Streptococcus mutans circular RNA circcsbd, use thereof, and overexpression strain thereof, construction method therefor, and use thereof
By discovering and validating the closed circular structure of the circular RNA circcsbD in Streptococcus mutans and constructing circcsbD overexpressing strains, the problem of caries biofilm formation was solved, enabling effective prediction and prevention of caries.
Patent Information
- Application Number
- PCT/CN2025/072468
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-30
- Filing Date
- 2025-01-15
- Publication Date
- 2025-11-06
AI Technical Summary
The lack of research and application of circular RNA from Streptococcus mutans in current technologies makes it difficult to effectively predict and control biofilm formation in dental caries, leading to difficulties in the prevention and treatment of dental caries.
The existence and closed circular structure of endogenous circular RNA circcsbD in Streptococcus mutans were discovered and verified. A circcsbD overexpression strain was designed and constructed to inhibit extracellular polysaccharide metabolism in biomembranes and reduce cariogenicity by overexpressing circcsbD.
The circcsbD overexpression strain can significantly inhibit the formation of biofilm and the synthesis of extracellular polysaccharides in Streptococcus mutans, reduce the risk of dental caries, provide new biomarkers and therapeutic targets for dental caries, and realize the auxiliary prediction and prevention of dental caries.
Smart Images

Figure CN2025072468_06112025_PF_FP_ABST
Abstract
Description
Streptococcus mutans circular RNA circcsbD and application, overexpression strain and construction method and application thereof TECHNICAL FIELD
[0001] The present application belongs to the field of biomedical technology, and particularly relates to Streptococcus mutans circular RNA circcsbD and application, overexpression strain and construction method and application thereof. BACKGROUND
[0002] Caries is a chronic infectious disease formed by demineralization of dental hard tissue. The fourth oral epidemiological survey in China showed that the caries rate of adults was as high as 89.0%; foreign research found that the burden of dental disease was serious, ranking second only to diabetes and cardiovascular disease in terms of disease expenditure. Caries brings a series of economic and health burdens, and its prevention and treatment have important practical social significance.
[0003] Plaque biofilm formed by oral microorganisms is the initiating factor of caries, and Streptococcus mutans occupies an important position in it due to its ability to synthesize extracellular polysaccharide and form biofilm. Extracellular polysaccharide of Streptococcus mutans is involved in the transport of nutrients and metabolic products, provides a stable three-dimensional framework structure, and wraps the interlaced microbial community into a network structure to form a highly organized cariogenic plaque biofilm. When the structural density is destroyed, the pathogenicity of the biofilm will be weakened. Therefore, controlling the metabolism of extracellular polysaccharide of the biofilm is an important measure for the prevention and treatment of caries, and the inhibition of biofilm formation can effectively reduce the incidence of caries.
[0004] Circular RNA is a kind of non-coding RNA widely existing in the transcriptome, which has been widely studied in eukaryotes and the related technical methods are mature. However, in prokaryotes, only endogenous circular RNA has been reported in archaea and viruses, and no related content has been reported in Streptococcus mutans, and the verification technology and related applications are not clear. SUMMARY
[0005] One of the purposes of the present application is to provide Streptococcus mutans circular RNA circcsbD, which has the same closed circular structure as eukaryotic circular RNA, is more sensitive to the change of Streptococcus mutans from low cariogenicity to high cariogenicity, and the expression level can realize the auxiliary prediction of caries, which can be used as a new type of caries-related biomarker and therapeutic target.
[0006] The second purpose of the present application is to provide a method for identifying the closed circular structure of prokaryotic circular RNA.
[0007] The third purpose of the present application is to provide the application of the Streptococcus mutans circular RNA circcsbD.
[0008] The fourth object of the present application is to provide a Streptococcus mutans with overexpression of circular RNA circcsbD.
[0009] The fifth object of the present application is to provide a construction method of the Streptococcus mutans with overexpression of circular RNA circcsbD.
[0010] The sixth object of the present application is to provide an application of the Streptococcus mutans with overexpression of circular RNA circcsbD.
[0011] To achieve the above-mentioned objects, the technical solutions adopted by the present application are as follows:
[0012] The present application discloses a Streptococcus mutans circular RNA circcsbD, the nucleotide sequence of which is shown as SEQ ID NO: 1, and specifically is as follows:
[0013] The present application discloses an application of the above-mentioned Streptococcus mutans circular RNA circcsbD as a caries biomarker.
[0014] The present application discloses an application of the Streptococcus mutans circular RNA circcsbD in preparation of a preparation for preventing or treating oral caries.
[0015] The present application discloses primers of the Streptococcus mutans circular RNA circcsbD, the upstream primer sequence of which is shown as SEQ ID NO: 2, and the downstream primer sequence of which is shown as SEQ ID NO: 3, and specifically is as follows:
[0016] circcsbD-F AGTTAGAACTTCTGTCTTTGGTGCT
[0017] circcsbD-R CCTTCTACACCGTCCTTGATATCTT
[0018] The present application discloses a kit for detecting the above-mentioned Streptococcus mutans circular RNA circcsbD, comprising the above-mentioned primers.
[0019] The present application discloses a Streptococcus mutans with overexpression of circular RNA circcsbD, which is preserved in the China Center for Type Culture Collection, located in Wuhan University, Wuhan, Hubei, China, and preserved on March 27, 2024, with the preservation number CCTCC NO: M2024567, and named Streptococcus mutans pDL278-circ4-202403.
[0020] The application discloses a construction method of Streptococcus mutans with overexpressed circular RNA circcsbD, and comprises the following steps: a promoter sequence is designed according to the sequence of the circular RNA of the Streptococcus mutans, a nucleotide sequence of the circular RNA of the Streptococcus mutans with the connected promoter is synthesized, and restriction endonuclease BamHI and EcoRI restriction enzyme cutting sites are added to the upstream and downstream of the synthesized nucleotide sequence; the sequence after enzyme cutting is connected to a pDL278 vector which is also double-enzyme cut, a circcsbD recombinant expression plasmid is constructed, and finally a Streptococcus mutans circular RNA overexpression strain is constructed by using a plasmid transformation method.
[0021] The application discloses an application of the Streptococcus mutans with overexpressed circular RNA circcsbD in preparation of a preparation for preventing or treating dental caries.
