Method of treating and diagnosing cancers
Combining VGKC inhibitors with TKIs, such as 4-aminopyridine with imatinib, targets and eradicates TKI-resistant cancer cells by using KCNAB1 mRNA or Kvβ1.1 as a biomarker, enhancing treatment efficacy in GIST and other cancers.
Patent Information
- Application Number
- PCT/US2025/044342
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-10-11
- Filing Date
- 2025-08-29
- Publication Date
- 2026-03-05
AI Technical Summary
Current tyrosine kinase inhibitor (TKI) therapies for gastrointestinal stromal tumors (GIST) and other cancers are only modestly effective, with many tumors developing resistance, and there is a need to identify and eradicate intrinsically resistant tumor cells.
Administering a voltage-gated potassium channel (VGKC) inhibitor, such as 4-aminopyridine, in combination with TKIs like imatinib, to target and eliminate TKI-resistant cancer cells, using KCNAB1 mRNA or Kvβ1.1 expression as a biomarker for predicting treatment response.
The combination therapy effectively reduces tumor burden and increases treatment efficacy by synergistically inhibiting K channel activity, inducing apoptosis, and overcoming TKI resistance in GIST and other cancers.
Smart Images

Figure US2025044342_05032026_PF_FP_ABST
Abstract
Description
Attorney Docket No.00015-441WO1 METHOD OF TREATING AND DIAGNOSING CANCERS CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority under 35 U.S.C. §119 from U.S. Application Serial No. 63 / 689,175, filed August 30, 2024 and U.S. Application Serial No. 63 / 706,552, filed October 11, 2024, the disclosures of which are incorporated herein by reference. TECHNICAL FIELD
[0002] The disclosure provides methods of diagnosing tyrosine kinase inhibitor (TKI) resistant GIST and other cancers and predicting response to TKI therapy in treatment. The disclosure also provide methods of treating such cancer. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0003] This invention was made with government support under CA226803 awarded by the National Institute of Health. The Government has certain rights in the invention. INCORPORATION BY REFERENCE OF SEQUENCE LISTING
[0004] Accompanying this filing is a Sequence Listing entitled, “00015-441WO1.xml” created on August 29, 2025 and having 4,650 bytes of data, machine formatted on IBM-PC, MS-Windows operating system. The sequence listing is hereby incorporated by reference in its entirety for all purposes. BACKGROUND
[0005] Gastrointestinal stromal tumor (GIST) is a rare cancer with ~6,000 new cases annually in the United States. A majority of GIST are driven by oncogenic KIT (the receptor for stem cell factor (SCF or Kit ligand (Kitl)) mutations, and all FDA-approved therapies (such as imatinib, IM) involve targeting the KIT oncoprotein. For patients who are receiving chemotherapy for the first time, IM is prescribed to shrink tumors and reduce the extent and morbidity of surgical resection. Despite having mutations that portend IM sensitivity, only 50-60% of KIT mutant GIST have radiologic partial responses (PR; i.e., ≥30% shrinkage) following IM therapy, and pathologic complete responses (pCR) are so rare as to be almost case reportable. This raises the question as to whether GIST possess tumor cells that are intrinsically resistant to IM. If this is true, then a new therapeutic strategy might involve identifying these cells and devising an approach to eradicate them.Attorney Docket No.00015-441WO1 SUMMARY
[0006] The disclosure provides a method of treating a tyrosine kinase inhibitor (TKI)-resistant cancer in a subject, comprising administering a voltage gated potassium channel (VGKC) inhibitor and a tyrosine kinase inhibitor (TKI) to the subject. In one embodiment, the VGKC inhibitor and TKI are administered simultaneously. In yet another embodiment, the VGKC inhibitor is administered prior to the TKI. In still another embodiment, the VGKC inhibitor is administered after the TKI. In another or further embodiment of the foregoing, the VGKC inhibitor is 4-aminopyridine (4-AP) or an analog thereof. In a further embodiment, the 4-AP analog is 3,4 di-aminopyridine. In still another or further embodiment, the TKI is selected from the group consisting of imatinib (IM), Sunitinib, Regorafenib, Ripretinib, Avapritinib, Bezuclastinib, and IDRX-42. In another embodiment, the TKI resistant cancer is a KIT-associated cancer. In a further embodiment, the KIT-associated cancer comprises increased KIT expression or aberrant KIT activity. In another or further embodiment, the TKI resistant or KIT-associated cancer is selected from gastrointestinal stromal tumor (GIST), acute myelogenous leukemia, small-cell lung carcinoma, ovarian carcinoma, breast carcinoma, melanoma, neuroblastoma, myelodysplastic syndrome (MDS), myeloproliferative disease (MPD), aggressive systemic mastocytosis (ASM), hypereosinophilic syndrome (HES), dermatofibrosarcoma protuberans (DFSP), soft-tissue sarcomas of neuroectodermal origin, and heptocellular carcinoma.
[0007] The disclosure also provides a method for treating a subject with tyrosine kinase inhibitor resistant gastrointestinal stromal tumor (GIST), the method comprising administering to the subject a therapeutically effective amount of a tyrosine kinase inhibitor (TKI) and a voltage-gated potassium channel (VGKC) inhibitor. In one embodiment, the tyrosine kinase inhibitor is selected from imatinib (IM), Sunitinib, Regorafenib, Ripretinib, Avapritinib, Bezuclastinib, and IDRX-42. In another embodiment, the voltage-gated potassium channel (VGKC) inhibitor is 4-aminopyridine (4-AP) or an analog thereof. In another embodiment, the TKI and VGKC inhibitor are administered simultaneously. In another embodiment, the TKI is administered prior to or after the VGKC inhibitor.Attorney Docket No.00015-441WO1
[0008] The disclosure also provides a method comprising collecting a tumor cell sample from a subject; and measuring a KIT Kvβ1.1 cell population in the tumor cell sample, wherein the presence of KITKvβ1.1 cells is indicative that the subject has a tyrosine kinase inhibitor (TKI) resistant cancer. In one embodiment, the method further comprises administering a voltage gated potassium channel (VGKC) inhibitor and a TKI inhibitor to the subject when the sample comprises KITKvβ1.1 cells. In a further embodiment, the TKI is selected from imatinib (IM), Sunitinib, Regorafenib, Ripretinib, Avapritinib, Bezuclastinib, and IDRX-42. In another or further embodiment, the voltage-gated potassium channel (VGKC) inhibitor is 4-aminopyridine (4-AP) or an analog thereof. In another embodiment, the tumor sample is a gastrointestinal stromal cell tumor (GIST).
[0009] The disclosure provides a method for predicting treatment response to tyrosine kinase inhibitor (TKI) therapy, the method comprising collecting a tumor cell sample from a pretreatment subject; measuring the level of expression of KCNAB1 mRNA or Kvβ1.1 protein in the tumor cell sample; wherein an elevated amount of KCNAB1 mRNA or Kvβ1.1 protein in the tumor cell sample is indicative of a TKI resistant tumor. In one embodiment, the TKI is selected from imatinib (IM), Sunitinib, Regorafenib, Ripretinib, Avapritinib, Bezuclastinib, and IDRX-42. In another embodiment, the tumor cell sample is obtained from a gastrointestinal stromal tumor (GIST).
[0010] The disclosure provides a method to predict whether a cancer will respond to tyrosine kinase inhibitor (TKI) treatment comprising obtaining a tissue biopsies followed by flow cytometry analysis to estimate the proportion of KITKvβ1.1 and KITKvβ1.1 cell populations in the tumor, wherein the presence of KITKvβ1.1 in the tissue biopsy is indicative of a TKI resistant cancer. In one embodiment, the method further comprises measuring mRNA expression of KCNAB1. In another embodiment, the cancer is a gastrointestinal stromal tumor (GIST).
[0011] The disclosure also provides a pharmaceutical composition comprising a tyrosine kinase inhibitor (TKI) and a voltage gated potassium channel (VGKC) inhibitor. In one embodiment, the TKI is selected from imatinib (IM), Sunitinib, Regorafenib, Ripretinib, Avapritinib, Bezuclastinib, and IDRX-42. In yet another embodiment,Attorney Docket No.00015-441WO1 the voltage-gated potassium channel (VGKC) inhibitor is 4- aminopyridine (4-AP) or an analog thereof.
[0012] The disclosure provides a pharmaceutical composition comprising imatinib and 4-aminopyridine (4-AP) or an analog thereof. DESCRIPTION OF DRAWINGS
[0013] Fig. 1A-E shows Kvβ1.1 is a marker of KIT tumor cells in GIST. (A) UMAP projection of 10 KIT mutant tumors (age range: 31- 80 y.o.; 70% female), comprising 47,317 tumor cells along with violin plots of GIST markers (KIT & ANO1) expression, showing notable KIT and KIT tumor cell clusters. KCNAB1 expression was seen exclusively in Cluster 7 (KIT ). (B) Gene set enrichment scores for inverse correlation between KCNAB1 and KIT mRNA expression in 134 GIST (both treatment naive and treated) from 4 independent publicly available data sets. (C) KCNAB1 mRNA expression was significantly higher in sorted KIT cells compared to KIT cells from GIST-T1 (mKIT exon 11) and GIST882 (mKIT exon 13) by RT- PCR. *P<0.05 compared to KIT . (D) KCNAB1 mRNA was increased upon IM treatment vs. vehicle controls from two GIST lines (RT-PCR). *P<0.05 vs. Control. (E) Sorted Kvβ1.1 cells have higher viability than Kvβ1.1 cells treated with low (20 nM) and high (50 nM) doses of IM (48 h). *P<0.05 compared to Kvβ1.1.
[0014] FIG. 2A-D shows Kvβ1.1 overexpression increases cell proliferation. (A) Conceptual model showing the working model for effects of Kvβ1.1 expression on VGKC channel activity and downstream effects in GIST. (B) Immunoblots show increased or decreased levels of Kvβ1.1 in T1-Kvβ1.1 over-expressing cells (OE) and T1-Kvβ1.1 knock-down (KD) cell lines as compared to T1 empty vector (EV) control. Alpha-tubulin serves as loading control. (C) Representative images and bar graph show colony forming capabilities of EV, OE, and KD cells cultured for 15 days. *P<0.05 vs. EV. (D) Phase area representing cell confluence for 3 lines: EV, OE, and KD. The cells were cultured, and data analyzed through live-cell imaging (Sartorius IncucyteR SX5). *P<0.05 vs. T1-EV.
[0015] FIG. 3A-E shows overexpression Kvβ1.1 and DPP10 (a Kv4.2 ternary complex expressed in human GIST) affect colony formation, proliferation rate, and TKI sensitivity. (A) Heatmap of the expression levels of GIST marker genes and 48 VGKC subunits fromAttorney Docket No.00015-441WO1 snRNAseq performed on 10 GIST. Arrows indicated the most highly expressed VGKC components vs. GIST markers (KIT & ANO1). (B) Immunoblots show levels of VGKC subunits pulled-down by immuno- precipitation (IP) without or with anti-DPP10 antibody (lanes 1 & 3, respectively) and total lysate as input (lane 2). (C) Bar graph shows colony forming capabilities in T1-EV, T1-DPP10 OE, and T1- Kvβ1.1 OE cultured for 15d. (D) Phase area representing cell confluence for 3 cell lines: EV, DPP OE, and Kvβ1.1 OE (Incucyte live-cell analysis system). (E) Relative cell viability by MTT assay with IC values in EV (squares), DPP10 OE (circles), and Kvβ1.1 OE (triangles) treated with TKIs or 4-AP for 72 h. Arrows indicate directions of killing curve shifting vs. EV control. *P<0.05 vs. T1- EV.
