Combination of USP48 inhibitors and DNMT1 inhibitors for use in cancer therapy

Abstract

The present disclosure provides methods of treating acute myeloid leukemia by administering an effective amount of a DNMT1 inhibitor, or a pharmaceutically acceptable salt thereof, and an USP48 inhibitor, or a pharmaceutically acceptable salt thereof.

Description

DFCI IP No. 3546.W01WOCOMBINATION OF USP48 INHIBITORS AND DNMT1 INHIBITORS FOR USE IN CANCER THERAPYGOVERNMENT INTERESTS

[0001] This invention was made with government support under R35 CA283977 awarded by the National Institutes of Health. The government has certain rights in the invention.FIELD

[0002] The present disclosure is in the field of treating patients with AML. The present disclosure is in the field of a new treatment for AML by combining DNMT1 inhibitors with a reduction of USP48 activity.BACKGROUND

[0003] The DNA methyltransferase (DNMT) family encompasses a group of DNA-modifying enzymes which catalyze the transfer of a methyl group to DNA and are essential to epigenetic gene regulation. DNMT activity is highly regulated with functions including DNA repair, cell cycle regulation, gene silencing, transcriptional activations and post-transcriptional regulations. DNA (cytosine-5-)-m ethyltransferase 1 (DNMT1) is considered as the key maintenance methyltransferase in mammals and is the most abundant in cells. DNMT1 provides instruction for making DNA methyltransferase 1 which is involved in DNA methylation. DNA methylation is important in many cellular functions including gene silencing, genomic imprinting, X-chromosome inactivation, and transposable element suppression. DNMT1 is also known as ADCADN, ATM, CXXC9, HSN1E, MCMT, and m.Hsal.

[0004] Disruptions in DNA methylation patterns can lead to several human diseases and cancers. Therefore, DNMTs are therapeutic targets in cancer and other disease states. DNMT1 aberrations are implicated in many disorders including lung, gastric, breast, pancreatic, prostate, and colorectal cancers. Additionally, myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML) have been noted as expressing deregulated DNMT1 activity.

[0005] Specifically, DNMT1 has been implicated in silencing tumor suppressor genes via methylation of CpG sites. Inhibition of DNMTs reduces the levels of DNA methylation and therefore re-activates tumor suppressor genes. Therefore, DNMT1 inhibitors (DNMTli) or hypomethylating agents (HMA) are highly sought after treatment options for disorders linked to DNMT1 aberrations.DFCI IP No. 3546.W01WOHMA treatment is an especially critical option for patients with AML and MDS that are not eligible for more intensive chemotherapy such as older adult patients.

[0006] DNMT1 is a well validated clinical target with the use of small molecule HMAs. In particular, decitabine and azacitidine are both approved for clinical use for the treatment of myelodysplastic syndrome and acute myeloid leukemia. Unfortunately, HMA monotherapy only achieves low response rates in patients with AML and is not a curative treatment as resistance to these treatments is thought to be inevitable.

[0007] The impact of clonal heterogeneity on disease behavior in AML is not well understood and drug sensitivities are consistently assessed for treatment optimization. Sequencing technologies can reveal a number of molecular abnormalities which contribute to pathogenesis. Consequently, approved targeted therapies, in combination with standard of care HMA monotherapy, have been developed to exploit molecular vulnerabilities required for AML cell survival. Some of these targeted therapies include BCL-2, FLT3, and IDH inhibitors.

[0008] Combination therapies with DNMT1 inhibitors have proven successful in relapsed or refractory AML. Notably, the BCL-2 inhibitor ventoclax in combination with azacitidine has been used for treatment of AML with modest improvement of overall survival and response rate. Despite these advancements, intrinsic and acquired mechanisms of venetoclax resistance in AML are prevalent.

[0009] DNMT is a well validated target for clinical therapy as seen with monotherapy treatments utilizing HMAs and in targeted combination therapies such as with venetoclax. Therefore, combination therapies utilizing small molecule DNMT1 inhibitors and targeting sensitizers specific to AML will enhance effectiveness of treatment in patients with AML. The prevalence of cancer coupled with the variable effectiveness and resistances to current treatments for cancer necessitate that more treatment options be available to patients.SUMMARY

[0010] The present disclosure provides a method of treating cancer comprising the administration to a patient in need thereof an effective amount of a USP48 inhibitor or a pharmaceutically acceptable salt thereof, and an effective amount of a DNMT1 inhibitor, or a pharmaceutically acceptable salt thereof. In a preferred embodiment, the DNMT1 inhibitor is selected from GSK-3685032, decitabine, and azacitidine, or a pharmaceutically acceptable salt thereof. In a more preferred embodiment, the DNMT1 inhibitor is decitabine or azacitidine. In a preferred embodiment, the USP48 inhibitor isDFCI IP No. 3546.W01WO selected from WH 9943-119C, XL_10320_054A, and ED_11370_017, or a pharmaceutically acceptable salt thereof.

[0011] The present disclosure provides a method of treating acute myeloid leukemia (AML) comprising the administration to a patient in need thereof an effective amount of a USP48 inhibitor or a pharmaceutically acceptable salt thereof, and an effective amount of a DNMT1 inhibitor, or a pharmaceutically acceptable salt thereof. In a preferred embodiment, the DNMT1 inhibitor is selected from GSK-3685032, decitabine, and azacitidine, or a pharmaceutically acceptable salt thereof. In a more preferred embodiment, the DNMT1 inhibitor is decitabine or azacitidine. In a preferred embodiment, the USP48 inhibitor is selected from WH 9943-119C, XL_10320_054A, and ED_11370_017, or a pharmaceutically acceptable salt thereof.

[0012] The present disclosure provides a method of treating myelodysplastic syndrome (MDS) comprising the administration to a patient in need thereof an effective amount of a USP48 inhibitor or a pharmaceutically acceptable salt thereof, and an effective amount of a DNMT1 inhibitor, or a pharmaceutically acceptable salt thereof. In a preferred embodiment, theDNMTl inhibitor is selected from GSK-3685032, decitabine, and azacitidine, or a pharmaceutically acceptable salt thereof. In a more preferred embodiment, the DNMT1 inhibitor is decitabine or azacitidine. In a preferred embodiment, the USP48 inhibitor is selected from WH 9943-119C, XL_10320_054A, and ED_11370_017, or a pharmaceutically acceptable salt thereof.