[0022] Compared with the prior art, the application has the following beneficial effects:
[0023] The application first discovers an endogenous circular RNA circcsbD in the prokaryotic Streptococcus mutans, and the endogenous circular RNA circcsbD is more sensitive to the change of the Streptococcus mutans from a low cariogenic state to a high cariogenic state, the expression level of the endogenous circular RNA circcsbD can realize auxiliary prediction of dental caries, and the endogenous circular RNA circcsbD can be used as a dental caries related biomarker and a treatment target.
[0024] The application finds that overexpression of the circcsbD can inhibit extracellular polysaccharide metabolism of a Streptococcus mutans biofilm and reduce cariogenicity of the Streptococcus mutans by constructing a circcsbD overexpression Streptococcus mutans strain. BRIEF DESCRIPTION OF DRAWINGS
[0025] Fig. 1 is a clustering heat map of circular RNA high-throughput sequencing, wherein Count represents alignment quantification; Color Key and Histogramg represent color key distribution; and Row Z-score represents Z value scaling.
[0026] Fig. 2 is a sequence comparison analysis diagram of circcsbD and a source gene csbD;
[0027] Fig. 3 is a Sanger sequencing peak diagram of a circcsbD cyclization site;
[0028] Fig. 4 is a result diagram of the influence of RNase R enzyme treatment on circcsbD abundance;
[0029] Fig. 5 is a diagram of circular RNA expression amount of the Streptococcus mutans in a low cariogenic state (a planktonic state);
[0030] Fig. 6 is a diagram of circular RNA expression amount of the Streptococcus mutans in a high cariogenic state (a biofilm state);
[0031] Figure 7 is a sequence construction diagram of the circcsbD overexpression strain;
[0032] Figure 8 is a comparison of the micro-morphology of the Streptococcus mutans circcsbD overexpression strain pDL278-circ4-202403 (i.e., pDL278-circcsbD) of Example 3 and the standard strain UA159 of Streptococcus mutans after Gram staining;
[0033] Figure 9 is an electron microscope comparison of the Streptococcus mutans circcsbD overexpression strain pDL278-circcsbD of Example 3 and the standard strain UA159 of Streptococcus mutans;
[0034] Figure 10 is a graph showing the change in the expression abundance of circcsbD in the circcsbD overexpression strain compared with the standard strain UA159 of Streptococcus mutans;
[0035] Figure 11 is a graph showing the results of investigating the biofilm formation ability of the circcsbD overexpression strain;
[0036] Figure 12 is a scanning electron microscope observation of the biofilm formation of the circcsbD overexpression strain;
[0037] Figure 13 is a graph showing the results of investigating the amount of extracellular polysaccharide synthesis of the biofilm of the circcsbD overexpression strain;
[0038] Figure 14 is a laser confocal microscope observation of the formation and distribution and three-dimensional structure of the extracellular polysaccharide of the biofilm of the circcsbD overexpression strain;
[0039] Figure 15 is an atomic force microscope observation of the surface topography characteristics of the biofilm of the circcsbD overexpression strain; the upper graph of each group is an atomic force microscope scan, and the lower graph is an atomic force microscope scan three-dimensional reconstruction;
[0040] Figure 16 is a comparison of the surface roughness of the biofilm of the circcsbD overexpression strain;
[0041] Figure 17 is a comparison of the surface adhesion of the biofilm of the circcsbD overexpression strain;
[0042] Figure 18 is a graph showing the results of the circcsbD overexpression strain for rat caries prevention and treatment test; Blank: blank control group; UA159: UA159 positive control group; pDL278-circcsbD: experimental group; the upper left graph of each test group is a stereomicroscope under the microscope, the upper right graph is a micro-CT scan three-dimensional color reconstruction, the lower left graph is a micro-CT scan cross-sectional view, and the lower right graph is a micro-CT scan three-dimensional black and white reconstruction; the arrow indicates caries;
[0043] Figure 19 is a graph showing the results of a fissure caries prevention experiment using the circcsbD overexpression strain for a rat caries prevention experiment;
[0044] Figure 20 is a graph showing the results of a superficial caries prevention experiment using the circcsbD overexpression strain for a rat caries prevention experiment;
[0045] Figure 21 is a graph showing the results of a middle caries prevention experiment using the circcsbD overexpression strain for a rat caries prevention experiment;
[0046] Figure 22 is a graph showing the results of a deep caries prevention experiment using the circcsbD overexpression strain for a rat caries prevention experiment.
[0047] In figures 19-22, ns means not significant; * means P<0.05 (statistically significant difference and P value less than 0.05); ** means P<0.01 (statistically significant difference and P value less than 0.01). DETAILED DESCRIPTION
[0048] In order to make the purposes, technical solutions and advantages of the embodiments of the present application more clear, the technical solutions will be described clearly and completely below in conjunction with the embodiments of the present application. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of the present application.
[0049] Unless otherwise specifically stated, the various raw materials, reagents, instruments and equipment used in the present application can be purchased from the market or can be prepared by existing methods.
[0050] The standard strain of Streptococcus mutans UA159 (i.e., Streptococcus mutans UA159, abbreviated as "S. mutans UA159") described in the present application is obtained from the National Key Laboratory for Oral Disease Prevention and Treatment located in Chengdu, Sichuan Province, China.
[0051] The instruments, reagents and drugs used in the embodiments of the present application are as follows:
[0052] Anaerobic incubator (Gene-Science Scientific Instruments, USA), model Anaerobox IV, American Gene Science Instrument Co., Ltd.
