Platform for expression of non-replicating (conventional) messenger RNA (MRNA) for the development of vaccines and therapies, nucleic acid sequence, composition, use, method of treatment and / or prevention of diseases, and method for preparing the composition

The use of VEEV UTRs and a short poly-A tail stabilizes mRNA, optimizing translation and industrial production, addressing stability and efficiency challenges in non-replicating mRNA vaccines and therapies.

WO2026123082A1PCT designated stage Publication Date: 2026-06-18FUNDACAO OSWALDO CRUZ (FIOCRUZ)

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
FUNDACAO OSWALDO CRUZ (FIOCRUZ)
Filing Date
2025-11-19
Publication Date
2026-06-18

AI Technical Summary

Technical Problem

Current mRNA vaccine technologies, particularly non-replicating (conventional) mRNA, face challenges in stability and efficiency due to limitations in untranslated regions (UTRs) and poly(A) tail lengths, which affect mRNA durability and translation, hindering their use in effective prophylaxis and therapy applications.

Method used

A platform utilizing 3' and 5' UTR elements from Venezuelan Equine Encephalitis Virus (VEEV) and a short poly-A tail (40 adenines) stabilizes mRNA, optimizing coding sequences for improved protein translation and industrial production, encapsulated in lipid nanoparticles for enhanced stability and homogeneity.

🎯Benefits of technology

The platform enhances mRNA stability and translation efficiency, facilitating the development of high-quality mRNA-based vaccines and therapies, addressing the limitations of existing technologies by improving productivity and product quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BR2025050533_18062026_PF_FP_ABST
    Figure BR2025050533_18062026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a platform for obtaining non-replicating (conventional) messenger RNA (mRNA) using specific regulatory elements. This approach allows the platform's "plug-and-play" framework to be maintained across different constructs, with only the gene encoding the protein of interest being modified. In addition, the present invention relates to nucleic acid sequences, nanolipid compositions comprising the mRNAs, and the use thereof for preparing a medicament, as well as a method for preparing the nanolipid compositions and a method for treating and / or preventing diseases.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] "PLATFORM FOR EXPRESSION OF NON-REPLICATING (CONVENTIONAL) MESSENGER RNA (mRNA) FOR VACCINE AND THERAPY DEVELOPMENT, NUCLEIC ACID SEQUENCING, COMPOSITION, USE, METHOD OF TREATMENT AND / OR PREVENTION OF DISEASES AND METHOD OF PREPARATION OF THE COMPOSITION"

[0002] Regarding access to Brazilian genetic resources.

[0003]

[0001] Some tests performed to prove the action of the messenger RNAs of the invention described in the object of this patent application used the SARS-CoV-2 virus obtained as a result of access to a sample of a component of the Brazilian Genetic Heritage, carried out from June 30, 2000, and the provisions of Law 13.123 of May 20, 2015 were fulfilled through the registration number AD46ADA for the SARS-CoV-2 virus in SisGen. It should also be noted that, for the Yellow Fever virus, also used in some tests to prove the action of the messenger RNAs of the invention, registration in SisGen is not applicable, since the Yellow Fever vaccine strain 17DD used was not isolated in Brazil.

[0004] Field of Application:

[0005]

[0002] The present invention falls within the field of genetic engineering, more specifically, in the area of ​​immunology, since the present invention relates to a platform for obtaining non-replicating (conventional) messenger RNA (mRNA), useful for prophylaxis or therapy of diseases.

[0006] Fundamentals of the Invention and State of the Art:

[0007]

[0003] In December 2019, a pneumonia of unknown origin appeared in Wuhan province, China. Soon after, infection by the newly described SARS-CoV-2 virus spread rapidly, causing thousands of deaths, until in March 2020, the COVID-19 pandemic was declared, recognized as being caused by the SARS-CoV-2 virus, by the World Health Organization. Coronaviruses, such as SARS-CoV-2, SARS-CoV, and MERS, are known to cause enzootic infections in birds and mammals. It is common behavior for betacoronaviruses to jump the species barrier and cause frequent outbreaks and epidemics in humans, mainly due to their high prevalence and wide distribution, their great genetic diversity and frequent recombination of their genomes, and the increased interface activities between humans and animals.

[0008]

[0004] In terms of structure, coronaviruses (CoVs) are 80-160 nm in diameter and their genetic material is composed of a positive-sense RNA, capable of encoding its own RNA polymerase (RdRp), two large non-structural proteins called ORF-1a and ORF-1b, in addition to four structural proteins called Spike (S), Envelope (E), Membrane (M) and nucleocapsid (N).

[0009]

[0005] The Spike (S) protein is one of the main targets of the immune system in response to SARS-CoV-2 infection, and has been the preferred target for the development of vaccines and neutralizing monoclonal antibodies used in COVID-19 therapy. The same protein has also been considered the preferred target for containing SARS-CoV and MERS-CoV infections. The S protein is a type I glycosylated membrane protein anchored to the viral envelope. The precursor polypeptide forms a trimer that covers the entire viral surface, giving the particle a crown-like appearance, hence the name of the genus Corona. The trimer is subsequently cleaved by the cellular protease furin into two fragments: the SI receptor-binding fragment and the S2 fusion fragment.The mechanism by which the virus enters the cell occurs through the binding of the receptor-binding domain (RBD) located in the SI portion to a receptor on the host cell, Angiotensin-Converting Enzyme 2 (ACE2), followed by additional proteolytic cleavage at a second site in S2 by a serine protease, Transmembrane Serine Protease 2 (TMPRSS2). This mechanism promotes the fusion of the viral envelope to the cell membrane, where the virus's genetic material is injected to initiate its replication within the cell.

[0010]

[0006] Yellow fever (YF) is an acute viral disease transmitted to susceptible hosts, generally primates and humans, through the bite of infected mosquitoes. The disease manifests as an acute hemorrhagic fever characterized by high viremia, lesions in organs such as the liver, kidneys, and heart, as well as hemorrhage, resulting in a very high case fatality rate, ranging from 20% to 50%. Transmission occurs in forests and savannas of South America and Africa, periodically appearing in enzootic cycles. Approximately 200,000 cases of yellow fever are reported each year in tropical areas of Africa and South America, and rare sporadic cases may occur among travelers to endemic areas. There is no specific treatment for this disease, and vaccination is the most important preventive measure against yellow fever.

[0011]

[0007] The 17D vaccine is one of the most successful vaccines ever developed and has an excellent safety record over years of widespread use. However, in recent years, rare serious adverse effects associated with the vaccine have been identified occurring 2 to 30 days after immunization with a mortality rate exceeding 50%, depending on the type of event. Furthermore, the vaccine is contraindicated for immunocompromised individuals, children under 6 months of age, pregnant women, breastfeeding women, and individuals with hypersensitivity to chicken eggs.

[0012]

[0008] PD-1 (programmed cell death 1) is a receptor of the CD28 family that interacts with two ligands, PD-L1 and PD-L2, both of the B7 family. PD-L1 is more widely expressed and distributed, being observed in T and B lymphocytes, monocytes, and dendritic cells. The PD-L2 ligand exhibits higher affinity and is normally expressed in active dendritic cells and macrophages.

[0013]

[0009] The PD-1 receptor is induced in T cells after their activation by inflammatory signals and limits T cell function in a variety of peripheral tissues. As the T cell response increases, there is an increase in PD-1 expression, which decreases the magnitude and duration of the response to prevent tissue damage.

[0014]

[0010] The PD-1 pathway plays a critical role in suppressing the tumor-induced immune response. The interaction between PD-1 and PD-L1 generates an immunosuppressive effect that allows the tumor to escape immune system responses. In addition to suppressing the immune response, it can also lead to the development of exhausted T lymphocytes, characterized by loss of proliferation and reduced cytotoxic activity. Therefore, antibodies that block the PD-L1 / PD-1 interaction can restore and improve T cell function, including cytolytic activity against tumor cells.

[0015]

[0011] Nucleic acid-based vaccine approaches have been under development for many years and became a reality during the COVID-19 pandemic. RNA-based vaccines licensed for COVID-19 prevention have achieved the highest efficacy rates among all vaccines in use to date, reaching 95% (Pfizer-Biontech) and 91% (Moderna) overall efficacy against the original strain, making the platform one of the most promising for vaccine development this century. This platform offers several advantages, such as inducing balanced immune responses, both cellular and humoral, due to its ability to activate the innate immune system without the need for adjuvants, in addition to avoiding the risks associated with virulence reversion or incorporation into host DNA.Another important aspect to consider for this platform is its lower complexity, in terms of production, when compared to biotechnological products (based on cells) and its flexibility in promoting changes in nucleic acid sequences (APIs) when necessary. These characteristics allow for a rapid response in combating the emergence of variants, in the case of epidemics, or even in accelerating the development process of therapeutic options for unmet medical needs.

[0016]

[0012] The two main approaches to messenger RNA (mRNA) vaccines are: (i) non-replicating (conventional) and (ii) self-replicating (non-conventional, self-amplifying). The conventional approach contains an mRNA similar to the endogenous one, containing the region encoding the antigen of interest flanked by 5' and 3' untranslated regions (UTRs) and the poly-A tail, and generally uses modified uridines to increase its stability and reduce the immunogenicity of the molecule. The self-replicating approach, in addition to these elements, contains a viral replication machinery, which is used to amplify the mRNA inside the cell and does not use modified uridines.

[0017]

[0013] The main advantages of the non-replicating (conventional) approach are the simplicity and relatively small size of the RNA molecule. Due to its simpler form, the stability and activity of non-replicating (conventional) mRNA in vivo are limited, since cells have mechanisms to control the duration of expression. Therefore, optimization of structural elements and the coding sequence of mRNA can increase antigen expression and durability. In addition, the use of cap, UTR, and poly(A) tail elements is also crucial for the stability of the mRNA molecule, accessibility to ribosomes, and interaction with the translation machinery, thus representing an important target for optimization.

[0018]

[0014] The strategy of using non-replicating (conventional) mRNA to combat infectious diseases and some types of cancer has been investigated in several preclinical and clinical studies. In this context, mRNAs encoding antigens from various pathogenic microorganisms and tumors have been explored as preventive or therapeutic vaccines, while those encoding therapeutic proteins, such as antibodies or immunomodulators, are considered for immunotherapies.

[0019]

[0015] The use of mRNA obtained by the self-replicating method (non-conventional, sci f-amplifying) for the prophylactic or therapeutic treatment of diseases is well known in the state of the art.

[0020]

[0016] International patent application no. WO 2023 / 057979 Al, filed on October 7, 2022 and published on April 13, 2023, in the name of PRECISION NANOSYSTEMS ULC, entitled: "RNA VACCINE LIPID NANOPARTICLES" describes recombinant expression vectors useful as self-replicating RNA vaccines (non-conventional, sf-amplifying).The provided expression vector comprises: a 5' untranslated region of Venezuelan Equine Encephalitis Virus (VEEV) (5'-UTR); a nucleotide sequence encoding the VEEV non-structural proteins nsP1, nsP2, nsP3, and nsP4; a VEEV 26S subgenomic promoter; a designed multiple cloning site (MCS) containing a gene of interest; a 3' untranslated region of VEEV (3'-UTR); and a nucleotide sequence encoding a VEEV poly-A sequence, wherein preferably the nucleotide sequence encoding the VEEV poly-A sequence comprises 38 to 40 base pairs, and wherein the gene of interest may be a nucleotide sequence encoding an amino acid sequence of the SARS-CoV-2 Spike protein or a modified SARS-CoV-2 Spike protein amino acid sequence.

[0021]

[0017] International patent application no. WO / 2021 / 183563 Al, filed on March 9, 2021 and published on September 16, 2021, in the name of ARCTURUS THERAPEUTICS, INC., SEAN MICHAEL SULLIVAN, DAIKI MATSUDA, KIYOSHI TACHIKAWA, PADMANABH CHIVUKULA, PRIYA PRAKASH KARMALI, JARED HENRY DAVIS, YANJIE BAG, and AMIT SAGI, entitled: "CORONAVIRUS VACCINE COMPOSITIONS AND METHODS" provides nucleic acid molecules encoding viral replication proteins and coronavirus antigenic proteins or fragments thereof.Specifically, the nucleic acid molecules comprise (i) a first polynucleotide encoding one or more viral replication proteins, wherein the first polynucleotide is codon-optimized compared to a wild-type polynucleotide encoding one or more viral replication proteins; and (11) a second polynucleotide comprising a first transgene encoding a first antigenic protein or a fragment thereof, wherein the first antigenic protein is a coronavirus protein. Furthermore, international patent application WO / 2021 / 183563 specifies that the STARR self-replicating RNA molecules additionally possess VEEV replicase genes and the 3' and 5' UTR regulatory elements. Therefore, the document refers to self-replicating RNA (non-conventional, slf-amplifying).

[0022]

[0018] In contrast, the teachings of patent applications WO 2023 / 057979 Al and WO / 2021 / 183563 Al differ from the object of the present invention in that they present self-replicating (non-conventional, self-amplifying) mRNAs, whose stability parameters and elements differ from those used in the non-replicating (conventional) mRNAs of the invention, in addition to the various optimizations that were performed on the nucleotide sequences of the invention.

[0019] Furthermore, the state of the art also describes the use of mRNA obtained by the non-replicating (conventional) method for the prophylactic or therapeutic treatment of diseases.

[0023]

[0020] Chapter 5 of the thesis entitled "mRNA Modification and delivery strategies towards the establishment of a platform for safe and effective gene therapy", published in 2015 by the Faculty of Veterinary Medicine - Ghent University, on behalf of Oliwia Andries, seeks to identify RNA base modifications that could further reduce the immunogenicity and translation capacity of mRNA.Specifically, this thesis reveals the use of plasmids for the in vitro transcription of luciferase and mVenus mRNA, including a T7 bacteriophage polymerase promoter, the open reading frame (ORF) of interest flanked by the 5' UTR segment of the Venezuelan equine encephalitis virus (VEEV) subgenomic RNA and two tandem repeats of the 3' UTR of the VEEV subgenomic RNA, a consensus recognition sequence for I-Scel homing endonuclease, and a 40-nucleotide poly(A) sequence that is subsequently augmented to approximately 150 adenine repeats using the A-Plus™ Poly(A) Polymerase Tailing (Cellscript) kit to perform the enzymatic polyadenylation reaction.However, unlike the present invention, the aforementioned thesis teaches that the use of a single 3' UTR repeat of VEEV was not effective in stabilizing RNA and therefore requires the use of tandem repeats of the 3' UTR of VEEV in addition to using the increased poly(A) tail to aid in the stability of the molecule.

[0021] In contrast, the previously cited documents differ from the object of the present invention in that the present invention uses, together, in a non-replicating (conventional) platform, the 3' and 5' UTR elements of VEEV, which are normally used only in the self-replicating (non-conventional, self-amplifying) method, in addition to optimized coding sequences aimed not only at improving the protein translation phase, but also at improving the productivity of the in vitro transcription reaction (IVT reaction).This results in the stabilization of the exogenous mRNA sequence, containing a very short poly-A tail (containing 40 Adenines), so that the platform of the present invention can be used as a platform for obtaining vaccines or therapies.

[0024]

[0022] As widely described in the prior art, the poly(A) tails found in mRNA molecules from mammalian cells have a size of approximately 250 nucleotides, which is gradually shortened during the mRNA's lifetime in the cytosol. Since the tail size affects mRNA degradation, incorporating this element is desirable in the production of mRNA vaccines and therapies that aim for a longer half-life. Thus, adding approximately 100 nucleotides (nt) to the poly(A) tail can result in the production of molecules with a suitable half-life profile.

[0025]

[0023] Currently, several approaches are being employed to adjust the poly(A) tail size to be used in different mRNA vaccines. In the influenza vaccine developed by Pardi et al. 2018 (Nucleoside-modified mRNA immunization elicits influenza virus hemagglutinin stalk-specific antibodies. Nat Commun. 2018 Aug 22; 9 (1): 3361. doi: 10.1038 / s41467-018-05482-0.), a poly(A) tail with a size of 101 nucleotides was successfully employed. Furthermore, BioNTech demonstrates, in its international patent application no. WO 2017 / 059902 Al, that the stability and translation efficiency of a 120 nt poly(A) tail mRNA was greater than that of 16 nt, 42 nt, and 67 nt mRNAs, using mammalian regulatory elements (3' and 5' UTR of Beta-globin).

[0026]

[0024] Therefore, it is worth highlighting the contributions to the state of the art brought by the present invention by using viral 3' and 5' UTR elements instead of mammalian UTR elements, as previously described for non-replicating (conventional) mRNA vaccines. It is known in the state of the art that non-coding regions found at the 5' and 3' UTR ends of Alphavirus genomes regulate viral gene expression, replication, translation, and virus-host interactions, which have significant implications for viral evolution, host range, and pathogenesis. The functions of these non-coding regions are mediated by a combination of linear sequence and structural elements. The untranslated 5' UTR region contains promoter elements, translation regulatory sequences that modulate the dependence on cellular translation factors, and structures that help evade innate immune defenses.The 3' UTR polyadenylated region contains highly conserved sequence elements for viral replication, binding sites for cellular miRNAs that determine cellular tropism, host range and pathogenesis, and conserved binding regions for a cellular protein that influences viral RNA stability.

[0027]

[0025] In this way, the use of the 3' 5' UTR elements of an Alphavirus, together with the optimizations that were carried out in the nucleotide sequence of the non-replicating (conventional) mRNAs of the invention, allowed the use of a shorter poly A tail than the poly A tails in use in the state of the art. A short poly A tail makes the mRNA more stable and generates advantages in the construction of the template plasmid bank, which positively impacts obtaining the product (vaccine or therapy) with the quality levels required by regulatory agencies.

[0028]

[0026] It is noteworthy that no prior art document is able to provide a platform for messenger RNA (mRNA) expression that can be applied to the development of mRNA-based vaccines and biopharmaceuticals, as per the present invention. Therefore, the need remains for alternatives that can effectively and usefully provide mRNA for use in the prophylaxis or therapy of diseases.

[0029]

[0027] The present invention provides a "plug and play" platform for obtaining non-replicating (conventional) mRNA, which utilizes untranslated regulatory elements (3' and 5' UTRs) from the VEEV-TC-83 virus and a short poly-A tail (containing 40 adenines) that, together, stabilize the obtained mRNA and facilitate the construction of the template plasmid bank, in addition to promoting the homogeneity and stability of the product, which are critical attributes of the quality of products based on mRNA technology. Finally, the optimizations performed on the coding regions of the mRNAs, as presented in the invention, solved a technical problem in mRNA production, as they improved the productivity of the in vitro transcription reaction (IVT reaction), as well as improving the translation of the protein of interest, thus generating important advantages in industrial production.

[0030] Summary of the Invention:

[0031]

[0028] The present invention will provide significant advantages in the fields of immunology, biotechnology and industrial production.

[0032]

[0029] In a first aspect, the present invention relates to a platform for the expression of non-replicating (conventional) messenger RNA (mRNA) comprising 5' UTR and 3' UTR regions of Venezuelan Equine Encephalitis Virus (VEEV) and a short poly-A tail and at least one specific regulatory element.

[0033]

[0030] In a second aspect, the present invention provides a nucleic acid sequence comprising a coding region for a protein of interest or a fragment thereof operationally linked to 5' UTR and 3' UTR regions of Venezuelan Equine Encephalitis Virus (VEEV) and a short poly-A tail.

[0034]

[0031] In a third aspect, the present invention provides a pharmaceutical composition comprising a pharmaceutically effective amount of the nucleic acid sequence as provided by the present invention, encapsulated in lipid nanoparticles.

[0035]

[0032] In a fourth aspect, the present invention provides at least the use of the nucleic acid sequence or pharmaceutical composition, as provided by the present invention, to prepare a medicament for preventing and / or treating diseases.

[0036]

[0033] In a fifth aspect, the present invention provides a method for preventing and / or treating diseases comprising administering an effective amount of at least one nucleic acid sequence or pharmaceutical composition, as provided by the present invention, to an individual in need thereof.

[0037]

[0034] In a sixth aspect, the present invention provides a method for preparing the pharmaceutical composition of the present invention, wherein the method comprises encapsulating the mRNAs, as provided by the present invention, in lipid nanoparticles, as provided by the present invention, by a microfluidic process.

[0038] Brief description of the figures:

[0039]

[0035] The structure and operation of the present invention, together with its additional advantages, can be better understood by referring to the attached images and the following description.

[0040]

[0036] In order to facilitate understanding of the invention taught herein, the plasmid and mRNA schemes presented in the Figures may represent both optimized and non-optimized constructs, since the difference between them lies in the optimization of the coding sequence, which does not alter said schemes.

[0041]

[0037] Figure 1 provides the map of the empty pBiol plasmid (without the coding sequence of the protein of interest or a fragment thereof) containing the following coordinates:

[0042] Origin of replication: 24 - 612 nt

[0043] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0044] - T7 RNA polymerase promoter: 1787 - 1803 nt - 5' UTR VEEV: 1810 - 1853 nt

[0045] - 3' UTR VEEV: 1878 - 1994 nt

[0046] - Poly-A tail: 1995 - 2034 nt.

[0047]

[0038] Figure 2 provides the map of the empty pBio2 plasmid (without the coding sequence of the protein of interest or a fragment thereof) containing the following coordinates:

[0048] Origin of replication: 24 - 612 nt

[0049] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0050] - T7 RNA polymerase promoter: 1787 - 1803 nt - Co-transcriptional capping motif: 1804 - 1806 nt

[0051] - 5' UTR VEEV: 1810 - 1853 nt

[0052] - 3' UTR VEEV: 1878 - 1994 nt

[0053] - Poly-A tail: 1995 - 2034 nt.

[0054]

[0039] Figure 3 provides the map of the empty pBio3 plasmid (without the coding sequence of the protein of interest or a fragment thereof) containing the following coordinates:

[0055] Origin of replication: 24 - 612 nt

[0056] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0057] - Strong Gyrase (SGS) site: 1866 - 2014 nt - T7 RNA polymerase promoter: 2077 - 2093 nt - Cotranscriptional capping motif: 2094 - 2096 nt

[0058] - 5' UTR VEEV: 2100 - 2143 nt

[0059] - 3' UTR VEEV: 2168 - 2284 nt

[0060] - Poly-A tail: 2285 - 2324 nt.

[0061]

[0040] Figure 4 provides the map of the empty pBio4 plasmid (without the coding sequence of the protein of interest or a fragment thereof) containing the following coordinates:

[0062] Origin of replication: 24 - 612 nt

[0063] - Sequence cer (mrs): 690 - 973 nt

[0064] - Ampicillin resistance gene: 1067 - 1927 nt - Ampicillin resistance gene promoter: 1928 - 2032 nt

[0065] - Strong Gyrase (SGS) site: 2150 - 2298 nt - T7 RNA polymerase promoter: 2361 - 2377 nt - Cotranscriptional capping motif: 2378 - 2380 nt

[0066] - 5' UTR VEEV: 2384 - 2427 nt

[0067] - 3' UTR VEEV: 2452 - 2568 nt

[0068] - Poly-A tail: 2569 - 2608 nt.

[0069]

[0041] Figure 5 provides the luciferase mRNA map, expressed in pBiol, containing the following coordinates:

[0070] - 5' UTR VEEV: 7 - 50 nt

[0071] Kozak sequence: 60-65 nt

[0072] - Coding sequence for luciferase: 66 - 1718 nt

[0073] - 3' UTR VEEV: 1734 - 1850 nt

[0074] - Poly-A tail: 1851 - 1895 nt.

[0042] Figure 6 provides the luciferase mRNA map, expressed in pBio2, pBio3 and pBio4 containing the following coordinates:

[0075] - 5' UTR VEEV: 7 - 50 nt

[0076] Kozak sequence: 60-65 nt

[0077] - Luciferase sequence: 66 - 1718 nt

[0078] - 3' UTR VEEV: 1734 - 1850 nt

[0079] - Poly-A tail: 1851 - 1890 nt.

[0080]

[0043] Figure 7 provides the map of the non-optimized delta variant Spike mRNA, expressed in pBiol, containing the following coordinates:

[0081] - 5' UTR VEEV: 7 - 50 nt

[0082] Kozak sequence: 60-65 nt

[0083] - Spike signal peptide: 66 - 104 nt

[0084] - Complete SARS-CoV-2 delta spike (non-optimized): 105 - 3881 nt

[0085] - 3' UTR VEEV: 3897 - 4013 nt

[0086] - Poly-A tail: 4014 - 4058 nt.

[0087]

[0044] Figure 8 provides the map of the non-optimized delta variant Spike mRNA, expressed in pBio2, containing the following coordinates:

[0088] - 5' UTR VEEV: 7 - 50 nt

[0089] Kozak sequence: 60-65 nt

[0090] - Spike signal peptide: 66 - 104 nt

[0091] - Complete SARS-CoV-2 delta spike (non-optimized): 105 - 3881 nt

[0092] - 3' UTR VEEV: 3897 - 4013 nt

[0093] - Poly-A tail: 4014 - 4053 nt.

[0045] Figure 9 provides the map of the optimized delta variant Spike mRNA expressed in pBiol containing the following coordinates:

[0094] - 5' UTR VEEV: 7 - 50 nt

[0095] Kozak sequence: 60-65 nt

[0096] - Spike signal peptide: 66 - 104 nt

[0097] - Optimized full spike SARS-CoV-2 delta: 105 - 3881 nt

[0098] - 3' UTR VEEV: 3897 - 4013 nt

[0099] - Poly-A tail: 4014 - 4058 nt.

[0100]

[0046] Figure 10 provides the map of the optimized delta variant Spike mRNA expressed in pBio2, pBio3, and pBio4 containing the following coordinates:

[0101] - 5' UTR VEEV: 7 - 50 nt

[0102] Kozak sequence: 60-65 nt

[0103] - Spike signal peptide: 66 - 104 nt

[0104] - Optimized full spike SARS-CoV-2 delta: 105 - 3881 nt

[0105] - 3' UTR VEEV: 3897 - 4013 nt

[0106] - Poly-A tail: 4014 - 4053 nt.

[0107]

[0047] Figure 11 provides the Spike mRNA map of the optimized and non-optimized BA4 / BA5 variant, expressed in pBio2, pBio3 and pBio4, containing the following coordinates:

[0108] - 5' UTR VEEV: 7 - 50 nt

[0109] Kozak sequence: 60-65 nt

[0110] - Spike signal peptide: 66 - 104 nt

[0111] - Optimized and non-optimized full spike SARS-CoV-2 omicron BA4 / BA5: 105 - 3869 nt - 3' UTR VEEV: 3888 - 4004 nt

[0112] - Poly-A tail: 4005 - 4044 nt.

[0113]

[0048] Figure 12 provides the map of the optimized and non-optimized XBB omicron variant Spike mRNA, expressed in pBio2, pBio3 and pBio4, containing the following coordinates:

[0114] - 5' UTR VEEV: 7 - 50 nt

[0115] Kozak sequence: 60-65 nt

[0116] - Spike signal peptide: 66 - 104 nt

[0117] - Optimized and non-optimized full spike SARS-CoV-2 omicron XBB: 105 - 3872 nt

[0118] - 3' UTR VEEV: 3891 - 4007 nt

[0119] - Poly-A tail: 4008 - 4047 nt.

[0120]

[0049] Figure 13 provides the optimized and non-optimized Yellow Fever 1 mRNA map, expressed in pBio2, pBio3 and pBio4 containing the following coordinates:

[0121] - 5' UTR VEEV: 7 - 50 nt

[0122] Kozak sequence: 60-65 nt

[0123] - Signal peptide (transmembrane region of yellow fever protein C): 66 - 128 nt

[0124] - Optimized and non-optimized prM Yellow Fever sequence: 129 - 620 nt

[0125] - Optimized and non-optimized Yellow Fever E-sequence (envelope): 621 - 2102 nt

[0126] - 3' UTR VEEV: 2118 - 2234 nt

[0127] - Poly-A tail: 2235 - 2274 nt.

[0128]

[0050] Figure 14 provides the optimized and non-optimized Yellow Fever 2 mRNA map, expressed in pBio2, pBio3 and pBio4 containing the following coordinates: - 5' UTR VEEV: 7 - 50 nt

[0129] Kozak sequence: 60-65 nt

[0130] - SARS-CoV-2 Spike signal peptide: 66 - 104 nt - Optimized and non-optimized Yellow Fever prM sequence: 105 - 596 nt

[0131] - Optimized and non-optimized Yellow Fever E-sequence (envelope): 597 - 2078 nt

[0132] - 3' UTR VEEV: 2094 - 2210 nt

[0133] - Poly-A tail: 2211 - 2250 nt.

