Lipid nanoparticles comprising coding RNA molecules for use in gene editing and as vaccines and therapeutic agents

Abstract

The present disclosure describes improved LNP-based RNA vaccines, nucleobase editing systems, and therapeutics for use in treating and / or immunization against disease. In particular, the disclosure describes improved LNPs, including novel and improved ionizable lipids for making LNPs, that enhance the targeted delivery of LNP-based RNA vaccines and therapeutics based on linear and / or circular RNAs. The improved LNPs protect linear and / or circular RNA payloads from degradation and clearance while achieving targeted systemic or local delivery for use as enhanced vaccines and / or therapeutic agents.

Description

Ref. No. OR-048WO1 / / OBS-033WOLIPID NANOPARTICLES COMPRISING CODING RNA MOLECULES FOR USE IN GENE EDITING AND AS VACCINES AND THERAPEUTIC AGENTS TECHNICAL FIELD

[0001] The present disclosure generally relates to the field of nucleic acid lipid nanoparticle (LNP) compositions and delivery thereof for use as vaccines and / or therapeutics for the treatment of disease. Tire disclosure further relates to compositions comprising LNPs formulated with coding RNAs, including linear and / or circular RNAs, for the delivery of encoded vaccine antigens and / or therapeutic proteins for the vaccination against infectious agents and / or treatment of disease, including infectious disease and cancer.BACKGROUND

[0002] There are many challenges associated with the delivery of nucleic acids to affect a desired response in a biological system, such as an immune response or the production of a therapeutically beneficial protein to treat a disease. Nucleic acid-based therapeutics and vaccines have enormous potential but there remains a need for more effective delivery of nucleic acids to appropriate sites within a cell or organism in order to realize this potential.

[0003] Thus, improved LNPs that enhance the delivery of LNP-based RNA vaccines and therapeutics to cells, tissues, and bodily sites and which are more protective of RNA payloads would advance the art. Preferably, such improved LNPs would protect RNA payloads from degradation and clearance while achieving delivery, be suitable for subcutaneous delivery, and provide deli very of any target, including RNA in linear and / or circular and / or modified form. In addition, such improved LNP-based RNA vaccines and therapeutics should exhibit low toxicity and provide an adequate therapeutic index, such that patient treatment at an effective dose of the LNP minimizes risk to tire patient while maximizing therapeutic benefit. The present disclosure provides these and related advantages.SUMMARY

[0004] Described herein are compositions, methods, processes, kits and devices for the selection, design, preparation, manufacture, formulation, and / or use of LNP-based RNA medicines (e.g., vaccines and geneediting therapeutics). In particular, described herein are compositions, methods, processes, kits and devices for the selection, design, preparation, manufacture, formulation, and / or use of LNP-based RNA medicines (e.g., vaccines and gene editing therapeutics) for the delivery of one or more coding and / or non-coding RNA molecules. In various embodiments, the non-coding RNAs may comprise one or more guide RNAs relating to a gene editing system, such as one based on CRISPR-Cas9 or CRISPR-Casl2a, each of which require complexing with a guide RNA that facilitates the localizing tire protein-RNA complex to a target sequence having an enzyme-specific PAM site (protospacer adjacent motif -recognized by the CRISPR enzyme) and a target nucleotide sequence (i.e., the protospacer) that isRef. No. OR-048WO1 / / OBS-033WOcomplementary to a portion of the guide RNA (i.e., to the spacer region). In other embodiments, the coding RNA may encode any protein component of LNP-based RNA medicine, such as, but limited to a virus antigen (e.g., a viral envelope spike protein), a therapeutic protein (e.g., a functional version of a defective protein), or one or more gene editing components (e.g., a programmable nuclease or other effector protein, such as a deaminase or reverse transcriptase). Further described herein are compositions, methods, processes, kits and devices for the selection, design, preparation, manufacture, formulation, and / or use of LNP-based RNA medicines (e.g., vaccines and / or gene editing therapeutics) for the delivery of one or more RNA molecules, e.g., a coding RNA that codes for one or more therapeutic proteins for the prophylactic and / or therapeutic treatment of one or more diseases or a symptom thereof, or a noncoding RNA, such as, but not limited to a guide RNA for a gene editing system, hi various embodiments, the RNA molecule delivered by the herein disclosed LNPs can be a linear mRNA. In other embodiments, the RNA molecule delivered by the herein disclosed LNPs can be a circular RNA. In still other embodiments, the RNA molecule delivered by the herein disclosed LNPs can include both linear and circular forms of RNA. In further embodiments, the RNA may comprise one or more modifications, including chemical modifications (e.g., ribonucleotide analogs, alternative phosphate chain linkers), sequence modification (e.g., relative to a wild type sequence), and / or structural modification (e.g.. secondary-folded structures, such as, but not limited to, stem-loops, hairpins, and G-quadruplexes, and tertiary structural elements, such as, but not limited to, helical duplexes and triple -stranded structures). In various other embodiments, the disclosure provides novel lipid components of the herein disclosed LNPs, including, but not limited to, novel ionizable lipids.

[0005] Tire present disclosure describes improved LNP-based RNA medicines (e.g., vaccines and therapeutics) for use in treating and / or immunization against disease. In particular, the disclosure describes improved LNPs. including better performing ionizable lipids, that enhance the targeted delivery of LNP-based RNA vaccines and therapeutics based on linear and / or circular RNAs. The improved LNPs protect linear and / or circular RNA cargos (i.e., the circular and / or linear RNA molecules encapsulated by the LNPs) from degradation and clearance while achieving targeted systemic or local delivery for use as enhanced vaccines and / or therapeutic agents.

[0006] In another aspect of the disclosure, provided herein is a method for delivering a nucleic acid to a cell comprising contacting the cell with a LNP disclosed herein or a pharmaceutical composition disclosed herein.

[0007] In another aspect of the disclosure, provided herein is a method for treating a disease characterized by a deficiency of a functional protein, the method comprising administering to a subject having the disease, a LNP formulation comprising a LNP disclosed herein, wherein the RNA encodes the functional protein or a protein having the same biological activity as the functional protein.Ref. No. OR-048WO1 / / OBS-033WO

[0008] In another aspect of the disclosure, provided herein is a method for treating a disease characterized by overexpression of a polypeptide, comprising administering to a subject having the disease a LNP formulation comprising a LNP disclosed herein and a siRNA, wherein the siRNA targets expression of the overexpressed polypeptide.

[0009] In another aspect of the disclosure, provided herein pharmaceutical composition comprising:(a) a lipid nanoparticle;(b) a buffer;(c) hyaluronidase; and(d) a nucleic acid encoding a CAR or TCR complex protein.

[0010] In some embodiments, a pharmaceutical composition comprising hyaluronidase as disclosed herein may be useful in the subcutaneous administration of a LNP to a subject in need thereof.BRIEF DESCRIPTION OF THE DRAWINGS

[0011] FIG. 1 is a diagram illustrating the LNP-based RNA vaccines and therapeutics disclosed herein which arc encapsulated with RNA payloads (c.g., linear and / or circular RNAs).

[0012] FIG. 2 is a diagram illustrating an originator polynucleotide construct of the present disclosure which may be linear or circular.

[0013] FIG. 3-1 comprises 6 panels, each of bar graphs showing VHH expression in splenic immune cell populations.

[0014] FIG. 3-2 comprises 6 panels, each of bar graphs showing VHH expression in immune cell populations in draining lymph nodes.

[0015] FIG. 4-1 comprises 4 exemplary ex vivo IVIS images following IV or SC dosing of formulation F-4.

[0016] FIG. 4-2 comprises 4 panels, each of bar graphs showing total flux in skin surrounding the injection site, liver, brachial lymph node, and spleen in animals treated IV or SC with F-3 or F-4.

[0017] FIG. 4-3 is a bar graph showing total flux in liver in animals treated IV or SC (with hyaluronidase) with F-4, F-5, F-6, F-7 and F-8.

[0018] FIG. 4-4 is a bar graph showing total flux in spleen in animals treated IV or SC (with hyaluronidase) with F-4, F-5, F-6. F-7 and F-8.

[0019] FIG. 4-5 is a bar graph showing % flux expression, as compared to total fLuc expression, in liver and spleen in animals treated IV or SC (with hyaluronidase) with F-4, F-5, F-6, F-7 and F-8.

[0020] FIGs. 5-1, 5-2, 5-3, 5-4, 5-5 and 5-6 are bar graphs showing CAR expression in NHP lymph nodes after IV and subcutaneous administration of LNP F-Cl, as described in Example 5. The data shows better expression of the CAR payload in all lymph node T cell populations and comparable orRef. No. OR-048WO1 / / OBS-033WObetter expression in lymph node NK cell populations for the subcutaneously delivered LNP with hyaluronidase (represented by the central, cross-hatched bars), as compared to IV delivery' using the same test article (represented by tire right side, white bars).

[0021] FIGs. 5-7, 5-8, 5-9, and 5-10 are bar graphs showing CAR expression in NHP bone marrow after IV and subcutaneous administration of LNP F-C 1, as described in Example 5. The graphs show that test article F-Cl administered subcutaneously with hyaluronidase (represented by the central, cross-hatched bars) demonstrated lower, but statistically comparable expression of the CAR payload in bone marrow T cell and NK cell populations and comparable expression in bone marrow hematopoietic stem cell and hematopoietic stem cell progenitor populations, as compared to IV delivery of the same test article (represented by the right side, white bars).

[0022] FIGs. 5-11, 5-12, 5-13, 5-14, 5-15 and 5-16 are bar graphs showing CAR expression in NHP whole blood after IV and subcutaneous administration of LNP F-Cl, as described in Example 5. The graphs show that test article F-C 1 administered subcutaneously with hyaluronidase (represented by the central, cross-hatched bars) demonstrated comparable expression of the CAR payload in various immune cell populations collected from whole blood, as compared to IV delivery’ of the same test article (represented by the right side, white bars).

[0023] FIG. 6-1 is a graph showing B cell depletion in the peripheral blood using test article F-Dl comprising an oRNA CAR payload and F-3 comprising an oRNA reporter construct, as reported in Example 6. As shown, the CAR LNP F-Dl depleted peripheral blood B cells over a 72 hour period, while F-3 remained largely at pre-experimental baseline levels.

[0024] FIGs. 6-2, 6-3 and 6-4 are line graphs showing CAR expression in T cells, NK cells and monocytes in the peripheral blood after dosing CAR LNP F-DL as reported in Example 6.

[0025] FIGs. 6-5. 6-6 and 6-7 are line graphs showing VHH expression in T cells, NK cells, B cells and monocytes in the peripheral blood after dosing VHH reporter LNP F-3, as reported in Example 6.

[0026] FIGs. 6-8 through 6-15 are immunohistochemical staining images of the spleens and lymph nodes of NHPs dosed with test article F-Dl comprising an oRNA CAR payload and F-3 comprising an oRNA reporter construct, collected after 72 hours. FIG. 6-8 is an image of the spleen of an animal dosed with F-Dl, and FIG. 6-9 is a zoomed view of the same image. FIG. 6-10 is an image of tire spleen of an animal dosed with F-3, and FIG. 6-11 is a zoomed view of the same image. FIG. 6-12 is an image of the mesenteric lymph node of an animal dosed with F-Dl, and FIG. 6-13 is a zoomed view of the same image. FIG. 6-14 is an image of the mesenteric lymph node of an animal dosed with F-3, and FIG. 6-15 is a zoomed view of the same image.Ref. No. OR-048WO1 / / OBS-033WODETAILED DESCRIPTIONI. Introduction

[0027] The instant specification describes compositions, methods, processes, kits and devices for the selection, design, preparation, manufacture, formulation, and / or use of LNP -based RNA medicines (e.g., vaccines, gene therapies, or gene-editing therapeutics). In various embodiments, the LNP-based RNA medicines comprise an LNP delivery system (as described in detail herein) and an encapsulated cargo / payload (e.g., RNA in the case of RNA medicines).

[0028] In various embodiments and as described further herein, the LNP delivery vehicle is a complex nanostructured body that provides protection to an encapsulated RNA payload (i.e., one or more RNA molecules) environmental damage (e.g., an intracellular environment). LNPs are formed through selfassembly of multiple lipid components, including (i) an ionizable lipid (e.g., ALC-0315 as in COMIRNATY® (Pfizer-BioNTech), SM-102 as in SPIKEVAX® (Modema). or MC3 as in ONPATTRO® (Alnylam), or those ionizable lipids described herein), (ii) a helper lipid (such as, but not limited to, l,2-distearoyl-s«-glycero-3-phosphocholine (DSPC)), (iii) a sterol (e.g., cholesterol), and (iv) a PEG-lipid (e.g, PEG-DSPE).

[0029] In various embodiments and as described further herein, the RNA payload in the herein described LNP-based medicines may comprise coding and / or non-coding RNA, and / or mixtures thereof. The particular RNA payload constituents will generally reflect the medicine. For example, an LNP-based vaccine or therapeutic may comprise only coding RNA for expressing a vaccine antigen or a therapeutic protein, respectively. However, an LNP-based gene editing medicine may comprise a combination of coding RNA (e.g., encoding a CRISPR nuclease) and non-coding RNAs (e.g., guide RNAs). In various embodiments, the RNA molecule delivered by the herein disclosed LNPs can be a linear mRNA. In other embodiments, the RNA molecule delivered by the herein disclosed LNPs can be a circular RNA. In still other embodiments, the RNA molecule delivered by the herein disclosed LNPs can include both linear and circular forms of RNA. In further embodiments, the RNA may comprise one or more modifications, including chemical modifications (e.g., ribonucleotide analogs, alternative phosphate chain linkers), sequence modification (e.g., relative to a wild type sequence), and / or structural modification (e.g., secondary-folded structures, such as, but not limited to, stem-loops, hairpins, and G-quadruplexes, and tertiary structural elements, such as, but not limited to, helical duplexes and triple-stranded structures).A. LNP-Based RNA Vaccines

[0030] Described herein in certain aspects are improved LNP-based RNA vaccines for use in immunization against disease. In various aspects, the disclosure describes improved LNPs, including better performing ionizable lipids, that enhance the targeted delivery of LNP-based RNA vaccines and therapeutics based on linear and / or circular RNAs. The improved LNPs protect linear and / or circularRef. No. OR-048WO1 / / OBS-033WORNA cargos (i.e., the circular and / or linear RNA molecules encapsulated by the LNPs) from degradation and clearance while achieving targeted systemic or local delivery for use as enhanced vaccines.

[0031] Tire instant specification describes compositions, methods, processes, kits and devices for the selection, design, preparation, manufacture, formulation, and / or use of LNP -based RNA vaccines. In particular, as described herein are compositions, methods, processes, kits and devices for the selection, design, preparation, manufacture, formulation, and / or use of LNP-based RNA vaccines for the delivery of an RNA molecule that codes for one or more immunogenic viral antigens for use as vaccine and / or immunogenic compositions. In various embodiments, the RNA molecules delivered by the herein disclosed LNPs can be linear mRNA. In other embodiments, the RNA molecules delivered by the herein disclosed LNPs can be circular RNA. In still other embodiments, the RNA molecule delivered by the herein disclosed LNPs can include both linear and circular fonns of RNA. In further embodiments, the RNA may comprise one or more modifications, including chemical modifications (e.g., ribonucleotide analogs, alternative phosphate chain linkers), sequence modification (e.g., relative to a wild type sequence), and / or structural modification (e.g., secondary-folded structures, such as, but not limited to, stem-loops, hairpins, and G-quadruplcxcs, and tertiary structural elements, such as, but not limited to, helical duplexes and triple-stranded structures). In various other embodiments, the disclosure provides novel lipid components of the herein disclosed LNPs, including, but not limited to, novel ionizable lipids.B. LNP-Based RNA Therapeutics

[0032] Described herein in certain aspects are improved LNP-based RNA therapeutics for use in treating disease or a symptom thereof. In various aspects, the disclosure describes improved LNPs, including better performing ionizable lipids, that enhance the targeted delivery of LNP-based RNA therapeutics based on linear and / or circular RNAs. Hie improved LNPs protect linear and / or circular RNA cargos (i.e., the circular and / or linear RNA molecules encapsulated by the LNPs) from degradation and clearance while achieving targeted systemic or local delivery for use as enhanced therapeutic agents.

[0033] The instant specification describes compositions, methods, processes, kits and devices for the selection, design, preparation, manufacture, formulation, and / or use of LNP-based RNA therapeutics. In particular, described herein are compositions, methods, processes, kits and devices for the selection, design, preparation, manufacture, formulation, and / or use of LNP-based RNA therapeutics for the delivery of an RNA molecule that codes for one or more therapeutic proteins for use treating a disease or a symptom thereof. Further described herein are compositions, methods, processes, kits and devices for the selection, design, preparation, manufacture, formulation, and / or use of LNP-based RNA therapeutics for the administration of an RNA molecule that codes for one or more therapeutic proteins for the prophylactic and / or therapeutic treatment of one or more diseases or a symptom thereof. In various embodiments, the RNA molecules delivered by the herein disclosed LNPs can be linear mRNA. In otherRef. No. OR-048WO1 / / OBS-033WOembodiments, the RNA molecules delivered by the herein disclosed LNPs can be circular RNA. In still other embodiments, the RNA molecules delivered by the herein disclosed LNPs can include both linear and circular fonns of RNA. In further embodiments, the RNA may comprise one or more modifications, including chemical modifications (e.g., ribonucleotide analogs, alternative phosphate chain linkers), sequence modification (e.g.. relative to a wild type sequence), and / or structural modification (e.g.. secondary-folded structures, such as, but not limited to, stem-loops, hairpins, and G-quadruplexes, and tertiary structural elements, such as, but not limited to, helical duplexes and triple-stranded structures). In various other embodiments, the disclosure provides novel lipid components of the herein disclosed LNPs, including, but not limited to, novel ionizable lipids.C. LNP-Based Gene Editing Therapeutics

[0034] Also described herein are LNP compositions comprising gene editing systems for use in treating disease and / or otherwise modifying the sequence and / or expression of target nucleotide sequences. Tire disclosure provides LNPs capable of delivering a gene editing system to a target organ, tissue, and / or cell. The gene editing systems may be delivered to cells under in vitro or ex vivo conditions and to organs, tissues, or cells under in vivo conditions (e.g., administered to a subject in an effective amount).

[0035] The disclosure also provides in various aspects therapeutic or pharmaceutical compositions comprising LNPs comprising gene editing systems or one or more components thereof. The gene editing systems may comprise DNA components, RNA components, protein components, nucleoprotein components, polysaccharide components, or combinations thereof. In other aspects, the disclosure provides nucleic acid molecules (e.g., RNA or DNA) that encode and / or constitute various componentry of the deliverable gene editing systems contemplated herein. In addition, other aspects of the disclosure provide nucleic acid molecules as components of the herein contemplated gene editing systems, such as, but not limited to plasmids or vectors encoding one or more components of a gene editing system. RNAs encoding one or more components of a gene editing system (e.g., RNAs coding for a nuclease domain of a gene editing system), and non-coding RNAs (e.g., guide RNAs capable of complexing with and targeting a nucleic acid-programmable DNA binding domain to a specific target nucleotide sequence or a retron ncRNAs).

[0036] In further embodiments, the nucleic acid components (e.g., RNA) may comprise one or more modifications, including chemical modifications (e.g.. ribonucleotide analogs, alternative phosphate chain linkers), sequence modification (e.g., relative to a wild type sequence), and / or structural modification (e.g., secondary-folded structures, such as, but not limited to, stem-loops, hairpins, and G-quadruplexes, and tertiary structural elements, such as, but not limited to, helical duplexes and triple-stranded structures).Ref. No. OR-048WO1 / / OBS-033WO

[0037] The disclosure, in other aspects, describes various protein components (which may be encoded by the nucleic acid components described herein) of the various gene editing systems contemplated herein, including, but not limited to, user-programmable DNA binding proteins and various effector proteins, such as nucleases, polymerases, reverse transcriptases, recombinases, integrases, endonucleases, exonucleases, transposases, and deaminases.

[0038] The disclosure also describes nucleoprotein components of the gene editing systems contemplated herein, such as, but not limited to nuclease-guide RNA complexes. The disclosure also provides methods of modifying the sequence and / or expression level of a target nucleic acid molecule through the delivery and / or administration of an LNP described herein that comprises a gene editing system or components thereof. Still further, the disclosure provides methods of treating a disease by administering a therapeutically effective amount of an LNP-based gene editing system that results in the modification in the sequence and / or expression level of a target nucleic acid molecule (e.g., a disease-associated gene or regulatory sequence, such as a promoter, transcription factor binding site, or gene enhancer site).

[0039] Tire gene editing systems deliverable by the herein disclosed LNPs can be any type of gene editing system. Without limitation, the gene editing systems contemplated herein can include (A) nucleobase gene editing systems which result in one or more the changes to the sequence of a target nucleic acid molecule (e.g., a gene or gene regulatory sequence) (sequence modifications may include, but are not limited to, an insertion of one or more base pairs, a deletion of one of more base pairs, a substitution or one or more base pairs, a conversion of a base pair to another base pair (e.g., a G: C pair converted to an A: T pair), an inversion, or a translocation), (B) an epigenetic editing system which results in one or more modifications to the epigenome to bring about an effect on gene expression without altering the sequence of a nucleic acid molecule, and (C) gene editing systems that combine the features of nucleobase editing systems and epigenetic editing systems (e.g., combining components from both types of systems to change the sequence and an epigenomic component with one system).

[0040] Nucleobase editing systems include a wide array of configurations with various combinations of protein functionalities and / or nucleic acid molecule components, all of which are contemplated herein. In general, nucleobase editing systems comprise at least a (i) DNA binding domain that is user-programmable to target a specific sequence in a nucleic acid molecule and optionally (ii) one or more effector domains that facilitate the modification of the sequence of the nucleic acid molecule. Userprogrammability may comprise amino acid sequence-programmable DNA binding domains (e.g., TALENS, zinc finger-binding domains, meganucleases (or homing endonucleases)) or nucleic acid sequence -programmable DNA binding domains or proteins (“naspDBP") (e.g., CRISPR-Cas9, CRISPR-Casl2a, CRISPR-Casl2f, CRISPR-Casl3a, CRISPR-Casl3b, or TnpB).Ref. No. OR-048WO1 / / OBS-033WO

[0041] Similarly, epigenetic editing systems comprise at least a (i) DNA binding domain that targets a specific sequence in a nucleic acid molecule and (ii) one or more effector domains that facilitates the modification of one or more epigenomic features of the nucleic acid molecule.

[0042] Gene editing systems may comprise one or more effector domains that provide various functionalities that facilitate changes in nucleotide sequence and / or gene expression, such as, but not limited to, single-strand DNA binding proteins, nucleases, endonucleases, exonucleases, deaminases (e.g., cytidine deaminases or adenosine deaminases), polymerases (e.g., reverse transcriptases), integrases, recombinases, etc., and fusion proteins comprising one or more functional domains linked together.

[0043] In addition, gene editing systems that utilize a nucleic acid sequence-programmable DNA binding domain or protein (naspDBP) may also comprise one or more non-coding nucleic acids, such as, one or more guide RNAs which complex with the nucleic acid programmable DNA binding protein (naspDBP) and target the complex to a specific nucleotide sequence. In the case of prime editing, the guide RNA may be a prime editing guide RNA (“pegRNA”) which comprises a specialized RNA template molecule that provides a template or coding sequence for a reverse transcriptase of the prime editing system. In some embodiments, the RNA template molecule may be coupled to a guide RNA as an extension arm at the 5’ or 3’ end of the guide RNA. In other embodiments, the RNA template molecule may be provided in trans as a separate molecule in a manner such that the RNA template molecule may itself become localized and associated with the target sequence and / or the gene editing system at the site of editing. In some embodiments, co-localization of an in trans RNA template molecule may be achieved with an aptamer or other RNA structure which binds to a binding partner that is coupled to, integrated with, or otherwise associated with the editing complex.

[0044] In the case of editing systems comprising a nucleic acid sequence-programmable DNA binding protein (naspDBP), such as a CRISPR-Cas9 or CRISPR-Casl2a nuclease, appropriate guides may be designed and synthesized using methods, software, and commercial sources which are well known to those having ordinary skill in the art such that guide RNAs for any given naspDBP may be obtained without undue experimentation.

[0045] Reference may be made to the following references providing information and tools for the design, synthesis, modification, and structural configuration of guide RNAs: (1) Mohr SE, Hu Y, Ewen-Campen B, Housden BE, Viswanatha R, Perrimon N. CRISPR guide RNA design for research applications. FEBS J. 2016 Sep;283(17):3232-8. doi: 10.1 Hl / febs.13777. Epub 2016 Jun 22. PMID: 27276584; PMCID: PMC5014588; (2) Hoberecht L, Perampalam P. Lun A, Fortin JP. A comprehensive Bioconductor ecosystem for the design of CRISPR guide RNAs across nucleases and technologies, Nat Commun. 2022 Nov 2; 13( 1): 6568. doi: 10.1038 / s41467-022-34320-7. PMID: 36323688; PMCID:PMC9630310; (3) Cram D, Kulkarni M, Buchwaldt M, Rajagopalan N, Bhowmik P, Rozwadowski K,Ref. No. OR-048WO1 / / OBS-033WOParkin IAP, Sharpe AG, Kagale S. WheatCRISPR: a web-based guide RNA design tool for CRISPR / Cas9-mediated genome editing in wheat. BMC Plant Biol. 2019 Nov 6; 19( 1):474. doi:10.1186 / sl2870-019-2097-z. PMID: 31694550; PMCID: PMC6836449; (4) Pliatsika V, Rigoutsos I. " Off-Spotter": very fast and exhaustive enumeration of genomic lookalikes for designing CRISPR / Cas guide RNAs. Biol Direct. 2015 Jan 29; I0:4. doi: 10.1186 / sl3062-015-0035-z. PMID: 25630343; PMCID: PMC4326336; (5) Hoof JB. Nodvig CS, Mortensen UH Genome Editing: CRISPR-Cas9. Methods Mol Biol. 2018; 1775: 119-132. doi: 10.1007 / 978-1-4939-7804-5_11. PMID: 29876814; (6) Labun K, Krause M, Torres Cleuren Y, Valen E. CRISPR Genome Editing Made Easy Through the CHOPCHOP Website. Curr Protoc. 2021 Apr;l(4):c46. doi: 10.1002 / cpzl.46. PMID: 33905612; (7) Lee CM, Davis TH, Bao G. Examination of CR1SPR / Cas9 design tools and the effect of target site accessibility on Cas9 activity. Exp Physiol. 2018 Apr 1; J 03(4):456-460. doi: 10.1113 / EP086043. Epub 2017 Apr 12. PMID: 28303677; PMCID: PMC7266697; (8) Ma S, Lv J, Feng Z, Rong Z, Lin Y. Get ready for the CRISPR / Cas system: A beginner's guide to the engineering and design of guide RNAs. J Gene Med. 2021 Nov;23(l l):e3377. doi: 10.1002 / jgm.3377. Epub 2021 Jul 28. PMID: 34270141 (9) Hiranmanoj K, Chen Y. Wang X.CRISPR / Cas9 Guide RNA Design Rules for Predicting Activity. Methods Mol Biol. 2020;2115:351-364. doi: 10.1007 / 978-1-0716-0290-4_9. PMID: 32006410; (10) Wiles MV, Qin W, Cheng AW, Wang H. CRlSPR-Cas9-mediated genome editing and guide RNA design. Mamm Genome. 2015 Oct;26(9-10) 501-510. doi: 10.1007 / s00335-015-9565-z. Epub 2015 May 20. PMID: 25991564; PMCID:PMC4602062; (11) Creutzburg SCA, Wu WY, Mohanraju P, Swartjes T, Alkan F, Gorodkin J, Staals RHJ, van der Oost J. Good guide, bad guide: spacer sequence-dependent cleavage efficiency of Cast 2a. Nucleic Acids Res. 2020 Apr 6;48(6):3228-3243. doi: 10.1093 / nar / gkzl240. PMID: 31989168; PMCID: PMC7102956; (12) Heigwer F, Boutros M. Cloud-Based Design of Short Guide RNA (sgRNA) Libraries for CRISPR Experiments. Methods Mol Biol. 2021;2162:3-22. doi: 10.1007 / 978-1-0716-0687-2_1. PMID: 32926374; (13) Dronina J, Samukaite-Bubniene U, Ramanavicius A. Towards application of CRISPR-Casl2a in the design of modern viral DNA detection tools (Review). J Nanobiotechnology. 2022 Jan 2I;20(l):41. doi: 10.1186 / sl2951-022-01246-7. PMID: 35062978; PMCID: PMC8777428; (14) Krysler AR, Cromwell CR, Tu T, Jovel J, Hubbard BP. Guide RNAs containing universal bases enable Cas9 / Casl2a recognition of polymorphic sequences. Nat Commun. 2022 Mar 25; 13(1 ): 1617. doi:10.1038 / s41467-022-29202-x. PMID: 35338140; PMCID: PMC8956631; (15) Shin HR, Kweon J, Kim Y. Gene Manipulation Using Fusion Guide RNAs for Cas9 and Casl2a. Methods Mol Biol.2021;2162:185-193 doi: 10.1007 / 978-1-0716-0687-2_10. PMID: 32926383; (16) Schubert MS.Thommandru B, Woodley J, Turk R, Yan S, Kurgan G, McNeill MS, Rettig GR. Optimized design parameters for CRISPR Cas9 and Casl2a homology-directed repair. Sei Rep. 2021 Sep 30; 11(1): 19482. doi: 10.1038 / s41598-021-98965-y. PMID: 34593942; PMCID: PMC8484621; (17) Crone MA,Ref. No. OR-048WO1 / / OBS-033WOMacDonald JT, Freemont PS, Siciliano V. gDesigner: computational design of synthetic gRNAs for Casl2a-based transcriptional repression in mammalian cells. NPJ Syst Biol Appl. 2022 Sep 16;8( 1 ):34, doi: 10.1038 / s41540-022-00241-w. PMID: 36114193; PMCID: PMC9481559; (18) Konstantakos V, Nentidis A, Krithara A, Paliouras G. CRISPR-Cas9 gRNA efficiency prediction: an overview of predictive tools and the role of deep learning. Nucleic Acids Res. 202.2 Apr 22;50(7): 3616-3637. doi: 10.1093 / nar / gkacl92. PMID: 35349718; PMCID: PMC9023298; (19) Wang J, Zhang X, Cheng L, Luo Y. An overview and metanalysis of machine and deep learning-based CRISPR gRNA design tools. RNA Biol. 2020 Jan;17(l): 13-22. doi: 10.1080 / 15476286.2019.1669406. Epub 2019 Sep 27. PMID: 31533522; PMCID: PMC6948960; and (20) Cram D, Kulkarni M, Buchwaldt M, Rajagopalan N, Bhowmik P, Rozwadowski K, Parkin IAP, Sharpe AG, Kagale S. WheatCRISPR: a web-based guide RNA design tool for CRISPR / Cas9-mediated genome editing tn wheat. BMC Plant Biol, 2019 Nov 6; 19( 1):474. doi: 10 1186 / sl 2870-019-2097-z. PMID: 31694550; PMCID: PMC6836449; each of which are incorporated herein by reference in their entireties.

[0046] In the case of prime editing, in particular, further reference may be made to the following references providing information and tools for the design, synthesis, modification, and structural configuration of pegRNAs: (1) Hsu JY, Griinewald J, Szalay R, Shih J, Anzalone AV, Lam KC, Shen MW, Petri K, Liu DR. Joung JK, Pinello L. PrimeDesign software for rapid and simplified design of prime editing guide RNAs. Nat Commun. 2021 Feb 15;12(1): 1034. doi: 10.1038 / s41467-021-21337-7. PMID: 33589617; PMCID: PMC7884779; (2) Li Y, Chen J, Tsai SQ, Cheng Y. Easy-Prime: a machine learning-based prime editor design tool. Genome Biol. 2021 Aug 19;22( 1):235. doi: 10.1186 / sl 3059-021- 02458-0. PMID: 34412673; PMCID: PMC8377858; (3) Zhang W, Petri K, Ma J, Lee H, Tsai CL, Joung JK, Yeh JJ. Enhancing CRISPR prime editing by reducing misfolded pegRNA interactions. bioRxiv [Preprint]. 2023 Aug 15:2023.08.14553324. doi: 10.1101 / 2023.08.14.553324. PMID: 37645936;PMCID: PMC 10462064; (4) Jin S, Lin Q, Gao Q, Gao C. Optimized prime editing in monocot plants using PlantPegDesigner and engineered plant prime editors (ePPEs). Nat Protoc. 2023 Mar; 18(3): 831-853. doi: I0.1038 / s41596-022-00773-9. Epub 2022 Nov 25. PMID: 36434096; (5) Lin Q, Jin S, Zong Y, Yu H, Zhu Z, Liu G, Kou L, Wang Y, Qiu JL, Li J, Gao C. High-efficiency prime editing with optimized, paired pegRNAs in plants. Nat Biotechnol. 2021 Aug;39(8):923-927. doi: 10.1038 / s41587-021-00868-w. Epub 2021 Mar 25. PMID: 33767395; (6) Standage-Beier K, Tekel SJ, Brafinan DA, Wang X. Pnme Editing Guide RNA Design Automation Using PINE-CONE. ACS Synth Biol. 2021 Feb 19; I0(2):422- 427. doi: 10.1021 / acssynbio.0c00445. Epub 2021 Jan 19. PMID: 33464043; PMCID: PMC7901017; (7) Zhang W, Petri K, Ma J, Lee H, Tsai CL, Joung JK, Yeh JJ. Enhancing CRISPR prime editing by reducing misfolded pegRNA interactions. bioRxiv [Preprint], 2023 Aug 15:2023.08.14.553324. doi: 10.1101 / 2023.08.14.553324. PMID: 37645936; PMCID: PMCT0462064; (8) Chow RD, Chen JS. Shen J.Ref. No. OR-048WO1 / / OBS-033WOChen S. A web tool for the design of prime-editing guide RNAs Nat Biomed Eng. 2021 Feb;5(2): 190- 194 dot: 10 1038 / s41551-020-00622-8. Epub 2020 Sep 28. PMID: 32989284; PMCID: PMC7882013; each of which are incorporated herein by reference in their entireties.

[0047] Reference may also be made to the following commercial vendors which sell guide RNAs for CRISPR editing applications (including base editing and prime editing) and provide various tools and instruction for the ordering, design, synthesis, modification, and structural configuration of guide RNAs: GENSCRIPT, SYNTHEGO, TAKARA BIO, INTEGRATED DNA TECHNOLOGIES, LC SCIENCES, HORIZON DISCOVERY; SIGMA-ALDRICH; ORIGENE, and TWIST BIOSCIENCES, among others.

[0048] In addition, guide RNA may be modified with chemical modifications and / or structural modifications for enhancing various properties thereof, including specificity, stability, and limiting off-target activity. One of ordinary skill in the art will be able to modify a guide RNA with any known modification without undue experimentation. Guide modifications are discussed in the following references: (1) Ke Y, Ghalandari B, Huang S, Li S, Huang C, Zhi X, Cui D, Ding X. 2'-O-Methyl modified guide RNA promotes the single nucleotide polymorphism (SNP) discrimination ability of CRISPR-Cas 12a systems. Chem Sei. 2022 Feb 1; 13(7): 2050-2061. doi: 10.1039 / dlsc06832f. PMID: 35308857: PMCID: PMC8848812; (2) Allen D, Rosenberg M, Hendel A. Using Synthetically Engineered Guide RNAs to Enhance CRISPR Genome Editing Systems in Mammalian Cells. Front Genome Ed. 2021 Jan 28:2:617910. doi: 10.3389 / fgeed.2020.617910. PMID: 34713240; PMCID: PMC8525374; (3) BasilaM, Kelley ML, Smith AVB. Minimal 2'-O-methyl phosphorothioate linkage modification pattern of synthetic guide RNAs for increased stability and efficient CRISPR-Cas9 gene editing avoiding cellular toxicity. PLoS One. 2017 Nov 27;12(1 l):e0188593. doi: 10.1371 / journal.pone.0188593. PMID:29176845; PMCID: PMC5703482; (4) Sakovina L, Vokhtantsev I, Vorobyeva M, Vorobyev P, Novopashina D. Improving Stability and Specificity of CRISPR / Cas9 System by Selective Modification of Guide RNAs with 2'-fluoro and Locked Nucleic Acid Nucleotides. Int J Mol Sci. 2022 Nov 3;23(21): 13460. doi: I0.3390 / ijms232113460. PMID: 36362256; PMCID: PMC9655745; (5) Shapiro J, Tovin A, lancu O, Allen D, Hendel A. Chemical Modification of Guide RNAs for Improved CRISPR Activity in CD34+ Human Hematopoietic Stem and Progenitor Cells. Methods Mol Biol. 2021;2162:37-48. doi: 10.1007 / 978- 1-0716-0687-2_3. PMID: 32926376; (6) Filippova J, Matveeva A. Zhuravlev E, Stepanov G. Guide RNA modification as a way to improve CRISPR / Cas9-based genome-editing systems. Biochimie. 2019 Dec; 167:49-60. doi: 10.1016 / j.biochi.2019.09.003. Epub 2019 Sep 4. PMID: 31493470; (7) Hendel A, Bak RO, Clark IT, Kennedy AB, Ryan DE, Roy S, Steinfeld I, Lunstad BD, Kaiser RJ, Wilkens AB, Bacchetta R, Tsalenko A, Dellinger D, Bruhn L, Porteus MH. Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells. Nat Biotechnol. 2015 Sep;33(9):985-989. doi: 10.1038 / nbt.3290. Epub 2015 Jun 29. PMID: 26121415; PMCID: PMC4729442;Ref. No. OR-048WO1 / / OBS-033WO(8)_ Ryan DE, Taussig D, Steinfeld 1, Phadnis SM, Lunstad BD. Singh M, Vuong X, Okochi KD, McCaffrey R, Olesiak M, Roy S, Yung CW, Curry B, Sampson JR, Bruhn L, Dellinger DJ, Improving CRISPR-Cas specificity with chemical modifications in single-guide RNAs. Nucleic Acids Res. 2018 Jan 25;46(2):792-803. doi: 10.1093 / nar / gkxl 199. Erratum m: Nucleic Acids Res. 2022 Mar 21;50(5):2986. PMID: 29216382; PMCID: PMC5778453; (9) Palumbo CM, Gutierrez-Bujan JM, O'Geen H. Segal DJ, Beal PA Versatile 3’ Functionalization of CRISPR Single Guide RNA Chembiochem. 2020 Jun 2:21(11 ): 1633- 1640. dor 10.1002 / cbic.201900736. Epub 2020 Mar 5. PMID: 31943634; PMCID:PMC7323579; (10) Mullally G, van Aelst K, Naqvi MM, Diffin FM, Karvelis T, Gasiunas G, Siksnys V, Szczclkun MD. 5' modifications to CRISPR-Cas9 gRNA can change the dynamics and size of R-loops and inhibit DNA cleavage. Nucleic Acids Res. 2020 Jul 9;48(I2):6811-6823. doi: 10.1093 / nar / gkaa477. PMID: 32496535; PMCID: PMC7337959; (12) Lu S, Zhang Y, Yin H. Chimeric DNA-RNA Guide RNA Designs. Methods Mol Biol 2021;2162:79-85. doi: 10.1007 / 978-1-0716-0687-2_6. PMID: 32926379; each of which are incorporated by reference herein in their entireties.

[0049] In the specific case of prime editing, pegRNAs may be modified with chemical modifications and / or structural modifications for enhancing various properties thereof, including specificity, stability, and limiting off-target activity. One of ordinary skill in the art will be able to modify a pegRNA for prime editing with any known modification without undue experimentation. pegRNA modifications are discussed in the following references: (1) Nelson JW, Randolph PB, Shen SP, Everette KA. Chen PJ, Anzalone AV, An M, Newby GA, Chen JC, Hsu A, Liu DR. Engineered pegRNAs improve prime editing efficiency. Nat Biotechnol. 2022 Mar;40(3):402-410. doi: 10.1038 / s41587-021-01039-7. Epub 2021 Oct 4. Erratum in: Nat Biotechnol. 2021 Dec 8;: PMID: 34608327; PMCID: PMC8930418; (2) Liu B, Dong X, Cheng H, Zheng C. Chen Z, Rodriguez TC, Liang SQ, Xue W, Sontheimer EJ. A split prime editor with untethered reverse transcriptase and circular RNA template. Nat Biotechnol, 2022 Sep;40(9): 1388-1393. doi: 10.1038 / s41587-022-01255-9. Epub 2022 Apr 4. PMID: 35379962; each of which are incorporated by reference herein in their entireties.

[0050] Other specialized guide RNAs may be included depending upon the requirements and / or nature of the gene editing system and the cognate nucleic acid programmable proteins. For example, TnpB enzymes require a specialized guide RNA referred to as reRNA. Also, guide RNAs have different characteristics (e.g., PAM preferences, the spacer length, and the scaffold portion that binds to the nuclease protein) depending upon the programmable nuclease requirements.

[0051] The gene editing systems contemplated here may introduce a wide variety of changes, including (A) a change in the sequence of the target nucleic acid molecule, such as, but not limited to, (i) a nucleobase substitution (e g., a purine to a pyrimidine), (ii) a deletion of one or more nucleobases, (iii) an insertion of one or more nucleobases, (iv) a combination of a deletion and insertion of one or moreRef. No. OR-048WO1 / / OBS-033WOnucleobases, (v) an inversion of a nucleobase sequence, a (vi) translocation of a nucleobase sequence, and (vii) a combination or two or more such modifications, and (B) one or more modifications to the epigenome to bring about an effect on gene expression without altering the sequence of a nucleic acid molecule wherein said epigenetic change results in altered gene expression through altered chromatin structure or accessibility.

[0052] The LNP compositions and / or gene editing systems described herein may include a variety of coding RNA molecules that code for the various components of gene editors. In various aspects, the coding RNA may be linear mRNA. In other embodiments, the coding RNA may be circular RNA. In various aspects, the improved LNPs protect linear and / or circular RNA cargos from degradation and clearance while achieving targeted systemic or local delivery for use as enhanced gene editing platforms and / or therapeutic agents.