[0053] Turbidimeter (BD Phoenix Spec TM , BD, USA), American Biodi Company
[0054] BHI agar (BHI agar, 1.5% (m / V) of sucrose, Sichuan Chengdu Test Chemical Reagent Development Center, China);
[0055] ThermoFisher Scientific (USA), ThermoFisher Scientific, USA;
[0056] Ribo-Zero rRNA Removal Kit (Illumina, USA): Ribo-Zero rRNA Removal Kit, Illumina, USA;
[0057] CircRNA Enrichment Kit (Cloud-seq, USA): CircRNA Enrichment Kit, Shanghai Yunxu Biological Technology Co., Ltd.;
[0058] Ultra TM II Directional RNA Library Prep Kit for Illumina (NEB, USA): NEB II Directional RNA Library Prep Kit for Illumina, New England Biolabs, Inc., USA; Ultra TM II Directional RNA Library Prep Kit for Illumina, New England Biolabs, Inc., USA;
[0059] illumina Novaseq 6000: Illumina Novaseq 6000 Kit, Illumina, USA;
[0060] PrimeScript TM RT reagent Kit with gDNA Eraser (Takara, Japan): TaKaRa Reverse Transcription Kit with gDNA Eraser, Bora Biotech (Beijing) Co., Ltd.;
[0061] PCR Master Mix Kit (GenSeq Biotech, Inc.): PCR Amplification Kit, Shanghai Yunxu Biological Technology Co., Ltd.;
[0062] 1×TBE buffer (Solarbio, China), Beijing Solarbio Science & Technology Co., Ltd.;
[0063] 2% agarose gel (Invitrogen, USA): Invitrogen, USA;
[0064] TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0: TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0, TaKaRa Bio Inc., Japan;
[0065] Master Pure TM Complete DNA and RNA Purification Kit(Lucigen, epicentre, USA): Master Pure TM Complete DNA and RNA Purification Kit, Epicentre Biotechnologies, USA;
[0066] MPC Protein Precipitation Reagent: MPC Protein Precipitation Reagent, Epicentre Biotechnologies, USA;
[0067] NanoDrop TM 2000c Spectrophotometer, ThermoFisher Scientific, USA): NanoDrop TM 2000c Nucleic Acid Protein Analyzer, ThermoFisher Scientific, USA;
[0068] Ribonuclease R(Lucigen, epicentre, USA) Kit, Epicentre Biotechnologies, USA;
[0069] TB Green TM Premix Ex Taq II: TB Green TM Premix Ex Taq II Fluorescent PCR Kit, TaKaRa Bio Inc., Japan;
[0070] LightCycler 480(Roche, Switzterland): LightCycler 480 Real-Time Fluorescent Quantitative PCR Instrument, Roche, Switzerland;
[0071] Streptococcus mutans competent CSP, Zhengzhou Paitaide Biotechnology Co., Ltd., China;
[0072] Gram Staining Kit, Beijing Solabio Science and Technology Co., Ltd.;
[0073] Scanning Electron Microscope(FEI), Model Inspect F, ThermoFisher Scientific, USA;
[0074] Microplate Reader(BioTek, USA: iD5, Bio-Rad Laboratories, Inc.
[0075] Alexa Fluor 647 (Invitrogen, USA), ThermoFisher Scientific
[0076] Biosharp sterile glass bottom culture dishes (biosharp, China), Biosharp, Beijing Lanjiekeli Science and Technology Co., Ltd.
[0077] SYTO 9 nucleic acid dye (Invitrogen, USA): ThermoFisher Scientific
[0078] Anti-fade mounting medium (Solarbio, China), Solarbio, Beijing Solarbio Science & Technology Co., Ltd.
[0079] Atomic force microscope (SHIMADZU, Kyoto, Japan): Model Shimadzu SPM-9700 system, Shimadzu Corporation
[0080] Atomic force microscope probe (AppNano, USA), Model HYDRA-ALL-G-20, AppNano
[0081] Keyes 2000# cariogenic feed: Nantong Turofe Feedstuff Technology Co., Ltd.
[0082] m / V in the embodiments of the present application represents the mass-volume ratio of a substance to a solvent. For example, sucrose 1% (m / V) means that 1g of sucrose is added to 100ml of water. Embodiment 1
[0083] This embodiment discloses the discovery and verification test of the circular RNA circcsbD of the present application.
[0084] 1. This embodiment uses Streptococcus mutans standard strain UA159 for testing. High-throughput sequencing is performed on the differentially expressed circular RNAs in the high-cariogenic state (biofilm state) and the low-cariogenic state (planktonic state) of Streptococcus mutans standard strain UA159, respectively. The details are as follows:
[0085] Streptococcus mutans standard strain UA159 preserved with 25% (volume / volume: v / v) glycerol is inoculated into brain heart infusion medium (BHI) and recovered overnight in an anaerobic incubator (37℃, 5% CO2, 10% H2, 85% N2). After 16 hours of recovery, it is resuspended in fresh BHI at a volume ratio of 1:20, and cultured to the mid-logarithmic growth phase. The OD600 is measured by a turbidimeter nm = 0.4-0.5, obtaining the low-cariogenic state (planktonic state) of Streptococcus mutans standard strain UA159, ready for use.
[0086] A portion of the bacterial culture in the mid-logarithmic growth stage was taken and suspended at a volume ratio of 1:100 in sucrose bovine heart and brain extract medium (BHIS, with 1% sucrose (m / V), experimental, China). The culture was incubated in an anaerobic incubator for 24 hours to form a biofilm, thus obtaining the highly cariogenic state (biofilm state) of the Streptococcus mutans standard strain UA159, which was ready for use.
[0087] according to The reagent instructions were followed to extract total nucleic acid from bacterial samples in both highly cariogenic (biofilm) and low cariogenic (planktonic) states. Ribosomal RNA (rRNA) was removed using the Ribo-Zero rRNA Removal Kit, and circular RNA was enriched using the CircRNA Enrichment Kit. The recovered and purified circular RNA was randomly fragmented into short RNA fragments, and then... Ultra TM II. The Directional RNA Library Prep Kit was used for pretreatment, and double-stranded cDNA products were synthesized and purified. The sticky ends were then repaired and smoothed using T4 DNA polymerase and Klenow DNA polymerase. Sequencing libraries were then constructed, and high-throughput 150bp paired-end sequencing (Illumina Novaseq 6000) was performed on differentially expressed circular RNAs in highly cariogenic states (biofilm state) and low-cariogenic states (planktonic state). To obtain accurate and reliable sequencing results, the raw data was post-processed using cutadapt (v1.9.3) to remove adapters and low-quality reads, obtaining high-quality clean reads. Bowtie2 was used to match the clean reads to the genome, and find_circ technology was used to identify circRNAs. The identified circular RNAs were annotated using the circBase and circ2Trait disease databases. Finally, edgeR (v3.16.5) was used for data normalization and differentially expressed circRNA screening.
[0088] The results showed that the endogenous circular RNA circcsbD was located in the *Streptococcus mutans* genome as [NC_004350.2:c1564318-1564143Streptococcus mutans UA159, complete sequence], and the corresponding linear gene was csbD. This circular RNA is 176 bases long, and its sequence is shown in SEQ ID NO:1, as follows:
[0089] The heatmap of high-throughput sequencing clusters of Streptococcus mutans circular RNA is shown in Figure 1.