[0013] The present disclosure provides a method of treating AML in a patient in need thereof, the method comprising administering an effective amount of a means of inhibiting DNMT1 and a means of inhibiting USP48.

[0014] The present disclosure provides a method of treating MDS in a patient in need thereof, the method comprising administering an effective amount of a means of inhibiting DNMT1 and a means of inhibiting USP48.

[0015] The present disclosure provides a method of sensitizing cancer cells to treatment by DNMT1 inhibitors comprising reducing activity of USP48. In some embodiments, the activity of USP48 is reduced via an USP48 inhibitor. In a preferred embodiment, the DNMT1 inhibitor is selected from decitabine, azacitidine, and GSK-3685032. In a more preferred embodiment, the DNMT1 inhibitor is decitabine or azacitidine.

[0016] The present disclosure provides a pharmaceutical composition comprising decitabine or azacitidine, or a pharmaceutically acceptable salt thereof, and an USP48 inhibitor, or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable carriers,DFCI IP No. 3546.W01WO diluents, or excipients. In a preferred embodiment, the USP48 inhibitor is selected from a group comprising WH_9943-119C, XL_10320_054A, or ED_11370 017, or a pharmaceutically acceptable salt thereof. In a particular embodiment, the composition further comprised one or more other therapeutic agents.BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 shows USP48 as a top sensitizer for hypomethylating agents in genome wide CRISPR Cas9 screen. A scatterplot shows the log2 fold-change (LFC) of sgRNA abundance on the x-axis and average p-value on the y-axis in A) decitabine (DAC), B) azacitidine (AZA) and C) GSK3685032-treated cells compared to DMSO control cells. The scores of all sgRNAs targeting the same gene were averaged and shown as one data point. USP48 is highlighted in black.

[0018] Figure 2 shows that USP48 loss selectively synergizes with hypomethylating agents A) Cells were cultured for 72 hours with doxycycline (200ng / ml) to induce the USP48 knockout (KO). Western blot analysis of USP48 for KO validation is shown; actin served as a loading control. Dose response curve for decitabine (DAC), azacitidine (AZA) and GSK-385032 for MV4-11 non-target (sgNT, black), non-induced (dark gray, dashed line) and induced (light gray) sgUSP48 cells measured after 96 h (n=3). B) Dose response curve for drugs not involved in DNMT1 inhibition, cytarabine (AraC), doxorubicin, SN-38 and talazoparib show no enhanced response in MV4-11 sgUSP48 cells. MV4-11 non-target (sgNT, black), non-induced (dark gray, dashed line) and induced (light gray) sgUSP48 cells were measured after 96 hours (n=3).

[0019] Figure 3 shows that healthy CD34 positive HSPCs are not affected by USP48 loss. A) Validation of KO via western blot for USP48 of HSPCs nucleofected with Cas9 protein and guides against Chr2-2, USP48 or the essential gene RPA3. Samples were collected 5 days after nucleofecti on. B) Cells were counted every 72-96 hours and normalized to day 2 after nucleofection. Chr2-2 (black) served as negative control and RPA3 (dark gray, dashed line), a common essential gene, served as a positive control. Cells counts for sgUSP48 #1 are represented in light gray, sgUSP48 #2 in light gray with a dashed line C) Representative microscopy image of a colony formation experiment in sgChr2- 2, sgUSP48 #1, sgUSP48 #2 and sgRPA3 nucleofected HSPCs 14 days after plating. Per experiment and guide, cells were plated in triplicates. D) HSPCs nucleofected with Cas9 protein and guides against Chr2-2, USP48 or RPA3 were plated in 384-well plates and incubated with DMSO, 0.1 pM or 2.5 pM decitabine for 96 hours. Cell viability was determinate using a luminescence readout after CellTiterGlo treatment.DFCI IP No. 3546.W01WO

[0020] Figure 4 shows that loss of USP48 in combination with HMAs increases DNA damage and cell death at early timepoint in AML cells. A) Annexin V-APC / PI staining was performed at day 3 after treatment with 200nM decitabine (DAC) or 50nM GSK-3685032 (GSK) of sgNT or sgUSP48 in MV4-11 cells (n=3). Cells were stained and percentage of Annexin V- / PI- (light gray), Annexin V+ / PI- (gray) and double positive cells (dark gray) was measured using flow cytometry. B) Representative western blot of sgNT and sgUSP48 in MV4-11 cells treated with increasing concentrations of decitabine (DAC) for 72 hours. Changes in USP48, DNMT1, cleaved PARP (C- PARP), Caspase 3, cleaved Caspase 3 (c-Caspase3) and phosphor-H2AX (Serl39, yH2AX) were assessed. Actin served as loading control.

[0021] Figure 5 shows that loss of USP48 in AML blasts increases response to GSK-3685032 in vivo A) Measurement of human CD45 positive cells by flow cytometry in the bone marrow of NSG mice injected with Cas9 positive MV4-11 cells carrying doxycycline inducible sgRNAs against USP48 or a non-targeting control (NT). Samples were collected following treatment with multiple concentrations of GSK-3685032 (subcutaneous, twice daily) or vehicle control (VEH) for 7 days. Each dot represents one mouse measurement. B) Measurement of spleen weight and human CD45 positive cells by flow cytometry in the blood, spleen and bone marrow of NSG mice injected with Cas9 positive MV4-11 cells carrying doxycycline inducible sgRNAs against USP48 or a nontargeting control (NT). Samples were collected after mice were treated with GSK-3685032 (45 mg / kg per dose) or vehicle control (VEH) for 7 days, BID. Each dot represents one mouse measurement.DETAILED DESCRIPTION

[0022] Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0023] As used herein, the term “AML” refers to acute myeloid leukemia (AML).

[0024] As used herein, the phrase “administering” (or “administer” or “administration”) refers to the act of the attending physician or caregiver, prescribing the agent for administration and thereby causing the application of an agent to a subject, through ingestion, infusion, injection, or any other means, whether self-administered or administered by a clinician or other qualified caregiver. Two or more compounds of the disclosure may be administered in combination or separately, and if separately, simultaneously, or sequentially over a period of time as determined by a qualified caregiver. In some embodiments, the DNMT1 inhibitor and USP48 inhibitor are administeredDFCI IP No. 3546.W01WO simultaneously. In some embodiments, if given sequentially, the USP48 inhibitor is to be administered first before the DNMT1 inhibitor. In other embodiments, the DNMT1 inhibitor is administered before the USP48 inhibitor.