[0053] In various other aspects, the LNP compositions and / or gene editing systems described herein may also include a repair template, e.g., an homology-directed repair (HDR)-dependent repair template (or HDR template). Such HDR templates are well-known in the art and can include single-strand or doublestranded DNA (e.g., oligos) or RNA. Further information regarding HDR and HDR templates for use in editing systems for various applications, such as gene knock-in, may be found in Fu YVv. Dai XY, Wang WT. Yang ZX. Zhao JJ, Zhang JP, Wen W, Zhang F, Oberg KC, Zhang L, Cheng T, Zhang XB.Dynamics and competition of CRISPR-Cas9 ribonucleoproteins and AAV donor-mediated NHEJ, MMEJ and HDR editing. Nucleic Acids Res 2021 Jan 25;49(2):969-985. doi: 10 1093 / nar / gkaal251 PMID: 33398341; PMCID: PMC7826255; Iyer S, Mir A, Vega-Badillo J, Roscoe BP, Ibraheim R, Zhu LJ, Lee J, Liu P, Luk K, Mintzer E, Guo D, Soares de Brito J, Emerson CP Jr, Zamore PD, Sontheimer EJ, Wolfe SA. Efficient Homology-Directed Repair with Circular Single-Stranded DNA Donors. CRISPR J. 2022 Oct:.5(5):685-701, doi: I0.1089 / crispr.2022.0058. Epub 2022 Sep 7. PMID: 36070530; PMCID:PMC9595650; and Richardson CD, Ray GJ, DeWitt MA, Curie GL, Com JE. Enhancing homology- directed genome editing by catalytically active and inactive CR1SPR-Cas9 using asymmetric donor DNA. Nat Biotechnol. 2016 Mar;34(3):339-44. doi: 10.1038 / nbt.3481. Epub 2016 Jan 20. PMID: 26789497, each of which are incorporated herein by reference in their entireties.

[0054] Accordingly, the instant specification describes compositions, methods, processes, kits and devices for the selection, design, preparation, manufacture, formulation, and / or use of LNP-based gene editing systems as therapeutic compositions. Further described herein are compositions, methods, processes, kits and devices for the selection, design, preparation, manufacture, formulation, and / or use of LNP-based gene editing therapeutics for the prophylactic and / or therapeutic treatment of one or more diseases or a symptom thereof. Tire components capable of being encapsulated by or otherwise incorporated by the LNPs described herein may be referred to as LNP “payloads” and may include all ofRef. No. OR-048WO1 / / OBS-033WOthe biological materials described above, including DNA molecules, RNA molecules (coding and / or noncoding), proteins, and nucleoproteins (e.g., Cas / guide RNA complexes).II. LNP delivery systems

[0055] The RNA payloads (e.g., linear and circular RNAs) described herein may be encapsulated and delivered by lipid nanoparticles (LNPs) and compositions and / or formulations comprising RNA-encapsulated LNPs.

[0056] Below describes LNPs that may be used as the RNA payload delivery vehicles contemplated herein, as well as the various ionizable lipids, structural lipids, PEGylated lipids, and phospholipids that may be used to make the herein LNPs for delivery RNA payloads to cells. In addition, below describes additional LNP components that are contemplated, such as targeting moieties and other lipid components.A. Lipid Nanoparticle Compositions

[0057] In one aspect, the present disclosure further provides delivery systems for delivery of a therapeutic payload (e.g., the RNA payloads described herein which may encode a polypeptid of interest, e.g., an antigen or a therapeutic protein) disclosed herein. In some embodiments, a delivery system suitable for delivery of the therapeutic payload disclosed herein comprises a lipid nanoparticlc (LNP) formulation.

[0058] In some embodiments, an LNP of the present disclosure comprises an ionizable lipid, a structural lipid, a PEGylated lipid (aka PEGylated lipid), and a phospholipid. In alternative embodiments, an LNP comprises an ionizable lipid, a structural lipid, a PEGylated lipid (aka PEGylated lipid), and a zwitterionic amino acid lipid. In some embodiments, an LNP further comprises a 5th lipid, besides any of the aforementioned lipid components. In some embodiments, the LNP encapsulates one or more elements of the active agent of the present disclosure. In some embodiments, an LNP further comprises a targeting moiety covalently or non-covalently bound to the outer surface of the LNP. In some embodiments, the targeting moiety is a targeting moiety that binds to, or otherwise facilitates uptake by, cells of a particular organ system.

[0059] In some embodiments, an LNP has a diameter of at least about 20nm, 30 nrn, 40nm, 50nm, 60nm, 70nm, 80nm, or 90nm. In some embodiments, an LNP has a diameter of less than about lOOnm, 1 lOnm, 120nm, 130nm, 140nm, 150nm, or 160nm. In some embodiments, an LNP has a diameter of less than about 120 run. In some embodiments, an LNP has a diameter of less than about lOOnm. In some embodiments, an LNP has a diameter of less than about 90nm. In some embodiments, an LNP has a diameter of less than about 80nm. In some embodiments, an LNP has a diameter of about 60-100nm. In some embodiments, an LNP has a diameter of about 50-120nm. In some embodiments, an LNP has a diameter of about 75-80nm.Ref. No. OR-048WO1 / / OBS-033WOi. Ionizable lipids

[0060] In some embodiments, an LNP disclosed herein comprises an ionizable lipid. In some embodiments, an LNP comprises two or more ionizable lipids.

[0061] Described below are a number of exemplary ionizable Lipids of the Disclosure.

[0062] In some embodiments, an ionizable lipid is selected from a lipid disclosed in PCT Publications WO2023044343AL WO2023044333A1, WO2023122752A1. WO2024044728A1, andWO2023196931 Al, and WO2024192277A1 (each of which is incorporated by reference herein in their entirety). In some embodiments, an ionizable lipid is selected from a lipid disclosed in PCT Publications W02015095340A1, WO2021021634A1, WO2020237227A1, WO2019236673A1, WO2021226597A1, WO2021113777A1, W02023056033A1, and WO2023081526A1 (each of which is incorporated by reference herein in their entirety).

[0063] In some embodiments, an LNP of the present disclosure comprises an ionizable lipid disclosed in PCT Application Publication WO2023044343A 1, which is incorporated by reference herein, in its entirety. In certain embodiments, the ionizable lipid is one of Formulae (VII-A), (VIII-A), (X), or (X-A) of PCT Application Publication WO2023044343A1.

[0064] In some embodiments, an LNP of the present disclosure comprises an ionizable lipid disclosed in PCT Application Publication WO2023044333AL which is incorporated by reference herein, in its entirety. In certain embodiments, the ionizable lipid is one of Fonnulae (CY), (CY-I), (CY-IV), (CY-IV’), or (CY-VF) of PCT Application Publication WO2023044333A1.

[0065] In some embodiments, an LNP of the present disclosure comprises an ionizable lipid disclosed in PCT Publication WO2023122752A1, which is incorporated by reference herein, in its entirety. In certain embodiments, the ionizable lipid is one of Fonnulae II, III, VI, VI’, VI”, VI”’, VII. VIF, VII”. VII’”, VIII, VIII’, VIII”. VIII ”, IX. IX’, IX”, IX ”, X. X’. X ”, X ”, XL XI’, XI”, XI ”, XII, XII’, XII”, XII”’, XIIL XIII’, XIII”, XIII XIV, XIV’, XIV ”, XIV’”, XV, XV’, XV ”, XV ”, XVL XVI’, XVI ”, XVI’”, XVII, XVIII, XVIII’, XIX, XX, or XXI of PCT Application Publication WO2023122752A1.

[0066] In some embodiments, an LNP of the present disclosure comprises an ionizable lipid disclosed in PCT Publication WO2023196931A1, which is incorporated by reference herein, in its entirety. In certain embodiments, the ionizable lipid is one of Fonnulae (CX-I). (CX-i). or (CZ) of PCT Application Publication WO2023196931 A 1. WO2024192277A

[0067] In some embodiments, an LNP of the present disclosure comprises an ionizable lipid disclosed in PCT Publication WO2024192277A1, which is incorporated by reference herein, in its entirety. In certain embodiments, the ionizable lipid is one of Formulae (S-I), (S-M), (AT), (AT-E’), (AT-F’”), (AT-M), (AT-N’), (AT-O’), (AT-P ”), (AC), (CO), (CC), (CC-A), (CC-C), (CC-E), (CC-F’), (CC-H), (CC-J), or (CC-L) of PCT Application Publication WO2024I92277A1.Ref. No. OR-048WO1 / / OBS-033WOFormula (AX’”)

[0068] The present disclosure, in some embodiments, provides compounds of Formula (AX’”):(AX”’),or a pharmaceutically acceptable salt thereof, wherein:A is selected from an optionally substituted 4-14 membered bridged carbocyclic bicycle, bridged carbocyclic multicycle, bridged heterocyclic bicycle, or bridged heterocyclic multicycle:n is and integer selected from 0, 1 or 2;m is an integer selected from 1 or 2, such that m plus n is less than or equal io 3;R1is selected from the group consisting of -OH, -OAc, -NR2, -N(R)RHeach R is independently -H or Ci-Cg aliphatic:each RHis Ci-Cts aliphatic-OH:each X1and XAare each independently a bond or optionally substituted Ci-Ce aliphatic; each Y;is independently selected from the group consisting ofeach X:and X3is independently a bond or optionally substituted C1-C12 aliphatic;each Y2and Y3is independently selected from the group consisting ofRef. No. OR-048WO1 / / OBS-033WOwherein the bond marked with an "*" is attached to X2or X3:each X4and X is independently a bond or optionally substituted Ci-Ce aliphatic;each Y4and Y5is independently selected from the group consisting of a bond.R'; wherein the bond marked with an is attached to X4or X5;each X6and X' is independently a bond or optionally substituted Ci-Cs aliphatic;R2is -CH(OR°)(OR7), -CH(SR6)(SR7), -CH(R6)(R7), -CF(R6)(R j. -R10, optionally substituted Cs-Cis aliphatic, or optionally substituted C1-C14 aliphatic-R1", wherein one or more methylene linkages of R2are each optionally and independently replaced with an optionally substituted C3-Cs cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-, or -C(O)O-;each R3is independently -CH(OR8)(OR9), -CH(SR8)(SR9), -CH(R8)(R9), -CF(R8)(R9), -R11, optionally substituted Cs-Cis aliphatic, or optionally substituted C1-C14 aliphatic-R11, wherein one or more methylene linkages of R3are each optionally and independently replaced with an optionally substituted Cg-Cg cycloalkylenyl, phenyl, -O-. -Nil-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-, or -C(O)O-;Rband R7are each independently optionally substituted -C1-C14 aliphatic, -R1C, or optionally substituted -C1-C14 aliphatic-R10; wherein one or more methylene linkages of R6and R7are each optionally and independently replaced with an optionally substituted Cj-Cg cycloalkylcnyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-. or -C(O)O-:R8and Ryare each independently optionally substituted -C1-C14 aliphatic, -R11, or optionally substituted - C1-C14 aliphatic-R11: wherein one or more methylene linkages of R8and R9are each optionally and independently replaced with an optionally substituted C;!-C8cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NITC(O)-, or -C(O)O-; andeach R10and R11is independently an optionally substituted cy He. bicyclic, bridged bicyclic, multicyclic or bridged multicyclic C4-CY cycloalkyl or optionally substituted cylic, bicyclic, bridged bicyclic, multicyclic or bridged multicyclic 4-14 membered heterocyclyl. or two R10or two R” taken together form an optionally substituted bridged bicyclic or multicyclic C4-C44 cycloalkyl or optionally substituted bridged bicyclic or multicyclic 4-14 membered heterocyclyl:Ref. No. OR-048WO1 / / OBS-033WOwherein one or more of X1, XA, X, X3, X4, Xs, X6. X7. R2and R3is optional!}' and independently substituted with one or more substituents selected from -F. -Cl, -Br and -IFormula (AX”)

[0069] The present disclosure, in some embodiments, provides compounds of Formula (AX”):(AX”),or a pharmaceutically acceptable salt thereof, wherein:A is selected from an optionally substituted 4-14 membered bridged carbocyclic bicycle, bridged carbocyclic multicycle, bridged heterocyclic bicycle, or bridged heterocyclic multicycle;n is and integer selected from 0, 1 or 2;m is an integer selected from 1 or 2, such that m plus n is less than or equal to 3;R1is selected from the group consisting of -OH, -OAc, -NR2,each R is independently -FI or Ci-Cs aliphatic;X1and XAare each independently a bond or optionally substituted Ci-Ce aliphatic;Y1is selected from the group consisting ofR, and a bond; wherein the bond marked with an is attached to X!each X2and X3is independently a bond or optionally substituted C1-C12 aliphatic;each Y2and Y3is independently selected from the group consisting ofRef. No. OR-048WO1 / / OBS-033WO0° „ O * 11 || \ R JL 1 \ A A; " NA / *ANA t \\ 7 ° 7 XoA AyAZ H 'H\ and R♦A^zOy'; wherein the bond marked with an "*" is attached to X2or X3:each X4and X is independently optionally substituted Ci-Cg aliphatic;each Y4and ¥ ' is independently selected from the group consisting of a bond,O On,? o °. \ U 7. A A Isx JL snA / u \ x A 5 L \ \ 7 ° 7 *AoA HZHandR'; wherein the bond marked with an is attached to X4or X5;each X6and X' is independently a bond or optionally substituted Ci-Cs aliphatic;R2is -CH(0Rc)(0R7). -CH(SR6)(SR7), -CH(R6)(R7). -R10, optionally substituted C5-C18 aliphatic, or optionally substituted C1-C1 aliphatic-R10, wherein one or more methylene linkages of R2are each optionally and independently replaced with an optionally substituted C3-Cs cycloalkylenyl, phenyl, -0-, - NIL, -S-, -SS-, -C(0)-, -0C(0)0-, -0C(0)-, -NHC(O)-. or -C(0)0-;each R3is independently -CH(OR8)(OR9), -CH(SR8)(SR9), -CH(R8)(R9), -R11, optionally substituted Cs-Cis aliphatic, or optionally substituted CI-CM aliphatic-R11, wherein one or more methylene linkages of R3are each optionally and independently replaced with an optionally substituted C Cs cycloalkylenyl. phenyl, -0-, -NIL, -S-, -SS-, -C(0)-, -0C(0)0-, -0C(0)-. -NHC(O)-, or -C(0)0-;Rband R7are each independently optionally substituted -C1-C14 aliphatic, -R1C, or optionally substituted -C1-C1 aliphatic-R10; wherein one or more methylene linkages of R6and R7are each optionally and independently replaced with an optionally substituted Cj-Cg cycloalkylcnyl, pheny l, -0-, -NH-, -S-, -SS-, -C(0)-, -0C(0)0-, -0C(0)-, -NHC(O)-. or -C(0)0-;R8and Ryare each independently optionally substituted -C1-C14 aliphatic, -R11, or optionally substituted - C1-C14 aliphatic-R11: wherein one or more methylene linkages of R8and R9are each optionally and independently replaced with an optionally' substituted Cg-Cg cycloalkylenyl, phenyl, -0-, -NH-, -S-, -SS-, -C(0)-, -0C(0)0-, -0C(0)-, -NIIC(O)-, or -C(0)0-; andeach R10and R11is independently an optionally substituted cylic, bicyclic, bridged bicyclic, multicyclic or bridged multicyclic C4-C14 cycloalkyl or optionally substituted cylic, bicyclic, bridged bicyclic, multicyclic or bridged multicyclic 4-14 membered heterocyclyl. or two R10or two R” taken together form an optionally substituted bridged bicyclic or multicyclic C4-C14 cycloalkyl or optionally substituted bridged bicyclic or multicyclic 4-14 membered heterocyclyl.Ref. No. OR-048WO1 / / OBS-033WOFormula (AX’)

[0070] The present disclosure, in some embodiments, provides compounds of Formula (AX’):or a pharmaceutically acceptable salt thereof wherein:A is selected from an optionally substituted 4-14 membered bridged carbocyclic bicycle, bridged carbocyclic multicycle, bridged heterocyclic bicycle, or bridged heterocyclic multicycle;n is and integer selected from 1 or 2;R' is selected from the group consisting of -OH. -OAc, -NR2,each R is independently -H or Ci-Cs aliphatic;X1and XAare each independently a bond or optionally substituted Ci -Ce aliphatic;Y!is selected from the group consisting of', and a bond; wherein the bond marked with an is attached to X1;each X2and X3is independently a bond or optionally substituted C1-C12 aliphatic;each Y2and Y3is independently selected from the group consisting ofRef. No. OR-048WO1 / / OBS-033WOR'; wherein the bond marked with an "*" is attached to X2or X3:each X4and X is independently optionally substituted Ci-Cg aliphatic;R2is -CH(OR6)(OR7), -CH(SR6)(SR7), -CH(R6)(R7), -R!0, optionally substituted C5-C18 aliphatic, or optionally substituted C1-C14 aliphatic-R10, wherein one or more methylene linkages of R2are each optionally and independently replaced with an optionally substituted Cs-Cs cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-. or -C(O)O-;each R3is independently -CH(ORs)(ORy), -CH(SRS)(SRS), -CH(R5)(Ry), -R. optionally substituted Cs-Cis aliphatic, or optionally substituted C1-C14 aliphatic-R11, wherein one or more methylene linkages of R3are each optionally and independently replaced with an optionally substituted Cj-Cg cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O~, -OC(O)-, -NHC(O)-, or -C(O)O-;R6and R7are each independently optionally substituted -CI-CH aliphatic, -R10, or optionally substituted -C1-C14 aliphatic-R10: wherein one or more methylene linkages of R6and R7are each optionally and independently replaced with an optionally substituted Cs-Cg cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-. -NHC(O)-, or -C(O)O-;Rsand R9are each independently optionally substituted -C1-C14 aliphatic, -R”, or optionally substituted - C1-C1 aliphatic-R11; wherein one or more methylene linkages of R8and Ryare each optionally and independently replaced with an optionally substituted Cg-Cg cycloalkylenyl, phenyl, -O-, -NFI-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-, or -C(O)O-; andeach R10and R11is independently an optionally substituted cylic. bicyclic, bridged bicyclic, multicyclic or bridged multicyclic C.-( cycloalkyl or optionally substituted cylic, bicyclic, bridged bicyclic, multicyclic or bridged multicyclic 4-14 membered heterocyclyl, or two R10or two R11taken together form an optionally substituted bridged bicyclic or multicyclic C4-C14 cycloalkyl or optionally substituted bridged bicyclic or multicyclic 4-14 membered heterocyclyl.Formula (AX^)

[0071] The present disclosure, in some embodiments, provides compounds of Formula (AX*):(AX*),Ref. No. OR-048WO1 / / OBS-033WOor a pharmaceutically acceptable salt thereof, wherein:A is selected from an optionally substituted bridged carbocyclic or heterocyclic core selected from thegroup consisting of:n is and integer selected from 0, 1 or 2;m is an integer selected from 1 or 2, such that m plus n is less than or equal to 3;R1is selected from the group consisting of -OH, -OAc, -NRj, -N(R)Reach R is independently -H or Ci-Ce aliphatic:each RHis Ci-Cs aliphatic-OH;each X'1and XAare each independently a bond or optionally substituted Ci-Cg aliphatic:each Y;is independently selected from the group consisting ofR', and a bond; wherein the bond marked with an is attached to X1;each X and X3is independently a bond or optionally substituted C1-C12 aliphatic;each Y2and Y3is independently selected from the group consisting ofRef. No. OR-048WO1 / / OBS-033WORwherein the bond marked with an "*" is attached to X2or X3:each X4and X' is independently a bond or optionally substituted Ci-Ce aliphatic;each Y4and Y5is independently selected from the group consisting of a bond.R'; wherein the bond marked with an is attached to X4or X5;each X6and X' is independently a bond or optionally substituted Ci-Cs aliphatic;R2is -CH(OR°)(OR7), -CH(SR6)(SR7), -CH(R6)(R7), -CF(R6)(R j. -R10, optionally substituted Cs-Cis aliphatic, or optionally substituted C1-C14 aliphatic-R1", wherein one or more methylene linkages of R2are each optionally and independently replaced with an optionally substituted C3-Cs cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-, or -C(O)O-;each R3is independently -CH(OR8)(OR9), -CH(SR8)(SR9), -CH(R8)(R9), -CF(R8)(R9), -R11, optionally substituted C5-C18 aliphatic, or optionally substituted C1-C14 aliphatic-R11, wherein one or more methylene linkages of R3are each optionally and independently replaced with an optionally substituted Cg-Cg cycloalkylenyl, phenyl, -O-. -Nil-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-, or -C(O)O-;Rband R7are each independently optionally substituted -C1-C14 aliphatic, -R1C, or optionally substituted -C1-C14 aliphatic-R10; wherein one or more methylene linkages of R6and R7are each optionally and independently replaced with an optionally substituted Cj-Cg cycloalkylcnyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-. or -C(O)O-:R8and Ryare each independently optionally substituted -C1-C14 aliphatic, -R11, or optionally substituted - C1-C14 aliphatic-R11: wherein one or more methylene linkages of R8and R9are each optionally and independently replaced with an optionally substituted Cg-Cg cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NFTC(O)-, or -C(O)O-; andeach R10and R11is independently an optionally substituted cy He. bicyclic, bridged bicyclic, multicyclic or bridged multicyclic C4-CY cycloalkyl or optionally substituted cylic, bicyclic, bridged bicyclic, multicyclic or bridged multicyclic 4-14 membered heterocyclyl. or two R10or two R” taken together form an optionally substituted bridged bicyclic or multicyclic C4-C44 cycloalkyl or optionally substituted bridged bicyclic or multicyclic 4-14 membered heterocyclyl:Ref. No. OR-048WO1 / / OBS-033WOwherein one or more of X1, XA, X, X3, X4, Xs, X6. X7. R2and R3is optional!}' and independently substituted with one or more substituents selected from -F. -Cl, -Br and -IFormula (AX)

[0072] The present disclosure, in some embodiments, provides compounds of Formula (AX):Y3^R3 / ( A )' / nR1. A 1 k2R2(AX),or a pharmaceutically acceptable salt thereof, wherein:A is selected from an optionally substituted bridged carbocyclic or heterocyclic core selected from then is and integer selected from 1 or 2;R1is selected from the group consisting of -OH, -OAc, -NR?,each R is independently -H or Ci-Ce aliphatic;X!and XAare each independently a bond or optionally substituted Ci-C0aliphatic;Y!is selected from the group consisting ofR AN^°y', and a bond; wherein the bond marked with an is attached to X!;each X2and X3is independently a bond or optionally substituted Ci-Ci? aliphatic;each Y2and Y3is independently selected from the group consisting ofRef. No. OR-048WO1 / / OBS-033WOo oR*N^°y': wherein the bond marked with an "*" is attached to X2or X3:each X4and X' is independently optionally substituted Ci-Cg aliphatic;R2is -CH(ORft)(OR7), -CH(SR6)(SR7), -CH(R6)(R7), -Ri0, optionally substituted C5-C18 aliphatic, or optionally substituted C1-C14 aliphatic-R1 u, wherein one or more methylene linkages of R2are each optionally and independently replaced with an optionally substituted Cs-Cs cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-. or -C(O)O-;each R3is independently -CH(ORs)(ORy), -CH(SRS)(SRS), -CH(R5)(Ry), -R. optionally substituted Cs-Cis aliphatic, or optionally substituted C1-C14 aliphatic-R11, wherein one or more methylene linkages of R3are each optionally and independently replaced with an optionally substituted Cj-Cg cycloalkylenyl, phenyl, -O-, -NH-. -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-, or -C(O)O-;R6and R7are each independently optionally substituted -CI-CH aliphatic, -R1C, or optionally substituted - C1-C14 ahphatic-R10: wherein one or more methylene linkages of R6and R7are each optionally and independently replaced with an optionally substituted Cs-Cg cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-. -NHC(O)-, or -C(O)O-;Rsand R9are each independently optionally substituted -C1-C14 aliphatic, -R”, or optionally substituted - C1-C1 aliphatic-R11; wherein one or more methylene linkages of R8and Ryare each optionally and independently replaced with an optionally substituted Cg-Cg cycloalkylenyl, phenyl, -O-, -Nil-, -S-, -SS-. -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-, or -C(O)O-; andeach R10and R11is independently an optionally substituted cylic. bicyclic, bridged bicyclic, multicyclic or budged multicycliccycloalkyl or optionally substituted cylic, bicyclic, bridged bicyclic, multicyclic or bridged multicyclic 4-14 membered heterocyclyl, or two R10or two R11taken together form an optionally substituted bridged bicyclic or multicyclic C4-C14 cycloalkyl or optionally substituted bridged bicyclic or multicyclic 4-14 membered heterocyclyl.Ref. No. OR-048WO1 / / OBS-033WOFormula (TL’)

[0073] The present disclosure, in some embodiments, provides compounds of Formula (TL’):(TL ).or a pharmaceutically acceptable salt thereof, wherein:A’1is selected from CH and N;A2is selected from CH and N;L1is optionally substituted Ci-Cs aliphatic, wherein one or more methylene linkages of L1are each optionally and independently replaced with -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-. -OC(O)-. -NHC(O)-, or -C(O)O-;Ref. No. OR-048WO1 / / OBS-033WOZ2is selected from the group consisting of -O-, -NR-, and -S-;Z3is selected from the group consisting of a bond. -O-, -NR-, -S-, -OC(O)-, -C(O)O-, -NRC(O)-, - C(O)NR-,-NRC(O)O-. or -OC(O)NR-;each Z4is independently selected from:::CR- andL2is optionally substituted Ci-Cg aliphatic, wherein one or more methylene linkages of L1are each optionally and independently replaced with -O-, -NH-, -S-. -SS-, -C(O)-. -OC(O)O-, -OC(O)-, -NHC(O)-, or -C(O)O-;R1is selected from the group consisting of -OH, -OAc, -NR2,Ref. No. OR-048WO1 / / OBS-033WOXzis a bond or optionally substituted Ci-Ce aliphatic;Rzis NR? or OH;X1and XAare each independently a bond or optionally substituted Ci-Cg aliphatic;Y1is selected from the group consisting ofRand bond; wherein the bond marked with an is atached to X’!;each of X2, X3, and X“ is independently a bond or optionally substituted C1-C12 aliphatic;each of Y2, Y3. and Y4is independently selected from the group consisting ofR'; wherein the bond marked with an "*" is attached to X2, X3, of X°, as appropriate; each of X4, X5, and X7is independently optionally substituted Ci-Ce aliphatic;R2is -CH(OR6)(OR ), -CH(SR6)(SR7), -CH(R6)(R7), -R10, optionally substituted C5-CY aliphatic, or optionally substituted C1-C14 aliphatic-R10, wherein one or more methylene linkages of R2are each optionally and independently replaced with an optionally substituted Cs-C? cycloalkylenyl, phenyl, -O-. - NH-. -S-. -SS-. -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-, or -C(O)O-;R3is -CH(ORS)(OR9), -CH(SR8)(SR9), -CH(RS)(R9). -Rn, optionally substituted C5-C18 aliphatic, or optionally substituted C1-C14 aliphatic-R11, wherein one or more methylene linkages of R5are each optionally and independently replaced with an optionally substituted Cs-Cs cycloalkylenyl, phenyl, -O-, - NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-. or -C(O)O-;R12is -CH(OR,3)(OR14). -CH(SR13)(SR14). -CH(R13)(R14). -R15, optionally substituted C5-C1Saliphatic, or optionally substituted C1-C14 aliphatic-R15, wherein one or more methylene linkages of R12are each optionally and independently replaced with an optionally substituted Ch-Cs cycloalkylenyl, phenyl, -O-, - NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-. -NHC(O)-, or -C(O)O-;Rhand R7are each independently optionally substituted -C1-C1 aliphatic, -R1G, or optionally substituted - C1-C14 aliphatic-R10; wherein one or more methylene linkages of R6and R7are each optionally and independently replaced with an optionally substituted C -Cs cycloalkylenyl. phenyl. -O-, -NH-, -S-, -SS-, -C(O)-. -OC(O)O-, -OC(O)-, -NHC(O)-. or -C(O)O-;Ref. No. OR-048WO1 / / OBS-033WOR8and R9are each independently optionally substituted -Ci-Cu aliphatic, -Rn, or optionally substituted - C1-C14 alipbatic-R11; wherein one or more methylene linkages of R8and R9are each optionally and independently re (pla,ced with an optionally substituted Cj-Cs cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-,\ / -C(O)-, -OC(O)O-, -O > < C(O)-, -NHC(O)-, or -C(O)O-:R13and R14are each ind < >ependently optionally substituted -C1-C14 aliphatic, -R19, or optionally substituted X-C1-C14 aliphatic-R1’; where (in one or more methylene linkages of R13and O< R14are each optionally and / independently replaced with an optionally substituted Cj-Cg cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-,)-C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-, or -C(O)O-; rZ— / \ Xeach of RIJ, R.. and R15is independently ( a an optionally substi > Ht Outed cy lie, bicyclic, bridged bicyclic, multicyclic or bridged multicyclic C4-C14 cycloalkyl or ( op <tionally substituted cylic, bicyclic, bridged bicyclic, multicyclic or bridged multicyclic 4-14 membered heterocyclyl, or two Rlu, R" or R'5are takeni< > \ ) <together form an optionally substituted bridged bicyclic or multicyclic C4-C14 cycloalkyl or optionally ) 9 ( ( \substituted bridged bicyclic or multicyclicM4- / 14 membered hTe O (h -te T 1 \rocyclyl.

[0007] n o e > 0 fO (~4 I s m embodiments, Lipids of the Disclosure are select / Xed _ from any lipid in Table (I) below or a pharmaceutically acceptable salt, solvate, stereoisomer, or enantiome / r thereof:> (. \Table (I). Non-Limiting Examples of Ionizable Lipids of the Disclosure\IL # Structure 0X1\ / OH1\ / 23Ref. No. OR-048WO1 / / OBS-033WOIL # Structure4 OHN / N / N / NAQAQ5\vx'\x^x-^x, N xx-'\x0H1 [ < A\x''‘^^'x-''X^x^6\ x\ x^..x-...,, N..._1 r OH °H70 OHxx A A - / x A^FK ^\, OHN O <8"""'■j O OH\, N. xx^1 ° J OH9" N O OHX XX x^ xx X -X J-' x -0A- \X- XX - XX A■■-... „ xN's X'x.-OH\x^x^x,^\ / 1^o> AKx-\x"\.x / >Ref. No. OR-048WO1 / / OBS-033WO IL # Structure100 OH( ( / / \ X< <?i h \ / / X A / x. X'--xo> / ? l s11 V V >zzd o o o\ \ ~ _AO F= —H° r <> <2 \< ) ) (> <V (QJ ' X12 (0 OH / C H S od XXN. JDH.. x^ A I '1314 ON / V / \V\N / x 1 '0 A^'00HRef. No. OR-048WO1 / / OBS-033WO IL # Structure15< < (X X X oO O / 16 > << > / V O OH / 7 / ; / z — ~~ <O / y, z —\ o o \ Zo N.„ JDHy~\xXV 1 "O1 -O\?) H); (k (, oo / <' ° ’> 17 ( p )< —X M \ < ° o== —> xxo o o o o=so b / / _. / / V <o / \ V < 5 ' \ / " J"\ / s) * " / o / \ / / \ p \)18 / oX / / \ $19 0 OH20Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WOIL # Structure30 ■■x.v9 ■H^0X-.,xX-xx X / ^ xX'xxxX) HX.. X V.. 1..............OSQH31'x9 OH” 0,.9-z-...320 OHv ■-. Z-.. X.z.. '..'v-..■•- • ^...0.. A -X,,. X.,X / X^X'-XX ZX / \ / \X 'vXXx'-x0H33 9XX "'•'X XX Xx'>'0''X\ / X.. X X^... T X.-X' -xT -.....1■•• -0’ ' (}34' 1 o?HXX X / '-'s / XyA, ZX.zXX XCt, X x X. XXz.. ' X.,.z X ^^^35X Z-, x / xx Z-'S "•■ X z-x Xx....-V -xX z^^xXx N’^ -xx xx Z-X Nx1 1<)Hv'xX^xXyxv.xv^x Xr-' >0Ref. No. OR-048WO1 / / OBS-033WO IL # Structure360 OH.............. -g- 1............ X yz-,.. zx.zx A zv z-.'OHL^X^Xz^Xz^Xz^QZ^g37 OH.... k J.. z.. 1■‘O'X, N.I38 OH39 CH| I OH•X XZ XZ x.z-. XX xz z'N. -0.-.z^-N -v'-.040 / j J..... X X,z$H410 OH.1 I AX z^.zXs.,zZ-x.,zOHRef. No. OR-048WO1 / / OBS-033WO IL # Structure42' '] 1 9HxxxxVj Q f, N_........-s.,. OHXX' XX X, X \ / XX' \z X... X43 Q OHX XXX XX xx XX XX.,. N •xXX^'X.,, -OH X, XXXXX(XC440N / \x N / N / '"'0'"xx xx xfxz^s / XXxz®" AH'::1)45 "1 £ J OH"xxzNZ \Z NZvg -''X / SZXZ0H'zy / X„ / -XX^, / %X<i?0460,-'x.. N..xX ^-x,.0H,. I, 1 1,1 1. " X "Ref. No. OR-048WO1 / / OBS-033WO IL # Structure470 CH. U.,..x1 / N. ZNXV^^Z^N XOHf ' ' OH"4890HXv / X s-T-,. Z- xx^xv.,. z-OH[V6H"" Oz*049 oA. / \ o x OHO 1 ^ 150 OH51Nx / \ / XQH52 O OHRef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # Structure920To93> \ O \*0 H / TO^J) \ / o=9495 ^CCXX°^ ^N^OH0Ref. No. OR-048WO1 / / OBS-033WO IL # Structure96| OH097] OHO98O HC\^J990Ref. No. OR-048WO1 / / OBS-033WO IL # Structure100IO101 z> \ o ' — '\ _ / I _0 / \ O102O103O HO^JRef. No. OR-048WO1 / / OBS-033WO IL # Structure104| OH0 HO^J10501060 HO^J107 X X ^uwO HO^JRef. No. OR-048WO1 / / OBS-033WO IL # Structure108Io° \ \ / ° / \109 z\ \ ' I' '\ o4 o0o—\ / / Txi H < ' OO" O - \^J\ \ / I _z / \ °oZE1101110Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # Structure177zX X X oO O O178 O OH179O 0 o o o o 00180181 O OH X / X / 'X / \ / ^‘OxUs—182 N O OH183Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WOIL # Structure191 OHXOx\ c 1192 OH \z^x / XZXZ\z°'^ / X / \z\\xx\ / J sr~vJz\193 0 OHo oJ \\ ° ° N OH—x'\ / 194 OH / \ZX / \X\ / V'C\Z'X / \zK195196 '\Z~\x''\ OH\x / x^ v / x / V / Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # Structure0s> / > 239\ / \ / 'A-l HO. ^0^ / x x-x ^...~ ** ~vIf ' ' '.. ~ 'k 0 ) < o0 z \< z '--- •■" ' • ' " O p 'N• • ■. / A-2 HO \ 0.,-■...,.^.......N / Y ■'■-■" ■■-" ■•-■- ••■■0z ■■■■■■'L. M0 / / A-3 >o ’X HO. ■v'- N,0. '-M- A. -x-z „x V oL O N........-X. -..z-- " If "0A-4Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # StructureA-16 X X XO O O10 02 Z y— y—2 y—A-172 \ z21 / \4 °=\ ( O2= ^—OOz o o / / ,) / < o <ZI22 y— y—\(O=^O z=— xA-18 ( > O \ / XZ~\ \ / 2 — 'A-19O IA-201 HA-21Ref. No. OR-048WO1 / / OBS-033WO IL # StructureA-22 X 0O) \ 6 z— / x^x^x / HCK o^o^ / x / \z\zA-23 OH 0° \ / o ° 2 / X / XzX / A-24\ / o ° > / °\ / X / / ° —z. —> •A-25 / A-26 00Ref. No. OR-048WO1 / / OBS-033WO IL # StructureA-27 X XO O( / Z2 — / oA-28 °= / \2 O oX° \ / A-29 0 ° \A-30A-31Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # StructureA-47 0A-48 / \ ( o\ / \ ( \ / °o—( / \ o— / \ \ \° ° ° / —( \ / °A-49 / °zZ —>Z— fA-50o OT IA-51 oHO _ _ JI 0 _ _\ O °\ / z\^zNZ\ / Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # StructureA-62 X XO o8IZZ -Z. > —. \ / / °A-6 Z y— \ \ / o \ / 4 °( \ / o—\\ °\ / ° / o O \ \ ( 2 (\ o°=— °° y / / ) \O °=° ^o=° / \)O\° \=( / / O°= o / A-65 / ° ) o / ( ° / \ / / oO / \ / ) (O° / \ \z z —>A-66X oI oA-67Ref. No. OR-048WO1 / / OBS-033WO IL # StructureA-68 X Xo oz Z / — t—.\ / / q / A-69 z \ o\ / \ / / ° °z\ / °z( o o \ \ / \ \ ° °) \° > oz= \ \ ° / oO >\ / o=\\ °o=\^o= / (\ / O=° ( °o= / ) / )° ° ° / / A-70 / \ / ° ° / \ / ) ° / \j Z — / ziA-71o o OX X XA-72Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # StructureCY8 H XOO _ j oZ y - CY9O0\ / \ O OCY10 0° \ / N / NZN^CY11 OH1 °“ JOJCCCCCY12Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # StructureCY24 H XOOzCY25Fo\ o —yo o=? °CY26zO X CY27XN-^OH5CY28V / YRef. No. OR-048WO1 / / OBS-033WO IL # StructureCY29 HOV^j o2 ° \\CY30o=— / / o o 0CY31o oy OZ Z= - / \ °CY32Q>—' > — f r\) xCY33H% 0Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # StructureC4 IOC5 0Io oo oC6 0 ° / > / = — / \ °C7 z ^- 0zo ' VJ fC8 0HCK^0rC9CIO oN NRef. No. OR-048WO1 / / OBS-033WOIL # StructureCllr^lC12iC13 0 o o o oN\Z X / \ 0 r-7^^QxU^itr / C14 f I oN-^Z nC15 0<0^C16 0NC17V^x^XzN\ / \ / \ / \o^o^“AAyRef. No. OR-048WO1 / / OBS-033WOIL # StructureC18C192-^1O^O - / C20O^O— / C21NC22C23kA>Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # StructureC30LoC31 O1C32 O 00°= / —,o oC33 ob4^N NC34 o / x / \ / ^N^X / NX / ^^C35 oV- N N |ZTpO^O - 'C36Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WOIL # StructureC50 Oi?J / — < >, —v >\ ocr^On. / y^—(C51 OC52H°~"'" - ix^C53 0o0C54 0^ / N^X^Q / XZV^ / NC55 0H0x\Z\x' N x / X^\z^\°^z [LK (R)Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # StructureC72 I O0^N JL 1 _L z-^ 0C73 ON JL JL'02= — / / K0—C74 ° / \ 00\ ° / 0= —° ^ \ — / 0 z=00\0C7501z —C76 \ 0\ 0C77Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # StructureC90C91 oHoA °^ \ / \ °( ) ( o— / \ °C92 \( °~\ °”-VHw©C93O o^y^ / z —HO^^N'1I O CX-1 O. N '"' — '"'O X — '^•=^CX-2Ref. No. OR-048WO1 / / OBS-033WO IL # StructureCX-3 \^ zz——IZL )O=z z — PzCX-4x°° o / / t yo o- o o=° ° / / / / ^o / \=o / \ / °° / / C ° / CX-5o o / — ° \ / tvz^^ 00^CX-6CX-7Ref. No. OR-048WO1 / / OBS-033WO IL # StructureCX-8zo>°z \ / \ / \ \ ° °CX-8a 2 (( ( \ \ / \ o ) o—- °( o \ / — / / \ \ ° °v° 2 \ \ ( / \ °\ (o / O / < ( ° ° / / > ° \t>°" ) ° / \CX-8b0) O \ / o o<( °= °=O\ \ z—CX-8cCX-9 0Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # StructureCX-23\ 2—O > o° 2 / —CX-24 0\ Or!i s N J^l \ 9° 0= ^° - / \CX-25 O |X\X\- —TCX-26 0 z^ / X*TCX-X O.CX-27Ref. No. OR-048WO1 / / OBS-033WO IL # StructureCX-28^ / 2 —CX-29 0 \ / \ °( / \ °— / \ °( \ ( o o=50= — \ / \ °oCX-30\ Z —CX-30aCX-30bRef. No. OR-048WO1 / / OBS-033WO IL # StructureCX-30c OCZ-1\ N 1 H_ O N _ 01^ ^ i rr\ / °CZ-2H H 1 o OZ- NNor^ i r z yX CZ-3H H 11yJX OC\CZ-4H 11° kJCZ-5Ref. No. OR-048WO1 / / OBS-033WO IL # StructureCZ-6 s'hn— ( | J / —Snkz^°\ / N / \ / \ / \CZ-7H HN— / " y o o—" X J\-< O61 J^o\ / ° ) \ / \ \ o / °( > o ( o o o (——CZ-8r tktIZ CZ-9 z^ 1 o1^ ortCZ-10CZ-11. N _ O O _ ORef. No. OR-048WO1 / / OBS-033WO IL # StructureCZ-12H 1oCZ-13o\ \ \ / ° \ z ° ° / ( °—5CZ-14 o o / —o o o / —' ° ° / / \ 5 < oo °'Y* °3CZ-15 zIz —n / CZ-16 o. ZX.O—fl / — °CZ-17Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # StructureAT-2 J c / )rZ >—.AT-3o o^ p3! Z < o= —o \) )o= / \ / \ 4 ° ° — / \°xAT-4 )o= / O( ° / N 1 1( ° / \o Oo / =AT-5 0Ji w °TFA H2N— 'll? [ °Z - r 0^0^ —Z ""AT-6 / / o\i^S oAT-7AT-8 0 / X / \N JI 1Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # StructureCC-8 X 0oZ—y.\ 1CC-9 0\ o y w \^o oCC-10CC-11 0CC-12 0Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # StructureCC-25 T 0o z —zZ-^— ^ \0'Xz^x / X / X / CC-26 o o 0 \ / / °\ / °o \ \ \ °0— c° / ° \ o° ( \ / = °CC-27 ° / \(° °\ / ( ° / \z —>CC-100 oHCi AX^ o °^^X^X^X,^X I o Lxx^o^°xxxxx\ CC-101CC-102Ref. No. OR-048WO1 / / OBS-033WOIL # StructureCC-103 0CC-104 0CC-105 oHO / \ / NY^ OCC-106 oCC-107 oHCrxx"~"N'Y^ OCT-1 o 1^^^^!^ / ^\0 u \ — L^y n=l, 2, or 3Ref. No. OR-048WO1 / / OBS-033WOIL # StructureCT-2 oN ZK A JI ZK ZK zx_z?x _x / n \ / / \o<^oA / n=l, 2, or 3 CT-3 oN zx A A zx zx zx0A0HUx'"'"■J' n=l, 2, or 3 CT-4 0 z^Xz^X.0N / x A Z\ Z\ ZX \z / T-V-.o^o^\vJ 71„— ■ / n=l, 2, or 3 CT-5 OH n=l, 2, or 3 CT-5a o / N x / \ AnZX / -\ Z\ Z\AXjtCo0^0n=l, 2, or 3 CT-6 o0 z^\^^zx^Xoz\^A^z\ / \Z N X / z^\xX A^Cr JLXz^ z\x / z\^s^ z\X' — ' n=l, 2, or 3Ref. No. OR-048WO1 / / OBS-033WOIL # StructureCT-7 oo\ n=l, 2, or 3 CT-8 on=l, 2, or 3 CT-9 o Z\ / No Z / XZ^ / \AO / NX^ / \Z / \\--S2^ n=l, 2, or 3 CT- 10 oN Z\ JI JL Z\ Z\< Ao-(k^n=l, 2, or 3 CT- 11 Oo ZN / N / N / ^ / XZA / ^^N JI JL / \ / \ / \°^O"^V \^7- / > n=l, 2, or 3Ref. No. OR-048WO1 / / OBS-033WOIL # StructureCT-12 oN A JL' 'nn=l, 2, or 3 CT- 13 O1 ONJ p1 o&A \ / \ / ° ° — — A n=l, 2, or 3 / \ / \°°x xCT-13ao o n=l, 2, or 3 CT-14 O1 1z z N — —\ \ A ACK ^O-Pjn^ 'nn=l, 2, or 3 CT- 15n=l, 2, or 3 CT- 16 0o — ''XAQ / X—N A AH.r'n Hn=l, 2, or 3Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WOIL # StructureCT-21n=l, 2, or 3 CT-22 oo o ooX / o 0 z o / = —W-W \^< / n=l, 2, or 3 CT-23 / \ 0°xo^o^bo n=l, 2, or 3 CT-24 o <^x1: Z —\n=l, 2, or 3 CT-25 0 / X^xH0 / X^XN\ / XX^obbb 7X- / n=l, 2, or 3 CT-26 ° C'Ho<^cC^V-'n=l, 2, or 3Ref. No. OR-048WO1 / / OBS-033WOIL # StructureCT-26a OHO^N^No cC ' N--J n=l, 2, or 3 CT-27 0o^cAffV'N n=l, 2, or 3 CT-28 oAHJ^' — ' n=l, 2, or 3 CT-29o [x~x"XX'n=l, 2, or 3 CT-30 on=l, 2, or 3Ref. No. OR-048WO1 / / OBS-033WOIL # StructureCT-31 OO^^O'G^^'''^ n=l, 2, or 3 CT-32? o o on=l, 2, or 3 CT-33 0T\ / n n=l, 2, or 3 CT-34 0o oT Tr\ / n n=l, 2, or 3 CT-34a 0Z^oA. zjfO“V / n n=l, 2, or 3 CT-35n=l, 2, or 3Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # StructureCT-611-0^^y7CT-621- C82 oT °p o*C83 0T0^0 'oIC84H0''''^N-'- / ^^°^ t>C85Ref. No. OR-048WO1 / / OBS-033WOIL # StructureC86 0HO^NAC$' '^ vC87C88C891ooT CAQAC90 0CAQA"1C91 oH0^\°ARef. No. OR-048WO1 / / OBS-033WO IL # StructureC92o^° cV °rC93 ^( v O= o° y°° / =O HGT~"^N> <5^1I O^QJ\C94 )) / )?AX-1AX-2AX-3x> o °\_N / / 1 \ 1 A. / o^ / " " Am r IRef. No. OR-048WO1 / / OBS-033WOIL # StructureAX-4QAX-5AA °ov_\° 2= / \ / °) bo o- AX-6\ > °>^1 o — °bn3o)AX-7 0) IA^oAX-8 oX^xbzbb ° ^bx / \ / \xx / X°AA3 / AX-9 0bb_ ] _xT 0^O / \XX / --XXXRef. No. OR-048WO1 / / OBS-033WOIL # StructureAX- 10 o~A O"''CrAX- 11 oO \AX- 12 Do - ( O, — O=AX’JR / / / V — \ / 7 OAX- 13 oo r^\ HN'0H AX- 14 0HO^NA^AO 7H AX- 15 0r^ViHNH 1 DrzV,O \HArRef. No. OR-048WO1 / / OBS-033WO IL # StructureAX- 16 0) V z\Jr) oHo / \ 7 °oAX- 17 / \ °A / o / ( o= / o—oSr° o~H° \AX- 18AX- 19 °'%°K / O OX-NII VAX 11 rZXAX-20Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # StructureAX-25 OAX-26 OZ \ )=o \( \ o= / o pAX-27 oo> 0r / XZXo II 1X^x^o / X / X / X^^ ZX-'AX-28 0z'° / A LHO-Z\ / A / N\AX-29Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # StructureAX-41J Jo oAX-42^ \o=o=AX-43 o / x / xAX-44 oAX-450\° rAAX-46 " A o r" X A^ccr\ N. A \Q / / ^A V —— z-x, _ z" AX-47 A0A'\ N / \ A z^ A — ■r \. o0^rrooCARef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WOIL # StructureAX-76o.\ / NZ\^A ZAQAX-77 o°. c^Jpl J'V^z^zv / 0^0fI^1AX-78 oO / V7\AX-79Q,. N - iJr-f 1 _ _ _ _fi ° p^'^'-^''ZA & / n=lRef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # StructureAX- 103 ooV — \ OZ^-N ft L u ouZ^zX / A / X / X / XJ AX- 104 \ ° / \ oJo) ° \O V o-°= / / ° \) \ ° —°f / \=^ °— ° °AX- 105or z-^o AX- 106Ref. No. OR-048WO1 / / OBS-033WO IL # StructureAX- 107 O 1^° / T7|crz o ^—° ° / \AX- 108 ) / > < o o o °-—(oo== / / \O-\ b 4 A —°z~ —frt{^ ° O0.=o o — / ey vr z\ °O o o-A ^—° / Vo==z— / / \O — / yer vz— / \ / z—^AX- 109 o■ Z— \z—AX-110AX-111Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # StructureAX- 140j 1o oAX-141) ) o ° O o / O / O / Ob V oz=-- ^ A O°i f \AX- 142 ^A(co o HAX- 143 oA A1 A / ^cr yAX- 144AX- 145Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # StructureAX-117 o o0 Cr Yo °\ / V / V / 'A / TL-1 1 °1 101 ° l^"TL-2 1 °0 oo > - 'z. — ' ~ 0TL-3 O 1 1 °X 11 QHOX~X-X^' N -^x^o-x<'Ox^x^ NY OkY O TL-4Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # StructureTL-10 ZEoZ —Z.\ \ ° °TL-11 / ° \ / \ \ ° — ° —) )o= —oz / —z / — / \o oo oTL-12 ( (( (o o=—o \ / °=—o — / / z — ' > oz — 'z. —z —TL-13O X XoTL-14 NH2, 0H2N N N NHL LRef. No. OR-048WO1 / / OBS-033WO IL # StructureTL-1500TL-16 o ooTL-17 o oH 0'^^^ N N0TL-18 i o oH 0'^^' N N0 / x\^^TL-19 o | ooRef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO IL # StructureTL-30 100TL-31 i00x / A'0 / ^X / TL-32 i0oTL-33 i0oTL-34 o0Ref. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WORef. No. OR-048WO1 / / OBS-033WO