[0090] The circcsbD sequence comparison analysis chart with csbD sequence is shown in Figure 2, and the results show that the two have 41.2% consistency.
[0091] 2. Verification
[0092] The present application first found that circcsbD has the same closed circular structure as eukaryotic circular RNA. The verification of the closed circular structure of Streptococcus mutans circular RNA mainly includes Sanger sequencing and RNase R enzyme resistance experiment.
[0093] 2.1 Sanger sequencing
[0094] The total nucleic acid of Streptococcus mutans standard strain UA159 in the logarithmic growth phase was extracted by the above method, and the total nucleic acid sample was configured according to the PrimeScript TM RT reagent Kit with gDNA Eraser instruction to remove gDNA and perform reverse transcription to obtain cDNA sample, and then the sample was subjected to PCR amplification reaction according to the PCR Master Mix reagent kit instruction. The primer sequence is:
[0095] F AAAAGAGCAGAAATCCTATCT, as shown in SEQ ID NO: 4.
[0096] R TCTTTGATGCTGTCTTTTGC, as shown in SEQ ID NO: 5.
[0097] The PCR reaction system is as follows:
[0098] Table 1 PCR reaction system
[0099] The PCR reaction conditions are as follows:
[0100] Pre-denaturation: 98℃ 30 seconds; 1 cycle
[0101] Denaturation: 98℃ 10 seconds
[0102] Annealing: 58℃ 30 seconds
[0103] Denaturation and annealing for 30 cycles
[0104] Extension: 72℃ 30 seconds
[0105] Final extension: 72℃ 5 minutes
[0106] The PCR product was subjected to agarose gel electrophoresis using a 2% agarose gel configured with 1x TBE buffer, the target PCR product was recovered by cutting the gel using TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0, the recovered and purified PCR product was subjected to Sanger sequencing, the sequencing results were analyzed using analysis software Chromas, the specific splicing site was detected, and the circular RNA closed loop site was confirmed.
[0107] 2.2 RNase R enzyme tolerance experiment
[0108] The standard strain of Streptococcus mutans UA159 was extracted according to the Master Pure TM Complete DNA and RNA Purification Kit instructions, the experiment was carried out in an enzyme-free environment and each reaction was operated on ice, and the specific experimental steps were as follows:
[0109] (1) Bacterial cell wall disruption: 1x Tissue and Cell Lysis Solution and Proteinase K were added to the sample, shaken for 10 seconds to mix well, and incubated in a dry heating instrument at 65°C for 15 minutes, shaken every 5 minutes, and the broken sample was cooled on ice for 3-5 minutes;
[0110] (2) Protein precipitation: MPC Protein Precipitation Reagent was added to the sample, gently shaken for 10 seconds, and centrifuged at 12800 rpm for 10 minutes at 4°C;
[0111] (3) Transfer the supernatant to an enzyme-free 1.5 mL centrifuge tube;
[0112] (4) Nucleic acid precipitation: add pre-cooled isopropanol, mix well by inverting, centrifuge at 12800 rpm for 10 minutes at 4°C, and take the precipitate;
[0113] (5) Remove impurities: rinse the precipitate twice with pre-cooled 70% ethanol, and dry at room temperature for no more than 10 minutes;
[0114] (6) Obtain total nucleic acid sample: dissolve the nucleic acid precipitate with enzyme-free water, measure the concentration and purity (OD260 / A280, NanoDrop TM 2000c Spectrophotometer, ThermoFisher Scientific, USA) of the nucleic acid sample, and store the sample at -80°C.
[0115] The total nucleic acid sample was configured according to the PrimeScript TM RT reagent Kit with gDNA Eraser instruction to configure a corresponding reaction system to remove gDNA. The experiment was performed in an enzyme-free environment and on ice. The reaction system and operation steps are as follows:
[0116] Table 2 gDNA removal reaction system and operation steps
[0117] Incubate at 42°C for 2 minutes to obtain a purified total RNA sample with a concentration of about 50 ng / μL.
[0118] The above total RNA sample was equally divided into two groups. One group was used as an experimental group, and the RNA sample in this group was treated with RNase R to remove linear RNA. The other group was used as a control group and an equal amount of enzyme-free water was added. The reaction system of the experimental group was configured according to the Ribonuclease R kit instructions, and RNase R was used to act on the linear RNA in the experimental group. The reaction system is as follows:
[0119] Table 3 RNase R resistant enzyme experiment reaction system of the experimental group
[0120] The control group was configured according to the reaction system of the experimental group, and an equal amount of enzyme-free water was added. The specific reaction system is as follows:
[0121] Table 4 Resistant enzyme experiment reaction system of the control group
[0122] The experimental group and the control group were incubated at 37°C for 15 minutes. The above two RNA samples were incubated under the same conditions, and the reverse transcription was performed according to the PrimeScript TM RT reagent Kit with gDNA Eraser instruction to configure a corresponding reaction system. The reaction system and operation steps are as follows:
[0123] Table 5 Reverse transcription reaction system
[0124] Reverse transcription reaction: incubate at 37°C for 15 minutes, enzyme inactivation: incubate at 85°C for 5 seconds, and obtain two cDNA samples.
[0125] The relative quantitative method was used, and the mRNA expression amount of the gyrA gene of the standard strain UA159 BHI under the culture conditions was used as the internal reference. Since the mRNA of the gyrA gene in the experimental group is linear RNA, it has been degraded by RNase R under normal circumstances, so the mRNA expression amount of the gyrA gene in the experimental group is referenced to the mRNA expression amount of the gyrA gene in the control group. Similarly, after qPCR amplification, 2-ΔΔct The fold difference of expression of the experimental group was calculated. The above cDNA samples were prepared according to the TB Green TM Premix Ex Taq II instructions to configure the corresponding reaction system, each sample set three wells, the experiment was carried out on ice, and the LightCycler 480 was run qPCR program, the reaction system and reaction conditions were as follows:
[0126] Table 6 RT-qPCR reaction system
[0127] The primer sequences are as follows:
[0128] circcsbD-F AGTTAGAACTTCTGTCTTTGGTGCT, as shown in SEQ ID NO: 2;
[0129] circcsbD-R CCTTCTACACCGTCCTTGATATCTT, as shown in SEQ ID NO: 3.