[0016] FIG. 4A-E shows targeting VGKC is synergistic with IM in vitro & in vivo. (A) Phase area representing cell confluence for T1- EV control, DPP10 OE, and Kvβ1.1 OE cells. The cells were cultured with sequential treatment – 100 nM IM for 2.5 days followed by indicated compound(s) for 3.5 days. IM, imatinib; Combo, IM+4-AP. (B) Proliferation, caspase 3 / 7 activity, Annexin V staining in GIST- T1 by Incucyte live-cell analysis system. (C) Heatmap summary of proliferation inhibition synergy scores in 2 GIST lines treated with IM+4-AP (N=3). Synergy scores are indicated: >10 (synergy); <-10 (antagonism; scale not shown as not detected). (D) Quantification of tumor weight (top) for tumor burden after 4-week treatment (IM: 45 mg / kg. 4-AP: 1 mg / kg IP; translated dose < FDA-approved human dose). *P<0.05. (E) A schematic illustration of higher apoptosis induction by IM+4-AP compared to single agents (IM or 4-AP). *P<0.05 vs. DMSO control; #P<0.05 vs. IM; $P<0.05 vs. to 4-AP.
[0017] Fig. 5A-D shows Kvβ1.1 expression in human GIST is a biomarker of TKI resistance. (A) A schema represents tumor processing and dot plots of KIT-mutated GIST labeled with KIT and Kvβ1.1 antibodies analyzed by flow cytometry. The bar graph shows the composition of KITKvβ and KITKvβ populations in human GIST (22 untreated vs. 26 treated). (B) KCNAB1 mRNA expression levels (by microarray, GSE15966) inversely correlate with neoadjuvant IM treatment responses by mRECIST v1.1 in an independent dataset of KIT exon 11 mutant GIST patients (RTOG 0132). PR: partial response; SD:Attorney Docket No.00015-441WO1 stable disease. *P<0.05 (C) Correlation of number of days of IM treatment and KITKvβ populations in IM treated KIT-mutant primary localized GIST (exon 11) from UCSD cohort (N=12). (D) Positive immunostaining of Kvβ1.1 is increased in resected human KIT exon 11- mutant GIST after IM vs. untreated control (both gastric localized GIST)(Top panels). Arrows indicate positive staining. Normalized KCNAB1 mRNA expression in same patients before and after IM treatment (bottom panel).
[0018] FIG. 6A-D shows K channel activity is synergistically inhibited by IM + 4-AP in GIST cells. Basal K channel activity in (A) 3 cell lines: T1-EV, Kvβ1.1 OE and KD; and in (B) T1-EV and 2 OE lines. *P<0.05 compared to T1-EV. (C) K channel activity in indicated cell lines treated with indicated compound(s) for 24h. *P<0.05 vs. DMSO control. #P<0.05 vs. IM. $P<0.05 vs. 4-AP. (D) Heatmap summary of K channel activity inhibition (synergy scores as per Fig. 4) in GIST-T1 treated with IM + 4-AP (N=3).
[0019] FIG. 7 shows VGKC-KIT Binding. Immunoblots showing levels of indicated VGKC subunits and KIT pulled down by IP with or without anti-KIT antibody vs. total lysate as input for IP.
[0020] FIG. 8A-E shows cell cycle regulation via cyclin B1 by K channel blockade in GIST cells. (A) Day 5 cell cycle progression images and pie graphs of T1-CellCycle reporter (using Incucyte Cell Cycle Lentivirus Reagent) with indicated treatment. Percent of population was labelled in pie graphs (top panels). Cell cycle analysis using flow cytometry after staining with propidium iodide. GIST-DKC cells were treated with IM (100 nM), 4-AP (2 mM), combo (IM 100 nM + 4-AP 2 mM) for 72 h. (bottom panel) (B) Venn diagram with protein counts labelled for decreased protein expression in T1 and 3 TKI-resistant cell lines treated with 4-AP (2.5 mM, 48 h) vs. respective vehicle controls. Cyclin B1 (indicated by the star) is the single molecule decreased by 4-AP in all 4 lines. (C-D) Immunoblots showing expression and phosphorylation levels of cyclin B1 (C) upon treating T1 with indicated compound(s); and (D) in T1-EV vs. both OE lines. (E) Kaplan-Meier analysis of event- free survival (EFS defined as recurrence, progression, or death) based on the level of CCNB1 (encoding cyclin B1) in 83 bRNAseq samples. Patients with >223 median expression value were considered high CCNB1 level.Attorney Docket No.00015-441WO1
[0021] FIG. 9A-D shows reproducible targeting of VGKCs is synergistic with imatinib in vivo. (A) Waterfall plot demonstrating percent change. Inset: Tumor changes per RECIST stratification [i.e., CR, Complete Response = 100% shrinkage; PR, Partial Response ≥ 30% shrinkage; SD, Stable Disease = 29% shrinkage to 19% growth; PD, Progressive Disease ≥ 20% growth]. *p-value<0.05 *p-value<0.005. (B) Mean percent tumor volume vs. controls (Day 0) after 11-day treatment (Imatinib 25 mg / kg and 4-AP 2 mg / kg; oral translated dose < FDA-approved human dose). *p-value<0.005 compared to Control, #p- value<0.005 compared to Imatinib, $p-value<0.005 compared to 4-AP (C) Combo group resulted in good histological response (grade 3 and grade 4) in more than 70% of tumors. Histologic response (HR) was graded by assessing the percentage of necrosis, myxoid degeneration and / or fibrosis follows: grade 1 (<10%), grade 2 (10–50%), grade 3 (50–90%) or grade 4 (>90%). (D) Evolution of the tumor volumes over 11^days of drug exposure in the KIT exon 11 mutant GIST PDXs. Data displayed as average relative tumor volume compared to baseline (IM 25 mg / kg & 4-AP 2 mg / kg; oral translated dose < FDA-approved human dose). Absolute tumor volume change in each mice between day 1 (D1) and day 11 (D11). Tumor weight after resection on D11. Proliferative activity. Combo-treated tumors of UZLX-GIST3KIT 11 showed decreased mitotic count and phospho-histone H3 positive cells. DETAILED DESCRIPTION
[0022] As used herein and in the appended claims, the singular forms "a,” "an,” and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a probe" includes a plurality of such cells and reference to "the cell" includes reference to one or more cells and equivalents thereof known to those skilled in the art, and so forth.
[0023] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although any methods and reagents similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, the exemplary methods and materials are now described.Attorney Docket No.00015-441WO1
[0024] All publications mentioned herein are incorporated herein by reference in full for the purpose of describing and disclosing the methodologies, which are described in the publications, which might be used in connection with the description herein. The publications discussed above and throughout the text are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior disclosure. Moreover, with respect to any term that is presented in one or more publications that is similar to, or identical with, a term that has been expressly defined in this disclosure, the definition of the term as expressly provided in this disclosure will control in all respects.
[0025] The terms "about" or "approximately" as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, are meant to encompass variations of and from the specified value, such as variations of + / -10% or less, +1-5% or less, + / -1% or less, and + / -0.1% or less of and from the specified value. It is to be understood that the value to which the modifier "about" or "approximately" refers is itself also specifically contemplated.
[0026] A "biological sample" includes sections of tissues such as biopsy and autopsy samples, and frozen sections taken for histologic purposes. Such samples include skin samples, samples of muscosal surfaces, blood and blood fractions or products (e.g., serum, plasma, platelets, red blood cells, and the like), sputum, lymph and tongue tissue, cultured cells, e.g., primary cultures, explants, and transformed cells, stool, urine, etc. A biological sample is typically obtained from a eukaryotic organism, most commonly a mammal such as a primate e.g., chimpanzee or human; cow; dog; cat; or a rodent, e.g., guinea pig, rat, mouse, or rabbit.
[0027] A "biopsy" refers to the process of removing a tissue sample for diagnostic or prognostic evaluation, and to the tissue specimen itself. Any biopsy technique known in the art can be applied to the diagnostic and prognostic methods of the disclosure. The biopsy technique applied will depend on the tissue type to be evaluated (e.g., skin, mucosal surface, etc.), the size and type ofAttorney Docket No.00015-441WO1 the tumor (e.g., solid or suspended, blood or ascites), among other factors. Representative biopsy techniques include, but are not limited to, excisional biopsy, incisional biopsy, needle biopsy, surgical biopsy. An "excisional biopsy" refers to the removal of an entire tumor mass with a small margin of normal tissue surrounding it. An "incisional biopsy" refers to the removal of a wedge of tissue that includes a cross-sectional diameter of the tumor. A diagnosis or prognosis made by endoscopy or fluoroscopy can require a "core-needle biopsy" of the tumor mass, or a "fine-needle aspiration biopsy" which generally contains a suspension of cells from within the tumor mass. Biopsy techniques are discussed, for example, in Harrison's Principles of Internal Medicine, Kasper, et al., eds., 16th ed., 2005, Chapter 70, and throughout Part V.
[0028] A biomarker refers to a detectable biological entity associated with a particular phenotype or risk of developing a particular phenotype. The biological entity can be a polypeptide or polynucleotide. A biomarker to be detected can be referred to as a target. For example, a target polynucleotide refers to a biomarker comprising a polynucleotide (e.g., an mRNA or cDNA) that is to be detected. In another example, a target polypeptide refers to a protein expressed (i.e., transcribed and translated) that is to be detected. A biomarker, as defined by the National Institutes of Health (NIH), refers to a molecular indicator of a specific biological property; a biochemical feature or facet that can be used to measure the progress of disease or the effects of treatment. A panel of biomarkers is a selection of at least two biomarkers. Biomarkers may be from a variety of classes of molecules.
[0029] Reference throughout this specification to "one embodiment", "an embodiment," "an exemplary embodiment," means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the invention. Thus, appearances of the phrases "in one embodiment," "in another embodiment," or "an exemplary embodiment" in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures or characteristics may be combinedAttorney Docket No.00015-441WO1 in any suitable manner, as would be apparent to a person skilled in the art from this disclosure, in one or more embodiments.
[0030] An oligonucleotide probe or primer refers to a nucleic acid molecule of between 8 and 2000 nucleotides in length, or is about 6 and 1000 nucleotides in length. More particularly, the length of these oligonucleotides can range from about 8, 10, 15, 20, or 30 to 100 nucleotides, but typically about 10 to 50 (e.g., 15 to 30 nucleotides). The appropriate length for oligonucleotides in assays of the disclosure under a particular set of conditions may be empirically determined by one of skill in the art.
[0031] Oligonucleotide primers and probes can be prepared by any suitable method, including, for example, cloning and restriction of appropriate sequences and direct chemical synthesis. The oligonucleotide primers and probes can contain conventional nucleotides, as well as any of a variety of analogs. For example, the term "nucleotide", as used herein, refers to a compound comprising a nucleotide base linked to the C-1' carbon of a sugar, such as ribose, arabinose, xylose, and pyranose, and sugar analogs thereof. The term nucleotide also encompasses nucleotide analogs. The sugar may be substituted or unsubstituted. Substituted ribose sugars include, but are not limited to, those riboses in which one or more of the carbon atoms, for example the 2'-carbon atom, is substituted with one or more of the same or different Cl, F, --R, -- OR, --NR or halogen groups, where each R is independently H, C-C alkyl or C-C aryl. Exemplary riboses include, but are not limited to, 2'-(C-C)alkoxyribose, 2'-(C-C )aryloxyribose, 2',3'- didehydroribose, 2'-deoxy-3'-haloribose, 2'-deoxy-3'-fluororibose, 2'-deoxy-3'-chlororibose, 2'-deoxy-3'-aminoribose, 2'-deoxy-3'-(C- C)alkylribose, 2'-deoxy-3'-(C-C)alkoxyribose and 2'-deoxy-3'-(C- C )aryloxyribose, ribose, 2'-deoxyribose, 2',3'-dideoxyribose, 2'- haloribose, 2'-fluororibose, 2'-chlororibose, and 2'-alkylribose, e.g., 2'-O-methyl, 4'-α-anomeric nucleotides, 1'-α-anomeric nucleotides, 2'-4'- and 3'-4'-linked and other "locked" or "LNA", bicyclic sugar modifications (see, e.g., PCT published application nos. WO 98 / 22489, WO 98 / 39352;, and WO 99 / 14226). Exemplary LNA sugar analogs within a polynucleotide include, but are not limited to, the structures: where B is any nucleotide base.Attorney Docket No.00015-441WO1
[0032] Modifications at the 2'- or 3'-position of ribose include, but are not limited to, hydrogen, hydroxy, methoxy, ethoxy, allyloxy, isopropoxy, butoxy, isobutoxy, methoxyethyl, alkoxy, phenoxy, azido, amino, alkylamino, fluoro, chloro and bromo. Nucleotides include, but are not limited to, the natural D optical isomer, as well as the L optical isomer forms (see, e.g., Garbesi (1993) Nucl. Acids Res. 21:4159-65; Fujimori (1990) J. Amer. Chem. Soc. 112:7435; Urata, (1993) Nucleic Acids Symposium Ser. No. 29:69- 70). When the nucleotide base is purine, e.g. A or G, the ribose sugar is attached to the N-position of the nucleotide base. When the nucleotide base is pyrimidine, e.g. C, T or U, the pentose sugar is attached to the N-position of the nucleotide base, except for pseudouridines, in which the pentose sugar is attached to the C position of the uracil nucleotide base (see, e.g., Kornberg and Baker, (1992) DNA Replication, 2 Ed., Freeman, San Francisco, CA.). The 3' end of the probe can be functionalized with a capture or detectable label to assist in detection of a target polynucleotide.