[0134]

[0051] Figure 15 provides the optimized and non-optimized Yellow Fever 3 mRNA map, expressed in pBio2, pBio3 and pBio4 containing the following coordinates:

[0135] - 5' UTR VEEV: 7 - 50 nt

[0136] Kozak sequence: 60-65 nt

[0137] - Signal peptide (transmembrane region of yellow fever protein C): 66 - 128 nt

[0138] - Optimized and non-optimized prM Yellow Fever sequence: 129 - 620 nt

[0139] - Optimized and non-optimized Yellow Fever E-sequence (envelope): 621 - 2099 nt

[0140] - Optimized and non-optimized NS1 sequence for Yellow Fever: 2100 - 3329 nt

[0141] - 3' UTR VEEV: 3345 - 3461 nt

[0142] - Poly-A tail: 3462 - 3501 nt.

[0143]

[0052] Figure 16 provides the optimized and non-optimized Yellow Fever 4 mRNA map, expressed in pBio2, pBio3 and pBio4 containing the following coordinates:

[0144] - 5' UTR VEEV: 7 - 50 nt - Kozak sequence: 60 - 65 nt

[0145] - SARS-CoV-2 Spike signal peptide: 66 - 104 nt - Optimized and non-optimized Yellow Fever prM sequence: 105 - 596 nt

[0146] - Optimized and non-optimized Yellow Fever E-sequence (envelope): 597 - 2075 nt

[0147] - Optimized and non-optimized NS1 sequence for Yellow Fever: 2076 - 3305 nt

[0148] - 3' UTR VEEV: 3321 - 3437 nt

[0149] - Poly-A tail: 3438 - 3477 nt.

[0150]

[0053] Figure 17 provides the mRNA map of the optimized and non-optimized Anti-PDl antibody heavy chain (HC) expressed in pBio2, pBio3, and pBio4 containing the following coordinates:

[0151] - 5' UTR VEEV: 7 - 50 nt

[0152] Kozak sequence: 60-65 nt

[0153] - Rituximab heavy chain signaling peptide: 66 - 122 nt

[0154] - Optimized and non-optimized anti-PD1 nivolumab heavy chain sequence: 123 - 1445 nt - 3' UTR VEEV: 1461 - 1577 nt

[0155] - Poly-A tail: 1578 - 1617 nt.

[0156]

[0054] Figure 18 provides the mRNA map of the optimized and non-optimized Anti-PDl antibody light chain (LC), expressed in pBio2, pBio3 and pBio4 containing the following coordinates:

[0157] - 5' UTR VEEV: 7 - 50 nt

[0158] - Kozak sequence: 60-65 nt - Rituximab light chain signal peptide: 66-131 nt - Nivolumab light chain optimized and non-optimized anti-PDI sequence: 132-776 nt - 3' UTR VEEV: 792-908 nt

[0159] - Poly-A tail: 909 - 948 nt.

[0160]

[0055] Figure 19 provides the pBiol+luciferase plasmid map containing the following coordinates:

[0161] Origin of replication: 24 - 612 nt

[0162] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0163] - T7 RNA polymerase promoter: 1787 - 1803 nt - 5' UTR VEEV: 1810 - 1853 nt

[0164] Kozak Sequence: 1863 - 1868

[0165] - Sequence encoding luciferase: 1869 - 3521 nt

[0166] - 3' UTR VEEV: 3537 - 3653 nt

[0167] - Poly-A tail: 3654 - 3693 nt.

[0168]

[0056] Figure 20 provides the map of the non-optimized delta variant pBiol + Spike plasmid containing the following coordinates:

[0169] Origin of replication: 24 - 612 nt

[0170] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0171] - T7 RNA polymerase promoter: 1787 - 1803 nt - 5' UTR VEEV: 1810 - 1853 nt

[0172] - Kozak sequence: 1863 - 1868 nt - Spike signal peptide: 1869 - 1907 nt - Complete SARS-CoV-2 delta non-optimized spike:

[0173] 1908 - 5684 nt

[0174] - 3' UTR VEEV: 5700 - 5816 nt

[0175] - Poly-A tail: 5817 - 5856 nt.

[0176]

[0057] Figure 21 provides the map of the optimized delta variant pBiol + Spike plasmid containing the following coordinates:

[0177] Origin of replication: 24 - 612 nt

[0178] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0179] - T7 RNA polymerase promoter: 1787 - 1803 nt - 5' UTR VEEV: 1810 - 1853 nt

[0180] Kozak Sequence: 1863 - 1868

[0181] - Spike signal peptide: 1869 - 1907 nt

[0182] - Optimized full spike SARS-CoV-2 delta: 1908 - 5684 nt

[0183] - 3' UTR VEEV: 5700 - 5816 nt

[0184] - Poly-A tail: 5817 - 5856 nt.

[0185]

[0058] Figure 22 provides the pBio2+ luciferase plasmid map containing the following coordinates:

[0186] Origin of replication: 24 - 612 nt

[0187] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0188] - T7 RNA polymerase promoter: 1787 - 1803 nt - Co-transcriptional capping motif: 1804 - 1806 nt

[0189] - 5' UTR VEEV: 1810 - 1853 nt

[0190] Kozak Sequence: 1863 - 1868

[0191] - Luciferase sequence: 1869 - 3521 nt

[0192] - 3' UTR VEEV: 3537 - 3653 nt

[0193] - Poly-A tail: 3657 - 3693 nt.

[0194]

[0059] Figure 23 provides the map of the non-optimized delta variant pBio2+ Spike plasmid containing the following coordinates:

[0195] Origin of replication: 24 - 612 nt

[0196] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0197] - T7 RNA polymerase promoter: 1787 - 1803 nt - Co-transcriptional capping motif: 1804 - 1806 nt

[0198] - 5' UTR VEEV: 1810 - 1853 nt

[0199] Kozak Sequence: 1863 - 1868

[0200] - Spike signal peptide: 1869 - 1907 nt

[0201] - Complete non-optimized SARS-CoV-2 delta spike:

[0202] 1908 - 5684 nt

[0203] - 3' UTR VEEV: 5700 - 5816 nt

[0204] - Poly-A tail: 5817 - 5856 nt.

[0205]

[0060] Figure 24 provides the map of the optimized delta variant pBio2+Spike plasmid containing the following coordinates:

[0206] - Origin of replication: 24 - 612 nt - Ampicillin resistance gene: 783 - 1643 nt - Promoter of the ampicillin resistance gene: 1644 - 1748 nt

[0207] - T7 RNA polymerase promoter: 1787 - 1803 nt - Co-transcriptional capping motif: 1804 - 1806 nt

[0208] - 5' UTR VEEV: 1810 - 1853 nt

[0209] Kozak Sequence: 1863 - 1868

[0210] - Spike signal peptide: 1869 - 1907 nt

[0211] - Optimized full spike SARS-CoV-2 delta: 1908 - 5684 nt

[0212] - 3' UTR VEEV: 5700 - 5816 nt

[0213] - Poly-A tail: 5817 - 5856 nt.

[0214]

[0061] Figure 25 provides the map of the optimized and non-optimized BA4 / BA5 omicron variant pBio2+ Spike plasmid containing the following coordinates:

[0215] Origin of replication: 24 - 612 nt

[0216] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0217] - T7 RNA polymerase promoter: 1787 - 1803 nt - Co-transcriptional capping motif: 1804 - 1806 nt

[0218] - 5' UTR VEEV: 1810 - 1853 nt

[0219] Kozak Sequence: 1863 - 1868

[0220] - Spike signal peptide: 1869 - 1907 nt

[0221] - Optimized and non-optimized full spike SARS-CoV-2 omicron: 1908 - 5672 nt - 3' UTR VEEV: 5691 - 5807 nt

[0222] - Poly-A tail: 5808 - 5847 nt.

[0223]

[0062] Figure 26 provides the map of the optimized and non-optimized XBB omicron variant pBio2+ Spike plasmid containing the following coordinates:

[0224] Origin of replication: 24 - 612 nt

[0225] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0226] - T7 RNA polymerase promoter: 1787 - 1803 nt - Co-transcriptional capping motif: 1804 - 1806 nt

[0227] - 5' UTR VEEV: 1810 - 1853 nt

[0228] Kozak Sequence: 1863 - 1868

[0229] - Spike signal peptide: 1869 - 1907 nt

[0230] - Full spike optimized and non-optimized SARS-CoV-2 XBB: 1908 - 5672 nt

[0231] - 3' UTR VEEV: 5694 - 5810 nt

[0232] - Poly-A tail: 5811 - 5850 nt.

[0233]

[0063] Figure 27 provides the optimized and non-optimized pBio2+ Yellow Fever 1 plasmid map containing the following coordinates:

[0234] Origin of replication: 24 - 612 nt

[0235] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0236] - T7 RNA polymerase promoter: 1787 - 1803 nt - Co-transcriptional capping motif: 1804 - 1806 nt

[0237] - 5' UTR VEEV: 1810 - 1853 nt

[0238] Kozak Sequence: 1863 - 1868

[0239] - Signal peptide (transmembrane region of yellow fever protein C): 1869 - 1931 nt

[0240] - Optimized and non-optimized prM Yellow Fever sequence: 1932 - 2423 nt

[0241] - Optimized and non-optimized Yellow Fever E sequence (envelope): 2424 - 3905 nt

[0242] - 3' UTR VEEV: 3921 - 4037 nt

[0243] - Poly-A tail: 4038 - 4077 nt.

[0244]

[0064] Figure 28 provides the optimized and non-optimized pBio2+ Yellow Fever plasmid map containing the following coordinates:

[0245] Origin of replication: 24 - 612 nt

[0246] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0247] - T7 RNA polymerase promoter: 1787 - 1803 nt - Co-transcriptional capping motif: 1804 - 1806 nt

[0248] - 5' UTR VEEV: 1810 - 1853 nt

[0249] Kozak Sequence: 1863 - 1868

[0250] - SARS-CoV-2 Spike signal peptide: 1869 - 1907 nt - Optimized and non-optimized Yellow Fever prM sequence: 1908 - 2399 nt - Optimized and non-optimized Yellow Fever E (envelope) sequence: 2400 - 3881 nt

[0251] - 3' UTR VEEV: 3897 - 4013 nt

[0252] - Poly-A tail: 4014 - 4053 nt.

[0253]

[0065] Figure 29 provides the optimized and non-optimized pBio2+ Yellow Fever 3 plasmid map containing the following coordinates:

[0254] Origin of replication: 24 - 612 nt

[0255] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0256] - T7 RNA polymerase promoter: 1787 - 1803 nt - Co-transcriptional capping motif: 1804 - 1806 nt

[0257] - 5' UTR VEEV: 1810 - 1853 nt

[0258] Kozak Sequence: 1863 - 1868

[0259] - Signal peptide (transmembrane region of Yellow Fever protein C): 1869 - 1931 nt

[0260] - Optimized and non-optimized prM Yellow Fever sequence: 1932 - 2423 nt

[0261] - Optimized and non-optimized Yellow Fever E sequence (envelope): 2424 - 3902 nt

[0262] - Optimized and non-optimized NS1 sequence for Yellow Fever: 3903 - 5132 nt

[0263] - 3' UTR VEEV: 5148 - 5264 nt

[0264] - Poly-A tail: 5265 - 5304 nt.

[0066] Figure 30 provides the optimized and non-optimized pBio2+ Yellow Fever 4 plasmid map containing the following coordinates:

[0265] Origin of replication: 24 - 612 nt

[0266] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0267] - T7 RNA polymerase promoter: 1787 - 1803 nt - Co-transcriptional capping motif: 1804 - 1806 nt

[0268] - 5' UTR VEEV: 1810 - 1853 nt

[0269] Kozak Sequence: 1863 - 1868

[0270] - SARS-CoV-2 Spike signal peptide: 1869 - 1907 nt - Optimized and non-optimized Yellow Fever prM sequence: 1908 - 2399 nt

[0271] - Optimized and non-optimized Yellow Fever E-sequence (envelope): 2400 - 3878 nt

[0272] - Optimized and non-optimized NS1 sequence for Yellow Fever: 3879 - 5108 nt

[0273] - 3' UTR VEEV: 5124 - 5240 nt

[0274] - Poly-A tail: 5241 - 5280 nt.

[0275]

[0067] Figure 31 provides the pBio2+ Heavy Chain (HC) plasmid map of the optimized and non-optimized anti-PDl antibody containing the following coordinates:

[0276] Origin of replication: 24 - 612 nt

[0277] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt - T7 RNA polymerase promoter: 1787 - 1803 nt - Cotranscriptional capping motif: 1804 - 1806 nt

[0278] - 5' UTR VEEV: 1810 - 1853 nt

[0279] Kozak Sequence: 1863 - 1868

[0280] - Signal peptide Rituximab heavy chain: 1869 - 1925 nt

[0281] - Optimized and non-optimized anti-PD1 nivolumab heavy chain sequence: 1926 - 3248 nt - 3' UTR VEEV: 3264 - 3380 nt

[0282] - Poly-A tail: 3381 - 3420 nt.

[0283]

[0068] Figure 32 provides the pBio2+ Light Chain (LC) plasmid map of the optimized and non-optimized anti-PDl antibody containing the following coordinates:

[0284] Origin of replication: 24 - 612 nt

[0285] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0286] - T7 RNA polymerase promoter: 1787 - 1803 nt - Co-transcriptional capping motif: 1804 - 1806 nt

[0287] - 5' UTR VEEV: 1810 - 1853 nt

[0288] Kozak Sequence: 1863 - 1868

[0289] - Rituximab light chain signal peptide: 1869 - 1934 nt

[0290] - Anti-PD1 Nivolumab light chain sequence (optimized and non-optimized): 1935 - 2579 nt - 3' UTR VEEV: 2595 - 2711 nt - Poly-A tail: 2712 - 2751 nt.

[0291]

[0069] Figure 33 provides the pBio3+ luciferase plasmid map containing the following coordinates:

[0292] Origin of replication: 24 - 612 nt

[0293] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0294] - Strong Gyrase (SGS) site: 1866 - 2014 nt - T7 RNA polymerase promoter: 2077 - 2093 nt - Cotranscriptional capping motif: 2094 - 2096 nt

[0295] - 5' UTR VEEV: 2100 - 2143 nt

[0296] Kozak sequence: 2153 - 2158 nt

[0297] - Luciferase sequence: 2159 - 3808 nt

[0298] - 3' UTR VEEV: 3827 - 3943 nt

[0299] - Poly-A tail: 3944 - 3983 nt.

[0300]

[0070] Figure 34 provides the map of the optimized delta variant pBio3+ Spike plasmid containing the following coordinates:

[0301] Origin of replication: 24 - 612 nt

[0302] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0303] - Strong Gyrase (SGS) site: 1866 - 2014 nt - T7 RNA polymerase promoter: 2077 - 2093 nt - Cotranscriptional capping motif: 2094 - 2096 nt

[0304] - 5' UTR VEEV: 2100 - 2143 nt - Kozak sequence: 2153 - 2158 nt

[0305] - Spike signal peptide: 2159 - 2197 nt

[0306] - Optimized full spike SARS-CoV-2 delta: 2198 - 5971 nt

[0307] - 3' UTR VEEV: 5990 - 6106 nt

[0308] - Poly-A tail: 6107 - 6146 nt.

[0309]

[0071] Figure 35 provides the map of the optimized and non-optimized BA4 / BA5 omicron variant pBio3+ Spike plasmid containing the following coordinates:

[0310] Origin of replication: 24 - 612 nt

[0311] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0312] - Strong Gyrase (SGS) site: 1866 - 2014 nt - T7 RNA polymerase promoter: 2077 - 2093 nt - Cotranscriptional capping motif: 2094 - 2096 nt

[0313] - 5' UTR VEEV: 2100 - 2143 nt

[0314] Kozak sequence: 2153 - 2158 nt

[0315] - Spike signal peptide: 2159 - 2197 nt

[0316] - Optimized and non-optimized full spike protein SARS-CoV-2 omicron BA4 / BA4: 2198 - 5962 nt

[0317] - 3' UTR VEEV: 5981 - 6097 nt

[0318] - Poly-A tail: 6098 - 6137 nt.

[0319]

[0072] Figure 36 provides the map of the optimized and non-optimized XBB omicron variant pBio3+ Spike plasmid with the following coordinates:

[0320] - Origin of replication: 24 - 612 nt - Ampicillin resistance gene: 783 - 1643 nt - Promoter of the ampicillin resistance gene: 1644 - 1748 nt

[0321] - Strong Gyrase (SGS) site: 1866 - 2014 nt - T7 RNA polymerase promoter: 2077 - 2093 nt - Cotranscriptional capping motif: 2094 - 2096 nt

[0322] - 5' UTR VEEV: 2100 - 2143 nt

[0323] Kozak sequence: 2153 - 2158 nt

[0324] - Spike signal peptide: 2159 - 2197 nt

[0325] - Optimized and non-optimized full spike SARS-CoV-2 omicron XBB: 2198 - 5965 nt

[0326] - 3' UTR VEEV: 5984 - 6100 nt

[0327] - Poly-A tail: 6101 - 6140 nt.

[0328]

[0073] Figure 37 provides the optimized and non-optimized pBio3+ Yellow Fever plasmid map containing the following coordinates:

[0329] Origin of replication: 24 - 612 nt

[0330] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0331] - Strong Gyrase (SGS) site: 1866 - 2014 nt - T7 RNA polymerase promoter: 2077 - 2093 nt - Cotranscriptional capping motif: 2094 - 2096 nt

[0332] - 5' UTR VEEV: 2100 - 2143 nt

[0333] - Kozak sequence: 2153 - 2158 nt - Signal peptide (transmembrane region of yellow fever protein C): 2159 - 2221 nt

[0334] - Optimized and non-optimized prM Yellow Fever sequence: 2222 - 2713 nt

[0335] - Optimized and non-optimized Yellow Fever E sequence (envelope): 2714 - 4192 nt

[0336] - 3' UTR VEEV: 4211 - 4327 nt

[0337] - Poly-A tail: 4328 - 4367 nt.

[0338]

[0074] Figure 38 provides the optimized and non-optimized pBio3+ Yellow Fever 2 plasmid map containing the following coordinates:

[0339] Origin of replication: 24 - 612 nt

[0340] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0341] - Strong Gyrase (SGS) site: 1866 - 2014 nt - T7 RNA polymerase promoter: 2077 - 2093 nt - Cotranscriptional capping motif: 2094 - 2096 nt

[0342] - 5' UTR VEEV: 2100 - 2143 nt

[0343] Kozak sequence: 2153 - 2158 nt

[0344] - SARS-CoV-2 Spike signal peptide: 2159 - 2197 nt - Optimized and non-optimized Yellow Fever prM sequence: 2198 - 2689 nt

[0345] - Optimized and non-optimized Yellow Fever E-sequence (envelope): 2690 - 4168 nt

[0346] - 3' UTR VEEV: 4187 - 4303 nt

[0347] - Poly-A tail: 4304 - 4343 nt.

[0075] Figure 39 provides the optimized and non-optimized pBio3+ Yellow Fever 3 plasmid map containing the following coordinates:

[0348] Origin of replication: 24 - 612 nt

[0349] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0350] - Strong Gyrase (SGS) site: 1866 - 2014 nt - T7 RNA polymerase promoter: 2077 - 2093 nt - Cotranscriptional capping motif: 2094 - 2096 nt

[0351] - 5' UTR VEEV: 2100 - 2143 nt

[0352] Kozak sequence: 2153 - 2158 nt

[0353] - Signal peptide (transmembrane region of Yellow Fever protein C): 2159 - 2221 nt

[0354] - Optimized and non-optimized prM Yellow Fever sequence: 2222 - 2713 nt

[0355] - Optimized and non-optimized Yellow Fever E sequence (envelope): 2714 - 4192 nt

[0356] - Optimized and non-optimized NS1 sequence for Yellow Fever: 4193 - 5419 nt

[0357] - 3' UTR VEEV: 5438 - 5554 nt

[0358] - Poly-A tail: 5555 - 5594 nt.

[0359]

[0076] Figure 40 provides the optimized and non-optimized pBio3+ Yellow Fever plasmid map containing the following coordinates:

[0360] Origin of replication: 24 - 612 nt

[0361] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0362] - Strong Gyrase (SGS) site: 1866 - 2014 nt - T7 RNA polymerase promoter: 2077 - 2093 nt - Cotranscriptional capping motif: 2094 - 2096 nt

[0363] - 5' UTR VEEV: 2100 - 2143 nt

[0364] Kozak sequence: 2153 - 2158 nt

[0365] - SARS-CoV-2 Spike signal peptide: 2159 - 2197 nt - Optimized and non-optimized Yellow Fever prM sequence: 2198 - 2689 nt

[0366] - Optimized and non-optimized Yellow Fever E-sequence (envelope): 2690 - 4168 nt

[0367] - Optimized and non-optimized NS1 sequence for Yellow Fever: 4169 - 5395 nt

[0368] - 3' UTR VEEV: 5414 - 5530 nt

[0369] - Poly-A tail: 5531 - 5570 nt.

[0370]

[0077] Figure 41 provides the pBio3+ Heavy Chain (HC) plasmid map of the optimized and non-optimized Anti-PDl antibody containing the following coordinates:

[0371] Origin of replication: 24 - 612 nt

[0372] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0373] - Strong Gyrase site (SGS): 1866 - 2014 nt - T7 RNA polymerase promoter: 2077 - 2093 nt - Co-transcriptional capping motif: 2094 - 2096 nt - 5' UTR VEEV: 2100 - 2143 nt

[0374] Kozak sequence: 2153 - 2158 nt

[0375] - Rituximab heavy chain signaling peptide: 2159 - 2215 nt

[0376] - Optimized and non-optimized anti-PD1 nivolumab heavy chain sequence: 2216 - 3535 nt - 3' UTR VEEV: 3554 - 3670 nt

[0377] - Poly-A tail: 3671 - 3710 nt.

[0378]

[0078] Figure 42 provides the pBio3+ plasmid map of the optimized and non-optimized anti-PDl antibody light chain (LC) containing the following coordinates:

[0379] Origin of replication: 24 - 612 nt

[0380] - Ampicillin resistance gene: 783 - 1643 nt - Ampicillin resistance gene promoter: 1644 - 1748 nt

[0381] - Strong Gyrase (SGS) site: 1866 - 2014 nt - T7 RNA polymerase promoter: 2077 - 2093 nt - Cotranscriptional capping motif: 2094 - 2096 nt

[0382] - 5' UTR VEEV: 2100 - 2143 nt

[0383] Kozak sequence: 2153 - 2158 nt

[0384] - Rituximab signaling peptide light chain: 2159 - 2224 nt

[0385] - Anti-PDI sequence Nivolumab light chain optimized and non-optimized: 2225 - 2866 nt - 3' UTR VEEV: 2885 - 3001 nt

[0386] - Poly-A tail: 3002 - 3041 nt.

[0079] Figure 43 provides the pBio4+ luciferase plasmid map containing the following coordinates:

[0387] Origin of replication: 24 - 612 nt

[0388] - Sequence cer (mrs): 690 - 973 nt

[0389] - Ampicillin resistance gene: 1067 - 1927 nt - Ampicillin resistance gene promoter: 1928 - 2032 nt

[0390] - Strong Gyrase (SGS) site: 2150 - 2298 nt - T7 RNA polymerase promoter: 2361 - 2377 nt - Cotranscriptional capping motif: 2378 - 2380 nt

[0391] - 5' UTR VEEV: 2384 - 2427 nt

[0392] Kozak sequence: 2437 - 2442 nt

[0393] - Luciferase sequence: 2443 - 4092 nt

[0394] - 3' UTR VEEV: 4111 - 4227 nt

[0395] - Poly-A tail: 4228 - 4267 nt

[0396]

[0080] Figure 44 provides the map of the optimized delta variant pBio4+ Spike plasmid containing the following coordinates:

[0397] Origin of replication: 24 - 612 nt

[0398] - Sequence cer (mrs): 690 - 973 nt

[0399] - Ampicillin resistance gene: 1067 - 1927 nt - Ampicillin resistance gene promoter: 1928 - 2032 nt

[0400] - Strong Gyrase (SGS) site: 2150 - 2298 nt - T7 RNA polymerase promoter: 2361 - 2377 nt - Cotranscriptional capping motif: 2378 -

[0401]

[0402] - 5' UTR VEEV: 2384 - 2427 nt

[0403] Kozak sequence: 2437 - 2442 nt

[0404] - Spike signal peptide: 2443 - 2481 nt

[0405] - Optimized full spike SARS-CoV-2 delta: 2482 - 6255 nt

[0406] - 3' UTR VEEV: 6274 - 6390 nt

[0407] - Poly-A tail: 6391 - 6430 nt.

[0408]

[0081] Figure 45 provides the map of the optimized and non-optimized BA4 / BA5 omicron variant pBio4+ Spike plasmid containing the following coordinates:

[0409] Origin of replication: 24 - 612 nt

[0410] - Sequence cer (mrs): 690 - 973 nt

[0411] - Ampicillin resistance gene: 1067 - 1927 nt - Ampicillin resistance gene promoter: 1928 - 2032 nt

[0412] - Strong Gyrase (SGS) site: 2150 - 2298 nt - T7 RNA polymerase promoter: 2361 - 2377 nt - Cotranscriptional capping motif: 2378 - 2380 nt

[0413] - 5' UTR VEEV: 2384 - 2427 nt

[0414] Kozak sequence: 2437 - 2442 nt

[0415] - Spike signal peptide: 2443 - 2481 nt

[0416] - Optimized and non-optimized full spike protein SARS-CoV-2 omicron BA4 / BA5: 2482 - 6246 nt

[0417] - 3' UTR VEEV: 6265 - 6381 nt

[0418] - Poly-A tail: 6382 - 6421 nt.

[0082] Figure 46 provides the map of the optimized and non-optimized XBB omicron variant pBio4+ Spike plasmid containing the following coordinates:

[0419] Origin of replication: 24 - 612 nt

[0420] - Sequence cer (mrs): 690 - 973 nt

[0421] - Ampicillin resistance gene: 1067 - 1927 nt - Ampicillin resistance gene promoter: 1928 - 2032 nt

[0422] - Strong Gyrase (SGS) site: 2150 - 2298 nt - T7 RNA polymerase promoter: 2361 - 2377 nt - Cotranscriptional capping motif: 2378 - 2380 nt

[0423] - 5' UTR VEEV: 2384 - 2427 nt

[0424] Kozak sequence: 2437 - 2442 nt

[0425] - Spike signal peptide: 2443 - 2481 nt

[0426] - Full spike protein, optimized and non-optimized, SARS-CoV-2 XBB: 2482 - 6249 nt

[0427] - 3' UTR VEEV: 6268 - 6384 nt

[0428] - Poly-A tail: 6385 - 6424 nt.

[0429]

[0083] Figure 47 provides the optimized and non-optimized pBio4+ Yellow Fever plasmid map containing the following coordinates:

[0430] Origin of replication: 24 - 612 nt

[0431] - Sequence cer (mrs): 690 - 973 nt

[0432] - Ampicillin resistance gene: 1067 - 1927 nt - Ampicillin resistance gene promoter: 1928 - 2032 nt

[0433] - Strong Gyrase (SGS) site: 2150 - 2298 nt - T7 RNA polymerase promoter: 2361 - 2377 nt - Cotranscriptional capping motif: 2378 - 2380 nt

[0434] - 5' UTR VEEV: 2384 - 2427 nt

[0435] Kozak sequence: 2437 - 2442 nt

[0436] - Signal peptide (transmembrane region of yellow fever protein C): 2443 - 2505 nt

[0437] - Optimized and non-optimized prM Yellow Fever sequence: 2506 - 2997 nt

[0438] - Optimized and non-optimized Yellow Fever E-sequence (envelope): 2998 - 4476 nt

[0439] - 3' UTR VEEV: 4495 - 4611 nt

[0440] - Poly-A tail: 4612 - 4651 nt.

[0441]

[0084] Figure 48 provides the optimized and non-optimized pBio4+ Yellow Fever plasmid map containing the following coordinates:

[0442] Origin of replication: 24 - 612 nt

[0443] - Sequence cer (mrs): 690 - 973 nt

[0444] - Ampicillin resistance gene: 1067 - 1927 nt - Ampicillin resistance gene promoter: 1928 - 2032 nt

[0445] - Strong Gyrase (SGS) site: 2150 - 2298 nt - T7 RNA polymerase promoter: 2361 - 2377 nt - Cotranscriptional capping motif: 2378 - 2380 nt

[0446] - 5' UTR VEEV: 2384 - 2427 nt

[0447] Kozak sequence: 2437 - 2442 nt

[0448] - SARS-CoV-2 Spike signal peptide: 2443 - 2481 nt - Optimized and non-optimized Yellow Fever prM sequence: 2482 - 2973 nt

[0449] - Optimized and non-optimized Yellow Fever E-sequence (envelope): 2974 - 4452 nt

[0450] - 3' UTR VEEV: 4471 - 4587 nt

[0451] - Poly-A tail: 4588 - 4627 nt.