[0025] In one aspect, the terms “co-administered” and “co-administration” as relating to a subject refer to administering to the subject a composition of the disclosure, or salt thereof, along with a composition that may also treat any of the diseases contemplated within the disclosure. In one embodiment, the co-administered compositions are administered separately, or in any kind of combination as part of a single therapeutic approach. The co-administered composition may be formulated in any kind of combinations as mixtures of solids and liquids under a variety of solid, gel, and liquid formulations, and as a solution.

[0026] As used herein, the term “composition” or “pharmaceutical composition” refers to a mixture of at least one compound useful within the disclosure with a pharmaceutically acceptable carrier. The pharmaceutical composition facilitates administration of the compound to a subject.

[0027] By “disease” or “disorder” is meant any condition that damages or interferes with the normal function of a cell, tissue, or organ. In certain embodiments, the disease is cancer. In certain embodiments, the disease comprises a hematological cancer, such as acute myeloid leukemia (AML).

[0028] As used herein, the term “DNMT1 inhibitor” refers to an inhibitor of DNMT1. DNMT1 mutations are known to affect AML cell proliferation. DNMT1 is a known therapeutic target in AML as it regulated drug resistance and is known to repress tumor suppressor genes. Some known DNMT1 inhibitors are known in the art and include decitabine [also known as Dacogen; DAC; AzadC; 5- AZA-CDR; Deoxycytidine; Dezocitidine; Dixitabin; E-7373; JNJ-30979754; NSC-127716; 5- azadeoxycytidine; and 4-amino-l -[(27?,4S,57?)-4-hydroxy-5-(hydroxymethyl)oxolan-2-yl]-l ,3,5- triazin-2-one; CAS No. 2353-33-5], azacitidine [also known as 5-AZA-CR; 5-AZC; AZA-C; BMS- 986345; CC-486; Ladakamycin; NEX-18; NS-17; NSC-102816; Onureg; U-18496; Vidaza; and 4- amino-l-[3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]-l,3,5-triazin-2-one; CAS No. 320-67-2], and GSK-3685032 [also known as NSC-837081; DA-73919; GTPL11750; BDBM491199; EX- A5484; and 2-[6-(4-aminopiperidin-l-yl)-3,5-dicyano-4-ethylpyridin-2-yl]sulfanyl-2- phenyl acetamide; CAS No. 2170137-61-6], Decitabine and azacitidine are commercially available. Other DNMT1 inhibitors are also known in the art. See Zhang et al. Front Pharmocol. 2022 Dec 16; 13 : 1072651 and equivalents thereof.

[0029] Preferred DNMT1 inhibitors are decitabine, azacitidine, and GSK-3685032.DFCI IP No. 3546.W01WO

[0030] As used herein, the phrase "effective amount” means an amount of a compound of the disclosure that is sufficient to treat in one or more doses a condition or detrimental effect thereof herein described or an amount of a compound of the disclosure that is sufficient to inhibit DNMT1 or USP48 to achieve the objectives of the disclosure. More particularly, an effective amount provides improvement in important cancer endpoints, Overall Survival (OS), Disease-Free Survival (DFS), Objective Response Rate, Complete Response Rate or Progression Free Survival (PFS). See Dept, of Health and Human Services, Food and Drug Admin, Clinical Trial Endpoints for the Approval of Cancer Drugs and Biologies: Guidance for Industry (2018); E.A. Eisenhauer, et al., New Response Evaluation Criteria in Solid Tumours: Revised RECIST Guideline (Version 1.1), 45 Eur. J. Cancer 228 (2009).

[0031] As used herein, the term “HMA” refers to hypomethylating agent (HMA).

[0032] As used herein, the term “MDS” refers to myelodysplastic syndrome (MDS).

[0033] As used herein, "patient" refers to a mammal, preferably human.

[0034] As used herein, the phrase “pharmaceutically acceptable carrier” (sometimes referred to as a “carrier”) means a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is generally safe and non-toxic and includes a carrier that is acceptable for human pharmaceutical or therapeutic use. Pharmaceutically acceptable carriers can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as an oil / water or water / oil emulsion) and / or various types of wetting agents. The term carrier may also encompass any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations. The choice of a carrier for use in a composition will depend upon the intended route of administration for the composition. Pharmaceutical compositions disclosed herein can advantageously comprise between about 0.1% and 99% by weight ofthe DNMTl inhibitor or the USP48 inhibitor based on the weight of the total composition including the carrier.

[0035] As used herein, the language “pharmaceutically acceptable salt” refers to a salt of the administered compound prepared from pharmaceutically acceptable non-toxic acids and bases, including inorganic acids, inorganic bases, organic acids, inorganic bases, solvates, hydrates, and clathrates thereof.

[0036] As used herein, the term “PROTAC” refers to proteolysis-targeting chimera (PROTAC).

[0037] As used herein, the term “reduced DNMT1 activity” refers to a patient whose DNTM1 expression is being inhibited, protein levels reduced, or enzymatic activity decreased, either throughDFCI IP No. 3546.W01WO an inhibitor, a PROTAC, chemotherapeutic agent, or through known methods of genetic targeting, such as CRISPR.

[0038] As used herein, the term “reduced USP48 activity” refers to a patient whose USP48 expression is being inhibited, protein levels reduced, or enzymatic activity decreased, either through an inhibitor, a PROTAC, a chemotherapeutic agent, or through known methods of genetic targeting, such as CRISPR.

[0039] As used herein, the term “treating” (or “treat” or “treatment”) refers to restraining, slowing, stopping, or reversing the progression or severity of an existing symptom, condition, or disorder.

[0040] As used herein, the term “USP48 inhibitor” refers to an inhibitor of USP48. Ubiquitin-specific proteases are a family of enzymes that catalyze the cleavage of ubiquitin from specific substrate proteins to regulate activity. Some known USP48 inhibitors include:Other USP48 inhibitors are known in the art. See W02024006956A2. (Each of these USP48 inhibitors may be obtained by making the compounds in the manner outlined in the cited reference).