[0033] Any of the oligonucleotides or nucleic acids of the disclosure can be labeled by incorporating a detectable label measurable by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. For example, such labels can comprise radioactive substances (e.g., P, S, H, I), fluorescent dyes (e.g., 5-bromodesoxyuridin, fluorescein, acetylaminofluorene, digoxigenin), biotin, nanoparticles, and the like. Such oligonucleotides are typically labeled at their 3' and 5' ends.
[0034] A probe refers to a molecule which can detectably distinguish changes in gene expression or can distinguish between target molecules differing in structure. Detection can be accomplished in a variety of different ways depending on the type of probe used and the type of target molecule. Thus, for example, detection may be based on discrimination of activity levels of the target molecule, but typically is based on detection of specific binding. Examples of such specific binding include antibody binding and nucleic acid probe hybridization. Commercially available antibodies that bind to Kvβ1.1 are sold by, for example, Antibodies, Inc. (Davis, California)(see also, Cho et al., PNAS USA, 117(47):29937-29947, 2020). Thus, for example, probes can includeAttorney Docket No.00015-441WO1 antibodies and antibody fragments, and nucleic acid hybridization probes (including primers useful for polynucleotide amplification and / or detection). Thus, in one embodiment, the detection of the presence, absence or expression level of the at least one target polynucleotide involves contacting a sample with a probe, such as an oligonucleotide probe, where the probe hybridizes with a target polynucleotide in the biological sample containing a complementary sequence, where hybridization is carried out under selective hybridization conditions. Such an oligonucleotide probe can include one or more nucleic acid analogs, labels or other substituents or moieties so long as the base-pairing function is retained.
[0035] A reference or control population refers to a group of subjects or individuals who are predicted to be representative of the genetic variation found in the general population having a particular genotype or expression profile. Typically, the reference population represents the genetic variation in the population at a certainty level of at least 85%, typically at least 90%, least 95% and but commonly at least 99%.
[0036] By the term "tumor cell" is meant a component of a cell population characterized by inappropriate accumulation in a tissue. This inappropriate accumulation may be the result of a genetic or epigenetic variation that occurs in one or more cells of the cell population. This genetic or epigenetic variation causes the cells to grow faster, die slower, or differentiate slower than the surrounding, normal cells. The term "tumor cell" as used herein also encompasses cells that support the growth or survival of a malignant cell. Such supporting cells may include fibroblasts, vascular or lymphatic endothelial cells, inflammatory cells or co-expanded non- neoplastic cells that favor the growth or survival of the malignant cell. The term "tumor cell" is meant to include cancers of hematopoietic, epithelial, endothelial, or solid tissue origin. The term "tumor cell" is also meant to include cancer stem cells.
[0037] KIT is a cytokine receptor expressed on the surface of hematopoietic stem cells as well as other cell types. Altered forms of this receptor may be associated with some types of cancer. KIT is a receptor tyrosine kinase type III, which binds to stem cell factor, also known as "steel factor" or "c-kit ligand". When thisAttorney Docket No.00015-441WO1 receptor binds to stem cell factor (SCF) it forms a dimer that activates its intrinsic tyrosine kinase activity, that in turn phosphorylates and activates signal transduction molecules that propagate the signal in the cell. After activation, the receptor is ubiquitinated to mark it for transport to a lysosome and eventual destruction. Signaling through KIT plays a role in cell survival, proliferation, and differentiation. For instance, KIT signaling is required for melanocyte survival, and it is also involved in haematopoiesis and gametogenesis.
[0038] By "KIT tumor cell" is meant a cell expressing KIT associated with a tumor. By "KIT associated disease" or “KIT- associated cancer” is meant a disease that is characterized by increased KIT expression or aberrant KIT activity (e.g., KIT activation) in a variety of cell types, including but not limited to: mast cells, hematopoietic progenitor cells, melanocytes, germ cells, and / or gastrointestinal pacemaker cells. A KIT associated disease can arise from KIT stem cells. Examples of KIT associated diseases include but are not limited to: gastrointestinal stromal tumor (GIST), acute myelogenous leukemia, small-cell lung carcinoma, ovarian carcinoma, breast carcinoma, melanoma, neuroblastoma, myelodysplastic syndrome (MDS), myeloproliferative disease (MPD), aggressive systemic mastocytosis (ASM), hypereosinophilic syndrome (HES), dermatofibrosarcoma protuberans (DFSP), soft-tissue sarcomas of neuroectodermal origin, heptocullular carcinoma, and all neoplasms derived from KIT stem cells.
[0039] By definition a “potassium channel blocker” or “K channel blocker” is any agent that specifically and sterically inserts itself into (or otherwise deactivates) any of the several and growing classes of K channels. This includes both fast and slowly activating channels and both “voltage gated or non-gated” channels. Almost all channels for K are “gated” by the voltage across the cell membrane. When these channels are open, K tends to move from the cytoplasm into the extracellular fluid because it is about 100 times more concentrated inside than outside the cell. There are many known K channel blockers including reversible blockers (TEA) and some proteins (synthesized from snake venoms) that irreversibly block these channels. Potassium channel blockersAttorney Docket No.00015-441WO1 include substituted pyridines and, more particularly, amino- substituted pyridines. Suitable blocker for use herein include the fast potassium channel, type I, blocker 4-AP (4-aminopyridine) and its analog 3,4 di-aminopyridine.
[0040] Voltage-gated potassium channel (VGKC) subunit beta-1 is a protein that in humans is encoded by the KCNAB1 gene (aliases include Kvβ1.1, AKR6A3, KCNA1B, KV-BETA-1, Kvb1.3, hKvBeta3, hKvb3, potassium voltage-gated channel subfamily A member regulatory beta subunit 1, potassium voltage-gated channel subfamily A regulatory beta subunit 1). KCNAB1 coding sequence and protein sequences are known and include a number of variants as set forth in accession numbers: coding sequences- NM_001308217, NM_001308222, NM_003471, NM_172159, and NM_172160; protein sequences - NP_001295146, NP_001295151, NP_003462, NP_751891, and NP_751892; the sequences of each accession number are incorporated herein by reference for all purposes). Using the foregoing accessions numbers and the sequences associated therewith, probes, primers, antigenic epitopes can be designed and used for diagnostics using ordinary skill in the art.
[0041] VGKCs regulate many normal cellular functions and might also affect processes that are important to tumor development, such as growth, metastasis and division of cancer cells. Mutations in genes encoding VGKCs have been linked to epilepsy and other central nervous system disorders, but also regulate cell cycle progression, proliferation, and apoptosis, all of which are hallmarks of cancer growth. As described herein, research has identified Kβ1.1 as a positive selection cell surface biomarker that characterizes TKI- resistant GIST cells in vitro and in resected human tumors. For example, high Kvβ1.1 expression is a biomarker of IM resistance in GIST, and the VGKC complex is a novel drug target in GIST.
[0042] Kv or VGKC are heteromultimeric transmembrane complexes specific for selective flow of K ion gated by changes in the membrane potential. The channel complex is composed of α-subunits that form the ion conductance pore together with regulatory subunits that modulate channel activity. Regulatory subunits promote stability of the pore-forming α-subunits that maintain plasma membrane potential and cell volume. There are currently 12 known isoforms (Kv1–Kv12). VGKCs regulate many normal cellular functionsAttorney Docket No.00015-441WO1 and also affect processes that are important to tumor development, such as growth, metastasis and division of cancer cells. Mutations in genes encoding VGKCs have been linked to epilepsy and other central nervous system disorders, but also regulate cell proliferation and differentiation, migration, cell cycle progression, apoptosis, autophagy, angiogenesis, stem cell dynamics, carcinogenesis and apoptosis, all of which are hallmarks of cancer growth.
[0043] Dysregulated / altered expression of several members of VGKC effect pathogenesis and are reported in almost all types of cancer. In GIST Kv4.2 complex (DPP10, KCHIP4, KV4.2) seem predominantly expression (FIG. 3A) than other subtypes.
[0044] Very little research has examined the signaling pathways downstream of VGKC in cancer cells. In Leukemia cells, inhibition of VGKC channel can concurrently inhibit AKT, S6 and ERK1 / 2 and reinforces nuclear down-regulation of MYC, a master regulator of cell cycle entry and proliferation in cancer. In TNBC cells, inhibition of VGKC showed anti-metastatic phenotype by inhibiting cell migration via cadherin-11 and the MAPK pathway as well as via promoting Cav-1 dephosphorylation. VGKCs have been reported to be located in nucleus where it regulates nuclear membrane potential and activation of transcription factors, such as phosphorylated CREB and c-Fos. Regulation of cell cycle by VGKCs principally occur through regulation of cell volume, membrane polarization / potential. The change in membrane polarization which is hyperpolarized at G1 / S transition and depolarized towards mitosis with changes in cell volume is maintained through changing K concentration in the cells.
[0045] The VGKCs function primarily to regulate the membrane potential. This in turn regulates many normal cellular functions and might also affect processes that are important to tumor development, like growth and division of cancer cells. The disclosure shows that Kvβ1.1 can be used as a marker that identifies drug-resistant GIST cells both in experimental cell cultures and in resected human tumors. This finding has led to the conclusion that VGKCs can be a drug target on GIST cells. VGKC can be targeted with pharmacological activation / inhibition of specific isoforms (Dendrotoxin-K, DPO-1, Margatoxin, astemizole, E-4031, NS1643 etc.) and / or with non-Attorney Docket No.00015-441WO1 specific channel blockers (4-Aminopyridine, tetraethylammonium etc.). Inhibiting / blocking VGKC can induce the inhibition of cell proliferation, migration / invasion, and induce apoptosis in various cancer types.
[0046] Gastrointestinal stromal tumors (GIST) are most often driven by oncogenic KIT mutations and are currently treated with tyrosine kinase inhibitors (TKIs) such as imatinib (IM) that target constitutively active KIT. Other similar drugs the inhibit tyrosine kinases and kinases include Sunitinib, Regorafenib, Ripretinib, Avapritinib, Bezuclastinib, and IDRX-42, each of which can be used in the methods of the disclosure alone or in combination. However, these drugs are at best only modestly efficacious. Even in the treatment naive setting, ≤10% patients have complete pathological responses, indicating that TKIs do not kill every tumor cell despite the absence of secondary resistance mutations in KIT. Data demonstrate that KIT mutant GIST contain subpopulations of IM- resistant “persister” tumor cells that lack KIT.
[0047] Despite the discovery that tyrosine kinase inhibition treats GIST, clinical trials show that 40% of primary localized GIST develop recurrence within 5 years. In clinical trials, high-risk patients with completely resected GIST begin developing recurrences between 8 to 12 months after stopping adjuvant IM, leading to near convergence of all recurrence-free survival curves irrespective of the length of IM therapy. The later lines of FDA-approved anti-GIST TKIs (i.e., sunitinib, regorafenib, and ripretinib) can provide additional survival benefit, but disease control is short-lived.