[0130] The reaction conditions are as follows:
[0131] Pre-denaturation: 95°C for 30 seconds; 1 cycle;
[0132] PCR: analysis mode-quantitative analysis 95°C for 5 seconds, 60°C for 30 seconds; 40 cycles;
[0133] Melting: analysis mode-melting curve 95°C for 5 seconds, 60°C for 1 minute, 95°C; 1 cycle;
[0134] Cooling: 50°C for 30 seconds; 1 cycle.
[0135] 2.3 Results
[0136] The results of circcsbD closed loop structure verification are shown in FIG. 3 and FIG. 4. FIG. 3 is a sequencing peak map of circcsbD cyclization site, and the circcsbD cleavage site is TGGT. FIG. 4 is a result map of the effect of RNase R enzyme treatment on circcsbD abundance. *P<0.05.
[0137] The results show that the RNA circcsbD has the same closed loop structure as the eukaryotic circular RNA.
[0138] Example 2
[0139] Divergent primers were designed based on the circcsbD circularization site. Annealing at 60℃, the product size was 87 bp. Specificity was verified using NCBI Primer BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi). Primer pairs capable of amplifying the circcsbD circularization site were used. The primer sequences are as follows:
[0140] circcsbD-F AGTTAGAACTTCTGTCTTTGGTGCT, as shown in SEQ ID NO:2;
[0141] circcsbD-R CCTTCTACACCGTCCTTGATATCTT, as shown in SEQ ID NO:3.
[0142] Streptococcus mutans exerts its cariogenic effect primarily through biofilm formation, which represents its highly cariogenic state. To detect the expression levels of circcsbD in both low-cariogenic and high-cariogenic states, the Streptococcus mutans standard strain UA159 was revived overnight for 16 hours and then resuspended at a 1:20 volume ratio in fresh, saccharified bovine heart and brain extract medium. The culture was then incubated to mid-logarithmic growth to obtain a low-cariogenic state (planktonic state) of the Streptococcus mutans standard strain UA159 under the same culture conditions as the high-cariogenic state. This low-cariogenic state was then compared with the biofilm-form Streptococcus mutans standard strain UA159 obtained in the above culture. The samples were then processed according to Master Pure... TM Extract total nucleic acid from the sample according to the Complete DNA and RNA Purification Kit instructions. Then, follow the PrimeScript instructions for processing the total nucleic acid sample. TM The RT reagent kit with gDNA eraser removes gDNA and performs reverse transcription, as per the instructions. Finally, follow the instructions of TB Green. TM Configure the appropriate reaction system according to the Premix Ex Taq II instructions and run the qPCR program on a LightCycler 480.
[0143] The primer sequences are as follows:
[0144] circcsbD-F AGTTAGAACTTCTGTCTTTGGTGCT, as shown in SEQ ID NO:2;
[0145] circcsbD-R CCTTCTACACCGTCCTTGATATCTT, as shown in SEQ ID NO:3.
[0146] The circcsbD expression level in S. mutans under low cariogenic state (planktonic state) and high cariogenic state (biofilm state) was detected by qRT-PCR. The results are shown in FIG. 5 and FIG. 6.
[0147] The results show that the circcsbD expression level is sensitive to the change of S. mutans from low cariogenic state to high cariogenic state. The detection of the circcsbD expression level can assist in the prediction of dental caries, and the circcsbD can be used as a novel biomarker and therapeutic target for dental caries.
[0148] Example 3
[0149] This example discloses a method for constructing S. mutans with overexpression of circcsbD. The circcsbD sequence (SEQ ID NO: 1) was obtained from the NCBI database, and a promoter sequence (underlined sequence shown in FIG. 7) was designed upstream of the sequence. The circcsbD fragment nucleotide sequence with the promoter was synthesized, and BamHI and EcoRI restriction enzyme sites (lowercase sequence shown in FIG. 7) were introduced at the 5' end and 3' end upstream and downstream of the synthesized nucleotide sequence. The circcsbD sequence with the promoter (FIG. 7) was double-digested with BamHI / EcoRI, and the digested fragment was ligated with the pDL278 plasmid that was also double-digested, to obtain a circcsbD recombinant expression vector. The S. mutans circcsbD overexpression strain was constructed by plasmid transformation. The S. mutans standard strain UA159 was resuscitated overnight for 16 hours, resuspended in fresh bovine heart brain infusion medium at a volume ratio of 1:20, and cultured to the mid-logarithmic growth phase. The S. mutans competent CSP was added at a final concentration of 1 μg / mL, and the recombinant plasmid was added at a final concentration of 0.5-1 ng / μL, and the mixture was incubated for 3 hours. The transformation system is as follows:
[0150] Table 7 Recombinant plasmid transformation system
[0151] The pDL278 plasmid carries a spectinomycin resistance gene, and the bacteria transformed with the plasmid have spectinomycin resistance. The mixed culture is inoculated on a BHI spectinomycin resistance plate with a final concentration of 1000 μg / mL of spectinomycin and incubated for 48 hours. Single colonies are selected on the antibiotic selection plate, inoculated again on a BHI spectinomycin resistance plate with a final concentration of 1000 μg / mL of spectinomycin and incubated for 48 hours. The single colonies are resuspended in PBS and uniformly smeared on a glass slide, which is then air-dried at room temperature. The bacteria on the glass slide are stained according to the instructions of the Gram staining kit (Solarbio, China), and observed using an optical microscope after staining. The results are shown in FIG. 8: the selected colonies are Gram-positive and chain-shaped, and show no significant difference in morphology from the standard strain of S. mutans UA159. Further, single colonies are selected and subjected to microscopic examination of colony morphology, resuspended in fresh BHI at a volume ratio of 1:20, cultured to the mid-logarithmic growth phase, resuspended in fresh BHIS at a volume ratio of 1:100, and incubated for 3 hours using a 12-well plate with sterile cell climbing slides and 2 mL of the above-mentioned BHIS resuspended bacteria. The morphology and structure of the bacteria are observed using a scanning electron microscope (FEI, Eindhoven, Holland), and the specific processing steps are as follows:
[0152] (1) After 3 hours, the cell climbing slides with adhered bacteria are removed and transferred to a new 12-well plate;
[0153] (2) The sample is gently rinsed with PBS three times, the liquid is absorbed, and the sample is air-dried at room temperature;
[0154] (3) The sample is fixed with a 2.5% (volume / volume) glutaraldehyde solution under wet conditions, and placed in the dark at 4°C for 4 hours;
[0155] (4) The glutaraldehyde solution is absorbed, and the sample is dehydrated with 30%, 50%, 75%, 85%, 95%, and 99% (volume / volume) ethanol solutions, respectively, for 15 minutes at each concentration;
[0156] (5) After dehydration, the ethanol solution is absorbed, and the sample is treated with n-pentyl acetate, dried, gold-coated, and subjected to a series of treatments to complete the sample processing steps;
[0157] (6) The morphology of the bacteria is observed using a scanning electron microscope, and images are collected at magnifications of 5000x, 20000x, and 50000x.