[0041] The disclosure generally provides methods that can be used to treat or prevent certain types of hematological cancer in a subject in need thereof. In certain embodiments, the disclosure provides a combination of DNMT1 inhibitors and USP48 inhibitors to treat patients with cancer.DFCI IP No. 3546.W01WO

[0042] The present disclosure is based, in part, on the discovery that USP48 is a top sensitizer for HMAs in multiple AML cell lines, as well as on the discovery of USP48 knock-out (KO) models displayed decreased levels of AML cell survival when treated with HMAs than models without USP48 KO. Therefore, by using DNMT1 inhibition in combination with USP48 inhibition, AML cancer cells may be killed, and thus, this combination may provide a new treatment for patients with AML.

[0043] The present disclosure provides a method of treating cancer comprising the administration to a patient in need thereof an effective amount of a USP48 inhibitor or a pharmaceutically acceptable salt thereof, and an effective amount of a DNMT1 inhibitor, or a pharmaceutically acceptable salt thereof. In a preferred embodiment, the DNMT1 inhibitor is selected from GSK-3685032, decitabine, and azacitidine, or a pharmaceutically acceptable salt thereof. In a more preferred embodiment, the DNMT1 inhibitor is decitabine or azacitidine. In a preferred embodiment, the USP48 inhibitor is selected from WH 9943-119C, XL 10320 054A, and ED 11370 017, or a pharmaceutically acceptable salt thereof.

[0044] The present disclosure provides a method of treating acute myeloid leukemia (AML) comprising the administration to a patient in need thereof an effective amount of a USP48 inhibitor or a pharmaceutically acceptable salt thereof, and an effective amount of a DNMT1 inhibitor, or a pharmaceutically acceptable salt thereof. In a preferred embodiment, theDNMTl inhibitor is selected from GSK-3685032, decitabine, and azacitidine, or a pharmaceutically acceptable salt thereof. In a more preferred embodiment, the DNMT1 inhibitor is decitabine or azacitidine. In a preferred embodiment, the USP48 inhibitor is selected from WH 9943-119C, XL_10320_054A, and ED I 1370 017, or a pharmaceutically acceptable salt thereof.

[0045] The present disclosure provides a method of treating myelodysplastic syndrome (MDS) comprising the administration to a patient in need thereof an effective amount of a USP48 inhibitor or a pharmaceutically acceptable salt thereof, and an effective amount of a DNMT1 inhibitor, or a pharmaceutically acceptable salt thereof. In a preferred embodiment, theDNMTl inhibitor is selected from GSK-3685032, decitabine, and azacitidine, or a pharmaceutically acceptable salt thereof. In a more preferred embodiment, the DNMT1 inhibitor is decitabine or azacitidine. In a preferred embodiment, the USP48 inhibitor is selected from WH 9943-119C, XL_10320_054A, and ED I 1370 017, or a pharmaceutically acceptable salt thereof.DFCI IP No. 3546.W01WO

[0046] The present disclosure provides a method of treating AML in a patient in need thereof, the method comprising administering an effective amount of a means of inhibiting DNMT1 and a means of inhibiting USP48.

[0047] The present disclosure provides a method of treating MDS in a patient in need thereof, the method comprising administering an effective amount of a means of inhibiting DNMT1 and a means of inhibiting USP48.

[0048] The present disclosure includes DNMT1 inhibitors defined as a compound means for inhibiting DNMT1. Such compound means include compounds selected from GSK-3685032, decitabine, azacitidine, and other DNMT1 inhibitors known in the art and equivalents thereof. For the purposes of defining the compounds falling within such compound means, the function is inhibiting DNMT1.

[0049] The present disclosure includes USP48 inhibitors defined as a compound means for inhibiting USP48. Such compound means include compounds from W02024006956A2, other USP48 inhibitors known in the art, and equivalents thereof. For the purposes of defining the compounds falling within such compound means, the function is inhibiting USP48. Such compounds are organic compounds that are small molecules with a molecular weight less than 500 and may inhibit USP48 by binding a variety of binding sites but does so through direct molecular interaction between the compound and USP48. The result is inhibition of USP48 to a degree sufficient to increase the sensitivity of AML cancer cells to DNMT1 inhibitors.

[0050] The present disclosure provides a method of sensitizing cancer cells to treatment by DNMT1 inhibitors comprising reducing activity of USP48. In some embodiments, the activity of USP48 is reduced via an USP48 inhibitor. In a preferred embodiment, the DNMT1 inhibitor is selected from decitabine, azacitidine, and GSK-3685032. In a more preferred embodiment, the DNMT1 inhibitor is decitabine or azacitidine.

[0051] The present disclosure provides a method of treating acute myeloid leukemia (AML) in a patient in need thereof comprising inhibiting USP48 and administering an effective amount of a DNMT1 inhibitor, or a pharmaceutically acceptable salt thereof. In a preferred embodiment, the DNMT1 inhibitor is selected from decitabine, azacitidine, and GSK-3685032. In a more preferred embodiment, the DNMT1 inhibitor is decitabine or azacitidine.

[0052] The present disclosure provides a method of treating myelodysplastic (MDS) in a patient in need thereof comprising inhibiting USP48 and administering an effective amount of a DNMT1 inhibitor, or a pharmaceutically acceptable salt thereof. In a preferred embodiment, the DNMT1DFCI IP No. 3546.W01WO inhibitor is selected from decitabine, azacitidine, and GSK-3685032. In a more preferred embodiment, the DNMT1 inhibitor is decitabine or azacitidine.

[0053] The present disclosure provides a method of treating acute myeloid leukemia (AML) in patient in need thereof, wherein the patient has reduced DNMT1 activity, the method comprising administering an effective amount of an USP48 inhibitor or a pharmaceutically acceptable salt thereof.

[0054] The present disclosure provides a method of treating acute myeloid leukemia (AML) in patient in need thereof, wherein the patient has reduced USP48 activity, the method comprising administering an effective amount of an DNMT1 inhibitor or a pharmaceutically acceptable salt thereof.

[0055] The present disclosure provides a method of treating myelodysplastic syndrome (MDS) in patient in need thereof, wherein the patient has reduced DNMT1 activity, the method comprising administering an effective amount of an USP48 inhibitor or a pharmaceutically acceptable salt thereof.

[0056] The present disclosure provides a method of treating myelodysplastic syndrome (MDS) in patient in need thereof, wherein the patient has reduced USP48 activity, the method comprising administering an effective amount of an DNMT1 inhibitor or a pharmaceutically acceptable salt thereof.