[0048] Most GIST have overexpression of oncogenic KIT. However, GIST may possess tumor cells lacking KIT (KIT cells) that have cancer stem cell (CSC) properties and are resistant to anti-KIT tyrosine kinase inhibitors (e.g., IM-imatinib, SU-sunitinib, RIP- ripretinib). Although all anti-KIT TKIs hit the “right” target in KIT-expressing GIST cells, they do not target KIT cells, a cellular reservoir for disease persistence and recurrence. Moreover, IM treatment can induce expression of such persister / recurrence genes, which make cells TKI-resistant.
[0049] The disclosure demonstrates that these persister cells express Kvβ1.1, the protein product of the KCNAB1 gene. Kvβ1.1Attorney Docket No.00015-441WO1 regulates channel activity of pore-forming α-subunits in voltage- gated potassium channels (VGKCs) that conduct K ions, and thus regulate plasma membrane potential and cell volume. K ions also participate in cancer biologic processes, including cell cycle regulation, cell migration, and cell invasion. FDA-approved in 2010 to treat multiple sclerosis, 4-AP (fampridine) non-specifically blocks these VGKCs. The disclosure demonstrate that: (1) Kvβ1.1 is a novel selection biomarker that characterizes TKI-resistant GIST cells in vitro, as well as in treated and untreated human GISTs; (2) IM treatment is linked to clonal selection and upregulation of KCNAB1 mRNA; (3) KCNAB1 overexpression increases IM resistance in vitro; and (4) 4-AP synergizes with IM and other TKIs to better treat KIT mutant GIST vs. TKIs alone.
[0050] The disclosure demonstrates that high Kvβ1.1 protein (or high KCNAB1 mRNA) expression unequivocally identifies TKI-resistant persister cells in KIT mutant GIST; and combined with KIT targeting by TKIs, the VGKC complex is a therapeutic target that can eradicate both TKI-sensitive and TKI-resistant tumor cells in KIT mutant GIST. Thus, the disclosure provides a positive selection markers and therapeutic targets in KIT cells.
[0051] Disclosed herein is a method to predict and treat drug- resistance and treatment responses for GIST. The predictive biomarker methodologies described herein, risk stratify GIST. This method can be applied in other cancers including, but not limited to, ovarian, breast (including HER2 and metastatic), colorectal, colon, renal, rectal, pancreatic, prostate, stomach, gastrointestinal, gastric, stomach, esophageal, bile duct, lung (including small cell and non-small cell lung tumors; adenocarcinoma of the lung and squamous carcinoma of the lung), liver, epidermoid tumors, squamous tumors such as head and neck tumors, epithelial squamous cell cancer, thyroid, cervical, neuroendocrine tumors of the digestive system, neuroendocrine tumors, cancer of the peritoneum, hepatocellular cancer, hepatoblastoma, HPCR, glioblastoma, bladder cancer, hepatoma, endometrial or uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, bone cancer, soft tissue sarcoma (including embryonal and alveolar rhabdomyosarcoma, GIST, alveolar soft part sarcoma and clear cellAttorney Docket No.00015-441WO1 sarcoma), cholangiocarcinoma, bile cancer, gallbladder carcinoma, myeloma, vulval cancer, hepatic carcinoma, anal carcinoma, penile carcinoma, retinal, hematopoietic cancer, androgen-dependent tumors, androgen-independent tumors, Other examples include Kaposi's sarcoma, synovial sarcoma, vasoactive intestinal peptide secreting tumor, CNS neoplasms, neuroblastomas, capillary hemangioblastomas, meningiomas, and cerebral metastases, melanoma, rhabdomyosarcoma, glioblastoma, including glioblastoma multiforme, EMB, RMS, ALV, medulloblastoma, ependymoma, Wilm's cancer, Ewing's cancer, osteosarcoma, PNT, rhabdoid, rhabdomyosarcoma, retinoblastoma, adrenal cortical cancer, adrenal cancer, and leiomyosarcoma.
[0052] The disclosure provides a positive selection marker, Kvβ1.1, of KIT population that are intrinsically resistant to IM (or other TKI) treatment. In human GIST, the disclosure demonstrates that treatment with IM raises the Kvβ1.1 population within tumors which negatively impacts the IM treatment. Hence, Kvβ1.1 is a proxy for IM resistance in tumors specifically, and other cancers resistance to tyrosine kinase inhibitors.
[0053] Thus, the disclosure provides, in one embodiment, a method of diagnosis of tyrosine kinase inhibitor resistant GIST. In one embodiment, the disclosure provides a flow cytometry method for diagnosis. As discussed, the increase in KITKvβ1.1 population increases IM resistance in GIST cells. Thus, the measurement of KIT Kvβ1.1 population within a human tumor determines the sensitivity to TKI therapy (e.g., IM sensitivity). For example, a tissue biopsy followed by flow cytometric-based estimation of the proportion of KITKvβ1.1 and KITKvβ1.1 populations can predict whether the GIST will respond to imatinib treatment or not. This helps with staging the tumor, or it might aid in focusing treatments on drugs that might work, as opposed to drugs that have little chance of working. Estimation of higher KITKvβ1.1 population than KITKvβ1.1 population in human GIST could represent an important method to diagnose Imatinib resistance.
[0054] The disclosure provides a method of determining whether a subject will respond to be resistant to TKI therapy comprising measuring the level of Kvβ1.1 expression in a target cell. In one embodiment, the target cell is a cancer cell. In a furtherAttorney Docket No.00015-441WO1 embodiment, the cancer cell is a gastrointestinal cell. In still a further embodiment, the cancer cell expresses KIT. In another embodiment, the cancer cell expresses KIT at a low level. In one embodiment, the method comprises measuring the level of KCNAB1 mRNA in a cancer cell. In another embodiment, the method comprises measuring the level of Kvβ1.1 protein in a cell.
[0055] Methods known in the art can be used to quantitatively measure the amount of mRNA transcribed by cells present in a sample. Examples of such methods include quantitative polymerase chain reaction (PCR), northern and southern blots. PCR allows for the detection and measurement of very low quantities of mRNA using an amplification process. Genes may either be up regulated or down regulated in any particular biological state, and hence mRNA levels shift accordingly.
[0056] In one embodiment, a method for expression profiling comprises measuring KCNAB1 mRNA levels in a biological sample from a subject suspected of having a KIT-associated cancer, e.g., GIST. Such a method can include the use of primers, probes, enzymes, and other reagents for the preparation, detection, and quantitation of KCNAB1 mRNA (e.g., by PCR, by Northern blot and the like). Primers and probes useful for measuring KCNAB1 expression can be designed based upon the known KCNAB1 sequence as set forth in accession number NM_001308217, NM_001308222, NM_003471, NM_172159, and NM_172160. In addition to the primers and probes, reagents such as a dinucleotide triphosphate mixture having all four dinucleotide triphosphates (e.g., dATP, dGTP, dCTP, and dTTP), a reverse transcriptase enzyme, and a thermostable DNA polymerase are typically used for RT-PCR. Additionally buffers, inhibitors and activators can also be used for the RT-PCR process. Once a cDNA, for example, has been sufficiently amplified to a specified end point, the cDNA sample can be prepared for detection and quantitation. Though a number of detection schemes are contemplated, as will be discussed in more detail below, one method contemplated for detection of polynucleotides is fluorescence spectroscopy, and therefore labels suited to fluorescence spectroscopy are desirable for labeling polynucleotides. One example of such a fluorescent label is SYBR Green, though numerous related fluorescent moleculesAttorney Docket No.00015-441WO1 are known including, without limitation, DAPI, Cy3, Cy3.5, Cy5, CyS.5, Cy7, umbelliferone, fluorescein, fluorescein isothiocyanate (FITC), rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin.
[0057] Oligonucleotide primers and probes can be immobilized on a solid support for detection of KCNAB1 expression. Solid supports are known to those skilled in the art and include the walls of wells of a reaction tray, test tubes, polystyrene beads, magnetic beads, nitrocellulose strips, membranes, microparticles such as latex particles, glass and the like. The solid support is not critical and can be selected by one skilled in the art. Thus, latex particles, microparticles, magnetic or non-magnetic beads, membranes, plastic tubes, walls of microtiter wells, glass or silicon chips and the like are all suitable examples. Suitable methods for immobilizing oligonucleotides on a solid phase include ionic, hydrophobic, covalent interactions and the like. The solid support can be chosen for its intrinsic ability to attract and immobilize the capture reagent. The oligonucleotide probes or primers can be attached to or immobilized on a solid support individually or in groups.
[0058] A substrate comprising a plurality of oligonucleotide primers or probes may be used either for detecting or amplifying targeted sequences (e.g., KCNAB1 nucleic acids). The oligonucleotide probes and primers of the disclosure can be attached in contiguous regions or at random locations on the solid support. Alternatively the oligonucleotides may be attached in an ordered array wherein each oligonucleotide is attached to a distinct region of the solid support which does not overlap with the attachment site of any other oligonucleotide. Typically, such oligonucleotide arrays are "addressable" such that distinct locations are recorded and can be accessed as part of an assay procedure. The knowledge of the location of oligonucleotides on an array make "addressable" arrays useful in hybridization assays. For example, the oligonucleotide probes can be used in an oligonucleotide chip. These chip arrays can be produced using mechanical synthesis methods or light directed synthesis methods which incorporate a combination of photolithographic methods and solid phase oligonucleotide synthesis. An array of oligonucleotides can also be used to determine theAttorney Docket No.00015-441WO1 identity of the target, measure its amount, and detect differences between the target and a reference wild-type sequence.
[0059] Hybridization of an oligonucleotide probe to a target polynucleotide may be performed with both entities in solution, or such hybridization may be performed when either the oligonucleotide or the target polynucleotide is covalently or noncovalently affixed to a solid support. Attachment may be mediated, for example, by antibody-antigen interactions, poly-L-Lys, streptavidin or avidin- biotin, salt bridges, hydrophobic interactions, chemical linkages, UV cross-linking baking, etc. Oligonucleotides may be synthesized directly on the solid support or attached to the solid support subsequent to synthesis. Solid-supports suitable for use in detection methods of the disclosure include substrates made of silicon, glass, plastic, paper and the like, which may be formed, for example, into wells (as in 96-well plates), slides, sheets, membranes, fibers, chips, dishes, and beads. The solid support may be treated, coated or derivatized to facilitate the immobilization of the allele-specific oligonucleotide or target nucleic acid.
[0060] In one aspect, a sandwich hybridization assay comprises separating the variant and / or wild-type target nucleic acid biomarker in a sample using a common capture oligonucleotide immobilized on a solid support and then contact with specific probes useful for detecting the variant and wild-type nucleic acids. The oligonucleotide probes are typically tagged with a detectable label.
[0061] Hybridization assays based on oligonucleotide arrays rely on the differences in hybridization stability of short oligonucleotides to perfectly matched and mismatched target variants. Each DNA chip can contain thousands to millions of individual synthetic DNA probes arranged in a grid-like pattern and miniaturized to the size of a dime or smaller. Such a chip may comprise oligonucleotides representative of both a wild-type and variant sequences.
[0062] Oligonucleotides can be designed to specifically hybridize to a target region of a KCNAB1 polynucleotide. As used herein, specific hybridization means the oligonucleotide forms an anti-parallel double-stranded structure with the target region under certain hybridizing conditions, while failing to form such aAttorney Docket No.00015-441WO1 structure when incubated with a different target polynucleotide or another region in the polynucleotide or with a polynucleotide lacking the desired locus under the same hybridizing conditions. Typically, the oligonucleotide specifically hybridizes to the target region under conventional high stringency conditions.