[0075] In some embodiments, Lipids of the Disclosure are selected from any lipid in Table (I) above, an enantiomer thereof, or any mixture of enantiomers thereof, or a pharmaceutically acceptable salt of any of the aforementioned. In some embodiments, Lipids of the Disclosure are selected from any lipid in Table (I) above, any diastereomer thereof, any enantiomer thereof, or any mixture of diastereomers and / or enantiomers thereof, or a pharmaceutically acceptable salt of any of the aforementioned.Ref. No. OR-048WO1 / / OBS-033WOii. Structural lipids

[0076] In some embodiments, an LNP comprises a structural lipid. In some embodiments, an LNP comprises two or more structural lipids. Structural lipids can be selected from the group consisting of, but are not limited to, cholesterol, fecosterol, fiicosterol. beta sitosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, cholic acid, sitostanol, litocholic acid, tomatine, ursolic acid, alpha-tocopherol, Vitamin D3, Vitamin D2, Calcipotriol, botulin, lupeol, oleanolic acid, beta-sitosterol-acetate and mixtures thereof. In some embodiments, the structural lipid is cholesterol. In some embodiments, the structural lipid is a cholesterol analogue disclosed by Patel, et al., Nat Commun., 11, 983 (2020), which is incorporated herein by reference in its entirety. In some embodiments, the structural lipid comprises cholesterol and a corticosteroid (such as prednisolone, dexamethasone, prednisone, and hydrocortisone), or any combinations thereof. In some embodiments, a structural lipid is described in international patent application WO2019152557A1, which is incorporated herein by reference in its entirety.

[0077] In some embodiments, a structural lipid is a cholesterol analog. Using a cholesterol analog may enhance cndosomal escape as described in Patel ct aL, Naturally-occurring cholesterol analogues in lipid nanoparticles induce polymorphic shape and enhance intracellular delivery of mRNA, Nature Communications (2020), which is incorporated herein by reference.

[0078] In some embodiments, a structural lipid is a phytosterol. Using a phytosterol may enhance endosomal escape as described in Herrera et al., Illuminating endosomal escape of polymorphic lipid nanoparticles that boost mRNA delivery. Biomaterials Science (2020), which is incorporated herein by reference.

[0079] In some embodiments, a structural lipid contains plant sterol mimetics for enhanced endosomal release.

[0080] In some embodiments, the structural lipid is cholesteryl hemisuccinate (CHEMS). In some embodiments, the structural lipid is 3-(4-((2-(4-morpholinyl)ethyl)amino)-4-oxobutanoate) (Mochol). Hi. PEGylated lipids

[0081] A PEGylated lipid is a lipid modified with polyethylene glycol. The term “PEGylated lipid" is used interchangeably herein with the shortened tenn “PEGylated lipid”.

[0082] In some embodiments, an LNP comprises one, two or more PEGy lated lipid or PEG-modified lipid. A PEGylated lipid may be selected from the non-limiting group consisting of PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof. For example, a PEGylated lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid.Ref. No. OR-048WO1 / / OBS-033WO

[0083] In some embodiments, the PEGylated lipid is selected from (R)-2,3-bis(octadecyloxy)propyl-l-(methoxypoly(ethyleneglycol)2000)propylcarbamate, PEG-S-DSG, PEG-S-DMG, PEG-PE, PEG-PAA, PEG-OH DSPE Cl 8, PEG-DSPE, PEG-DSG, PEG-DPG, PEG-DOMG, PEG-DMPENa, PEG-DMPE, PEG-DMG2000, PEG-DMG C14. PEG-DMG, PEG-DMA, PEG-Ceramide C16, PEG-C-DOMG, PEG-c-DMOG, PEG-c-DMA, PEG-cDMA, PEGA. PEG750-C-DMA, PEG400, PEG2k-DMG. PEG2k-Cll, PEG2000-PE. PEG2000P. PEG2000-DSPE. PEG2000-DOMG. PEG2000-DMG, PEG2000-C-DMA. PEG2000, PEG200, PEG(2k)-DMG, PEG DSPE Cl 8, PEG DMPE Cl 4, PEG DLPE Cl 2, PEG Click DMG C14, PEG Click C12, PEG Click CIO, N(Carbonyl-methoxypolyethylenglycol-2000)-l,2-distearoyl-sn-glycero3-phosphoethanolamine, Myrj52, mPEG-PLA, MPEG-DSPE, mPEG3000-DMPE, MPEG-2000-DSPE, MPEG2000-DSPE, mPEG2000-DPPE. mPEG2000-DMPE, mPEG2000-DMG, mDPPE-PEG2000, l,2-distearoyl-sn-glycero-3-phosphoethanolamine-PEG2000, HPEG-2K-LIPD, Folate PEG-DSPE. DSPE-PEGMA 500, DSPE-PEGMA, DSPE-PEG6000, DSPE-PEG5000, DSPE-PEG2K-NAG, DSPE-PEG2k, DSPE-PEG2000maleimide, DSPE-PEG2000, DSPE-PEG, DSG-PEGMA, DSG-PEG5000, DPPE-PEG-2K, DPPE-PEG, DPPE-mPEG2000, DPPE-mPEG, DPG-PEGMA, DOPE-PEG2000, DMPE-PEGMA, DMPE-PEG2000, DMPE-Pcg, DMPE-mPEG2000, DMG-PEGMA, DMG-PEG2000, DMG-PEG, distearoyl-glycerol-poly ethyleneglycol, C18PEG750, C18PEG5000.C18PEG3000. C18PEG2000, C16PEG2000, C14PEG2000. C18-PEG5000. C18PEG. C16PEG, C16 mPEG (polyethylene glycol) 2000 Ceramide, C14-PEG-DSPE200, C14-PEG2000, C14PEG2000, C14-PEG 2000, C14-PEG, C14PEG, 14:0-PEG2KPE, l,2-distearoyl-sn-glycero-3-phosphoethanolamine-PEG2000, (R)-2,3-bis(octadecyloxy)propyl-l-(methoxypoly(ethyleneglycol)2000)propylcarbamate, (PEG)-C-DOMG, PEG-C-DMA, and DSPE-PEG-X.

[0084] In some embodiments, the LNP comprises a PEGylated lipid disclosed in one of US 2019 / 0240354; US 2010 / 0130588; US 2021 / 0087135: WO 2021 / 204179; US 2021 / 0128488; US 2020 / 0121809; US 2017 / 0119904; US 2013 / 0108685; US 2013 / 0195920; US 2015 / 0005363; US 2014 / 0308304: US 2013 / 0053572; WO 2019 / 232095A1; WO 2021 / 077067; WO 2019 / 152557; US 2015 / 0203446; US 2017 / 0210697; US 2014 / 0200257; or WO 2019 / 089828A1, each of which is incorporated by reference herein in their entirety. In some embodiments, the LNP comprises a PEGylated lipid described or disclosed in PCT / US2023 / 072878 filed August 25, 2023, which is incorporated by reference herein in its entirety.

[0085] In some embodiments, the LNP comprises a PEGylated lipid substitute in place of the PEGylated lipid. All embodiments disclosed herein that contemplate a PEGylated lipid should be understood to also apply to PEGylated lipid substitutes. In some embodiments, the LNP comprises a polysarcosine-lipid conjugate, such as those disclosed in US 2022 / 0001025 Al, which is incorporated by reference herein inRef. No. OR-048WO1 / / OBS-033WOits entirety. In some embodiments the LNP comprises a polyoxazoline-lipid conjugate, such as those disclosed in US 2022 / 0249695 Al, which is incorporated by reference herein in its entirety.

[0086] In some embodiments, the LNP comprises a PEGylated lipid disclosed and described in PCT Application WO 2024 / 044728 Al, which is incorporated by reference herein, in its entirety. In certain embodiments, the PEGylated lipid is a lipid of any one of formulas PL-T, PL-T', PL-I, PL-Ia. PL-Ib, PL-laa, PL-Iab, PL-Iac. PL-Iad. PL-Iae. PL-Iaf. PL-Iag. PL-Iah. PL-lba, PL-lbb, PL-lbc, PL-lbd, PL-Ibe. PL-Ibf, PL-Ibg, PL-Ibh, PL-Ica, PL-Icb, PL-Icc, PL-Icd, PL-Id PL-Ie, PL-If, PL-Ig, PL-Ih, PL-Ii, PL-Iha, PL-Ihb, PL-Ihc, PL-Ihd, PL-Iia, PL-lib, PL-Iic, PL-Iid, PL-Ij, PL-Ik, L-Il, PL-Im, PL-In, PL-Io, PL-Ip, PL-Iq, PL-Ioa, PL-Iob, PL-Ioc, PL-Iod, PL-Ioe, PL-Iof, PL-Iog, PL-Ioh, PL-Ipa, PL-Ipb, PL-Ipc, PL-Ipd, PL-Ipe, PL-Ipf, PL-Ipg, PL-Iph, PL-Iqa, PL-Iqb, PL-Iqc, PL-Iqd, PL-Ir, PL-Is, PL-It, PL-Iu, PL-Iv, PL-Iw, PL-Iva, PL-Ivb, PL-Ivc, PL-Ivd. PL-Iwa, PL-Iwb. PL-Iwc, PL-Iwd, PL-Ix, PL-Ixx, PL-Iy. PL-Iyy, PL-lyyy, PL-Iz. PL-Izz. PL-Izzz, PL-II’, PL-II ”, PL-IL PL-IIc. PL-IId, PL-IIe, PL-IIf, PL-IIg, PL-IIh, PL-Ila, PL-IIb, PL-IIk, PL-IIrn or PL-IIn.

[0087] In some embodiments, the PEGylated lipid is a compound of formula PL-I’:L2-R2X1-L14 A1'|Of / n O\L3PL-I’or a pharmaceutically acceptable salt thereof, wherein:A1is a saturated 5-6 membered carbocyclic ring or a saturated 5-6 membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein the carbocyclic ring and heterocyclic ring are substituted with t occurrences of R4;X1is -N(H)-, -N(CI-6 alkyl)-, -Ci-6 aliphatic -N(H)-, -Ci-6 aliphatic-N(Ci-6 alkyl)-, -O- or -Cue aliphatic-O-; L1is -C(O)(Ci-6 aliphatic)C(O)-N(R)-. -C(O)(Ci-6 aliphatic)-N(R)C(O)-, -C(O)(Ci-6 aliphatic)C(O)O-, -C(O)(Ci.6 aliphatic)C(O)-, -C(O)(Ci 6 aliphatic)C(O)OCH2-, -C(O)(Ci.6 aliphatic)-, -C(O)(Ci.6 aliphatic)-N(R)-, or -C(O)-;L2and L3are independently a covalent bond or Ci-e alkylene wherein one methylene unit of tire Ci-6 alkylene is optionally replaced with -O-, -NR-, -S-, -S-S-, -S(O)-, -S(O)2-, -C(O)-, -C(O)O-, -OC(O)-, -OC(O)O-, -OC(O)N(R)-, -N(R)C(O)O-_ -C(O)N(R)-, -N(R)C(O)-, -N(R)C(O)N(R)-, -C(R5)=N-, or -C(R5)=N-O-;R1is H, Ci-6 alkyl, -(Cue alkyl)-Ns, -(Ci.e alkyl)-SH, or Cs-s alkynyl;R2and R3are independently a straight or branched Ce-3o alkyl, straight or branched Ce-3o alkenyl, or straight or branched Cg-3o alkynyl; wherein 1, 2, or 3 methylene units are independently and optionallyRef. No. OR-048WO1 / / OBS-033WOreplaced by a saturated or partially unsaturated C3-6 carbocyclic ring or phenylene; wherein the alkyl, alkenyl, and alkynyl and any carbocyclic ring or phenylene is substituted with m instances of Rx;R4is C1.4 alkyl;R5is C1-6 alkyl or C2-14 alkenyl;each R is independently hydrogen or an optionally substituted group selected from C1-6 aliphatic, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur:each Rxis independently halogen, -CN, -OR, -SR, -C(O)R, -C(O)OR, or -OC(O)OR;n is an integer from 10-75, inclusive:m is 0, 1, 2, 3, or 4; andt is 0, 1, or 2.

[0088] In some embodiments, the PEGylated lipid is a compound of formula PL-II’:XR3PL-II’or a pharmaceutically acceptable salt thereof, wherein:X1is -N(H)-, -N(CI-6 alkyl)-, -C1-6 aliphatic -N(H)-, -Cue aliphatic-N(Ci-e alkyl)-, -O- or -Ci s aliphatic-O-; L1is -C(O)(Ci-e aliphatic)C(O)-, -C(O)(Ci-e aliphatic)-, or -C(O)-;L2and L3arc a covalent bond or C1-6 alkylene wherein one methylene unit of the Cue alkylene is optionally replaced with -O-, -NR-, -S-, -S-S-, -S(O)-, -S(O)2-, -C(O)-, -C(O)O-, -OC(O)-, -OC(O)O-. -OC(O)N(R)-, -N(R)C(O)O-. -C(O)N(R)-, -N(R)C(O)-, -N(R)C(O)N(R)-, -C(R6)=N-, or -C(R6)=N-O-; R1is H, C1-6 alkyl, -(Ci-e alkyl)-N?„ -(C1-6 alkyl)-SH, or C3-8 alkynyl;R2and R3are independently straight or branched C6-3o alkyl, straight or branched C6-3o alkenyl, or straight or branched C6-3o alkynyl; wherein 1, 2, or 3 methylene units are independently and optionally replaced by a saturated or partially unsaturated C3-6 carbocyclic ring or phenylene; wherein the alkyl, alkenyl, and alkynyl and any carbocyclic ring or phenylene is substituted with m instances of Rx:R6is Cue alkyl or C2-14 alkenyl;Ref. No. OR-048WO1 / / OBS-033WOeach R is independently hydrogen or an optionally substituted group selected from Ci.6 aliphatic, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur;each Rxis independently halogen, -CN, -OR, -SR, -C(O)R, -C(O)OR, or OC(O)OR;n is an integer from 10-75, inclusive; andm is 0, 1, 2, 3, or 4.

[0089] In some embodiments, the PEGylated lipid\ o?= co=ompound is one of those shown in Table (I-X). or a pharmaceutically acceptable salt thereof.Table (I-X). Exemplary PEGylated CompoundsVCmpd No. Structure< °=oPL-1 o2o / oPL-1Ao,. H °O J _ N _ JI / - <PL-2 / V^opz ( \' '45 0 X _ / Oop N y „ JI > — <PL-2A NzZ\NH / \' ' 45 0 X _ LRef. No. OR-048WO1 / / OBS-033WO Cmpd No. StructureO / oPL-3o?HZI 0 O^xAxAx^xX^^x^^ PL-3A^O=°=PL-4 APL-4A0z. H ° _ O^^\^x^^X / \^x PL-5 O / V N U / — < / 'A \ oA / 45zv U ^^'Nn— ( \ / V° x^ xx _ xx xx — _ xx _ xx / 0|_| 0 _ 0’'^'' —PL-5AOHO O''ll'x / Xx-xXs^\zx^^0 / N JL yT^ZPL-6 x -Sxx^O-px' XZ'XX''\N— <\ / 45 flH^^°Y~X / '\X'^^Ref. No. OR-048WO1 / / OBS-033WO Cmpd No. Structure / oPL-6Ao7zx o( ) o=o=PL-7^c^= o=¥21 ohPL-7A (°= / °=Z°PXO)N / \(AN / / 0^O=O=12ojg,xH 0o / O N 11, — <PL-8 \ °7 y ( \' '45 0 \ _ LPL-8A0H 0PL-90H0PL-9ARef. No. OR-048WO1 / / OBS-033WO Cmpd No. Structure / oPL-10o7PL-10A ZT0^O=°=. H ° IZ _PL-11 O / V N A / \ / 'P^'O-p — ' 'Y ^^NH— ( >-o _ _ _...\ / 45 A \ _ / A0( °o= / . H ° _PL-11 A. A o\ N JL / — \^NHP VO\ / 45 U \ _ / AZIZ0o* ' H 00 / N JL / — <PL-12o45oH'^°YZN / N / N / A / \ / K / N / K / \0H 0 oA^X~X\^ - - A o\ N _ JLPL-12A ^o<\^ y \ / >p — ^N— / 1' M5 0 HPL-12BH0nPL-13Ref. No. OR-048WO1 / / OBS-033WO Cmpd No. Structure / \ oD H0HPL-13AoO T H Z1 ZI0nPL-141 =t o oitPL-14A >° \\O / ozPL-150H 11PL-15A \ / 45 ft T0H 11PL-160H11PL-16A ° \ / 45 6 J — / "jRef. No. OR-048WO1 / / OBS-033WO

[0090] In some embodiments the PEG-modified lipids are a modified form of PEG-DMG. PEG-DMG has the following structure:0C #v

[0091] In some embodiments, the PEG lipid is a compound of Formula (Pl):or a salt or isomer thereof, wherein:r is an integer between 1 and 100;R is C10-40 alkyl, C 10-40 alkenyl, or C10-40 alkynyl; and optionally one or more methylene groups of R are independently replaced with C3-10 carbocyclylene, 4 to 10 membered heterocyclylene, C6-10 arylene, 4 to 10 membered heteroarylene, -N(RN)-, -O-, -S-, -C(O)-,-C(O)N(RN)-, -NRNC(O)-, -NRNC(O)N(RN)-, -C(O)O- -OC(O)-, -OC(O)O-,-OC(O)N(RN)-, -NRNC(O)O- -C(O)S- -SC(O)-, -C(=NRN)-, -C(=NRN)N(RN)-, -NRNC(=NRN)-, -NRNC(=NRN)N(RN)-,-C(S)-, -C(S)N(RN)-, -NRNC(S)-, -NRNC(S)N(RN)-, -S(O)-, -OS(O)-, -S(O)O-, -OS(O)O-, -OS(O)2-, -S(O)2O-, -OS(O)2O-, -N(RN)S(O)-, -S(O)N(RN)-, -N(RN)S(O)N(RN)-, -OS(O)N(RN)-, -N(RN)S(O)O-, -S(O)2-, -N(RN)S(O)2-, -S(O)2N(RN)-, -N(RN)S(O)2N(RN)-, -OS(O)2N(RN)-, or -N(RN)S(O)2O-; andeach instance of RN is independently hydrogen, Cl -6 alkyl, or a nitrogen protecting group.

[0092] For example, Ris C17 alkyl. For example, the PEG lipid is a compound of Formula (Pl-a):or a salt or isomer thereof, wherein r is an integer between 1 and 100.

[0093] In some embodiments the PEG-modified lipids are a modified form of PEG-C18, or PEG-1. PEG-1 has the following structure:

[0094] PEG-lipids are known in the art, such as those described in U. S. Pat. No. 8,158,601 and International Pat. Publ. No. WO2015 / 130584 A2, which are incorporated herein by reference in their entirety. In one embodiment, PEG lipids can be PEGylated lipids described in International PublicationRef. No. OR-048WO1 / / OBS-033WONo. WO2012099755, the contents of which is herein incorporated by reference in its entirety. Any of these exemplary PEG lipids described herein may be modified to comprise a hydroxyl group on the PEG chain. In certain embodiments, the PEG lipid is a PEG-OH lipid. In certain embodiments, the PEG-OH lipid includes one or more hydroxyl groups on the PEG chain. In certain embodiments, a PEG-OH or hydroxy-PEGylated lipid comprises an -OH group at the terminus of the PEG chain. Each possibility represents a separate embodiment.iv. Phospholipids

[0095] In some embodiments, an LNP of the present disclosure comprises a phospholipid. In some embodiments, an LNP of the present disclosure comprises two or more phospholipids. Phospholipids useful in the compositions and methods may be selected from the non-limiting group consisting of 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), L2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), l,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1.2-dioleoyl-sn-glycero-3 -phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glyccro-3-phosphocholinc (DPPC), 1,2-diundccanoyl-sn-glyccro-phosphocholinc (DUPC), 1 -palmitoyl -2-oleoyl-sn-glycero-3-phosphocholine (POPC), l,2-di-O-octadecenyl-sn-glycero-3 -phosphocholine (18:0 Diether PC). 1 -oleoyl -2 -cholesterylhemisuc cinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), l,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1.2-diarachidonoyl-sn-glycero-3-phosphocholine, l,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1.2-diphytanoylsn-glycero-3-phosphoethanolamine (ME 16.0 PE), l,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3 -phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3 -phosphoethanolamine. l,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine. 1,2-dioleoyl-sn-glycero-3-phospho-rac-( 1 -glycerol) sodium salt (DOPG), sodium (S)-2-ammonio-3-((((R)-2-(oleoyloxy)-3- ( stearoyloxy )propoxy)oxidophosphoryl)oxy)propanoate (L-a-phosphatidylserine; Brain PS), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphoethanolamine (DMPE), dimyristoylphosphatidylglycerol (DMPG), dioleoyl-phosphatidylethanolamine4-(N-maleimidomethyl)-cyclohexane-1 -carboxylate (DOPE-mal), dioleoylphosphatidylglycerol (DOPG), 1,2-dioleoyl-sn-glycero-3-(phospho-L-serine) (DOPS), a cell-fusogenic phospholipid (DPhPE). dipalmitoylphosphatidylethanolamine (DPPE), 1,2-Dielaidoyl-sn-phosphatidylethanolamine (DEPE), dipalmitoylphosphatidylglycerol (DPPG), dipalmitoylphosphatidylserine (DPPS), distearoylphosphatidylcholine (DSPC), distearoyl-phosphatidyl-ethanolamine (DSPE), distearoyl phosphoethanolamineimidazole (DSPEI), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), egg phosphatidylcholine (EPC), l,2-dioleoyl-sn-glycero-3 -phosphate (18:1 PA; DOPA), ammonium bis((S)-Ref. No. OR-048WO1 / / OBS-033WO2-hydroxy-3-(oleoyloxy)propyl) phosphate (18:1 DMP; LBPA), l,2-dioleoyl-sn-glycero-3-phospho-(l’-myo-inositol) (DOPI; 18:1 PI), l,2-distearoyl-sn-glycero-3-phospho-L-serine (18:0 PS), 1,2-dilinoleoyl-sn-glycero-3-phospho-L-serine (18:2 PS), 1 -palmitoyl -2 -oleoyl -sn-glycero-3-phospho-L-serine (16:0-18:1 PS; POPS). 1 -stearoyl -2 -oleoyl-sii-glycero-3-phospho-L-serine (18:0-18:1 PS), l-stearoyl-2-linoleoyl-sn-glycero-3-phospho-L-serine (18:0-18:2 PS), 1 -oleoyl -2 -hydroxy-sn-glycero-3 -phospho-L-serine (18:1 Lyso PS), l-stearoyl-2-hydroxy-sn-glycero-3-phospho-L-serine (18:0 Lyso PS), and sphingomyelin. In some embodiments, an LNP comprises DSPC. In certain embodiments, an LNP comprises DOPE. In some embodiments, an LNP comprises both DSPC and DOPE.

[0096] In some embodiments, the LNP comprises a phospholipid selected from l-pcntadccanoyl-2-oleoyl-sn-glycero-3 -phosphocholine, 1 -myristoyl -2 -palmitoyl-sn-glycero-3 -phosphocholine, 1 -myristoyl -2-stearoyl-sn-glycero-3-phosphocholine, l-palmitoyl-2-myristoyl-sn-glycero-3-phosphocholine, 1-palmitoyl-2-stearoyl-sn-glycero-3-phosphocholine, l-palmitoyl-2-oleoyl-glycero-3-phosphocholine, 1-palmitoyl-2-linoleoyl-sn-glycero-3-phosphocholine, l-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphocholine, 1 -palmitoyl -2 -docosahexaenoyl-sn-glycero-3-phosphocholine, 1 -ste aroyl -2 -myristoyl -sn-glyccro-3-phosphocholinc, l-stcaroyl-2-palmitoyl-sn-glyccro-3-phosphocholinc, 1 -stcaroyl-2 -oleoyl -sn-glycero-3-phosphocholine, l-stearoyl-2-linoleoyl-sn-glycero-3-phosphocholine, l-stearoyl-2-arachidonoyl-sn-glycero-3-phosphocholine, l-stearoyl-2-docosahexaenoyl-sn-glycero-3-phosphocholine, l-oleoyl-2-myristoyl-sn-glycero-3-phosphocholine, 1 -oleoyl -2 -palmitoyl-sn-glycero-3 -phosphocholine, l-oleoyl-2-stearoyl-sn-glycero-3-phosphocholine, l-palmitoyl-2-acetyl-sn-glycero-3-phosphocholine, l,2-dioleoyl-sn-glycero-3-phospho-(l’-myo-inositol-3’,4’-bisphosphate), l,2-dioleoyl-sn-glycero-3-phospho-(l’-myo-inositol-3 ’,5 ’-bisphosphate), l,2-dioleoyl-sn-glycero-3-phospho-(l'-myo-inositol-4’,5’-bisphosphate), l,2-dioleoyl-sn-glycero-3-phospho-(l'-myo-inositol-3'.4',5'-trisphosphate), 1,2-dioleoyl-sn-glycero-3-phospho-(l’-myo-inositol-3’-phosphate), l,2-dioleoyl-sn-glycero-3-phospho-(l’-myo-inositol-4’-phosphate), l,2-dioleoyl-sn-glycero-3-phospho-(l'-myo-inositol-5'-phosphate), 1,2-dioleoyl-sn-glycero-3-phospho-(l ’-myo-inositol), l,2-dioleoyl-sn-glycero-3-phospho-L-serine, and 1-(8Z-octadecenoyl)-2-palmitoyl-sn-glycero-3-phosphocholine.

[0097] In some embodiments, the LNP comprises a phospholipid selected from DSPS (Distearoylphosphatidylserine), DSPG (l,2-distearoyl-sn-glycero-3-phospho-(l'-rac-glycerol)), DSPA (1.2-Distearoyl-sn-glycero-3-phosphate), diPhyPC (1.2-diphytanoyl-sn-glycero-3-phosphocholine). diPhy-diether-PC (l,2-di-O-phytanyl-sn-glycero-3-phosphocholine), diPhyPE (L2-diphytanoyl-sn-glycero-3-phosphoethanolamine), diPhy-diether-PE ( 1,2-di-O-phytanyl-sn-glycero-3-phosphoethanolamine), diPhyPS (l.2-diphytanoyl-sn-glyccro-3-phospho-L-serine). diPhyPG (1,2-diphytanoyl-sn-glycero-3-phospho-(l'-rac -glycerol)), diPhyPA (l,2-diphytanoyl-sn-glycero-3 -phosphate), Egg PA (L-a-phosphatidic acid), and Soy PA (L-a-phosphatidic acid).Ref. No. OR-048WO1 / / OBS-033WO

[0098] In some embodiments, the LNP comprises a phospholipid selected from 18:1 (A9-Cis) PE (DOPE), 18:0-18:1 PE (SOPE), C16-18: 1 PE, 16:0-18:1 PE (POPE), 18:1 BMP (S, R), 18:0-18:1 PC (SOPC), 16:0-18: 1 PC (POPC), 4ME 16:0 Diether PE (4Me), 18: 1 (A9-Trans) PE (DEPE), 16: 1 PE (DPPE), and CL. In certain embodiments, the LNP comprises a phospholipid described or disclosed in Alvarez-Benedicto, et al. (Biomater. Sci., 2022, 10, 549) and Li, et al. (Asian Journal of Pharmaceutical Sciences, 2015, 10, 81-98).

[0099] In certain embodiments, the phospholipid is a sphingoid lipid or sphingolipid (used interchangeably herein), such as, but not limited to sphingomyelin. As used herein, the terms “sphingoid lipid” and “sphingolipid” are meant to refer to a class of lipids containing a backbone comprising a sphingoid base. An exemplary sphingoid base is sphingosine. In certain embodiments, the LNP comprises a sphingolipid selected from Egg Sphingomyelin (Egg SM / ESM / (2S,3R. E)-3-hydroxy-2-palmitamidooctadec-4-en-I-yl (2-(trimethylammonio)ethyl) phosphate), Brain or Porcine Sphingomyelin (Brain SM / (2S,3R, E)-3-hydroxy-2-stearamidooctadec-4-en-l-yl (2-(trimethylammonio)ethyl) phosphate), Milk or Bovine Sphingomyelin (Milk SM / (2S,3R, E)-3-hydroxy-2-tricosanamidooctadec-4-cn-l-yl (2-(trimcthylammonio)cthyl) phosphate), 28:0 SM (N-octacosanoyl-D-crythro-sphingosylphosphorylcholine), 14:0 SM (N-myristoyl-D-erythro-sphingosylphosphorylcholine), 16:1 SM (N-palmitoleoyl-D-erythro-sphingosylphosphorylcholine), 12:0 Dihydro SM (N-lauroyl-D-erythro-sphinganylphosphorylcholine), Lyso SM (Sphingosylphosphorylcholine), Lyso SM (Sphingosylphosphorylcholine), Lyso SM (dihydro) (Sphinganine Phosphorylcholine), 24: 1 SM (N-nervonoyl-D-erythro-sphingosylphosphorylcholine), 24:0 SM (N-lignoceroyl-D-erythro-sphingosylphosphorylcholine), 18:1 SM (N-oleoyl-D-erythro-sphingosylphosphorylcholine), 18:0 SM (N-stearoyl-D-erythro-sphingosylphosphorylcholine), 17:0 SM (N-heptadecanoyl-D-erythro-sphingosylphosphorylcholine), 16:0 SM (N-palmitoyl-D-erythro-sphingosylphosphorylcholine), 12:0 SM (N-lauroyl-D-erythro-sphingosylphosphorylcholine), 06:0 SM (N-hcxanoyl-D-crythro-sphingosylphosphorylcholine), 02:0 SM (N-acetyl-D-erythro-sphingosylphosphorylcholine), 3-O-methyl Lyso SM (3-O-methyl-spingosylphosphorylcholine), 3-O-methyl-N-methyl Lyso SM (3-O-methyl-N-methyl-spingosylphosphorylcholine), and 3-N-methyl Lyso SM (3-N-methyl-spingosylphosphorylcholine).

[0100] In some embodiments, the LNP comprises a phospholipid comprising at least one constrained tail, such as those described by Gan, et al. (Bioeng Transl Med. 2020 Sep; 5(3): e1016L). In certain embodiments, the phospholipid is one selected from:Ref. No. OR-048WO1 / / OBS-033WO

[0101] In some embodiments, the LNP comprises a phospholipid comprising a ceramide analogue having a triazole linkage, such as those described by Kim et al., Bioorg. Med. Chem. Lett., 17(16), 2007, 4584-4587.

[0102] In some embodiments, the LNP comprises a phospholipid disclosed in WO 2023 / 141470. which is incorporated by reference herein, in its entirety. In certain embodiments, the phospholipid is(al5:0-il5:0 PE).

[0103] In some embodiments, the LNP comprises a phospholipid disclosed in W02022040641A2, which is incorporated by reference herein, in its entirety.

[0104] In some embodiments, a phospholipid tail may be modified in order to promote endosomal escape as described in U. S. 2021 / 0121411, which is incorporated herein by reference.

[0105] In some embodiments, the LNP comprises a phospholipid disclosed in one of US 2019 / 0240354; US 2010 / 0130588; US 2021 / 0087135; WO 2021 / 204179; US 2021 / 0128488; US 2020 / 0121809; US 2017 / 0119904; US 2013 / 0108685; US 2013 / 0195920; US 2015 / 0005363; US 2014 / 0308304; US 2013 / 0053572; WO 2019 / 232095A1; WO 2021 / 077067; WO 2019 / 152557: US 2017 / 0210697; or WO 2019 / 089828A1, each of which is incorporated by reference herein in their entirety.

[0106] In some embodiments, phospholipids disclosed in US 2020 / 0121809 have the following structure:Ref. No. OR-048WO1 / / OBS-033WOwherein R1 and R2 are each independently a branched or straight, saturated or unsaturated carbon chain (e.g., alkyl, alkenyl, alkynyl).v. Targeting moieties

[0107] In some embodiments, the lipid nanoparticle further comprises a targeting moiety. The targeting moiety may be an antibody or a fragment thereof. The targeting moiety may be capable of binding to a target antigen. In certain embodiments, the lipid nanoparticle comprises more than one targeting moiety. In certain embodiments, the lipid nanoparticle comprises more than one targeting moiety, wherein the targeting moieties target at least two different receptors, and in some embodiments, the at least two different receptors are prevalent on different types of cells or tissues.

[0108] In some embodiments, the pharmaceutical composition comprises a targeting moiety that is operably connected to a lipid nanoparticle. In some embodiments, the targeting moiety is capable of binding to a target antigen. In some embodiments, the target antigen is expressed in a target organ. In some embodiments, the target antigen is expressed more in the target organ than it is in the liver.

[0109] In some embodiments, the targeting moiety is an antibody as described in WO2016189532A1, which is incorporated herein by reference. For example, in some embodiments, the targeted particles are conjugated to a specific anti-CD38 monoclonal antibody (mAb), which allows specific delivery of the siRNAs encapsulated within the particles at a greater percentage to B-cell lymphocytes malignancies (such as MCL) than to other subtypes of leukocytes.

[0110] In some embodiments, the targeting moiety targets a receptor selected from CD20, CCR7, CD3, CD4, CDS, CD8, CD16. CD19, CD20, CD21. CD22, CD25, CD28. CD35, CD40, CD45RA, CD45RO. CD52, CD62L, CD80, CD95, CD 127, and CD 137. In some embodiments, the targeting moiety targets a receptor selected from CD1, CD2, CD3, CD5, CD7, CD8, CD16, CD25, CD26, CD27, CD28, CD30, CD38, CD39, CD40L, CD44, CD45, CD62L, CD69, CD73, CD80, CD83, CD86, CD95, CD103, CD119, CD126, CD150, CD153, CD154, CD161, CD183, CD223, CD254, CD275, CD45RA, CXCR3, CXCR5, FasL, IL18R1, CTLA-4. 0X40, GITR. LAG3, ICOS, PD-1, leu-12, TCR, TLR1, TLR2, TLR3, TLR4, TLR6. NKG2D. CCR CCR1. CCR2, CCR4, CCR6, and CCR7. In some embodiments, the targetingRef. No. OR-048WO1 / / OBS-033WOmoiety targets a receptor selected from CD2, CD3, CD5 and CD7. In some embodiments, the targeting moiety targets a receptor selected from CD2, CD3, CD5, CD7, CD8, CD4, beta 7 integrin, beta 2 integrin, and Clq. In some embodiments, the targeting moiety targets CD117. In some embodiments, the targeting moiety targets CD90. In some embodiments, the targeting moiety targets a receptor selected from a mannose receptor. CD206 and Clq. In some embodiments, the targeting moiety is selected from T-cell receptor motif antibodies, T-cell a chain antibodies, T-cell 0 chain antibodies, T-cell y chain antibodies, T-cell 8 chain antibodies, CCR7 antibodies, CD3 antibodies, CD4 antibodies, CD5 antibodies, CD7 antibodies, CD8 antibodies, CDllb antibodies, CDllc antibodies, CD16 antibodies, CD19 antibodies, CD20 antibodies, CD21 antibodies, CD22 antibodies, CD25 antibodies, CD28 antibodies, CD34 antibodies, CD35 antibodies, CD40 antibodies, CD45RA antibodies, CD45RO antibodies, CD52 antibodies, CD56 antibodies, CD62L antibodies, CD68 antibodies, CD80 antibodies, CD90 antibodies, CD95 antibodies, CD117 antibodies, CD127 antibodies, CD133 antibodies, CD137 (4-1BB) antibodies, CD 163 antibodies, F4 / 80 antibodies, IL-4Ra antibodies, Sca-1 antibodies, CTLA-4 antibodies, GITR antibodies GARP antibodies, LAP antibodies, granzyme B antibodies, LFA-1 antibodies, transferrin receptor antibodies, and fragments thereof. In certain embodiments, the targeting moiety is any one described or contemplated in US20230312713A1, US20230203538A1, US20230320995A1, US20160145348, and US20110038941. each of which is incorporated by reference herein in its entirety.

