBC therapeutic agent to the non-human animal, wherein the non-human animal has an immune disease; 2) determining the therapeutic effect of the TRBC therapeutic agent on the immune disease.57.The method of claim 56, wherein the immune disease is systemic lupus erythematosus, asthma, rheumatoid arthritis, or multiple sclerosis.58.A protein comprising an amino acid sequence, wherein the amino acid sequence is one of the following:(a) an amino acid sequence set forth in SEQ ID NO: 24 or 25;(b) an amino acid sequence that is at least 90%identical to SEQ ID NO: 24 or 25;(c) an amino acid sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 24 or 25;(d) an amino acid sequence that is different from the amino acid sequence set forth in SEQ ID NO: 24 or 25 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid; and(e) an amino acid sequence that comprises a substitution, a deletion and / or insertion of one, two, three, four, five or more amino acids to the amino acid sequence set forth in SEQ ID NO: 24 or 25.59.A nucleic acid comprising a nucleotide sequence, wherein the nucleotide sequence is one of the following:(a) a sequence that encodes the protein of claim 58;(b) SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 26, 27, 28, or 29;(c) a sequence that is at least 90%identical to SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 26, 27, 28, or 29, and(d) a sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 26, 27, 28, or 29.60.A cell comprising the protein of claim 58 and / or the nucleic acid of claim 59.61.An animal comprising the protein of claim 58 and / or the nucleic acid of claim 59.