[0063] A nucleic acid molecule such as an oligonucleotide or polynucleotide is said to be a "perfect" or "complete" complement of another nucleic acid molecule if every nucleotide of one of the molecules is complementary to the nucleotide at the corresponding position of the other molecule. A nucleic acid molecule is "substantially complementary" to another molecule if it hybridizes to that molecule with sufficient stability to remain in a duplex form under conventional low-stringency conditions. Conventional hybridization conditions are described, for example, in Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd ed., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989), and in Haymes et al., Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, D.C. (1985). While perfectly complementary oligonucleotides are used in most assays for detecting target polynucleotides or polymorphisms, departures from complete complementarity are contemplated where such departures do not prevent the molecule from specifically hybridizing to the target region. For example, an oligonucleotide primer may have a non- complementary fragment at its 5' or 3' end, with the remainder of the primer being complementary to the target region. Those of skill in the art are familiar with parameters that affect hybridization; such as temperature, probe or primer length and composition, buffer composition and salt concentration and can readily adjust these parameters to achieve specific hybridization of a nucleic acid to a target sequence.
[0064] A variety of hybridization conditions may be used in the disclosure, including high, moderate and low stringency conditions; see for example Maniatis et al., Molecular Cloning: A Laboratory Manual, 2d Edition, 1989, and Short Protocols in Molecular Biology, ed. Ausubel, et al., hereby incorporated by reference. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higherAttorney Docket No.00015-441WO1 temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays" (1993). Generally, stringent conditions are selected to be about 5- 10°C lower than the thermal melting point (T) for the specific sequence at a defined ionic strength and pH. The T is the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the polyadenylated mRNA target sequence at equilibrium (as the target sequences are present in excess, at T, 50% of the probes are occupied at equilibrium). Stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of helix destabilizing agents such as formamide. The hybridization conditions may also vary when a non-ionic backbone, i.e., PNA is used, as is known in the art. In addition, cross- linking agents may be added after target binding to cross-link, i.e., covalently attach, the two strands of the hybridization complex.
[0065] Methods and compositions of the disclosure are useful for diagnosing or determining whether a subject is a candidate for TKI therapy or whether there is a population of KIT cells that would be resistant to TKI therapy. Such tests can be performed using DNA or RNA samples collected from blood, cells, tissue scrapings or other cellular materials, and can be performed by a variety of methods including, but not limited to, hybridization with biomarker-specific probes, mass spectrometry or nucleic acid sequencing. Diagnostic tests may involve a panel of one or more markers, often on a solid support, or using PCR techniques, which enables the simultaneous determination of more than one indication, diagnosis or therapy.
[0066] Quantitative PCR and digital PCR can be used to measure the level of a polynucleotide in a sample. Digital Polymerase ChainAttorney Docket No.00015-441WO1 Reaction (digital PCR, dPCR or dePCR) can be used to directly quantify and clonally amplify nucleic acids including DNA, cDNA or RNA. Digital PCR amplifies nucleic acids by temperature cycling of a nucleic acid molecule with a DNA polymerase. The reaction is typically carried out in the dispersed phase of an emulsion capturing each individual nucleic acid molecule present in a sample within many separate chambers or regions prior to PCR amplification. A count of chambers containing detectable levels of PCR end-product is a direct measure of the absolute nucleic acids quantity.
[0067] Quantitative polymerase chain reaction (qPCR) is a modification of the polymerase chain reaction and real-time quantitative PCR are useful for measuring the amount of a polynucleotide after each cycle of PCR by use of fluorescent markers or other detectable labels. Quantitative PCR methods use the addition of a competitor RNA (for reverse-transcriptase PCR) or DNA in serial dilutions or co-amplification of an internal control to ensure that the amplification is stopped while in the exponential growth phase. Modifications of PCR and PCR techniques are routine in the art and there are commercially available kits useful for PCR amplification.
[0068] A detectable label may be a radioactive label or may be a luminescent, fluorescent of enzyme label. Indirect detection processes typically comprise probes covalently labeled with a hapten or ligand such as digoxigenin (DIG) or biotin. For example, following a hybridization step, a target-probe duplex is detected by an antibody- or streptavidin-enzyme complex. Enzymes commonly used in DNA diagnostics are horseradish peroxidase and alkaline phosphatase. Direct detection methods include the use of fluorophor- labeled oligonucleotides, lanthanide chelate-labeled oligonucleotides or oligonucleotide-enzyme conjugates. Examples of fluorophor labels are fluorescein, rhodamine and phthalocyanine dyes.
[0069] Examples of detection modes contemplated for the disclosed methods include, but are not limited to, spectroscopic techniques, such as fluorescence and UV-Vis spectroscopy, scintillation counting, and mass spectroscopy. Complementary to these modes of detection, examples of labels for the purpose ofAttorney Docket No.00015-441WO1 detection and quantitation used in these methods include, but are not limited to, chromophoric labels, scintillation labels, and mass labels. The expression levels of polynucleotides and polypeptides measured using these methods may be normalized to a control established for the purpose of the targeted determination.
[0070] Label detection will be based upon the type of label used in the particular assay. Such detection methods are known in the art. For example, radioisotope detection can be performed by autoradiography, scintillation counting or phosphor imaging. For hapten or biotin labels, detection is with an antibody or streptavidin bound to a reporter enzyme such as horseradish peroxidase or alkaline phosphatase, which is then detected by enzymatic means. For fluorophor or lanthanide-chelate labels, fluorescent signals may be measured with spectrofluorimeters with or without time-resolved mode or using automated microtitre plate readers. With enzyme labels, detection is by color or dye deposition (p-nitropheny phosphate or 5-bromo-4-chloro-3-indolyl phosphate / nitroblue tetrazolium for alkaline phosphatase and 3,3'- diaminobenzidine-NiCl for horseradish peroxidase), fluorescence (e.g., 4-methyl umbelliferyl phosphate for alkaline phosphatase) or chemiluminescence (the alkaline phosphatase dioxetane substrates LumiPhos 530 from Lumigen Inc., Detroit Mich. or AMPPD and CSPD from Tropix, Inc.). Chemiluminescent detection may be carried out with X- ray or polaroid film or by using single photon counting luminometers.
[0071] In another embodiment, expression levels of Kvβ1.1 proteins can be measured and quantitated using techniques known in the art including, for example, Western blots, ELISA assays and the like. The term "polypeptide" or "polypeptides" is used interchangeably with the term "protein" or "proteins" herein.
[0072] In another embodiment, a method for protein expression profiling comprises using an antibody that specifically binds to a Kvβ1.1 protein for measuring levels from a biological sample. In one embodiment, the method an antibody can be bound to a solid support. The method for protein expression profiling may use a second antibody having specificity to some portion of an anti-Kvβ1.1 antibody. Such a second antibody may be detectably labeled withAttorney Docket No.00015-441WO1 molecules useful for detection and quantitation of the bound anti- Kvβ1.1 antibody.
[0073] The disclosure also contemplates the use of immunoassay techniques for measurement of a polypeptide biomarker e.g., Kvβ1.1 and / or Kvβ1.1 and KIT. For example, a method based on flow cytometry can be used to determine a KITKvβ1.1 cell population quantitatively as shown in FIG. 5A. Stained cells are analyzed with any standard flowcytometry. No specific flow cytometer is required. Proportion of KITKvβ1.1 and KITKvβ1.1 cells among live cells (Calcein Violet-AM positive staining with no staining of Propidium iodide) is calculated.
[0074] Methods and kits for the polynucleotide and polypeptide expression profiling for are also contemplated as part of the disclosure. In one embodiment, a kit for gene expression profiling comprises the reagents and instructions necessary for the gene expression profiling of Kvβ1.1, or Kvβ1.1 and KIT. Thus, for example, the reagents may include primers, enzymes, and other reagents for the preparation, detection, and quantitation of KCNAB1 polynucleotides. In addition to primers, reagents such as dinucleotide triphosphate comprising dinucleotide triphosphates (e.g., dATP, dGTP, dCTP, and dTTP), reverse transcriptase, and a thermostable DNA polymerase. Additionally buffers, inhibitors and activators used for the RT-PCR process are suitable reagents for inclusion in the kit embodiment. One method contemplated for detection of polynucleotides is fluorescence spectroscopy using fluorescent moieties or labels that are suited to fluorescence spectroscopy are desirable for labeling polynucleotides and may also be included in reagents of the kit embodiment.
[0075] In one embodiment, the disclosure provides a kit useful for identifying biomarkers indicative of GIST TKI-resistant cells. For example, the kit of the disclosure can comprise one or more oligonucleotides designed for identifying KCNAB1. In another embodiment, the kit further comprises a manual with instructions for performing one or more reactions on a human nucleic acid sample to identify biomarkers in the sample.
[0076] The oligonucleotides in a kit of the disclosure may also be immobilized on or synthesized on a solid surface such as aAttorney Docket No.00015-441WO1 microchip, bead, or glass slide. Such immobilized oligonucleotides may be used in a variety of detection assays, including but not limited to, probe hybridization and polymerase extension assays. Immobilized oligonucleotides useful in practicing the disclosure may comprise an ordered array of oligonucleotides designed to rapidly screen a nucleic acid sample.
[0077] Kits of the disclosure may also contain other components such as hybridization buffer (e.g., where the oligonucleotide probes) or dideoxynucleotide triphosphates (ddNTPs; e.g., for primer extension). Kits may also include detection reagents, such as biotin- or fluorescent-tagged oligonucleotides or ddNTPs and / or an enzyme-labeled antibody and one or more substrates that generate a detectable signal when acted on by the enzyme. It is also contemplated that the above described methods and compositions of the disclosure may be utilized in combination with other biomarker techniques.
[0078] In another embodiment, a kit for Kvβ1.1 protein expression profiling comprises the reagents and instructions necessary for protein expression profiling. Thus, in this embodiment, the kit for protein expression profiling includes supplying an antibody for measuring Kvβ1.1 polypeptide levels from a biological sample. One embodiment contemplated for such a panel includes an antibody bound to a solid support. Additionally, the reagents included with the kit may use a second antibody having specificity to some portion of the anti-Kvβ1.1 antibody. Such a second antibody may be labeled with molecules useful for detection and quantitation of the bound polypeptides.
[0079] Integrated systems can be envisaged when microfluidic systems are used. These systems comprise a pattern of microchannels designed onto a glass, silicon, quartz, or plastic wafer included on a microchip. The movements of the samples are controlled by electric, electroosmotic or hydrostatic forces applied across different areas of the microchip. The microfluidic system may integrate nucleic acid amplification, microsequencing, capillary electrophoresis and a detection method such as laser-induced fluorescence detection.Attorney Docket No.00015-441WO1
[0080] It is also contemplated that the gene expression profile may be transmitted to a remote location for analysis. For example, changes in a detectable signal related to gene expression from a first time and a second time are communicated to a remote location for analysis.
[0081] The digital representation of the detectable signal is transmittable over any number of media. For example, such digital data can be transmitted over the Internet in encrypted or in publicly available form. The data can be transmitted over phone lines, fiber optic cables or various air-wave frequencies. The data are then analyzed by a central processing unit at a remote site, and / or archived for compilation of a data set that could be mined to determine, for example, changes with respect to historical mean "normal" values of a genetic expression profile of a subject.
[0082] Embodiments of the disclosure include systems (e.g., internet based systems), particularly computer systems which store and manipulate the data corresponding to the detectable signal obtained an expression profile. As used herein, "a computer system" refers to the hardware components, software components, and data storage components used to analyze the digital representative of an expression profile or plurality of profiles. The computer system typically includes a processor for processing, accessing and manipulating the data. The processor can be any well-known type of central processing unit.
[0083] Typically the computer system is a general purpose system that comprises the processor and one or more internal data storage components for storing data, and one or more data retrieving devices for retrieving the data stored on the data storage components. A skilled artisan can readily appreciate that any one of the currently available computer systems are suitable.