[0111] In some embodiments, the lipid nanoparticles may be targeted when conjugated / attached / associated with a targeting moiety such as an antibody, or a fragment thereof.vi. Zwitterionic amino lipids

[0112] In some embodiments, an LNP comprises a zwitterionic lipid. In some embodiments, an LNP comprising a zwitterionic lipid does not comprise a phospholipid. In some embodiments, an LNP comprising a zwitterionic lipid further comprises a phospholipid.

[0113] Zwitterionic amino lipids have been shown to be able to self-assemble into LNPs without phospholipids to load, stabilize, and release RNAs intracellularly as described in U. S. Patent Application 20210121411, which is incorporated herein by reference in its entirety. Zwitterionic, ionizable cationic and permanently cationic helper lipids enable tissue-selective RNA delivery and CRISPR-Cas9 gene editing in spleen, liver and lungs as described in Liu et al.. Membrane-destablizing ionizable phospholipids for organ-selective mRNA delivery and CRISPR-Cas gene editing. Nat Mater. (2021), which is incorporated herein by reference in its entirety.

[0114] The zwitterionic lipids may have head groups containing a cationic amine and an anionic carboxylate as described in Walsh et aL, Synthesis, Characterization and Evaluation of Ionizable Lysine-Based Lipids for siRNA Delivery, Bioconjug Chem. (2013), which is incorporated herein by reference in its entirety. Ionizable lysine-based lipids containing a lysine head group linked to a long-chainRef. No. OR-048WO1 / / OBS-033WOdialkylamine through an amide linkage at the lysine a-amine may reduce immunogenicity as described in Walsh et aL, Synthesis, Characterization and Evaluation of Ionizable Lysine-Based Lipids for siRNA Delivery, Bioconjug Chern. (2013).vii. Additional lipid components

[0115] In some embodiments, the LNP compositions of the present disclosure further comprise one or more additional lipid components capable of influencing the tropism of the LNP. In some embodiments, the LNP further comprises at least one lipid selected from DDAB, EPC, 14PA, 18BMP, DODAP, DOTAP, and C12-200 (see Cheng, et al. Nat Nanotechnol. 2020 April; 15(4): 313-320.; Dillard, et al. PNAS 2021 Vol. 118 No. 52.).

[0116] In some embodiments, an LNP of the present disclosure further comprises one or more additional ionizable lipids, such as. but not limited to those disclosed in one of US 2023 / 0053437; US 2019 / 0240354; US 2010 / 0130588; US 2021 / 0087135; WO 2021 / 204179: US 2021 / 0128488; US 2020 / 0121809: US 2017 / 0119904: US 2013 / 0108685; US 2013 / 0195920; US 2015 / 0005363; US 2014 / 0308304; US 2013 / 0053572; WO 2019 / 232095A1; WO 2021 / 077067; WO 2019 / 152557; US 2017 / 0210697; or WO 2019 / 089828A1, each of which is incorporated by reference herein in their entirety.

[0117] In some embodiments, the LNP compositions of the present disclosure comprise, or further comprise one or more lipids selected from l,2-di-O-octadecenyl-sn-glycero-3 -phosphocholine (18:0 Diether PC), l,2-dilinolenoyl-sn-glycero-3-phosphocholine (18:3 PC), Acylcamosine (AC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), N-oleoyl-sphingomyelin (SPM) (C 18:1), N-lignoceryl SPM (C24:0), N-nervonoylshphingomyelin (C24:l), Cardiolipin (CL), l,2-bis(tricosa-10,12-diynoyl)-sn-glycero-3 -phosphocholine (DC8-9PC), dicetyl phosphate (DCP), dihexadecyl phosphate (DCP1), 1.2-Dipalmitoylglycerol -3 -hemi succinate (DGSucc), short-chain bis-n-heptadecanoyl phosphatidylcholine (DHPC), dihexadecoyl -phosphoethanolamine (DHPE), L2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), l,2-dilauroyl-sn-glycero-3-PE (DLPE), dimyristoyl glycerol hemisuccinate (DMGS), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphoethanolamine (DMPE), dimyristoylphosphatidylglycerol (DMPG), dioleyloxybenzylalcohol (DOB A), I,2-dioleoylglyceryl-3-hemisuccinate (DOGHEMS), N-[2-(2-{2-[2-(2,3-Bis-octadec-9-enyloxy-propoxy)-ethoxy]-ethoxy}-ethoxy)-ethyl]-3-(3,4,5-dihydroxy-6-hydroxymethyl-tetrahydro-pyran-2-ylsulfanyl)-propionamide (DOGP4aMan), dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylethanolamine (DOPE), dioleoyl-phosphatidylethanolamine4-(N-maleimidomethyl)-cyclohexane-l-carboxylate (DOPE-mal), dioleoylphosphatidylglycerol (DOPG), l,2-dioleoyl-sn-glycero-3-(phospho-L-serine) (DOPS), a cell-fusogenic phospholipid (DPhPE), dipalmitoylphosphatidylethanolamine (DPPE), dipalmitoylphosphatidylglycerol (DPPG), dipalmitoylphosphatidylserine (DPPS),Ref. No. OR-048WO1 / / OBS-033WOdistearoylphosphatidylcholine (DSPC), distearoyl-phosphatidyl-ethanolamine (DSPE), distearoyl phosphoethanolamineimidazole (DSPEI), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), egg phosphatidylcholine (EPC), histaminedistearoylglycerol (HDSG), 1,2-Dipalmitoylglycerol-hemisuccinate-Na-Histidinyl-Hemisuccinate (HistSuccDG). N-(5 '-hydroxy-3 '-oxypentyl)- 10- 12-pentacosadiynamide (h-Pegi-PCDA), 2-[l-hexyloxyethyl]-2-devinylpyropheophorbide-a (HPPH), hydrogenatedsoybeanphosphatidylcholine (HSPC), 1,2-Dipalmitoylglycerol-O-a-histidinyl-N a-hemisuccinate (IsohistsuccDG), mannosialized dipalmitoylphosphatidylethanolamine (ManDOG), 1,2-Dioleoyl-sn-Glycero-3-Phosphoethanolamine-N-[4-(p-maleimidomethyl)cyclohexane-carboxamide] (MCC-PE), l,2-diphytanoyl-sn-glycero-3 -phosphoethanolamine (ME 16:0 PE), 1 -myristoyl -2 -hydroxy-sn-glycero-phosphocholine (MHPC), a thiol-reactive maleimide headgroup lipid e.g.l,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-[4-(p-maleimidophenyl)butyramid (MPB-PE), Nervonic Acid (NA), sodium cholate (NaChol), l,2-dioleoyl-sn-glycero-3-[phosphoethanolamine-N-dodecanoyl (NC12-DOPE), 1 -oleoyl-2 -cholesteryl hemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), phosphatidylethanolamine lipid (PE), PE lipid conjugated with polyethylene glycol(PEG) (e.g., polyethylene glycol-distcaroylphosphatidylcthanolaminc lipid (PEG-PE)), phosphatidylglyccrol (PG), partially hydrogenated soy phosphatidylchloline (PEISPC), phosphatidylinositol lipid (PI), phosphotidylinositol-4-phosphate (PIP), palmitoyloleoylphosphatidylcholine (POPC). phosphatidylethanolamine (POPE), palmitoyloleyolphosphatidylglycerol (POPG), phosphatidylserine (PS), lissamine rhodamineB-phosphatidylethanolamine lipid (Rh-PE), purified soy-derived mixture of phospholipids (SIOO), phosphatidylcholine (SM), 18-l-trans-PE,l-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), soybean phosphatidylcholine (SPC), sphingomyelins (SPM), alpha, alpha-trehalose-6,6'-dibehenate (TDB), l,2-dielaidoyl-sn-glycero-3-phophoethanolamine (transDOPE), ((2S,5R)-3-(bis(hexadecyloxy)methoxy)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-2-yl)methylmethylphosphate, l,2-diarachidonoyl-sn-glycero-3-phosphocholine, l,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, l,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, l,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3 -phosphocholine, l,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, l,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine. l,2-dioleyl-sn-glycero-3-phosphoethanolamine, l,2-distearoyl-sn-glycero-3-phosphoethanolamine. 16-O-monomethyl PE. 16-O-dimethyl PE, and dioleylphosphatidylethanolamine.B. Exemplary LNP Compositions

[0118] In some embodiments the present disclosure includes a pharmaceutical composition comprising:(a) a lipid nanoparticle;(b) a buffer; and(c) hyaluronidase.Ref. No. OR-048WO1 / / OBS-033WO

[0119] In some embodiments, a lipid nanoparticle comprises an ionizable lipid. In some embodiments, a lipid nanoparticle comprising an ionizable lipid further comprises:i) at least one structural lipid;ii) at least one phospholipid, non-ionizable lipid or zwitterionic lipid; andiii) at least one PEGylated lipid.

[0120] In some embodiments, the PEGylated is selected from the group consisting of PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, and PEG-DSPE. In some embodiments, the PEGylated lipid is DMG-PEG.

[0121] In some embodiments, a lipid nanoparticle comprises 1-3 mol% of PEGylated lipid. In some embodiments, a lipid nanoparticle comprises 1.5-2.5 mol% of PEGylated lipid. In some embodiments, a lipid nanoparticle comprises 1.75-2.25 mol% of PEGylated lipid. In some embodiments, a lipid nanoparticle comprises about 1.0 mol% of PEGylated lipid. In some embodiments, a lipid nanoparticle comprises about 1.5 mol% of PEGylated lipid. In some embodiments, a lipid nanoparticle comprises about 1.75 mol% of PEGylated lipid. In some embodiments, a lipid nanoparticle comprises about 2.0 mol% of PEGylated lipid. In some embodiments, a lipid nanoparticle comprises about 2.25 mol% of PEGylated lipid. In some embodiments, a lipid nanoparticle comprises about 2.5 mol% of PEGylated lipid. In some embodiments, a lipid nanoparticle comprises about 2.75 mol% of PEGylated lipid. In some embodiments, a lipid nanoparticle comprises about 3.0 mol% of PEGylated lipid.

[0122] In some embodiments, a structural lipid is selected from the group consisting of cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, and alpha-tocopherol. In some embodiments, a structural lipid is cholesterol.

[0123] In some embodiments, a lipid nanoparticle comprises 23-45 mol% structural lipid.

[0124] In some embodiments, a lipid nanoparticle comprises 36-45 mol% structural lipid. In some embodiments, a lipid nanoparticle comprises 37-44 mol% structural lipid. In some embodiments, a lipid nanoparticle comprises 38-42 mol% structural lipid. In some embodiments, a lipid nanoparticle comprises 39-40 mol% structural lipid. In some embodiments, a lipid nanoparticle comprises about 35 mol% structural lipid. In some embodiments, a lipid nanoparticle comprises about 37 mol% structural lipid. In some embodiments, a lipid nanoparticle comprises about 39.5 mol% structural lipid. In some embodiments, a lipid nanoparticle comprises about 40 mol% structural lipid. In some embodiments, a lipid nanoparticle comprises about 42 mol% structural lipid. In some embodiments, a lipid nanoparticle comprises about 45 mol% structural lipid.

[0125] In some embodiments, a lipid nanoparticle comprises 20-30 mol% structural lipid. In some embodiments, a lipid nanoparticle comprises 22-28 mol% structural lipid. In some embodiments, a lipid nanoparticle comprises 23-27 mol% structural lipid. In some embodiments, a lipid nanoparticle comprisesRef. No. OR-048WO1 / / OBS-033WO24-26 mol% structural lipid. In some embodiments, a lipid nanoparticle comprises 24.5-25.5 mol% structural lipid. In some embodiments, a lipid nanoparticle comprises about 20 mol% structural lipid. In some embodiments, a lipid nanoparticle comprises about 22 mol% structural lipid. In some embodiments, a lipid nanoparticle comprises about 23 mol% structural lipid. In some embodiments, a lipid nanoparticle comprises about 24 mol% structural lipid. In some embodiments, a lipid nanoparticle comprises about 25 mol% structural lipid. In some embodiments, a lipid nanoparticle comprises about 26 mol% structural lipid. In some embodiments, a lipid nanoparticle comprises about 27 mol% structural lipid. In some embodiments, a lipid nanoparticle comprises about 28 mol% structural lipid.. In some embodiments, a lipid nanoparticle comprises about 30 mol% structural lipid.

[0126] In some embodiments, a phospholipid selected from the group consisting of 1,2-distearoyl-sn-glycero-3 -phosphocholine (DSPC), l,2-dioleoyl-sn-glycero-3 -phosphoethanolamine (DOPE). 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), l-palmitoyl-2-oleoyl-sn-glycero-3-phosphocho line (POPC), l,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuc cinoyl-sn-glycero-3-phosphocholine (OChemsPC). 1-hexadecyl-sn-glycero-3 -phosphocholine (C16 Lyso PC). l,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3 -phosphocholine, l,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoylsn-glycero-3 -phosphoethanolamine (ME 16.0 PE), l,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, l,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, l,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine. l,2-dioleoyl-sn-glycero-3-phospho-rac-(l -glycerol) sodium salt (DOPG), sodium (S)-2-ammonio-3-((((R)-2-(oleoyloxy)-3-(stearoyloxy)propoxy)oxidophosphoryl)oxy)propanoate (L-a-phosphatidylserine; Brain PS), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphoethanolamine (DMPE), dimyristoylphosphatidylglycerol (DMPG), dioleoyl-phosphatidylethanolamine4-(N-maleimidomethyl)-cyclohexane- 1 -carboxylate (DOPE-mal), dioleoylphosphatidylglycerol (DOPG), l,2-dioleoyl-sn-glycero-3-(phospho-L-serine) (DOPS), a cell-fusogenic phospholipid (DPhPE), dipalmitoylphosphatidylethanolamine (DPPE), dipalmitoylphosphatidylglycerol (DPPG), dipalmitoylphosphatidylserine (DPPS). distearoylphosphatidylcholine (DSPC), distearoyl-phosphatidyl-ethanolamine (DSPE), distearoyl phosphoethanolamineimidazole (DSPEI), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), egg phosphatidylcholine (EPC), l,2-dioleoyl-sn-glycero-3 -phosphate (18:1 PA; DOPA), ammonium bis((S)-2-hydroxy-3-(oleoyloxy)propyl) phosphate (18:1 DMP; LBPA), l,2-dioleoyl-sn-glycero-3-phospho-(l’-myo-inositol) (DOPI; 18:1 PI), l,2-distearoyl-sn-glycero-3-phospho-L-serine (18:0 PS). 1,2-dilinoleoyl-Ref. No. OR-048WO1 / / OBS-033WOsn-glycero-3-phospho-L-serine (18:2 PS), l-palmitoyl-2-oleoyl-sn-glycero-3-phospho-L-serine (16:0-18:1 PS; POPS), 1 -stearoyl -2 -oleoyl-sn-glycero-3-phospho-L-serine (18:0-18:1 PS), l-stearoyl-2-linoleoyl-sn-glycero-3-phospho-L-serine (18:0-18:2 PS), l-oleoyl-2-hydroxy-sn-glycero-3-phospho-L-serine (18:1 Lyso PS), l-stearoyl-2-hydroxy-sn-glycero-3-phospho-L-serine (18:0 Lyso PS), and sphingomyelin. In some embodiments, a phospholipid, non-ionizable lipid or zwitterionic lipid is DSPC or ESM. In some embodiments, a phospholipid, non-ionizable lipid or zwitterionic lipid is DSPC. In some embodiments, a phospholipid, non-ionizable lipid or zwitterionic lipid is ESM.

[0127] In some embodiments, the non-ionizable lipid is a phospholipid selected from the group consisting of Egg Sphingomyelin (Egg SM / ESM / (2S,3R, E)-3-hydroxy-2-palmitamidooctadec-4-en-l-yl (2-(trimethylammonio)ethyl) phosphate), Brain or Porcine Sphingomyelin (Brain SM / (2S,3R, E)-3-hydroxy-2-stearamidooctadec-4-en-l-yl (2-(trimethylammonio)ethyl) phosphate). Milk or Bovine Sphingomyelin (Milk SM / (2S,3R, E)-3-hydroxy-2-tricosanamidooctadec-4-en-l-yl (2-(trimethylammonio)ethyl) phosphate), 28:0 SM (N-octacosanoyl-D-erythro-sphingosylphosphorylcholine), 14:0 SM (N-myristoyl-D-erythro-sphingosylphosphorylcholine). 16:1 SM (N-palmitoleoyl-D-erythro-sphingosylphosphorylcholine), 12:0 Dihydro SM (N-lauroyl-D-erythro-sphinganylphosphorylcholine), Lyso SM (Sphingosylphosphorylcholine), Lyso SM (Sphingosylphosphorylcholine). Lyso SM (dihydro) (Sphinganine Phosphorylcholine), 24:1 SM (N-nervonoyl-D-erythro-sphingosylphosphorylcholine), 24:0 SM (N-lignoceroyl-D-erythro-sphingosylphosphorylcholine), 18:1 SM (N-oleoyl-D-erythro-sphingosylphosphorylcholine), 18:0 SM (N-stearoyl-D-erythro-sphingosylphosphorylcholine), 17:0 SM (N-heptadecanoyl-D-erythro-sphingosylphosphorylcholine), 16:0 SM (N-palmitoyl-D-erythro-sphingosylphosphorylcholine), 12:0 SM (N-lauroyl-D-erythro-sphingosylphosphorylcholine), 06:0 SM (N-hexanoyl-D-erythro-sphingosylphosphorylcholine), 02:0 SM (N-acetyl-D-erythro-sphingosylphosphorylcholine), 3-O-methyl Lyso SM (3-O-methyl-spingosylphosphorylcholine), 3-O-methyl-N-methyl Lyso SM (3-O-methyl-N-methyl-spingosylphosphorylcholine), and 3-N-methyl Lyso SM (3-N-methyl-spingosylphosphorylcholine).

[0128] In some embodiments, a lipid nanoparticle comprises 5-45 mol% phospholipid, non-ionizable lipid or zwitterionic lipid.

[0129] In some embodiments, a lipid nanoparticle comprises 5-10 mol% phospholipid, non-ionizable lipid or zwitterionic lipid. In some embodiments, a lipid nanoparticle comprises 8-12 mol% phospholipid, non-ionizable lipid or zwitterionic lipid. In some embodiments, a lipid nanoparticle comprises 9-11 mol% phospholipid, non-ionizable lipid or zwitterionic lipid. In some embodiments, a lipid nanoparticle comprises 9.5-10.5 mol% phospholipid, non-ionizable lipid or zwitterionic lipid. In some embodiments, a lipid nanoparticle comprises about 8 mol% phospholipid, non-ionizable lipid or zwitterionic lipid. InRef. No. OR-048WO1 / / OBS-033WOsome embodiments, a lipid nanoparticle comprises about 9 mol% phospholipid, non-ionizable lipid or zwitterionic lipid. In some embodiments, a lipid nanoparticle comprises about 10 mol% phospholipid, non-ionizable lipid or zwitterionic lipid. In some embodiments, a lipid nanoparticle comprises about 11 mol% phospholipid, non-ionizable lipid or zwitterionic lipid. In some embodiments, a lipid nanoparticle comprises about 12 mol% phospholipid, non-ionizable lipid or zwitterionic lipid.

[0130] In some embodiments, a lipid nanoparticle comprises 30-50 mol% phospholipid, non-ionizable lipid or zwitterionic lipid. In some embodiments, a lipid nanoparticle comprises 35-45 mol% phospholipid, non-ionizable lipid or zwitterionic lipid. In some embodiments, a lipid nanoparticle comprises 36-44 mol% phospholipid, non-ionizable lipid or zwitterionic lipid. In some embodiments, a lipid nanoparticle comprises 38-42 mol% phospholipid, non-ionizable lipid or zwitterionic lipid. In some embodiments, a lipid nanoparticle comprises 39-41 mol% phospholipid, non-ionizable lipid or zwitterionic lipid. In some embodiments, a lipid nanoparticle comprises 39.5-40.5 mol% phospholipid, non-ionizable lipid or zwitterionic lipid. In some embodiments, a lipid nanoparticle comprises about 35 mol% phospholipid, non-ionizable lipid or zwitterionic lipid. In some embodiments, a lipid nanoparticle comprises about 38 mol% phospholipid, non-ionizable lipid or zwitterionic lipid. In some embodiments, a lipid nanoparticle comprises about 39 mol% phospholipid, non-ionizable lipid or zwitterionic lipid. In some embodiments, a lipid nanoparticle comprises about 40 mol% phospholipid, non-ionizable lipid or zwitterionic lipid. In some embodiments, a lipid nanoparticle comprises about 41 mol% phospholipid, non-ionizable lipid or zwitterionic lipid. In some embodiments, a lipid nanoparticle comprises about 42 mol% phospholipid, non-ionizable lipid or zwitterionic lipid. In some embodiments, a lipid nanoparticle comprises about 45 mol% phospholipid, non-ionizable lipid or zwitterionic lipid.

[0131] In some embodiments, the lipid nanoparticle compositions of the present disclosure are described according to the respective molar ratios of the component lipids in the formulation. As a non-limiting example, the mol-% of the ionizable lipid may be from about 10 mol-% to about 80 mol-%. As a nonlimiting example, the mol-% of the ionizable lipid may be from about 20 mol-% to about 70 mol-%. As a non-limiting example, the mol-% of the ionizable lipid may be from about 30 mol-% to about 60 mol-%. As a non-limiting example, the mol-% of the ionizable lipid may be from about 35 mol-% to about 55 mol-%. As a non-limiting example, the mol-% of the ionizable lipid may be from about 40 mol-% to about 50 mol-%. As a non-limiting example, the mol-% of the ionizable lipid may be from about 30 mol-% to about 40 mol-%. As a non-limiting example, the mol-% of the ionizable lipid may be from about 25 mol-% to about 35 mol-%. In some embodiments, the mol-% of the ionizable lipid is about 10 mol-%. In some embodiments, the mol-% of the ionizable lipid is about 15 mol-%. In some embodiments, the mol-% of the ionizable lipid is about 20 mol-%. In some embodiments, the mol-% of the ionizable lipid is about 25 mol-%. In some embodiments, the mol-% of the ionizable lipid is about 30 mol-%. In someRef. No. OR-048WO1 / / OBS-033WOembodiments, the mol-% of the ionizable lipid is about 33 mol-%. In some embodiments, the mol-% of the ionizable lipid is about 35 mol-%. In some embodiments, the mol-% of the ionizable lipid is about 40 mol-%. In some embodiments, the mol-% of the ionizable lipid is about 45 mol-%. In some embodiments, the mol-% of the ionizable lipid is about 55 mol-%. In some embodiments, the mol-% of the ionizable lipid is about 60 mol-%.

[0132] In some embodiments, the mol-% of the phospholipid may be from about 1 mol-% to about 50 mol-%. In some embodiments, the mol-% of the phospholipid may be from about 2 mol-% to about 45 mol-%. In some embodiments, the mol-% of the phospholipid may be from about 3 mol-% to about 40 mol-%. In some embodiments, the mol-% of the phospholipid may be from about 4 mol-% to about 35 mol-%. In some embodiments, the mol-% of the phospholipid may be from about 5 mol-% to about 30 mol-%. In some embodiments, the mol-% of the phospholipid may be from about 10 mol-% to about 20 mol-%. In some embodiments, the mol-% of the phospholipid may be from about 5 mol-% to about 20 mol-%. In some embodiments, the mol-% of the phospholipid is from about 30 mol-% to about 60 mol-%. In some embodiments, the mol-% of the phospholipid is from about 35 mol-% to about 55 mol-%. In some embodiments, the mol-% of the phospholipid is from about 35 mol-% to about 45 mol-%. In some embodiments, the mol-% of the phospholipid is about 10 mol-%. In some embodiments, the mol-% of the phospholipid is about 15 mol-%. In some embodiments, the mol-% of the phospholipid is about 20 mol-%. In some embodiments, the mol-% of the phospholipid is about 25 mol-%. In some embodiments, the mol-% of the phospholipid is about 30 mol-%. In some embodiments, the mol-% of the phospholipid is about 35 mol-%. In some embodiments, the mol-% of the phospholipid is about 40 mol-%. In some embodiments, the mol-% of the phospholipid is about 45 mol-%. In some embodiments, the mol-% of the phospholipid is about 55 mol-%. In some embodiments, the mol-% of the phospholipid is about 60 mol-%.

[0133] In some embodiments, the mol-% of the phospholipid as described above comprises two or more phospholipids at an individual mol-% that totals to an aforementioned amount. In certain embodiments, the mol-% of the phospholipid is about 20 mol-% each of two phospholipids. In certain embodiments, the mol-% of the phospholipid is about 15 mol-% each of two phospholipids. In certain embodiments, the mol-% of the phospholipid is about 25 mol-% each of two phospholipids. In certain embodiments, the mol-% of the phospholipid is about 30 mol-% each of two phospholipids. In certain embodiments, the mol-% of the phospholipid is about 15 mol-% of a first phospholipid and about 20 mol-% of a second phospholipid. In certain embodiments, the mol-% of the phospholipid is about 30 mol-% of a first phospholipid and about 10 mol-% of a second phospholipid. In certain embodiments, the mol-% of the phospholipid is about 25 mol-% of a first phospholipid and about 10 mol-% of a second phospholipid. In certain embodiments, the mol-% of the phospholipid is about 25 mol-% of a first phospholipid and aboutRef. No. OR-048WO1 / / OBS-033WO20 mol-% of a second phospholipid. In certain embodiments, the mol-% of the phospholipid is about 15 mol-% of a first phospholipid and about 20 mol-% of a second phospholipid.

[0134] In some embodiments, the mol-% of the structural lipid may be from about 10 mol-% to about 80 mol-%. In some embodiments, the mol-% of the structural lipid may be from about 20 mol-% to about 70 mol-%. In some embodiments, the mol-% of the structural lipid may be from about 30 mol-% to about 60 mol-%. In some embodiments, the mol-% of the structural lipid may be from about 35 mol-% to about 55 mol-%. In some embodiments, the mol-% of the structural lipid may be from about 40 mol-% to about 50 mol-%.

[0135] In some embodiments, the mol-% of the PEGylated lipid may be from about 0.1 mol-% to about 10 mol-%. In some embodiments, the mol-% of the PEGylated lipid may be from about 0.2 mol-% to about 5 mol-%. In some embodiments, the mol-% of the PEGylated lipid may be from about 0.5 mol-% to about 3 mol-%. In some embodiments, the mol-% of the PEGylated lipid may be from about 1 mol-% to about 2 mol-%. In some embodiments, the mol-% of the PEGylated lipid may be about 1.5 mol-%. In some embodiments, the mol-% of the PEGylated lipid may be about 2.5 mol-%.

[0136] In some embodiments, a lipid comprises (a) a PEGylated lipid wherein the PEGylated lipid is DMG-PEG; (b) a structural lipid, wherein the structural lipid is cholesterol; and (c) a phospholipid, A non-ionizable lipid, or zwitterionic lipid, wherein the phospholipid, non-ionizable lipid or zwitterionic lipid is DSPC or ESM.

[0137] In some embodiments, a lipid nanoparticle comprises:(a) 1-3 mol% of PEGylated lipid;(b) 23-45 mol% structural lipid;(c) 5-45 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and(d) 30-50 mol% of ionizable lipid.

[0138] In some embodiments, a lipid nanoparticle comprises:(a) 1-3 mol% of PEGylated lipid;(b) 36-44 mol% structural lipid;(c) 8-12 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and(d) 45-55 mol% of ionizable lipid.

[0139] In some embodiments, a lipid nanoparticle comprises:(a) 1-3 mol% of PEGylated lipid;(b) 38-42 mol% structural lipid;(c) 9-11 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and(d) 48-52 mol% of ionizable lipid.Ref. No. OR-048WO1 / / OBS-033WO

[0140] In some embodiments, a lipid nanoparticle comprises:(a) about 2.0 mol% of PEGylated lipid;(b) about 39.5 mol% structural lipid;(c) about 10 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and(d) about 48.5 mol% of ionizable lipid.

[0141] In some embodiments, a lipid nanoparticle comprises:(a) 1-3 mol% of PEGylated lipid;(b) 20-30 mol% structural lipid;(c) 36-44 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and(d) 30-36 mol% of ionizable lipid.

[0142] In some embodiments, a lipid nanoparticle comprises:(a) 1-3 mol% of PEGylated lipid;(b) 23-27 mol% structural lipid;(c) 38-42 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and(d) 32-34 mol% of ionizable lipid.

[0143] In some embodiments, a lipid nanoparticle comprises:(a) about 2.0 mol% of PEGylated lipid;(b) about 25 mol% structural lipid;(c) about 40 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and(d) about 33 mol% of ionizable lipid.

[0144] In some embodiments, a lipid nanoparticle comprises:(a) 2 mol% ± 0.04 mol% of PEGylated lipid;(b) 25 mol% ± 0. 5 mol% structural lipid;(c) 40 mol% ± 0.8 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and (d) 33 mol% ± 0.7 mol% of ionizable lipid.

[0145] In some embodiments, a lipid nanoparticle comprises:(a) 1-3 mol% of DMG-PEG;(b) 23-45 mol% cholesterol:(c) 5-45 mol% DSPC or ESM; and(d) 30-50 mol% of ionizable lipid.

[0146] In some embodiments, a lipid nanoparticle comprises:(a) 1-3 mol% of DMG-PEG;(b) 36-44 mol% cholesterol;(c) 8-12 mol% DSPC or ESM; andRef. No. OR-048WO1 / / OBS-033WO(d) 45-55 mol% of ionizable lipid.

[0147] In some embodiments, a lipid nanoparticle comprises:(a) 1-3 mol% of DMG-PEG;(b) 38-42 mol% cholesterol:(c) 9-11 mol% DSPC or ESM; and(d) 48-52 mol% of ionizable lipid.

[0148] In some embodiments, a lipid nanoparticle comprises:(a) about 2.0 mol% of DMG-PEG;(b) about 39.5 mol% cholesterol;(c) about 10 mol% DSPC or ESM; and(d) about 48.5 mol% of ionizable lipid.

[0149] In some embodiments, a lipid nanoparticle comprises:(a) 1-3 mol% of DMG-PEG:(b) 20-30 mol% cholesterol;(c) 36-44 mol% DSPC or ESM; and(d) 30-36 mol% of ionizable lipid.

[0150] In some embodiments, a lipid nanoparticle comprises:(a) 1-3 mol% of DMG-PEG;(b) 23-27 mol% cholesterol;(c) 38-42 mol% DSPC or ESM; and(d) 32-34 mol% of ionizable lipid.

[0151] In some embodiments, a lipid nanoparticle comprises:(a) about 2.0 mol% of DMG-PEG;(b) about 25 mol% cholesterol;(c) about 40 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and(d) about 33 mol% of ionizable lipid.

[0152] In some embodiments, a lipid nanoparticle comprises:(a) 2 mol% ± 0.04 mol% of DMG-PEG:(b) 25 mol% ± 0. 5 mol% cholesterol:(c) 40 mol% ± 0.8 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and (d) 33 mol% ± 0.7 mol% of ionizable lipid.

[0153] In some embodiments, a lipid nanoparticle comprises:(a) 2 mol% ± 0.04 mol% of PEG-DMG2k;(b) 25 mol% ± 0. 5 mol% cholesterol;Ref. No. OR-048WO1 / / OBS-033WO(c) 40 mol% ± 0.8 mol% Egg Sphingomyelin; and(d) 33 mol% ± 0.7 mol% of AX-6.

[0154] In some embodiments, a lipid nanoparticle comprises:(a) 0.1-10 mol% of PEGylated lipid;(b) 20-40 mol% structural lipid;(c) 20-40 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and(d) 28-48 mol% of ionizable lipid.

[0155] In some embodiments, a lipid nanoparticle comprises:(a) 0.1-5 mol% of PEGylated lipid;(b) 25-35 mol% structural lipid;(c) 25-35 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and(d) 33-42 mol% of ionizable lipid.

[0156] In some embodiments, a lipid nanoparticle comprises:(a) 1-3 mol% of PEGylated lipid;(b) 28-32 mol% structural lipid;(c) 28-32 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and(d) 36-40 mol% of ionizable lipid.

[0157] In some embodiments, a lipid nanoparticle comprises:(a) about 2 mol% of PEGylated lipid;(b) about 30 mol% structural lipid;(c) about 30 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and(d) about 38 mol% of ionizable lipid.

[0158] In some embodiments, a lipid nanoparticle comprises:(a) 2 mol% ± 0.04 mol% of PEGylated lipid;(b) 30 mol% ± 0.6 mol% structural lipid;(c) 30 mol% ± 0.6 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and (d) 38 mol% ± 0.7 mol% of ionizable lipid.

[0159] In some embodiments, a lipid nanoparticle comprises:(a) 0.1-10 mol% of PEG-1;(b) 20-40 mol% Cholesterol;(c) 20-40 mol% 16:0 SM (N-palmitoyl-D-erythro-sphingosylphosphorylcholine); and (d) 28-48 mol% ofAX-6.

[0160] In some embodiments, a lipid nanoparticle comprises:(a) 0.1-5 mol% ofPEG-l;Ref. No. OR-048WO1 / / OBS-033WO(b) 25-35 mol% Cholesterol:(c) 25-35 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and(d) 33-42 mol%ofAX-6.

[0161] In some embodiments, a lipid nanoparticle comprises:(a) 1-3 mol% of PEG- 1:(b) 28-32 mol% Cholesterol;(c) 28-32 mol% 16:0 SM (N-palmitoyl-D-erythro-sphingosylphosphorylcholine); and(d) 36-40 mol%ofAX-6.

[0162] In some embodiments, a lipid nanoparticle comprises:(a) about 2 mol% of PEG- 1;(b) about 30 mol% Cholesterol;(c) about 30 mol% 16:0 SM (N-palmitoyl-D-erythro-sphingosylphosphorylcholine); and (d) about 38 mol% of AX-6.

[0163] In some embodiments, a lipid nanoparticle comprises:(a) 2 mol% ± 0.04 mol% of PEG-1;(b) 30 mol% ± 0.6 mol% Cholesterol;(c) 30 mol% ± 0.6 mol% 16:0 SM (N-palmitoyl-D-erythro-sphingosylphosphorylcholine); and (d) 38 mol% ± 0.7 mol% of AX-6.

[0164] In some embodiments, the LNP further comprises a targeting moiety. In some embodiments, the targeting moiety is an antibody or a fragment thereof.

[0165] In some embodiments, the LNP further comprises an active agent. In some embodiments, the active agent is a nucleic acid. In some embodiments, the nucleic acid is a ribonucleic acid. In some embodiments, the ribonucleic acid is at least one ribonucleic acid selected from the group consisting of a small interfering RNA (siRNA), an asymmetrical interfering RNA (aiRNA), a microRNA (miRNA), a Dicer-substrate RNA (dsRNA), a small hairpin RNA (shRNA), a messenger RNA (mRNA), and a long non-coding RNA (IncRNA). In some embodiments, the nucleic acid is a linear messenger RNA or a circular RNA (oRNA). In some embodiments, the mRNA or circular RNA comprises an open reading frame encoding a cancer antigen. In some embodiments, the linear mRNA or circular RNA comprises an open reading frame encoding an immune checkpoint modulator. In some embodiments, the mRNA or circular RNA comprises at least one motif selected from the group consisting of a stem loop, a chain terminating nucleoside, a polyA sequence, a polyadenylation signal, and a 5' cap structure. In some embodiments, the nucleic acid is suitable for a genome editing technique. In some embodiments, the genome editing technique is clustered regularly interspaced short palindromic repeats (CRISPR) orRef. No. OR-048WO1 / / OBS-033WOtranscription activator-like effector nuclease (TALEN). In some embodiments, the nucleic acid is at least one nucleic acid suitable for a genome editing technique selected from the group consisting of a CRISPR RNA (crRNA), a trans -activating crRNA (tracrRNA), a single guide RNA (sgRNA), and a DNA repair template. In some embodiments, the mRNA or circular RNA is at least 30 nucleotides in length. In some embodiments, the mRNA or circular RNA is at least 300 nucleotides in length. In some embodiments, the nucleic acid encodes a therapeutic protein. In some embodiments, the therapeutic protein is a CAR or TCR complex protein. In some embodiments, the CAR or TCR complex protein comprises an antigen binding domain specific for an antigen selected from the group: CD 19, CD123, CD22, CD30, CD171, CS-1, C-type lectin-like molecule- 1, CD33, epidermal growth factor receptor variant III (EGFRvIII), disialoganglioside GD2, disaloganglioside GD3, TNF receptor family member, B cell maturation antigen (BCMA), Tn antigen ((Tn Ag) or (GalNAca-Ser / Thr)), prostate- specific membrane antigen (PSMA), Receptor tyrosine kinase-like orphan receptor 1 (ROR1), Fms-Like Tyrosine Kinase 3 (FLT3), Tumor-associated glycoprotein 72 (TAG72), CD38, CD44v6, Carcinoembryonic antigen (CEA), Epithelial cell adhesion molecule (EPC AM), B7H3 (CD276), KIT (CD 117), Interleukin- 13 receptor subunit alpha-2, mcsothclin, Interleukin 11 receptor alpha (IL-1 IRa), prostate stem cell antigen (PSCA), Protease Serine 21, vascular endothelial growth factor receptor 2 (VEGFR2), Lewis(Y) antigen, CD24, Platelet-derived growth factor receptor beta (PDGFR-beta), Stage-specific embryonic antigen-4 (SSEA-4), CD20, Folate receptor alpha, HER2, HER3, Mucin 1, cell surface associated (MUC1), epidermal growth factor receptor (EGFR), neural cell adhesion molecule (NCAM), Prostase, prostatic acid phosphatase (PAP), elongation factor 2 mutated (ELF2M), Ephrin B2, fibroblast activation protein alpha (FAP), insulin-like growth factor 1 receptor (IGF-I receptor), carbonic anhydrase IX (CAIX), Proteasome (Prosome, Macropain) Subunit, Beta Type, 9 (LMP2), glycoprotein 100 (gp100), oncogene fusion protein consisting of breakpoint cluster region (BCR) and Abelson murine leukemia viral oncogene homolog 1 (Abl) (bcr-abl). tyrosinase, ephrin type- A receptor 2 (EphA2), Fucosyl GML sialyl Lewis adhesion molecule (sLe), ganglioside GM3, transglutaminase 5 (TGS5), high molecular weight-melanoma-associated antigen (HMWMAA), o-acetyl-GD2 ganglioside (0AcGD2), Folate receptor beta, tumor endothelial marker 1 (TEM1 / CD248), tumor endothelial marker 7 -related (TEM7R), claudin 6 (CLDN6), claudin 18.2 (CLDN18.2), thyroid stimulating hormone receptor (TSHR), G protein-coupled receptor class C group 5, member D (GPRC5D), chromosome X open reading frame 61 (CXORF61). CD97, and CD 179a.III. LNP payload

[0166] Tire instant specification describes compositions, methods, processes, kits and devices for the selection, design, preparation, manufacture, formulation, and / or use of LNP -based RNA medicines (e g., vaccines, gene therapies, or gene-editing therapeutics). In various embodiments, the LNP-based RNARef. No. OR-048WO1 / / OBS-033WOmedicines comprise an LNP delivery system (as described in detail herein) and an encapsulated cargo / payload (e.g., RNA in the case of RNA medicines).

[0167] In the case of RNA medicines, the payload can be one or more RNA molecules, including coding RNA (e.g., linear or circular RNA) or non-coding RNA (e.g., guide RNA, pegRNA, or retron ncRNA).

[0168] In various other embodiments, tire payloads can include any type of nucleic acid molecule, including coding RNA molecules (e.g., linear mRNA or circular RNA), guide RNAs for editing systems (e.g., Cas9 guides, Casl2a guides, base editor guides, and prime editor guides), other non-coding RNAs relating to editing systems (e.g., retron ncRNAs), small RNAs (sRNAs) — which refer to a wide variety of polymeric RNA molecules that are generally less than 200 nucleotides in length with various functionalities, such as RNA interference, and include small-interfering RNA (siRNA), microRNAs (miRNA), piwi-interacting RNA (piRNA), repeat associated small interfering RNA (rasiRNA), small nuclear RNA (snRNA or U-RNA), small nucleolar RNA (snoRNA), small rDNA-derived RNA (srRNA), rRNA fragment (tRF), and Y RNA-derived small RNA, tRNA, rRNA, and self-amplifying RNA (saRNA) — and DNA molecules, such as DNA vectors, DNA plasmids, HDR donors, oligonucleotides, primers, etc., and chimeric molecules comprising both DNA and RNA. The cargo nucleic acid molecules may be single-stranded or double-stranded. Such nucleic acid cargo may comprise exactly one molecule. Such nucleic acid cargo may comprise exactly two molecules. Such nucleic acid cargo may comprise exactly three molecules. Such nucleic acid cargo may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 distinct molecules. Such nucleic acid cargo may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 distinct molecules. Such nucleic acid cargo may comprise between 1-25, or 5-30, or 10-35, or 20-40, or up to 100, or more distinct molecules.

[0169] In various other aspects, the LNPs described herein may be used to deliver any payload of interest to a biological target, e.g.. to a cell or a bodily tissue.

[0170] In various embodiments, the payload is an RNA molecule, which may be linear or circular and may comprise one or more functional nucleotide sequences of interest, which may include, but are not limited to coding and non-coding nucleotide sequences. In various embodiments, the non-coding nucleotide sequences may comprise regulator ’ elements that influence RNA post-transcriptional processing, nuclear translation control sequences, and sequences which encode one or more biological products of interest, e.g., a therapeutic protein or antigen, among other sequence elements that may impact the functioning of the RNA or its encoded products. As used herein, the term “coding region of interest” or “product coding region” or the like may be used to refer to the encoded one or more biological products of interest. Equivalently, a product coding region may be referred to as a “product expression sequence.”Ref. No. OR-048WO1 / / OBS-033WO

[0171] In various embodiments herein, the specification refers to “originator constructs” (or “originator polynucleotide constructs”) and “benchmark constructs” (or “benchmark polynucleotide constructs”), which are embodiments of payloads comprising nucleic acid molecules, i.e., embodiments of linear and / or circular RNA payloads, and which may comprise a product coding region that encodes a polypeptide, such as, but not limited to an antigen or a therapeutic protein or to components of a gene editing system (e.g., a programmable nuclease).