[0452]

[0085] Figure 49 provides the optimized and non-optimized pBio4+ Yellow Fever plasmid map containing the following coordinates:

[0453] Origin of replication: 24 - 612 nt

[0454] - Sequence cer (mrs): 690 - 973 nt

[0455] - Ampicillin resistance gene: 1067 - 1927 nt - Ampicillin resistance gene promoter: 1928 - 2032 nt

[0456] - Strong Gyrase (SGS) site: 2150 - 2298 nt - T7 RNA polymerase promoter: 2361 - 2377 nt - Cotranscriptional capping motif: 2378 - 2380 nt

[0457] - 5' UTR VEEV: 2384 - 2427 nt

[0458] Kozak sequence: 2437 - 2442 nt

[0459] - Signal peptide (transmembrane region of yellow fever protein C): 2443 - 2505 nt

[0460] - Optimized and non-optimized prM Yellow Fever sequence: 2506 - 2997 nt

[0461] - Optimized and non-optimized Yellow Fever E-sequence (envelope): 2998 - 4476 nt

[0462] - Optimized and non-optimized NS1 sequence for Yellow Fever: 4477 - 5703 nt - 3' UTR VEEV: 5722 - 5838 nt

[0463] - Poly-A tail: 5839 - 5878 nt.

[0464]

[0086] Figure 50 provides the optimized and non-optimized pBio4+ Yellow Fever plasmid map containing the following coordinates:

[0465] Origin of replication: 24 - 612 nt

[0466] - Sequence cer (mrs): 690 - 973 nt

[0467] - Ampicillin resistance gene: 1067 - 1927 nt - Ampicillin resistance gene promoter: 1928 - 2032 nt

[0468] - Strong Gyrase (SGS) site: 2150 - 2298 nt - T7 RNA polymerase promoter: 2361 - 2377 nt - Cotranscriptional capping motif: 2378 - 2380 nt

[0469] - 5' UTR VEEV: 2384 - 2427 nt

[0470] Kozak sequence: 2437 - 2442 nt

[0471] - SARS-CoV-2 Spike signal peptide: 2443 - 2481 nt - Optimized and non-optimized Yellow Fever prM sequence: 2482 - 2973 nt

[0472] - Optimized and non-optimized Yellow Fever E-sequence (envelope): 2974 - 4452 nt

[0473] - Optimized and non-optimized NS1 sequence for Yellow Fever: 4453 - 5679 nt

[0474] - 3' UTR VEEV: 5698 - 5814 nt

[0475] - Poly-A tail: 5815 - 5854 nt.

[0476]

[0087] Figure 51 provides the pBio4+ plasmid map of the optimized and non-optimized anti-PDl antibody heavy chain (HC) containing the following coordinates: - Origin of replication: 24 - 612 nt

[0477] - Sequence cer (mrs): 690 - 973 nt

[0478] - Ampicillin resistance gene: 1067 - 1927 nt - Ampicillin resistance gene promoter: 1928 - 2032 nt

[0479] - Strong Gyrase (SGS) site: 2150 - 2298 nt - T7 RNA polymerase promoter: 2361 - 2377 nt - Cotranscriptional capping motif: 2378 - 2380 nt

[0480] - 5' UTR VEEV: 2384 - 2427 nt

[0481] Kozak sequence: 2437 - 2442 nt

[0482] - Rituximab heavy chain signal peptide: 2443 - 2499 nt

[0483] - Optimized and non-optimized anti-PD1 nivolumab heavy chain sequence: 2500 - 3819 nt - 3' UTR VEEV: 3838 - 3954 nt

[0484] - Poly-A tail: 3955 - 3994 nt.

[0485]

[0088] Figure 52 provides the pBio4+ plasmid map of the optimized and non-optimized anti-PDl antibody light chain (LC) containing the following coordinates:

[0486] Origin of replication: 24 - 612 nt

[0487] - Sequence cer (mrs): 690 - 973 nt

[0488] - Ampicillin resistance gene: 1067 - 1927 nt - Ampicillin resistance gene promoter: 1928 - 2032 nt

[0489] - Strong Gyrase (SGS) site: 2150 - 2298 nt - T7 RNA polymerase promoter: 2361 - 2377 nt - Cotranscriptional capping motif: 2378 - 2380 nt

[0490] - 5' UTR VEEV: 2384 - 2427 nt

[0491] Kozak sequence: 2437 - 2442 nt

[0492] - Rituximab signaling peptide light chain: 2443 - 2508 nt

[0493] - Anti-PDI sequence Nivolumab light chain optimized and non-optimized: 2509 - 3150 nt - 3' UTR VEEV: 3169 - 3285 nt

[0494] - Poly-A tail: 3286 - 3325 nt.

[0495]

[0089] Figure 53 illustrates the transcription of (A) non-optimized mRNA and (B) optimized mRNA, referring to the Delta variant, obtained by electrophoresis on denaturing agarose gel. Secondary bands and abortive remnants generated after in vitro transcription reactions (IVT) are marked with arrows. (A) Column 1: molecular size standard ssRNA ladder; Column 2: in vitro transcription reaction (IVT) containing the non-optimized Delta construct (Ipg of RNA per well); (B) Column 1: molecular size standard ssRNA ladder; Column 2: in vitro transcription reaction (IVT) containing the optimized Delta construct (Ipg of RNA per well).

[0496]

[0090] Figure 54 illustrates the results of the in vitro mRNA expression assay in HEK 293T cells (A: Tube 1 - Non-optimized Delta mRNA (n-methylpseudouridine); B: Tube 2 - Optimized Delta mRNA (n-methylpseudouridine); C: Tube 3 - Non-optimized Delta mRNA (pseudouridine); D: Tube 4 - Optimized Delta mRNA (pseudouridine); E: Tube 5 - Optimized Omicron BA4 / BA5 mRNA (n-methylpseudouridine) and F: Tube 6 - Optimized Omicron BA4 / BA5 mRNA (pseudouridine)).

[0091] Figure 55 illustrates the flow cytometry results of the in vitro delivery and expression assay of optimized and non-optimized mRNAs, modified with pseudouridine or n-methylpseudouridine, formulated with formulation BI-1, in HEK 293T cells (A: Unlabeled control (cells); B: Labeled control (Alexa Fluor 488); C: Positive control 15pg; D: Non-optimized Delta mRNA (n-methylpseudouridine); E: Optimized Delta mRNA (n-methylpseudouridine); F: Non-optimized Delta mRNA (pseudouridine); G: Optimized Delta mRNA (pseudouridine); H: Optimized Omicron BA4 / BA5 mRNA (n-methylpseudouridine); and I: Optimized Omicron BA4 / BA5 mRNA). (pseudouridine)).

[0497]

[0092] Figure 56 illustrates the results of the in vitro delivery and expression assay of mRNA formulated with formulation BI-1, in HEK 293T cells.

[0498]

[0093] Figure 57 illustrates the results of the in vivo delivery and expression assay of the formulated mRNA-Luciferase with formulations BI-1, BK-1, G-1 and I-1 in K18 mice, 1 day after inoculation (1 DPI) (A) Region of interest (ROI) in K18 mice tested with a: Buffer; b: Control formulation 2-1; c: Control formulation 1-1; d: Formulation BI-1; e: Formulation BK-1; f: Formulation G-1; g: Formulation I-1). (B) ROI graph obtained in the assay.

[0499]

[0094] Figure 58 A illustrates the results of the in vivo delivery and expression assay of the formulated mRNA-Luciferase with the CG-1, CP-1 and CZ-1 formulations in K18 mice, 3 days after inoculation (3 DPI) (A) Region of interest (ROI) in K18 mice tested with a: Buffer; b: CG-1 formulation; c: CP-1 formulation; d: Control 2-1 formulation; ee: CZ-1 formulation; (B) ROI graph obtained in the assay.

[0095] Figure 59 illustrates the immunization scheme of K18 mice, challenged with the Gamma strain (heterologous challenge) for immunogenicity and efficacy studies of mRNA vaccines.

[0500]

[0096] Figure 60 illustrates the results of the ELISPOT immunogenicity assessment (quantification of IFN-γ in animal splenocytes) of the BI-1, BC-1 and BK-1 formulations containing non-optimized delta mRNA modified with methylpseudouridine.

[0501]

[0097] Figure 61 illustrates the results of the evaluation of the immunogenicity of the BI-1, BC-1 and BK-1 formulations containing the non-optimized delta mRNA modified with pseudouridine by antibody quantification using ELISA.

[0502]

[0098] Figure 62 illustrates the results of the evaluation of the immunogenicity of the BI-1, BC-1 and BK-1 formulations containing non-optimized Delta mRNA modified with pseudouridine by quantification of antibodies in the neutralization assay on plates using sera from animals challenged with Sars-Cov-2 strain Wuhan (A) and strain Omicron (B).

[0503]

[0099] Figure 63 illustrates the results of the evaluation of the efficacy of the BI-1, BC-1 and BK-1 formulations containing non-optimized delta mRNA modified with pseudouridine, by quantifying viral load in the oropharynx of K18 animals challenged with Sars-Cov-2, at 3 days (A) and 5 days (B) after inoculation (3 and 5 DPI).

[0504]

[0100] Figure 64 illustrates the results of the evaluation of the efficacy of formulations BI-1, BC-1 and BK-1, containing non-optimized delta mRNA modified with pseudouridine, by quantifying viral load in the lung (A) and brain (B) of K18 animals challenged with Sars-Cov-2.

[0101] Figure 65 illustrates the results of the evaluation of the efficacy of formulations BI-1, BC-1 and BK-1 containing non-optimized delta mRNA modified with pseudouridine, by evaluating the survival of animals challenged with Sars-Cov-2 strain Gamma.

[0505]

[0102] Figure 66 illustrates the results of the ELISPOT immunogenicity assessment (quantification of IFN-γ in animal splenocytes) of the BI-1 formulation containing mRNA with optimized and non-optimized sequences, comparing pseudouridine with n-methylpseudouridine and bivalent formulations.

[0506]

[0103] Figure 67 illustrates the results of the evaluation of the immunogenicity of the BI-1 formulation containing mRNA with optimized and non-optimized sequences, comparing pseudouridine with n-methylpseudouridine and bivalent compositions, by quantification of antibodies by ELISA.

[0507]

[0104] Figure 68 illustrates the results of the evaluation of the immunogenicity of the BI-1 formulation containing mRNA with optimized and non-optimized sequences, comparing pseudouridine with n-methylpseudouridine and bivalent compositions, by quantification of antibodies in the plate neutralization assay (A) Wuhan strain; (B) Omicron strain.

[0508]

[0105] Figure 69 illustrates the results of the Efficacy Assessment of the BI-1 formulation containing mRNA with optimized and non-optimized sequences, comparing pseudouridine with n-methylpseudouridine and bivalent compositions, by quantifying viral load in the oropharynx of K18 animals challenged with Sars-Cov-2, at 3 days (A) and 5 days (B) after inoculation (3 and 5 DPI).

[0106] Figure 70 illustrates the results of the Efficacy Assessment of the BI-1 formulation containing mRNA with optimized and non-optimized sequences, comparing pseudouridine with n-methylpseudouridine and bivalent compositions, by quantifying viral load in the lung (A) and brain (B) of K18 animals challenged with Sars-Cov-2, at 5 / 6 days after inoculation (5 / 6 DPI).

[0509]

[0107] Figure 71 illustrates the results of the evaluation of the efficacy of the BI-1 formulation containing mRNA with optimized and non-optimized sequences, comparing pseudouridine with n-methylpseudouridine and bivalent compositions, by evaluating the survival of animals challenged with Sars-Cov-2.

[0510]

[0108] Figure 72 illustrates the results of the ELISPOT immunogenicity assessment (quantification of IFN-γ in animal splenocytes) of the CG-1 and CP-1 formulations containing mRNA with optimized and non-optimized sequences, comparing pseudouridine with n-methylpseudouridine and bivalent formulations.

[0511]

[0109] Figure 73 illustrates the results of the evaluation of the immunogenicity of CG-1 and CP-1 formulations containing mRNA with optimized and non-optimized sequences, comparing pseudouridine with n-methylpseudouridine and monovalent and bivalent vaccines, by quantification of antibodies by ELISA.

[0512]

[0110] Figure 74 illustrates the results of the evaluation of the immunogenicity of CG-1 and CP-1 formulations containing mRNA with optimized and non-optimized sequences, comparing pseudouridine with n-methylpseudouridine and monovalent and bivalent vaccines, by neutralization assay on plates (A) Wuhan strain; (B) Omicron strain.

[0111] Figure 75 illustrates the results of the evaluation of the efficacy of CG-1 and CP-1 formulations containing mRNA with optimized and non-optimized sequences, comparing pseudouridine with n-methylpseudouridine and monovalent and bivalent vaccines, by quantification of viral load in the oropharynx of K18 animals challenged with Sars-Cov-2, at 3 days (A) and 5 days (B) after inoculation (3 and 5 DPI).

[0513]

[0112] Figure 76 illustrates the results of the Efficacy Assessment of CG-1 and CP-1 formulations containing mRNA with optimized and non-optimized sequences, comparing pseudouridine with n-methylpseudouridine and monovalent and bivalent vaccines, by quantifying viral load in the lung (A) and brain (B) of K18 animals challenged with Sars-Cov-2, 5 to 6 days after inoculation (5-6 DPI).

[0514]

[0113] Figure 77 illustrates the results of the evaluation of the efficacy of CG-1 and CP-1 formulations containing mRNA with optimized and non-optimized sequences, comparing pseudouridine with n-methyl pseudouridine and monovalent and bivalent vaccines, by evaluating the survival of animals challenged with Sars-Cov-2.

[0515]

[0114] Figure 78 illustrates the results of the evaluation of the immunogenicity of the CZ-1 formulation containing optimized and pseudouridine-modified BA4 / BA5 omicron mRNA, by ELISPOT (quantification of IFN-γ in animal splenocytes).

[0516]

[0115] Figure 79 illustrates the results of the evaluation of the immunogenicity of the CZ-1 formulation containing mRNA with optimized BA4 / BA5 omicron sequences, modified with pseudouridine, by quantification of antibodies by ELISA.

[0517]

[0116] Figure 80 illustrates the results of the evaluation of the immunogenicity of the CZ-1 formulation containing mRNA with optimized BA4 / BA5 omicron sequences, modified with pseudouridine, by neutralization assay in plates (A) Wuhan strain; (B) Omicron strain.

[0518]

[0117] Figure 81 illustrates the results of the evaluation of the efficacy of the CZ-1 formulation containing mRNA with optimized BA4 / BA5 omicron sequences, modified with pseudouridine, by quantifying viral load in the oropharynx of K18 animals challenged with Sars-Cov-2, at 3 days (A) and 5 days (B) after inoculation (3 and 5 DPI).

[0519]

[0118] Figure 82 illustrates the results of the evaluation of the efficacy of the CZ-1 formulation containing mRNA with optimized BA4 / BA5 omicron sequences, modified with pseudouridine, by quantifying viral load in the lung (A) and brain (B) of K18 animals challenged with Sars-Cov-2.

[0520]

[0119] Figure 83 illustrates the results of the evaluation of the efficacy of the CZ-1 formulation containing mRNA with optimized BA4 / BA5 omicron sequences, modified with pseudouridine, by evaluating the survival of animals challenged with Sars-Cov-2.

[0521]

[0120] Figure 84 provides the flow cytometry results of the in vitro delivery and expression assay of optimized and non-optimized mRNAs, modified with pseudouridine or n-methylpseudouridine, monovalent and bivalent vaccines formulated with the CG-1 and CP-1 formulations in HEK 293T cells (A: Unlabeled control (cells); B: Alexa Fluor 488+ control (AF488 antibody); G2: 2-1 control containing non-optimized methylpseudo delta mRNA; G3: CG-1 formulation containing non-optimized methylpseudo delta mRNA; G4: CP-1 formulation containing non-optimized methylpseudo delta mRNA; G5: CG-1 formulation containing optimized pseudo delta mRNA; G6: CP-1 formulation containing optimized pseudo delta mRNA; G7: CG-1 formulation containing optimized pseudo-omicron BA4 / BA5 mRNA; G8: CP-1 formulation containing optimized pseudo-omicron mRNA Omicron BA4 / BA5; G9: CG-1 formulation containing optimized pseudo-bivalent mRNA; G10: CP-1 formulation containing optimized pseudo-bivalent mRNA).

[0522]

[0121] Figure 85 provides the flow cytometry results of the in vitro delivery and expression assay of optimized, pseudouridine-modified BA4 / BA5 omicron mRNA, formulated with formulations BI-1 and CZ-1 in HEK 293T cells (A: Unlabeled control (cells); B: Alexa Fluor 488+ control (AF488 antibody); G2: Control 2-1 containing optimized pseudo-omicron BA4 / BA5 mRNA; G3: Formulation BI-1 containing optimized pseudo-omicron BA4 / BA5 mRNA; G4: Formulation CZ-1 pH 4.0 containing optimized pseudo-omicron BA4 / BA5 mRNA; G5: Formulation CZ-1 pH 5.2 containing optimized pseudo-omicron BA4 / BA5 mRNA; G6: Formulation CZ-1 pH 6.0 containing optimized pseudo-omicron BA4 / BA5 mRNA).

[0523]

[0122] Figure 86 provides the flow cytometry results of the in vitro mRNA expression assay of the pBio2 plasmid-containing gene for the non-optimized Yellow Fever constructs (FA-3 and FA-4), modified with pseudouridine, in HEK 293T cells (A: Unlabeled control (cells); B: Control Primary antibody 4G2; C: Control Secondary antibody AF488; D: Control Antibody 4G2 + AF488; E: Yellow Fever mRNA 3 (15pg) 4G2 + AF488; F: Yellow Fever mRNA 4 (15pg) 4G2 + AF488).

[0524]

[0123] Figure 87 provides the flow cytometry results of the in vitro expression assay of mRNA expressed in the pBio2 plasmid containing the gene for the optimized anti-PD1 monoclonal antibody, modified with pseudouridine, proposed in the invention, in HEK 293T cells (A: Control (cells encapsulated in lipofetamine); B: mRNA (2.5pg light chain and 2.5pg heavy chain) encapsulated in lipofetamine; C: mRNA (7.5pg light chain and 7.5pg heavy chain) encapsulated in lipofetamine).

[0525]

[0124] Figure 88 provides a flowchart of the in silico methodology employed in constructing the optimized sequences.

[0526]

[0125] Figure 89 shows the alignment of the non-optimized delta mRNA sequence without the poly-A tail and without the 3' and 5' UTR element segments (SEQ ID NO: 53) with the optimized delta mRNA sequence of the present invention, expressed in pBiol (SEQ ID NO: 9).

[0527]

[0126] Figure 90 shows the alignment of the non-optimized delta mRNA sequence without the poly-A tail and without the 3' and 5' UTR element segments (SEQ ID NO: 53) with the optimized delta mRNA sequence of the present invention, expressed in pBio2, pBio3 and pBio4 (SEQ ID NO: 10).

[0528]

[0127] Figure 91 shows the alignment of the non-optimized BA4 / BA5 omicron mRNA sequence without the poly-A tail and without the 3' and 5' UTR element segments (SEQ ID NO: 54) with the optimized BA4 / BA5 omicron mRNA sequence of the present invention, expressed in pBio2, pBio3 and pBio4 (SEQ ID NO: 11).

[0529]

[0128] Figure 92 shows the alignment of the non-optimized XBB omicron mRNA sequence without the poly-A tail and without the 3' and 5' UTR element segments (SEQ ID NO: 55) with the optimized XBB omicron mRNA sequence of the present invention, expressed in pBio2, pBio3 and pBio4 (SEQ ID NO: 12).

[0530]

[0129] Figure 93 shows the alignment of the non-optimized Yellow Fever 1 mRNA sequence without the poly-A tail and without the 3' and 5' UTR element segments (SEQ ID NO: 78) with the optimized Yellow Fever 1 mRNA sequence of the present invention, expressed in pBio2, pBio3 and pBio4 (SEQ ID NO: 13).

[0531]

[0130] Figure 94 shows the alignment of the non-optimized Yellow Fever 2 mRNA sequence without the poly-A tail and without the 3' and 5' UTR element segments (SEQ ID NO: 79) with the optimized Yellow Fever 2 mRNA sequence of the present invention, expressed in pBio2, pBio3 and pBio4 (SEQ ID NO: 14).

[0532]

[0131] Figure 95 shows the alignment of the non-optimized Yellow Fever 3 mRNA sequence without the poly-A tail and without the 3' and 5' UTR element segments (SEQ ID NO: 80) with the optimized Yellow Fever 3 mRNA sequence of the present invention, expressed in pBio2, pBio3 and pBio4 (SEQ ID NO: 15).

[0533]

[0132] Figure 96 shows the alignment of the non-optimized Yellow Fever 4 mRNA sequence without the poly-A tail and without the 3' and 5' UTR element segments (SEQ ID NO: 81) with the optimized Yellow Fever 4 mRNA sequence of the present invention, expressed in pBio2, pBio3 and pBio4 (SEQ ID NO: 16).

[0534]

[0133] Figure 97 shows the alignment of the non-optimized Anti-PDl Heavy Chain mRNA sequence without the poly-A tail and without the 3' and 5' UTR element segments (SEQ ID NO: 72) with the optimized Anti-PDl Heavy Chain mRNA sequence of the present invention, expressed in pBio2, pBio3 and pBio4 (SEQ ID NO: 17).

[0535]

[0134] Figure 98 shows the alignment of the non-optimized Anti-PDl Light Chain mRNA sequence without the poly-A tail and without the 3' and 5' UTR element segments (SEQ ID NO: 73) with the optimized Anti-PDl Light Chain mRNA sequence of the present invention, expressed in pBio2, pBio3 and pBio4 (SEQ ID NO: 18).

[0536]

[0135] Figure 99 illustrates the immunization scheme of K18 mice, challenged with the omicron XBB strain (homologous challenge) for immunogenicity and efficacy studies of mRNA vaccines.

[0537]

[0136] Figure 100 illustrates the results of the evaluation of the immunogenicity of the CZ-1 formulation containing 1, 2 or 4 pg of optimized and pseudouridine-modified XBB omicron mRNA, by ELISPOT (quantification of IFN-γ in K18 mouse splenocytes).

[0538]

[0137] Figure 101 illustrates the results of the evaluation of the immunogenicity of the CZ-1 formulation containing 1, 2 or 4 pg of optimized XBB omicron mRNA, modified with pseudouridine, by quantification of antibodies from K18 mice, by ELISA, at pre-challenge and at different days after inoculation (dpi).

[0539]

[0138] Figure 102 illustrates the results of the evaluation of the immunogenicity of the CZ-1 formulation containing 1, 2 or 4 pg of optimized, pseudouridine-modified omicron XBB mRNA, by neutralization assay on plates of the omicron XBB strain, in K18 mice at pre-challenge and on different days post-inoculation (dpi).

[0139] Figure 103 illustrates the results of the evaluation of the efficacy of the CZ-1 formulation containing 1, 2 or 4 pg of optimized, pseudouridine-modified omicron XBB mRNA, by quantification of viral load in the oropharynx of K18 animals challenged with the omicron XBB strain, at 3 DPI (A) and 6 DPI (B).

[0540]

[0140] Figure 104 illustrates the results of the Efficacy Assessment of the CZ-1 formulation containing 1, 2 or 4 pg of optimized, pseudouridine-modified XBB omicron mRNA, by viral load quantification in the lungs of K18 animals challenged with the XBB omicron strain, at 3 DPI (A) and 6 DPI (B).

[0541]

[0141] Figure 105 illustrates the results of the Efficacy Assessment of the CZ-1 formulation containing 1, 2 or 4 pg of optimized, pseudouridine-modified XBB omicron mRNA, by viral load quantification in the brain of K18 animals challenged with the XBB omicron strain, at 3 DPI (A) and 6 DPI (B).

[0542]

[0142] Figure 106 illustrates the immunization scheme of golden Syrian hamsters, challenged with the omicron XBB strain (homologous challenge) for immunogenicity and efficacy studies of mRNA vaccines.

[0543]

[0143] Figure 107 illustrates the results of the evaluation of the immunogenicity of the CZ-1 formulation containing 1, 2 or 4 pg of optimized and pseudouridine-modified XBB omicron mRNA, by ELISPOT (quantification of IFN-γ in splenocytes of golden Syrian hamsters).

[0544]

[0144] Figure 108 illustrates the results of the evaluation of the immunogenicity of the CZ-1 formulation containing 1, 2 or 4 pg of optimized XBB omicron mRNA, modified with pseudouridine, by quantification of antibodies from golden Syrian hamsters, by ELISA.

[0545]

[0145] Figure 109 illustrates the results of the evaluation of the immunogenicity of the CZ-1 formulation containing 1, 2 or 4 pg of omicron XBB mRNA, optimized, modified with pseudouridine, by neutralization assay on omicron XBB strain plates, in golden Syrian hamster.

[0546]

[0146] Figure 110 illustrates the results of the Efficacy Assessment of the CZ-1 formulation containing 1, 2 or 4pg of optimized, pseudouridine-modified omicron XBB mRNA, by viral load quantification in the oropharynx of Syrian golden hamsters challenged with the omicron XBB strain, at 3 DPI (A) and 6 DPI (B).

[0547]

[0147] Figure 111 illustrates the results of the Efficacy Assessment of the CZ-1 formulation containing 1, 2 or 4pg of optimized, pseudouridine-modified omicron XBB mRNA, by viral load quantification in the lungs of Syrian golden hamsters challenged with the omicron XBB strain, at 3 DPI (A) and 6 DPI (B).

[0548]

[0148] Figure 112 illustrates the immunization scheme of BALB / c mice, for the study of in vivo expression of the optimized anti-PDl antibody.

[0549]

[0149] Figure 113 illustrates the results of the ELISA evaluation of the in vivo expression of the anti-PD-1 antibody in BALB / c mice inoculated with optimized mRNA, modified with pseudouridines, expressed in the pBio3 plasmid, which encodes for the light and heavy chains of the anti-PD-1 antibody.

[0550]

[0150] Figure 114 provides the flow cytometry results of the in vitro expression assay of optimized mRNA, modified with pseudouridines, expressed in the pBio4 plasmid, containing the gene for the Yellow Fever 2 and Yellow Fever 4 (YF-2 and YF-4) constructs, in HEK 293T cells (A: Control cells encapsulated in lipophytamine; B: Optimized Yellow Fever 2 mRNA modified with pseudouridine and encapsulated in lipophytamine; C: Optimized Yellow Fever 4 mRNA modified with pseudouridine and encapsulated in lipophytamine; D: Optimized Yellow Fever 2 mRNA modified with pseudouridine and encapsulated in the CZ-1 formulation; E: Optimized Yellow Fever 4 mRNA modified with pseudouridine and encapsulated in the CZ-1 formulation).

[0551]

[0151] Figure 115 illustrates the results of the delivery and in vivo expression assay of the mRNA-Lucif erase, expressed in pBio3, formulated with the CZ-1 nanolipid formulation, in K18 mice, at 24, 48, 120, 144 and 366 hours after vaccination.

[0552]

[0152] Figure 116 illustrates the results of the delivery and in vivo expression assay of the mRNA-Lucif erase, expressed in pBio4, formulated with the CZ-1 nanolipid formulation, in K18 mice, at 24, 48, 120, 144 and 366 hours after vaccination.

[0553]

[0153] Figure 117 illustrates the immunization scheme of C57BL / 6 mice with mRNA, expressed in pBio4, Yellow Fever-2 (spike-prM-E) or Yellow Fever-4 (spike-prM-E-NS1), optimized, modified with pseudouridine and encapsulated in the CZ-1 nanolipid formulation.

[0554]

[0154] Figure 118 illustrates the results of the evaluation of the immunogenicity of the CZ-1 formulation containing 1, 2 or 4 pg of Yellow Fever 2 (spike-prM-E) or Yellow Fever-4 (spike-prM-E-NSl) mRNA optimized and modified with pseudouridine, by ELISPOT (quantification of IFN-γ in splenocytes of C57BL / 6 mice).