[0084] In one particular embodiment, the computer system includes a processor connected to a bus which is connected to a main memory (preferably implemented as RAM) and one or more internal data storage devices, such as a hard drive and / or other computer readable media having data recorded thereon. In some embodiments, the computer system further includes one or more data retrieving device for reading the data stored on the internal data storage devices.Attorney Docket No.00015-441WO1
[0085] Based upon the link between TKI-resistant cancers and Kvβ1.1 expression a pharmacologic approaches was evaluated to target VGKC complex in TKI-sensitive vs. TKI-resistant cells using IM treatment in combination with 4-aminopyridine (4AP or fampridine, which is FDA-approved for treating multiple sclerosis that blocks VGKCs). The combination treatments was analyzed in TKI-sensitive and TKI-resistant lines. As demonstrated herein the combination therapy showed synergy, based upon a score >10 in four different modeling tools. The disclosure demonstrates that, e.g., 4AP, is ubiquitously synergistic with IM, sunitnib (SU) and ripretinib (RIP) in killing TKI-sensitive and TKI-resistant cells. Moreover, in the presence of 4AP, even dual TKI-resistant cells become sensitive to IM again.
[0086] The disclosure provides methods of treating GIST and TKI- resistant GIST or KIT-associated cancers. In one embodiment, a diagnostic assay as described herein is used to measure Kvβ1.1 expression in determining a therapy. In a further embodiment, the disclosure provides a method of treating a subject comprising measuring Kvβ1.1 expression in a sample from a subject having a KIT- associated cancer (e.g., GIST), wherein if Kvβ1.1 expression is high, the subject is treated with a potassium channel inhibitor prior to, simultaneously with or after treatment with a TKI therapy. In another embodiment, a subject having a KIT-associated cancer (e.g., GIST) is treated without prior Kvβ1.1 expression diagnosis with a combination of a potassium channel inhibitor and a TKI.
[0087] The disclosure demonstrates that a combination therapy of VGKC inhibitor and TKI inhibitors provide a synergistic effect to GIST therapy. Accordingly, the disclosure provides a method for treating a patient with tyrosine kinase inhibitor resistant cancer, the method comprising administering to the subject a therapeutically effective amount of a tyrosine kinase inhibitor (TKI) in combination with a voltage-gated potassium channel (VGKC) inhibitor. In one embodiment, the tyrosine kinase inhibitor is imatinib (IM). In another embodiment, the voltage-gated potassium channel (VGKC) inhibitor is 4AP (fampridine). In still another embodiment, the TKI and VGKC inhibitor are administered simultaneously. In another embodiment, the TKI is administered prior to, concurrently with or after the VGKC inhibitor.Attorney Docket No.00015-441WO1
[0088] The disclosure provides a method for treating a subject with tyrosine kinase inhibitor resistant GIST, the method comprising administering to the patient therapeutically effective amount of a tyrosine kinase inhibitor (TKI) in combination with a voltage-gated potassium channel (VGKC) inhibitor. In one embodiment, the tyrosine kinase inhibitor is imatinib (IM). In another embodiment, the voltage-gated potassium channel (VGKC) inhibitor is 4AP (fampridine). In still another embodiment, the TKI and VGKC inhibitor are administered simultaneously. In another embodiment, the TKI is administered prior to, concurrently with or after the VGKC inhibitor.
[0089] The disclosure also provides a pharmaceutical composition comprising a tyrosine kinase inhibitor (TKI) and a voltage gated potassium channel (VGKC) inhibitor. In one embodiment, the TKI is imatinib (IM). In another or further embodiment, the VGKC inhibitor is 4AP (fampridine).
[0090] The disclosure also provides a pharmaceutical composition comprising imatinib and 4AP (fampridine) and optionally one or more cell-cycle inhibitors. For example, suitable cell-cycle inhibitors that can be used include, but are not limited to, CDK4 / 6 inhibitor selected from palbociclib, ribociclib, trilaciclib, abemaciclib and any combination thereof.
[0091] The disclosure also shows that expression of DPP10, another regulatory subunit of VGKC like Kvβ1.1 can regulate the proliferation, TKI sensitivity, and K channel activity of GIST cells. The disclosure shows that Kv4.2-KChIP4-DPP10 form a VGKC complex in GIST; TKI sensitive {KIT+Kvβ1.1 (KIT )} cells have DPP10 regulated VGKC whereas TKI resistant {KIT-Kvβ1.1 (KIT )} cells have Kvβ1.1 regulated VGKC. Thus, targeting VGKC with 4-AP, can thereby target both TKI sensitive as well as TKI resistant population in GIST and / or cancer therapy. Cyclin B1 is downstream of VGKC signaling and / or expression of cyclin B1 is directly / indirectly modulated through VGKC. Targeting cyclin B1 in GIST is an attractive therapeutic strategy. KIT may regulate the activity of VGKCs via direct phosphorylation.
[0092] Since Kvβ1.1, Kv4.2, KChIPs and DPP10 have been reported to possess multiple phosphorylation sites (DPP10 alone has 14 pTyrAttorney Docket No.00015-441WO1 sites per NetPhos 3.1 database), it was hypothesized that KIT may regulate the activity of VGKCs via direct / indirect phosphorylation.
[0093] To verify the findings that DPP10 expression is expressed in most of the population of GIST that are represented by KITKvβ1.1 (KIT ) cells. Flow cytometric sorting of human GIST sample into KITKvβ1.1 (KIT ) and KITKvβ1.1 (KIT ) populations based on surface expression of KIT and Kvβ1.1 was performed. The DPP10 mRNA expression between the populations were measured. IM-resistant KIT tumor cells have lower expression of DPP10 mRNA. Thus, it was concluded that TKI sensitive (KITKvβ1.1 (KIT )) cells have DPP10 regulated VGKC whereas TKI resistant (KITKvβ1.1 (KIT )) cells have Kvβ1.1 regulated VGKC. Targeting VGKC with 4-AP can thereby target TKI sensitive as well as TKI resistant population in GIST cells.
[0094] In preclinical studies, TKIs combined with 4AP work in cell killing synergistically, both in vitro and in vivo in GIST transgenic mice. The combination of IM and 4AP significantly reduces tumor mass (FIG. 4D). The results indicated that targeting GIST with a combination of KIT-dependent (IM) and KIT-independent (VGKC blockade, for example by using 4AP) approaches have synergistic effects to enhance treatment response rates.
[0095] The disclosure provides for a combined therapy that was shown to have efficacy based upon preliminary clinical data. More specifically it was found that a combination of medications from different drug classes provided synergistic results in the treatment of tyrosine kinase inhibitor (TKI) resistant cancers (e.g., gastrointestinal stromal tumors). In one embodiment, the combined therapy comprises a first drug comprising a tyrosine kinase inhibitor and a second drug comprising a voltage gated potassium channel inhibitor. The first drug and second drug may be administered together (simultaneously) or the first drug may be administered prior to or after the second drug. In one embodiment, the subject is identified as having a TKI resistant cancer. In one embodiment, the TKI inhibitor is administered at a dose of about 50 mg / day to about 800 mg / day (e.g., 50, 100, 200, 400, 500, 600, or 800 mg / day or any value there between) and the VGKC inhibitor is administered at a dose of about 2 mg / day to about 40 mg / day (or any value there between).Attorney Docket No.00015-441WO1
[0096] The disclosure provides compositions for treating a TKI resistant cancer such as GIST. The compositions of the disclosure comprise a first medication comprising a TKI and a second medication comprising a voltage gated potassium channel inhibitor. In a further embodiment, the composition of the disclosure comprises a first medication and a second medication in a therapeutic ratio (e.g., TKI:VGKCi of 2:1 to 20:1).
[0097] The disclosure provides a composition which comprises a first medication of a TKI and a second medication of a VGKC inhibitor. In another embodiment, a composition disclosed herein comprises a TKI at a dose of about 50 mg / day (in one or more doses) to about 800 mg / day, or a range that includes or is between any two of the foregoing doses. In another or further embodiment a VGKC inhibitor (e.g., 4AP) can be dosed at 2-40 mg / day in one or more divided doses.
[0098] The disclosure further provides that a composition disclosed herein is formulated as a pharmaceutical composition in a single unit dosage form, or a multi-unit dosage form. Such pharmaceutical compositions may comprise physiologically acceptable surface-active agents, carriers, diluents, excipients, smoothing agents, suspension agents, film forming substances, and coating assistants, or combinations thereof. Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, 18 Ed., Mack Publishing Co., Easton, Pa. (1990), which is incorporated herein by reference in its entirety. Preservatives, stabilizers, dyes, sweeteners, fragrances, flavoring agents, and the like may be provided in the pharmaceutical composition. For example, sodium benzoate, ascorbic acid and esters of p-hydroxybenzoic acid may be added as preservatives. In addition, antioxidants and suspending agents may be used. In various embodiments, alcohols, esters, sulfated aliphatic alcohols, and the like may be used as surface active agents; sucrose, glucose, lactose, starch, crystallized cellulose, mannitol, light anhydrous silicate, magnesium aluminate, magnesium metasilicate aluminate, synthetic aluminum silicate, calcium carbonate, sodium acid carbonate, calcium hydrogen phosphate, calcium carboxymethyl cellulose, and the likeAttorney Docket No.00015-441WO1 may be used as excipients; magnesium stearate, talc, hardened oil and the like may be used as smoothing agents; coconut oil, olive oil, sesame oil, peanut oil, soya may be used as suspension agents or lubricants; cellulose acetate phthalate as a derivative of a carbohydrate such as cellulose or sugar, or methyl acetate- methacrylate copolymer as a derivative of polyvinyl may be used as suspension agents; and plasticizers such as ester phthalates and the like may be used as suspension agents.
[0099] The term “carrier” defines a chemical compound that facilitates the incorporation of medications disclosed herein into cells or tissues. For example, dimethyl sulfoxide (DMSO) is a commonly utilized carrier as it facilitates the uptake of many organic compounds into the cells or tissues of an organism.
[0100] The term “diluent” defines a chemical compound that will dissolve the medications of interest as well as stabilize the biologically active form of the medication. Salts dissolved in buffered solutions are utilized as diluents in the art. One commonly used buffered solution is phosphate buffered saline because it mimics the salt conditions of human blood. Since buffer salts can control the pH of a solution at low concentrations, a buffered diluent rarely modifies the biological activity of a medication.
[0101] The term “physiologically acceptable” defines a carrier or diluent that does not abrogate the biological activity and properties of the medications disclosed herein.
[0102] Techniques for formulation and administration of the compositions described herein may be found in “Remington's Pharmaceutical Sciences,” Mack Publishing Co., Easton, Pa., 18th edition, 1990.
[0103] Suitable routes of administration of the pharmaceutical composition may, for example, include oral, rectal, transmucosal, topical, or intestinal administration; parenteral delivery, including intramuscular, subcutaneous, intravenous, intramedullary injections, as well as intrathecal, direct intraventricular, intraperitoneal, intranasal, or intraocular injections. The pharmaceutical composition can also be administered in sustained or controlled release dosage forms, including depot injections, osmotic pumps, pills, transdermal (including electrotransport) patches, andAttorney Docket No.00015-441WO1 the like, for prolonged and / or timed, pulsed administration at a predetermined rate.
[0104] The pharmaceutical compositions of the disclosure may be manufactured in a manner that is itself known, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or tableting processes.
[0105] Pharmaceutical compositions for use as described herein thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active medications into preparations which can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen. Any of the well-known techniques, carriers, and excipients may be used as suitable and as understood in the art; e.g., in Remington's Pharmaceutical Sciences, above.
[0106] Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions. Suitable excipients are, for example, water, saline, dextrose, mannitol, lactose, lecithin, albumin, sodium glutamate, cysteine hydrochloride, and the like. In addition, if desired, the injectable pharmaceutical compositions may contain minor amounts of nontoxic auxiliary substances, such as wetting agents, pH buffering agents, and the like. Physiologically compatible buffers include, but are not limited to, Hanks's solution, Ringer's solution, or physiological saline buffer. If desired, absorption enhancing preparations (for example, liposomes), may be utilized.
[0107] For transmucosal administration, penetrants appropriate to the barrier to be permeated may be used in the formulation.