[0057] The present disclosure provides a pharmaceutical composition comprising decitabine or azacitidine, or a pharmaceutically acceptable salt thereof, and an USP48 inhibitor, or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable carriers, diluents, or excipients. In a preferred embodiment, the USP48 inhibitor is selected from a group comprising WH_9943-1 19C, XL_10320_054A, or ED I 1370_017, or a pharmaceutically acceptable salt thereof. In a particular embodiment, the composition further comprised one or more other therapeutic agents.

[0058] Further, the present disclosure also provides decitabine or azacitidine, or a pharmaceutically acceptable salt thereof, and an USP48 inhibitor, or a pharmaceutically acceptable salt thereof, for use in therapy, in particular for the treatment of AML. In a preferred embodiment, the USP48 inhibitor is selected from a group comprising WH 9943-119C, XL_10320_054A, or ED_11370_017, or a pharmaceutically acceptable salt thereof.

[0059] Further, the present disclosure also provides decitabine or azacitidine, or a pharmaceutically acceptable salt thereof, and an USP48 inhibitor, or a pharmaceutically acceptable salt thereof, for use in therapy, in particular for the treatment of MDS. In a preferred embodiment, the USP48 inhibitor isDFCI IP No. 3546.W01WO selected from a group comprising WH_9943-119C, XL_10320_054A, or ED_11370_017, or a pharmaceutically acceptable salt thereof.

[0060] In another aspect, the present disclosure provides the use of decitabine or azacitidine, or a pharmaceutically acceptable salt thereof, and an USP48 inhibitor, or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament for the treatment of AML.

[0061] In another aspect, the present disclosure provides the use of decitabine or azacitidine, or a pharmaceutically acceptable salt thereof, and an USP48 inhibitor, or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament for the treatment of MDS.

[0062] In the present methods, DNMT1 inhibitors may be administered as a pharmaceutically acceptable salt. Pharmaceutically acceptable salts and common methodologies for preparing them are well known in the art. See, e.g., P. Stahl, et al., Handbook of Pharmaceutical Salts: Properties, Selection and Use, 2nd 30 Revised Edition Wiley-VCR (2011); S. M. Berge, et al., "Pharmaceutical Salts" Journal of Pharmaceutical Sciences (1977), 66(1). See US20060069060A1 for salts of decitabine. See US20060063735A1 for salts of azacitidine. See US10975056B2 for salts of GSK — 3685032.

[0063] In the present methods, USP48 inhibitors may be administered as a pharmaceutically acceptable salt. Pharmaceutically acceptable salts and common methodologies for preparing them are well known in the art. See, e g., P. Stahl, et al., Handbook of Pharmaceutical Salts: Properties, Selection and Use, 2nd 30 Revised Edition Wiley-VCR (2011); S. M. Berge, et al., "Pharmaceutical Salts" Journal of Pharmaceutical Sciences (1977), 66(1).

[0064] DNMT1 inhibitors and USP48 inhibitors are preferably formulated as pharmaceutical compositions administered by a variety of routes. Such pharmaceutical compositions and processes for preparing the same are well known in the art. See, e.g., Remington: The Science and Practice of Pharmacy (I) [A. Gennaro, et al., eds., 21st ed., Mack Publishing Co., (2005)]. DNMT1 inhibitors, USP48 inhibitors and other compounds included in the methods of the present disclosure, or salts thereof, may be prepared by a variety of procedures known in the art or are commercially available.

[0065] Azacitidine, decitabine, GSK-3685032, USP48 inhibitors, and other compounds included in the methods of the present disclosure, or salts thereof, may be prepared by a variety of procedures known in the art or are commercially available. Azacitidine and decitabine can be purchased at SelleckChem (https: / / www.selleckchem.com / ). GSK-3685032 can be purchased at MedChemExpress (https: / / www.medchemexpress.com / ). WH_9943-119C, XL_10320_054A, and ED_11370 017 can be prepared as outlined in W02024006956A2.DFCI IP No. 3546.W01WO

[0066] The pharmaceutical compositions of the present application include those suitable for any acceptable route of administration. Acceptable routes of administration include oral, parenteral, or intraperitoneal administration.

[0067] In some embodiments, the pharmaceutical composition may be formulated for oral administration. Compositions suitable for oral administration can be presented as discrete units such as capsules or tablets each containing a predetermined amount (e.g., a unit dose amount, which when administered as one or more doses, preferably 1 or 2 doses, provides an effective amount) of the active ingredient.

[0068] Compositions suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions or infusion solutions which can contain antioxidants, buffers, bacteriostats and solutes that render the formulation isotonic with the blood of the intended recipient. The formulations can be presented in unit-dose or multi-dose containers, for example, sealed ampules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injections, saline (e g., 0.9% saline solution) or 5% dextrose solution, immediately prior to use.

[0069] The effective dose of DNMT1 and USP48 inhibitors can vary with the severity of the disease, the route of administration, the sex, age and general health condition of the subject, excipient usage, the possibility of co-usage with other therapeutic treatments such as use of other agents and the judgment of the treating physician.

[0070] The mechanism of how HMAs is enhanced through USP48 loss was investigated via utilization of cell differentiation and cell death assays. It was found that the loss of USP48 alone did not affect cell growth or viability but, with the addition of low doses of HMAs, there was significant decrease in cell viability with increased DNA damage and induction of apoptosis. However, no cell differentiation was observed. In vivo models showed that with USP48 KO and 7-day treatment with GSK-3685032 ablated disease burden in bone marrow (< 0.5% hCD45+ blasts) and prolonged survival. Mice with non-targeting guides or USP48 KO treated with the vehicle control had -25% hCD45+ blasts, while the DNMT1 inhibitor in the non-targeting control mice showed some antitumor effect (9% hCD45+ blasts).

[0071] To date, little is known about the direct substrates of USP48. To gain better insight into possible targets of USP48, an omics-based approach was used, generating ubiquitinome, proteome, interactome IP-mass spectrometry and RNA-Seq data. The ubiquitinome data revealed a significant enrichment of H2A variant ubiquitination and enhanced ubiquitination of key proteins involved in theDFCI IP No. 3546.W01WO recognition of DNA double-strand breaks (DSB) (Ku70 / Ku80 and PRKDC) upon USP48 KO. These findings were confirmed in the interactome data set, where the H2AX core histone complex was among the most enriched CORUM protein complexes. RNA-Seq data show an increased expression of gene sets involved in DNA damage repair and chromatin organization upon USP48 loss, consistent with a cellular response to maintain chromatin stability.