[0555]

[0155] Figure 119 illustrates the results of the evaluation of the immunogenicity of the CZ-1 formulation, containing 1, 2 or 4 pg of Yellow Fever-2 mRNA (spike-prM-E) or Yellow Fever-4 mRNA (spike-prM-E-NSl), optimized and modified with pseudouridine, by ELISA quantification of anti-IgG antibodies to the yellow fever virus (YFV) from C57BL / 6 mice.

[0556] Detailed description of the invention:

[0557]

[0156] Although the present invention may be susceptible to different embodiments, the drawings and the following detailed discussion show a preferred embodiment with the understanding that the present embodiment should be considered an exemplification of the principles of the invention and is not intended to limit the present invention to what has been illustrated and described in this report.

[0558]

[0157] It should also be understood that the terminology used here is only for the purpose of describing particular embodiments and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0559]

[0158] When a range of values ​​is given, it is understood that each intermediate value, down to the tenth of a unit of the lower limit, unless the context clearly indicates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intermediate value in a stated range and any other stated or intermediate value in that stated range is covered by the invention. The upper and lower limits of these smaller ranges may be independently included or excluded in the range, and each range where one, neither, or both limits are included in the smaller ranges is also covered by the invention, subject to any limit specifically excluded in the stated range. When the stated range includes one or both limits, the ranges that exclude one or both included limits are also included in the invention.

[0560]

[0159] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one skilled in the subject matter to which this invention pertains. Although any methods and materials similar or equivalent to those described herein may be used in the practice or testing of this invention, some potential and exemplary methods and materials may now be described. Any and all publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. It is understood that this disclosure supersedes any disclosure of an incorporated publication to the extent that there is a contradiction.

[0561]

[0160] It should be noted that, as used in this descriptive report and the accompanying claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly indicates otherwise. Thus, for example, reference to "a droplet" includes a plurality of such droplets, and reference to "discrete entity" includes reference to one or more discrete entities, and so forth. Note also that claims may be worded to exclude any element, for example, any optional element. As such, this statement is intended to serve as a background for the use of exclusive terminology such as "only," "just," and the like in connection with the recitation of claim elements, or the use of a "negative" limitation.

[0562]

[0161] The publications discussed herein are provided for your information only prior to the filing date of this application. Furthermore, the publication dates provided may differ from the actual publication dates, which may require independent confirmation. To the extent that the definition or use of any term herein conflicts with a definition or use of a term in an application or reference incorporated herein by reference, this application shall prevail.

[0563]

[0162] As will be evident to those skilled in the art after reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features that can be easily separated from or combined with the features of any of the other various embodiments without departing from the scope or spirit of the present invention. Any recited method can be performed in the order of the recited events or in any other order that is logically possible.

[0564]

[0163] An "immune response" or "immune response" to a composition or vaccine is the development in the host of a cellular and / or antibody-mediated immune response to the composition or vaccine of interest. Generally, an "immune response" or "immune response" includes, but is not limited to, one or more of the following effects: the production of antibodies, B cells, helper T cells, and / or cytotoxic T cells, directed specifically to an antigen or antigens included in the composition or vaccine of interest. Preferably, the host will exhibit a therapeutic or protective immune response such that resistance to new infection is increased and / or the clinical severity of the disease is reduced. Such protection may be demonstrated by either a reduction or lack of symptoms normally presented by an infected host, a faster recovery time, and / or a reduced viral titer in the infected host.

[0565]

[0164] The terms "protein", "peptide", "polypeptide" and "polypeptide fragment" are used interchangeably herein to refer to polymers of amino acid residues of any length. The polymer may be linear or branched, may comprise modified amino acids or amino acid analogs, and may be interrupted by other amino acids from chemical moieties. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a bioactive component or labeling.

[0566]

[0165] The term "immunogenic protein, polypeptide or peptide" also includes deletions, additions and substitutions to the sequence, provided the polypeptide functions to produce an immune response as defined herein. The term "conservative variation" designates the substitution of an amino acid residue for another biologically similar residue, or the substitution of a nucleotide in a nucleic acid sequence such that the encoded amino acid residue does not change or is another biologically similar residue. In this respect, particularly preferred substitutions will generally be of a conservative nature, i.e., substitutions that occur within a family of amino acids.For example, amino acids are generally divided into four families: (1) acidic - aspartate and glutamate; (2) basic - lysine, arginine, histidine; (3) nonpolar - alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) polar uncharged - glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids. Examples of conservative variations include the substitution of a hydrophobic residue such as isoleucine, valine, leucine, or methionine for another hydrophobic residue, or the substitution of a polar residue for another polar residue, such as the substitution of arginine for lysine, glutamic acid for aspartic acid, or glutamine for asparagine, and the like; or a similar conservative substitution of an amino acid with a structurally related amino acid that will not have a significant effect on biological activity.Proteins having substantially the same amino acid sequence as the reference molecule, but possessing minor amino acid substitutions that do not substantially affect the immunogenicity of the protein, are therefore within the definition of the reference polypeptide. All polypeptides produced by these modifications are included here. The term "conservative variation" also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid, provided that antibodies created for the substituted polypeptide also immunoreact with the unsubstituted polypeptide.

[0567]

[0166] As used herein, the term "derivative" or "variant" refers to a polypeptide, or a nucleic acid encoding a polypeptide, that has one or more conservative amino acid variations or other minor modifications, such that (1) the corresponding polypeptide has substantially equivalent function when compared with the wild-type polypeptide or (2) an antibody created against the polypeptide is immunoreactive with the wild-type polypeptide. These variants or derivatives include polypeptides with minor modifications of the amino acid polypeptide sequences that may result in peptides that have substantially equivalent activity compared with the unmodified homologous polypeptide. Such modifications may be deliberate, as by site-directed mutagenesis, or may be spontaneous.The term "variant" also includes deletions, additions, and substitutions to the sequence, provided that the polypeptide functions to produce an immune response as defined herein.

[0568]

[0167] The term "nucleic acid" and "polynucleotide" refers to RNA or DNA that is linear or branched, single-stranded or double-stranded, or a hybrid thereof. The term also encompasses RNA / DNA hybrids. The following are examples of non-limiting polynucleotides: a gene or gene fragment, exons, introns, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, DNA isolated from any sequence, RNA isolated from any sequence, nucleic acid probes, and primers. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracil, other sugars and linking groups, such as fluororibose and thiolate, and nucleotide branches. The nucleotide sequence may be further modified after polymerization, such as by conjugation, with a labeling component.Other types of modifications included in this definition are buffers, replacement of one or more naturally occurring nucleotides with an analog, and the introduction of means for attaching the polynucleotide to proteins, labeling components, other polynucleotides, or solid support. Polynucleotides can be obtained by chemical synthesis or derived from a microorganism.

[0569]

[0168] The term "gene" is used broadly to refer to any polynucleotide segment associated with a biological function. Thus, genes include introns and exons as in the genomic sequence, or just the c sequences, as in cDNA, and coding or regulatory sequences required for its expression. For example, a gene also refers to a nucleic acid fragment that expresses mRNA or functional RNA, or codes for a specific protein, and which includes regulatory sequences.

[0570]

[0169] In a first aspect, the present invention consists of a platform for obtaining non-replicating (conventional) messenger RNA (mRNA), comprising 5' UTR and 3' UTR regions of Venezuelan Equine Encephalitis Virus (VEEV), a short poly-A tail and at least one specific regulatory element.

[0571]

[0170] The term "regulatory element" is intended to include non-coding RNA regions, promoters, enhancers, and usual expression control elements of the technique.

[0572]

[0171] In one particular embodiment, regulatory elements may be the ORI sequence and the T7 RNA polymerase promoter.

[0573]

[0172] The approach of the present invention allows the "plug and play" framework of the mRNA acquisition platform to be maintained for different constructs, modifying only the gene that encodes the protein of interest.

[0574]

[0173] To this end, four proprietary plasmids were constructed that served as templates for obtaining mRNAs. These plasmids were named pBiol, pBio2, pBio3 and pBio1.

[0575]

[0174] Plasmid 1 (pBiol) requires two steps to obtain functional mRNA (transcription and capping), whereas the other plasmids (pBio2, pBio3 and pBio4) allow co-transcriptional capping, enabling mRNA to be obtained in a single step.

[0576]

[0175] The strategy adopted for all plasmids allows the gene of interest to be modified according to the interest and the disease in question, characterizing the invention platform in the "plug and play" concept.

[0577]

[0176] In a particular embodiment, the pBiol plasmid (SEQ ID NO: 1, Figure 1) was constructed, into which an origin of replication and an ampicillin antibiotic resistance gene were inserted, elements necessary to allow amplification of the template DNA in bacteria. To allow in vitro transcription of mRNA from the template DNA, the T7 RNA polymerase enzyme promoter was added. After the promoter region, the 5' UTR, 3' UTR and short poly-A tail regions were inserted. In addition, restriction sites for the following enzymes were inserted along the sequence: Xhol, Apal, Xbal, Nhel and EcoRI. The Xhol enzyme site allows linearization of the template plasmid, an important step to insert a stop signal for the T7 RNA polymerase enzyme, which is very processive.Sites for Apal, Xbal, Nhel, and EcoRI were inserted to flank the cloning region, making it possible to insert any gene of interest as well as to make changes to some elements of the plasmid, such as: promoter region, 5' UTR, 3' UTR, and short poly-A tail.

[0578]

[0177] The design of the 5' UTR and 3' UTR regions of the constructs presented here was based on the attenuated TC-83 strain of Venezuelan Equine Encephalitis Virus (VEEV). VEEV is a member of the genus Alphavirus, family Togaviridae, and its infection in mammals is characterized by high viremia, fever, and skin redness, which can result in severe encephalitis, neuronal disorders, and ultimately death.

[0579]

[0178] The choice of the 5' and 3' UTR regions of VEEV (TC-83) for the construction of the constructs of the present invention was due to the unique characteristics of these regulatory elements, which allow for the stabilization of mRNA and increased expression of the gene of interest. The 5' UTR region of VEEV plays an important role in promoter function, translation initiation, and prevention of innate immune mechanisms. The 3' UTR region of this virus has conserved binding regions for cellular proteins that influence RNA stability. Thus, it was observed that the 3' and 5' UTR regions have a strong interaction with other viral proteins that are translated by the VEEV (TC-83) genome as a whole.

[0580]

[0179] Therefore, it is important to emphasize that it is not reasonable to extrapolate the functions performed by the 3' and 5' UTR elements in replicating (non-conventional, self-amplifying) mRNAs to non-replicating (conventional) mRNAs, since the 3' and 5' UTR elements interact with viral factors in replicating RNA constructs, viral factors that are not present for interaction in non-replicating RNA constructs. In the case of replicating mRNAs, it is the replication of the replicative subgenomic RNA, due to the presence of the viral enzyme Replicase, that makes the translation of the protein of interest stable for a certain period, which is not true for a non-replicating RNA, where the stability of the RNA (using 3' and 5' UTR VEEV and short poly-A tail), the lipid nanoparticle delivery system, and the initial dose exert a great influence on its mode of action.

[0581]

[0180] The length of the poly-A tail is another important parameter for RNA design, as it influences transcript stability and plays a significant role in translation initiation. While some research groups believe that a longer poly-A sequence (150–200 nucleotides) is more effective in boosting translation, another perspective indicates that the most abundant proteins can be derived from transcripts with shorter poly-A tails (50–100 nucleotides). Therefore, adjustments to the poly-A tail length play an important role in optimizing mRNA translation efficiency.

[0582]

[0181] In a particular embodiment, from the platform of the present invention it is possible to obtain mRNA containing a poly-A tail of 30 to 80 adenine nucleotides. Preferably, a tail of at least 40 adenine nucleotides was used.

[0583]

[0182] The use of VEEV regulatory elements (TC-83) in the non-replicating (conventional) method together with a shorter poly-A tail contributes to the uniqueness of the invention, allowing increased mRNA stability, even when using the short poly-A tail, in addition to generating production advantages, since the short tail ensures greater ease in constructing plasmid banks and also ensures greater ease in achieving the tail size during product quality control, as well as abolishing the formation of abortive remnants during the in vitro transcription (IVT) reaction of RNA.

[0584]

[0183] In a particular embodiment, the present invention provides the pBio2 plasmid (SEQ ID NO: 2; Figure 2), which was constructed from the pBiol plasmid scaffold, allowing the maintenance of some basic structures, such as: origin of replication, antibiotic resistance gene, T7 RNA polymerase promoter, 5' UTR region, 3' UTR region, and short poly-A tail. Immediately after the promoter region, the AGG nucleotide sequence was added to allow co-transcriptional capping. Along the sequence, the following restriction sites were also inserted: Apal, Xhol, Nhel, BspQI, Xbal, and EcoRI. The BspQI enzyme site was used to allow linearization of the template plasmid without leaving any additional nucleotides after the short poly-A tail. The plasmid was digested to insert a stop signal for the T7 RNA polymerase enzyme.The sites for Apal, Xhol, Nhel, Xbal, and EcoRI were inserted to flank the cloning region, making it possible to insert any gene of interest or to make changes to regulatory elements.

[0585]

[0184] In a particular embodiment, the present invention provides the pBio3 plasmid (SEQ ID NO: 3; Figure 3), which was constructed from the pBio2 plasmid scaffold and therefore has all the regulatory elements and restriction sites described for its predecessor. Additionally, a gene segment (Strong Gyrase site - SGS) was introduced to increase the production of supercoiled plasmid DNA during bacterial culture. The objective of inserting the Strong Gyrase site is to increase the percentage of supercoiled plasmid required for mRNA production on an industrial scale.

[0586]

[0185] The high content of plasmids in their supercoiled form is important to ensure efficacy in various applications such as vaccines and gene therapy. Furthermore, it is important to highlight that the twists associated with the supercoiled form make the molecule more compact. This characteristic is potentially essential for downstream processing of the plasmid, since compaction is able to reduce sensitivity to shear force during centrifugation, pump flows, and filtration steps.

[0186] The catalytic activity of DNA gyrase involves binding to a specific DNA sequence and using ATP energy to introduce negative supercoiling in the molecule. Thus, identifying sequences that allow for the extension of the binding may contribute to increasing the rate at which DNA gyrase introduces twists for the formation of supercoiled DNA.Since the Mu bacteriophage gyrase binding sequence has been reported to be a high-affinity sequence, it has been incorporated into plasmids.

[0587]

[0187] In a particular embodiment, the present invention provides the pBio4 plasmid (SEQ ID NO: 4; Figure 4), which was constructed from the pBio3 plasmid scaffold. In addition to all the elements already described for the pBio3 plasmid, a gene segment was introduced to stabilize plasmid replication (cer sequence), thus allowing the resolution of multimers that affect the correct segregation of plasmid DNA to daughter cells.

[0588]

[0188] With respect to the cer promoter sequence, XerCD-mediated recombination in cer converts ColEl plasmid multimers into monomers, maximizing the number of independently segregating molecules and minimizing the frequency of plasmid loss.

[0589]

[0189] Segregational instability of plasmids with high copy numbers can result in the accumulation of multimers generated by homologous recombination. This reduces the number of plasmid molecules segregated independently during cell division, leading to an increased frequency of daughter cells lacking the plasmid of interest. In this context, the insertion of the cer sequence allows for site-specific recombination that converts plasmid dimers into monomers, restoring the correct segregation of plasmids in daughter cells and increasing the industrial productivity of the plasmid.

[0590]

[0190] In a particular embodiment, the plasmid scaffold containing regulatory sequences (5' UTR, 3' UTR of VEEV and short poly-A tail) of the present invention allows the insertion of different genes according to the applications of interest, not limited only to vaccines against infectious diseases, but also encompassing the production of therapeutic antibodies in vivo, enzyme replacement therapy in rare diseases or even gene editing, proving that the platform can be classified as "plug and play".

[0591]

[0191] In one particular embodiment, the plasmid framework further comprises an additional regulatory element for the gene of interest. The "additional regulatory element" is intended to include non-coding RNA regions, promoters, enhancers, targeting elements and expression control elements typical of the technique.

[0592]

[0192] In an even more particular embodiment, the additional regulatory element may be a kozak fragment and / or a signal peptide.

[0593]

[0193] In a particular embodiment, the protein of interest or a fragment thereof is preferably an antigen or a therapeutic protein or a fragment thereof. Furthermore, said antigen may be a viral, bacterial, parasitic, fungal, etc. antigen. Preferably, the antigen is viral and is selected from the group comprising a SARS-CoV-2 or Yellow Fever protein, such as a SARS-CoV-2 Spike protein or structural (pre-membrane, transmembrane protein C fragment and envelope) or non-structural (NS1) proteins of the yellow fever virus, and the therapeutic protein is preferably selected from the group comprising an anti-PD-1 antibody, such as the light and heavy chains of an anti-PD1 antibody or a fragment thereof.

[0594]

[0194] In a particular embodiment, the present invention is useful for (i) prevention of severe acute respiratory syndrome coronavirus (SARS-CoV-2) infections, (ii) prevention of yellow fever virus infections, and (iii) treatment of neoplasms sensitive to PD-1 / PD-L1 axis blockade.

[0595]

[0195] To this end, the nucleic acid sequences of an mRNA expression platform containing the genes encoding the SARS-CoV-2 Spike protein, the light and heavy chains of an anti-PD1 antibody, the structural (pre-membrane, transmembrane C protein fragment and envelope) and non-structural (NS1) proteins of the Yellow Fever vaccine virus and the respective non-replicating (conventional) messenger RNA constructs obtained are presented.

[0596]

[0196] At the end of 2021, the first variants of the optimized Omicron (BA. and BA. 1.1) emerged with more than 30 amino acid substitutions, deletions, or insertions in the SARS-CoV-2 Spike protein. Since then, the optimized Omicron variant has evolved with additional mutations, which facilitate the escape of neutralizing antibodies. These modifications in the Spike of the subvariants are associated with symptomatic infections in vaccinated and / or previously infected individuals. In this context, bivalent or updated vaccines represent a strategy to increase protection against currently circulating variants, as well as to broaden neutralization to previous variants and those that may still emerge.

[0597]

[0197] In a particular embodiment, the coding sequences of the SARS-CoV-2 Spike protein of the invention are selected from SEQ ID NO: 57, 68 and 69.

[0598]

[0198] In a particular embodiment, the coding sequences of the SARS-CoV-2 Spike protein of the invention are optimized in silico, on a case-by-case basis, considering various criteria of skill in the art and using routine techniques, which aimed to maximize mRNA expression, increase the chance of obtaining a functional and active protein, and minimize potential adverse effects. The optimizations performed include adjusting the %GC content; using codons for human hosts; removing RNase splicing sites; removing Cis elements; removing restriction enzyme sites; and removing repetitive elements.

[0599]

[0199] In a particular embodiment, the amino acid sequence encoded by the mRNA obtained in the present disclosure is encoded by a coding sequence that is codon-optimized and / or whose GC% content is increased by 40-60% compared to the wild-type coding sequence. This percentage is present in most mammalian genes and is associated with greater stability and transcription efficiency of mRNA in the cell. This increase in mRNA stability also contributes to its integrity during the vaccine manufacturing process, bringing production advantages as well. Furthermore, the persistence of stable mRNA within the cell increases its ability to be transcribed into the protein of interest, resulting in greater persistence and efficacy of the immune response and / or enabling a shorter interval between doses in the case of treatment.

[0600]

[0200] The term "codon optimization" refers to altering the codons in the coding region of a nucleic acid molecule to reflect the typical codon usage of a host organism without preferentially altering the amino acid sequence encoded by the nucleic acid molecule. In the context of the present disclosure, coding regions can be codon-optimized for optimal expression in humans, while taking into account other parameters that lead to mRNA stabilization at a given sequence. Codon optimization is based on the finding that translation efficiency is also determined by the different frequency of tRNA occurrence in cells. Thus, the mRNA sequence can be modified in such a way that codons for which frequently occurring tRNAs are available are inserted in place of "rare codons".

[0601]

[0201] In some embodiments, the guanosine / cytosine (GC%) content of the RNA coding region is increased compared to the GC% content of the corresponding wild-type RNA coding sequence, wherein the amino acid sequence encoded by the RNA is preferably unmodified compared to the amino acid sequence encoded by the wild-type RNA. This modification of the RNA sequence is based on the fact that the sequence of any RNA region to be translated is important for efficient translation of said RNA. Sequences with an increased G (guanosine) / C (cytosine) content are more stable than sequences with an increased A (adenosine) / U (uracil) content. In relation to the fact that several codons encode one and the same amino acid (degeneracy of the genetic code), the codons most favorable for stability can be determined (alternative codon usage).Depending on the amino acid to be encoded by the RNA, there are several possibilities for modifying the RNA sequence compared to its wild-type sequence. In particular, codons containing A and / or U nucleotides can be modified by replacing these codons with other codons that encode the same amino acids but do not contain A and / or U, or contain a lower proportion of A and / or U nucleotides.

[0602]

[0202] In some embodiments, the GC% content of a coding region of an mRNA described here is increased by at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, or more compared to the GC% content of the wild-type RNA coding region.

[0603]

[0203] In a particular embodiment, the GC% content of a coding region of an mRNA described herein is increased, in particular, by at least 40% to at least 60%.

[0604]

[0204] In one particular embodiment, preferred codons for the human host were also used to ensure efficient and accurate antigen translation. The choice of preferred human codons was made based on combined criteria. For example, the most frequent codon will not always be the one used. A less frequent codon that increases the GC percentage of the mRNA molecule and does not generate splicing sites may be chosen. In this sense, codon optimization will depend on the entire set, and the differences in optimizations are explained in the examples.

[0605]

[0205] Codon optimization for expression in mammals aims to increase the rate of protein synthesis and minimize the occurrence of translation errors, resulting in more efficient antigen production and, consequently, a more intense immune response.

[0606]

[0206] In one particular embodiment, to avoid mRNA degradation by endogenous RNases, sites in the mRNA sequence that promoted splicing from the activity of cellular RNase enzymes were identified and removed. This measure is crucial to preserve the integrity of the mRNA within the cell, preventing it from being degraded by these enzymes and ensuring greater efficiency in the translation of the protein of interest, increasing its effectiveness in vaccination or the duration of the therapeutic protein in the mammalian organism.

[0607]

[0207] In one particular embodiment, cis elements and repetitive elements that could interfere with protein translation or mRNA stability were removed from the sequences. Cis elements, as described in the state of the art, are encoded primarily in the mRNA itself and can affect its stability. Cis elements that affect mRNA stability include, but are not limited to: elements that affect the secondary structure of mRNA, sequence motifs present in the 3' UTR, including RNA protein binding sites and start and stop codons.

[0608]

[0208] In a particular embodiment, the catalytic sites of restriction enzymes were also altered in the mRNA sequences. In the case of the optimized sequences of the invention, these refer to the restriction enzyme sites Xbal [TCTAGA], Nhel [GCTAGC], BspQI [GCTCTCT], EcoRI [GAATTC], Xhol [CTCGAG], Apal [GGGCCC]. The exclusion of these undesirable elements contributes to the reduction of interferences, increases the stability of the secondary structure of the mRNA, consequently increasing the accuracy of the expression of the target antigen or protein.

[0609]

[0209] In particular, the optimized coding sequences of the SARS-CoV-2 Spike protein of the invention may be selected from SEQ ID NO: 58 to 60.

[0610]

[0210] Regarding the Yellow Fever virus, after entering the cell and uncoating, the yellow fever virus RNA is transported to the endoplasmic reticulum and translated into a single precursor polyprotein. This polyprotein is post-translationally modified by cellular glycosyltransferases, and the release of 10 mature viral proteins is mediated by viral and host cell proteases. The processed polyprotein produces 3 structural proteins (C, prM, and E), which comprise the virion, and 7 non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5), which are involved in viral RNA replication in the endoplasmic reticulum membranes. The envelope protein (E) is the main protein exposed on the surface of mature particles, being the main target for inducing protective humoral immunity. Neutralizing activity has also been reported for antibodies against the prM protein.Furthermore, the non-structural protein NS1 also plays an important role in protective immunity through antibody-mediated cellular cytotoxicity.

[0611]

[0211] In a particular embodiment, the nucleic acid sequences encoding the Yellow Fever proteins of the invention are selected from SEQ ID NO: 61 to 64.

[0612]

[0212] In a particular embodiment, the coding sequences of the Yellow Fever proteins of the invention are optimized in silico. The optimizations include adjusting the %GC content; using codons for human hosts; removing RNase splicing sites; removing Cis elements; restriction enzyme sites and removing repetitive elements. The aforementioned optimized coding sequences are selected from SEQ ID NO: 74 to 77.

[0613]

[0213] In terms of using mRNA as therapy, it is worth knowing that tumor cells acquire various mechanisms to escape host immunity in the tumor microenvironment. During the last two decades, several studies on cancer immune escape have revealed that one of the most important components of the mechanism involved is an immunosuppressive co-signal mediated by the PD-1 / PD-L1 interaction.

[0614]

[0214] The PD-1 receptor is a representative immunosuppressive checkpoint, expressed primarily on activated T and B cells, serving as a regulator that controls extreme and inappropriate immune responses. The inhibitory signals of the PD-1 receptor are activated by interaction with the ligands PD-L1 and PD-L2, which belong to the B7 family.

[0215] Cancer immunotherapy using monoclonal antibodies against immune checkpoint proteins, including PD-1 and its ligand PD-L1, has demonstrated unprecedented therapeutic benefits and brought a major advance in oncology, helping to obtain durable long-term responses in a subset of patients with various types of advanced cancer.

[0615]

[0216] In a particular embodiment, the nucleic acid sequences encoding the Anti-PD-1 antibody of the invention are selected from SEQ ID NO: 70 and 71.

[0616]

[0217] In a particular embodiment, the coding sequences of the Anti-PD-1 antibody of the invention are optimized in silico. The optimizations include adjusting the %GC content; using codons for human hosts; removing RNase splice sites; removing Cis elements; restriction enzyme sites and removing repetitive elements. In particular, the aforementioned optimized coding sequences can be selected from SEQ ID NO: 65 and 66.

[0617]

[0218] In a particular embodiment, the nucleic acid sequence relating to the mRNA expression platform containing a coding sequence is selected from among the SEQ ID NO: 20, 21, 23 to 32, 34 to 42, 44 to 52 and 88 to 111.

[0618]

[0219] In a second aspect, the present invention provides a nucleic acid sequence comprising a coding region for a protein of interest or a fragment thereof operationally linked to the 5' UTR and 3' UTR regions of Venezuelan Equine Encephalitis Virus (VEEV) and a short poly-A tail.

[0220] In a particular embodiment, the short poly-A tail has about 30 to 80 adenine nucleotides, preferably the poly-A tail has 40 adenine nucleotides.

[0619]

[0221] In one particular embodiment, the nucleic acid sequence further comprises an additional regulatory element for the gene of interest. The "additional regulatory element" is intended to include non-coding RNA regions, promoters, enhancers, targeting elements and expression control elements typical of the technique.

[0620]

[0222] In an even more particular embodiment, the additional regulatory element may be a kozak fragment and / or a signal peptide.

[0621]

[0223] In a particular embodiment, the protein of interest or a fragment thereof is an antigen or a therapeutic protein. Preferably, the antigen is viral and is a protein of SARS-CoV-2 or Yellow Fever, such as a SARS-CoV-2 Spike protein or structural (pre-membrane, transmembrane protein C fragment and envelope) or non-structural (NS1) proteins of the yellow fever virus, and the therapeutic protein is an anti-PD-1 antibody, such as the light and heavy chains of an anti-PD1 antibody or fragments thereof.

[0622]

[0224] In a particular embodiment, the SARS-CoV-2 nucleic acids of the invention are messenger RNAs containing genes encoding a SARS-CoV-2 Spike protein selected from SEQ ID NO: 7, 8, 112 and 113.

[0623]

[0225] In a particular embodiment, the nucleic acids of the invention are messenger RNAs containing genes optimized in silico that encode a SARS-CoV-2 Spike protein. The optimizations include adjusting the %GC content; using codons for human hosts; removing RNase splice sites; removing Cis elements; removing restriction enzyme sites; and removing repetitive elements. The nucleic acids containing the aforementioned optimized genes are selected from SEQ ID NO: 9 to 12.

[0624]

[0226] In a particular embodiment, the Yellow Fever nucleic acids of the invention are mRNAs containing genes encoding a Yellow Fever protein selected from SEQ ID NO: 82 to 85.

[0625]

[0227] In a particular embodiment, the nucleic acids of the invention are messenger RNAs containing genes optimized in silico that encode a Yellow Fever protein. The optimizations include adjusting the %GC content; using codons for human hosts; removing RNase splice sites; removing Cis elements; removing restriction enzyme sites; and removing repetitive elements. The aforementioned optimized nucleic acids are selected from SEQ ID NO: 13 to 16.