[0108] Pharmaceutical formulations for parenteral administration, e.g., by bolus injection or continuous infusion, include aqueous solutions of the active medications in water-soluble form. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or other organic oils such as soybean, grapefruit or almondAttorney Docket No.00015-441WO1 oils, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents that increase the solubility of the compounds to allow for the preparation of highly concentrated solutions. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents. Alternatively, the medications may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
[0109] For oral administration, the medications can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the compounds of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated. Pharmaceutical preparations for oral use can be obtained by combining the active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross- linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, Carbopol gel, polyethylene glycol, and / orAttorney Docket No.00015-441WO1 titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses. For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, Carbopol gel, polyethylene glycol, and / or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
[0110] Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and / or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the medications may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for such administration.
[0111] For buccal administration, the pharmaceutical compositions may take the form of tablets or lozenges formulated in conventional manner.
[0112] For administration by inhalation, the compositions for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichloro- difluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in an inhaler or insulator may be formulated containing a powder mix of the medications and a suitable powder base such as lactose or starch.
[0113] Further disclosed herein are various pharmaceutical compositions well known in the pharmaceutical art for uses thatAttorney Docket No.00015-441WO1 include intraocular, intranasal, and intra-auricular delivery. Suitable penetrants for these uses are generally known in the art. Pharmaceutical compositions for intraocular delivery include aqueous ophthalmic solutions of the active compounds in water-soluble form, such as eyedrops, or in gellan gum (Shedden et al., Clin. Ther., 23(3):440-50 (2001)) or hydrogels (Mayer et al., Opthalmologica, 210(2):101-3 (1996)); ophthalmic ointments; ophthalmic suspensions, such as microparticulates, drug-containing small polymeric particles that are suspended in a liquid carrier medium (Joshi, A., J. Ocil. Pharmacol., 10(1):29-45 (1994)), lipid-soluble formulations (Alm et al., Prog. Clin. Biol. Res., 312:447-58 (1989)), and microspheres (Mordenti, Toxicol. Sci., 52(1):101-6 (1999)); and ocular inserts. All of the above-mentioned references, are incorporated herein by reference in their entireties. Such suitable pharmaceutical formulations are most often and preferably formulated to be sterile, isotonic and buffered for stability and comfort. Pharmaceutical compositions for intranasal delivery may also include drops and sprays often prepared to simulate in many respects nasal secretions to ensure maintenance of normal ciliary action. As disclosed in Remington's Pharmaceutical Sciences, 18 Ed., Mack Publishing Co., Easton, Pa. (1990), which is incorporated herein by reference in its entirety, and well-known to those skilled in the art, suitable formulations are most often and preferably isotonic, slightly buffered to maintain a pH of 5.5-6.5, and commonly include antimicrobial preservatives and appropriate drug stabilizers. Pharmaceutical formulations for intra-auricular delivery include suspensions and ointments for topical application in the ear. Common solvents for such formulations include glycerin and water.
[0114] The pharmaceutical composition may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
[0115] In addition to the pharmaceutical formulations described previously, the medications may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the compounds may beAttorney Docket No.00015-441WO1 formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
[0116] For hydrophobic compounds, a suitable pharmaceutical carrier may be a cosolvent system comprising benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. A common cosolvent system used is the VPD co-solvent system, which is a solution of 3% w / v benzyl alcohol, 8% w / v of the nonpolar surfactant Polysorbate 80™, and 65% w / v polyethylene glycol 300, made up to volume in absolute ethanol. Naturally, the proportions of a co-solvent system may be varied considerably without destroying its solubility and toxicity characteristics. Furthermore, the identity of the co-solvent components may be varied: for example, other low-toxicity nonpolar surfactants may be used instead of POLYSORBATE 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
[0117] Alternatively, other delivery systems for hydrophobic pharmaceutical compounds may be employed. Liposomes and emulsions are well known examples of delivery vehicles or carriers for hydrophobic drugs. Certain organic solvents such as dimethyl sulfoxide also may be employed, although usually at the cost of greater toxicity. Additionally, the compounds may be delivered using a sustained-release system, such as semipermeable matrices of solid hydrophobic polymers containing the therapeutic agent. Various sustained-release materials have been established and are well known by those skilled in the art. Sustained-release capsules may, depending on their chemical nature, release the compounds for a few weeks up to over 100 days. Depending on the chemical nature and the biological stability of the therapeutic reagent, additional strategies for protein stabilization may be employed.
[0118] Agents intended to be administered intracellularly may be administered using techniques well known to those of ordinary skill in the art. For example, such agents may be encapsulated into liposomes. All molecules present in an aqueous solution at the timeAttorney Docket No.00015-441WO1 of liposome formation are incorporated into the aqueous interior. The liposomal contents are both protected from the external micro- environment and, because liposomes fuse with cell membranes, are efficiently delivered into the cell cytoplasm. The liposome may be coated with a tissue-specific antibody. The liposomes will be targeted to and taken up selectively by the desired organ. Alternatively, small hydrophobic organic molecules may be directly administered intracellularly.
[0119] The following examples are intended to illustrate but not limit the disclosure. While they are typical of those that might be used, other procedures known to those skilled in the art may alternatively be used. EXAMPLES Example 1: Assessment of Drug Targets in GIST
[0120] Tumor samples: Patient tumor samples were either fresh resected or frozen. Fresh tumor samples can be stored in tissue storage solution (tested up to 48 h) (MACS Tissue storage solution, catalog number 130-100-008, Miltenyi Biotec, Bergisch Gladbach, North Rhine-Westphalia, Germany). Tumors can be viably frozen in freezing medium (Cryostor CS10 cell cryopreservation media, Sigma- Aldrich Co, St. louis, MO, USA). To recover frozen tumors, the frozen vials were first thawed rapidly in a 37°C water bath followed by 2-3 washes with RPMI 1640 medium (Sigma-Aldrich): added RPMI 1640 slowly (drop-by-drop) to the thawed vials, mixed gently by pipetting, and removed all solution.
[0121] Homogenization: Homogenization of tumor was performed using Tissue Dissociation Kit (human, catalog number 130-095-929, Miltenyi Biotec). The gentleMACS Dissociator (catalog number 130- 093-235, Miltenyi Biotec) was used during the process with the following steps: (1) prepare enzyme cocktail by mixing three components: enzyme H, enzyme R, and enzyme A in RPMI 1640 medium as described in the kit into a gentleMACS C tube. (2) Cut the tissue into small pieces of 2-4 mm and transfer the pieces into the gentleMACS C tube containing the enzyme cocktail. (3) Attach the gentleMACS C tube upside down onto the sleeve of the gentleMACS Dissociator. (4) Start the dissociation by running the gentleMACS program h_tumor_01. (5) Detach C tube from the dissociator andAttorney Docket No.00015-441WO1 incubate for 30 minutes at 37C under continuous end-to-end mixing after termination of the program. (6) Repeat the dissociation process with the gentleMACS program h_tumor_01. (7) (optional - if the dissociation is not sufficient upon visual inspection) repeat the incubation for 30 minutes at 37C with continuous mixing followed by the dissociation process using the h_tumor_01 program. (8) Resuspend sample and apply the cell suspension to a cell strainer (70 or 100 μm) placed on a 50 mL tube. (9) Wash the strainer with 20 mL of RPMI 1640 medium. (10) Collect cell pellet after centrifugation at 300Xg for 7 min. (11) Remove erythrocytes (RBC) using BD Pharm Lyse™ Lysing Buffer (catalog number 555899, BD Biosciences, NJ, USA) by suspending cells in lysis buffer and incubating at room temperature for 15 minutes. (12) Collect cell pellet after centrifugation at 300Xg for 7 minutes. (13) Resuspend cells with 5% BSA in PBS and obtain final cell counts.
[0122] Cell staining: Cells were stained with APC anti-human CD117 (c-kit) Antibody (catalog number 313206, Biolegend, San Diego, CA, USA), PE anti-human Kvβ1.1 Antibody (catalog number sc-373986, Santa Cruz Biotechnology, Inc., Dallas, Texas, USA), Calcein Violet- AM (catalog number 425203, Biolegend), and Propidium iodide (catalog number 11348639001, Roche, Basel, Switzerland). Cells were stained with 5 μL per million cells in 100 μL staining volume (with 5% BSA in PBS solution) of APC anti-human CD117 (c-kit) Antibody and PE anti-human Kvβ1.1 Antibody. Calcein Violet-AM was added at final staining concentration of 0.01 μM. Cells were stained at room temperature for 30 minutes. Then cells were centrifuged at 2000 rpm for 2 minutes and washed with 5% BSA in PBS solution. Washing step was repeated again. After final washing cell solution was transferred into Polystyrene Test Tube containing 1 μL (0.5mg / mL) Propidium iodide per million cells in 100 μL 5% BSA in PBS solution.
[0123] Flow cytometry analysis: Stained cells can be analyzed with any standard flowcytometry. No specific flow cytometer is required. Proportion of KITKvβ1.1 and KITKvβ1.1 cells among live cells (Calcein Violet-AM positive staining with no staining of Propidium iodide) was calculated.
[0124] Total RNA from tissue biopsies was prepared using the RNeasy Kit (Qiagen, Hilden, Germany) according to the manufacturer’sAttorney Docket No.00015-441WO1 instructions. Reverse transcription was performed with iScript cDNA synthesis kit (Bio-Rad, Hercules, CA) and quantitative real-time PCR was conducted with iTaq universal SYBR Green supermix (Bio-Rad). Samples were run on a CFX96 real-time system (Bio-Rad) with the following PCR parameters: denaturing at 95C for 30 seconds, followed by 40 cycles of 10-second denaturation at 95C, 30-second annealing at the optimal primer annealing temperatures, and 10- second extension at 72C. The primers are as following: KCNAB1-Forward CATGGAAGCCTATTCTGTAGCAA (SEQ ID NO:1 KCNAB1-Reverse CGCCAACACCTATTTTGTGGTAG (SEQ ID NO:2) ACTB-Forward AATGTGGCCGAGGACTTTGATTGC (SEQ ID NO:3) ACTB-Reverse AGGATGGCAAGGGACTTCCTGTAA (SEQ ID NO:4)
[0125] Biostatistical Analysis. In vitro and ex vivo experiments were performed in replicates (N=3-6), and outcomes were compared using 2-sided t-testing. Continuous data was compared between groups using the Mann-Whitney test. Categorical variables are compared using the χ or Fisher’s exact tests. Paired comparison of continuous data is performed using the Wilcoxon signed ranks test.
[0126] Clinical Studies. Clinically relevant doses in humans where imatinib (IM) was administered was at a dose of 400 mg / day. When considering the average weight of a human to be 80 kg, this dose translates to 5 mg / kg / day. Applying dose translation methods from humans to animal studies, this dose translates to 61.5 mg / kg / day. Typical treatment is at the dose of 45 mg / kg / day. Similarly, during treatment of multiple sclerosis, 4AP / fampridine was prescribed as 10 mg, twice daily (i.e., 20 mg / day). If the average weight of a human is considered to be 80 kg, a reasonable dose would thus be 0.25 mg / kg / day, which translates to 3.1 mg / kg / day. Typical treatment for mice is at a dose of 1-2 mg / kg / day. Overdose of 4AP / fampridine is known to cause toxicity.
[0127] FIG. 1A-E shows results using Kvβ1.1 as a marker of KIT tumor cells in GIST, where it was seen exclusively in Cluster 7 KIT (FIG. 1A). Gene enrichment scores showed an inverse correlation between KCNAB1 and KIT mRNA in GIST (FIG. 1B). Notably, KCNAB1 mRNA was significantly higher in sorted KIT cells compared to KIT cells as determined from GIST-T1 (mKIT exon 11) and GIST882 (mKIT exon 13) by RT-PCR (FIG. 1C). KCNAB1 mRNA wasAttorney Docket No.00015-441WO1 increased upon IM treatment as shown in FIG. 1D. Kvβ1.1, which is a marker of KIT tumor cells, have higher viability when treated with both how and high doses of IM (FIG. 1E).