[0172] FIG. 2 shows an example of an originator construct 100, which may be a linear or circular RNA molecule. Hie originator construct 100 may include at least one product coding region 10 which is or encodes a polypeptide of interest, such as, but not limited to a vaccine antigen or a therapeutic protein. The originator construct 100 may contain 1 or 2 flanking regions 20. The flanking regions 20 may be located 5' to the product coding region 10 and / or 3' to the product coding region 10. In some instances the originator construct 100 does not contain a flanking region 20. The flanking region 20 of the originator construct 100 may include at least one regulatory region 30. At least one flanking region 20 of the originator polynucleotide construct 100 may include at least one identifier region 40. The identifier region 40 may be, but is not limited to, a barcode, label, signal and / or tag. Additionally, the identifier region 40 may be located within the product coding region 10 or may be located in the product coding region 10 and at least one flanking region 20.

[0173] In some embodiments, the originator construct comprises from about 5 to about 10,000 nucleotides in length. As a non-limiting examples, the length of the originator construct may be from 5 to 30, from 5 to 50, from 5 to 100, from 5 to 250, from 5 to 500, from 5 to 1,000, from 5 to 1,500, from 5 to 3,000 from 5 to 5,000, from 5 to 7,000, from 5 to 10,000 from 30 to 50, from 30 to 100, from 30 to 250, from 30 to 500, from 30 to 1,000, from 30 to 1,500, from 30 to 3,000, from 30 to 5,000, from 30 to 7,000, from 30 to 10.000, from 100 to 250. from 100 to 500, from 100 to 1,000, from 100 to 1.500. from 100 to 3,000, from 100 to 5,000, from 100 to 7,000, from 100 to 10,000, from 500 to 1,000, from 500 to 1,500, from 500 to 2,000, from 500 to 3,000, from 500 to 5,000, from 500 to 7,000, from 500 to 10,000, from 1,000 to 1,500, from 1,000 to 2,000, from 1,000 to 3,000, from 1,000 to 5,000, from 1,000 to 7,000, from 1,000 to 10,000, from 1,500 to 3,000, from 1,500 to 5,000, from 1,500 to 7,000, from 1,500 to 10,000, from 2,000 to 3,000. from 2,000 to 5,000, from 2,000 to 7,000, from 2,000 to 10,000, from 3,000 to 5,000. from 3.000 to 7,000, from 3,000 to 10,000, from 5,000 to 7,000, from 5,000 to 10,000, and from 7,000 to 10,000 nucleotides in length.

[0174] In some embodiments, the length of the product coding region is greater than about 5 nucleotides in length such as, but not limited to, at least or greater than about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200. 250, 300. 350, 400. 450, 500. 600, 700, 800, 900, 1,000, 1,100. 1,200, 1,300.Ref. No. OR-048WO1 / / OBS-033WO1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000 or more than 10,000 nucleotides in length.

[0175] In some embodiments, the flanking region may range independently from 0 to 10,000 nucleotides in length such as, but not limited to, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23. 24, 25, 26, 27, 28, 29, 30, 31. 32. 33, 34, 35, 40, 45, 50, 55, 60. 70, 80, 90, 100, 120, 140, 160. 180, 200. 250, 300. 350, 400. 450, 500. 600, 700. 800, 900, 1,000, 1.100. 1,200, 1.300. 1,400, 1,500.1,600, 1,700, 1,800, 1,900, 2,000, 2,500, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, and 10,000 nucleotides in length.

[0176] In some embodiments, the regulatory region may range independently from 0 to 3,000 nucleotides in length such as, but not limited to, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20. 21, 22, 23, 24, 25, 26, 27, 28. 29. 30, 31, 32, 33, 34, 35, 40, 45. 50. 55, 60, 70, 80, 90, 100, 120. 140, 160. 180, 200. 250, 300. 350, 400. 450, 500. 600, 700, 800. 900, 1,000, 1.100. 1,200, 1.300. 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides in length.

[0177] In some embodiments, the originator construct may be circularized. In other embodiments, the originator construct may be concatcmcrizcd.

[0178] Originator constructs which include at least one identifier 40 or “identifier region" 40 (e.g., barcodes, labels, signals and / or tags) may also be referred to as “benchmark constructs” or “benchmark polynucleotide constructs." The benchmark construct may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more identifiers which may be the same or different throughout the benchmark polynucleotide construct.

[0179] In some embodiments, the identifier region may range independently from 1 to 3,000 nucleotides in length such as, but not limited to, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31. 32, 33, 34, 35, 40, 45, 50, 55, 60. 70, 80, 90, 100, 120, 140, 160. 180, 200. 250, 300. 350, 400. 450, 500. 600, 700. 800, 900, 1,000, 1,100. 1,200, 1,300. 1,400, 1,500.1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000. As a non-limiting example the identifier region may be 1-5 residues, 2-5 residues, 3-5 residues, 2-7 residues, 3-7 residues, 1-10 residues, 2-10 residues, 3-10 residues, 5-10 residues, 7-10 residues, 1-15 residues, 2-15 residues, 3-15 residues, 5-15 residues, 7-15 residues, 10-15 residues, 12-15 residues, 1-20 residues, 2-20 residues, 3-20 residues, 5-20 residues, 7-20 residues, 10-20 residues, 12-20 residues, 15-20 residues, 17-20 residues, 1-25 residues, 2-25 residues, 3-25 residues, 5-25 residues, 7-25 residues, 10-25 residues, 12-25 residues, 15-25 residues, 17-25 residues, 20-25 residues, 1-30 residues, 2-30 residues, 3-30 residues, 5-30 residues, 7-30 residues, 10-30 residues, 12-30 residues, 15-30 residues, 17-30 residues, 20-30 residues, 25-30 residues, 1-35 residues, 2-35 residues, 3-35 residues, 5-35 residues, 7-35 residues, 10-35 residues, 12-35 residues, 15-35 residues, 17-35 residues, 20-35 residues, 25-35 residues, 30-35 residues, 1-35 residues, 2-35 residues, 3-35 residues, 5-35 residues, 7-35 residues, 10-35 residues, 12-35 residues, 15-35 residues, 17-35 residues, 20-35 residues,Ref. No. OR-048WO1 / / OBS-033WO25-35 residues, 30-35 residues, 1-40 residues, 2-40 residues, 3-40 residues, 5-40 residues, 7-40 residues, 10-40 residues, 12-40 residues, 15-40 residues, 17-40 residues, 20-40 residues, 25-40 residues, 30-40 residues, 35-40 residues, 1-45 residues, 2-45 residues, 3-45 residues, 5-45 residues, 7-45 residues, 10-45 residues, 12-45 residues, 15-45 residues, 17-45 residues, 20-45 residues, 25-45 residues, 30-45 residues, 35-45 residues, 40-45 residues, 1-50 residues, 2-50 residues, 3-50 residues, 5-50 residues. 7-50 residues, 10-50 residues, 12-50 residues, 15-50 residues, 17-50 residues, 20-50 residues, 25-50 residues, 30-50 residues, 35-50 residues, 40-50 residues, or 45-50 nucleotides in length.

[0180] In some embodiments, the identifier region in the benchmark construct overlaps with the product coding region. As used herein, "overlap" means that at least one nucleotide of tire identifier region extends into the product coding region. In some aspects the identifier region overlaps with the product coding region by 1 nucleotide. 2 nucleotides, 3 nucleotides, 4 nucleotides. 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 nucleotides, 38 nucleotides, 39 nucleotides, 40 nucleotides 41 nucleotides, 42 nucleotides, 43 nucleotides, 44 nucleotides.45 nucleotides, 46 nucleotides, 47 nucleotides, 48 nucleotides, 49 nucleotides, 50 nucleotides or more than 50 nucleotides. In some aspects the identifier region overlaps with the product coding region by 1-5 nucleotides, 2-5 nucleotides, 3-5 nucleotides, 2-7 nucleotides, 3-7 nucleotides, 1-10 nucleotides, 2-10 nucleotides, 3-10 nucleotides, 5-10 nucleotides, 7-10 nucleotides, 1-15 nucleotides, 2-15 nucleotides, 3- 15 nucleotides, 5-15 nucleotides, 7-15 nucleotides, 10-15 nucleotides, 12-15 nucleotides, 1-20 nucleotides, 2-20 nucleotides, 3-20 nucleotides, 5-20 nucleotides, 7-20 nucleotides, 10-20 nucleotides, 12-20 nucleotides, 15-20 nucleotides, 17-20 nucleotides, 1-25 nucleotides, 2-25 nucleotides, 3-25 nucleotides, 5-25 nucleotides, 7-25 nucleotides, 10-25 nucleotides, 12-25 nucleotides, 15-25 nucleotides, 17-25 nucleotides, 20-25 nucleotides, 1-30 nucleotides, 2-30 nucleotides, 3-30 nucleotides, 5-30 nucleotides, 7-30 nucleotides, 10-30 nucleotides, 12-30 nucleotides, 15-30 nucleotides, 17-30 nucleotides, 20-30 nucleotides. 25-30 nucleotides, 1-35 nucleotides, 2-35 nucleotides, 3-35 nucleotides, 5-35 nucleotides, 7-35 nucleotides, 10-35 nucleotides, 12-35 nucleotides. 15-35 nucleotides, 17-35 nucleotides, 20-35 nucleotides, 25-35 nucleotides, 30-35 nucleotides, 1-35 nucleotides, 2-35 nucleotides, 3-35 nucleotides, 5-35 nucleotides, 7-35 nucleotides, 10-35 nucleotides, 12-35 nucleotides, 15-35 nucleotides, 17-35 nucleotides, 20-35 nucleotides, 25-35 nucleotides, 30-35 nucleotides, 1-40 nucleotides, 2-40 nucleotides, 3-40 nucleotides, 5-40 nucleotides, 7-40 nucleotides, 10-40 nucleotides, 12-40 nucleotides, 15-40 nucleotides. 17-40 nucleotides, 20-40 nucleotides, 25-40 nucleotides, 30-40 nucleotides, 35-40Ref. No. OR-048WO1 / / OBS-033WOnucleotides, 1-45 nucleotides, 2-45 nucleotides, 3-45 nucleotides, 5-45 nucleotides, 7-45 nucleotides, 10-45 nucleotides, 12-45 nucleotides, 15-45 nucleotides, 17-45 nucleotides, 20-45 nucleotides, 25-45 nucleotides, 30-45 nucleotides, 35-45 nucleotides, 40-45 nucleotides, 1-50 nucleotides, 2-50 nucleotides, 3-50 nucleotides, 5-50 nucleotides, 7-50 nucleotides, 10-50 nucleotides, 12-50 nucleotides, 15-50 nucleotides, 17-50 nucleotides, 20-50 nucleotides. 25-50 nucleotides, 30-50 nucleotides, 35-50 nucleotides, 40-50 nucleotides, or 45-50 nucleotides.

[0181] In some embodiments, the benchmark polynucleotide construct comprises a product coding region and an identifier region. The identifier region may be located 5' to the product coding region, 3' to the product coding region, or the identifier region may overlap with the 5' end or the 3 'end of the product coding region.

[0182] In some embodiments, the benchmark polynucleotide construct comprises a product coding region and two identifier regions. Each identifier region may independently be located 5' to the product coding region, 3' to the product coding region, or the identifier region may overlap with the 5' end or the 3 'end of the product coding region.

[0183] As a non-limiting example, the first identifier region is located 5' to the product coding region and the second identifier region is located 3' to the product coding region. As a non-limiting example, the first and second identifier regions are located 5' to the product coding region. As a non-limiting example, tire first and second identifier regions are located 3' to the product coding region.

[0184] As a non-limiting example, the first identifier region is inverted and is located 5' to the product coding region and the second identifier region is located 3' to the product coding region. As a nonlimiting example, the first identifier region is inverted and is located 5' to the product coding region and the second identifier region is inverted and is located 3' to the product coding region. As a non-limiting example, the first identifier region is located 5' to the product coding region and the second identifier region is inverted and is located 3' to the product coding region. As a non-limiting example, the first and second identifier regions are both inverted and are located 5' to the product coding region. As a nonlimiting example, the first and second identifier regions are located 5' to the product coding region and the first identifier region is inverted. As a non-limiting example, the first and second identifier regions are located 5' to the product coding region and the second identifier region is inverted. As a non-limiting example, the first and second identifier region are both inverted and located 3' to the product coding region. As a non-limiting example, the first and second identifier regions are located 3' to the product coding region and the first identifier region is inverted. As a non-limiting example, the first and second identifier regions are located 3' to the product coding region and the second identifier region is inverted.

[0185] As a non-limiting example, the first identifier region is located 5' to the product coding region and overlaps with the product coding region and the second identifier region is located 3' to the productRef. No. OR-048WO1 / / OBS-033WOcoding region. As a non-limiting example, the first identifier region is located 5' to the product coding region and the second identifier region is located 3' to the product coding region and overlaps with the product coding region.

[0186] As a non-limiting example, the first and second identifier regions are located 5' to the product coding region and the second identifier region overlaps with the product coding region. As a non-limiting example, the first and second identifier regions are located 3' to the product coding region and the first identifier region overlaps with the product coding region.

[0187] As a non-limiting example, the first identifier region is inverted, is located 5' to the product coding region and overlaps with the product coding region, and the second identifier region is located 3' to the product coding region. As a non-limiting example, the first identifier region is inverted and is located 5' to the product coding region and the second identifier region is located 3' to the product coding region and overlaps with the product coding region. As a non-limiting example, the first identifier region is inverted, is located 5' to the product coding region, the second identifier region is located 3' to the product coding region, and both of the first and second identifier regions overlap with the product coding region.

[0188] As a non-limiting example, the first identifier region is inverted, is located 5' to the product coding region and overlaps with the product coding region, and the second identifier region is inverted and is located 3' to the product coding region. As a non-limiting example, the first identifier region is inverted and is located 5' to the product coding region and the second identifier region is inverted, is located 3' to the product coding region and overlaps with the product coding region. As a non-limiting example, the first identifier region is inverted and is located 5' to the product coding region, and tire second identifier region is inverted and is located 3' to the product coding region, and both of the first and second identifier regions overlap with the product coding region.

[0189] As a non-limiting example, the first identifier region is located 5' to the product coding region and overlaps with the product coding region, and the second identifier region is inverted and is located 3' to the product coding region. As a non-limiting example, the first identifier region is located 5' to the product coding region and the second identifier region is inverted, is located 3' to the product coding region and overlaps with the product coding region. As a non-limiting example, the first identifier region is located 5' to the product coding region and the second identifier region is inverted and is located 3' to the product coding region, and both of the first and second identifier regions overlap with the product coding region.

[0190] As a non-limiting example, the first and second identifier regions are both inverted and are located 5' to the product coding region, and the second identifier region overlaps with the product coding region. As a non-limiting example, the first and second identifier regions are located 5' to the productRef. No. OR-048WO1 / / OBS-033WOcoding region and the first identifier region is inverted, and the second identifier region overlaps with the product coding region. As a non-limiting example, the first and second identifier regions are located 5' to the product coding region and the second identifier region is inverted and overlaps with the product coding region. As a non-limiting example, the first and second identifier region are both inverted and located 3' to the product coding region, and the first identifier region overlap with the product coding region. As anon-limiting example, the first and second identifier regions are located 3' to the product coding region and the first identifier region is inverted and overlaps with the product coding region. As a non-limiting example, the first and second identifier regions are located 3' to the product coding region and the second identifier region is inverted, and the first product coding region overlap with tire product coding region.

[0191] In some embodiments, at least one identifier moiety may be associated with the benchmark polynucleotide construct. The benchmark polynucleotide construct may have 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more identifier moieties associated with the benchmark polynucleotide construct which may be the same moiety or different moieties associated with the benchmark polynucleotide construct. Each identifier moiety may independently be located on the flanking region 5' to the product coding region, on the flanking region 3' to the product coding region, or the location of the identifier moiety may span the 5' end or the 3'end of the product coding region and a flanking region. In some aspects the location of the identifier moiety may include one or more nucleotides of the product coding region such as, but not limited to, 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 nucleotides, 38 nucleotides, 39 nucleotides, 40 nucleotides 41 nucleotides, 42 nucleotides, 43 nucleotides, 44 nucleotides, 45 nucleotides, 46 nucleotides, 47 nucleotides, 48 nucleotides, 49 nucleotides, 50 nucleotides or more than 50 nucleotides. In some aspects the location of the identifier moiety may include one or more nucleotides of the product coding region such as, but not limited to, 1-5 nucleotides. 2-5 nucleotides, 3-5 nucleotides, 2-7 nucleotides, 3-7 nucleotides, 1-10 nucleotides, 2-10 nucleotides, 3-10 nucleotides, 5-10 nucleotides, 7-10 nucleotides, 1-15 nucleotides, 2-15 nucleotides, 3-15 nucleotides, 5-15 nucleotides, 7- 15 nucleotides, 10-15 nucleotides, 12-15 nucleotides, 1-20 nucleotides, 2-20 nucleotides, 3-20 nucleotides, 5-20 nucleotides, 7-20 nucleotides, 10-20 nucleotides, 12-20 nucleotides, 15-20 nucleotides, 17-20 nucleotides, 1-25 nucleotides, 2-25 nucleotides, 3-25 nucleotides, 5-25 nucleotides, 7-25 nucleotides, 10-25 nucleotides, 12-25 nucleotides. 15-25 nucleotides, 17-25 nucleotides, 20-25Ref. No. OR-048WO1 / / OBS-033WOnucleotides, 1-30 nucleotides, 2-30 nucleotides, 3-30 nucleotides, 5-30 nucleotides, 7-30 nucleotides, 10-30 nucleotides, 12-30 nucleotides, 15-30 nucleotides, 17-30 nucleotides, 20-30 nucleotides, 25-30 nucleotides, 1-35 nucleotides, 2-35 nucleotides, 3-35 nucleotides, 5-35 nucleotides, 7-35 nucleotides, 10-35 nucleotides, 12-35 nucleotides, 15-35 nucleotides, 17-35 nucleotides, 20-35 nucleotides, 25-35 nucleotides, 30-35 nucleotides, 1-35 nucleotides, 2-35 nucleotides, 3-35 nucleotides, 5-35 nucleotides, 7-35 nucleotides, 10-35 nucleotides, 12-35 nucleotides, 15-35 nucleotides, 17-35 nucleotides, 20-35 nucleotides, 25-35 nucleotides, 30-35 nucleotides, 1-40 nucleotides, 2-40 nucleotides, 3-40 nucleotides, 5-40 nucleotides, 7-40 nucleotides, 10-40 nucleotides, 12-40 nucleotides, 15-40 nucleotides, 17-40 nucleotides, 20-40 nucleotides, 25-40 nucleotides, 30-40 nucleotides, 35-40 nucleotides, 1-45 nucleotides, 2-45 nucleotides, 3-45 nucleotides, 5-45 nucleotides, 7-45 nucleotides, 10-45 nucleotides, 12-45 nucleotides, 15-45 nucleotides, 17-45 nucleotides. 20-45 nucleotides, 25-45 nucleotides, 30-45 nucleotides, 35-45 nucleotides, 40-45 nucleotides, 1-50 nucleotides, 2-50 nucleotides, 3-50 nucleotides, 5-50 nucleotides, 7-50 nucleotides, 10-50 nucleotides, 12-50 nucleotides, 15-50 nucleotides, 17-50 nucleotides, 20-50 nucleotides, 25-50 nucleotides, 30-50 nucleotides, 35-50 nucleotides, 40-50 nucleotides, or 45-50 nucleotides.

[0192] In some embodiments, one identifier moiety may be associated with the benchmark polynucleotide construct. As a non-limiting example, the identifier moiety may be associated with the benchmark polynucleotide construct on the 5' end of the benchmark polynucleotide construct. As a nonlimiting example, the identifier moiety may be associated with the benchmark polynucleotide construct on the 5' flanking region. As a non-limiting example, the identifier moiety may be associated with the benchmark polynucleotide construct on the 3' flanking region. As a non-limiting example, the identifier moiety may be associated with the benchmark polynucleotide construct on the 3' end of the benchmark polynucleotide construct. As a non-limiting example, the identifier moiety may be associated with the benchmark polynucleotide construct on the product coding region. As a non-limiting example, the benchmark polynucleotide construct comprises an identifier moiety and the location of the identifier moiety spans the 5' end of the product coding region and the 5' flanking region. As a non-limiting example, the benchmark polynucleotide construct comprises an identifier moiety and the location of the identifier moiety spans the 3' end of the product coding region and tire 3' flanking region.

[0193] In some embodiments, two identifier moieties are associated with the benchmark polynucleotide construct. As a non-limiting example, the first identifier moiety and the second identifier moiety are located on the 5' flanking region. As a non-limiting example, the first identifier moiety and the second identifier moiety are located on the product coding region. As a non-limiting example, the first identifier moiety and the second identifier moiety are located on the 3' flanking region. As a non-limiting example, the first identifier moiety and the second identifier moiety are located on the 5' end of the benchmarkRef. No. OR-048WO1 / / OBS-033WOpolynucleotide construct. As a non-limiting example, the first identifier moiety and the second identifier moiety are located on the 3' end of the benchmark polynucleotide construct.

[0194] As a non-limiting example, the first identifier moiety is located on the 5' end of the benchmark polynucleotide construct and the second identifier moiety is located on tire 5' flanking region. As a nonlimiting example, the first identifier moiety is located on the 5' end of the benchmark polynucleotide construct and the second identifier moiety is located on the product coding region. As a non-limiting example, the first identifier moiety is located on the 5' end of the benchmark polynucleotide construct and the second identifier moiety is located on the 3' flanking region. As a non-limiting example, the first identifier moiety is located on the 5' end of the benchmark polynucleotide construct and the location of the second identifier moiety spans the 5' flanking region and the product coding region. As a non-limiting example, the first identifier moiety is located on the 5' end of the benchmark polynucleotide construct and the location of the second identifier moiety spans the 3' flanking region and the product coding region. As a non-limiting example, the first identifier moiety is located on the 5' end of the benchmark polynucleotide construct and the second identifier moiety is located on the 3' end of the benchmark polynucleotide construct.

[0195] As a non-limiting example, the first identifier moiety is located on the 5' flanking region and the second identifier moiety is located on the product coding region. As a non-limiting example, the first identifier moiety is located on the 5' flanking region and the second identifier moiety is located on the 3' flanking region. As a non-limiting example, the first identifier moiety is located on the 5' flanking region and the location of the second identifier moiety spans the 5' flanking region and the product coding region. As anon-limiting example, the first identifier moiety is located on the 5' flanking region and the location of the second identifier moiety spans the 3' flanking region and the product coding region. As a non-limiting example, the first identifier moiety is located on the 5' flanking region and the second identifier moiety is located on the 5' end of the benchmark polynucleotide construct. As a non-limiting example, the first identifier moiety is located on the 5' flanking region and the second identifier moiety is located on the 3' end of the benchmark polynucleotide construct.

[0196] As a non-limiting example, the location of the first identifier moiety spans the 5' flanking region and the product coding region and the second identifier moiety is located on the 5' end of the benchmark polynucleotide construct. As a non-limiting example, the location of the first identifier moiety spans the 5' flanking region and the product coding region and the second identifier moiety is located on the 5' flanking region. As a non-limiting example, the location of the first identifier moiety spans the 5' flanking region and the product coding region and the second identifier moiety is located on the product coding region. As anon-limiting example, the location of tire first identifier moiety spans the 5' flanking region and the product coding region and the location of the second identifier moiety spans the 3' flanking regionRef. No. OR-048WO1 / / OBS-033WOand the product coding region. As a non-limiting example, the location of the first identifier moiety spans the 5' flanking region and the product coding region and the second identifier moiety is located on the 3' flanking region. As a non-limiting example, the location of the first identifier moiety spans the 5' flanking region and the product coding region and the second identifier moiety is located on the 3' end of the benchmark polynucleotide construct.

[0197] As a non-limiting example, the first identifier moiety is located on the product coding region and the second identifier moiety is located on the 5' end of the benchmark polynucleotide construct. As a nonlimiting example, the first identifier moiety is located on the product coding region and the second identifier moiety is located on the 5' flanking region. As a non-limiting example, the first identifier moiety is located on the product coding region and the location of the second identifier moiety spans the 5' flanking region and the product coding region. As a non-limiting example, the first identifier moiety is located on the product coding region and the location of the second identifier moiety spans the 3' flanking region and the product coding region. As a non-limiting example, the first identifier moiety is located on the product coding region and the second identifier moiety is located on the 3' flanking region. As a nonlimiting example, the first identifier moiety is located on the product coding region and the second identifier moiety is located on the 3' end of the benchmark polynucleotide construct.

[0198] As a non-limiting example, the location of the first identifier moiety spans the 3' flanking region and the product coding region and the second identifier moiety is located on the 5' end of the benchmark polynucleotide construct. As a non-limiting example, the location of the first identifier moiety spans the 3' flanking region and the product coding region and the second identifier moiety is located on the 5' flanking region. As a non-limiting example, the location of the first identifier moiety spans the 3' flanking region and the product coding region and the location of the second identifier moiety spans the 5' flanking region and the product coding region. As a non-limiting example, the location of the first identifier moiety spans the 3' flanking region and the product coding region and the second identifier moiety is located on the product coding region. As a non -limiting example, the location of the first identifier moiety spans the 3' flanking region and the product coding region and the second identifier moiety is located on the 3' flanking region. As a non-limiting example, the location of the first identifier moiety spans the 3' flanking region and the product coding region and the second identifier moiety is located on the 3 'end of the benchmark polynucleotide construct.

[0199] As a non-limiting example, the location of the first identifier moiety spans the 3' flanking region and the product coding region and the second identifier moiety is located on the 5' flanking region. As a non-limiting example, the location of the first identifier moiety spans the 5' flanking region and the product coding region and the second identifier moiety is located on the product coding region. As a nonlimiting example, the location of the first identifier moiety spans the 5' flanking region and tire productRef. No. OR-048WO1 / / OBS-033WOcoding region and the location of the second identifier moiety spans the 3' flanking region and the product coding region. As a non-limiting example, the location of the first identifier moiety spans the 5' flanking region and the product coding region and the second identifier moiety is located on the 3' flanking region. As a non-limiting example, the location of the first identifier moiety spans the 5' flanking region and the product coding region and the second identifier moiety is located on the 3' end of the benchmark polynucleotide construct.

[0200] As a non-limiting example, the first identifier moiety is located on the 3' flanking region and the second identifier moiety is located on the 5' end of the benchmark polynucleotide construct. As a nonlimiting example, the first identifier moiety is located on the 3' flanking region and the second identifier moiety is located on the 5' flanking region. As a non-limiting example, the first identifier moiety is located on the 3' flanking region and the location of the second identifier moiety spans the 5' flanking region and the product coding region. As a non-limiting example, the first identifier moiety is located on the 3' flanking region and the second identifier moiety is located on the product coding region. As a nonlimiting example, the first identifier moiety is located on the 3' flanking region and the location of the second identifier moiety spans the 3' flanking region and the product coding region. As a non-limiting example, the first identifier moiety is located on the 3' flanking region and the second identifier moiety is located on the 3' end of the benchmark polynucleotide construct.

[0201] As a non-limiting example, the first identifier moiety is located on the 3' end of the benchmark polynucleotide construct and the second identifier moiety is located on the 5' end of the benchmark polynucleotide construct. As a non-limiting example, the first identifier moiety is located on the 3' end of the benchmark polynucleotide construct and the second identifier moiety’ is located on the 5' flanking region. As a non-limiting example, the first identifier moiety is located on the 5' end of the benchmark polynucleotide construct and the location of the second identifier moiety’ spans the 5' flanking region and the product coding region. As a non-limiting example, the first identifier moiety is located on the 3' end of the benchmark polynucleotide construct and the second identifier moiety is located on the product coding region. As a non-limiting example, the first identifier moiety is located on the 5' end of the benchmark polynucleotide construct and the location of the second identifier moiety spans the 3' flanking region and the product coding region. As a non-limiting example, the first identifier moiety is located on the 3' end of the benchmark polynucleotide construct and the second identifier moiety is located on the 3' flanking region.

[0202] In some embodiments, three identifier moieties are associated with the benchmark polynucleotide construct. In some embodiments, four identifier moieties are associated with the benchmark polynucleotide construct. In some embodiments, five identifier moieties are associated with the benchmark polynucleotide construct. In some embodiments, six identifier moieties are associated with theRef. No. OR-048WO1 / / OBS-033WObenchmark polynucleotide construct. In some embodiments, seven identifier moieties are associated with the benchmark polynucleotide construct. In some embodiments, eight identifier moieties are associated with the benchmark polynucleotide construct. In some embodiments, nine identifier moieties are associated with the benchmark polynucleotide construct, In some embodiments, ten identifier moieties are associated with the benchmark polynucleotide construct.

[0203] In some embodiments, the product coding region encodes a biologically active molecule such as, but not limited to a therapeutic protein or an antigen. As used herein, the term "biologically active" refers to a characteristic of any agent that has activity in a biological system, and particularly in an organism. For instance, an agent that, when administered to an organism, has a biological effect on that organism, is considered to be biologically active. In some embodiments, the CROI encodes one or more prophylactically- or therapeutically-active proteins, polypeptides, or other factors. As a non-limiting example, the CROI may encode an agent that enhances tumor killing activity such as, but not limited to, TRAIL or tumor necrosis factor (TNF), in a cancer. As another non-limiting example, the CROI may encode an agent suitable for the treatment of conditions such as muscular dystrophy (e.g., CROI encodes Dystrophin), cardiovascular disease (e.g., CROI encodes SERCA2a, GATA4, Tbx5, Mcf2C, Hand2, Myocd, etc.), neurodegenerative disease (e.g., CROI encodes NGF, BDNF, GDNF, NT-3, etc.), chronic pain (e.g., CROI encodes GlyRal), an enkephalin, or a glutamate decarboxylase (e.g., CROI encodes GAD65, GAD67, or another isoform), lung disease (e.g., CROI encodes CFTR), hemophilia (e.g., CROI encodes Factor VIII or Factor IX), neoplasia (e.g., CROI encodes PTEN, ATM, ATR, EGFR, ERBB2, ERBB3, ERBB4, Notchl, Notch2, Notch3, Notch4, AKT, AKT2, AKT3, HIF, HI Fla, HIF3a, Met, HRG, Bcl2, PPARalpha, PP AR gamma, WT1 (Wilms Tumor), FGF Receptor Family members (5 members: 1, 2, 3, 4, 5), CDKN2a, APC, RB (retinoblastoma), MEN1, VHL, BRCA1, BRCA2, AR (Androgen Receptor). TSG101. IGF, IGF Receptor. Igfl (4 variants), Igf2 (3 variants), Igfl Receptor, Igf2 Receptor, Bax, Bcl2, caspases family (9 members: 1, 2, 3, 4, 6, 7, 8, 9, 12), Kras, Ape), age-related macular degeneration (e.g., CROI encodes Aber, Ccl2, Cc2, cp (ceruloplasmin), Timp3, cathepsin D, Vldlr), schizophrenia (e.g. Neuregulin (Nrgl), Erb4 (receptor for Neuregulin), Complexin-1 (Cplxl), Tphl Try ptophan hydroxylase, Tph2 Try ptophan hydroxylase 2, Neurexin 1, GSK3, GSK3a, GSK3b, 5-HIT (Slc6a4), COMT, DRD (Drdla), SLC6A3, DAOA, DTNBPI, Dao (Daol)), trinucleotide repeat disorders (e.g., HTT (Huntington's Dx), SBMA / SMAXI / AR (Kennedy's Dx), FXN / X25 (Friedrich's Ataxia), ATX3 (Machado-Joseph's Dx), ATXNI and ATXN2 (spinocerebellar ataxias), DMPK (myotonic dystrophy), Atrophin-1 and Atnl(DRPLA Dx), CBP (Creb-BP-global instability), VLDLR (Alzheimer's), Atxn7, AtxnlO), fragile X syndrome (e.g., CROI encodes FMR2, FXRI, FXR2, mGLUR5), secretase related disorders (e.g., CROI encodes APH-1 (alpha and beta), Presenilin (Psenl), nicastrin (Ncstn), PEN-2), ALS (e.g., CROI encodes SOD1, ALS2. STEX, FUS, TARD BP, VEGF (VEGF-a, VEGF-b, VEGF-c)),Ref. No. OR-048WO1 / / OBS-033WOautism (e.g., CROI encodes Mecp2, BZRAP1, MDGA2, Sema5A, Neurexin 1), Alzheimer's disease (e.g., CROI encodes El, CHIP, UCH, UBB, Tan, LRP, PICALM, Clustenn, PSI, SORL1, CR1, Vldlr, Ubal, Uba3, CHIP28 (Aqpl, Aquaporin 1), Uchll, Uchl3, APP), inflammation (e.g., CROI encodes IL-10, IL-1 (IL-Ia, IL-Ib), IL-13, IL-17 (IL-17a (CTLA8), IL-17b, IL-17c, IL-17d, IL-171), 11-23, Cx3crl, ptpn22, TNFa, NOD2 / CARD15 for IBD, IL-6, IL-12 (IL-12a, IL-12b), CTLA4. Cx3cll), Parkinson's Disease (e.g., x-Synuclein, DJ-1, LRRK2, Parkin, P1NK1), blood and coagulation disorders, such as, e.g., anemia, bare lymphocyte syndrome, bleeding disorders, hemophagocytic lymphohistiocytosis disorders, hemophilia A, hemophilia B, hemorrhagic disorders, leukocyte deficiencies and disorders, sickle cell anemia, and thalassemia (e.g., CROI encodes CRAN1, CDA1, RPS19, DBA, PKLR, PK1, NT5C3, UMPH1, PSNI, RHAG, RH50A, NRAMP2, SPTB, ALAS2, ANH1, ASB, ABCB7. ABC7, ASAT, TAPBP. TPSN, TAP2, ABCB3. PSF2, RING11, MHC2TA. C2TA, RFX5, RFXAP, RFX5. TBXA2R, P2RXL P2X1, HP I, CPH, HUS, MCPD2, PANCA, FAC A, FA1, FA, FA A. FAAP95. FAAP90, FLJ34064, FANCB, FANCC, FACC, BRCA2, FANCDI, FANCD2, FANCD, FACD, FAD, FANCE, FACE, FANCE, XRCC9, EANCG, BR1PI, BACH1, FANCJ, PHF9, FANCL, FANCM, KIAA1596, PRF1, HPLH2, UNC13D, MUNC13-4, HPLH3, HLH3, FHL3, F8, FSC, PI, ATT, F5, ITGB2, CD18, LCAMB, LAD, EIF2B1, EIF2BA, EIF2B2, EIF2B3, EIF2B5. LVWM, CACH, CLE, EIF2B4, HBB, HBA2, HBB, HBD, LCRB, HBA1). B-cell non-Hodgkin lymphoma or leukemia (e.g., CROI encodes BCL7A, BCL7, ALI, TCL5, SCL, TAL2, FLT3, NBSL NBS, ZNFN1AL 1KI, LYF1, H0XD4, H0X4B, BCR, CML, PHL, ALL, ARNT, KRAS2, RASK2, GMPS, AFIO, ARHGEF12, LARG, KIAA0382, CALM, CLTH, CEBPA, CEBP, CHIC2, BTL, FLT3, KIT, PBT, LPP, NPMI, NUP214, D9S46E, CAN, CAIN, RUNXI, CBFA2, AML1, WHSC1LI, NSD3, FLT3, AE1Q, NPMI, NUMA1, ZNL145, PLZF, PML, MYL. STAT5B, AF1Q. CALM, CLTH, ARL11, ARLTS1, P2RX7, P2X7, BCR, CML, PHL, ALL, GRAF, NF1, VRNF, WSS, NFNS, PTPNII. PTP2C, SHP2, NS1, BCL2, CCND1. PRAD1, BCL1, TCRA, GATA1, GFL ERYF1, NFE1, ABLL NQO1, DIA4, NM0R1, NUP214, D9S46E, CAN, CAIN), inflammation and immune related diseases and disorders (e.g., CROI encodes KIR3DL1, NKAT3, NKB1, AMB11, K1R3DS1, IFNG, CXCL12, TNFRSE6, APT1, FAS, CD95, ALPS1A, IL2RG, SCIDX1, SCIDX, IMD4, CCL5, SCYA5, D17S136E, TCP228, IL10, CSIF, CMKBR2, CCR2, CMKBR5, CCCKR5 (CCR5). CD3E, CD3G, AICDA, AID, HIGM2, TNFRSF5, CD40, UNG, DGU. HIGM4. TNFSFS, CD40LG, HIGML IGM, FOXP3, IPEX. AIID, XPID. PIDX, TNFRSF14B, TACI), inflammation (e.g., CROI encodes IL-10, IL-1 (IL-IA, IL-IB), IL-13, IL-17 (IL-17a (CTLA8), IL-17b, IL-17c, IL-17d, IL-171), 11-23, Cx3crl, ptpn22, TNFa, NOD2 / CARD15 for IBD, IL-6, IL-12 (IL-12a, IL-12b), CTLA4, Cx3cII), JAK3, JAKL, DCLREIC, ARTEMIS, SCIDA, RAG1, RAG2, ADA, PTPRC, CD45, LCA, IL7R, CD3D, T3D, IL2RG, SCIDXI, SCIDX, IMD4), metabolic, liver, kidney and protein diseases and disorders (e.g., CROI encodes TTR, PALB, AP0A1, APP, AAA, CVAP, ADI, GSN, FGA,Ref. No. OR-048WO1 / / OBS-033WOLYZ, TTR, PALB, KRT18, KRT8, CIRH1A, NAIC, TEX292, KIAA1988, CFTR, ABCC7, CF, MRP7, SLC2A2, GLUT2, G6PC, G6PT, G6PT1, GAA, LAMP2, LAMPB, AGL, GDE, GBE1, GYS2, PYGL, PFKM, TCF1, HNF1A, M0DY3, SC0D1, SCO1, CTNNB1, PDGFRL, PDGRL, PRLTS, AX1NI, AXIN, CTNNB1, TP53, P53, LFS1, IGF2R, MPRI, MET, CASP8, MCH5, UMOD, HNFJ, FJHN, MCKD2, ADMCKD2, PAH, PKU1, QDPR DHPR PTS. FCYT, PKHD1, ARPKD, PKD1, PKD2. PKD4, PKDTS, PRKCSH, G19P1, PCLD, SEC63), muscular / skeletal diseases and disorders (e.g., CR01 encodes DMD, BMD, MYF6, LMNA, LMN1, EMD2, FPLD, CMDIA, HGPS, LGMDIB, LMNA, LMNI, EMD2, FPLD, CMDIA, FSHMD1A, FSHD1A, FKRP, MDC1C, LGMD2I, LAMA2, LAMM, LARGE, KIAA0609, MDC1D, FCMD, TTID, MYOT, CAPN3, CANP3, DYSF, LGMD2B, SGCG, LGMD2C, DMDA1, SCG3, SGCA, ADL, DAG2, LGMD2D. DMDA2, SGCB. LGMD2E, SGCD, SGD, LGMD2F. CMD1L. TCAP, LGMD2G, CMD1N, TRIM32, HT2A, LGMD2H, FKRP, MDCIC.LGMD2L TTN. CMD1G, TMD, LGMD2J. POMTL CAV3, LGMD1C, SEPNL SELN, RSMD1, PLEC1, PLTN, EBS1, LRP5, BMND1, LRP7, LR3, OPPG, VBCH2, CLCN7, CLC7, OPTA2, OSTMI, GL, TCIRG1, TIRC7, OC116, OPTB1, VAPB, VAPC, ALS8, SMN1, SMA1, SMA2, SMA3, SMA4, BSCL2, SPG17, GARS, SMAD1, CMT2D, HEXB, IGHMBP2, SMUBP2, CATF1, SMARD1), neurological and neuronal diseases and disorders (e.g., CROI encodes SOD1, ALS2, STEX. FUS, TARDBP. VEGF (VEGF-a. VEGF-b. VEGF-c), APP, AAA, CVAP, ADI, APOE, AD2, PSEN2, AD4, STM2, APBB2, FE65LI, NOS3, PLAU, URK, ACE, DCPL ACEI, MPO, PAC1PL PAXIPIL, PTIP, A2M, BLMH, BMH, PSEN1, AD3, Mecp2, BZRAP1, MDGA2, Sema5A, Neurexin 1, GLO1, MECP2, RTT, PPMX, MRX16, MRX79, NLGN3, NLGN4, KIAA1260, AUTSX2, FMR2, FXR1, FXR2, mGLUR5, HD, IT15, PRNP, PRIP, JPH3, JP3, HDL2, TBP, SCA17, NR4A2, NURR1, NOT, TINUR, SNCAIP, TBP, SCA17, SNCA, NACP, PARK1, PARK4, DJI, PARK7. LRRK2, PARK8, PINK1, PARK6. UCHL1, PARK5, SNCA, NACP, PARK1, PARK4, PRKN, PARK2, PDJ, DBH, NDUFV2, MECP2, RTT, PPMX, MRX16, MRX79, CDKL5, STK9, MECP2, RTT, PPMX, MRX16, MRX79, x-Synuclein, DJ-1, Neuregulin-1 (Nrgl), Erb4 (receptor for Neuregulin), Complexin-1 (Cplxl), Tphl Tryptophan hydroxylase, Tph2, Tryptophan hydroxylase 2, Neurexin 1, GSK3, GSK3a, GSK3b, 5-HTT (Slc6a4), COMT, DRD (Drdla), SLC6A3, DAOA, DTNBP1, Dao (Daol), APH-l(alpha and beta), Presenilin (Psenl), Nicastrin, (Ncstn), PEN-2, Nosl, Parpl, Natl, Nat2, HTT, SBMA / SMAX1 / AR, FXN / X25. ATX3. TXN, ATXN2. DMPK, Atrophin-1, Atnl, CBP, VLDLR. Atxn7. and AtxnlO), and ocular diseases and disorders (e.g., Aber, Ccl2, Cc2, cp (ceruloplasmin), Timp3, cathepsin-D, Vldlr, Ccr2, CRYAA, CRYA1, CRYBB2, CRYB2, PITX3, BFSP2, CP49, CP47, CRYAA, CRYAI, PAX6, AN2, MGDA, CRYBAI, CRYB1, CRYGC, CRYG3, CCL, LIM2, MP19, CRYGD, CRYG4, BFSP2, CP49, CP47, HSF4, CTM, HSF4, CTM, MIP, AQPO, CRYAB, CRYA2, CTPP2, CRYBB1, CRYGD, CRYG4, CRYBB2, CRYB2, CRYGC, CRYG3, CCL, CRYAA, CRYAI, GJA8, CX50, CAE1, GJA3, CX46,Ref. No. OR-048WO1 / / OBS-033WOCZP3, CAE3, CCM1, CAM, KRIT1, AP0A1, TGFBI, CSD2, CDGG1, CSD, BIGH3, CDG2, TACSTD2, TROP2, M1SI, VSX1, RINX, PPCD, PPD, KTCN, COL8A2, FECD, PPCD2, PIP5K3, CFD, KERA, CNA2, MYOC, TIGR, GLCIA, JO AG, GPOA, OPTN, GLC1E, FIP2, HYPL, NRP, CYP1BI, GLC3A. OPA1, NTG. NPG, CYP1BE GLC3A, CRB1, RP12. CRX, CORD2, CRD, RPGRIPI, LCA6, CORD9, RPE65, RP20, AIPL1, LCA4, GUCY2D, GUC2D, LCA1, CORD6, RDH12, LCA3. ELOVL4, ADMD. STGD2, STGD3. RDS. RP7. PRPH2, PRPH. AVMD, AOFMD, and VMD2).