[0158] The results are shown in FIG. 9: the morphology of the selected colonies shows no significant difference from the standard strain of S. mutans UA159, and the colonies have a chain structure.
[0159] Single colonies were selected and revived in BHI at a final concentration of 1000 μg / mL for 16 hours. The colonies were then resuspended in fresh BHI at a 1:20 volumetric ratio and cultured to mid-logarithmic growth. The Streptococcus mutans standard strain UA159 was cultured in BHI under the same conditions to mid-logarithmic growth, and the cells were collected by centrifugation. Samples were processed according to Master Pure... TM Extract total nucleic acid from the sample using the Complete DNA and RNA Purification Kit (Lucigen, Epicentre, USA) according to the instructions. Then, follow the PrimeScript procedure to extract the total nucleic acid sample. TM The RT reagent kit with gDNA Eraser (Takara, Japan) was used to remove gDNA and perform reverse transcription, and finally, the procedure was followed according to the TB Green instructions. TM Configure the appropriate reaction system according to the Premix Ex TaqⅡ (Takara, Japan) instructions and run the qPCR program on a LightCycler 480 (Roche, Switzterland).
[0160] The primer sequences are as follows:
[0161] circcsbD-F AGTTAGAACTTCTGTCTTTGGTGCT, as shown in SEQ ID NO:2;
[0162] circcsbD-R CCTTCTACACCGTCCTTGATATCTT, as shown in SEQ ID NO:3.
[0163] The expression of circcsbD in the standard strain UA159 of Streptococcus mutans and the screened strain was verified by qRT-PCR. The results showed that the screened strain overexpressed circcsbD, as shown in Figure 10. The circcsbD overexpressing strain pDL278-circ4-202403 was named pDL278-circcsbD.
[0164] Experimental Example 1
[0165] In this experiment, the total amount of biofilm in the circcsbD overexpressing strain was measured, and the biofilm formation of the overexpressing strain was observed using scanning electron microscopy.
[0166] 1. The total amount of biofilm of circcsbD overexpression strain was determined by crystal violet staining experiment, and the biofilm formation ability of circcsbD overexpression strain was investigated. The standard strain of Streptococcus mutans UA159 and the circcsbD overexpression strain were inoculated in BHI medium and BHI medium with a final concentration of 1000 μg / mL spectinomycin, respectively, and recovered overnight in an anaerobic incubator (37°C, 5% CO2, 10% H2, 85% N2). After 16 hours of recovery, they were resuspended in fresh BHI at a volume ratio of 1:20, cultured to the middle of logarithmic growth, resuspended in sugar-added bovine heart infusion medium (BHIS, added with 1% (m / V) sucrose, Chengshi, China) at a volume ratio of 1:100, and cultured in the above anaerobic incubator for 24 hours to form biofilm. After biofilm formation, the samples were gently rinsed with PBS for 3 times, the liquid was absorbed, and the samples were air-dried at room temperature for 15 minutes. 0.5 times the volume of crystal violet solution (0.01%, mass / volume) of the bacterial solution was added to each well, and the samples were stained for 10 minutes. After staining, the excess dye was washed off with running water, the plate was inverted on the absorbent paper, and the samples were air-dried at room temperature for 15 minutes. 1.25 times the volume of glacial acetic acid solution (33%, volume / volume) of the bacterial solution was added to each well, and the samples were eluted at 37°C for 5 minutes on a constant temperature shaker at 150 rpm. The above samples were transferred to a 96-well plate, 200 μL per well, and the OD 575nm value was read by a microplate reader.
[0167] The results are shown in Figure 11: the total amount of biofilm of circcsbD overexpression strain is less than that of the standard strain of Streptococcus mutans UA159, and the biofilm formation ability of circcsbD overexpression strain is weaker than that of the standard strain of Streptococcus mutans UA159.
[0168] 2. The biofilm formation of circcsbD overexpression strain was observed by scanning electron microscope experiment.
[0169] The standard strain of Streptococcus mutans UA159 and the circcsbD overexpression strain were inoculated in BHI medium and BHI medium with a final concentration of 1000 μg / mL spectinomycin, respectively, and recovered for 16 hours in an anaerobic incubator (37°C, 5% CO2, 10% H2, 85% N2). They were resuspended in fresh BHI at a volume ratio of 1:20, cultured to the middle of logarithmic growth, resuspended in sugar-added bovine heart infusion medium (BHIS, added with 1% (m / V) sucrose), and cultured in the above anaerobic incubator for 24 hours to form biofilm. Sterile cell climbing films and 2 mL of the above resuspended bacterial solution were added to a 12-well plate and cultured in the above anaerobic incubator for 24 hours to form biofilm. The morphology and structure of the bacterial cells were observed by scanning electron microscope, and the specific processing steps were the same as above.
[0170] The results are shown in Figure 12: compared with the standard strain of Streptococcus mutans UA159, the circcsbD overexpression strain has significantly reduced extracellular matrix of biofilm, the biofilm is flat, does not form a reticulated cross-linked three-dimensional structure, and there are few bacterial clusters wrapped in extracellular matrix. Under high magnification, a flat bacterial layer can be seen, and no obvious extracellular matrix is observed, indicating that circcsbD can severely damage the formation of extracellular matrix of Streptococcus mutans biofilm.
[0171] Test Example 2
[0172] In this test example, the amount of extracellular polysaccharide synthesis of the circcsbD overexpression strain biofilm was detected by anthrone-sulfuric acid experiment, the formation and distribution of extracellular polysaccharide of the circcsbD overexpression strain biofilm were observed by laser confocal microscope, and the surface characteristics of the circcsbD overexpression strain biofilm were observed by atomic force microscope.
[0173] 1. The amount of extracellular polysaccharide synthesis of the circcsbD overexpression strain biofilm was detected by anthrone-sulfuric acid experiment.