[0128] Results are consistent with a model for Kvβ1.1 activity as shown in FIG. 2A. T1 cells, which are a cancer cell line derived from a gastrointestinal stromal tumor, were engineered with an empty vector (EV), or was made to overexpress (OE) Kvβ1.1, or was knocked sown (KD) for Kvβ1.1. See FIG. 2B. Effects of Kvβ1.1 on proliferation activity is shown in FIG. 2C and 2D, which show that Kvβ1.1 overexpression increases cell proliferation.
[0129] Expression levels of GIST marker genes and VGKC subunits by snRNAseq in GIST samples is shown in FIG. 3A. The results shown that KIT, ANO1, DPP10, KCND2 (encode Kv4.2) and KCNIP4 (encode KCHIP4) were the most highly expressed. FIG. 3B shows levels of the Kv4.2 and KchIP4 subunits by immunoblot in immunoprecipitates pulled down with an antibody against DPP10, which is a auxiliary subunit of Kv4.2. Comparison of overexpression of DPP10 and Kvβ1.1 in T1 cells shows that their overexpression increases colony formation and proliferation rate (FIG. 3C and FIG. 3D). When treated with IM, sunitinib(SU), ripretinib (RIP), or 4-aminopuridine (4-AP), the results show an effect on viability (FIG. 3E).
[0130] When DPP10-OE or Kvβ1.1 OE cells were cultured with IM, 4-AP or the combo IM and 4-AP, results show a synergistic activity with the combination of IM and 4-AP (FIG. 4A-4C). This result is consistent with an observation that targeting VGKC is synergistic with IM. In tumor-bearing mice, administration of the combo also showed a substantial improvement on tumor burden compared to either IM or 4-AP alone with a showing that the combination significantly reduced tumor mass (FIG. 4D). This is consistent with a mechanism that the combination supports higher apoptosis compared to the single agents (FIG. 4E).
[0131] FIG. 5A shows that Kvβ1.1 is expressed in human GIST, and shows the composition of KITKvβ and KITKvβ populations. With response to treatment by IM as determined by mRECIST v1.1, KCNAB1 mRNA expression levels were inversely correlated (FIG. 5B). Treatment with IM increases KITKvβ populations in IM treated KIT-Attorney Docket No.00015-441WO1 mutant primary localized GIST (exon 11), as shown in FIG. 5C and FIG. 5D.
[0132] FIG. 6A-6D show K+ channel activity in T1 cells that are overexpressed for DPP10 or Kvβ1.1. The results show that K+ channel activity was synergistically inhibited by IM + 4-AP in GIST cells.
[0133] To assess VGKC and Kit binding, levels of VGKC subunits pulled down with a c-KIT antibody were determined by immunoblot and shown in FIG. 7.
[0134] T1 cells were engineered with a cell cycle reporter (Incubye Cell Cycle Lentivirus Reagent) and cell cycle progression was monitored in the presence of IM, 4-AP or the combination (FIG. 8A). Cyclin B1 was shown to be decreased by 4-AP in indicated cell lines (FIG. 8B). Cyclin B1 is downstream VGKC signaling and plays a role in G2 / M phase. FIGs. 8C-D show expression and phosphorylation levels of cyclin B1 in various T1 cells treated with IM, 4-AP or the Combo or in cells overexpressing DPP10 or Kvβ1.1. FIG. 8E shows event-free survival in human patients based on the levels of CCNB1, which encodes cyclin B1. Example 2: GIST patient-derived xenograft (PDX) biobank models
[0135] To provide further evidence of robust changes in tumor size, a GIST patient-derived xenograft (PDX) biobank with 12 different PDX models (i.e., primary vs. metastatic; treatment naïve vs. previously treated; gastric vs. small bowel vs. metastatic; and KIT exon 9 vs. 11 vs. 13 vs. 17 or PDGFRA D842V) were studied. Drug testing in these GIST PDX models can provide a preclinical rationale and supportive evidence for clinical trials. To support the study, the KIT exon 11 mutant primary gastric GIST PDX model (UZLX-GIST3X) was used to independently assess the efficacy of the combination of imatinib and 4-AP. As opposed to the model that was performed with IP injections, the UZLX-GIST3X in vivo PDX experiments were conducted using oral administration of both IM and 4-AP treatment because these better model the oral administration to humans.
[0136] As shown in FIG. 9, the combination of IM + 4AP (Combo) worked so well that the tumors treated with the Combo had shrunk by 67% relative to the initial tumor volume whereas imatinib resulted in 39% tumor volume reduction. Ultimately, at 11 days post-treatment (FIG. 9A-B), there was a mean shrinkage of 75% in the Combo groupAttorney Docket No.00015-441WO1 vs. 45% shrinkage in the imatinib group (P=0.005). Meanwhile, the untreated controls had growth by a mean of 32% and the 4-AP alone by 68%. Finally, two complete responses (CR) were observed in the Combo group and none in the imatinib group (FIG. 9C).
[0137] In clinical practice and per published studies, it is known that ~70–85% of patients with KIT exon 11 mutations have tumor shrinkage of ≥30% with imatinib (i.e., the objective response rate or ORR) (Table 2). Typically, the average tumor shrinkage using RECIST is 40-50% in these ~70–85% of patients that respond. Thus, the mean tumor shrinkage of 45% (FIG. 9B) with 71% of mice having an objective response (FIG. 9) in these PDXs is perfectly aligned with clinical expectations.
[0138] Based upon the observed mean tumor shrinkage (75%; FIG. 9) and ORR (100%; FIG. 9), Artificial intelligence (AI) was used to create a hypothetical model to estimate patient outcomes under improved response conditions (i.e., average tumor shrinkage increased to 70–80%). Assuming that deeper tumor shrinkage will correlate with better outcomes (e.g., survival and resectability), the benefits would be substantial in several clinical and practical ways as shown in the Table 1.
[0139] Table 1: Hypothetical projections for combination therapy versus single agent imatinib based upon AI analysis of the literature with ChatGPT. Metric Currently Improved Projected Expected Projections Increases ete, , .
[0140] A number of embodiments have been described herein. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of this disclosure. Accordingly, other embodiments are within the scope of the following claims.
Claims
Attorney Docket No.00015-441WO1 What is claimed is:
1. A method of treating a tyrosine kinase inhibitor-resistant cancer in a subject, comprising: administering a voltage gated potassium channel (VGKC) inhibitor and a tyrosine kinase inhibitor (TKI) to the subject.
2. The method of claim 1, wherein the VGKC inhibitor and TKI are administered simultaneously.
3. The method of claim 1, wherein the VGKC inhibitor is administered prior to the TKI.
4. The method of claim 1, wherein the VGKC inhibitor is administered after the TKI.
5. The method of any one of the foregoing claims, wherein the VGKC inhibitor is 4-aminopyridine (4-AP) or an analog thereof.
6. The method of claim 5, wherein the 4-AP analog is 3,4 di- aminopyridine.
7. The method of any one of claims 1-4, wherein the TKI is selected from the group consisting of imatinib (IM), Sunitinib, Regorafenib, Ripretinib, Avapritinib, Bezuclastinib, and IDRX-42.
8. The method of claim 1, wherein the TKI resistant cancer is a KIT-associated cancer.
9. The method of claim 8, wherein KIT-associated cancer comprises increased KIT expression or aberrant KIT activity.
10. The method of claim 1 or 8, wherein the TKI resistant or KIT- associated cancer is selected from gastrointestinal stromal tumor (GIST), acute myelogenous leukemia, small-cell lung carcinoma, ovarian carcinoma, breast carcinoma, melanoma, neuroblastoma, myelodysplastic syndrome (MDS), myeloproliferative disease (MPD), aggressive systemic mastocytosis (ASM), hypereosinophilic syndromeAttorney Docket No.00015-441WO1 (HES), dermatofibrosarcoma protuberans (DFSP), soft-tissue sarcomas of neuroectodermal origin, and heptocellular carcinoma.
11. A method for treating a subject with tyrosine kinase inhibitor resistant gastrointestinal stromal tumor (GIST), the method comprising administering to the subject a therapeutically effective amount of a tyrosine kinase inhibitor (TKI) and a voltage-gated potassium channel (VGKC) inhibitor.
12. The method of claim 11, wherein the tyrosine kinase inhibitor is selected from imatinib (IM), Sunitinib, Regorafenib, Ripretinib, Avapritinib, Bezuclastinib, and IDRX-42.
13. The method of claim 11, wherein the voltage-gated potassium channel (VGKC) inhibitor is 4-aminopyridine (4-AP) or an analog thereof.
14. The method of claim 13, wherein the 4-AP analog is 3,4 di- aminopyridine.
15. The method of claim 11, wherein the TKI and VGKC inhibitor are administered simultaneously.
16. The method of claim 11, wherein the TKI is administered prior to or after the VGKC inhibitor.
17. A method comprising: collecting a tumor cell sample from a subject; and measuring a KITKvβ1.1 cell population in the tumor cell sample, wherein the presence of KITKvβ1.1 cells is indicative that the subject has a tyrosine kinase inhibitor (TKI) resistant cancer.
18. The method of claim 17, further comprising administering a voltage gated potassium channel (VGKC) inhibitor and a TKI inhibitor to the subject when the sample comprises KITKvβ1.1 cells.Attorney Docket No.00015-441WO1 19. The method of claim 18, wherein the TKI is selected from imatinib (IM), Sunitinib, Regorafenib, Ripretinib, Avapritinib, Bezuclastinib, and IDRX-42.
20. The method of claim 18, wherein the voltage-gated potassium channel (VGKC) inhibitor is 4-aminopyridine (4-AP) or an analog thereof.
21. The method of claim 20, wherein the 4-AP analog is 3,4 di- aminopyridine.
22. The method of claim 17, wherein the tumor sample is a gastrointestinal stromal cell tumor (GIST).
23. A method for predicting treatment response to tyrosine kinase inhibitor (TKI) therapy, the method comprising: collecting a tumor cell sample from a pretreatment subject; measuring the level of expression of KCNAB1 mRNA or Kvβ1.1 protein in the tumor cell sample; wherein an elevated amount of KCNAB1 mRNA or Kvβ1.1 protein in the tumor cell sample is indicative of a TKI resistant tumor.
24. The method of claim 23, wherein the TKI is selected from imatinib (IM), Sunitinib, Regorafenib, Ripretinib, Avapritinib, Bezuclastinib, and IDRX-42.
25. The method of claim 23, wherein the tumor cell sample is obtained from a gastrointestinal stromal tumor (GIST).
26. A method to predict whether a cancer will respond to tyrosine kinase inhibitor (TKI) treatment comprising obtaining a tissue biopsies followed by flow cytometry analysis to estimate the proportion of KITKvβ1.1 and KITKvβ1.1 cell populations in the tumor, wherein the presence of KITKvβ1.1 in the tissue biopsy is indicative of a TKI resistant cancer.
27. The method of claim 26, wherein the method further comprisesAttorney Docket No.00015-441WO1 measuring mRNA expression of KCNAB1.
28. The method of claim 26, wherein the cancer is a gastrointestinal stromal tumor (GIST).
29. A pharmaceutical composition comprising a tyrosine kinase inhibitor (TKI) and a voltage gated potassium channel (VGKC) inhibitor.
30. The composition of claim 29, wherein the TKI is selected from imatinib (IM), Sunitinib, Regorafenib, Ripretinib, Avapritinib, Bezuclastinib, and IDRX-42.
31. The composition of claim 29, wherein the voltage-gated potassium channel (VGKC) inhibitor is 4-aminopyridine (4-AP) or an analog thereof.
32. The method of claim 31, wherein the 4-AP analog is 3,4 di- aminopyridine.
33. A pharmaceutical composition comprising imatinib and 4- aminopyridine (4-AP) or an analog thereof.
34. The method of claim 33, wherein the 4-AP analog is 3,4 di- aminopyridine.