[0204] In some embodiments, the product coding region of the RNA payloads described herein encodes a factor that can affect the differentiation of a cell. As a non -limiting example, the expression of one or more of Oct4, Klf4, Sox2, c-Myc, L-Myc, dominant-negative p53, Nanog, Glisl, Lin28, TFIID, mir-302 / 367, or other miRNAs can cause the cell to become an induced pluripotent stem (iPS) cell.

[0205] In some embodiments, the product coding region of the RNA payloads described herein encodes a factor for transdifferentiating cells. Non-limiting examples of factors include: one or more of GATA4, Tbx5, Mef2C, Myocd, Hand2, SRF, Mespl, SMARCD3 for cardiomyocytes: Ascii, Nurrl, LmxlA, Bm2, Mytll, NeuroDl, FoxA2 for neural cells; and Hnf4a, Foxal, Foxa2 or Foxa3 for hepatic cells.

[0206] Additional product coding regions of the RNA payloads described herein are described elsewhere.A. Nucleic acid payloads

[0207] In various embodiments, the LNP compositions described herein can be used to deliver a nucleic acid or polynucleotide payload, e g., a DNA HDR donor, a linear or circular RNA, or a chimeric DNA / RNA guide.

[0208] In some embodiments, a LNP is capable of delivering a polynucleotide to a target cell, tissue, or organ. A polynucleotide, in its broadest sense of the term, comprises any compound and / or substance that is or can be incorporated into an oligonucleotide chain. Exemplary polynucleotides for use in accordance with the present disclosure include, but are not limited to, one or more of deoxyribonucleic acid (DNA), ribonucleic acid (RNA) including messenger mRNA (mRNA), hybrids thereof, RNAi-inducing agents, RNAi agents, siRNAs, shRNAs, miRNAs, antisense RNAs, ribozymes, catalytic DNA, RNAs that induce triple helix formation, aptamers, vectors, etc. RNAs useful in the compositions and methods described herein can be selected from the group consisting of but are not limited to, shortimers, antagomirs, antisense, ribozymes, short interfering RNA (siRNA), asymmetrical interfering RNA (aiRNA), microRNA (miRNA), Dicer substrate RNA (dsRNA), short hairpin RNA (shRNA), transfer RNA (tRNA), messenger RNA (mRNA), and mixtures thereof. In some embodiments, a polynucleotide is mRNA. In some embodiments, a polynucleotide is circular RNA. In some embodiments, a polynucleotide encodes a protein, e.g., a vaccine antigen, a therapeutic protein, or a nucleobase editing enzyme. A polynucleotide may encode any polypeptide of interest, including any naturally or non-naturally occurringRef. No. OR-048WO1 / / OBS-033WOor otherwise modified polypeptide. A polypeptide may be of any size and may have any secondary structure or activity. In some embodiments, a polypeptide encoded by an RNA may have a therapeutic effect when expressed in a cell.

[0209] Ribonucleic acid (RNA) is a molecule that is made up of nucleotides, which are ribose sugars attached to nitrogenous bases and phosphate groups. The nitrogenous bases include adenine (A), guanine (G), uracil (U), and cytosine (C). Generally, RNA mostly exists in the single-stranded form but can also exists double-stranded in certain circumstances. The length, form and structure of RNA is diverse depending on the purpose of the RNA. For example, the length of an RNA can vary from a short sequence (e.g., siRNA) to a long sequences (e.g., IncRNA), can be linear (e.g., mRNA) or circular (e.g., oRNA), and can either be a coding (e.g., mRNA) or a non-coding (e.g., IncRNA) sequence.

[0210] In other embodiments, a polynucleotide is an siRNA. An siRNA may be capable of selectively knocking down or down regulating expression of a gene of interest. For example, an siRNA could be selected to silence a gene associated with a particular disease, disorder, or condition upon administration to a subject in need thereof of a nanoparticle composition including the siRNA. An siRNA may comprise a sequence that is complementary to an mRNA sequence that encodes a gene or protein of interest. In some embodiments, the siRNA may be an immunomodulatory siRNA.

[0211] In some embodiments, a polynucleotide is an shRNA or a vector or plasmid encoding the same. An shRNA may be produced inside a target cell upon delivery of an appropriate construct to the nucleus. Constructs and mechanisms relating to shRNA are well known in the relevant arts.

[0212] A polynucleotide may include a first region of linked nucleosides encoding a polypeptide of interest (e.g., a coding region), a first flanking region located at the 5'-terminus of the first region (e.g., a 5'-UTR), a second flanking region located at the 3'-tenninus of the first region (e.g., a 3'-UTR), at least one 5'-cap region, and a 3 '-stabilizing region. In some embodiments, a polynucleotide further comprises a poly-A region or a Kozak sequence (e.g., in the 5'-UTR). In some cases, polynucleotides may contain one or more intronic nucleotide sequences capable of being excised from the polynucleotide. In some embodiments, a polynucleotide (e.g., an RNA) may include a 5 'cap structure, a chain terminating nucleotide, a stem loop, a polyA sequence, and / or a polyadenylation signal.

[0213] In various embodiments, the nucleic acid payloads may contain one or more modifications. Such modifications include various chemical and / or structural modifications. For example, in tire case of RNA, the RNA may comprise one or more modifications, including chemical modifications (e.g., ribonucleotide analogs, alternative phosphate chain linkers), sequence modification (e.g., relative to a wild type sequence), and / or structural modification (e.g., secondary-folded structures, such as, but not limited to, stem-loops, hairpins, and G-quadruplexes, and tertiary structural elements, such as, but not limited to, helical duplexes and triple-stranded structures). To date, hundreds of different RNA modifications haveRef. No. OR-048WO1 / / OBS-033WObeen characterized Among them, several RNA modifications, including N⁶-methyladenosine (m6A), N6,2'-O-dimethyladenosine (m6Am), 8-oxo-7,8-dihydroguanosine (8-oxoG), pseudouridine (Ψ), 5-methylcytidine (m5C), and N4-acetylcytidine (ac4C), have been shown to regulate mRNA stability, consequently affecting diverse cellular and biological processes. Any known modification to RNA or DNA is contemplated herein.

[0214] In some embodiments, a nucleic acid may include one or more alternative components (e.g., an alternative nucleoside). For example, the 3'-stabilizing region may contain an alternative nucleoside such as an L-nucleoside, an inverted thymidine, or a 2'-O-methyl nucleoside and / or the coding region, 5'-UTR, 3'-UTR, or cap region may include an alternative nucleoside such as a 5-substituted uridine (e.g., 5-methoxyu ridine), a 1 -substituted pseudouridine (e.g., 1 -methyl pseudouridine or 1-ethyl-pseudouridine), and / or a 5-substituted cytidine (e.g., -methyl -cytidine). In some embodiments, a polynucleotide contains only naturally occurring nucleosides. Nucleic acid modifications are well known in the art and are further discussed in the following references: (1) Crooke ST, Witztum JL, Bennett CF, Baker BF RNA-Targeted Therapeutics. Cell Metab. 2018 Apr 3;27(4):714-739. doi: 10.1016 / j.cmet.2018 03.004. Erratum in: Cell Metab. 2019 Feb 5;29(2):501. PMID: 29617640; (2) JP, Wen W, Zhang F, Oberg KC, Zhang L, Cheng T, Zhang XB. Dynamics and competition of CRISPR-Cas9 ribonucleoproteins and AAV donor-mediated NHEJ. MMEJ and HDR editing. Nucleic Acids Res. 2021 Jan 25;49(2):969-985. doi:10.1093 / nar / gkaa1251. PMID: 33398341; PMC1D: PMC7826255; (3) Pradeep SP, Malik S. Slack FJ, Bahai R. Unlocking the potential of chemically modified peptide nucleic acids for RNA-based therapeutics. RNA. 2023 Apr;29(4): 434-445. doi: 10.1261 / rna.079498.122. Epub 2023 Jan 18. PMID: 36653113; PMCID: PMC10019372; (4) Haruehanroengra P, Zheng YY, Zhou Y, Huang Y, Sheng J. RNA modifications and cancer. RNA Biol. 2020 Nov;17(l 1): 1560-1575. doi:10.1080 / 15476286.2020.1722449. Epub 2020 Feb 7. PMID: 31994439; PMCID: PMC7567502; (5) Heidenreich O, Pieken W, Eckstein F. Chemically modified RNA: approaches and applications. FASEB J. 1993 Jan;7(1):90-6. doi: 10.1096 / fasebj.7.1.7678566. PMID: 7678566; (6) Zhang HY. Du Q, Wahlestedt C. Liang Z. RNA Interference with chemically modified siRNA. Curr Top Med Chem.2006;6(9):893-900. doi: 10.2174 / 156802606777303676. PMID: 16787282; (7) Jin G, Xu M, Zou M, Duan S. Tire Processing, Gene Regulation, Biological Functions, and Clinical Relevance ofN4-Acetylcytidine on RNA: A Systematic Review. Mol Ther Nucleic Acids. 2020 Jun 5;20: 13-24. doi: 10.1016 / j.omtn.2020.01.037. Epub 2020 Feb 8. PMID: 32171170; PMCID: PMC7068197; (8) Gao M, Zhang Q, Feng XH, Liu J. Synthetic modified messenger RNA for therapeutic applications. Acta Biomater, 2021 Sep 1;131: 1-15. doi: 10.1016 / j.actbio.2021.06.020. Epub 2021 Jun 13. PMID: 34133982; PMCID: PMC8198544; (9) Filippova JA, Semenov DV, Juravlev ES, Komissarov AB, Richter VA, Stepanov GA. Modern Approaches for Identification of Modified Nucleotides in RNA. BiochemistryRef. No. OR-048WO1 / / OBS-033WO(Mose). 2017 Nov;82(ll):1217-1233. doi: 10.1134 / S000629791711001. PMID: 29223150: (10) Rothlisberger P, Berk C, Hall J. RNA Chemistry for RNA Biology. Chimia (Aarau). 2019 May 29;73(6):368-373. doi: 10.2533 / chimia.2019.368. PMID: 31118118; and (11) Elkhalifa D, Rayan M, Negmeldin AT, Elhissi A, Khalil A. Chemically modified mRNA beyond COVID-19: Potential preventive and therapeutic applications for targeting chronic diseases. Biomed Pharmacother. 2022 Jan;145: 112385. doi: 10.1016 / j.biopha.2021.1 12385. Epub 2021 Oct 28. PMID: 34915673: PMCID: PMC8552589; (12) Boo SH, Kim YK The emerging role of RNA modifications in the regulation of mRNA stability. Exp Mol Med. 2020 Mar;52(3):400-408. doi: 10.1038 / sl2276-020-0407-z. Epub 2020 Mar 24. PMID: 32210357; PMCID: PMC7156397; (13) Varshney D, Spiegel J, Zyner K, Tannahill D, Balasubramanian S. The regulation and functions of DNA and RNA G-quadruplexes. Nat Rev Mol Cell Biol. 2020 Aug;21(8):459-474. doi: 10.1038 / s41580-020-0236-x. Epub 2020 Apr 20. PMID: 32313204; PMCID: PMC7115845; each of which are incorporated herein by reference in their entireties.

[0215] In some cases, a polynucleotide is greater than 30 nucleotides in length. In another embodiment, the poly nucleotide molecule is greater than 35 nucleotides in length. In another embodiment, the length is at least 40 nucleotides. In another embodiment, the length is at least 45 nucleotides. In another embodiment, the length is at least 55 nucleotides. In another embodiment, the length is at least 50 nucleotides. In another embodiment, the length is at least 60 nucleotides. In another embodiment, the length is at least 80 nucleotides. In another embodiment, the length is at least 90 nucleotides. In another embodiment, the length is at least 100 nucleotides. In another embodiment, the length is at least 120 nucleotides. In another embodiment, the length is at least 140 nucleotides. In another embodiment, the length is at least 160 nucleotides. In another embodiment, the length is at least 180 nucleotides. In another embodiment, the length is at least 200 nucleotides. In another embodiment, the length is at least 250 nucleotides. In another embodiment, the length is at least 300 nucleotides. In another embodiment, the length is at least 350 nucleotides. In another embodiment, the length is at least 400 nucleotides. In another embodiment, the length is at least 450 nucleotides. In another embodiment, the length is at least 500 nucleotides. In another embodiment, the length is at least 600 nucleotides. In another embodiment, the length is at least 700 nucleotides. In another embodiment, the length is at least 800 nucleotides. In another embodiment, the length is at least 900 nucleotides. In another embodiment, the length is at least 1000 nucleotides. In another embodiment, the length is at least 1100 nucleotides. In another embodiment, the length is at least 1200 nucleotides. In another embodiment, the length is at least 1300 nucleotides. In another embodiment, the length is at least 1400 nucleotides. In another embodiment, the length is at least 1500 nucleotides. In another embodiment, the length is at least 1600 nucleotides. In another embodiment, the length is at least 1800 nucleotides. In another embodiment, the length is at least 2000 nucleotides. In another embodiment, the length is at least 2500 nucleotides. In another embodiment, the length is at leastRef. No. OR-048WO1 / / OBS-033WO3000 nucleotides. In another embodiment, the length is at least 4000 nucleotides. In another embodiment, the length is at least 5000 nucleotides, or greater than 5000 nucleotides.

[0216] In some embodiments, a polynucleotide molecule, formula, composition or method associated therewith comprises one or more polynucleotides comprising features as described in W02002 / 098443, W02003 / 051401, W02008 / 052770, W02009 / 127230, WO2006 / 122828, W02008 / 083949, WO2010 / 088927. W02010 / 037539, W02004 / 004743, W02005 / 016376. W02006 / 024518,W 02007 / 095, 976, W02008 / 014979, W02008 / 077592, W02009 / 030481, W02009 / 095226, WO2011 / 069586, WO2011 / 026641, WO2011 / 144358, W02012 / 019780, WO2012 / 013326, WO2012 / 089338, WO2012 / 113513, WO2012 / 116811, WO2012 / 116810, WO2013 / 113502, WO2013 / 113501, WO2013 / 113736, WO2013 / 143698, WO2013 / 143699, W02013 / 143700, WO2013 / 120626, WO2013 / 120627, WO2013 / 120628, WO2013 / 120629, WO2013 / 174409, WO2014 / 127917, WO2015 / 024669, WO2015 / 024668, WO2015 / 024667. WO2015 / 024665, WO2015 / 024666, WO2015 / 024664, WO2015 / 101415, WO2015 / 101414, WO2015 / 024667, WO2015 / 062738, W02015 / 101416, all of which are incorporated by reference herein.

[0217] In some embodiments, a polynucleotide comprises one or more microRNA binding sites. In some embodiments, a microRNA binding site is recognized by a microRNA in a non-target organ. In some embodiments, a microRNA binding site is recognized by a microRNA in the liver. In some embodiments, a microRNA binding site is recognized by a microRNA in hepatic cells.B. Linear mRNA payloads

[0218] In various embodiments, the LNP-based RNA vaccines, RNA therapeutics and pharmaceutical compositions thereof described herein can be used to deliver an RNA payload that is a linear mRNA molecule.

[0219] In various embodiments, the LNP-based pharmaceutical compositions described herein, e.g., LNP-based gene editing systems, may include one or more linear mRNA molecules or linear mRNA payloads. In various embodiments, the mRNA payloads may encode one or more components of the herein described gene editing systems. For example, an mRNA payload may encode an amino acid sequence -programmable DNA binding domain (e.g., TALENS and zinc finger-binding domains) or a nucleic acid sequence-programmable DNA binding domain (e.g., CRISPR Cas9, CRISPR Casl2a, CRISPR Casl2f, CRISPR Casl3a, CRISPR Casl3b, or TnpB).

[0220] mRNA payloads may also encode, depending upon the nature of the gene editing system, one or more effector domains that provide various functionalities that facilitate changes in nucleotide sequence and / or gene expression, such as, but not limited to, single-strand DNA binding proteins, nucleases, endonucleases, exonucleases, deaminases (e.g., cytidine deaminases or adenosine deaminases),Ref. No. OR-048WO1 / / OBS-033WOpolymerases (e.g., reverse transcriptases), integrases, recombinases, etc., and fusion proteins comprising one or more functional domains linked together.

[0221] In various embodiments, the LNP-based RNA vaccines, RNA therapeutics, gene editing systems and pharmacal compositions thereof described herein can be used to deliver a mRNA payload that is a linear mRNA molecule. In embodiments, the mRNA payload may comprise one or more nucleotide sequences that encode a product of interest, such as, but not limited to a vaccine antigen, a component of a gene editing system (e.g., an endonuclease, a prime editor, etc.) and / or a therapeutic protein.

[0222] In some embodiments, the RNA payload may be a linear mRNA.

[0223] Generally, a mRNA molecule comprises at least a coding region, a 5' untranslated region (UTR), a 3' UTR, a 5' cap and a poly-A tail. In some aspects, one or more structural and / or chemical modifications or alterations may be included in the RNA which can reduce the innate immune response of a cell in which the mRNA is introduced. As used herein, a "structural" feature or modification is one in which two or more linked nucleotides are inserted, deleted, duplicated, inverted or randomized in a nucleic acid without significant chemical modification to the nucleotides themselves. Because chemical bonds will necessarily be broken and reformed to affect a structural modification, structural modifications are of a chemical nature and hence are chemical modifications. However, structural modifications w ill result in a different sequence of nucleotides. For example, the polynucleotide " ATCG" may be chemically modified to " AT-5meC-G".

[0224] Generally, a coding region of interest in an mRNA used herein may encode a dipeptide, a tripeptide, a tetrapeptide, a pentapeptide, a hexapeptide, a heptapeptide, an octapeptide, a nonapeptide, or a decapeptide. In another embodiment, the mRNA may encode a peptide of 2-30 amino acids, e g. 5-30, 10-30, 2-25, 5-25, 10-25, or 10-20 amino acids. Tire mRNA may encode a peptide of at least 10, 11, 12, 13, 14, 15, 17. 20. 25, 26, 27, 28, 29, 30, 31. 32. 33. 34, 35, 36, 37, 38, 39, or 40 amino acids, or apeptide that is no longer than 10, 11, 12, 13, 14, 15, 17, 20, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 amino acids.

[0225] Generally, the length of the region of the mRNA encoding a product of interest is greater than about 30 nucleotides in length (e.g., at least or greater than about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200. 250, 300. 350, 400. 450, 500. 600, 700, 800, 900, 1000, 1,100, 1.200, 1,300, 1,400. 1,500, 1,600, 1.700, 1,800, 1.900, 2,000, 2.500. and 3,000, 4.000, 5,000, 6.000. 7,000, 8,000. 9,000, 10,000, 20,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000 or up to and including 100,000 nucleotides).

[0226] In some embodiments, the mRNA has a total length that spans from about 30 to about 100,000 nucleotides (e.g., from 30 to 50, from 30 to 100, from 30 to 250, from 30 to 500, from 30 to 1,000, from 30 to 1,500, from 30 to 3,000, from 30 to 5,000, from 30 to 7,000. from 30 to 10,000, from 30 to 25,000,Ref. No. OR-048WO1 / / OBS-033WOfrom 30 to 50,000, from 30 to 70,000, from 100 to 250, from 100 to 500, from 100 to 1,000, from 100 to 1,500, from 100 to 3,000, from 100 to 5,000, from 100 to 7,000, from 100 to 10,000, from 100 to 25,000, from 100 to 50,000, from 100 to 70,000, from 100 to 100,000, from 500 to 1,000, from 500 to 1,500, from 500 to 2,000, from 500 to 3,000, from 500 to 5,000, from 500 to 7.000, from 500 to 10,000, from 500 to 25,000. from 500 to 50,000, from 500 to 70,000, from 500 to 100,000, from 1,000 to 1,500, from 1,000 to 2,000, from 1,000 to 3.000. from 1.000 to 5,000, from 1,000 to 7.000, from 1,000 to 10,000, from 1,000 to 25,000, from 1,000 to 50,000, from 1,000 to 70,000, from 1,000 to 100,000, from 1,500 to 3,000, from 1,500 to 5,000, from 1,500 to 7,000, from 1,500 to 10,000, from 1,500 to 25,000, from 1,500 to 50,000, from 1,500 to 70,000, from 1,500 to 100,000, from 2,000 to 3,000, from 2,000 to 5,000, from 2,000 to 7,000, from 2,000 to 10,000, from 2,000 to 25,000, from 2,000 to 50,000, from 2,000 to 70,000, and from 2,000 to 100,000 nucleotides).

[0227] In some embodiments, the region or regions flanking the region encoding the product of interest may range independently from 15-1,000 nucleotides in length (e.g., greater than 30, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, and 900 nucleotides or at least 30, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, and 1,000 nucleotides).

[0228] In some embodiments, the mRNA comprises a tailing sequence which can range from absent to 500 nucleotides in length (e.g., at least 60, 70, 80, 90, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, or 500 nucleotides). Where the tailing region is a polyA tail, the length may be determined in units of or as a function of polyA Binding Protein binding. In this embodiment, the polyA tail is long enough to bind at least 4 monomers of PolyA Binding Protein. PolyA Binding Protein monomers bind to stretches of approximately 38 nucleotides. As such, it has been observed that polyA tails of about 80 nucleotides and 160 nucleotides are functional.

[0229] In some embodiments, the mRNA comprises a capping sequence which comprises a single cap or a series of nucleotides forming the cap. The capping sequence may be from 1 to 10, e.g. 2-9, 3-8, 4-7, 1-5, 5-10, or at least 2, or 10 or fewer nucleotides in length. In some embodiments, the caping sequence is absent.

[0230] In some embodiments, the mRNA comprises a region comprising a start codon. Tire region comprising the start codon may range from 3 to 40, e.g.. 5-30. 10-20, 15, or at least 4. or 30 or fewer nucleotides in length.

[0231] In some embodiments, the mRNA comprises a region comprising a stop codon. The region comprising the stop codon may range from 3 to 40, e.g., 5-30, 10-20, 15, or at least 4, or 30 or fewer nucleotides in length.Ref. No. OR-048WO1 / / OBS-033WO

[0232] In some embodiments, the mRNA comprises a region comprising a restriction sequence. The region comprising the restriction sequence may range from 3 to 40, e.g., 5-30, 10-20, 15, or at least 4, or 30 or fewer nucleotides in length.Untranslated Regions (UTRs)

[0233] In various embodiments, the mRNA payloads of the LNP-based RNA vaccines. RNA therapeutics, nucleobase editing systems and pharmacal compositions thereof described herein, may comprise at least one untranslated region (UTR) which flanks the region encoding the product of interest and / or is incorporated within the mRNA molecule. UTRs are transcribed by not translated. The mRNA payloads can include 5’ UTR sequences and 3’ UTR sequences, as well as internal UTRs.

[0234] The RNA payloads of the present disclosure may comprise one or more regions or parts which act or function as an untranslated region. Where nucleic acids are designed to encode at least one polypeptide of interest, the nucleic acid may comprise one or more of these untranslated regions (UTRs). Wild-type untranslated regions of a nucleic acid are transcribed but not translated. In mRNA, the 5' UTR starts at the transcription start site and continues to the start codon but does not include the start codon; whereas, the 3' UTR starts immediately following the stop codon and continues until the transcriptional termination signal. Tire re is growing body of evidence about the regulatory roles played by the UTRs in temis of stability of the nucleic acid molecule and translation. The regulatory features of a UTR can be incorporated into the RNA payload molecules (e.g., linear and circular RNA molecules) of the present disclosure to, among other tilings, enhance the stability of the molecule. The specific features can also be incorporated to ensure controlled down-regulation of the transcript in case they are misdirected to undesired organs sites. A variety of 5'UTR and 3'UTR sequences are known and available in the art.

[0235] In various embodiments, the mRNA payloads of the UNP-based RNA vaccines. RNA therapeutics, nucleobase editing systems, and pharmaceutical compositions thereof described herein, may comprise at least one UTR that may be selected from any UTR sequence listed in Tables 19 or 20 of U. S. Patent No. 10,709,779, which is incorporated herein by reference.5' UTR regions

[0236] In various embodiments, the mRNA payloads of the UNP-based RNA vaccines, RNA therapeutics, nucleobase editing systems, and pharmaceutical compositions thereof described herein, may comprise at least one 5' UTR.

[0237] In an embodiment, the 5’ UTR comprises a sequence provided in Table (II) or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to a 5’ UTR sequence provided in Table (II), or a variant or a fragment thereof (e.g., a fragment that lacks the first one, two, three, four, five, or six nucleotides of the 5’ UTR sequence provided in Table (II)). In an embodiment, the 5' UTR comprises a sequence with at least 80%, 85%. 90%. 95%, 96%, 97%, 98%, 99% or 100% identityRef. No. OR-048WO1 / / OBS-033WOto SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, or SEQ ID NO: 28.

[0238] Table (11) - Exemplary nucleotide sequences of 57UTRs5’ UTR Nucleotide Sequence Sequence Identifier ggaaaucgca aaauuugcuc uucgcguuag auuucuuuua guuuucucgc aacuagcaag SEQ ID NO: 1 cuuuuuguuc ucgccgccgc cggaaaucgca aaauuuucuu uucgcguuag auuucuuuua guuuucuuuc aacuagcaag SEQ ID NO: 2 cuuuuuguuc ucgccgccgc cggaaaucgca aaauuuuugc ucuuuuucgc guuagauuuc uuuuaguuuu cuykcaacua SEQ ID NO: 3 gcaagcuuuu uguucucgcc rccggaaaucccc acaaccgccu cauauccagg cucaagaaua gagcucagug uuuuguuguu SEQ ID NO: 4 uaaucauucc gacguguuuu gcgauauucg cgcaaagcag ccagucgcgc gcuugcuuuuaaguagaguu guuuuuccac ccguuugcca ggcaucuuua auuuaacaua uuuuuauuuuucaggcuaac cuacgccgcc accggaaauaaga gagaaaagaa gaguaagaag aaauauaaga ucucccugag cuucagggag SEQ ID NO: 5 ccccggcgcc gccaccggaaaccccc cacccccgua agagagaaaa gaagaguaag aagaaauaua agaucucccu SEQ ID NO: 6 gagcuucagg gagccccggc gccgccaccggagaacuuc cgcuuccguu ggcgcaagcg cuuucauuuu uucugcuacc gugacuaag SEQ ID NO: 7 ggaaauaaga gagaaaagaa gaguaagaag aaauauaaga gccacc SEQ ID NO: 8 ggaaauaaga gagaaaagaa gaguaagaag aaauauaaga ccccggcgcc gccacc SEQ ID NO: 9 ggaaacuuua uuuaguguua cuuuauuuuc uguuuauuug uguuucuuca guggguuugu SEQ ID NO: 10 ucuaauuucc uuggccgccggaaaaucug uauuagguug gcguguucuu uggucgguug uuaguauugu uguugauucg SEQ ID NO: 11 uuuguggucg guugccgccggaaaauuau uaacaucuug guauucucga uaaccauucg uuggauuuua uuguauucgu SEQ ID NO: 12 aguuuggguu ccugccgccggaaauuauu auuauuucua gcuacaauuu aucauuguau uauuuuagcu auucaucauu SEQ ID NO: 13 auuuacuugg ugaucaacaRef. No. OR-048WO1 / / OBS-033WOggaaauaggu uguuaaccaa guucaagccu aauaagcuug gauucuggug acuugcuuca SEQ ID NO: 14 ccguuggcgg gcaccgaucggaaaucgua gagagucgua cuuaguacau aucgacuauc gguggacacc aucaagauua SEQ ID NO: 15 uaaaccaggc cagaggaaacccgc ccaagcgacc ccaacauauc agcaguugcc caaucccaac ucccaacaca SEQ ID NO: 16 auccccaagc aacgccgccggaaagcgau ugaaggcguc uuuucaacua cucgauuaag guuggguauc gucgugggac SEQ ID NO: 17 uuggaaauuu guuguuuccggaaacuaau cgaaauaaaa gagccccgua cucuuuuauu ucuauuaggu uaggagccuu SEQ ID NO: 18 agcauuugua ucuuagguaggaaauguga uuuccagcaa cuucuuuuga auauauugaa uuccuaauuc aaagcgaaca SEQ ID NO: 19 aaucuacaag ccauauaccggaaaucgua gagagucgua cuuacguggu cgccauugca uagcgcgcga aagcaacagg SEQ ID NO: 20 aacaagaacg cgccggaaaucgua gagagucgua cuuagaauaa acagagucgg gucgacuugu cucugauacu SEQ ID NO: 21 acgacgucac aaucggaaaauuug ccuucggagu ugcguauccu gaacugccca gccuccugau auacaacugu SEQ ID NO: 22 uccgcuuauu cgggccgccggaaaucuga gcaggaaucc uuugugcauu gaagacuuua gauuccucuc ugcgguagac SEQ ID NO: 23 gugcacuuau aaguauuugggaaagcgau ugaaggcguc uuuucaacua cucgauuaag guuggguauc gucgugggac SEQ ID NO: 24 uuggaaauuu guugccaccggaaaauuuu agccuggaac guuagauaac uguccuguug ucuuuauaua cuuggucccc SEQ ID NO: 25 aaguaguuug ucuuccaaaggaaauuuuu uuuugauauu auaagaguuu uuuuuugaua uuaagaaaau uuuuuuuuga SEQ ID NO: 26 uauuagaaga guaagaagaa auauaagacc ccggcgccgc caccggaaauaaga gagaaaagaa gaguaagaag aaauauaaga gccaaaaaaa aaaaacc SEQ ID NO: 27 ggaaaucucc cugagcuuca gggaguaaga gagaaaagaa gaguaagaag aaauauaaga SEQ ID NO: 28 ccccggcgcc gccacc

[0239] A 5' UTR is region of an mRNA that is directly upstream (5') from the start codon (the first codon of an mRNA transcript translated by a ribosome). A 5' UTR does not encode a protein (is non-coding). Natural 5'UTRs have features that play roles in translation initiation. They harborRef. No. OR-048WO1 / / OBS-033WOsignatures like Kozak sequences which are commonly known to be involved in the process by which the ribosome initiates translation of many genes. Kozak sequences have the consensus CCR(A / G)CCAUGG (SEQ ID NO: 30), where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), which is followed by another ‘G’. 5'UTR also have been known to form secondary structures which are involved in elongation factor binding. 5’ UTR sequences are also known to be important for ribosome recruitment to the mRNA and have been reported to play a role in translation (Hinnebusch A, et al., (2016) Science, 352:6292: 1413-6). In addition, 5’ UTR sequences may confer increased half-life, increased expression and / or increased activity of a polypeptide encoded by the RNA payload described herein.

[0240] In various embodiments, the RNA payload constructs contemplated herein may include 5’UTRs that are found in nature and those that are not. For example, the 5'UTRs can be synthetic and / or can be altered in sequence with respect to a naturally occurring 5’UTR. Such altered 5’UTRs can include one or more modifications relative to a naturally occurring 5’UTR, such as, for example, an insertion, deletion, or an altered sequence, or the substitution of one or more nucleotide analogs in place of a naturally occurring nucleotide.

[0241] The 5' UTR starts at the transcription start site and continues to the start codon but does not include the start codon; whereas, the 3 'UTR starts immediately following the stop codon and continues until the transcriptional termination signal. While not wishing to be bound by theory, the UTRs may have a regulatory role in terms of translation and stability of the nucleic acid.

[0242] Natural 5' UTRs usually include features which have a role in translation initiation as they tend to include Kozak sequences which are commonly known to be involved in the process by which the ribosome initiates translation of many genes. Kozak sequences have the consensus CCR(A / G)CCAUGG. where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), which is followed by another 'G'. 5' UTR also have been known to form secondary structures which are involved in elongation factor binding.

[0243] In some embodiments of the disclosure, a 5' UTR is a heterologous UTR, i.e., is a UTR found in nature associated with a different mRNA. In another embodiment, a 5' UTR is a synthetic UTR, i.e., does not occur in nature. Synthetic UTRs include UTRs that have been mutated to improve their properties, e.g., which increase gene expression as well as those which are completely synthetic. Exemplary 5' UTRs include Xenopus or human derived alpha-globin or beta-globin (e.g., US8,278,063 and US9,012,219), human cytochrome b-245 polypeptide, and hydroxysteroid (17b) dehydrogenase, and Tobacco etch virus. CMV immediate-early 1 (IE1) gene (see US20140206753 and WO2013 / 185069), the sequence GGGAUCCUACC (SEQ ID NO: 29) (WO2014144196) may also be used. In another embodiment, 5' UTR of a TOP gene is a 5' UTR of a TOP gene lacking theRef. No. OR-048WO1 / / OBS-033WO5' TOP motif (the oligopyrimidine tract) (e g., WO / 2015101414, WO2015101415,WO / 2015 / 062738, WO2015024667, WO2015024667; 5' UTR element derived from ribosomal protein Large 32 (L32) gene (WO / 2015101414, WO2015101415, WO / 2015 / 062738)), 5' UTR element derived from the 5 'UTR of an hydroxysteroid ( 17-P) dehydrogenase 4 gene (HSD17B4) (WO2015024667), or a 5' UTR element derived from the 5' UTR of ATP5A1 (WO2015024667) can be used. In one embodiment, an internal ribosome entry site (IRES) is used as a substitute for a 5' UTR.

[0244] In some embodiments, a 5' UTR of the present disclosure comprises SEQ ID NO: 31 (GGGAAAUAAG AGAGAAAAGA AGAGUAAGAA GAAAUAUAAG AGCCACC).3 ' UTR regions

[0245] In various embodiments, the mRNA payloads of the LNP-based RNA vaccines, RNA therapeutics, nucleobase editing systems, and pharmaceutical compositions thereof described herein, may comprise at least one 3' UTR. 3' UTRs may be heterologous or synthetic.

[0246] A 3' UTR is region of an mRNA that is directly downstream (3') from the stop codon (the codon of an mRNA transcript that signals a termination of translation). A 3' UTR does not encode a protein (is non-coding). Natural or wild type 3' UTRs are known to have stretches of adenosines and uridines embedded in them. These AU rich signatures are particularly prevalent in genes with high rates of turnover. Based on their sequence features and functional properties, the AU rich elements (AREs) can be separated into three classes (Chen et al, 1995): Class I AREs contain several dispersed copies of an AUUUA motif within U-rich regions. C-Myc and MyoD contain class I AREs. Class II AREs possess two or more overlapping UUAUUUA(U / A)(U / A) nonamers. Molecules containing this type of AREs include GM-CSF and TNF-a. Class III ARES are less well defined. These U rich regions do not contain an AUUUA motif. c-Jun and Myogenin are two well-studied examples of this class. Most proteins binding to the AREs are known to destabilize the messenger, whereas members of the ELAV family, most notably HuR, have been documented to increase the stability of mRNA. HuR binds to AREs of all the three classes. Engineering the HuR specific binding sites into the 3' UTR of nucleic acid molecules will lead to HuR binding and thus, stabilization of the message in vivo.

[0247] 3’ UTRs are known to have stretches of adenosines and uridines embedded in them. These AU rich signatures are particularly prevalent in genes with high rates of turnover. Based on their sequence features and functional properties, the AU rich elements (AREs) can be separated into three classes (Chen et al., 1995): Class I AREs contain several dispersed copies of an AUUUA motif within U-rich regions. C-Myc and MyoD contain class I AREs. Class II AREs possess two or more overlapping UUAUUUA(U / A)(U / A) nonamers. Molecules containing this type of AREs include GM-CSF and TNF-a.Ref. No. OR-048WO1 / / OBS-033WOClass III ARES are less well defined. These U rich regions do not contain an AUUUA motif. c-Jun and Myogenin are two well-studied examples of this class. Most proteins binding to the AREs are known to destabilize the messenger, whereas members of the ELAV family, most notably HuR, have been documented to increase the stability of mRNA. HuR binds to AREs of all the three classes. Engineering the HuR specific binding sites into the 3' UTR of nucleic acid molecules will lead to HuR binding and thus, stabilization of the message in vivo.

[0248] Introduction, removal or modification of 3' UTR AU rich elements (AREs) can be used to modulate the stability of tire mRNA payloads described herein. For example, one or more copies of an ARE can be introduced to make mRNA less stable and thereby curtail translation and decrease production of the resultant protein. Alternatively, AREs can be identified and removed or mutated to increase the intracellular stability and thus increase translation and production of the resultant protein.

[0249] In some embodiments, the introduction of features often expressed in genes of target organs the stability and protein production of the mRNA can be enhanced in a specific organ and / or tissue. As a nonlimiting example, the feature can be a UTR. As another example, the feature can be introns or portions of introns sequences.

[0250] Those of ordinary skill in the art will understand that 5' UTRs that are heterologous or synthetic may be used with any desired 3' UTR sequence. For example, a heterologous 5' UTR may be used with a synthetic 3' UTR with a heterologous 3' UTR.

[0251] Non-UTR sequences may also be used as regions or subregions within an RNA payload construct. For example, introns or portions of introns sequences may be incorporated into regions of nucleic acid of the disclosure. Incorporation of intronic sequences may increase protein production as well as nucleic acid levels.

[0252] Combinations of features may be included in flanking regions and may be contained within other features. For example, the polypeptide coding region of interest in an mRNA payload may be flanked by a 5' UTR which may contain a strong Kozak translational initiation signal and / or a 3' UTR which may include an oligo(dT) sequence for templated addition of a poly-A tail. 5' UTR may comprise a first polynucleotide fragment and a second polynucleotide fragment from the same and / or different genes such as the 5' UTRs described in US Patent Application Publication No. 20100293625 and PCT / US2014 / 069155. herein incorporated by reference in its entirety

[0253] It should be understood that any UTR from any gene may be incorporated into the regions of an RNA payload molecule (e.g., a linear mRNA). Furthermore, multiple wild-type UTRs of any known gene may be utilized. It is also within the scope of the present disclosure to provide artificial UTRs which are not variants of wild type regions. These UTRs or portions thereof may be placed in the same orientation as in the transcript from which they were selected or may be altered in orientation or location. Hence a 5'Ref. No. OR-048WO1 / / OBS-033WOor 3' UTR may be inverted, shortened, lengthened, made with one or more other 5' UTRs or 3' UTRs. As used herein, the term "altered" as it relates to a UTR sequence, means that the UTR has been changed in some way in relation to a reference sequence. For example, a 3' UTR or 5' UTR may be altered relative to a wild-tj pe or native UTR by the change in orientation or location as taught above or may be altered by the inclusion of additional nucleotides, deletion of nucleotides, swapping or transposition of nucleotides. Any of these changes producing an “altered” UTR (whether 3' or 5') comprise a variant UTR.

[0254] In some embodiments, a double, triple or quadruple UTR such as a 5' UTR or 3' UTR may be used. As used herein, a “double” UTR is one in which two copies of the same UTR are encoded either in series or substantially in series. For example, a double beta-globin 3' UTR may be used as described in US Patent publication 20100129877, the contents of which are incorporated herein by reference in its entirety.

[0255] It is also within the scope of the present disclosure to have patterned UTRs. As used herein “patterned UTRs” are those UTRs which reflect a repeating or alternating pattern, such as ABABAB or AABBAABBAABB or ABCABCABC or variants thereof repeated once, twice, or more than 3 times. In these patterns, each letter, A, B, or C represent a different UTR at the nucleotide level.

[0256] In some embodiments, flanking regions are selected from a family of transcripts whose proteins share a common function, structure, feature or property. For example, polypeptides of interest may belong to a family of proteins which are expressed in a particular cell, tissue or at some time during development. The UTRs from any of these genes may be swapped for any other UTR of the same or different family of proteins to create a new polynucleotide. As used herein, a “family of proteins” is used in the broadest sense to refer to a group of two or more polypeptides of interest which share at least one function, structure, feature, localization, origin, or expression pattern.

[0257] The untranslated region may also include translation enhancer elements (TEE). As a non-limiting example, the TEE may include those described in US Application No. 20090226470, herein incorporated by reference in its entirety, and those known in the art.5' Capping

[0258] In various embodiments, the mRNA payloads of the LNP-based RNA vaccines, RNA therapeutics, nucleobase editing systems, and pharmaceutical compositions thereof described herein, may comprise a 5’ cap structure.

[0259] The 5’ cap structure of an mRNA is involved in nuclear export, increasing mRNA stability and binds the mRNA Cap Binding Protein (CBP), which is responsible for mRNA stability in the cell and translation competency through the association of CBP with poly(A) binding protein to form the mature cyclic mRNA species. The cap further assists the removal of 5' proximal introns removal during mRNA splicing.Ref. No. OR-048WO1 / / OBS-033WO

[0260] Endogenous mRNA molecules may be 5'-end capped generating a 5'-ppp-5'-triphosphate linkage between a terminal guanosine cap residue and the 5 '-terminal transcribed sense nucleotide of the mRNA molecule. This 5'-guanylate cap may then be methylated to generate an N7-methyl-guanylate residue. The ribose sugars of the terminal and / or anteterminal transcribed nucleotides of the 5' end of the mRNA may optionally also be 2'-O-methylated. 5'-decapping through hydrolysis and cleavage of the guanylate cap structure may target a nucleic acid molecule, such as an mRNA molecule, for degradation.