[0174] Streptococcus mutans standard strain UA159 and circcsbD overexpression strain were inoculated in BHI medium and BHI medium with a final concentration of 1000 μg / mL spectinomycin, respectively, and recovered in an anaerobic incubator (37°C, 5% CO2, 10% H2, 85% N2) for 16 hours overnight. The volume ratio was 1:20, and they were resuspended in fresh BHI medium. They were cultured to the middle of the logarithmic growth phase, resuspended in sugar bovine heart brain infusion medium (BHIS, with 1% (m / V) sucrose) at a volume ratio of 1:100, and used in a 6-well plate. 2 mL of the above-mentioned BHIS resuspended bacterial solution was added to each well, and cultured in an anaerobic incubator for 24 hours to form a biofilm. After the biofilm was formed, the medium was aspirated, 3 mL of sterile double distilled water was added to each well, the biofilm was scraped off with a cell scraper and transferred to a centrifuge tube, and centrifuged at 4000 rpm for 20 minutes at 4°C. The supernatant and precipitate were separated; the supernatant was filtered with a 0.22 μm filter to obtain a water-soluble polysaccharide solution; the precipitate was dissolved with 6 mL of 1M NaOH, mixed thoroughly, and incubated at 37°C for 3 hours on a constant-temperature shaker at 120 rpm. After incubation, the mixture was centrifuged at 4000 rpm for 20 minutes at 4°C, and the supernatant was filtered with a 0.22 μm filter to obtain a water-insoluble polysaccharide solution. The 0.2% (mass / volume) anthrone-sulfuric acid reagent was prepared immediately before use, and the sample was mixed thoroughly at a ratio of polysaccharide solution:anthrone-sulfuric acid reagent = 1:3, incubated at 95°C for 6 minutes, and cooled on ice.
[0175] A standard concentration glucose solution was prepared as a standard curve, and the reference concentration of the standard curve was as follows:
[0176] Table 8 Standard curve concentration of anthrone-sulfuric acid experiment
[0177] Using 96-well plate, 200 μL per well, OD reading by microplate reader 625nm Values, the content of biofilm exopolysaccharide of each sample was calculated by standard curve.
[0178] The results are shown in Figure 13. Wherein A represents the ratio of water-insoluble polysaccharide / water-soluble polysaccharide; B represents the content of water-insoluble polysaccharide; C represents the content of water-soluble polysaccharide. *P<0.05, the results show that the circcsbD overexpression strain has significantly lower ratio of water-insoluble exopolysaccharide / water-soluble exopolysaccharide, content of water-insoluble exopolysaccharide and content of water-soluble exopolysaccharide than the standard strain of Streptococcus mutans UA159 (*P<0.05). It is suggested that circcsbD damages the synthesis ability of water-insoluble polysaccharide and water-soluble polysaccharide of Streptococcus mutans biofilm.
[0179] 2. Laser confocal microscope was used to observe the formation and distribution of exopolysaccharide of circcsbD overexpression strain biofilm.
[0180] The standard strain of Streptococcus mutans UA159 and circcsbD overexpression strain were inoculated in BHI medium and BHI medium with a final concentration of 1000 μg / mL spectinomycin respectively, and recovered in an anaerobic incubator (37°C, 5% CO2, 10% H2, 85% N2) for 16 hours. The recovered bacteria were resuspended in fresh BHI medium at a volume ratio of 1:20, and cultured to the mid-logarithmic growth phase. The bacteria in the mid-logarithmic growth phase were resuspended in sugar-added bovine heart infusion medium (BHIS, 1% (m / V) sucrose) at a volume ratio of 1:100, and Alexa Fluor 647 was added to the resuspended bacteria to a final concentration of 1 μL / mL. The mixed bacteria were then added to sterile glass-bottomed culture dishes, and cultured in an anaerobic incubator for 24 hours to form biofilms. After the biofilms were formed, the glass-bottomed culture dishes were taken out, the suspension was aspirated, and the planktonic bacteria were removed by gentle rinsing with sterile distilled water. The biofilms were air-dried at room temperature in the dark. Under the wet state of the biofilms, 100 μL of SYTO 9 nucleic acid dye with a concentration of 2.5 μM was added to each sample, and the sample was incubated at room temperature in the dark for 15 minutes. After incubation, the dye was aspirated, and the residual dye was removed by gentle rinsing with sterile distilled water. The residual water on the edges of the glass slides was absorbed with sterile filter paper, and the samples were air-dried at room temperature in the dark. An appropriate amount of anti-fluorescence quenching mounting medium was added to each sample under the wet state of the biofilms to complete the sample preparation. The samples were stored at 4°C in the dark. The three-dimensional structure of the biofilms and the formation of exopolysaccharide were observed under a laser confocal microscope. The excitation wavelength of SYTO 9 was 488 nm, and the excitation wavelength of Alexa Fluor 647 was 640 nm. The three-dimensional structure of the biofilms was scanned at a fixed layer height of 1 μm. The three-dimensional images of the biofilms were reconstructed using Imaris 7.2.3 software.
[0181] The results are shown in Figure 14. As can be seen from the figure, compared with the standard strain of Streptococcus mutans UA159, the circcsbD overexpression strain biofilm is flat, no obvious bacterial clusters are formed, the bacterial content and the content of extracellular polysaccharide are reduced, and the extracellular polysaccharide is sparsely distributed. It is indicated that circcsbD damages the content and distribution of extracellular polysaccharide of Streptococcus mutans biofilm.
[0182] 3. The surface characteristics of the circcsbD overexpression strain biofilm were observed by atomic force microscopy.
[0183] The standard strain of Streptococcus mutans UA159 and the circcsbD overexpression strain were inoculated in BHI medium and BHI medium with a final concentration of 1000 μg / mL spectinomycin, respectively, and recovered in an anaerobic incubator (37°C, 5% CO2, 10% H2, 85% N2) for 16 hours overnight. Then, they were resuspended in fresh BHI at a volume ratio of 1:20 and cultured to the middle logarithmic growth phase. Then, they were resuspended in BHIS (sucrose 1% (m / V)) at a volume ratio of 1:100, and sterile cell climbing sheets and 2 mL of the above-mentioned BHIS resuspended bacterial solution were added to a 12-well plate and cultured in the above-mentioned anaerobic incubator for 24 hours to form biofilm. After the biofilm was formed, the cell climbing sheets were taken out, transferred to a new 12-well plate, gently rinsed with sterile distilled water to remove planktonic bacteria, and air-dried at room temperature. Atomic force microscopy was used to observe the surface morphology of each sample biofilm, and a 0.085 N / m atomic force microscope probe was used to scan a 10 μm x 10 μm range in contact mode to determine the surface roughness and adhesion of each sample biofilm.