[0626]

[0228] In a particular embodiment, the nucleic acids of the Anti-PD-1 antibody invention are mRNAs encoding the Anti-PD-1 antibody selected from SEQ ID NO: 86 and 87.

[0627]

[0229] In a particular embodiment, the nucleic acids of the invention encoding an Anti-PD-1 antibody are messenger RNAs containing genes optimized in silico that encode an Anti-PD-1 antibody. The optimizations include adjusting the %GC content; using codons for human hosts; removing RNase splice sites; removing Cis elements; removing restriction enzyme sites; and removing repetitive elements. The aforementioned optimized nucleic acids are selected from SEQ ID NO: 17 and 18.

[0628]

[0230] The present invention further discloses below the sequences of non-optimized mRNAs (nucleic acids) in the absence of the poly-A tail and the 5' UTR and 3' UTR segments of VEEV, which may help visualize the differences resulting from the optimization provided by the present invention:

[0629] - Luciferase mRNA, represented by SEQ ID NO: 56; - Delta variant Spike mRNA, represented by SEQ ID NO: 53;

[0630] - Spike mRNA variant omicron BA4 / BA5, represented by SEQ ID NO: 54;

[0631] - Omicron variant Spike mRNA XBB, represented by SEQ ID NO: 55;

[0632] - Yellow Fever mRNA 1, represented by SEQ ID NO: 78;

[0633] - Yellow Fever 2 mRNA, represented by SEQ ID NO: 79;

[0634] - Yellow Fever mRNA 3, represented by SEQ ID NO: 80;

[0635] - Yellow Fever mRNA 4, represented by SEQ ID NO: 81;

[0636] - Anti-PD-1 Heavy Chain mRNA, represented by SEQ ID NO: 72;

[0637] - Anti-PD-1 light chain mRNA, represented by SEQ ID NO: 73.

[0638]

[0231] In a further particular embodiment, the mRNA sequences have the substitution of at least one modified nucleoside. In particular, the uridine nucleosides of the mRNA sequences of the invention are modified with n-methyl pseudouridines (mli]i or pseudouridines (W) or 5-methoxyuridine (mo5U) or 2-thiouridine (s2U) or 5-methylcytidine (m5C) or N6-methyladenosine (m6A). In particular, the mRNA sequences of the invention are modified with pseudouridines (W) or n-methyl pseudouridines (mli]i), more preferably, the mRNA sequences of the invention have had their uridines completely replaced by pseudouridines (W).

[0639]

[0232] The mRNA sequences of the present invention can be obtained by applying routine and usual methods of expansion, transcription and purification of the art on the platform of the invention.

[0640]

[0233] In a third aspect, nanolipid pharmaceutical compositions containing the nucleic acid (mRNA) sequences of the invention are also presented. The mRNAs obtained from the different versions of the pBio plasmid were encapsulated in lipid nanoparticles containing phospholipid, sterol, ionizable or cationic lipid, as well as a pegylated lipid, with positive results to date, with proportions different from those that have been used.

[0641]

[0234] RNA molecules are highly unstable and can be rapidly degraded by extracellular ribonucleases, which are present in blood and skin, making mRNA delivery to cells a challenge. Within this context, lipid nanoparticles play an essential role in protecting and carrying the mRNA molecule, allowing for its intact delivery to cells.

[0642]

[0235] The lipid nanoparticles developed in the present invention are formed by mRNAs and lipid solutions consisting of structural lipids (between 10 and 75%), sterols (between 10 and 60%), cationic or ionizable lipids (between 5.0 and 60%) and pegylated lipids (between 1.0 and 5.0%).

[0643]

[0236] In particular, lipid solutions contain structural lipids (between 10 and 45%), sterols (between 10 and 60%), cationic or ionizable lipids (between 35 and 60%) and pegylated lipids (between 1.0 and 5.0%).

[0644]

[0237] Structural lipids or auxiliary lipids can also be referred to as neutral lipids, non-cationic lipids, non-cationic auxiliary lipids, neutral auxiliary lipids, anionic lipids. Structural lipids are used to reduce the cytotoxic effects of cationic lipids, allowing entry and intracellular delivery. For example, most studies use 1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (DOPO), Di-oleoyl-phosphatidyl-ethanolamine (DOPE) and 1,2-diestearoyl-sn-glycero-3-phosphocholine (DSPC) as auxiliary lipids, the latter being considered more fusogenic, i.e., facilitating entry / fusion into cells, promoting the transition from the lamellar phase to a hexagonal phase, inducing fusion and rupture of the cell membrane. Other examples of non-cationic auxiliary lipids include other phospholipids such as: lecithin, phosphatidylethanolamine, lysolecithin, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol,esf ingomielina, esf ingomielina de ovo (ESM), cefalina, cardiolipina, ácido fosfatidico, cerebrosideos, dicetilfosf ato, dipalmitoilfosf atidilcolina (DPPC), dioleoilfosf atidilglicerol (DOPG), dipalmitoilfosf atidilglicerol (DPPG), palmitoiloleoil-fosf atidilcolina (POPC), palmitoiloleoil-fosf atidiletanolamina (POPE), palmitoiloleol-fosf atidilglicerol (POPG), dioleoilfosf atidiletanolamina 4- (N-maleimidometil ) -ciclohexano-l-carboxilato (DOPE-mal), dipalmitoil-fosf atidiletanolamina (DPPE), dimiristoil-fosf atidiletanolamina (DMPE), distearoil-fosf atidiletanolamina (DSPE), monometil-f osf atidil etanolamina, dimetil-fosf atidiletanolamina, dielaidoil-fosf atidiletanolamina (DEPE), estearoiloleoil-fosf atidiletanolamina (SOPE), lisofosf atidilcolina, dilinoleoilfosf atidilcolina,and the possible mixtures and compositions thereof. Other types of phospholipids such as diacylphosphate ethylcholine and diacylphosphate ethylethanolamine can be used. The acyl groups of lipids are generally derived from fatty acids containing C10-C24 carbon chains, such as lauroyl, myristoyl, palmitoyl, stearoyl or oleoyl. Sterols can be, for example, cholesterol and its derivatives.

[0645]

[0238] As an auxiliary lipid, cholesterol increases the space between the charges of a lipid membrane by intercalating with nucleic acid, which allows for better charge distribution between the membrane and nucleic acid. Other examples of cholesterol derivatives include polar analogs such as: 5α-cholestanol, 5α-coprostanol, cholestyl-(2'-hydroxy)-ethyl ether, cholestyl-(4'-hydroxy)-butyl ether, and 6-ketocholestanol; or non-polar analogs such as: 5α-cholestano, cholestenone, 5α-cholestanone, 5α-cholestanone, and cholestyl decanoate; in addition to possible mixtures / associations between them.

[0646]

[0239] Cationic or ionizable lipids can be, for example, Nl- [ 2- ( ( IS ) -1- [ ( 3-aminopropyl ) amino ] -4- [di ( 3 -amino -prop 11 ) amino] but yl carboxamide ) ethyl] -3, 4- di [oleyloxy ] -benzamide (MVL5); N-(4-carboxybenzyl)-N,N-dimethyl-2,3-bis(oleoyloxy)propan-1-ammonium (DOBAQ), 2-hexyldecanoic acid, 1,1'-[[(4-hydroxybutyl)imino]di-6,1-hexanediyl] ester or ((4-hydroxybutyl)azanodiyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), 1,2-dioleoyltrimethylammoniumpropane chloride (DOTAP) (also known as N-(2,3-dioleoyloxy)propyl)-N,N- N-trimethylammonium and 1,2-dioleyloxy-3-trimethylaminopropane chloride salt), 1,2-di-O-octadecenyl-3-trimethylammonium propane chloride (DOTMA),

[0647] N, N-dimethyl-2, 3-dioleyloxy ) propylamine (DODMA), 1, 2-dilinoleyloxy-N, N-dimethylaminopropane (DLinDMA), 1, 2- Dilinoleyloxy-N, N-dimethylaminopropane (DLenDMA), 1, 2- di-i-linoleyloxy-N, N-dimethylaminopropane (g-DLenDMA), 1, 2- Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1. 2-Dilinoleoyloxy-3-(dimethylamino) acetoxypropane (DLin-DAC), 1. 2-Dilinoleoyloxy-3-morpholinopropane (DLin-MA), 1, 2- Dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1, 2- Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1- Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DL in- 2- DMAP), 1, 2-dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA. Cl), 1, 2- dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TAP. Cl), 1, 2- Dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N, N-Dilinoleylamino)-1, 2-propanediol (DLinAP), 3-(N, N-Dioleylamino)-1, 2-propanediol (DOAP), l, 2 -Dilinoleyloxy-3-(2-N, N-dimethylamino)ethoxypropane (DLin-EG-DMA), 2,2- Dilinoleyl-4-dimethylaminomethyl- [ 1, 3 ] -dioxolano ( DLin-K-DMA) or its analogues, ( 3aR, 5s, 6aS ) -N, N-dimethyl-2, 2-di ( ( 9Z, 12 Z ) -octadeca- 9, 12-dienyl tetrahydro-3aH-cyclopenta [ d] [ 1, 3 ] dioxol-5-amine, ( 6Z, 9Z, 28 Z, 31 Z ) -heptatriaconta- 6, 9, 28, 3, 1-tetraenta- 19-114- ( lamino dime ) but anoa to ( 1 - 1 - MC ), ( 1 - 1 - MC ( 2- ( ( 2- (bis ( 2-hydroxydodecyl ) amino ) ethyl ) ( 2-hydroxydodecyl ) amino ) ethyl ) piperazin- l-yl ) ethylazanodiyl ) didodecano-2-ol ( Cl -dioxolane ( DLin-K-C2-DMA), 2, 2-dilinoleyl-4-dimethylaminomethyl- [ 1, 3 ] -dioxolane ( DLin-K-DMA), ( 6Z, 9Z, 28 Z, 31 Z ) -heptatriaconta- 6, 9, 28, 1-1-4-1-9 dimethylamino ) butanoate ( DLin-M-C3-DMA), 3- ( ( 6Z, 9Z, 28 Z, 31 Z ) -heptatriaconta- 6, 9, 28, 31-tetraen- 19-yloxy ) -N, N-dimethylpropane-l-amine (MC3 - Ethera, 6 Z, Z 31 Z ) -heptatriaconta- 6, 9, 28, 31-tetraen- 19-yloxy ) -N,N-dimethylbutan-1-amine (MC4 ether), or any combination thereof. Other cationic lipids can also be used, but are not limited to these: N,N-distearyl-N,N-dimethylammonium bromide (DDAB), 3P-(N-(N',N'-dimethylaminoethanol)-carbarnoyl)cholesterol (DC-Choi), 2,3-dioleyloxy-N-[2-(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanamino chloride (DOSPA), dioctadecylamidoglycyl carboxyspermine (DOGS), 1,2-dileoyl-sn-3-phosphoethanolamine (DOPE), 1,2-dioleoyl-3-dimethylammonium propane (DODAP), N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium bromide (DMRIE) hexyl]amino}octanoate and 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxo 1ano (XTC), Certest-A, Certest-B and JK-102-CA.,

[0648]

[0240] In addition, commercial solutions of cationic lipids can be used such as: LIPOFECTIN (including DOTMA and DOPE, available from GIBCO / BRL), Lipof ectamine (including DOSPA and DOPE, available from GIBCO / BRL) and Mirus Bio™ TransIT™-CHO Transfection Kit, available from Fisher Scientific.

[0649]

[0241] Pegylated lipids may be, but are not limited to, for example, DSPE-PEG (1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)-2000]), PEG coupled to dialkyloxypropyls (PEG-DAA), PEG coupled to diacylglycerol (PEG-DAG), methoxypolyethylene glycol (PEG-DMG or PEG2000-DMG), PEG coupled to phospholipids such as phosphatidylethanolamine (PEG-PE), PEG conjugated to ceramides, PEG conjugated to cholesterol or derivatives, and combinations thereof in formulations. PEG is a linear, water-soluble ethylene polymer with repeating units with two terminal hydroxyl groups; PEGs are classified according to molecular weight. PEG molecules or PEG-conjugated lipids comprise a large a range of molecular weights from 550 daltons to 10,000 daltons, or from 750 daltons to 5,000 daltons, including molecular weights of 2,000 daltons.The molecular weight used may be within any of these values ​​or subvalues ​​within the range, including the endpoints. Examples include: monomethoxypolyethylene glycol (MePEG-OH), monomethoxypolyethylene glycol succinate (MePEG-S), succinimidyl monomethoxypolyethylene glycol succinate (MePEG-S-NHS), monomethoxypolyethylene glycol-amine (MePEG-NH2), monomethoxypolyethylene glycol tresylate (MePEG-TRES), monomethoxypolyethylene glycol-imidazolyl-carbonyl (MePEG-IM), as well as other compounds containing the terminal hydroxyl group instead of a terminal methoxy group (e.g., HO-PEG-S, HO-PEG-S-NHS, HO-PEG-NH2), α-[2-(ditetradecylamino)-2-oxoethyl]-γ-methoxy-poly(oxy-1,2-ethanediyl) (ALC-0159). In certain aspects, PEG can be replaced by alkyl, alkoxy, acyl, or aryl groups. PEG can be directly conjugated to the lipid or linked to the lipid through a linker molecule.

[0650]

[0242] As used in this document, a "ligand" or "spacer" is a link, molecule, or group of molecules that links two separate entities into one another. Ligands and spacers can provide ideal spacing between two entities and can also provide a labile link that allows two entities to be separated from each other. Labile linkages include photocleavable groups, acid-labile moieties, base-labile moieties, and enzyme-cleavable groups.

[0651]

[0243] Suitable linker molecules for the present invention that can be used to couple a PEG to lipids are: non-ester linker moieties and ester-containing linker moieties. Examples include, but are not limited to, linker molecules of the non-ester linker moiety type: starch (-C(O)NH-), amino (-NR-), carbonyl (-C(O)-), carbamate (-NHC(O)O-), urea (-NHC(O)NH-), disulfide (-SS-), ether (-O-), succinyl (-(O)CCH2CH2C(O)-), succinamidyl (-NHC(O)CH2CH2C(O)NH-), ether, as well as possible combinations thereof (e.g., a linker containing both carbamate and starch molecules). In some studies, an ester coupled to a linker molecule can be used to couple PEG to the lipid. Examples of ester-containing linker moieties include, but are not limited to, carbonate (-OC(O)O-), succinoyl, phosphate esters (-O-(O)POH-O-), sulfonate esters, and combinations thereof.Phosphatidylethanolamines possess a variety of acyl group chain lengths and degrees of saturation that can be conjugated with PEG to form the lipid conjugate. Such phosphatidylethanolamines are commercially available or can be isolated or synthesized using conventional techniques known to those skilled in the art. Phosphatidylethanolamines containing saturated or unsaturated fatty acids with carbon chain lengths in the range of C10 to C20 are preferred. Phosphatidylethanolamines with mono- or di-unsaturated fatty acids and mixtures of saturated and unsaturated fatty acids can also be used. Suitable phosphate-ethyl ethanolamines include, but are not limited to, dimyristoyl-phosphate-ethyl ethanolamine (DMPE), dipalmitoyl-phosphate-ethyl ethanolamine (DPPE), dioleoyl-phosphate-ethyl ethanolamine (DOPE), and distearoyl-phosphate-ethyl ethanolamine (DSPE).In some respects, PEG-DAA conjugates are PEG-didecyloxypropyl (CI) conjugates, PEG-dilauryloxypropyl (C12) conjugates, PEG-dimyristyloxypropyl (C14) conjugates, PEG-dipalmethyloxypropyl (C16) conjugates, or PEG-distearyloxypropyl (C18) conjugates. In addition to the above, other hydrophilic polymers can be used as substitutes for PEG. Examples of suitable polymers that can be used in place of PEG include, but are not limited to, polyvinylpyrrolidone, polymethyloxazoline, polyethyloxazoline, polyhydroxypropyl, methacrylamide, polymethacrylamide and polydimethylacrylamide, polylactic acid, polyglycolic acid, and cellulose derivatives such as hydroxymethylcellulose or hydroxyethylcellulose.

[0652]

[0244] In a preferred embodiment, the nanolipid pharmaceutical compositions of the present invention comprise said nanoparticles stabilized in Tris-HCl buffer of 50 to 200 mM, pH 7.0 to 7.4 and further comprise preservatives / stabilizers. An acceptable preservative or stabilizer is any preservative or stabilizer known in the art for use in nanoparticles. Not limited to, suitable preservatives or stabilizers for use in the invention are: trehalose, sucrose, arginine, sorbitol, glycerol, proline or mannitol. The preservatives / stabilizers are present in a concentration range of about 0 to 35% (w / v), preferably 2 to 35% (w / v), more preferably 10% (w / v), but not limited to these.

[0653]

[0245] In a preferred embodiment, but not limited to, the nanolipid pharmaceutical compositions of the present invention comprise said nanoparticles stabilized in 100mM Tris-HCl buffer, pH 7.4, and further comprise 10% (w / v) sucrose.

[0246] Non-limiting examples of lipid solutions comprising the lipid nanoparticles of the present invention may be found in Table 1.

[0654] Table 1: Lipid composition and molar ratio of lipid nanoparticle formulations.

[0655] Lipids

[0656] Cationic lipids

[0657] Sterol Structural lipids or

[0658] Formulation (ratio pegylated (ratio ionizable

[0659] molar) (molar ratio) molar) / (ratio

[0660] molar)

[0661] DSPC CHOLESTEROL DODMA ( 35— DMG-PEG ( 2000 ) A

[0662] ( 10-45 ) ( 10- 60 ) 60 ) ( 1-5 )

[0663] DSPC CHOLESTEROL DLIN-KC2- DMG-PEG ( 2000 ) B

[0664] (10-45) (-10-60) DMA (35-60) (1-5)

[0665] DSPC CHOLESTEROL D-LIN-MC3- DMG-PEG ( 2000 ) C

[0666] (10-45) (10-60) DMA (35-60) (1-5)

[0667] DSPC CHOLESTEROL ALC- 0315 DMG-PEG ( 2000 ) D

[0668] ( 10-45 ) ( 10-60 ) ( 35-60 ) ( 1-5 )

[0669] DSPC CHOLESTEROL DOTAP ( 35— DMG-PEG ( 2000 ) E

[0670] ( 10-45 ) ( 10-60 ) 60 ) ( 1-5 )

[0671] DSPC CHOLESTEROL DOBAQ ( 35— DMG-PEG ( 2000 ) F

[0672] ( 10-45 ) ( 10-60 ) 60 ) ( 1-5 )

[0673] DSPC CHOLESTEROL BP-LIPID- DMG-PEG ( 2000 ) G

[0674] ( 10-45 ) ( 10-60 ) 103 ( 35-60 ) ( 1-5 )

[0675] DSPC CHOLESTEROL LP- 01 ( 35— DMG-PEG ( 2000 ) H

[0676] ( 10-45 ) ( 10-60 ) 60 ) ( 1-5 )

[0677] DSPC CHOLESTEROL BP-LIPID- DMG-PEG ( 2000 ) I

[0678] ( 10-45 ) ( 10-60 ) 217 ​​( 35-60 ) ( 1-5 )

[0679]

[0680] DSPE- DSPC CHOLESTEROL DODMA ( 35—

[0681] J PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) 60 )

[0682] 5 )

[0683] DSPE- DSPC CHOLESTEROL DLIN-KC2 - K PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) DMA ( 35- 60 )

[0684] 5 )

[0685] DSPE- DSPC CHOLESTEROL D-LIN-MC3- L PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) DMA ( 35- 60 )

[0686] 5 )

[0687] DSPE- DSPC CHOLESTEROL ALC- 0315

[0688] M PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) ( 35- 60 )

[0689] 5 )

[0690] DSPE- DSPC CHOLESTEROL DOTAP ( 35—

[0691] N PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) 60 )

[0692] 5 )

[0693] DSPE- DSPC CHOLESTEROL DOBAQ ( 35—

[0694] 0 PEG (2000) (1 - (10-45) (10-60) 60)

[0695] 5 )

[0696] DSPE- DSPC CHOLESTEROL BP-LI PID- P PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) 103 ( 35- 60 )

[0697] 5 )

[0698] DSPE- DSPC CHOLESTEROL LP- 01 ( 35—

[0699] Q PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) 60 )

[0700] 5 )

[0701] DSPE- DSPC CHOLESTEROL BP-LI PID- R PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) 217 ​​( 35- 60 )

[0702] 5 )

[0703] DSPC CHOLESTEROL DODMA ( 35— ALC- 0159 S

[0704] ( 10- 45 ) ( 10- 60 ) 60 ) ( 1 - 5 )

[0705]

[0706] DSPC CHOLESTEROL DLIN-KC2 - ALC- 0159 T

[0707] (10-45) (10-60) DMA (35-60) (1-5)

[0708] DSPC CHOLESTEROL D-LIN-MC3- ALC- 0159 U

[0709] (10-45) (10-60) DMA (35-60) (1-5)

[0710] DSPC CHOLESTEROL ALC- 0315 ALC- 0159 V

[0711] ( 10- 45 ) ( 10- 60 ) ( 35- 60 ) ( 1 - 5 )

[0712] DSPC CHOLESTEROL DOTAP ( 35— ALC- 0159 W

[0713] ( 10- 45 ) ( 10- 60 ) 60 ) ( 1 - 5 )

[0714] DSPC CHOLESTEROL DOBAQ ( 35— ALC- 0159 X

[0715] ( 10- 45 ) ( 10- 60 ) 60 ) ( 1 - 5 )

[0716] DSPC CHOLESTEROL BP-LI PID- ALC- 0159 Y

[0717] ( 10- 45 ) ( 10- 60 ) 103 ( 35- 60 ) ( 1 - 5 )

[0718] DSPC COLESTEROL LP- 01 ( 35— ALC- 0159 Z

[0719] ( 10- 45 ) ( 10- 60 ) 60 ) ( 1 - 5 )

[0720] DSPC CHOLESTEROL BP-LI PID- ALC- 0159 AA

[0721] ( 10- 45 ) ( 10- 60 ) 217 ​​( 35- 60 ) ( 1 - 5 )

[0722] DSPE CHOLESTEROL DODMA ( 35— DMG-PEG ( 2000 ) AB

[0723] ( 10- 45 ) ( 10- 60 ) 60 ) ( 1 - 5 )

[0724] DSPE CHOLESTEROL DLIN-KC2 - DMG-PEG ( 2000 ) AC

[0725] ( 10- 45 ) ( 10- 60 ) DMA ( 35- 60 ) ( 1 - 5 )

[0726] DSPE COLESTEROL D-LIN-MC3- DMG-PEG ( 2000 ) AD

[0727] ( 10- 45 ) ( 10- 60 ) DMA ( 35- 60 ) ( 1 - 5 )

[0728] DSPE COLESTEROL ALC- 0315 DMG-PEG ( 2000 ) AE

[0729] ( 10- 45 ) ( 10- 60 ) ( 35- 60 ) ( 1 - 5 )

[0730] DSPE COLESTEROL DOTAP ( 35— DMG-PEG ( 2000 ) AF

[0731] ( 10- 45 ) ( 10- 60 ) 60 ) ( 1 - 5 )

[0732] DSPE COLESTEROL DOBAQ ( 35— DMG-PEG ( 2000 ) AG

[0733] ( 10- 45 ) ( 10- 60 ) 60 ) ( 1 - 5 )

[0734]

[0735] DSPE COLESTEROL BP-LI PID- DMG-PEG ( 2000 ) AH

[0736] ( 10- 45 ) ( 10- 60 ) 103 ( 35- 60 ) ( 1 - 5 )

[0737] DSPE COLESTEROL LP- 01 ( 35— DMG-PEG ( 2000 ) AI

[0738] ( 10- 45 ) ( 10- 60 ) 60 ) ( 1 - 5 )

[0739] DSPE COLESTEROL BP-LI PID- DMG-PEG ( 2000 ) AJ

[0740] ( 10- 45 ) ( 10- 60 ) 217 ​​( 35- 60 ) ( 1 - 5 )

[0741] DSPE- DSPE CHOLESTEROL DODMA ( 35—

[0742] AK PEG (2000) (1 - (10- 45) (10- 60) 60)

[0743] 5)

[0744] DSPE- DSPE CHOLESTEROL DLIN-KC2 - AL PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) DMA ( 35- 60 )

[0745] 5)

[0746] DSPE DSPE CHOLESTEROL D-LIN-MC3- AM PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) DMA ( 35- 60 )

[0747] 5)

[0748] DSPE- DSPE CHOLESTEROL ALC- 0315

[0749] AN PEG (2000) (1 - (10- 45) (10- 60) (35- 60)

[0750] 5)

[0751] DSPE DSPE CHOLESTEROL DOTAP ( 35—

[0752] AO PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) 60 )

[0753] 5)

[0754] DSPE DSPE CHOLESTEROL DOBAQ ( 35—

[0755] AP PEG (2000) (1 - (10-45) (10-60) 60)

[0756] 5)

[0757] DSPE DSPE CHOLESTEROL BP-LI PID- AQ PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) 103 ( 35- 60 )

[0758] 5)

[0759]

[0760] DSPE

[0761] DSPE CHOLESTEROL LP- 01 ( 35—

[0762] AR PEG (2000) (1 - (10- 45) (10- 60) 60)

[0763] 5)

[0764] DSPE DSPE CHOLESTEROL BP-LI PID- AS PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) 217 ​​( 35- 60 )

[0765] 5 ) CHOLESTEROL DODMA ( 35 — ALC- 0159 AT DSPE ( 10- 45 )

[0766] ( 10- 60 ) 60 ) ( 1 - 5 ) CHOLESTEROL DLIN-KC2 - ALC- 0159 AU DSPE ( 10- 45 )

[0767] (10-60) DMA (35-60) (1-5)

[0768] DSPE CHOLESTEROL D-LIN-MC3- ALC- 0159 AV

[0769] ( 10- 45 ) ( 10- 60 ) DMA ( 35- 60 ) ( 1 - 5 )

[0770] DSPE CHOLESTEROL ALC- 0315 ALC- 0159 AW

[0771] ( 10- 45 ) ( 10- 60 ) ( 35- 60 ) ( 1 - 5 )

[0772] DSPE COLESTEROL DOTAP ( 35— ALC- 0159 AX

[0773] ( 10- 45 ) ( 10- 60 ) 60 ) ( 1 - 5 )

[0774] DSPE COLESTEROL DOBAQ ( 35— ALC- 0159 AY

[0775] ( 10- 45 ) ( 10- 60 ) 60 ) ( 1 - 5 )

[0776] DSPE COLESTEROL BP-LI PID- ALC- 0159 AZ

[0777] ( 10- 45 ) ( 10- 60 ) 103 ( 35- 60 ) ( 1 - 5 )

[0778] DSPE COLESTEROL LP-01 ( 35— ALC-0159 BA

[0779] ( 10- 45 ) ( 10- 60 ) 60 ) ( 1 - 5 )

[0780] DSPE COLESTEROL BP-LI PID- ALC- 0159 BB

[0781] ( 10- 45 ) ( 10- 60 ) 217 ​​( 35- 60 ) ( 1 - 5 )

[0782] DOPE COLESTEROL DODMA ( 35— DMG-PEG ( 2000 ) BC

[0783] ( 10- 45 ) ( 10- 60 ) 60 ) ( 1 - 5 )

[0784] DOPE COLESTEROL DLIN-KC2 - DMG-PEG ( 2000 ) BD

[0785] (10-45) (10-60) DMA (35-60) (1-5)

[0786]

[0787] DOPE COLESTEROL D-LIN-MC3- DMG-PEG ( 2000 ) BE

[0788] ( 10- 45 ) ( 10- 60 ) DMA ( 35- 60 ) ( 1 - 5 )

[0789] DOPE COLESTEROL ALC- 0315 DMG-PEG ( 2000 ) BE

[0790] ( 10- 45 ) ( 10- 60 ) ( 35- 60 ) ( 1 - 5 )

[0791] DOPE COLESTEROL DOTAP ( 35— DMG-PEG ( 2000 ) BG

[0792] ( 10- 45 ) ( 10- 60 ) 60 ) ( 1 - 5 )

[0793] DOPE COLESTEROL DOBAQ ( 35— DMG-PEG ( 2000 ) BH

[0794] ( 10- 45 ) ( 10- 60 ) 60 ) ( 1 - 5 )

[0795] DOPE COLESTEROL BP-LI PID- DMG-PEG ( 2000 ) BI

[0796] ( 10- 45 ) ( 10- 60 ) 103 ( 35- 60 ) ( 1 - 5 )