[0261] Modifications to mRNA may generate a non-hydrolyzable cap structure preventing decapping and thus increasing mRNA half-life. Because cap structure hydrolysis requires cleavage of 5 '-ppp-5' phosphorodiester linkages, modified nucleotides may be used during the capping reaction. For example, a Vaccinia Capping Enzyme from New England Biolabs (Ipswich, MA) may be used with a-thio-guanosine nucleotides according to the manufacturer's instructions to create a phosphorothioate linkage in the 5'-ppp-5' cap.

[0262] Additional modified guanosine nucleotides may be used such as a-m ethyl -phosphonate and seleno-phosphate nucleotides.

[0263] Additional modifications include, but arc not limited to, 2'-O-mcthylation of the ribose sugars of 5 '-terminal and / or 5'-anteterminal nucleotides of the mRNA (as mentioned above) on the 2'-hydroxyl group of the sugar ring. Multiple distinct 5 '-cap structures can be used to generate the 5 '-cap of a nucleic acid molecule, such as an mRNA molecule.

[0264] Cap analogs, which herein are also referred to as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, differ from natural (i.e. endogenous, wild-type or physiological) 5'-caps in their chemical structure, while retaining cap function. Cap analogs may be chemically (i.e. non-enzymatically) or enzymatically synthesized and / or linked to a nucleic acid molecule.

[0265] For example, the Anti-Reverse Cap Analog (ARCA) cap contains two guanines linked by a 5 '-5 '-triphosphate group, wherein one guanine contains an N7 methyl group as well as a 3'-O-methyl group (i.e., N7,3'-O-dimethyl-guanosine-5'-triphosphate-5 '-guanosine (m7G-3'mppp-G; which may equivalently be designated 3' O-Me-m7G(5')ppp(5')G). The 3'-0 atom of the other, unmodified, guanine becomes linked to the 5'-tenninal nucleotide of the capped nucleic acid molecule (e.g. an mRNA). The N7- and 3'-O-methlyated guanine provides the terminal moiety of the capped nucleic acid molecule (e.g. mRNA).

[0266] Another exemplary cap is mCAP, which is similar to ARCA but has a 2'-O-methyl group on guanosine (i.e., N7,2'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m7Gm-ppp-G).

[0267] While cap analogs allow' for the concomitant capping of a nucleic acid molecule in an in vitro transcription reaction, up to 20% of transcripts can remain uncapped. This, as well as the structural differences of a cap analog from an endogenous 5 '-cap structures of nucleic acids produced by theRef. No. OR-048WO1 / / OBS-033WOendogenous, cellular transcription machinery, may lead to reduced translational competency and reduced cellular stability.

[0268] mRNA may also be capped post-transcriptionally, using enzymes, in order to generate more authentic 5'-cap structures. As used herein, the phrase "more authentic" refers to a feature that closely mirrors or mimics, either structurally or functionally, an endogenous or wild type feature. That is, a "more authentic" feature is better representative of an endogenous, wild-type, natural or physiological cellular function and / or structure as compared to synthetic features or analogs, etc., of the prior art, or which outperforms the corresponding endogenous, wild-type, natural or physiological feature in one or more respects. Non-limiting examples of more authentic 5 'cap structures are those which, among other things, have enhanced binding of cap binding proteins, increased half-life, reduced susceptibility to 5' endonucleases and / or reduced 5'decapping, as compared to synthetic 5 'cap structures known in the art (or to a wild-type, natural or physiological 5 'cap structure). For example, recombinant Vaccinia Virus Capping Enzyme and recombinant 2'-O-methyltransferase enzyme can create a canonical 5 '-5 '-triphosphate linkage between the 5 '-terminal nucleotide of an mRNA and a guanine cap nucleotide wherein the cap guanine contains an N7 methylation and the 5 '-terminal nucleotide of the mRNA contains a 2'-O-methyl. Such a structure is termed the Capl structure. This cap results in a higher translational-competency and cellular stability and a reduced activation of cellular pro-inflammatory cytokines, as compared, e.g., to other 5 'cap analog structures known in the art. Cap structures include, but are not limited to, 7mG(5')ppp(5')NlpN2p (cap 0), 7mG(5')ppp(5')NlmpNp (cap 1), and 7mG(5')-ppp(5')NlmpN2mp (cap 2).

[0269] In some embodiments, the 5' terminal caps may include endogenous caps or cap analogs.

[0270] In some embodiments, a 5' tenninal cap may comprise a guanine analog. Useful guanine analogs include, but are not limited to, inosine, Nl-methyl-guanosine, 2'fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.IRES Sequences

[0271] In various embodiments, the mRNA payloads of the LNP-based RNA vaccines, RNA therapeutics, nucleobase editing systems, and pharmaceutical compositions thereof described herein, may comprise one or more IRES sequences.

[0272] In some embodiments, the mRNA may contain an internal ribosome entry site (IRES). First identified as a feature Picorna virus RNA, IRES plays an important role in initiating protein synthesis in absence of the 5' cap structure. An IRES may act as the sole ribosome binding site, or may serve as one of multiple ribosome binding sites of an mRNA. An mRNA that contains more than one functional ribosome binding site may encode several peptides or polypeptides that are translated independently by the ribosomes. Non-limiting examples of IRES sequences that can be used include without limitation, thoseRef. No. OR-048WO1 / / OBS-033WOfrom picomaviruses (e.g. FMDV), pest viruses (CSFV), polio viruses (PV), encephalomyocarditis viruses (ECMV), foot-and-mouth disease viruses (FMDV), hepatitis C viruses (HCV), classical swine fever viruses (CSFV), murine leukemia virus (MLV), simian immune deficiency viruses (SIV) or cricket paralysis viruses (CrPV).

[0273] In some embodiments, the IRES is from Taura syndrome virus, Triatoma virus, Theiler's encephalomyelitis virus. Simian Virus 40, Solenopsis invicta virus 1, Rhopalosiphum padi virus, Reticuloendotheliosis virus, Human poliovirus 1, Plautia stali intestine virus, Kashmir bee virus. Human rhinovims 2, Homalodisca coagulata virus-1, Human Immunodeficiency Vims type 1, Homalodisca coagulata virus- 1, Himetobi P vims, Hepatitis C virus, Hepatitis A virus, Hepatitis GB virus, Foot and mouth disease virus, Human enterovirus 71, Equine rhinitis virus, Ectropis obliqua picorna-like virus, Encephalomyocarditis virus, Drosophila C Virus, Human coxsackievirus B3, Crucifer tobamovirus. Cricket paralysis vims, Bovine viral diarrhea virus 1, Black Queen Cell Virus, Aphid lethal paralysis virus, Avian encephalomyelitis virus, Acute bee paralysis virus, Hibiscus chlorotic ringspot virus, Classical swine fever virus, Human FGF2, Human SFTPA1, Human AML1 / RUNX1,Drosophila antennapedia, Human AQP4, Human AT1R, Human BAG-1, Human BCL2, Human BiP, Human c-IAPl, Human c-myc, Human eIF4G, Mouse NDST4L, Human LEF1, Mouse HIF1 alpha, Human n-myc, Mouse Gtx, Human p27kip1, Human PDGF2 / c-sis, Human p53. Human Pim-1, Mouse Rbm3, Drosophila reaper. Canine Scamper, Drosophila Ubx, Human UNR, Mouse UtrA, Human VEGF-A, Human XIAP, Drosophila hairless, S. cerevisiae TFIID, S. cerevisiae YAP1, tobacco etch virus, turnip crinkle vims, EMCV-A, EMCV-B, EMCV-Bf, EMCV-Cf, EMCV pEC9, Picobimavims, HCV QC64, Human Cosavims E / D, Human Cosavims F, Human Cosavirus JMY, Rhinovims NAT001, HRV14, HRV89, HRVC-02, HRV-A21, Salivirus A SHI, Salivirus FHB, Salivirus NG-J1, Human Parechovims I, Crohivims B, Yc-3. Rosavims M-7, Shanbavims A, Pasivims A, Pasivims A 2. Echovirus El 4, Human Parechovims 5, Aichi Virus, Hepatitis A Virus HA16, Phopivims, CVA10, Enterovims C, Enterovirus D, Enterovirus J, Human Pegivims 2, GBV-C GT110, GBV-C K1737, GBV-C Iowa, Pegivims A 1220, Pasivims A 3, Sapelovims, Rosavims B, Bakunsa Virus, Tremovirus A, Swine Pasivims 1, PLV-CHN, Pasivims A, Sicinivirus, Hepacivirus K, Hepacivirus A, BVDV1, Border Disease Virus, BVDV2, CSFV-PK15C, SF573 Dicistrovims, Hubei Picorna-like Vims, CRPV, Salivirus A BNS, Salivirus A BN2, Salivirus A 02394, Salivirus A GUT, Salivirus A CH, Salivirus A SZ1, Salivirus FHB, CVB3, CVB1. Echovirus 7, CVB5, EVA71, CVA3, CVA12, EV24 or an aptamer to eIF4G.Poly-A tails and 3’ stabilizing region

[0274] In various embodiments, the mRNA payloads of the LNP -based RNA vaccines, RNA therapeutics, nucleobase editing systems, and pharmaceutical compositions thereof described herein, may comprise a poly-A tail.Ref. No. OR-048WO1 / / OBS-033WO

[0275] During RNA processing, a long chain of adenine nucleotides (poly-A tail) may be added to a polynucleotide such as an mRNA molecules in order to increase stability. Immediately after transcription, the 3' end of the transcript may be cleaved to free a 3' hydroxyl. Then poly-A polymerase adds a chain of adenine nucleotides to the free 3' hydroxyl end. The process, called polyadenylation, adds a poly-A tail of a certain length.

[0276] In some embodiments, the length of a poly-A tail is greater than 30 nucleotides in length. In another embodiment, the poly-A tail is greater than 35 nucleotides in length (e.g., at least or greater than about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides) and no more than about 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, or 3000 nucleotides in length. In some embodiments, the mRNA comprises a poly-A tail from about 30 to about 3,000 nucleotides (e.g., from 30 to 50, from 30 to 100, from 30 to 250, from 30 to 500, from 30 to 750, from 30 to 1,000, from 30 to 1,500, from 30 to 2,000, from 30 to 2,500, from 50 to 100, from 50 to 250, from 50 to 500, from 50 to 750, from 50 to 1,000, from 50 to 1,500, from 50 to 2,000, from 50 to 2,500, from 50 to 3,000, from 100 to 500, from 100 to 750, from 100 to 1,000, from 100 to 1,500, from 100 to 2,000, from 100 to 2,500, from 100 to 3,000, from 500 to 750, from 500 to 1,000, from 500 to 1,500, from 500 to 2,000, from 500 to 2,500, from 500 to 3,000. from 1,000 to 1,500, from 1,000 to 2,000, from 1,000 to 2,500, from 1,000 to 3,000, from 1,500 to 2,000, from 1,500 to 2,500, from 1,500 to 3,000, from 2,000 to 3,000, from 2,000 to 2,500, and from 2,500 to 3,000).

[0277] In some embodiments, the poly-A tail is designed relative to the length of the overall mRNA. This design may be based on the length of the region coding for a target of interest, the length of a particular feature or region (such as a flanking region), or based on the length of the ultimate product expressed from the mRNA.

[0278] In this context the poly-A tail may be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% greater in length than the mRNA or feature thereof. The poly-A tail may also be designed as a fraction of mRNA to which it belongs. In this context, the poly-A tail may be 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more of the total length of the construct or the total length of the construct minus the poly-A tail. Further, engineered binding sites and conjugation of mRNA for poly-A binding protein may enhance expression.

[0279] Additionally, multiple distinct mRNA may be linked together to the PABP (Poly-A binding protein) through the 3'-end using modified nucleotides at the 3 '-terminus of the poly-A tail. Transfection experiments can be conducted in relevant cell lines at and protein production can be assayed by ELISA at 12hr, 24hr, 48hr, 72 hr and day 7 post-transfection.Ref. No. OR-048WO1 / / OBS-033WO

[0280] In some embodiments, the mRNA are designed to include a polyA-G Quartet. The G-quartet is a cyclic hydrogen bonded array of four guanine nucleotides that can be formed by G-rich sequences in both DNA and RNA. In this embodiment, the G-quartet is incorporated at the end of the poly-A tail.Stop Codons

[0281] In various embodiments, the mRNA payloads of the LNP-based RNA vaccines. RNA therapeutics, nucleobase editing systems, and pharmaceutical compositions thereof described herein, may comprise one or more translation stop codons. Translational stop codons, UAA, UAG, and UGA, are an important component of the genetic code and signal the termination of translation of an mRNA. During protein synthesis, stop codons interact with protein release factors and this interaction can modulate ribosomal activity thus having an impact translation (Tate WP, et al., (2018) Biochem Soc Trans, 46(6): 1615-1625).

[0282] A stop element as used herein, refers to a nucleic acid sequence comprising a stop codon. The stop codon can be selected from TGA, TAA and TAG in the case of DNA, or from UGA, UAA and UAG in the case of RNA. In an embodiment, a stop element comprises two consecutive stop codons. In an embodiment, a stop element comprises three consecutive stop codons. In an embodiment, a stop element comprises four consecutive stop codons. In an embodiment, a stop element comprises five consecutive stop codons.

[0283] In some embodiments, the mRNA may include one stop codon. In some embodiments, the mRNA may include two stop codons. In some embodiments, the mRNA may include three stop codons. In some embodiments, the mRNA may include at least one stop codon. In some embodiments, the mRNA may include at least two stop codons. In some embodiments, the mRNA may include at least three stop codons. As non-limiting examples, the stop codon may be selected from TGA, TAA and TAG.

[0284] In other embodiments, the stop codon may be selected from one or more of the following stop elements of Table (III):

[0285] Table (III): Additional stop elementsNucleotide sequence (5’ to 3’) Sequence Identifier UGAUAAUAG SEQ ID NO: 32 UAAUAGUAA SEQ ID NO: 33 UAAGUCUAA SEQ ID NO: 34 UAAAGCUAA SEQ ID NO: 35 UAAGUCUCC SEQ ID NO: 36 UAAGGCUAA SEQ ID NO: 37 UAAGCCCCUCCGGGG SEQ ID NO: 38Ref. No. OR-048WO1 / / OBS-033WOUAAAGCUCCCCGGGG SEQ ID NO: 39 UAAGCCCCU SEQ ID NO: 40 UAAAGCUCC SEQ ID NO: 41 UAAAGCUCC SEQ ID NO: 42 UAGGGUUAA SEQ ID NO: 43 UAAGCACCC SEQ ID NO: 44 UGAUAGUAA SEQ ID NO: 45 UAAAGCGCU SEQ ID NO: 46

[0286] In some embodiments, the mRNA comprises the stop codon TGA and one additional stop codon. In a further embodiment the addition stop codon may be TAA.MicroRNA binding sites and other regulatory elements

[0287] In various embodiments, the mRNA payloads of the LNP-based RNA vaccines, RNA therapeutics, nucleobase editing systems, and pharmaceutical compositions thereof described herein, may comprise one or more regulatory elements, including, but not limited to microRNA (miRNA) binding sites, structured mRNA sequences and / or motifs, artificial binding sites to bind to endogenous nucleic acid binding molecules, and combinations thereof.Chemically unmodified nucleotides

[0288] In some embodiments, the mRNA payloads of the LNP-based RNA vaccines, RNA therapeutics, nucleobase editing systems, and pharmaceutical compositions thereof described herein are not chemically modified and comprises the standard ribonucleotides consisting of adenosine, guanosine, cytosine and uridine. In some embodiments, nucleotides and nucleosides of the present disclosure comprise standard nucleoside residues such as those present in transcribed RNA (e.g. A, G, C, or U). In some embodiments, nucleotides and nucleosides of the present disclosure comprise standard deoxyribonucleosides such as those present in DNA (e.g. dA, dG, dC, or dT).Chemically modified nucleotides

[0289] In some embodiments, the mRNA payloads of the LNP-based RNA vaccines, RNA therapeutics, nucleobase editing systems, and pharmaceutical compositions thereof described herein comprise, in some embodiments, comprises at least one chemical modification.

[0290] Tire tenns “chemical modification” and “chemically modified” refer to modification with respect to adenosine (A), guanosine (G), uridine (U), thymidine (T) or cytidine (C) ribonucleosides or deoxyribnucleosides in at least one of their position, pattern, percent or population. Generally, these terms do not refer to the ribonucleotide modifications in naturally occurring 5 '-terminal mRNA cap moi eties. With respect to a polypeptide, the term “modification” refers to a modification relative to the canonicalRef. No. OR-048WO1 / / OBS-033WOset 20 amino acids. Polypeptides, as provided herein, are also considered ‘'modified” if they contain amino acid substitutions, insertions or a combination of substitutions and insertions.

[0291] Polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides), in some embodiments, comprise various (more than one) different modifications. In some embodiments, a particular region of a polynucleotide contains one. two or more (optionally different) nucleoside or nucleotide modifications. In some embodiments, a modified RNA polynucleotide (e.g., a modified mRNA polynucleotide), introduced to a cell or organism, exhibits reduced degradation in the cell or organism, respectively, relative to an unmodified polynucleotide. In some embodiments, a modified RNA polynucleotide (e.g., a modified mRNA polynucleotide), introduced into a cell or organism, may exhibit reduced immunogenicity in the cell or organism, respectively (e.g., a reduced innate response).

[0292] Modifications of polynucleotides include, without limitation, those described herein.Polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides) may comprise modifications that are naturally-occurring, non-naturally-occurring or the polynucleotide may comprise a combination of naturally-occurring and non-naturally-occurring modifications. Polynucleotides may include any useful modification, for example, of a sugar, a nucleobase, or an internucleoside linkage (e.g., to a linking phosphate, to a phosphodiester linkage or to the phosphodiester backbone).

[0293] Polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides), in some embodiments, comprise non-natural modified nucleotides that are introduced during synthesis or postsynthesis of the polynucleotides to achieve desired functions or properties. The modifications may be present on an internucleotide linkages, purine or pyrimidine bases, or sugars. The modification may be introduced with chemical synthesis or with a polymerase enzyme at the terminal of a chain or anywhere else in the chain. Any of the regions of a polynucleotide may be chemically modified.

[0294] The present disclosure provides for modified nucleosides and nucleotides of a polynucleotide (e.g., RNA polynucleotides, such as mRNA polynucleotides). A “nucleoside” refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”). A “nucleotide” refers to a nucleoside, including a phosphate group. Modified nucleotides may be synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides. Polynucleotides may comprise a region or regions of linked nucleosides. Such regions may have variable backbone linkages. The linkages may be standard phosphodiester linkages, in which case the polynucleotides would comprise regions of nucleotides.

[0295] Modified nucleotide base pairing encompasses not only the standard adenosine-thymine, adenosine-uracil, or guanosine-cytosine base pairs, but also base pairs formed between nucleotides and / orRef. No. OR-048WO1 / / OBS-033WOmodified nucleotides comprising non-standard or modified bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures. One example of such nonstandard base pairing is the base pairing between the modified nucleotide inosine and adenine, cytosine or uracil. Any combination of base / sugar or linker may be incorporated into polynucleotides of the present disclosure.

[0296] In some embodiments, polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides) include a combination of at least two (e.g., 2, 3, 4 or more) of the aforementioned modified nucleobases.

[0297] In some embodiments, modified nucleobases in polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides) are selected from the group consisting of pseudouridine (ψ). N1-methylpseudouridine (m1ψ). N1 -ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5 -methylcytosine, 2-thio-1 -methyl -1 -deaza-pseudouri dine, 2-thio-l -methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine and 2'-O-methyl uridine. In some embodiments, polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides) include a combination of at least two (e.g., 2, 3, 4 or more) of the aforementioned modified nucleobases.

[0298] In some embodiments, modified nucleobases in polynucleotides (e g., RNA polynucleotides, such as mRNA polynucleotides) are selected from the group consisting of 1-methyl-pseudouridine (m1ψ), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), pseudouridine (ψ), a-thio-guanosine and a-thio-adenosine. In some embodiments, polynucleotides comprises a combination of at least two (e.g., 2, 3, 4 or more) of the aforementioned modified nucleobases.

[0299] In some embodiments, polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides) comprise pseudouridine (ψ) and 5-methyl-cytidine (m5C). In some embodiments, polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides) comprise 1-methyl-pseudouridine (m1ψ). In some embodiments, polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides) comprise 1-methyl-pseudouridine (m1ψ) and 5-methyl-cytidine (m5C). In some embodiments, polynucleotides (e.g.. RNA polynucleotides, such as mRNA polynucleotides) comprise 2-thiouridine (s2U). In some embodiments, polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides) comprise 2-thiouridine and 5-methyl-cytidine (m5C). In some embodiments, polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides) comprise methoxy-uridine (mo5U). In some embodiments, polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides) comprise 5-methoxy-uridine (mo5U) and 5-methyl-cytidine (m5C). In someRef. No. OR-048WO1 / / OBS-033WOembodiments, polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides) comprise 2'-O-methyl uridine. In some embodiments polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides) comprise 2'-O-methyl uridine and 5 -methyl -cytidine (m5C). In some embodiments, polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides) comprise N6-methyl-adenosine (m6A). In some embodiments, polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides) comprise N6-methyl-adenosine (m6A) and 5 -methyl -cytidine (mC).

[0300] In some embodiments, polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides) are uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification. For example, a polynucleotide can be uniformly modified with 5-methyl-cytidine (m5C), meaning that all cytosine residues in the mRNA sequence are replaced with 5-methyl-cytidine (m5C). Similarly, a polynucleotide can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as those set forth above.

[0301] Exemplary nucleobases and nucleosides having a modified cytosine include N4-acetyl-cytidine (ac4C), 5-methyl-cytidine (m5C), 5-halo-cytidine (e.g., 5-iodo-cytidine), 5-hydroxymethyl-cytidine (hm5C), 1-methyl-pseudoisocytidine, 2-thio-cytidine (s2C), and 2-thio-5-methyl-cytidine.

[0302] In some embodiments, a modified nucleobase is a modified uridine. Exemplary nucleobases and In some embodiments, a modified nucleobase is a modified cytosine, nucleosides having a modified uridine include 5 -cyano uridine, and 4'-thio uridine.

[0303]

[0304] The polynucleotides of the present disclosure may be partially or fully modified along the entire length of the molecule. For example, one or more or all or a given type of nucleotide (e.g., purine or pyrimidine, or any one or more or all of A, G, U, C) may be uniformly modified in a polynucleotide of the disclosure, or in a given predetermined sequence region thereof (e.g., in the mRNA including or excluding the polyA tail). In some embodiments, all nucleotides X in a polynucleotide of the present disclosure (or in a given sequence region thereof) are modified nucleotides, wherein X may any one of nucleotides A, G, U, C, or any one of the combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C or A+G+C.

[0305] The polynucleotide may contain from about 1% to about 100% modified nucleotides (either in relation to overall nucleotide content, or in relation to one or more types of nucleotide, i.e., any one or more of A, G, U or C) or any intervening percentage (e.g., from 1% to 20%, from 1% to 25%, from 1% to 50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to 90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%. from 20% to 95%, from 20% toRef. No. OR-048WO1 / / OBS-033WO100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%, from 50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to 95%, from 70% to 100%, from 80% to 90%, from 80% to 95%, from 80% to 100%, from 90% to 95%, from 90% to 100%, and from 95% to 100%). It will be understood that any remaining percentage is accounted for by the presence of unmodified A, G, U, or C.

[0306] The polynucleotides may contain at a minimum 1% and at maximum 100% modified nucleotides, or any intervening percentage, such as at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides. For example, the polynucleotides may contain a modified pyrimidine such as a modified uracil or cytosine. In some embodiments, at least 5%. at least 10%, at least 25%, at least 50%. at least 80%, at least 90% or 100% of the uracil in the polynucleotide is replaced with a modified uracil (e.g., a 5 -substituted uracil). The modified uracil can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the cytosine in the polynucleotide is replaced with a modified cytosine (e.g., a 5 -substituted cytosine). Tire modified cytosine can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures).C. Circular RNA payloads

[0307] Circular RNA (circRNA or circRNA) and precursor thereof (e.g., linear precursor RNA or DNA template) are also described herein. See also WO2020237227, WO2021113777, WO2021189059, WO2021236855, WO2022261490, WO2023141586, WO2024233308, WO2023250375, WO2024102677, WO2024129982, the contents of which are hereby incorporated by reference in their entireties.

[0308] As used herein, a 3’ intron segment (or 3’ intron fragment) refers to a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% similarity to the 3 ’-proximal end of a natural intron (e.g., a group I or group II intron). In certain embodiments, the 3' intron segment includes the 5’ nucleotide of the splice site dinucleotide. As used herein, a 3’ exon segment (or 3' exon fragment) refers to a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% similarity to the 5’-proximal end of an exon adjacent to a “3’ intron segment” as described herein. In certain embodiments, the 3’ exon segment includes the 3’ nucleotide of the splice site dinucleotide.Ref. No. OR-048WO1 / / OBS-033WO

[0309] As used herein, the term 5’ intron segment (or 5’ intron fragment) refers to a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% similarity to the 5'-proximal end of a natural intron (e.g., a group I or group II intron). In certain embodiments, the 5' intron segment includes the 3' nucleotide of the splice site dinucleotide. As used herein, a 5’ exon segment (or 5’ exon fragment) refers to a sequence with at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher 100% similarity to the 3 ’-proximal end of an exon adjacent to a “5’ intron segment” as described herein. In certain embodiments, the 5’ exon segment includes the 5’ nucleotide of the splice site dinucleotide.

[0310] In some embodiments, the 3' intron segment and the 3’ exon segment together form a first portion of an autocatalytic or self-splicing intron -exon sequence. In some embodiments, the 5’ intron segment and the 5’ exon segment together form the remainder (i.e., second portion) of the autocatalytic or self-splicing intron-exon sequence. In these embodiments, a linear nucleic acid molecule, e.g., RNA, comprising the 3’ intron segment and the 3’ exon segment at the 5’ end of the linear nucleic acid molecule and further the 5’ intron segment and the 5’ exon segment at the 3’ end tire linear nucleic acid molecule, is capable of autocatalytically self-splicing and thereby capable of forming a circular nucleic acid molecule, e.g., circular RNA. In these embodiments, the 3’ intron segment and the 5’ intron segments are excised from the circular nucleic acid molecule, e.g., circular RNA, and the 3’ exon segment and the 5’ exon segment are retained in the circular nucleic acid molecule, e.g., circular RNA. Each retained post-splicing exon segment may be referred to as a self-splicing or self-spliced exon segment, e.g., a 3' self-splicing or self-spliced exon segment and a 5’ self-splicing or self-spliced exon segment.

[0311] In some embodiments, the intron segment is a “Group I intron” and the corresponding exon segment may be referred to as a “Group I exon” or “Group 1 self-splicing exon” or “Group I self-spliced exon segment” or the like. In some embodiments, the intron segment is a “Group II intron” and the corresponding exon segment may be referred to as a “Group II exon” or “Group II self-splicing exon” or “Group II self-spliced exon segment” or the like.

[0312] In some embodiments, the retained, post-splicing, self-splicing 3‘ or 5’ exon segment is a noncoding sequence in the circular nucleic acid molecule, e.g., circular RNA. In some embodiments, the circular nucleic acid molecule, e.g., circular RNA, further comprises a desired coding sequence, and tire retained, post-splicing, self-splicing 3’ or 5’ exon segment is (e.g., designed) to be a portion of the desired coding sequence, contiguous with the desired coding sequence, and / or in frame with the desired coding sequence.Ref. No. OR-048WO1 / / OBS-033WO

[0313] In some embodiments, provided herein is a circular RNA polynucleotide comprising, in the following order, a 3 ' self-spliced exon segment, an intervening region, and a 5 ’ self-spliced exon segment. In some embodiments, provided herein is a circular RNA polynucleotide comprising, in the following order, a 3 ' self-spliced exon segment, a coding sequence, and a 5 ' self-spliced exon segment. In some embodiments, provided herein is a circular RNA polynucleotide comprising, in the following order, a 3’ self-spliced exon segment, a translation initiation element (TIE), a coding sequence, and a 5’ selfspliced exon segment. In some embodiments, provided herein is a circular RNA polynucleotide comprising, in the following order, a 3 ’ self-spliced exon segment, a translation initiation element (TIE), a coding sequence with which the TIE is not naturally associated, and a 5 " self-spliced exon segment.

[0314] In some embodiments, a 3’ self-spliced exon segment comprises a sequence having a percent sequence identity of about 70%. 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more to a sequence selected from SEQ ID NOs: 2990-3668, 25573, and 25574 of WO2024233308. In some embodiments, the 3’ self-spliced exon segment is selected from an exon segment disclosed in Table A, Table B, or SEQ ID NOs: 2990-3668, 25573, 25574 of WO2024233308. In some embodiments, the self-spliced exon segment is, e.g., 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, or 15 nucleotides. In some embodiments, the circular RNA comprises a self-spliced exon segment that is 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, or 15 nucleotides from the exonic sequences of Table A of WO2024233308 or is e.g., 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, or 10 nucleotides from the exonic sequences of Table B of WO2024233308.

[0315] In some embodiments, the 5’ self-spliced exon segment comprises a 5’ nucleotide of a 5’ splice site dinucleotide. In some embodiments, the 5' self-spliced exon segment comprises an exon segment and a 5’ nucleotide of a 5’ splice site dinucleotide. In some embodiments, the exon segment comprises a natural exon sequence or non-naturally occurring sequence. In some embodiments, the 5’ splice site dinucleotides are distinct from tire natural splice site dinucleotide(s) associated with a natural Group I or Group II intron sequence.

[0316] In some embodiments, the 5’ self-spliced exon segment comprises a sequence having a percent sequence identity of about 70%. 75%. 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more to a sequence selected from SEQ ID NOs: 2990-3668, 25573, and 25574 of WO2024233308. In some embodiments, the 5’ self-spliced exon segment is selected from an exon segment disclosed in Table A, Table B, or SEQ ID NOs: 2990-3668, 25573, 25574 of WO2024233308. In some embodiments, the self-spliced exon segment is e.g., 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides. 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides,Ref. No. OR-048WO1 / / OBS-033WOor 15 nucleotides. In some embodiments, the circular RNA comprises a self-spliced exon segment that is 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, or 15 nucleotides from the exonic sequences of Table A of WO2024233308 or is e.g., 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, or 10 nucleotides from the exonic sequences of Table B of ofWO2024233308. The contents of WO2024233308 are hereby incorporated by reference in their entireties.

[0317] In some embodiments, the intervening region comprises a noncoding sequence or a coding sequence. In some embodiments, the intervening region comprises at least one translation initiation element (TIE), e.g., with which the noncoding or coding sequence is not naturally associated. In some embodiments, the TIE comprises a viral or eukaryotic internal ribosome entry site (IRES) and a noncoding or coding sequence. In some embodiments, the IRES comprises a sequence selected from the sequences disclosed in WO2022261490 or WO2024129982, the contents of which are hereby incorporated by reference in their entireties.

[0318] In some embodiments, the intervening region comprises an untranslated region (UTR). In some embodiments, the UTR comprises one or more noncoding elements. In some embodiments, the one or more noncoding elements are selected from, e.g., a naturally occurring 3’ UTR, a naturally occurring 5' UTR, a synthetic 3’ UTR, a synthetic 5’ UTR. a synthetic spacer sequence, an aptamer, and IncRNA, miRNA, and a miRNA sponge. In some embodiments, the noncoding element is or comprises the TIE. In some embodiments, the circRNA is an aptamer. In some embodiments, the circRNA comprises a UTR having features as described elsewhere herein for general RNA payloads and linear mRNA payloads.

[0319] In some embodiments, the intervening region comprises a comprises a coding sequence. In some embodiments, the coding element comprises a sequence encoding at least one therapeutic protein. In some embodiments, the coding element encodes two or more polypeptides. In some embodiments, the coding sequence comprises a sequence encoding, for example, a therapeutic protein, cytokine, immune checkpoint inhibitor, an agonist, a chimeric antigen receptor, an inhibitor}’ receptor agonist or inhibitory receptor, an inhibitor} receptor antagonist, one or more TCR chains, a secreted T cell or immune cell engager, a transcription factor, an immunosuppressive enzyme, or a TvHd, as set forth in detail herein. In some embodiments, the coding sequence comprises one or more coding sequences or portions thereof.

[0320] In some embodiments, in the circular RNA polynucleotide, the 5’ exon element comprises the second nucleotide of a 3’ Group I or Group II exon splice site dinucleotide and a natural exon sequence. In some embodiments, the 3’ exon element fragment comprises the first nucleotide of a 5’ Group I or Group II splice site dinucleotide and a natural exon sequence. In some embodiments, the 5’ exon element comprises a 5' internal duplex; and the 3’ exon element comprises a 3’ internal duplex. In someRef. No. OR-048WO1 / / OBS-033WOembodiments, the 5’ exon element comprises a 5’ internal spacer. In some embodiments, the 3’ exon element comprises a 3’ internal spacer.

[0321] In some embodiments, the circular RNA polynucleotide comprises a 5’ internal duplex and a 3’ internal duplex.

[0322] In some embodiments, the circular RNA polynucleotide comprises a 5 ’ internal homology region and / or a 3’ internal homology region. See, e.g., WO2024233308.

[0323] In some embodiments, the circular RNA polynucleotide comprises internal spacers of different lengths, e.g., a 5’intemal spacer and / or a 3’ internal spacer. See, e.g., WO2024233308.

[0324] In some embodiments, the circular RNA polynucleotide is from about 50 nucleotides to about 15 kilobases in length. In some embodiments, the circular RNA polynucleotide is between 300 and 10000, between 400 and 9000, between 500 and 8000, between 600 and 7000, between 700 and 6000, between 800 and 5000, between 900 and 5000, between 1000 and 5000, between 1100 and 5000, between 1200 and 5000, between 1300 and 5000, between 1400 and 5000, or between 1500 and 5000 nucleotides in length. In some embodiments, the circular RNA polynucleotide is at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, at least 900 nucleotides, at least 1000 nucleotides, at least 1100 nucleotides, at least 1200 nucleotides, at least 1300 nucleotides, at least 1400 nucleotides, at least 1500 nucleotides, at least 2000 nucleotides, at least 2500 nucleotides, at least 3000 nucleotides, at least 3500 nucleotides, at least 4000 nucleotides, at least 4500 nucleotides, or at least 5000 nucleotides in length. In some embodiments, the circular RNA polynucleotide is no more than 3000 nucleotides, no more than 3500 nucleotides, no more than 4000 nucleotides, no more than 4500 nucleotides, no more than 5000 nucleotides, no more than 6000 nucleotides, no more than 7000 nucleotides, no more than 8000 nucleotides, no more than 9000 nucleotides, or no more than 10000 nucleotides in length. In some embodiments, the circular RNA polynucleotide is about 300 nucleotides, about 400 nucleotides, about 500 nucleotides, about 600 nucleotides, about 700 nucleotides, about 800 nucleotides, about 900 nucleotides, about 1000 nucleotides, about 1100 nucleotides, about 1200 nucleotides, about 1300 nucleotides, about 1400 nucleotides, about 1500 nucleotides, about 2000 nucleotides, about 2500 nucleotides, about 3000 nucleotides, about 3500 nucleotides, about 4000 nucleotides, about 4500 nucleotides, about 5000 nucleotides, about 6000 nucleotides, about 7000 nucleotides, about 8000 nucleotides, about 9000 nucleotides, or about 10000 nucleotides in length.

[0325] Circular RNA polynucleotides lack free ends for exonuclease-mediated degradation, which may yield more resistance to several mechanisms of RNA degradation and extended half-lives when compared to an equivalent linear RNA. Circularization may allow for the stabilization of RNA polynucleotides thatRef. No. OR-048WO1 / / OBS-033WOgenerally suffer from short half-lives and may improve the overall efficacy of exogenous RNA in a variety of applications.

[0326] In some embodiments, the circular RNA polynucleotide has an in vivo duration of therapeutic effect in a subject of at least about 10 hours. In some embodiments, the circular RNA polynucleotide has a functional half-life of at least about 10 hours. In some embodiments, the circular RNA polynucleotide has a duration of therapeutic effect in a cell greater than or equal to that of an equivalent linear RNA polynucleotide comprising the same coding sequence. In some embodiments, the circular RNA polynucleotide has a functional half-life in a cell greater than or equal to that of an equivalent linear RNA polynucleotide comprising the same coding sequence. In some embodiments, the circular RNA polynucleotide has an in vivo duration of therapeutic effect in a subject greater than that of an equivalent linear RNA polynucleotide having the same coding sequence. In some embodiments, the circular RNA polynucleotide has an in vivo functional half-life in a subject greater than that of an equivalent linear RNA polynucleotide having the same coding sequence.

[0327] In some embodiments, the circular RNA polynucleotide has a functional half-life of at least 5 hours, 10 hours, 15 hours, 20 hours, 30 hours, 40 hours, 50 hours, 60 hours, 70 hours, or 80 hours. In some embodiments, the circular RNA polynucleotide has a functional half-life of 5-80, 10-70, 15-60, or 20-50 hours. In some embodiments, the circular RNA polynucleotide has a functional half-life greater (e.g., at least 1.5-fold greater or at least 2-fold greater) than that of an equivalent linear RNA polynucleotide comprising the same coding sequence. In some embodiments, the circular RNA polynucleotide, or a pharmaceutical composition thereof, has a functional half-life in a human cell greater than or equal to that of a pre-determined threshold value. In some embodiments, tire functional half-life is determined by a functional protein assay. For example, in some embodiments, the functional half-life is determined by an in vitro luciferase assay, wherein the activity of Gaussia luciferase (GLuc) is measured in the media of human cells (e.g., HepG2) expressing the circular RNA polynucleotide every 1, 2, 6, 12, or 24 hours over 1, 2, 3, 4, 5, 6, 7, or 14 days. In some embodiments, the functional half-life is determined by an in vivo assay, wherein levels of a protein encoded by the coding sequence of the circular RNA polynucleotide are measured in patient serum or tissue samples every 1, 2, 6, 12, or 24 hours over 1, 2, 3, 4, 5, 6, 7, or 14 days. In some embodiments, the pre-determined threshold value is the functional half-life of a reference linear RNA polynucleotide comprising the same coding sequence as the circular RNA polynucleotide. In some embodiment, the fimctional half-life of a circular RNA polynucleotides provided herein in eukaryotic cells (e.g., mammalian cells, such as human cells) as assessed by protein synthesis is at least 20 hours (e.g., at least 80 hours).

[0328] In some embodiments, provided herein is a non-naturally occurring RNA polynucleotide comprising a translation initiation element (TIE), a coding sequence (e.g., with which the TIE is notRef. No. OR-048WO1 / / OBS-033WOnaturally associated), and a means for self-splicing. In some embodiments, provided herein is a non-naturally occurring RNA polynucleotide comprising a translation initiation element (TIE), a coding sequence (e.g., with which the TIE is not naturally associated), and a means for self-circularization. In some embodiments, provided herein is provided herein is a non-naturally occurring RNA polynucleotide comprising a translation initiation element (TIE), a coding sequence (e.g., with which the TIE is not naturally associated), and an autocatalytic intron-exon means for self-splicing. In some embodiments, provided herein is a non-naturally occurring RNA polynucleotide comprising a translation initiation element (TIE), a coding sequence (e.g., with which the TIE is not naturally associated), and an autocatalytic intron-exon means for self-circularization. In some embodiments, provided herein is a non-naturally occurring RNA polynucleotide comprising, in the following order, a 3’ exon segment means for self-splicing, a translation initiation element, a coding sequence, and a 5' exon segment means for selfsplicing. In some embodiments, provided herein is a non-naturally occurring RNA polynucleotide comprising, in the following order, a 3’ exon segment means for self-circularization, a translation initiation element, a coding sequence, and a 5’ exon segment means for self-circularization. In some embodiments, provided herein is a non-naturally occurring RNA polynucleotide comprising, in the following order, a 3‘ exon segment, a translation initiation element, a coding sequence, and a 5" exon segment, wherein the exon segments are means for self-splicing. In some embodiments, provided herein is a non-naturally occurring RNA polynucleotide comprising, in the following order, a 3 ’ exon segment, a translation initiation element, a coding sequence, and a 5 ’ exon segment, wherein the exon segments are means for self-circularization. In some embodiments, provided herein is a circular RNA polynucleotide comprising, in the following order, a 3 ’ exon segment means for self-circularization, a translation initiation element, a coding sequence, and a 5‘ exon segment means for self-circularization. In some embodiments, provided herein is a circular RNA polynucleotide comprising, in the following order, a 3 ’ exon segment, a translation initiation element, a coding sequence, and a 5’ exon segment, wherein the exon segments are means for self-splicing. See, e.g., WO2024233308.

[0329] In some embodiments, and as described in more detail elsewhere herein, the circular RNA polynucleotide or linear precursor thereof comprises modified nucleotides and / or modified nucleosides, namely comprising at least one modified A, C, G, or U / T nucleotide or nucleoside. In some embodiments, a circular RNA polynucleotide comprises modified nucleotides and / or modified nucleosides where between 1% and 100%, 1% and 2%, 1% and 3%, 1% and 4%, 1% and 5%, 5% and 6%, 5% and 7%, 5% and 8%, 5% and 9%, 5% and 10%, 10% and 20%, 20% and 30%, 30% and 40%, 40% and 50%, 50% and 60%, 60% and 70%, 70% and 80%, 80% and 90%, or 90% and 100% of the nucleotides or nucleosides are modified. In some embodiments, portions of the polynucleotide comprise betw een 1% and 10% modification of the nucleotides or nucleosides. In some embodiments, portions of the circular RNARef. No. OR-048WO1 / / OBS-033WOpolynucleotide comprise less than 10% modification. In some embodiments, portions of the polynucleotide or the polynucleotide in its entirety comprise no nucleotide or nucleoside modifications. In some embodiments, a circular RNA polynucleotide may lack modifications, where the linear precursors used to produce the circular RNA polynucleotide contained modifications (e.g., in the introns). In some embodiments, incorporation of a nucleotide or nucleoside modification to a precursor RNA polynucleotide hinders or lowers the capacity of the circular RNA to circularize, splice, or express.

[0330] In some embodiments, the polynucleotide is a precursor RNA polynucleotide and comprises at least one modified A, C, G, or U nucleotide or nucleoside. In some embodiments, the precursor RNA polynucleotide is linear. In some embodiments, the precursor RNA polynucleotide is capable of producing a circular RNA comprising at least one modified nucleotide or nucleoside after splicing. In some embodiments, the precursor RNA polynucleotide comprising one or more modified nucleotide or nucleoside is capable of circularizing when incubated in the presence of one or more guanosine nucleotides or nucleoside (e.g., GTP) and a divalent cation (e.g., Mg2+). In some embodiments, the polynucleotide is a circular RNA polynucleotide and comprises at least one modified A, C, G, or U nucleotide or nucleoside modifications.