[0072] Additional genome-scale CRISPR-Cas9 screening of USP48 KO cells with HMA treatment revealed the KO of RNF138, UBE2K and UBE2D3 is rendering resistance to all three drugs. While previous reports showed that USP48 erases BRCA1 ubiquitin sites, herein is reported a link of the RNF138-UBE2K / UBE2D3 ubiquitination machinery to USP48. RNF138, an E3 ubiquitin ligase, is also described to ubiquitinate and displace repair proteins from DSB sites, connecting RNF138 itself to DNA repair pathway choice. Low-throughput validation confirms rescue against HMA + USP48 KO toxicity with the knockout of either RNF138 or its E2 ligases UBE2K / UBE2D3 in AML cells.

[0073] Taken together, the present data confirm a role for USP48 as a histone deubiquitinase, influencing the modification of histones and other proteins important for DNA damage repair pathway choice. While USP48 KO alone does not affect cell viability, combining USP48 KO with HMA treatment is highly lethal to AML. While not being bound by theory, these results suggest a synergistic interplay between DNA hypomethylation, ubiquitin posttranslational modification, DNA damage and AML cell death. USP48 is thus a new target for combination therapy with HMAs for AML.

[0074] The abbreviations used herein are defined according to Aldrichimica Acta, Vol. 17, No. 1, 1984. Other abbreviations are defined as follows: “BSA” refers to bovine serum albumin; “DMSO” refers to dimethyl sulfoxide; “FBS” refers to fetal bovine serum; “FLT3L” refers to FMS-related tyrosine kinase 3 ligand; “GFP” refers to green fluorescent protein; “HRP” refers to horseradish peroxidase; “HSC” refers to hematopoietic stem cell; “HSPC” refers to hematopoietic stem and progenitor cells; “IgG” refers to immunoglobulin G; “IL3” refers to interleukin 3; “IL6” refers to interleukin 6; “LFC” refers to log fold change; “MTT” refers to 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide; “PARP” refers to poly (ADP -ribose) polymerase; “PBS” refers to phosphate buffered saline; “PCR” refers to polymerase chain reaction; “RIP A” refers to radioimmunoprecipitation assay; “RNP” refers to ribonucleoprotein; “RPMI” refers to Roswell Park Memorial Institute; “RT” refers to room temperature; “SCF” refers to stem cell factor; “SDS-PAGE” refers to sodium dodecyl sulfate-polyacrylamide gel electrophoresis; “sgNT” refers to single guide non-targeting; “TBST” refers to tris-buffered saline with Tween 20; “TPO” refers to thyroid peroxidase.DFCI IP No. 3546.W01WO

[0075] The following examples further illustrate the disclosure.DFCI IP No. 3546.W01WOEXAMPLES

[0076] Cell lines and cell culture: MV4-11 (RRID:CVCL_0064), OCLAML3 (DSMZ-OCL AML3), NB4 (DSMZ-ACC-207), and THP-1 (ATCC-TIB-202) were cultured in RPMI medium (THERMOFISHER™, cat. 11875-093) supplemented with 10% FBS and 1% penicillin-streptomycin (P / S). Cell lines were cultured for up to three months following thawing for experimental use. A patient-derived xenograft (PDX17-14) was briefly cultured in vitro using Iscove’s modified Dulbecco’s medium (ATTC®, cat. 30-2005™) supplemented with 20% FBS, 1% P / S, and cytokines (lOng / mL of SCF, TPO, FLT3L, IL3, and IL6). CD34+ hematopoietic stem / progenitor cells (HSPC) were briefly cultured in StemSpan II media supplemented with 100 ng / ml human SCF, TPO, and FLT3L, and 10 ng / ml IL3 and IL6. The identities of parental cell lines and newly generated models were validated Parental cell lines and newly generated models were verified by short tandem repeat profiling at the Molecular Diagnostics Laboratory at the Dana-Farber Cancer Institute and tested for Mycoplasma contamination using the My coAlert Mycoplasma Detection Kit (Lonza, LT07-318).CRISPR / Cas9 Screen

[0077] HMA modifier screen: MV4-11 Cas9-mCherry positive cells were transduced with the Avana CRISPR knockout library (lentiCRISPRv2) in two biological replicates to achieve 30-40% infection efficiency. Twenty-four hours after transduction, cells were pooled and selected with puromycin (2 pg / ml) for 72 hours. After selection, cells were counted and split in two sets of 50x106cells per replicate, to maintain a library representation of >500 cells per sgRNA. Treatment with DMSO, 200nM azacitidine (Sigma Aldrich, A3656) or 80nM decitabine (Tocris Bioscience, 26-241 -0) started on day 7 after transduction. Cells were counted, split, and retreated every 4 days; surviving cells were harvested after 16 days. Genomic DNA was extracted from the collected cell pellets using a NucleoSpin Blood L kit (Takara #740954.20). sgRNA sequences were PCR amplified and submitted for standard Illumina sequencing as previously described. In each sample, the read counts of each sgRNA were normalized to the total reads per million. The fold-change of normalized sgRNA counts in HMA-treated samples was determined relative to the DMSO-treated samples for each replicate, which were then log2 transformed and averaged across the two replicates (LFC). The p-values indicating the significant enrichment or depletion of each sgRNA were calculated using a probability mass function of hypergeometric distribution based on the sgRNA LFC ranking. The average LFCDFCI IP No. 3546.W01WO and p-values of all sgRNAs targeting the same gene were used as gene-level scores; only genes with at least three sgRNAs mapped were reported.Cloning and Lentiviral Transduction

[0078] Cells with constitutive and stable Cas9 expression were created. To generate CRISPR / Cas9 knockouts, single-guide RNAs (sgRNA) targeting genes of interest were cloned into either the lentiGuide-Puro backbone for constitutive knockout, or a vector containing doxycycline inducible sgRNA and constitutive GFP for an inducible system (Addgene plasmid #104990, Addgene plasmid #70183). The sgRNA sequences used are: non-targeting (GTAGCGAACGTGTCCGGCGT), sgUSP48#l (TTTGTGGGCCTGACTAACCT), sgUSP48 #2 (TCGATGATCCCAACTGTGAG), sgUBE2K #1 (AGCTGCAATGACTCTCCGCA), sgUBE2D3 #1 (AATGACAGCCCATATCAAGG), sgUBE2D3 #2 (GGGAAAATACTTGCCTTAGG). Lentiviral particles were produced using TransIT (Minis) in HEK293T cells. Virus was harvested 48 hours following transfection, and cells were transduced using lentivirus and polybrene (8 pg / mL) through a spin infection (2,000 rpm at 30 °C for 1.5 hours).Immunoblotting