[0184] The results are shown in Figures 15-17. As can be seen from Figure 15, the circcsbD overexpression strain biofilm lacks extracellular matrix coverage, and the individual bacterial morphology can be clearly seen. As can be seen from Figures 16 and 17, the roughness and adhesion of the circcsbD overexpression strain biofilm are lower than those of the standard strain of Streptococcus mutans UA159 (*P<0.05). It is indicated that circcsbD damages the colonization ability of Streptococcus mutans.
[0185] Test Example 3
[0186] This test example discloses an animal test of the circcsbD overexpression strain for preventing dental caries.
[0187] 30 SPF level 17-day-old SD rats were randomly divided into blank control group, positive control group (standard strain of Streptococcus mutans UA159) and experimental group (circcsbD overexpression strain), 10 in each group, half male and half female. Sterile cotton swab was used to dip equal amount of sterile double distilled water, standard strain of Streptococcus mutans UA159 in logarithmic growth phase and circcsbD overexpression strain liquid, respectively, and was applied to the corresponding group of rats' molar surface. Inoculate once a day at a fixed time, for 7 consecutive days, while feeding with Keyes 2000# cariogenic feed (Nantong Terofy Feed Technology) and sterilized 5% (m / V) sucrose solution. After the completion of strain inoculation, the rats were fed with cariogenic feed and 5% sucrose solution for 3 weeks. Finally, the rats were sacrificed by CO2 asphyxiation, and the mandible specimens were taken and washed with sterile PBS for 3 times.
[0188] 1. Stereomicroscope observation of rat molar caries degree.
[0189] 0.4% (w / w) of a solution of murexidum was used to stain the fixed specimens for 6 hours, and the occlusal surface of the molar was cut in mesial-distal direction using a hard tissue microtome. The degree of rat molar caries was observed under a stereomicroscope and images were collected, and the caries lesion was scored using Keyes scoring method.
[0190] 2. Micro-CT observation of rat molar caries degree.
[0191] The mandible specimens were placed in 4% paraformaldehyde for overnight fixation at 4°C in the dark, and then the specimens were rinsed and fixed in a Micro-CT 14mm sample tube, scanned with 10 μm accuracy, 500 projections / 180° resolution. Scanco Evaluation Software was used for three-dimensional reconstruction and image analysis.
[0192] 3. The results are shown in Figures 18-22. Figure 18 shows that the caries-inducing effect of the circcsbD overexpressing strain was greater than that of the blank control group but less than that of the positive control group of *Streptococcus mutans* standard strain UA159. Figure 19 shows that the degree of pit and fissure caries in the circcsbD overexpressing strain group was not statistically different from that in the blank control group (*P>0.05), but the caries-inducing effect was lower than that of *Streptococcus mutans* standard strain UA159 (*P<0.05). Figure 20 shows that the degree of superficial caries in the circcsbD overexpressing strain group was not statistically different from that in the blank control group and the *Streptococcus mutans* standard strain UA159. (*P>0.05); Figure 21 shows that the degree of caries in the circcsbD overexpressing strain group was not statistically different from that in the blank control group (*P>0.05), and the cariogenicity was lower than that of the standard strain of Streptococcus mutans UA159 (*P<0.05); Figure 22 shows that the degree of superficial caries in the circcsbD overexpressing strain group was not statistically different from that in the blank control group and the standard strain of Streptococcus mutans UA159 (*P>0.05); The above results suggest that circcsbD reduces the cariogenicity of Streptococcus mutans and can reduce the incidence of moderate caries.
[0193] The above embodiments are merely preferred embodiments of the present invention and are not intended to limit the present invention. Any person skilled in the art can modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by those skilled in the art without departing from the spirit and technical concept disclosed in the present invention should still be covered by the claims of the present invention.
Claims
1. A Streptococcus mutans circular RNA, circcsbD, characterized in that, The nucleotide sequence is shown as SEQ ID NO:
1.
2. The Streptococcus mutans circular RNA circcsbD for use as a biomarker for dental caries according to claim 1.
3. The use of the Streptococcus mutans circular RNA circcsbD according to claim 1 in the preparation of a preparation for preventing or treating dental caries in the oral cavity.
4. A primer for detecting the Streptococcus mutans circular RNA circcsbD according to claim 1, characterized by, The sequence of the upstream primer is shown as SEQ ID NO: 2, and the sequence of the downstream primer is shown as SEQ ID NO:
3.
5. A kit for detecting the Streptococcus mutans circular RNA circcsbD of claim 1, characterized by, The primer according to claim 4.
6. A Streptococcus mutans pDL278-circ4-202403 overexpressing a circular RNA circcsbD of claim 1, characterized by, The preservation number is CCTCC NO: M2024567.
7. The method for constructing Streptococcus mutans overexpressing a circular RNA circcsbD according to claim 6, wherein, The method comprises the following steps: designing a promoter sequence upstream of the sequence of the Streptococcus mutans circular RNA circcsbD according to claim 1, synthesizing the Streptococcus mutans circular RNA circcsbD nucleotide sequence connected with the promoter, adding restriction endonuclease BamHI and EcoRI restriction enzyme cleavage sites upstream and downstream of the synthesized nucleotide sequence, performing enzyme cleavage with restriction endonuclease BamHI / EcoRI, connecting the cleaved sequence to the pDL278 vector which has also been double-enzyme cleaved, constructing a circcsbD recombinant expression plasmid, and finally constructing a Streptococcus mutans circular RNA overexpression strain by using a plasmid transformation method.
8. The use of the Streptococcus mutans circular RNA circcsbD overexpression strain according to claim 7 in the preparation of a preparation for preventing or treating dental caries in the oral cavity.
Citation Information
Patent Citations
Streptococcusmutans rnc gene mutant strain and application thereof
CN103992962A
Streptococcus mutans, application of streptococcus mutans and microbial preparation
CN108130300A
New application of non-coding RNA (Ribonucleic Acid) and streptococcus constructed by non-coding RNA
CN114836422A
Streptococcus mutans circular RNA circcsbD and application thereof, overexpression strain of streptococcus mutans circular RNA circcsbD and construction method and application thereof
CN118127022A