[0331] In some embodiments, modified nucleotides or nucleosides occur throughout a precursor RNA polynucleotide. In some embodiments, the RNA polynucleotide comprises an intron element and / or exon element comprising one or more modified nucleotide or nucleoside.

[0332] In some embodiments, portions of the 3’ and / or 5’ intron and / or exon segments in a linear precursor RNA polynucleotide of the present disclosure contain modified nucleotides or nucleosides. In some embodiments, the secondary structures of at least the intron and / or exon segments are preserved. In some embodiments, the terminal element comprises at least one modified nucleotide or nucleoside. In some embodiments, the terminal element, intervening region, and / or monotron comprises at least one modified nucleotide or nucleoside. In certain embodiments, the RNA polynucleotide comprises a spacer comprising at least one modified nucleotide or nucleoside. In certain embodiments, the RNA polynucleotide comprises a duplex comprising at least one modified nucleotide or nucleoside. In certain embodiments, the RNA polynucleotide comprises an affinity sequence comprising at least one modified nucleotide or nucleoside. In certain embodiments, the RNA polynucleotide comprises a leading and / or lagging strand comprising at least one modified nucleotide or nucleoside. In some embodiments, the RNA polynucleotide comprises a coding or a noncoding element comprising at least one modified nucleotide or nucleoside. In some embodiments, the RNA polynucleotide comprises a translation initiation element comprising at least one modified nucleotide or nucleoside. In certain embodiments, the polynucleotide comprises a stop codon and / or stop cassette comprising one or more modified nucleotide or nucleoside.Ref. No. OR-048WO1 / / OBS-033WO

[0333] In some embodiments, the modified nucleoside is m5C (5-mcthylcytidinc). In another embodiment, the modified nucleoside is m5U (5-methyluridine). In another embodiment, the modified nucleoside is m6A (N6-methyladenosine). In another embodiment, the modified nucleoside is s2U (2-thiouridine). In another embodiment, tire modified nucleoside is (pseudouridine). In another embodiment, the modified nucleoside is Um (2'-O-methyluridine). In other embodiments, the modified nucleoside is mlA (1 -methyladenosine); m2A (2-methyladenosine); Am (2’-O-methyladenosine); ms2 m6A (2-methylthio-N6-methyladenosine); i6A (N6-isopentenyladenosine); ms2i6A (2-methylthio-N6 isopentenyladenosine); io6A (N6-(cis-hydroxyisopentenyl)adenosine); ms2io6A (2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine); g6A (N6-glycinylcarbamoyladenosine); t6A (N6-threonylcarbamoyladenosine); ms2t6A (2-methylthio-N6-threonyl carbamoyladenosine); m6t6A (N6-methyl-N6-threonylcarbamoyladenosine); hn6A(N6-hydroxynorvalylcarbamoyladenosine); ms2hn6A (2-methylthio-N6-hydroxynorvalyl carbamoyladenosine); Ar(p) (2’-O-ribosyladenosine (phosphate)); I (inosine); m il (1 -methylinosine); m 11m (l,2’-O-dimethylinosine); m3C (3-methylcytidine); Cm (2 -0-methylcytidine); s2C (2-thiocytidinc); ac4C (N4-acetylcytidine); f5C (5-formylcytidinc); m5Cm (5,2'-O-dimcthylcytidinc); ac4Cm (N4-acctyl-2'-O-mcthylcytidinc): k2C (lysidinc); mlG (1-mcthylguanosinc); m2G (N2-methylguanosine); m7G (7-methylguanosine); Gm (2'-O-methylguanosine); m22G (N2, N2-dimethylguanosine); m2Gm (N2,2‘-O-dimethylguanosine); m22Gm (N2. N2,2’-O-trimethylguanosine); Gr(p) (2’-O-ribosylguanosine(phosphate)); yW (wybutosine); o2yW (peroxywybutosine); oHyW (hydroxywybutosine); OhyW* (undermodified hydroxywybutosine); imG (wyosine); mimG (methylwyosine); Q (queuosine); oQ (epoxyqueuosine); galQ (galactosyl-queuosine); manQ (mannosyl-queuosine); preQO (7-cyano-7-deazaguanosine); preQi (7-aminomethyl-7-deazaguanosine); G+ (archaeosine); D (dihydrouridine); m5Um (5,2’-O-dimethyluridine); s4U (4-thiouridine); m5s2U (5-methyl-2 -thiouridine); s2Um (2-thio-2‘-O-methyluridine); acp3U (3-(3-amino-3-carboxypropyl)uridine); ho5U (5-hydroxyuridine); mo5U (5-methoxyuridine); cmo5U (uridine 5-oxyacetic acid); mcmo5U (uridine 5-oxyacetic acid methyl ester); chm5U (5-(carboxyhydroxymethyl)uridine)); mchm5U (5-(carboxyhydroxymethyl)uridine methyl ester); mcm5U (5-methoxycarbonylmethyluridine); mcm5Um (5-methoxycarbonylmethyl-2’-O-methyluridine); mcm5s2U (5 -methoxy carbonylmethyl -2 -thiouridine); nm5S2U (5 -aminomethyl -2-thiouridine); nmm5U (5 -methylaminomethyluridine); mnm5s2U (5-methylaminomethyl-2 -thiouridine); mnm5se2U (5-methylaminomethyl-2-selenouridine); ncm5U (5-carbamoylmethyluridine); ncm5Um (5-carbamoylmethyl-2'-O-methyluridine); cmnm5U (5-carboxymethylaminomethyluridine); cmnm5Um (5-carboxymethylaminomethyl-2'-O-methyluridine); cmnm5s2U (5-carboxymcthylaminomethyl-2-thiouridine); m62A (N6, N6-dimethyladenosine); Im (2’-O-methylinosine); m4C (N4-methylcytidine); m4Cm (N4,2’-O-dimethylcytidine); hm5C (5-hydroxymethylcytidine); m3U (3 -methyluridine); cm5U (5-carboxymethyluridine); m6Am (N6.2‘-O-Ref. No. OR-048WO1 / / OBS-033WOdimethyladenosine); m62Am (N6, N6, O-2’-trimethyladenosine): m2,7G (N2,7-dimethylguanosine); m2,2,7G (N2, N2,7-trimethylguanosine); m3Um (3,2’-O-dimethyluridine); m5D (5-methyldihydrouridine); f5Cm (5-fomiyl-2'-O-mcthylcytidinc): mlGm (l,2’-O-dimethylguanosine); mlAm (l,2'-O-dimethyladenosine); rm 5U (5-taurinomethyluridine); rm5s2U (5-taurinomethyl-2-thiouridine)); imG-14 (4-demethylwyosine): imG2 (isowyosine); N1 -methylpseudouridine; or ac6A (N6-acetyladenosine).

[0334] In some embodiments, the modified nucleoside may include a compound selected from the group of: yridine-4-one ribonucleoside, 5 -aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5 -hydroxyuridine, 3-methyluridine, 5 -carboxymethyl -uridine, 1 -carboxymethylpseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine, 1-taurinomethyl-pseudouridine, -taurinomethyl -2 -thio-uridine, l-taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl -pseudouridine. 4-thio- 1 -methyl -pseudouridine, 2-thio- 1 -methyl -pseudouridine, 1 -methyl- 1 -deazapseudouridine, 2-thio-l -methyl- 1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pscudouridinc, 4-m cthoxy-2-thio-pscudouridinc, 5-aza-cytidinc. pscudoisocytidinc, 3-mcthyl-cytidinc. N4-acetylcytidine. 5-fonnylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine. pyrrolo-pseudoisocytidine, 2-thio-cytidine. 2-thio-5 -methyl -cytidine.4-thio-pseudoisocytidine, 4-thio- 1 -methyl -pseudoisocytidine, 4-thio- 1 -methyl- 1 -deaza-pseudoisocytidine, 1 -methyl- 1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5 -methyl -zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidinc. 2-methoxy-5-mcthyl-cytidme. 4-methoxy-pseudoisocytidine, 4-methoxy-l -methyl -pseudoisocytidine, 2-aminopurine, 2, 6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyladenosine. N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl) adenosine, N6-glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonyl carbamoyladenosine, N6, N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, 2 -methoxy-adenine, inosine, 1-methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine. 6-thio-7-deaza-8-aza-guanosine, 7-methyl -guanosine, 6-thio- 7-methyl -guanosine, 7-methylinosine. 6-methoxy-guanosine, 1 -methylguanosine, N2-methylguanosine. N2, N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, l-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N1 -methylpseudouridine; and N2, N2-dimethyl-6-thio-guanosine.

[0335] In another embodiment, the modifications are independently selected from 5-methylcytosine, pseudouridine and 1 -methylpseudouridine.Ref. No. OR-048WO1 / / OBS-033WO

[0336] In some embodiments, the modified ribonucleosides include 5 -methylcytidine, 5 -methoxyuridine, 1 -methyl -pseudouridine, N6-methyladenosine, and / or pseudouridine.

[0337] In some embodiments, the modified nucleoside is N1 -methylpseudouridine.

[0338] In some embodiments, the modified nucleotide or nucleoside is selected from one or more of: 5-propynyluridine, 5-propynylcytidine, 6-methyladenine, 6-methylguanine, N, N, -dimethyladenine, 2-propyladenine, 2-propylguanine, 2-aminoadenine, 1 -methylinosine, 3 -methyluridine, 5 -methylcytidine, 5-methyluridine, 5-(2-amino)propyl uridine, 5- halocytidine, 5-halouridine, 4-acetylcytidine, 1-methyladenosine, 2-methyladenosine, 3- mcthyicytidinc. 6-methyluridine, 2-methylguanosine, 7-methylguanosine, 2,2- dimethylguanosine, 5 -methylaminoethyluridine, 5 -methyloxyuridine, 7-deaza-adenosine. 6- azouridine, 6-azocytidine, 6-azothymidine, 5 -methyl-2 -thiouridine, 2-thiouridine, 4-thiouridine, 2-thiocytidine, dihydrouridine, pseudouridine, queuosine, archaeosine, naphthyl substituted naphthyl groups, an O- and N-alkylated purines and pyrimidines, N6- methyladenosine, 5-methylcarbonylmethyluridine, uridine 5-oxyacetic acid, pyridine-4-one, pyridine-2-one, aminophenol, 2,4,6-trimethoxy benzene, modified cytosines that act as G- clamp nucleotides, 8-substituted adenines and guanines, 5-substitutcd uracils and thymines, azapyrimidincs, carboxyhydroxyalkyl nucleotides, carboxy alkylaminoalkyl nucleotides, and alkylcarbonylalkylated nucleotides.

[0339] Additional modified nucleotides and nucleosides can be selected from clinically validated modified nucleotides described in the art. See, e.g., US20190345503A1 (m6A-modified circRNA);US20220288176A1 (m6A modification of circRNA); US20220251578A1 (at least one N6-methyladenosine (m6A)); WO2022271965A2 (N6-methyladenosine, 2-thiouridine, and 2 -O-methylcytidine), which are each incorporated by reference in their entireties.

[0340] In particular embodiments, polynucleotides may be codon-optimized. A codon-optimized sequence may be one in which codons in a polynucleotide encoding a polypeptide have been substituted in order to increase the expression, stability and / or activity of the polypeptide. Factors that influence codon optimization include, but are not limited to one or more of: (i) variation of codon biases between two or more organisms or genes or synthetically constructed bias tables, (ii) variation in the degree of codon bias within an organism, gene, or set of genes, (iii) systematic variation of codons including context, (iv) variation of codons according to their decoding tRNAs, (v) variation of codons according to GC %, either overall or in one position of the triplet, (vi) variation in degree of similarity to a reference sequence for example a naturally occurring sequence, (vii) variation in the codon frequency cutoff, (viii) structural properties of RNAs transcribed from the DNA sequence, (ix) prior knowledge about the function of the DNA sequences upon which design of the codon substitution set is to be based, and / or (x) systematic variation of codon sets for each amino acid. In some embodiments, a codon optimizedRef. No. OR-048WO1 / / OBS-033WOpolynucleotide may minimize ribozyme collisions and / or limit structural interference between the coding sequence and other regions. Codon optimization can be performed by methods known in the art.

[0341] In various embodiments, a provided polynucleotide (e.g., a DNA template, a linear precursor RNA polynucleotide, or a circular RNA polynucleotide) comprises one or more coding sequences or portions thereof. In some embodiments, the precursor RNA polynucleotide and circular RNA constructs comprise at least one coding sequence encoding a binding molecule. In ce...

Claims

Ref. No. OR-048WO1 / / OBS-033WOCLAIMS1. A pharmaceutical composition comprising:(a) a lipid nanoparticle;(b) a buffer;(c) hyaluronidase; and(d) a nucleic acid encoding a CAR or TCR complex protein.

2. The pharmaceutical composition of claim 1, wherein the nucleic acid is an mRNA or a circular RNA (oRNA).

3. A pharmaceutical composition comprising:(a) a lipid nanoparticle;(b) a buffer:(c) hyaluronidase; and(d) a nucleic acid that is a circular RNA (oRNA) encoding a therapeutic protein.

4. The pharmaceutical composition of claim 3, wherein the oRNA encodes a CAR or TCR complex protein.

5. Tire pharmaceutical composition of any one of claims 1-2 or 4, wherein the CAR or TCR complex protein comprises an antigen binding domain specific for an antigen selected from the group: CD 19, CD123, CD22, CD30, CD171. CS-1, C-type lectin-like molecule- 1, CD33. epidermal growth factor receptor variant III (EGFRvIII), disialoganglioside GD2, disaloganglioside GD3, TNF receptor family member, B cell maturation antigen (BCMA), Tn antigen ((Tn Ag) or (GalNAca-Ser / Thr)), prostate- specific membrane antigen (PSMA), Receptor tyrosine kinase-like orphan receptor 1 (R0R1), Fms-Like Tyrosine Kinase 3 (FLT3), Tumor-associated glycoprotein 72 (TAG72), CD38, CD44v6, Carcinoembryonic antigen (CEA), Epithelial cell adhesion molecule (EPCAM), B7H3 (CD276), KIT (CD 117), Interleukin- 13 receptor subunit alpha-2, mesothelin, Interleukin 11 receptor alpha (IL-1 IRa), prostate stem cell antigen (PSCA), Protease Serine 21, vascular endothelial growth factor receptor 2 (VEGFR2), Lewis(Y) antigen, CD24, Platelet-derived growth factor receptor beta (PDGFR-beta), Stage-specific embryonic antigen-4 (SSEA-4), CD20, Folate receptor alpha, HER2, HER3, Mucin 1, cell surface associated (MUC1), epidermal growth factor receptor (EGFR), neural cell adhesion molecule (NCAM), Prostase, prostatic acid phosphatase (PAP), elongation factor 2 mutated (ELF2M), Ephrin B2, fibroblast activation protein alpha (FAP), insulin-like growth factor 1 receptor (IGF-I receptor), carbonic anhydrase IX (CAIX). Proteasome (Prosome, Macropain) Subunit, Beta Type, 9 (LMP2), glycoprotein 100 (gp100), oncogene fusion proteinRef. No. OR-048WO1 / / OBS-033WOconsisting of breakpoint cluster region (BCR) and Abelson murine leukemia viral oncogene homolog 1 (Abl) (bcr-abl), tyrosinase, ephrin type- A receptor 2 (EphA2), Fucosyl GM1, sialyl Lewis adhesion molecule (sLe), ganglioside GM3, transglutaminase 5 (TGS5), high molecular weight-melanoma-associated antigen (HMWMAA), o-acetyl-GD2 ganglioside (0AcGD2), Folate receptor beta, tumor endothelial marker 1 (TEM1 / CD248), tumor endothelial marker 7 -related (TEM7R), claudin 6 (CLDN6), claudin 18.2 (CLDN 18.2), thyroid stimulating honnone receptor (TSHR), G protein-coupled receptor class C group 5, member D (GPRC5D), chromosome X open reading frame 61 (CXORF61), CD97, and CD 179a.

6. The pharmaceutical composition of any one of claims 1-5, wherein the buffer comprises TrisHCl.

7. The pharmaceutical composition of claim 6, wherein TrisHCl has a concentration of 20 mM ± 0.4 mM.

8. The pharmaceutical composition of any one of claims 1-7, wherein the buffer comprises sucrose.

9. The pharmaceutical composition of claim 8, wherein sucrose has a concentration of 8 mol% ± 0.2 mol%.

10. The pharmaceutical composition of any of claims 1-9, wherein the pH of the buffer is 8 ± 0.

2.

11. The pharmaceutical composition of any of claims 1-10, wherein hyaluronidase has a concentration of 5-15 µg / mL.

12. The pharmaceutical composition of any of claims 1-10, wherein hyaluronidase has a concentration of 8-12 µg / mL.

13. The pharmaceutical composition of any of claims 1-10, wherein hyaluronidase has a concentration of 10 pg / mL ± 0.2 pg / mL.

14. of any one of claims 1-13. wherein the lipid nanoparticle comprises an ionizable lipid.

15. Tire pharmaceutical composition of claim 14, wherein the ionizable lipid is of Formula (AX””)(AX’”),Ref. No. OR-048WO1 / / OBS-033WOor a pharmaceutically acceptable salt thereof, wherein:A is selected from an optionally substituted 4-14 membered bridged carbocyclic bicycle, bridged carbocyclic multicycle, bridged heterocyclic bicycle, or bridged heterocyclic multicycle; n is and integer selected from 0, 1 or 2;m is an integer selected from 1 or 2. such that m plus n is less than or equal to 3;R1is selected from the group consisting of -OH. -OAc, -NR?. -N(R)RHeach R is independently -H or Ci-C6aliphatic;each RHis C1-C6aliphatic-OH;each X' and XAare each independently a bond or optionally substituted C1-C8aliphatic; each Y1is independently selected from the group consisting ofRr, and a bond; wherein the bond marked with an is attached to X1; each X2and X3is independently a bond or optionally substituted C1-C12 aliphatic;each Y2and Y3is independently selected from the group consisting ofR* O'; wherein the bond marked with an is attached to X2or X3;each X4and X5is independently a bond or optionally substituted C1-C8aliphatic;each Y'4and Y3is independently selected from the group consisting of a bond.Ref. No. OR-048WO1 / / OBS-033WOo o oR*; wherein the bond marked with an is attached to X4or Xs;each X6and X7is independently a bond or optionally substituted C1-C8aliphatic;R2is -CH(OR6)(OR7), -CH(SR6)(SR7), -CH(R6)(R7), -CF(R6)(R7), -R’°, optionally substituted C5-CiSaliphatic, or optionally substituted C1-C14 aliphatic-R1'9, wherein one or more methylene linkages of R2are each optionally and independently replaced with an optionally substituted C3-C8cycloalkylenyl, phenyl, -O-. -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-. or -C(O)O-each R3is independently -CH(OR8)(OR9), -CH(SR8)(SR9), -CH(R8)(R9), -CF(R8)(R9). -R”, optionally substituted Cs-Ci? aliphatic, or optionally substituted C1-C14 aliphatic-R11, wherein one or more methylene linkages of R3are each optionally and independently replaced with an optionally substituted C3-C8cycloalkylenyl, phenyl, -O-. -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, - NHC(O)-. or -C(O)O-;R6and R7are each independently optionally substituted -C4-C14 aliphatic, -R10, or optionally substituted -Ci-Cu aliphatic-R1 u; wherein one or more methylene linkages of R° and R7are each optionally and independently replaced with an optionally substituted C3-C8cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-. -OC(O)-, -NHC(O)-, or -C(O)O-;R8and R9are each independently optionally substituted -C1-C14aliphatic, -R11, or optionally- substituted -C1-C14 aliphatic-R11; wherein one or more methylene linkages of R8and R9are each optionally and independently replaced with an optionally substituted C3-C8cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-, or -C(O)O-; and each R‘° and R1!is independently an optionally substituted cylic, bicyclic, bridged bicyclic, multicyclic or bridged multicyclic C -C14 cycloalkyl or optionally substituted cylic, bicyclic, bridged bicyclic, multicyclic or bridged multicyclic 4-14 membered heterocyclyl, or two R'° or two R11taken together form an optionally substituted bridged bicyclic or multicyclic C4-C14 cycloalkyl or optionally substituted bridged bicyclic or multicyclic 4-14 membered heterocyclyl;wherein one or more of X1, XA, X2, X3, X4, X5, X6, X7, R2and R3is optionally and independently substituted with one or more substituents selected from -F, -Cl, -Br and -I.

16. The pharmaceutical composition of claim 14, wherein the ionizable lipid is selected from a compound described in Table (I) or a pharmaceutical salt thereof.Ref. No. OR-048WO1 / / OBS-033WO17. The pharmaceutical composition of claim 14, wherein the ionizable lipid is AX-6.

18. The pharmaceutical composition of any one of claims 1-17, wherein the lipid nanoparticle further comprises:i) at least one structural lipid;ii) at least one phospholipid, non-ionizable lipid or zwitterionic lipid: andiii) at least one PEGylated lipid.

19. The pharmaceutical composition of claim 18, wherein the at least one structural lipid is selected from cholesterol, fecosterol, fiicosterol, beta sitosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, cholic acid, sitostanol, litocholic acid, tomatine, ursolic acid, alpha-tocopherol, Vitamin D3, Vitamin D2, Calcipotriol, botulin, lupeol, oleanolic acid, beta-sitosterol-acetate and any combinations thereof.

20. The pharmaceutical composition of claim 18, wherein the at least one structural lipid is cholesterol..

21. The pharmaceutical composition of claim 18 or 20, wherein the at least one phospholipid is selected from 1.2-distearoyl-sn-glycero-3 -phosphocholine (DSPC), l,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), l,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3 -phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC). 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), l,2-dilinolenoyl-sn-glycero-3 -phosphocholine, 1.2-diarachidonoyl-sn-glycero-3-phosphocholine, l,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1.2-diphytanoylsn-glycero-3-phosphoethanolamine (ME 16.0 PE), l,2-distearoyl-sn-glycero-3-phosphoethanolamine, l,2-dilinoleoyl-sn-glycero-3 -phosphoethanolamine, l,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, l,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, l,2-dioleoyl-sn-glycero-3-phospho-rac-(l -glycerol) sodium salt (DOPG), sodium (S)-2-ammonio-3-((((R)-2-(oleoyloxy)-3-(stearoyloxy)propoxy)oxidophosphoryl)oxy)propanoate (L-a-phosphatidylserine; Brain PS), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphoethanolamine (DMPE), dimyristoylphosphatidylglycerol (DMPG), dioleoyl-phosphatidylethanolamine4-(N-maleimidomethyl)-cyclohexane- 1 -carboxylate (DOPE-mal), dioleoylphosphatidylglycerol (DOPG), l,2-dioleoyl-sn-glycero-3-(phospho-L-serine) (DOPS), a cell-fusogenic phospholipid (DPhPE), dipalmitoylphosphatidylethanolamine (DPPE), 1,2-Dielaidoyl-sn-Ref. No. OR-048WO1 / / OBS-033WOphosphatidylethanolamine (DEPE), dipalmitoylphosphatidylglycerol (DPPG), dipalmitoylphosphatidylserine (DPPS), distearoylphosphatidylcholine (DSPC), distearoyl-phosphatidyl-ethanolamine (DSPE), distearoyl phosphoethanolamineimidazole (DSPEI), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), egg phosphatidylcholine (EPC), l,2-dioleoyl-sn-glycero-3 -phosphate (18:1 PA; DOPA), ammonium bis((S)-2-hydroxy-3-(oleoyloxy)propyl) phosphate (18:1 DMP; LBPA), 1,2-dioleoyl-sn-glycero-3-phospho-(l’-myo-inositol) (D0P1; 18:1 Pl), l,2-distearoyl-sn-glycero-3-phospho-L-serine (18:0 PS), l,2-dilinoleoyl-sn-glycero-3-phospho-L-serine (18:2 PS), l-palmitoyl-2-oleoyl-sn-glycero-3-phospho-L-serine (16:0-18:1 PS; POPS), l-stearoyl-2-oleoyl-sn-glycero-3-phospho-L-serine (18:0-18:1 PS), l-stearoyl-2-linoleoyl-sn-glycero-3-phospho-L-serine (18:0-18:2 PS), l-oleoyl-2-hydroxy-sn-glycero-3-phospho-L-serine (18:1 Lyso PS), l-stearoyl-2-hydroxy-sn-glycero-3-phospho-L-serine (18:0 Lyso PS), and sphingomyelin.

22. Tire pharmaceutical composition of any one of claims 18-21, wherein the non-ionizable lipid is a phospholipid selected from the group consisting of Egg Sphingomyelin (Egg SM / ESM / (2S,3R, E)-3-hydroxy-2-palmitamidooctadec-4-en-l-yl (2-(triniethylammonio)ethyl) phosphate), Brain or Porcine Sphingomyelin (Brain SM / (2S,3R, E)-3-hydroxy-2-stearamidooctadec-4-en-l-yl (2-(trimethylammonio)ethyl) phosphate). Milk or Bovine Sphingomyelin (Milk SM / (2S,3R, E)-3-hydroxy-2-tricosanamidooctadec-4-en-l-yl (2-(trimethylammonio)ethyl) phosphate), 28:0 SM (N-octacosanoyl-D-erythro-sphingosylphosphorylcholine), 14:0 SM (N-myristoyl-D-crythro-sphingosylphosphorylcholine).16:1 SM (N-palmitoleoyl-D-erythro-sphingosylphosphorylcholine), 12:0 Dihydro SM (N-lauroyl-D-erythro-sphinganylphosphorylcholine), Lyso SM (Sphingosylphosphorylcholine), Lyso SM (Sphingosylphosphorylcholine). Lyso SM (dihydro) (Sphinganine Phosphorylcholine), 24:1 SM (N-nervonoyl-D-erythro-sphingosylphosphorylcholine), 24:0 SM (N-lignoceroyl-D-erythro-sphingosylphosphorylcholine), 18:1 SM (N-oleoyl-D-erythro-sphingosylphosphorylcholine), 18:0 SM (N-stcaroy I -D-erythro-sphingosy I phosphon Icholine), 17:0 SM (N-heptadecanoyl-D-erythro-sphingosylphosphorylcholine), 16:0 SM (N-pahnitoyl-D-erythro-sphingosylphosphorylcholine), 12:0 SM (N-lauroyl-D-erythro-sphingosylphosphorylcholine), 06:0 SM (N-hexanoyl-D-erythro-sphingosylphosphorylcholine), 02:0 SM (N-acetyl-D-erythro-sphingosylphosphorylcholine). 3-O-methyl Lyso SM (3-O-methyl-spingosylphosphorylcholine), 3 -O-methyl-N -methyl Lyso SM (3-O-methyl-N-methyl-spingosylphosphorylcholine), and 3-N-methyl Lyso SM (3-N-methyl-spingosylphosphorylcholine).

23. The pharmaceutical composition of claim 22, wherein the non-ionizable lipid is 16:0 SM (N-palmitoyl-D-erythro-sphingosylphosphoiy Icholine).Ref. No. OR-048WO1 / / OBS-033WO24. The pharmaceutical composition of any one of claims 18-23, wherein the at least one PEGylated lipid is selected from (R)-2,3-bis(octadecyloxy)propyl-l- (methoxypoly(ethyleneglycol)2000)propylcarbamate, PEG-S-DSG, PEG-S-DMG, PEG-PE, PEG-PAA, PEG-OH DSPE Cl 8, PEG-DSPE, PEG-DSG, PEG-DPG, PEG-DOMG, PEG-DMPE Na, PEG-DMPE, PEG-DMG2000, PEG-DMG C14, PEG-DMG 2000, PEG-DMG, PEG-DMA, PEG-Ceramide Cl 6, PEG-C-DOMG, PEG-c-DMOG, PEG-c-DMA, PEG-cDMA, PEGA, PEG750-C-DMA. PEG400, PEG2k-DMG, PEG2k-Cl 1, PEG2000-PE, PEG2000P, PEG2000-DSPE, PEG2000-DDMG, PEG2000-DMG, PEG2000-C-DMA, PEG2000, PEG200, PEG(2k)-DMG, PEG DSPE Cl 8, PEG DMPE C14, PEG DLPE C12, PEG Click DMG C14, PEG Click C12, PEG Click CIO, N(Carbonyl-methoxypolyethylenglycol-2000)-l,2-distearoyl-sn-glycero3-phosphoethanolamine, Myrj52, mPEG-PLA, MPEG-DSPE, mPEG3000-DMPE, MPEG-2000-DSPE. MPEG2000-DSPE, mPEG2000-DPPE, mPEG2000-DMPE, mPEG2000-DMG, mDPPE-PEG2000, l,2-distearoyl-sn-glycero-3-phosphoethanolamine-PEG2000, HPEG-2K-LIPD, Folate PEG-DSPE, DSPE-PEGMA 500, DSPE-PEGMA, DSPE-PEG6000, DSPE-PEG5000, DSPE-PEG2K-NAG, DSPE-PEG2k, DSPE-PEG2000maleimide, DSPE-PEG2000, DSPE-PEG, DSG-PEGMA, DSG-PEG5000, DPPE-PEG-2K, DPPE-PEG, DPPE-mPEG2000, DPPE-mPEG, DPG-PEGMA, DOPE-PEG2000, DMPE-PEGMA. DMPE-PEG2000, DMPE-Peg, DMPE-mPEG2000, DMG-PEGMA, DMG-PEG2000. DMG-PEG, distearoyl-glycerol-polyethyleneglycol, C18PEG750, CI8PEG5000, CI8PEG3000, CI8PEG2000, CI6PEG2000, CI4PEG2000, C18-PEG5000, C18PEG, C16PEG, C16 mPEG (polyethylene glycol) 2000 Ceramide, C14-PEG-DSPE200, C14-PEG2000, C14PEG2000, C14-PEG 2000, C14-PEG, C14PEG, 14:0-PEG2KPE, l,2-distearoyl-sn-glycero-3-phosphoethanolamine-PEG2000, (R)-2,3-bis(octadecyloxy)propyl-l-(methoxypoly(ethyleneglycol)2000)propylcarbamate, (PEG)-C-DOMG, PEG-C-DMA, and DSPE-PEG-X25. The pharmaceutical composition of any one of claims 18-23, wherein the at least one PEGylated lipid is PEG-1.

26. The pharmaceutical composition of any one of claims 18-25, wherein the lipid nanoparticle further comprises at least one additional lipid component selected from l,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), l,2-dilinolenoyl-sn-glycero-3-phosphocholine (18:3 PC), Acylcamosine (AC), l-hexadecyl-sn-glycero-3 -phosphocholine (C16 Lyso PC), N-oleoyl-sphingomyelin (SPM) (C18:l), N-lignoceryl SPM (C24:0), N-nervonoylshphingomyelin (C24:l), Cardiolipin (CL), 1,2-bis(tricosa-10.12-diynoyl)-sn-glycero-3 -phosphocholine (DC8-9PC), dicetyl phosphate (DCP), dihexadecyl phosphate (DCP1), l,2-Dipalmitoylglycerol-3-hemisuccinate (DGSucc), short-chain bis-n-heptadecanoyl phosphatidylcholine (DHPC), dihexadecoyl -phosphoethanolamine (DHPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), l,2-dilauroyl-sn-glycero-3-PE (DLPE), dimyristoylRef. No. OR-048WO1 / / OBS-033WOglycerol hemisuccinate (DMGS), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphoethanolamine (DMPE), dimyristoylphosphatidylglycerol (DMPG), dioleyloxybenzylalcohol (DOBA), l,2-dioleoylglyceryl-3-hemisuccinate (DOGHEMS), N-[2-(2-{2-[2-(2,3-Bis-octadec-9-enyloxy-propoxy)-ethoxy]-ethoxy}-ethoxy)-ethyl]-3-(3,4,5-dihydroxy-6-hydroxymethyl-letrahydro-pyran-2-ylsulfanyl)-propionamide (D0GP4aMan), dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylethanolamine (DOPE), dioleoyl-phosphatidylethanolamine4-(N-maleimidomethyl)-cyclohexane-1 -carboxyl ate (DOPE-mal), dioleoylphosphatidylglycerol (DOPG), 1,2-dioleoyl-sn-glycero-3-(phospho-L-serine) (DOPS), a cell-fusogenic phospholipid (DPhPE), dipalmitoylphosphatidylethanolamine (DPPE), dipalmitoylphosphatidylglycerol (DPPG), dipalmitoylphosphatidylserine (DPPS), distearoylphosphatidylcholine (DSPC), distearoyl-phosphatidyl-ethanolamine (DSPE), distearoyl phosphoethanolamineimidazole (DSPEI). 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), egg phosphatidylcholine (EPC), histaminedistearoylglycerol (HDSG), 1,2-Dipalmitoylglycerol-hemisuccinate-Na-Histidinyl-Hemisuccinate (HistSuccDG), N-(5'-hydroxy-3'-oxypentyl)- 10- 12-pentacosadiynamide (h-Pegi-PCDA), 2-[l-hexyloxyethyl] -2-devinylpyropheophorbide-a (HPPH), hydrogcnatcdsoybcanphosphatidylcholinc (HSPC), 1,2-Dipalmitoylglyccrol-O-a-histidinyl-Na-hemisuccinate (IsohistsuccDG), mannosialized dipalmitoylphosphatidylethanolamine (ManDOG), 1,2-Dioleoyl-sn-Glycero-3-Phosphoethanolamine-N-[4-(p-maleimidomethyl)cyclohexane-carboxamide] (MCC-PE), l,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16:0 PE), l-myristoyl-2-hydroxy-sn-glycero-phosphocholine (MHPC), a thiol-reactive maleimide headgroup lipid e.g.l,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-[4-(p-maleimidophenyl)but-yramid (MPB-PE), Nervonic Acid (NA), sodium cholate (NaChol), l,2-dioleoyl-sn-glycero-3-[phosphoethanolamine-N-dodecanoyl (NC12-DOPE), 1-oleoyl-2 -cholesteryl hemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), phosphatidylethanolamine lipid (PE), PE lipid conjugated with polyethylene glycol(PEG) (e.g., polyethylene glycol-distearoylphosphatidylethanolamine lipid (PEG-PE)), phosphatidylglycerol (PG), partially hydrogenated soy phosphatidylchloline (PHSPC), phosphatidylinositol lipid (PI), phosphotidylinositol-4-phosphate (PIP), palmitoyloleoylphosphatidylcholine (POPC), phosphatidylethanolamine (POPE), palmitoyloleyolphosphatidylglycerol (POPG), phosphatidylserine (PS), lissamine rhodamineB-phosphatidylethanolamine lipid (Rh-PE). purified soy-derived mixture of phospholipids (SIOO), phosphatidylcholine (SM). 18- 1 -trans-PE, 1 -stearoyl-2 -oleoyl -phosphatidyethanolamine (SOPE), soybean phosphatidylcholine (SPC), sphingomyelins (SPM), alpha, alpha-trehalose-6,6'-dibehenate (TDB), l,2-dielaidoyl-sn-glycero-3-phophoethanolamine (transDOPE), ((23S,5R)-3-(bis(hexadecyloxy)methoxy)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1 (2H)-yl)tetrahydrofuran-2-yl)methylmethylphosphate, 1,2-diarachidonoyl-sn-glycero-3 -phosphocholine, l,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, l,2-didocosahexaenoyl-sn-glycero-3-Ref. No. OR-048WO1 / / OBS-033WOphosphocholine, l,2-didocosahexaenoyl-sn-glycero-3 -phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, l,2-dilinolenoyl-sn-glycero-3 -phosphoethanolamine, l,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, l,2-dioleyl-sn-glycero-3-phosphoethanolamine, l,2-distearoyl-sn-glycero-3-phosphoethanolamine. 16-0-monomethyl PE, 16-O-dimethyl PE, and dioleylphosphatidylethanolamine.

27. The pharmaceutical composition of claim 18, wherein:(a) the PEGylated lipid is DMG-PEG;(b) the structural lipid is cholesterol; and(c) the phospholipid, non-ionizable lipid or zwitterionic lipid is DSPC or ESM.

28. The pharmaceutical composition of claim 27, wherein the phospholipid, non-ionizable lipid or zwitterionic lipid is DSPC.

29. The pharmaceutical composition of claim 27, wherein the phospholipid, non-ionizable lipid or zwitterionic lipid is ESM.

30. The pharmaceutical composition of any one of claims 1-29, wherein the lipid nanoparticle comprises:(a) 1-3 mol% of PEGylated lipid;(b) 20-30 mol% structural lipid;(c) 36-44 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and(d) 30-36 mol% of ionizable lipid.

31. The pharmaceutical composition of any one of claims 1-29, wherein the lipid nanoparticle comprises:(a) 1-3 mol% of PEGylated lipid;(b) 23-27 mol% structural lipid;(c) 38-42 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and(d) 32-34 mol% of ionizable lipid.

32. Tire pharmaceutical composition of any one of claims 1-29, wherein the lipid nanoparticle comprises:(a) 2 mol% ± 0.04 mol% of PEGylated lipid;(b) 25 mol% ± 0. 5 mol% structural lipid;(c) 40 mol% ± 0.8 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and(d) 33 mol% ± 0.7 mol% of ionizable lipid.Ref. No. OR-048WO1 / / OBS-033WO33. The pharmaceutical composition of any one of claims 1-29, wherein the lipid nanoparticle comprises:(a) 2 mol% ± 0.04 mol% of PEG-DMG2k;(b) 25 mol% ± 0. 5 mol% cholesterol:(c) 40 mol% ± 0.8 mol% Egg Sphingomyelin; and(d) 33 mol% ± 0.7 mol% of AX-6.

34. The pharmaceutical composition of any one of claims 1-29, wherein the lipid nanoparticle comprises:(a) 2 mol% ± 0.04 mol% of PEGylated lipid;(b) 30 mol% ± 0.6 mol% structural lipid;(c) 30 mol% ± 0.6 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and(d) 38 mol% ± 0.7 mol% of ionizable lipid.

35. The pharmaceutical composition of any one of claims 1-29, wherein the lipid nanoparticle comprises:(a) 2 mol% ± 0.04 mol% of PEG-1;(b) 30 mol% ± 0.6 mol% Cholesterol;(c) 30 mol% ± 0.6 mol% 16:0 SM (N-pahnitoyl-D-erythro-sphingosylphosphorylcholine); and (d) 38 mol% ± 0.7 mol% of AX-6.

36. Tire pharmaceutical composition of any one of claims 1-35 for use as a medicament.

37. The pharmaceutical composition of claims 1-35, formulated for subcutaneous administration.

38. A method of delivering a nucleic acid encoding a therapeutic protein to a subject in need thereof, the method comprising administering to the subject tire pharmaceutical composition of any one of claims 1-38.

39. A method for delivering a nucleic acid to a cell, the method comprising contacting the cell with a pharmaceutical composition of any one of claims 1-38.

40. A method for treating a disease characterized by a deficiency of a functional protein in a subject in need thereof, the method comprising administering to the subject a pharmaceutical composition of any one of claims 1-38.Ref. No. OR-048WO1 / / OBS-033WO41. A method of generating a CAR or TCR complex protein expressing cell in a subject in need thereof, the method comprising administering to the subject a pharmaceutical composition of any one of claims 1-38.

42. The method of claim 42, wherein the method is used to treat one or more diseases or disorders in the subject, selected from autoimmune disorder, and cancer.

43. The method of claim 43, wherein the autoimmune disorder autoimmune disorder is selected from systemic sclerosis (scleroderma), Grave's disease, Crohn's disease. Sjogren's disease, multiple sclerosis, Hashimoto's disease, psoriasis, myasthenia gravis, autoimmune polyendocrinopathy syndromes, Type 1 diabetes mellitus (TIDM), autoimmune gastritis, autoimmune uveoretinitis, polymyositis, colitis, thyroiditis, lupus nephritis, neuromyelitis optica spectrum disorder, Chronic Inflammatory Demyelinating Polyneuropathy, idiopathic inflammatory myopathy (IIM), rheumatoid arthritis, ANCA-Associated vasculitis, Autoimmune encephalitis, Primary membranous glomerulonephritis, Antibody mediated organ transplant rejection, and the generalized autoimmune diseases typified by human Lupus (e.g., systemic lupus erythematosus).

44. Tire method of claim 43, wherein the cancer is selected from acute myeloid leukemia (AML); alveolar rhabdomyosarcoma; B cell malignancies; bladder cancer (e.g., bladder carcinoma); bone cancer; brain cancer (e.g.. medulloblastoma and glioblastoma multiforme); breast cancer: cancer of the anus, anal canal, or anorectum; cancer of the eye: cancer of the intrahepatic bile duct; cancer of the joints: cancer of the neck; gallbladder cancer; cancer of tire pleura; cancer of the nose, nasal cavity, or middle ear; cancer of the oral cavity; cancer of the vulva; chronic lymphocytic leukemia; chronic myeloid cancer; colon cancer; esophageal cancer, cervical cancer; fibrosarcoma; gastrointestinal carcinoid tumor; head and neck cancer (e.g., head and neck squamous cell carcinoma); Hodgkin lymphoma; hypopharynx cancer; kidney cancer; larynx cancer; leukemia; liquid tumors; lipoma; liver cancer; lung cancer (e.g., non-small cell lung carcinoma, lung adenocarcinoma, and small cell lung carcinoma); lymphoma (e.g., large B-cell lymphoma. Mantle cell lymphoma, folicular lymphoma); mesothelioma; mastocytoma; melanoma; multiple myeloma; nasopharynx cancer; non-Hodgkin lymphoma: B-chronic lymphocytic leukemia; hairy' cell leukemia; Burkitt's lymphoma; ovarian cancer; pancreatic cancer; cancer of the peritoneum; cancer of the omentum; mesentery cancer; pharynx cancer; prostate cancer; rectal cancer; renal cancer; skin cancer; small intestine cancer; soft tissue cancer; solid tumors; synovial sarcoma; gastric cancer; teratoma: testicular cancer; thyroid cancer; gliobastoma; hepatocellular carcinoma (HCC), and ureter cancer.Ref. No. OR-048WO1 / / OBS-033WO45. The method of any of claims 39-44, wherein the pharmaceutical composition is administered subcutaneously.

46. The method of any of claims 39-44, wherein the pharmaceutical composition is administered intramuscularly.

47. Tire method of any of claims 39-47, wherein the subject is co-administered a corticosteroid.

48. The method of claim 48, wherein corticosteroid is dexamethasone.

Images