[0797] DOPE COLESTEROL LP- 01 ( 35— DMG-PEG ( 2000 ) BJ

[0798] ( 10- 45 ) ( 10- 60 ) 60 ) ( 1 - 5 )

[0799] DOPE COLESTEROL BP-LI PID- DMG-PEG ( 2000 ) BK

[0800] ( 10- 45 ) ( 10- 60 ) 217 ( 35- 60 ) ( 1 - 5 )

[0801] DSPE- DOPE COLESTEROL DODMA ( 35—

[0802] BL PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) 60 )

[0803] 5 )

[0804] DSPE- DOPE COLESTEROL DLIN-KC2 - BM PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) DMA ( 35- 60 )

[0805] 5 )

[0806] DSPE- DOPE COLESTEROL D-LIN-MC3- BN PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) DMA ( 35- 60 )

[0807] 5 )

[0808] DSPE- DOPE COLESTEROL ALC- 0315

[0809] BO PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) ( 35- 60 )

[0810] 5 )

[0811] DSPE- DOPE COLESTEROL DOTAP ( 35—

[0812] BP PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) 60 )

[0813] 5 )

[0814]

[0815] DSPE- DOPE COLESTEROL DOBAQ ( 35—

[0816] BQ PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) 60 )

[0817] 5 )

[0818] DSPE- DOPE COLESTEROL BP-LI PID- BR PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) 103 ( 35- 60 )

[0819] 5 )

[0820] DSPE- DOPE COLESTEROL LP- 01 ( 35—

[0821] BS PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) 60 )

[0822] 5 )

[0823] DSPE- DOPE COLESTEROL BP-LI PID- BT PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) 217 ( 35- 60 )

[0824] 5 )

[0825] DOPE COLESTEROL DODMA ( 35— ALC- 0159 BU

[0826] ( 10- 45 ) ( 10- 60 ) 60 ) ( 1 - 5 )

[0827] DOPE COLESTEROL DLIN-KC2 - ALC- 0159 BV

[0828] ( 10- 45 ) ( 10- 60 ) DMA ( 35- 60 ) ( 1 - 5 )

[0829] DOPE COLESTEROL D-LIN-MC3- ALC- 0159 BW

[0830] ( 10- 45 ) ( 10- 60 ) DMA ( 35- 60 ) ( 1 - 5 )

[0831] DOPE COLESTEROL ALC- 0315 ALC- 0159 BX

[0832] ( 10- 45 ) ( 10- 60 ) ( 35- 60 ) ( 1 - 5 )

[0833] DOPE COLESTEROL DOTAP ( 35— ALC- 0159 BY

[0834] ( 10- 45 ) ( 10- 60 ) 60 ) ( 1 - 5 )

[0835] DOPE COLESTEROL DOBAQ ( 35— ALC- 0159 BZ

[0836] ( 10- 45 ) ( 10- 60 ) 60 ) ( 1 - 5 )

[0837] DOPE COLESTEROL BP-LI PID- ALC- 0159 CA

[0838] ( 10- 45 ) ( 10- 60 ) 103 ( 35- 60 ) ( 1 - 5 )

[0839] DOPE COLESTEROL LP- 01 ( 35— ALC- 0159 CB

[0840] ( 10- 45 ) ( 10- 60 ) 60 ) ( 1 - 5 )

[0841]

[0842] DOPE COLESTEROL BP-LI PID- ALC- 0159 cc

[0843] ( 10- 45 ) ( 10- 60 ) 217 ( 35- 60 ) ( 1 - 5 )

[0844] DSPE-PEG EggPC COLESTEROL DOTAP ( 5- CD ( 2000 )

[0845] ( 65- 75 ) ( 18 -25 ) 10 )

[0846] ( 1, 5- 5 ) DSPC COLESTEROL CERTEST-A DMG-PEG ( 2000 ) CE

[0847] ( 10- 45 ) ( 10- 60 ) ( 35- 60 ) ( 1 - 5 )

[0848] DSPE CHOLESTEROL CERTEST-A DMG-PEG ( 2000 ) CF

[0849] ( 10- 45 ) ( 10- 60 ) ( 35- 60 ) ( 1 - 5 )

[0850] DOPE CHOLESTEROL CERTEST-A DMG-PEG ( 2000 ) CG

[0851] ( 10- 45 ) ( 10- 60 ) ( 35- 60 ) ( 1 - 5 )

[0852] DSPE- DSPC CHOLESTEROL CERTEST-A

[0853] CH PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) ( 35- 60 )

[0854] 5 )

[0855] DSPE- DSPE CHOLESTEROL CERTEST-A

[0856] CI PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) ( 35- 60 )

[0857] 5 )

[0858] DSPE-DOPE COLESTEROL CERTEST-A

[0859] CJ PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) ( 35- 60 )

[0860] 5 )

[0861] DSPC CHOLESTEROL CERTEST-A ALC- 0159 CK

[0862] ( 10- 45 ) ( 10- 60 ) ( 35- 60 ) ( 1 - 5 )

[0863] DSPE CHOLESTEROL CERTEST-A ALC- 0159 CL

[0864] ( 10- 45 ) ( 10- 60 ) ( 35- 60 ) ( 1 - 5 )

[0865] DOPE COLESTEROL CERTEST-A ALC- 0159 CM

[0866] ( 10- 45 ) ( 10- 60 ) ( 35- 60 ) ( 1 - 5 )

[0867] DSPC CHOLESTEROL CERTEST-B DMG-PEG ( 2000 ) CN

[0868] ( 10- 45 ) ( 10- 60 ) ( 35- 60 ) ( 1 - 5 )

[0869]

[0870] DSPE CHOLESTEROL CERTEST-B DMG-PEG ( 2000 ) co

[0871] ( 10- 45 ) ( 10- 60 ) ( 35- 60 ) ( 1 - 5 )

[0872] DOPE CHOLESTEROL CERTEST-B DMG-PEG ( 2000 ) CP

[0873] ( 10- 45 ) ( 10- 60 ) ( 35- 60 ) ( 1 - 5 )

[0874] DSPE- DSPC CHOLESTEROL CERTEST-B

[0875] CQ PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) ( 35- 60 )

[0876] 5 )

[0877] DSPE- DSPE CHOLESTEROL CERTEST-B

[0878] CR PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) ( 35- 60 )

[0879] 5 )

[0880] DSPE-DOPE COLESTEROL CERTEST-B

[0881] CS PEG ( 2000 ) ( 1 - ( 10-45 ) ( 10-60 ) ( 35-60 )

[0882] 5 )

[0883] DSPC COLESTEROL CERTEST-B ALC- 0159 CT

[0884] ( 10- 45 ) ( 10- 60 ) ( 35- 60 ) ( 1 - 5 )

[0885] DSPE COLESTEROL CERTEST-B ALC- 0159 CU

[0886] ( 10- 45 ) ( 10- 60 ) ( 35- 60 ) ( 1 - 5 )

[0887] DOPE COLESTEROL CERTEST-B ALC- 0159 CV

[0888] ( 10- 45 ) ( 10- 60 ) ( 35- 60 ) ( 1 - 5 )

[0889] DSPC COLESTEROL JK-102-CA DMG-PEG ( 2000 ) CX

[0890] ( 10- 45 ) ( 10- 60 ) ( 35- 60 ) ( 1 - 5 )

[0891] DSPE COLESTEROL JK- 102 -CA DMG-PEG ( 2000 ) CY

[0892] ( 10- 45 ) ( 10- 60 ) ( 35- 60 ) ( 1 - 5 )

[0893] DOPE COLESTEROL JK-102-CA DMG-PEG ( 2000 ) CZ

[0894] ( 10- 45 ) ( 10- 60 ) ( 35- 60 ) ( 1 - 5 )

[0895] DSPE- DSPC CHOLESTEROL JK- 102 -CA

[0896] DA PEG ( 2000 ) ( 1 - ( 10- 45 ) ( 10- 60 ) ( 35- 60 )

[0897] 5 )

[0898]

[0899] DSPE- DSPE CHOLESTEROL JK- 102-CA

[0900] DB PEG (2000) (1- (10-45) (10-60) (35-60)

[0901] 5 )

[0902] DSPE- DOPE CHOLESTEROL JK- 102-CA

[0903] DG PEG ( 2000 ) ( 1- ( 10-45 ) ( 10- 60 ) ( 35- 60 )

[0904] 5 )

[0905] DSPC CHOLESTEROL JK- 102-CA ALC- 0159 DD

[0906] ( 10-45 ) ( 10-60 ) ( 35-60 ) ( 1-5 )

[0907] DSPE CHOLESTEROL JK- 102-CA ALC- 0159 DE

[0908] ( 10-45 ) ( 10-60 ) ( 35-60 ) ( 1-5 )

[0909] DOPE CHOLESTEROL JK- 102-CA ALC- 0159 DF

[0910] ( 10-45 ) ( 10-60 ) ( 35-60 ) ( 1-5 )

[0911] DSPC CHOLESTEROL SM- 102 ( 35— DMG-PEG ( 2000 ) Control 1

[0912] ( 10-45 ) ( 10- 60 ) 60 ) ( 1-5 )

[0913] DOPE CHOLESTEROL SM- 102 ( 35— DMG-PEG ( 2000 ) Control 2

[0914] ( 10-45 ) ( 10- 60 ) 60 ) ( 1-5 )

[0915]

[0916]

[0247] In particular, the lipid nanoparticles of the present invention comprise one of the following formulations:

[0917] a) Formulation G

[0918] - Between 10 and 45% of DSPC,

[0919] - between 10 and 60% cholesterol,

[0920] between 35 and 60% cationic or ionizable lipids (BP-LIPID-103) and

[0921] - between 1.0 and 5.0% of pegylated lipids (DMG-PEG (2000));

[0922] b) Formulation I

[0923] - Between 10 and 45% of DSPC,

[0924] between 10 and 60% cholesterol between 35 and 60% cationic or ionizable lipids (BP-LIPID-217) and

[0925] - between 1.0 and 5.0% of pegylated lipids (DMG-PEG (2000));

[0926] c) BI Formulation

[0927] - between 10 and 45% DOPE,

[0928] - between 10 and 60% cholesterol,

[0929] between 35 and 60% cationic or ionizable lipids (BP-LIPID-103) and

[0930] - between 1.0 and 5.0% of pegylated lipids (DMG-PEG (2000));

[0931] d) BC Formulation

[0932] - between 10 and 45% DOPE,

[0933] - between 10 and 60% cholesterol,

[0934] between 35 and 60% cationic or ionizable lipids (DODMA) and

[0935] - between 1.0 and 5.0% of pegylated lipids (DMG-PEG (2000));

[0936] e) BK Formulation

[0937] - between 10 and 45% DOPE,

[0938] - between 10 and 60% cholesterol,

[0939] between 35 and 60% cationic or ionizable lipids (BP-LIPID-217) and

[0940] - between 1.0 and 5.0% of pegylated lipids (DMG-PEG (2000));

[0941] f) CG Formulation

[0942] - between 10 and 45% DOPE,

[0943] - between 10 and 60% cholesterol,

[0944] between 35 and 60% cationic or ionizable lipids (CERTEST-A) and - between 1.0 and 5.0% pegylated lipids (DMG-PEG (2000));

[0945] g) CP Formulation

[0946] - between 10 and 45% DOPE,

[0947] - between 10 and 60% cholesterol,

[0948] between 35 and 60% cationic or ionizable lipids (CERTEST-B) and

[0949] - between 1.0 and 5.0% of pegylated lipids (DMG-PEG (2000));

[0950] h) CZ Formulation

[0951] - between 10 and 45% DOPE,

[0952] - between 10 and 60% cholesterol,

[0953] between 35 and 60% cationic or ionizable lipids (JK-102-CA) and

[0954] - between 1.0 and 5.0% of pegylated lipids (DMG-PEG (2000)).

[0955]

[0248] Even more preferably, the lipid nanoparticles of the invention comprise one of the following formulations:

[0956] a) Formulation G

[0957] - between 10 and 20% of DSPC,

[0958] - between 30 and 60% cholesterol,

[0959] - between 35 and 50% BP-LIPID-103 and

[0960] - between 1.0 and 3.0% of DMG-PEG (2000);

[0961] b) Formulation I

[0962] - between 30 and 45% of DSPC,

[0963] - between 10 and 20% cholesterol,

[0964] - between 40 and 60% BP-LIPID-217 and

[0965] - between 1.0 and 3.0% of DMG-PEG (2000);

[0966] c) BI formulation - between 10 and 20% DOPE,

[0967] - between 40 and 60% cholesterol,

[0968] - between 35 and 50% BP-LIPID-103 and - between 1.0 and 3.0% DMG-PEG (2000); d) BC Formulation

[0969] - between 10 and 20% DOPE,

[0970] - between 40 and 60% cholesterol,

[0971] - between 35 and 50% of DODMA and

[0972] - between 1.0 and 3.0% of DMG-PEG (2000); e) BK formulation

[0973] - between 10 and 20% DOPE,

[0974] - between 40 and 60% cholesterol,

[0975] - between 35 and 50% BP-LIPID-217 and - between 1.0 and 3.0% DMG-PEG (2000); f) CG formulation

[0976] - between 10 and 20% DOPE,

[0977] - between 40 and 60% cholesterol,

[0978] - between 35 and 50% of CERTEST-A and

[0979] - between 1.0 and 3.0% of DMG-PEG (2000); g) CP formulation

[0980] - between 10 and 20% DOPE,

[0981] - between 40 and 60% cholesterol,

[0982] - between 35 and 50% of CERTEST-B and

[0983] - between 1.0 and 3.0% of DMG-PEG (2000); h) CZ formulation

[0984] - between 10 and 20% DOPE,

[0985] - between 40 and 60% cholesterol,

[0986] - between 35 and 50% of JK-102-CA and

[0987] - between 1.0 and 3.0% of DMG-PEG (2000).

[0249] In a particular embodiment, the present invention further provides a bivalent or monovalent immunogenic vaccine or composition or a therapeutic composition.

[0988]

[0250] The monovalent immunogenic compositions of the present invention contain 1 to 100 pg of mRNA, while the bivalent immunogenic compositions were obtained by mixing half the administered dose for each of the variants present, such as 0.5 to 50 pg of optimized Delta modified with n-methylpseudouridine or pseudouridine + 0.5 to 50 pg of optimized Omicron BA4 / BA5 or optimized Omicron XBB, both modified with n-methylpseudouridine or pseudouridine. To obtain the bivalent vaccine, the optimized mRNAs were encapsulated separately in lipid nanoparticles and then formulated in equimolar concentrations. Excellent performance of the bivalent vaccine was also observed, demonstrating that half the dose with each of the studied constructs is also capable of inducing robust cellular responses.

[0989]

[0251] In a preferred embodiment, the bivalent or monovalent vaccine with appropriate variant sequence update against SARS-CoV-2, using mRNA constructs encoding the Spike protein of the optimized Delta, optimized Omicron BA4 / BA5 and optimized Omicron XBB variants.

[0990]

[0252] The present invention further provides immunogenic compositions containing from 1 to 100 pg of optimized mRNAs, modified with pseudouridines, encoding Yellow Fever proteins 1, 2, 3 or 4.

[0253] In another preferred embodiment, the vaccine uses a pharmaceutically effective concentration of mRNA per dose. These mRNAs are optimized, modified with pseudouridines, encapsulated in the CZ-1 nanolipid formulation and encode Yellow Fever proteins 1, 2, 3 or 4.

[0991]

[0254] The therapeutic composition of the invention utilizes optimized and pseudouridine-modified mRNA constructs, which encode the light and heavy chains of an anti-PD1 antibody.

[0992]

[0255] In a preferred embodiment, the therapeutic composition of the invention utilizes a pharmaceutically effective dose concentration of mRNA. These mRNAs are optimized, modified with pseudouridines, encapsulated in the CZ-1 nanolipid formulation, and encode the anti-PD-1 antibody.

[0993]

[0256] Doses and dose volumes are discussed here in the general description, and may also be determined by a person skilled in the art from this disclosure, in conjunction with knowledge of the state of the art, without any undue experimentation.

[0994]

[0257] The term "pharmaceutically effective amount" refers to the amount that will exhibit a therapeutic or protective immune response such that resistance to new infection is increased and / or the clinical severity of the disease is reduced. Typically, the pharmaceutically effective amount is the amount that will lead to an improvement or cure of the disease.

[0995]

[0258] The compositions of the present invention can be prepared by encapsulating nucleic acid (mRNA) sequences in lipid nanoparticles using the microfluidic system, in a one- or multi-step procedure, containing different structural, cationic or ionizable, pegylated lipids and preservatives and, where appropriate, containing other additives.

[0996]

[0259] The compositions of the present invention can be administered intranasally, sublingually, orally, or parenterally, which includes subcutaneous, transcutaneous, intravenous, epidural, intramuscular, delivery pumps, or infusion. The compositions of the present invention may preferably be administered intramuscularly, in the case of vaccines, and intravenously, in the case of antibody therapy.

[0997]

[0260] Furthermore, the present invention provides the use of at least one nucleic acid sequence or pharmaceutical composition of the present invention to prepare a medicament for preventing and / or treating diseases, wherein the disease may preferably be, but not limited to, a viral, bacterial, parasitic, fungal or neoplastic disease. In particular, the disease may preferably be, but not limited to, severe acute respiratory syndrome caused by coronavirus (SARS-CoV-2), yellow fever virus infections or neoplasms sensitive to PD-1 / PD-L1 axis blockade.

[0998]

[0261] The present invention further provides a method for treating and / or preventing diseases, comprising administering an effective amount of at least one nucleic acid sequence or the pharmaceutical composition of the present invention to an individual in need thereof, wherein the disease may preferably, but not limited to, be a viral, bacterial, parasitic, fungal or neoplastic disease. In particular, the disease may preferably, but not limited to, be severe acute respiratory syndrome caused by coronavirus (SARS-CoV-2), yellow fever virus infections or neoplasms sensitive to PD-1 / PD-L1 axis blockade.

[0999]

[0262] Furthermore, the present invention provides a method for preparing a pharmaceutical composition of the present invention comprising encapsulating the mRNAs of the invention in lipid nanoparticles by a microfluidic process.

[1000] CONCRETIZATIONS OF THE PRESENT INVENTION

[1001]

[0263] Although not claimed, the process of identifying and obtaining said antigens is fundamental to achieving the essential characteristics of the antigens present invention.

[1002] EXAMPLE 1 - Plasmid design, antigen targeting strategies, and optimizations in sequences of interest.

[1003]

[0264] The pBiol, pBio2, pBio3 and pBio4 plasmids were constructed as disclosed in the detailed description of this application.

[1004]

[0265] Luciferase, isolated from the firefly Photinus pyralis, is one of the most extensively studied enzymes for catalyzing light production from the substrates luciferin, ATP, and O2. For this reason, the gene encoding this enzyme has been widely used as a reporter to analyze promoters, regulatory elements, and delivery systems. Thus, with the aim of validating the regulatory elements 5' UTR, 3' UTR, and short poly-A tail, as well as the lipid formulations for mRNA delivery, the gene encoding the luciferase enzyme (SEQ ID NO: 67) was inserted into the pBiol plasmid (SEQ ID NO: 1), obtaining the pBiol + luciferase plasmid (SEQ ID NO: 19; Figure 19).

[1005]

[0266] To corroborate the results obtained with the luciferase gene and, thereby, validate the concept of using the regulatory elements of the present invention, two new constructs were designed from the pBiol plasmid. The first construct contains a complete sequence of the non-optimized SARS-CoV-2 Spike gene, Delta variant (SEQ ID NO: 57) which was obtained from the global alignment of different sequences found in the GISAID database (https: / / gisaid.org / ), obtaining the non-optimized pBiol + Spike delta plasmid (SEQ ID NO: 20; Figure 20).

[1006]

[0267] During the RNA purification step, which will be described in Example 2, the formation of secondary bands was observed, with size and intensity lower than the mRNA of interest (5000 nt band), which represented byproducts of the transcription reaction (Figure 53). In order to minimize the appearance of secondary bands, some modifications to the in vitro transcription reaction (IVT reaction) were evaluated, such as: composition of added nucleotides, reaction time and temperature. However, these changes did not have the expected effect on the formation of the byproducts initially observed.

[1007]

[0268] Given this limitation of the technique, an optimization protocol for the coding sequences of the genes of interest for SARS-CoV-2, Yellow Fever, and anti-PD1 was developed and applied, as illustrated in Figure 88. The optimization protocol developed and taught in this invention used a multifactorial approach, which took into account not only codon usage, but also other parameters such as GC content, splicing sites, RNA destabilizing motifs, among others.

[1008]

[0269] Regarding the Spike protein sequences, more than 5,579,683 SARS-CoV-2 Delta variant genomes were obtained from the GISAID database (gisaid.org), which gave rise to SEQ ID NO: 57 used in this invention, BA4 / BA5 omicron variants, which gave rise to SEQ ID NO: 68 used in this invention, and XBB omicron variants, which gave rise to SEQ ID NO: 69 used in this invention, in addition to the Wuhan hCoV-19 / Wuhan / WIV04 / 2019 (WIV04) Spike (S) reference protein, as available at https: / / www.eurosurveillance.org / content / 10.2807 / 1560-7917.ES.2020.25.8.2000097.

[1009]

[0270] Regarding the Yellow Fever and anti-PD-1 sequences, it was not necessary to perform the consensus sequence determination step, as exact sequences of the vaccine virus already exist, in the case of Yellow Fever, and of the commercial antibody Opdivo® (Bristol Myers Squibb), in the case of the anti-PD-1 antibody. In these cases, the sequence of the YF vaccine yellow fever virus strain 17DD of African origin (Yellow fever virus vaccine strain 17DD, complete genome Genbank U17066.1) and of the anti-PD-1 antibody (DRUG BANK ref. DB 09035 https: / / go.drugbank.com / drugs / DB09035) were subjected to optimization steps, as will be described below.

[1010]

[0271] Regarding the SARS-CoV-2 consensus sequences, in order to minimize possible bias caused by similar sequences in the construction of the consensus sequences, redundant sequences were removed using the standard parameters offered by the Seqkit program, version v2.5.0.0. SeqKit is a program that provides executable binary files for all major operating systems, is open source, and is available at https: / / github.com / shenwei356 / seqkit.

[1011]

[0272] Subsequently, using the Shell programming language, a set of steps (pipeline) was developed to obtain the consensus sequence of SARS-CoV-2. This pipeline was designed to filter and eliminate low-quality nucleic acid sequences, ensuring the integrity and efficiency of the design and optimization process of the nucleic acid sequences to be used in the vaccine. Specifically, the pipeline performs an analysis of the obtained sequences, removing sequences whose length was greater or less than 20% of the expected size of the original sequence. In addition, the pipeline discarded sequences that contained an undetermined number of nucleotides (represented by the letter 'N') greater than 2 (two).

[1012]

[0273] These quality criteria are essential to ensure the accuracy and fidelity of the selected sequences, aligning with the rigorous genomic data curation guidelines established by the GISAID (Global Initiative on Sharing All Influenza Data) initiative (https: / / gisaid.org / ). The GISAID guidelines stipulate that integrity must be verified and sequencing artifacts removed, ensuring that only high-quality sequences representative of circulating viral variants are used in the development of vaccines and drugs.

[0274] The proposed pipeline is crucial to ensure that the nucleic acid sequences that will generate the mRNAs of this invention have high quality standards, providing a robust basis for the immunogenic efficacy of the mRNA vaccine proposed herein. The application of the pipeline in the sequence design and optimization process ensures the robustness and reliability necessary for the success of the vaccine platform.From the multifast of the obtained proteins, the global alignment of the sequences was performed using the MAFFT program, version 7, and is available at http: / / mafft.cbrc.jp / alignment / server / large.html.

[1013]

[0275] Based on the alignment obtained with the MAFFT program, an analysis and construction of the consensus sequence was performed, edited manually, using the Jalview program, which is a system for editing, analyzing, and interactively annotating WYSIWYG alignments of multiple sequences. The version used was 2.0 and the program is available at https: / / www.jalview.org / .

[1014]

[0276] For the mutation analysis stage, global alignment of SARS-CoV-2 reference proteins (WIV04) with the obtained consensus sequence was performed using the standard parameters of the MAFFT program. Subsequently, using the Jalview program, the final consensus sequence was constructed, which was generated and edited manually, case-by-case, altering the nucleotides in the sequence locations where a clear consensus could not be obtained. For example, in the optimized Spike Omicron XBB mRNA sequence of this invention, it was decided to preferentially maintain the mutations present in the XBB 1.5 strain, according to the World Health Organization's statement on current antigens recommended for the composition of COVID-19 vaccines (https: / / www.who.int / news / item / 26-04-2024-statement-on-the-antigen-composition-of-covid-19-vaccines).

[1015]

[0277] Finally, the validation of the mutations was performed with the aid of the online platform Outbreak.info (https: / / outbreak.info). The validation was performed by comparing the consensus sequence obtained with the sequence of the circulating variants, where the inventors compared the two sequences and identified whether the characteristic mutations of the circulating variant remained present in the consensus sequence.

[1016]

[0278] After obtaining the final consensus sequence of the Spike protein for each of the variants used here (Delta, omicron BA4 / BA5 and omicron XBB), and having the exact sequence of the anti-PD-1 antibody and the sequence of the E and NS1 proteins of yellow fever, all sequences were optimized on the online platform GenScript (https: / / www.genscript.com / gensmart-free-gene-codon-optimization.html).

[1017]

[0279] mRNA optimization was performed on a case-by-case basis, considering several criteria aimed at maximizing mRNA expression, increasing the chance of obtaining a functional and active protein, and minimizing potential adverse effects.

[1018]

[0280] Thus, the criteria that were used to perform the optimizations on the mRNA sequences of the invention were selected from the groups comprising: optimizations for adjusting the %GC content (above 40% up to 60%); optimization of the use of codons for human hosts; removal of RNase splicing sites; removal of Cis elements; removal of restriction enzyme sites and removal of repetitive elements (Figure 88).

[1019]

[0281] Firstly, a %GC content of 40% to 60% was established, which has been associated with the percentage present in most mammalian genes and with greater stability and efficiency of mRNA transcription in the cell.

[1020]

[0282] In addition, to optimize mRNA expression in humans, mammalian preferred codons were used according to the codon frequency table available at https: / / www.genscript.com / tools / codon-frequency-table, ensuring efficient and accurate antigen translation.

[1021]

[0283] To prevent mRNA degradation by endogenous RNases, the Genscript program identified and removed mRNA sequence sites that promote splicing from the activity of cellular RNase enzymes.

[1022]

[0284] Finally, cis elements and repetitive elements that could interfere with protein translation or mRNA stability were removed from the sequences.

[1023]

[0285] In addition to the cis elements and sequence repeats that affect the secondary structure of mRNA, the catalytic sites of restriction enzymes were also altered in the mRNA sequences. In particular, the sites of the restriction enzymes Xbal [TCTAGA], Nhel [GCTAGC], BspQI [GCTCTCT], EcoRI [GAATTC], Xhol [CTCGAG], Apal [GGGCCC], of the optimized sequences of the invention.

[1024]

[0286] The optimization of the sequences based on the optimization rationale developed and presented in the present invention resulted in the complete disappearance of secondary bands, as can be observed in Figure 53 (B, column 2) when compared to the non-optimized sequences (A, column 2), demonstrating that there was an increase in mRNA yield in its production stage, which will reflect in better industrial productivity. The benefits observed with the optimizations described here, in terms of increased protein expression and stability in cell assays, will be demonstrated later, confirming their positive impact on the invention.

[1025]

[0287] The second plasmid construct presented in this invention also contains the coding gene for the SARS-CoV-2 Spike, Delta variant (SEQ ID NO: 57), but features optimizations in its nucleic acid sequence (SEQ ID NO: 58), resulting in the pBiol + optimized Spike delta plasmid (SEQ ID NO: 21; Figure 21), which corresponds to the pBiol plasmid (SEQ ID NO: 1) + coding sequence of the optimized Spike delta (SEQ ID NO: 58).

[1026]

[0288] The sequence optimization did, in fact, result in productive advantages, eliminating secondary bands and abortive remnants in in vitro transcription, and also resulted in increased protein expression in assays performed in cells and in vivo, as will be described later in the results.

[1027]

[0289] After validating the 5' UTR, 3' UTR VEEV regulatory elements and short poly-A tail, a new version of the plasmid was constructed, which was named pBio2. This version has a specific sequence after the promoter region, which allows the addition of a cap during the transcription reaction, thus eliminating the need to perform two steps to obtain functional mRNA.