[0079] Cells were lysed using RIPA buffer (Sigma-Aldrich) supplemented with a complete Protease Inhibitor Cocktail tablet (Roche) and PhosSTOP (Roche) tablet on ice. The lysates were quantified using a bicinchoninic acid assay (Pierce), normalized, and diluted with RIPA and 4x Laemmli buffer with P-mercaptoethanol. Proteins were then separated using 4-12% SDS-PAGE gels and transferred to methanol-activated polyvinylidene difluoride membranes. Following the transfer, unspecific binding was blocked using 5% milk in TBST. The primary antibodies were diluted in TBST + 5% BSA and incubated over night at 4 °C. The following antibodies were used: USP48 (A301-190A, Bethyl, 12076-1-AP, Proteintech), actin (4970S, Cell Signaling Technologies), vinculin (13901 S, Cell Signaling Technologies), DNMT1 (PAI-880, Invitrogen), yH2AX (2577S, Cell Signaling Technologies), Caspase3 (9662S, Cell Signaling Technologies), cCaspase3 (9664S, Cell Signaling Technologies), PARP (9542S, Cell Signaling Technologies; 436400, Invitrogen), RNF138 (PA5- 110304, Invitrogen), UBE2K (3847S, Cell Signaling Technologies), UBE2D3 (4330S, Cell Signaling Technologies). Membranes were washed in TBST following incubation with primary antibodies and incubated with HRP -linked goat anti-rabbit IgG and anti-mouse IgG (CST #7074, #7076) secondaryDFCI IP No. 3546.W01WO antibodies, diluted in 5% milk before being imaged using Super Signal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific) on an Amersham Imager 680.Cell Viability Assay

[0080] Cells carrying Cas9 and sgRNA + GFP-inducible guides were doxycycline induced (200 ng / ml) and incubated at 37 °C for three days. Induced cells were then plated in 384-well plates with 50 pl per well at a density of 0.3x106 cells / ml. A drug dispenser (D300e Digital Dispenser, HP) was used to add serial drug dilutions before plates were incubated for 96 hours at 37 °C. At the time of read-out, 10 pl CellTiter-Glo was added to each well and plates were incubated, protected from light, for 15 minutes before luminescence was read on either a FLUOstar OPTIMA plate reader (BMG Labtech) or a CLARIOstar77"' (BMG Labtech).Nucleofection

[0081] For the Nucleofection of CD34+ HSPCs the P3 Primary Cell D4-Nucleofector X Kit S from Lonza was used. CD34+ HSPCs from Lonza (2M-101C) were thawed and stimulated in StemSpan II media supplemented with 100 ng / ml human SCF, TPO and FLT3L, and 10 ng / ml IL-3 and IL-6 or HSC-expansion media two days prior the experiment. Per transfection, 6 pg purified Cas9 nuclease (IDT) was mixed with 100 pmol chemically modified synthetic sgRNA (Synthego, sgRNA target sequence: sgChr2-2 (GGTGTGCGTATGAAGCAGTG), sgRPA3(GATGAATTGAGCTAGCATGC), sgUSP48#l (TTTGTGGGCCTGACTAACCT), sgUSP48 #2 (TCGATGATCCCAACTGTGAG)) in P3 buffer and incubated for 10 minutes at RT to form RNP. Cells were counted, washed and resuspended in P3 buffer (0.25x10A6 cells per reaction) and transferred to the RNP mixture. 25 pl of the cell + RNP mix were pipetted into one well of 16-well Nucleocuvette Strip and treated with program DZ-100. Afterwards the nucleofected cells were transferred into prewarmed media in a 24-well plate and incubated at 37°C for two days.Colony Formation

[0082] Nucleofected cells were counted and resuspended in MethoCult Express methylcellulose media (StemCell Technologies #04437) at a density of 2000-3000 cells / ml. Resuspended cells were vortexed and left at RT till mix is bubble-free. Afterwards 1 ml of the cell / methylcellulose mix was plated in triplicates on 35 mm cell plates and incubated at 37 °C for 10 days. At day of the readout plates were stained with MTT (mixed 1: 1 with PBS, 200 pl per 35 mm plate). MTT treated platesDFCI IP No. 3546.W01WO were incubated for 3-4 hours at 37 °C and analyzed with a FLUOstar OPTIMA plate reader (BMG LAB TECH).Annexin V / PI Staining

[0083] Cells carrying Cas9 and sgRNA +GFP-inducible guides were induced with doxycycline (200 ng / ml) and incubated at 37 °C for three days. Induced cells were then plated in a 12-well plate at a density of 0.3x106 cells / ml in triplicates, treated with drug, and incubated at 37 °C for 72 hours. Cells were stained using the BioLegend APC Annexin V apoptosis detection kit with PI (propidium iodide) according to the manufacturer’s protocol. Following two brief washes in PBS + 1% FBS, cells were resuspended in 100 pl Annexin V Binding Buffer with 10 pl PI solution and 5 pl APC-conj ugated Annexin V, vortexed, and incubated for 15 minutes at room temperature protected from light. Cells were then topped off with 400 pl Annexin V Binding Buffer and analyzed by flow cytometry (BD FACSCelesta). Data were analyzed using FloJo.Xenograft Transplantation

[0084] The in vivo studies carried out were approved by the Dana-Farber Cancer Institute Animal Care and Use Committee. For both studies, 7-week-old NOD / SCID / IL2rYnull mice (The Jackson Laboratory) were intravenously injected with 250,000 MV4-11 cells transduced with doxycycline inducible non-targeting or USP48 guides and Cas9. After validation of engraftment via bone marrow aspiration, mice were started on a doxycycline (625 ppm) diet. Beginning day 4 of the doxycycline diet, mice were treated with GSK-3685032 (45 mg / kg / dose) or with vehicle (10% captisol) via subcutaneous injection bi-daily for 7 days. Mice were sacrificed following 7-day treatment to assess tumor burden. Leukemic burden was determined by flow cytometry analysis of mouse CD45-APC and human CD45-V450 staining of the peripheral blood, spleen, and bone marrow.