[1028]

[0290] From the pBio2 plasmid (SEQ ID NO: 2; Figure 2) constructs containing luciferase and constructs for the development of vaccines against infectious diseases and immunotherapy against cancer were generated. The constructs are described below. The gene encoding the luciferase enzyme (SEQ ID NO: 67) was inserted into the pBio2 plasmid, obtaining the pBio2 + luciferase plasmid (SEQ ID NO: 22; Figure 22).

[1029]

[0291] For the development of a vaccine against SARS-CoV-2, the following constructs were designed using the pBio2 platform:

[1030] i. pBio2 construction + non-optimized delta variant Spike: SEQ ID NO: 23; Figure 23 corresponds to pBio2 (SEQ ID NO: 2) + non-optimized delta Spike coding sequence (SEQ ID NO: 57).

[1031] ii. pBio2 + Spike construction with an optimized delta variant:

[1032] SEQ ID NO: 24; Figure 24 corresponds to pBio2 (SEQ ID NO: 2) + optimized Spike delta coding sequence (SEQ ID NO: 58).

[1033] iii. pBio2 construction + optimized and non-optimized Õmicron BA4 / BA5 variant Spike: respectively, SEQ ID NO: 25 and SEQ ID NO: 100; Figure 25 corresponds to pBio2 (SEQ ID NO: 2) + coding sequence of the optimized (SEQ ID NO: 59) and non-optimized (SEQ ID NO: 68) Õmicron BA4 / BA5 Spike.

[1034] iv. Construction of pBio2 + Optimized and non-optimized Õmicron XBB Spike variant: respectively, SEQ ID NO: 26 and SEQ ID NO: 103; Figure 26 corresponds to pBio2 (SEQ ID NO: 2) + coding sequence of the optimized (SEQ ID NO: 60) and non-optimized (SEQ ID NO: 69) Õmicron XBB Spike.

[0292] As detailed above, it should be noted that the consensus sequences obtained for the Ômicron BA4 / BA5 and XBB subvariants were subjected to the same optimizations performed for the Delta variant.

[1035]

[0293] Additionally, 4 constructs were designed for the development of an mRNA vaccine against the yellow fever virus using the pBio2 platform.

[1036]

[0294] The first yellow fever construct contains the transmembrane region of the capsid protein (C), which is believed to play an important role in directing the structural polyprotein of the yellow fever virus to the endoplasmic reticulum. In the same open reading frame, the regions encoding the prM and E proteins were added, resulting in the optimized (SEQ ID NO: 27; Figure 27) and non-optimized (SEQ ID NO: 88; Figure 27) Yellow Fever 1 (spC-prM-E) construct, corresponding, respectively, to the optimized (SEQ ID NO: 74) and non-optimized (SEQ ID NO: 61) pBio2 (SEQ ID NO: 2) + FA1 (spC-prM-E) plasmid.

[1037]

[0295] The second construct contains the same regions as construct 1. However, the region corresponding to the signal sequence of the polyprotein has been replaced by the signal peptide of the SARS-CoV-2 Spike protein. This modification was performed to optimize the expression of the polyprotein of interest (prM-E), since the native signal peptide is not always necessarily the most effective. In addition, the Spike signal peptide has been used successfully. This construct was named pBio2 + Yellow Fever 2 (sp Spike-prM-E) optimized (SEQ ID NO: 28; Figure 28) and non-optimized (SEQ ID NO: 89; Figure 28), corresponding, respectively, to the pBio2 (SEQ ID NO: 2) + FA2 (sp Spike-prM-E) plasmid optimized (SEQ ID NO: 75) and non-optimized (SEQ ID NO: 62).

[1038]

[0296] With the aim of generating new constructs with greater potential for protection and durability of the response, another antigen was added to the coding sequences for the yellow fever prM-E polyprotein, generating the prM-E-NSl construct. Several reports in the literature implicate NS1 in the induction of antibodies that aid in protection against yellow fever virus infection, being involved in the elimination of virus-infected cells and assisting in the process of eliminating the virus from the organism. Following the rationale described above, the prM-E-NSl polyprotein was placed under the influence of two distinct signal peptides, the transmembrane region of the yellow fever protein C and the SARS-CoV-2 Spike signal sequence, generating the following constructs:

[1039] i. pBio2 + Yellow Fever 3 construction optimized and non-optimized (spC-prM-E-NSl): respectively, SEQ ID NO: 29 and SEQ ID NO: 90; Figure 29 corresponds to the pBio2 (SEQ ID NO: 2) + FA3 (spC-prM-E-NSl) plasmid optimized (SEQ ID NO: 76) and non-optimized (SEQ ID NO: 63).

[1040] ii. pBio2 + Yellow Fever 4 construction optimized and non-optimized (sp Spike-prM-E-NSl): respectively, SEQ ID NO: 30 and SEQ ID NO: 91; Figure 30 corresponds to the pBio2 (SEQ ID NO: 2) + FA4 (sp Spike-prM-E-NSl) plasmid optimized (SEQ ID NO: 77) and non-optimized (SEQ ID NO: 64).

[1041]

[0297] As for the genes that encode the light and heavy chains of an anti-PDl antibody, they were inserted into the pBio2 plasmid, generating the following constructs:

[1042] i. pBio2 + Heavy Chain (HC) Anti-PDl construction optimized and non-optimized: respectively, SEQ ID NO: 31 and SEQ ID NO: 106; Figure 31 corresponds to the pBio2 (SEQ ID NO: 2) + HC Anti-PDl plasmid optimized (SEQ ID NO: 65) and non-optimized (SEQ ID NO: 70).

[1043] ii. pBio2 + Light Chain (LC) Anti-PDl construction optimized and non-optimized: respectively, SEQ ID NO: 32 and SEQ ID NO: 107; Figure 32 corresponds to the pBio2 plasmid (SEQ ID NO: 2) + optimized (SEQ ID NO: 66) and non-optimized (SEQ ID NO: 71) Anti-PDl Light Chain (LC) construct.

[1044]

[0298] The light and heavy chain sequences of the anti-PDl antibody of the invention were extracted from the DRUGBANK database (https: / / go.drugbank.com / drugs / DB09035) under the identifier DB09035. The sequences of the signal peptides used to target the anti-PDl antibody of the invention to the secretion pathway were extracted from a chimeric anti-CD20 antibody, as described in international patent application WQ1994 / 011026. Thus, the heavy chain of the anti-PDl antibody of the invention has the signal sequence of the heavy chain of an anti-CD20 antibody, and, in turn, the light chain of the anti-PDl antibody of the invention has the signal sequence of the light chain of an anti-CD20 antibody. It is noteworthy that these sequences were successfully used by our working group to target the cellular expression of other complete antibodies and their fragments.

[1045]

[0299] The genes encoding the SARS-CoV-2 Spike proteins, the Yellow Fever polyproteins, and the anti-PDl antibody were also inserted into the pBio3 plasmid (SEQ ID NO: 3; Figure 3), which is distinguished by the addition of a gene segment (strong gyrase site - SGS) to increase the production of supercoiled plasmid DNA produced during bacterial culture.

[1046]

[0300] The pBio3 plasmid constructs are described below:

[1047] i. pBio3 + luciferase construct: SEQ ID NO: 33; Figure 33, containing the pBio3 plasmid (SEQ ID NO: 3) + luciferase (SEQ ID NO: 67).

[1048] ii. pBio3 + Spike construction with an optimized delta variant:

[1049] SEQ ID NO: 34; Figure 34, containing pBio3 plasmid (SEQ ID NO: 3) + optimized delta (SEQ ID NO: 58).

[1050] iii. pBio3 + Spike variant construction optimized and non-optimized: respectively, SEQ ID NO: 35 and SEQ ID NO: 101; Figure 35, containing the pBio3 plasmid (SEQ ID NO: 3) + optimized (SEQ ID NO: 59) and non-optimized (SEQ ID NO: 68).

[1051] iv. Optimized and non-optimized pBio3 + Spike Õmicron XBB construction: respectively, SEQ ID NO: 36 and SEQ ID NO: 104; Figure 36, containing the optimized (SEQ ID NO: 3) + Õmicron XBB plasmid (SEQ ID NO: 60) and non-optimized (SEQ ID NO: 69).

[1052] v. Optimized and non-optimized (spC-prM-E) pBio3 + Yellow Fever 1 construction: respectively, SEQ ID NO: 37 and SEQ ID NO: 92; Figure 37, containing the optimized (SEQ ID NO: 74) and non-optimized (SEQ ID NO: 61) pBio3 (SEQ ID NO: 3) + FA1 (spC-prM-E) plasmid.

[1053] vi. pBio3 + Yellow Fever 2 construction optimized and non-optimized (sp Spike-prM-E): SEQ ID NO: 38 and SEQ ID NO: 93; Figure 38, containing the pBio3 (SEQ ID NO: 3) + FA2 (sp Spike-prM-E) plasmid optimized (SEQ ID NO: 75) and non-optimized (SEQ ID NO: 62).

[1054] vii. pBio3 + Yellow Fever 3 construction optimized and non-optimized (spC-prM-E-NSl): respectively, SEQ ID NO: 39 and SEQ ID NO: 94; Figure 39, containing the pBio3 (SEQ ID NO: 3) + FA3 (spC-prM-E-NSl) plasmid optimized (SEQ ID NO: 76) and non-optimized (SEQ ID NO: 63).

[1055] viii. pBio3 + Yellow Fever 4 construction optimized and non-optimized (sp Spike-prM-E-NSl): respectively, SEQ ID NO: 40 and SEQ ID NO: 95; Figure 40, containing the pBio3 (SEQ ID NO: 3) + FA4 (sp Spike-prM-E-NSl) plasmid optimized (SEQ ID NO: 77) and non-optimized (SEQ ID NO: 64).

[1056] ix. pBio3 + Heavy Chain (HC) Anti-PDl construction optimized and non-optimized: respectively, SEQ ID NO: 41 and SEQ ID NO: 108; Figure 41, containing the pBio3 plasmid (SEQ ID NO: 3) + optimized (SEQ ID NO: 65) and non-optimized (SEQ ID NO: 70) Anti-PDl HC.

[1057] x. pBio3 + Light Chain (LC) Anti-PDl construction optimized and non-optimized: respectively, SEQ ID NO: 42 and SEQ ID NO: 109; Figure 42, containing the pBio3 plasmid (SEQ ID NO: 3) + optimized (SEQ ID NO: 66) and non-optimized (SEQ ID NO: 71) Anti-PDl LC.

[1058]

[0301] Finally, genes for SARS-CoV-2, yellow fever virus, and anti-PDl antibody were also inserted into the pBio4 plasmid (SEQ ID NO: 4; Figure 4). The main advantage of this plasmid is the resolution of multimers by recombination at the cer site, stabilizing the segregation of plasmids in daughter cells. The SGS gene segment is also present in this version, as observed in pBio3. Thus, version 4 of the plasmid brings improvements to the upstream (cer) and downstream (SGS) steps of the template plasmid DNA production process.

[1059]

[0302] The constructs designed from the pBio4 plasmid were as follows:

[1060] i. pBio4 + luciferase construct: SEQ ID NO: 43; Figure 43, containing the pBio4 plasmid (SEQ ID NO: 4) + Luciferase (SEQ ID NO: 67).

[1061] ii. Optimized pBio4 + Spike delta construction: SEQ ID NO: 44; Figure 44, containing the pBio4 plasmid (SEQ ID NO: 4) + optimized delta (SEQ ID NO: 58)

[1062] iii. Optimized and non-optimized pBio4 + Spike Õmicron BA4 / BA5 construction: respectively, SEQ ID NO: 45 and SEQ ID NO: 102; Figure 45, containing the optimized (SEQ ID NO: 4) + Õmicron BA4 / BA5 plasmid (SEQ ID NO: 59) and non-optimized (SEQ ID NO: 68).

[1063] iv. Optimized and non-optimized pBio4 + Spike Õmicron XBB construction: respectively, SEQ ID NO: 46 and SEQ ID NO: 105; Figure 46, containing the optimized (SEQ ID NO: 4) + Õmicron XBB plasmid (SEQ ID NO: 60) and non-optimized (SEQ ID NO: 69).

[1064] v. pBio4 + Yellow Fever 1 construction optimized and non-optimized (spC-prM-E): respectively, SEQ ID NO: 47 and SEQ ID NO: 96; Figure 47, containing the pBio4 plasmid (SEQ ID NO: 4) + FA1 optimized (spC-prM-E) (SEQ ID NO: 74) and non-optimized (SEQ ID NO: 61).

[1065] vi. Optimized and non-optimized (sp Spike-prM-E) pBio4 + Yellow Fever 2 construction: respectively, SEQ ID NO: 48 and SEQ ID NO: 97; Figure 48, containing the optimized (SEQ ID NO: 75) and non-optimized (SEQ ID NO: 62) pBio4 (SEQ ID NO: 4) + FA2 (sp Spike-prM-E) plasmid.

[1066] vii. pBio4 + Yellow Fever 3 construction optimized and non-optimized (spC-prM-E-NSl): respectively, SEQ ID NO: 49 and SEQ ID NO: 98; Figure 49, containing the pBio4 (SEQ ID NO: 4) + FA3 (spC-prM-E-NSl) plasmid optimized (SEQ ID NO: 76) and non-optimized (SEQ ID NO: 63).

[1067] viii. pBio4 + Yellow Fever 4 construction optimized and non-optimized (sp Spike-prM-E-NSl): respectively, SEQ ID NO: 50 and SEQ ID NO: 99; Figure 50, containing the pBio4 (SEQ ID NO: 4) + FA4 (sp Spike-prM-E-NSl) plasmid optimized (SEQ ID NO: 77) and non-optimized (SEQ ID NO: 64).

[1068] ix. pBio4 + Heavy Chain and non-optimized (Heavy Chain - HC) Anti-PDl construction: respectively, SEQ ID NO: 51 and SEQ ID NO: 110; Figure 51, containing the pBio4 plasmid (SEQ ID NO: 4) + optimized (SEQ ID NO: 65) and non-optimized (SEQ ID NO: 70) Anti-PDl HC.

[1069] x. pBio4 + Light Chain (LC) Anti-PDl construction optimized and non-optimized: respectively, SEQ ID NO: 52 and SEQ ID NO: 111; Figure 52, containing the pBio4 plasmid (SEQ ID NO: 4) + optimized (SEQ ID NO: 66) and non-optimized (SEQ ID NO: 71) Anti-PDl LC.

[1070] EXAMPLE 2 - RNA Transcription

[1071]

[0303] Plasmid mass expansion was performed using E. coli bacteria, TOP 10 strain, which were incubated for 18 h at 37°C and 200 rpm agitation. The plasmid mass was extracted using the QIAprep Spin Miniprep kit (Qiagen). After extraction, the DNA mass was quantified using the Qubit™ dsDNA BR Assay kit (Thermo) or by spectrophotometry using the Nanodrop platform (Thermo). After quantification, the pBiol plasmid was subjected to enzymatic digestion, where the appropriate amount of DNA was incubated with the restriction enzyme Xhol (New England Biolabs). The constructs based on the pBio2, pBio3, and pBio4 plasmids were linearized with the restriction enzyme BspQI (New England Biolabs).

[1072]

[0304] Linearized plasmids were purified using the Wizard® SV Gel and PCR Clean-Up System kit (Promega), following the manufacturer's instructions. Subsequently, the enzymatic reaction to obtain mRNA in vitro was prepared according to the protocol of the MEGAscript™ T7 Transcription kit manufacturer (Thermo). Transcription reactions were performed following routine state-of-the-art techniques and following the instructions of the MEGAscript™ T7 Transcription kit using the conventional nucleotides Adenosine triphosphate (ATP), Guanosine triphosphate (GTP), and Cytidine triphosphate (GTP), and replacing 100% of the conventional nucleotides Uridine triphosphate (UTP) with the modified nucleotide pseudouridine (ji) or the modified nucleotide Nl-methylpseudouridine (mlji), with no mixing of pseudouridine with Nl-methylpseudouridine in the same mRNA.Thus, during the mRNA elongation process, by the action of the T7 RNA polymerase enzyme in the kit, using the linearized DNA as a template, each time a uridine should have been incorporated into the sequence, it was automatically replaced by the modified uridine that was inserted into that reaction, as specified for each sequence. In other words, the mRNA obtained at the end of the reaction contained pseudouridine or Nl-methylpseudouridine, depending on which of the two was added to the kit mixture. The use of modified nucleotides aims to decrease the recognition of mRNA by the host's innate immune response and improve mRNA translation.

[1073]

[0305] The obtained mRNAs were then purified by precipitation with lithium chloride and subjected to the cap 1 addition reaction using the Vaccinia Capping System kit (New England Biolabs) associated with the mRNA Gap 2'-O-Methyltransferase enzyme (New England Biolabs). For the constructs based on the pBio2, pBio3, and pBio4 plasmids, cap addition was performed during the transcription reaction using the HiScribe® T7 mRNA Kit with CleanCap® Reagent AG (New England Biolabs). The manufacturer's recommendations were followed.

[1074]

[0306] For each 1 pg of template DNA (SEQ ID NO: 19 to 52 and 88 to 111), 100 pg of RNA were generated at the end of transcription.

[1075]

[0307] The following mRNAs were obtained from the plasmids containing the coding sequences (SEQ ID NO: 19 to 52 and 88 to 111):

[1076] - Luciferase mRNA, expressed in pBiol, represented by SEQ ID NO: 5 and Figure 5;

[1077] - Luciferase mRNA, expressed in pBio2, pBio3 and pBio4, represented by SEQ ID NO: 6 and Figure 6;

[1078] - Non-optimized delta variant Spike mRNA, expressed in pBiol, represented by SEQ ID NO: 7 and Figure 7;

[1079] - Non-optimized delta variant Spike mRNA, expressed in pBio2, represented by SEQ ID NO: 8 and Figure 8;

[1080] - Optimized delta variant Spike mRNA, expressed in pBiol, represented by SEQ ID NO: 9 and Figure 9;

[1081] - Optimized delta variant Spike mRNA, expressed in pBio2, pBio3 and pBio4, represented by SEQ ID NO: 10 and Figure 10;

[1082] Optimized BA4 / BA5 omicron variant Spike mRNA, expressed in pBio2, pBioS and pBio4, represented by SEQ ID NO: 11 and Figure 11;

[1083] - Non-optimized BA4 / BA5 omicron variant Spike mRNA, expressed in pBio2, pBioS and pBio4, represented by SEQ ID NO: 112 and Figure 11;

[1084] - Omicron XBB variant Spike mRNA, expressed in pBio2, pBioS and pBio4, represented by SEQ ID NO: 12; Figure 12;

[1085] Unoptimized XBB omicron variant Spike mRNA, expressed in pBio2, pBioS and pBio4, represented by SEQ ID NO: 113; Figure 12;

[1086] - Optimized Yellow Fever 1 mRNA, expressed in pBio2, pBio3 and pBio4, represented by SEQ ID NO: 13 and Figure 13;

[1087] - Non-optimized Yellow Fever 1 mRNA, expressed in pBio2, pBio3 and pBio4, represented by SEQ ID NO: 82 and Figure 13;

[1088] - Optimized Yellow Fever 2 mRNA, expressed in pBio2, pBio3 and pBio4, represented by SEQ ID NO: 14 and Figure 14;

[1089] - Non-optimized Yellow Fever 2 mRNA, expressed as pBio2, pBio3 and pBio4, represented by SEQ ID NO: 83 and Figure 14;

[1090] - Optimized Yellow Fever 3 mRNA, expressed in pBio2, pBio3 and pBio4, represented by SEQ ID NO: 15 and Figure 15;

[1091] - Non-optimized Yellow Fever 3 mRNA, expressed in pBio2, pBio3 and pBio4, represented by SEQ ID NO: 84 and Figure 15;

[1092] - Optimized Yellow Fever 4 mRNA, expressed in pBio2, pBio3 and pBio4, represented by SEQ ID NO: 16 and Figure 16;

[1093] - Non-optimized Yellow Fever 4 mRNA, expressed in pBio2, pBio3 and pBio4, represented by SEQ ID NO: 85 and Figure 16;

[1094] - Optimized Anti-PD-1 Heavy Chain mRNA, expressed in pBio2, pBio3 and pBio4, represented by SEQ ID NO: 17 and Figure 17;

[1095] - Non-optimized Anti-PD-1 heavy chain mRNA, expressed in pBio2, pBio3 and pBio4, represented by SEQ ID NO: 86 and Figure 17;

[1096] - Optimized Anti-PD-1 light chain mRNA, expressed in pBio2, pBio3 and pBio4, represented by SEQ ID NO: 18 and Figure 18;

[1097] - Non-optimized Anti-PD-1 light chain mRNA, expressed in pBio2, pBio3 and pBio4, represented by SEQ ID NO: 87 and Figure 18.

[1098]

[0308] In order to present the differences between optimized mRNAs (nucleic acids) containing a polyA tail and 5' UTR and 3' UTR regions, the non-optimized mRNAs (nucleic acids), without a polyA tail and without the 5' UTR and 3' UTR regions, are shown below:

[1099] - Luciferase mRNA, represented by SEQ ID NO: 56; - Delta variant Spike mRNA, represented by SEQ ID NO: 53;

[1100] - Spike mRNA variant omicron BA4 / BA5, represented by SEQ ID NO: 54;

[1101] - Omicron variant Spike mRNA XBB, represented by SEQ ID NO: 55;

[1102] - Yellow Fever mRNA 1, represented by SEQ ID NO: 78;

[1103] - Yellow Fever 2 mRNA, represented by SEQ ID NO: 79;

[1104] - Yellow Fever mRNA 3, represented by SEQ ID NO: 80;

[1105] Yellow Fever mRNA 4, represented by SEQ ID NO: 81;

[1106] - Anti-PD-1 Heavy Chain mRNA, represented by SEQ ID NO: 72;

[1107] - Anti-PD-1 light chain mRNA, represented by SEQ ID NO: 73.

[1108]

[0309] The invention further discloses the alignment between the sequences of non-optimized mRNAs (nucleic acids) in the absence of the poly-A tail and the 5' UTR and 3' UTR segments of VEEV, with the sequences of optimized mRNAs (nucleic acids) containing the poly-A tail and the 5' UTR and 3' UTR segments of VEEV, in order to aid in visualizing the improvements generated in the molecules of the present invention.

[1109]

[0310] The MAFFT program, version 7, available at http: / / mafft.cbrc.jp / alignment / server / large.html was used to perform the following alignments:

[1110] - alignment of the 3816 base pair sequence of the non-optimized delta mRNA (SEQ ID NO: 53) with the 4058 base pair sequence of the optimized delta mRNA, expressed in pBiol (SEQ ID NO: 9) (Figure 89);

[1111] - alignment of the 3816 base pair sequence of the non-optimized delta mRNA (SEQ ID NO: 53) with the 4053 base pair sequence of the optimized delta mRNA, expressed in pBio2, pBio3 and pBio4 (SEQ ID NO: 10) (Figure 90);

[1112] - alignment of the 3807 base pair sequence of the non-optimized BA4 / BA5 omicron mRNA (SEQ ID NO: 54) with the 4044 base pair sequence of the optimized BA4 / BA5 omicron mRNA (SEQ ID NO: 11) (Figure 91);

[1113] - alignment of the 3810 base pair sequence of the non-optimized XBB omicron mRNA (SEQ ID NO: 55) with the 4047 base pair sequence of the optimized XBB omicron mRNA (SEQ ID NO: 12) (Figure 92);

[1114] - alignment of the 2037 base pair sequence of non-optimized Yellow Fever 1 mRNA (SEQ ID NO: 78) with the 2274 base pair sequence of optimized Yellow Fever 1 mRNA (SEQ ID NO: 13) (Figure 93);

[1115] - alignment of the 2013 base pair sequence of non-optimized Yellow Fever 2 mRNA (SEQ ID NO: 79) with the 2250 base pair sequence of optimized Yellow Fever 2 mRNA (SEQ ID NO: 14) (Figure 94);

[1116] - alignment of the 3264 base pair sequence of non-optimized Yellow Fever 3 mRNA (SEQ ID NO: 80) with the 3501 base pair sequence of optimized Yellow Fever 3 mRNA (SEQ ID NO: 15) (Figure 95);

[1117] - alignment of the 3240 base pair sequence of non-optimized Yellow Fever 4 mRNA (SEQ ID NO: 81) with the 3477 base pair sequence of optimized Yellow Fever 4 mRNA (SEQ ID NO: 16) (Figure 96);

[1118] - alignment of the 1380 base pair sequence of the non-optimized Anti-PDl Heavy Chain mRNA (SEQ ID NO: 72) with the 1617 base pair sequence of the optimized Anti-PDl Heavy Chain mRNA (SEQ ID NO: 17) (Figure 97);

[1119] - alignment of the 711 base pair sequence of the non-optimized Anti-PDl Light Chain mRNA (SEQ ID NO: 73) with the 948 base pair sequence of the optimized Anti-PDl Light Chain mRNA (SEQ ID NO: 18) (Figure 98).

[1120]

[0311] The obtained mRNAs were subjected to a second purification step by precipitation with lithium chloride, making them suitable for encapsulation.

[1121] EXAMPLE 3 Formulation of mRNA in lipid nanoparticles, characterization tests, stability of the formulations and percentage of encapsulation.

[1122]

[0312] The obtained mRNA constructs were encapsulated in lipid nanoparticles by microfluidics, using the Ignite instrument (Precision Nanosystems). For this, the mRNA was diluted in 100 mM citrate buffer pH between 4.0 and 6.0 to achieve the desired encapsulation concentration (5 pg / 50 pL), and the lipid mixture was diluted in absolute ethanol, according to the final formulation volume, maintaining the nucleotide / phosphate ratio between 1:1 and 30:1, the RNA and lipid flow between 1:1 and 10:1, and a flow rate between 1 mL / min and 15 mL / min. After the formation of the lipid nanoparticle, the mRNAs were encapsulated and said nanoparticles containing mRNA were dialyzed in cassettes between 3, 5 and 30kDa against 100mM Tris buffer, pH 7.4, for 2 hours, in order to stabilize the nanoparticles, removing the ethanol from the formulations.Suitable preservatives / stabilizers for use in the invention are: trehalose, sucrose, arginine, sorbitol, glycerol, proline, or mannitol in concentrations ranging from 2 to 35%, but not limited to these. Ultimately, the pharmaceutical composition of the invention preferably consists of mRNAs encapsulated in lipid nanoparticles stabilized in 100mM Tris-HCl buffer, pH 7.4, with sucrose as a preservative at 10%.

[1123]

[0313] The monovalent compositions obtained contain 5 pg of non-optimized delta mRNA, optimized delta mRNA, optimized omicron BA4 / BA5 mRNA, or optimized omicron XBB mRNA, while the bivalent compositions were obtained by mixing half the administered dose for each of the variants tested (2.5 pg of optimized Delta mRNA + 2.5 pg of optimized omicron BA4 / BA5 mRNA). The mRNAs of the invention had all their uridines replaced by pseudouridines or n-methyl-pseudouridines for comparison purposes, as will be detailed later.

[1124]

[0314] Based on the results obtained in the animal delivery and immunogenicity assays, described later, the formulations Gl, 1-1, BI-1, BC-1, BK-1, CG-1, CP-1 and CZ-1 (Table 2) were chosen as prototypes for the experiments performed to demonstrate the superiority of the optimized sequence compared to the non-optimized sequence when analyzing protein expression. In addition, the assays performed also demonstrated the differences in expression when using mRNA prepared with pseudouridine or with n-methyl pseudouridine.

[1125] Table 2: Lipid composition and molar ratio of the nanolipid formulations of the invention.

[1126] Lipids Lipids Lipids Sterol

[1127] Cationic or pegylated structural formulation (ratio)

[1128] (ionizable ratio (molar ratio)

[1129] molar) (molar ratio) molar) DMG-CHOLESTEROL BP-LIPID-103

[1130] G-l DSPC ( 10) PEG (2000) (48 ) (40)

[1131] (2, 0) COLESTEROL DMG- BP-LIPID-217

[1132] 1-1 DSPC (40, 7 ) ( 14, 5) PEG (2000) (42, 8 )

[1133] (2, 0) DOPE ( 10) COLESTEROL DMG- BP-LIPID-103

[1134] BI-1 (48 ) PEG (2000) (40)

[1135] (2, 0)

[1136]

[1137] DOPE ( 10 ) COLESTEROL DMG- BC- 1 ( 48 ) DODMA ( 40 ) PEG ( 2000 ) ( 2, 0 ) DOPE ( 10 ) COLESTEROL DMG- BP-LIPID-217

[1138] BK- 1 ( 48 ) PEG ( 2000 ) ( 40 )

[1139] ( 2, 0 ) DOPE ( 10 ) COLESTEROL DMG- CG- 1 ( 48 ) Certest-A ( 40 ) PEG ( 2000 ) ( 2, 0 ) DOPE ( 10 ) COLESTEROL DMG- CP- 1 ( 48 ) Certest-B ( 40 ) PEG ( 2000 ) ( 2, 0 ) DOPE ( 10 ) COLESTEROL DMG- CZ- 1 ( 48 ) JK- 102-CA ( 40 ) PEG ( 2000 ) ( 2, 0 ) DSPC ( 10 ) COLESTEROL DMG- Controle

[1140] ( 48 ) SM- 102 ( 40 ) PEG ( 2000 ) 1- 1

[1141] (2,0) DOPE (10) CHOLESTEROL DMG- Control

[1142] ( 48 ) SM- 102 ( 40 ) PEG ( 2000 ) 2- 1

[1143] ( 2, 0 )

[1144]

[1145] [0315 Controls 1-1 and 2-1 used the ionizable lipid SM-102 in their formulation and contained the mRNAs of interest to act as the control for each experiment presented here.