[0085] Collectively, these data show that USP48 scores as a strong sensitizer for hypomethylating agents decitabine, azacitidine, and GSK-3685032 and USP48 KO synergizes with HMAs in a selective manner. Loss of USP48 combined with treatment of with HMAs increased DNA damage and cell death at an early timepoint. Additionally, in vitro results translate successfully to in vivo mouse models as demonstrated with USP48 KO in AML blasts increases the response to the HMA GSK-3685032. Together, these data show that a combination of USP48 loss with HMA treatmentDFCI IP No. 3546.W01WO lead to enhanced efficacy in AML cell death. Thus, USP48 is a new target for combination therapy with DNMT1 inhibitors, such as HMAs, for treatment of AML.

Claims

DFCI IP No. 3546.W01WOCLAIMSWhat is claimed:1 . A method of treating cancer in a patient in need thereof, the method comprising administering an effective amount of a DNMT1 inhibitor, or a pharmaceutically acceptable salt thereof and an USP48 inhibitor, or a pharmaceutically acceptable salt thereof.

2. The method of claim 1 wherein the DNMT1 inhibitor is selected from GSK-3685032, decitabine, and azacitidine, or a pharmaceutically acceptable salt thereof.

3. The method of claim 2 wherein the DNMT1 inhibitor is selected from decitabine and azacitidine, or a pharmaceutically acceptable salt thereof.

4. The method of any of claims 1-3 wherein the USP48 inhibitor is selected from WH_9943-119C, XL_10320_054A, and ED_11370 017, or a pharmaceutically acceptable salt thereof.

5. A method of treating acute myeloid leukemia (AML) in a patient in need thereof, the method comprising administering an effective amount of a DNMT1 inhibitor, or a pharmaceutically acceptable salt thereof and an USP48 inhibitor, or a pharmaceutically acceptable salt thereof.

6. The method of claim 5 wherein the DNMT1 inhibitor is selected from GSK-3685032, decitabine, and azacitidine, or a pharmaceutically acceptable salt thereof.

7. The method of claim 6 wherein the DNMT1 inhibitor is selected from decitabine and azacitidine, or a pharmaceutically acceptable salt thereof.

8. The method of any of claims 5-7 wherein the USP48 inhibitor is selected from WH_9943-119C, XL_10320_054A, and ED_11370_017, or a pharmaceutically acceptable salt thereof.

9. A method of treating myelodysplastic syndrome (MDS) in a patient in need thereof, the method comprising administering an effective amount of a DNMT1 inhibitor, or a pharmaceutically acceptable salt thereof and an USP48 inhibitor, or a pharmaceutically acceptable salt thereof.

10. The method of claim 9 wherein the DNMT1 inhibitor is selected from GSK-3685032, decitabine, and azacitidine, or a pharmaceutically acceptable salt thereof.

11. The method of claim 10 wherein the DNMT1 inhibitor is selected from decitabine and azacitidine, or a pharmaceutically acceptable salt thereof.

12. The method of any of claims 9-11 wherein the USP48 inhibitor is selected from WH_9943-119C, XL_10320_054A, and ED_11370_017, or a pharmaceutically acceptable salt thereof.

13. The method of any of claims 1-12, wherein the DNMT1 inhibitor, or a pharmaceutically acceptable salt thereof and the USP48 inhibitor, or a pharmaceutically acceptable salt thereof, is administered simultaneously.DFCI IP No. 3546.W01WO14. The method of any of claims 1-12, wherein the USP48 inhibitor, or a pharmaceutically acceptable salt thereof, is administered before the DNMT1 inhibitor, or a pharmaceutically acceptable salt thereof.

15. A method of treating AML in a patient in need thereof, wherein the patient has reduced USP48 activity, the method comprising administering an effective amount of a DNMT1 inhibitor or a pharmaceutically acceptable salt thereof.

16. The method of claim 15, wherein the DNMT1 inhibitor is selected from GSK-3685032, decitabine, and azacitidine, or a pharmaceutically acceptable salt thereof.

17. The method of claim 15, wherein the reduced USP48 activity is achieved by the use of an inhibitor, a PROTAC, a chemotherapeutic agent, or through known methods of genetic targeting, such as CRISPR.

18. A method of treating AML in a patient in need thereof, wherein the patient has reduced DNMT1 activity, the method comprising administering an effective amount of a USP48 inhibitor or a pharmaceutically acceptable salt thereof.

19. The method of claim 18, wherein the USP48 inhibitor is selected from WH 9943-119C, XL_10320_054A, and ED_11370_017, or a pharmaceutically acceptable salt thereof.

20. The method of claim 18, wherein the reduced DNMT1 activity is achieved by the use of an inhibitor, a PROTAC, a chemotherapeutic agent, or through known methods of genetic targeting, such as CRISPR.

21. A method of treating AML in a patient in need thereof, the method comprising administering an effective amount of a means of inhibiting DNMT1 and a means of inhibiting USP48.

22. A method of sensitizing AML cells in a patient to treatment by a DNMT1 inhibitor comprising reducing activity of USP48.

23. The method of claim 22, wherein the DNMT1 inhibitor is selected from GSK-3685032, decitabine, and azacitidine, or a pharmaceutically acceptable salt thereof.

24. The method of claim 22, wherein the DNMT1 inhibitor is selected from decitabine and azacitidine, or a pharmaceutically acceptable salt thereof.

25. The method of claim 22, wherein the activity of USP48 is reduced via an USP48 inhibitor.

26. A DNMT1 inhibitor, or a pharmaceutically acceptable salt thereof, and an USP48 inhibitor for use in treating AML in a patient in need thereof.

27. The use of claim 26, wherein the DNMT1 inhibitor is selected from the group consisting of GSK- 3685032, decitabine, and azacitidine, or a pharmaceutically acceptable salt thereof.DFCI IP No. 3546.W01WO28. The use of claim 26, wherein the DNMT1 inhibitor is selected from decitabine and azacitidine, or a pharmaceutically acceptable salt thereof.

29. The use of claim 26, wherein the USP48 inhibitor is selected from the group consisting of WH_9943-119C, XL_10320_054A, and ED_11370_017, or a pharmaceutically acceptable salt thereof.

Images