[1146]

[0316] Lipid nanoparticle formulations containing the mRNA constructs of the invention were subjected to characterization using dynamic light scattering (DLS) to verify size (Z-average), surface charge (zeta potential), and polydispersity index (PDI) using the Zetasizer Nano Ultra® equipment (Malvern, UK). For characterization, approximately 1 mL of the sample diluted 10x in DEPC water was transferred to a polystyrene cuvette. All evaluations were performed in triplicate at a temperature of 25°C, using the measurement beam at the backscatter angle and with the number of automatic runs defined by the equipment. The particle size and PDI values ​​are calculated from the average of the readings performed in triplicate for each of the samples.All formulations tested achieved encapsulation percentages above 90% and PDI (Product Development Index) less than 0.3, values ​​consistent with industrial-scale production and within the parameters described in the literature.

[1147] Example 4 - Proof of principle in cells (in vitro) and delivery test in animals.

[1148]

[0317] For mRNA delivery tests in cells, HEK 293T cells were used, a human cell line widely used in RNA vaccine potency assays.

[1149]

[0318] In these essays, IxlO 6Cells were plated in 6-well plates (Nunc) for flow cytometry assays the day before the start of the assay. On the day of the assay, 5 pg of mRNA from each of the tested variants (non-optimized Delta, optimized Delta, and optimized Omicron BA4 / BA5 variants, with all uridines replaced by pseudouridines; non-optimized Delta, optimized Delta, and optimized Omicron BA4 / BA5 variants, with all uridines replaced by n-methyl-pseudouridines) were prepared separately using the TransIT®-mRNA Transfection Kit (Mirus) according to the manufacturer's instructions. Then, 1000 microliters of medium were removed from each well, and the reagents were added to the remaining 1000 microliters in the well. The plate was incubated in 5% CO2 at 37 °C for 60 min. After this time, 1000 microliters of fresh medium were added and the plate was incubated for 24 hours.The same transfection protocol was used for HEK cells, which is the cell of choice for determining the potency of RNA vaccines widely described in the literature. After incubation, they were labeled with the anti-S monoclonal antibody (SARS-CoV-2 Spike SI conjugated with Alexa 488 - R&D Systems). For flow cytometry, the cells were removed from the culture, washed, permeabilized with Cytofix / Cytoperm reagent (BD Biosciences), and fixed with 2% paraformaldehyde. The cells were then labeled with 500 ng / mL of anti-S antibody, followed by a washing step to remove non-binding antibodies. After cell fixation, the reading was performed on an LSR Fortessa flow cytometer (BD Biosciences), and the analyses were performed using FlowJO software.

[1150]

[0319] Figure 54 shows the detection of S protein expression in HEK-293T cells transfected with the studied constructs. An increase in S protein detection was also observed in the transfection performed with the mRNA construct with the optimized delta sequence (B: Tube 2 - 17.1%) when compared to the same non-optimized construct (A: Tube 1 - 7.11%), demonstrating that, in addition to the gain in the production step, there was also a gain in the increase of S protein expression in the cells. When comparing the mRNAs prepared with n-methylpseudouridine (A, B and E: Tubes 1, 2 and 5) with those prepared with pseudouridine (C, D and F: Tubes 3, 4 and 6), we can observe a better performance of the mRNAs modified with pseudouridine, both in the optimized and non-optimized Delta variants and in the optimized Omicron BA4 / BA5 variant.

[1151]

[0320] Figures 55 and 56 show that the BI-1 formulation efficiently delivered mRNAs with optimized delta, non-optimized delta, and optimized Omicron BA4 / BA5 sequences, both modified with pseudouridine or n-methyl-pseudouridine, into cells when compared to the positive control (Comirnaty® vaccine - Pfizer) and that the results observed previously were maintained, with better S protein expression performance in assays with optimized RNA and prepared with pseudouridine.

[1152]

[0321] Figure 84 shows that the CG-1 and CP-1 nanolipid formulations also efficiently delivered RNA to HEK cells and that the optimized mRNA manufactured with pseudouridine performs better in terms of translation into the protein of interest, corroborating the previous results. In this experiment, the secondary antibody Alexa Fluor 488+ (AF488) (ThermoFisher) (Figure 84 B) and the control formulation 2-1 containing non-optimized delta mRNA modified with n-methyl-pseudouridine (Figure 84 G2) were used as labeling controls. Finally, Figure 85 shows that the CZ-1 nanolipid formulation was also able to efficiently deliver the optimized BA4 / BA5 omicron mRNAs modified with pseudouridine, regardless of the pH used. The secondary antibody Alexa Fluor 488+ (AF488) (Figure 85 B) and the control formulation 2-1, containing optimized Omicron BA4 / BA5 mRNA modified with pseudouridine (Figure 85 G2), were used as labeling controls.

[1153]

[0322] To continue the in vitro proof-of-principle, constructs containing the Yellow Fever genes and the anti-PD1 antibody were used. Thus, HEK-293T cells were transfected with Lipofectamine containing the pseudouridine-modified mRNA constructs, and the expression of the proteins of interest was evaluated by flow cytometry using specific antibodies. The procedures for sample preparation, data acquisition, and analysis were performed as previously described.

[1154]

[0323] Figure 86 shows that, after 24 hours of transfection, it was possible to detect the expression of the Yellow Fever virus E protein using the primary antibody against flavivirus E protein (clone 4G2 - Bio-Manguinhos) and the secondary antibody AF488 (ThermoFisher) in cells transfected with Lipofectamine containing 15pg of non-optimized Yellow Fever-3 mRNA, modified with pseudouridine (16.2%) (Figure 86 E) or non-optimized Yellow Fever-4 mRNA, modified with pseudouridine (30.3%) (Figure 86 F) each, observing, surprisingly, a better performance for the Yellow Fever-4 construct (sp Spike-prM-E-NSl), which contains the secretion motif of the Sars-Cov-2 Spike protein. The result found with the Yellow Fever-4 construct is unexpected, since it was believed that the Yellow Fever-3 construct (spC-prM-E-NSl) would have a better result, as it contains the secretion motif of the Yellow Fever E protein itself.This result demonstrates that different secretion motifs, even heterologous ones, can be more efficient in promoting the translocation of the protein to the endoplasmic reticulum, which is a critical step in protein secretion, and thus increase the immunogenicity of the composition, as already detailed in the prior art. This understanding was considered in the designs of the antigens presented here and corroborates the proposed invention.

[1155]

[0324] Based on results that indicated greater expression efficiency from the inclusion of the signal peptide of the SARS-CoV-2 Spike protein, optimized versions of the pBio4 Yellow Fever-2 plasmid (sp spike-prM-E) (SEQ ID NO: 48) expressing Yellow Fever-2 mRNA (SEQ ID NO: 14) and the pBio4 Yellow Fever-4 plasmid (sp spike-prM-E-NSl) (SEQ ID NO: 50) expressing Yellow Fever-4 mRNA (SEQ ID NO: 16) were developed.

[1156]

[0325] For the evaluation of these new constructs, the same methodology used in the experiments with the non-optimized versions was employed, with the only modification being the reduction of the transfected mRNA mass to 1 pg per sample. Thus, HEK cells were transfected with Lipofectamine containing the Yellow Fever-2 or Yellow Fever-4 mRNA constructs, both optimized and modified with pseudouridine, or transfected with the Yellow Fever-2 or Yellow Fever-4 mRNAs, both optimized and modified with pseudouridine prepared with the CZ-1 nanolipid formulation, and subsequently subjected to labeling and analysis, according to the previously described protocol.

[1157]

[0326] The results obtained (Figure 114) indicate that the mRNAs formulated with CZ-1 promoted a significant increase in delivery efficiency compared to the versions formulated with Lipofectamine. In the case of the Yellow Fever-2 construct, the percentage of Alexa Fluor 488+ positive HEK cells was 62.1% when transfected with Lipofectamine-containing mRNA (Figure 114B), increasing to 84.7% with the mRNA formulated with CZ-1 (Figure 114D). Similarly, the Yellow Fever-4 construct showed 46.1% positive cells with Lipofectamine-containing mRNA (Figure 114C), a value that increased to 71.0% with the mRNA formulated with CZ-1 (Figure 114E).

[1158]

[0327] Finally, it is important to highlight that, even using only 1 pg of optimized Yellow Fever-4 mRNA modified with pseudouridine in Lipofectamine, it was possible to achieve 46.1% positive cells (Figure 114 C), a value considerably higher than that observed with 15 pg of non-optimized Yellow Fever-4 mRNA modified with pseudouridine in Lipofectamine, which resulted in only 30.3% positivity (Figure 86). These data reinforce not only the effectiveness of the optimization strategy adopted in the design of the mRNA constructs, but also demonstrate the high capacity of the CZ-1 lipid formulation to promote efficient and functional mRNA delivery.

[1159]

[0328] Continuing with the in vitro proof of principle, Figure 87 presents the results obtained with the anti-PDl antibody. After 24 hours of transfection, it is possible to observe that there was expression of the proposed anti-PDl monoclonal antibody in the two optimized and modified light and heavy chain ratios with pseudouridines tested (2.5 pg light chain and 2.5 pg heavy chain (Figure 87 B); 7.5 pg light chain and 7.5 pg heavy chain (Figure 87 C)), as proven by the labeling with the human anti-IgG antibody, when compared to the control of cells transfected with empty Lipofectamine nanoparticles and labeled with the aforementioned antibodies.

[1160]

[0329] Finally, all experiments prove that the 3' UTR and 5' UTR regulatory elements of VEEV and the short poly A tail used in the tested mRNAs, together with the optimizations and efficient nanolipid formulations, are capable of stabilizing the expression of target genes in human cells.

[1161]

[0330] In parallel with the in vitro results, the efficiency of in vivo delivery of mRNA comprising a coding region of a protein of interest (in this case, Luciferase), the 5' UTR and 3' UTR regions of the Venezuelan Equine Encephalitis Virus (VEEV), and a short poly-A tail containing 40 Adenines, encapsulated in formulations, was evaluated. In this experiment, said mRNA was obtained from the pBIOl plasmid. The animals were injected with 50 microliters of each formulation BI-1, BK-1, Gl, 1-1, CG-1, CP-1, CZ-1, Control 1-1, and Control 2-1, containing the Luciferase mRNA, into the muscles of both thighs, in exactly the same manner and by the same route used for the vaccines under test in this invention. At each time point indicated in Figures 57 and 58 (1 DPI and 3 DPI), the animals were injected with 100 microliters of luciferin solution (30 mg / mL) via the intraperitoneal route. After 15 minutes of luciferin injection, readings were taken on the IVIS equipment (Perkin Elmer).Figures 57 and 58 show that there was adequate expression and delivery of Luciferase mRNA in animal tissues, with different efficiencies among the nanolipid formulations tested, 1 day after inoculation of Luciferase mRNA in formulations BI-1, BK-1, Gl, 1-1 and Control formulations 1-1 and 2-1, and 3 days after inoculation of Luciferase mRNA in formulations CG-1, CP-1 and CZ-1, observing the best performances of the nanolipid formulations CP-1 and CZ-1, compared to the Control formulation 2-1 which also contained Luciferase mRNA. The buffer used in the assays was Tris 100mM, pH 7.4.

[1162]

[0331] With the aim of demonstrating the functionality of mRNAs comprising a coding region of a protein of interest, the 5' UTR and 3' UTR regions of the Venezuelan Equine Encephalitis Virus (VEEV) and a short poly-A tail containing 40 Adenines expressed in the different plasmid scaffolds described in this invention, the luciferase gene was also inserted into the pBio3 and pBio4 plasmids. These plasmids were used for the synthesis of Luciferase mRNA, which was subsequently formulated with the CZ-1 nanolipid formulation and administered to K18 transgenic mice. Each animal received 50 pL of the CZ-1 formulation containing the Luciferase mRNA, in 100mM Tris buffer, pH 7.4, injected into the muscles of both thighs. The negative controls used were 100mM Tris buffer, pH 7.4.Bioluminescence analyses were performed using IVIS® equipment at 24, 48, 120, 144, and 366 hours after vaccination, following the same protocol previously established for obtaining pBio2-derived Luciferase mRNA. The results demonstrated that both pharmaceutical compositions, prepared with Luciferase mRNA derived from pBio3 (Figure 115) and pBio4 (Figure 116) plasmids and formulated with the CZ-1 nanolipid formulation, were able to induce a bioluminescent signal at the inoculation site, with maximum intensity observed at 24 hours and a gradual reduction at subsequent times.

[1163]

[0332] The results presented confirm that the plasmids presented in this invention enabled the functional expression of the proposed mRNAs, realizing the mRNA expression platform of the invention, with the use of the different plasmid scaffolds (pBiol, pBio2, pBio3 and pBio4) that utilize the 3' UTR and 5' UTR regulatory elements of VEEV and the short Poly A tail described in this invention.

[1164] Example 5 - Proof of principle in animals (in vivo)

[0333] To evaluate the immunogenicity and efficacy of the vaccines of the invention, a stringent model was used for better evaluation of the formulations and testing of the mRNA constructs. In this experiment, groups of 10 K18 mice transgenic for human ACE-2 were used, as they are characterized as a better model for evaluating the protection conferred by the vaccine, since these animals die in the absence of protection.

[1165]

[0334] These assays utilized mRNA constructs modified with pseudouridines, containing the genes of SARS-CoV-2, non-optimized Delta variant, optimized Delta variant, and optimized Omicron BA4 / BA5 variant, encapsulated in the lipid nanoparticles of the invention. In the control formulations 1-1 and 2-1, the ionizable lipid SM-102 was used, which has been considered the prototype lipid for in vivo delivery, achieving high levels of delivery efficacy. In the present assays, SM-102 was used as a positive control, allowing comparative evaluations with the other lipids under test and confirming that the mRNA constructs of the present invention are immunogenic and protective.

[1166]

[0335] The formulations were initially administered intramuscularly. In the first immunogenicity and protection experiments, 2 doses of approximately 5 pg of RNA were inoculated, being 100 pL (50 pL in each hind limb) intramuscularly, with a 28-day interval between doses and a 14-day interval after the last dose until the challenge (Figure 59). The heterologous challenge was performed using the Sars-Cov2 virus of the Gamma strain. 2 x 10 4 Total viral particles were measured, with 5 pL in each nostril of the animal. After inoculation, the animals were monitored for 14 days, observing signs of morbidity and mortality, which occurs between 6 and 10 days in unprotected animals, in which Tris buffer 100mM, pH 7.4, was inoculated.

[1167]

[0336] Also in the K18-hACE2 transgenic mouse animal model, a homologous challenge assay was conducted using the SARS-CoV-2 virus of the Omicron XBB strain, corresponding to the same variant of the spike protein encoded by the messenger RNA (mRNA) present in the tested vaccine formulations.

[1168]

[0337] The protocol adopted for the homologous challenge followed the same steps already described for the heterologous challenge. However, in this assay, groups of 20 animals were used, with the objective of more robustly evaluating the immunogenicity and efficacy parameters of the CZ-1 formulation containing 1, 2, or 4 pg of optimized and fully pseudouridine-modified Omicron XBB mRNA. Figure 99 shows the immunization scheme of K18-hACE2 mice for the homologous challenge with the Omicron XBB strain.

[1169]

[0338] In order to demonstrate the efficacy of the vaccine candidate in more than one animal model and the robustness of the preclinical data obtained, an immunization scheme was also carried out in golden Syrian hamsters. In this immunization scheme, a homologous challenge was again performed, using the Sars-Cov2 virus, Omicron XBB strain. The challenge performed in hamsters followed the same protocol performed with K18 mice, previously described. The immunogenicity and efficacy studies of the Omicron XBB variant mRNA vaccine modified with pseudouridine and encapsulated in the CZ-1 formulation used groups of 18 animals for the homologous challenge with the Omicron XBB strain. Therefore, Figure 106 shows the immunization scheme of the golden Syrian hamsters used in the homologous challenge with the Omicron XBB strain.

[1170]

[0339] Data obtained from assays with K18 mice and hamsters as animal models were analyzed using GraphPad Prism software version 8.0 (GraphPad Software, San Diego, CA, USA). Specific statistical tests were selected according to the type of functional assay performed. Results with a p-value less than 0.05 were considered statistically significant.

[1171]

[0340] For the study of in vivo expression of the anti-PD-1 antibody, groups of five BALB / c mice were used. The treatment scheme adopted is shown in Figure 112.

[1172]

[0341] BALB / c mice were treated intravenously with the CZ-1 formulation, containing mRNA encoding the light chain and mRNA encoding the heavy chain of the anti-PD-1 antibody proposed in this invention, mixed in a 1:2 ratio (mass:mass; heavy chain:light chain). These mRNAs were optimized and fully modified with pseudouridines.

[1173]

[0342] Each group received two doses of the treatment, administered on days 0 and 7, at concentrations of 0.2 mg / kg or 0.4 mg / kg per dose. A control group received only 100mM Tris buffer solution, pH 7.4, following the same administration schedule. Blood samples were collected on days -1 (pre-treatment), 6, and 14 for quantification of antibodies produced in vivo by ELISA. The data obtained were analyzed by two-way ANOVA with Tukey's post-test.

[1174]

[0343] Figure 113 presents the results of anti-PD-1 IgG expression on days 6 and 14 after administration of the first and second doses, respectively, of the CZ-1 formulation containing optimized mRNAs, modified with pseudouridines, for the light and heavy chains of the anti-PD-1 antibody, at concentrations of 0.2 mg / kg and 0.4 mg / kg. The mRNAs used were expressed on the pBIO3 plasmid. A significant increase in anti-PD-1 IgG levels was observed in the mRNA-treated groups compared to the control group (Tris buffer 100mM, pH 7.4), with the highest expression observed at the 0.4 mg / kg dose. These results indicate that the therapeutic composition of the CZ-1 formulation containing optimized mRNAs for the light and heavy chains of the anti-PD-1 antibody is functional, promoting in vivo expression of the anti-PD-1 antibody in a murine model.

[1175]

[0344] Finally, in order to demonstrate the efficacy of the yellow fever vaccine candidates of the invention, groups of 17 C57BL / 6 mice were used. Therefore, Figure 117 shows the yellow fever immunization scheme in C57BL / 6 mice used in the immunogenicity assay by ELISpot (quantification of IFN-γ in animal splenocytes) and ELISA.

[1176]

[0345] C57BL / 6 mice were immunized with mRNAs, transcribed from pBio4, Yellow Fever-2 (spike-prM-E) and Yellow Fever-4 (spike-prM-E-NSl), optimized, modified with pseudouridine and encapsulated in the CZ-1 nanolipid formulation.

[1177]

[0346] The animals received two doses of 4, 2, or 1 pg of Yellow Fever-2 mRNA or Yellow Fever-4 mRNA, intramuscularly, at 28-day intervals. A negative control (100 mM Tris buffer, pH 7.4) was included as a comparison group. The data obtained were analyzed by one-way ANOVA, followed by Dunnett's multiple comparisons test.

[1178] Example 6 - Evaluation of immunogenicity by ELISPOT (quantification of IFN-γ in animal splenocytes)

[1179]

[0347] K18 animals and golden Syrian hamsters were immunized as described in Example 5 (Figures 59, 99, and 106), and spleen samples were collected at the time of euthanasia of the vaccinated animals, one day before the challenge. The spleens were subjected to a splenocyte separation process by mechanical maceration. After cell recovery, they were subjected to an ELISPOT assay to assess whether the vaccine induced T-cell responses. Thus, the frequency of interferon-gamma (IFN-γ)-secreting cells in splenocytes from vaccinated animals was analyzed using the commercial ELISPOT assay.

[1180]

[0348] Cell suspensions were plated (1 x 10 6Cells (per well) were placed in pre-coated plates (ELISpotplus Mabtech) and cultured for 40 hours in the presence or absence of the antigen (Spike protein peptide pool). As a positive control, cells were incubated with 2 pg / well of Concanavalin A (Sigma-Aldrich). After incubation and development, the spots of the cells secreting the aforementioned mediators were quantified using the ImmunoSpot® image analyzer (CTL). The number of spots generated by cells stimulated with the antigen was subtracted from the nonspecific spots generated in unstimulated cells, generating the quantity of antigen-specific spots per million cells. Statistical analyses were performed using one-way ANOVA followed by Dunnett's multiple comparisons test.

[1181]

[0349] Figure 60 shows that a cellular response was induced in K18 animals vaccinated with formulations BI-1, BC-1, and BK-1, with the best performance for the cellular response induced by formulation BI-1. In this experiment, only non-optimized delta RNA prepared with n-methylpseudouridine was used to test formulations BI-1, BC-1, and BK-1, in addition to the control formulation 2-1. The buffer used was 100mM Tris, pH 7.4. Formulation BI-1 was then chosen to continue the assay comparing optimized mRNAs with non-optimized mRNAs and mRNAs prepared with n-methylpseudouridine or pseudouridine.

[1182]

[0350] Figure 66 shows improved performance of the optimized constructs compared to the non-optimized constructs, as well as improved performance of the mRNA containing pseudouridine compared to those containing n-methylpseudouridine, corroborating the results obtained in vitro. Excellent performance of the bivalent formulation was also observed, demonstrating that half the dose with each mRNA (2.5 pg of optimized Delta mRNA + 2.5 pg of optimized Omicron BA4 / BA5 mRNA) is also capable of inducing robust cellular responses. To obtain the bivalent formulation, the mRNAs were encapsulated separately in lipid nanoparticles and then formulated in equimolar concentrations.

[1183]

[0351] Continuing the studies in K18-hACE2 mice, of formulations with different ionizable lipids, Figure 72 shows that all formulations and mRNAs studied were able to induce robust cellular responses, with emphasis on all groups of the CP-1 formulation, which induced higher responses, regardless of the mRNA used - non-optimized Delta, optimized Delta, optimized Omicron BA4 / BA5, modified with pseudouridine or with n-methyl pseudouridine, or bivalent formulation. In Figure 78 it was possible to observe that the CZ-1 formulation was also able to induce robust cellular responses, this time using only the Omicron BA4 / BA5 RNA optimized with pseudouridine, as the vaccine prototype of the present invention. In this assay, the encapsulation pH (pH 4.0, 5.2 and 6.0) was evaluated and there was no impact on the immunogenicity of the vaccine. The virus inactivated in vitro used as the control for the experiment was the SARS-CoV-2 virus, Wuhan strain.Figure 100 presents the results obtained with the CZ-1 formulation containing 1, 2, or 4 pg of optimized XBB omicron mRNA, modified with pseudouridine. In this assay, it was observed that all tested doses induced a significantly superior cellular response compared to the control group (Tris buffer 100mM, pH 7.4). Furthermore, the data indicate that all tested formulations induced a robust cellular immune response against the XBB omicron variant, including the lowest mRNA dose evaluated (1 pg). The absence of statistical differences between the vaccinated groups suggests that, within the analyzed dose range, increasing the mRNA concentration did not result in a proportional amplification of the cellular response.

[1184]

[0352] Figure 107 shows the results obtained in Syrian golden hamsters immunized with the CZ-1 formulation containing 1, 2, or 4 pg of optimized XBB omicron mRNA modified with pseudouridine. The results showed that, although the differences between the vaccinated groups and the control group (Tris buffer 100mM, pH 7.4) did not reach statistical significance, the higher mean number of spots in the immunized groups suggests a possible induction of a cellular response by the CZ-1 formulation containing the XBB omicron variant mRNA. The presence of discrete cellular responses in some individuals of the control group contributed to increased variability and may have attenuated the statistical contrast between the groups.

[1185]

[0353] It is noteworthy that these results are consistent with the data presented by Andrade et al. (2023), who compared the INO-4800 DNA vaccine with the BNT162b2 (Pfizer) and mRNA-1273 (Moderna) vaccines in different preclinical models, including hamsters. In that study, IFN-γ ELISpot analyses performed with hamster splenocytes showed numerically higher mean spots in the vaccinated groups compared to the control, reflecting the induction of a cellular response, although they did not always show statistically significant differences. These findings corroborate the consistency and adequacy of the results observed in the present evaluation.

[1186]

[0354] Finally, Figure 118 presents the results obtained in C57BL / 6 mice immunized with 1, 2 or 4 pg mRNA, transcribed from pBio4, Yellow Fever-2 (spike-prM-E) and Yellow Fever-4 (spike-prM-E-NSl), optimized, modified with pseudouridine and encapsulated in the CZ-1 nanolipid formulation.

[1187]

[0355] According to the immunization schedule presented in Figure 117, the cellular immune response was evaluated 14 days after the second immunization with Yellow Fever-2 or Yellow Fever-4 mRNA formulations, using an ELISpot assay for IFN-γ quantification in splenocytes stimulated with specific peptides of the yellow fever virus (PepMix™ Pan-Yellow Fever Virus Select, JPT). The results presented in Figure 118 demonstrated that the formulation containing 4 pg of optimized Yellow Fever-2 mRNA, modified with pseudouridine and encapsulated in CZ-1, induced a significantly superior cellular response compared to the control group (Tris buffer 100mM, pH 7, 4), confirming the immunogenic robustness of this formulation.The other groups immunized with mRNA (1 or 2 pg Yellow Fever-2 or 1, 2 or 4 pg Yellow Fever-4) showed numerically higher mean spots than the control group, although without reaching a statistical difference, possibly due to nonspecific responses in some animals of the control group that increased the variability.

[1188]

[0356] Taken together, these findings reinforce that the optimized Yellow Fever-2 or Yellow Fever-4 mRNA formulations, modified with pseudouridine and encapsulated in the CZ-1 nanolipid formulation, induce superior cellular responses compared to the control group, confirming that the mRNA formulations of the present invention are capable of generating consistent and robust immune responses.

[1189] Example 7 - ELISA

[0357] To quantify anti-SARS-CoV-2 antibodies in samples from K18 mouse and Syrian golden hamster assays, as described in Example 5 (Figures 59, 99 and 106), the ELISA technique was used. The development of the ELISA assay began with the sensitization of 96-well flat-bottom microplates, Nunc MaxiSorp. Then, the S protein antigens produced by the Recombinant Technology Laboratory (VDINV / Bio-Manguinhos) were added at 2.5 pg / mL in Carbonate / Bicarbonate buffer pH 9. 6.50 pL in each well. After overnight incubation at 4 °C, washing was performed with 300 pL of PBS solution pH 7.4 + tween 20 at 0.05% to remove unadsorbed material from the plate. This step was performed three times. After washing the plates, 100 µL of the solution containing 5% skim milk powder and 0.5% BSA was added to the washing solution, and the plates were incubated for 1 hour at 37 °C.After washing the plates, pre-immune and immune sera diluted 1 / 50 were added to the plate in a volume of 50 pL of the samples. Incubation was performed for 2 hours at 37 °C. After washing the plates, a volume of 50 pL of the conjugate, anti-IgG HRP from mice or hamsters diluted in 1:40000 Blocking solution, was added to each well and incubated for 1 hour at 37 °C. After washing the plates, 50 pL of the ultrasensitive TMB substrate ESO 22 was added, followed by incubation for 10 minutes at room temperature. Finally, the reaction was stopped by adding 50 pL of 2N sulfuric acid (H2SO4). Absorbances were determined at 450 nm using a microplate reader. The data obtained were analyzed using the non-parametric Kruskal-Wallis test.

[0358] ELISA results using samples from the K18 mouse assays (Figure 61) indicated that anti-S antibodies were produced when non-optimized Delta mRNA modified with pseudouridine was formulated with formulations BI-1, BC-1, and BK-1, in addition to the control formulation 2-1, in pre- and post-challenge dosages with the Sars-Cov2 virus Gamma strain, as previously described (the latter demonstrating that there was priming of immune system cells), with better performance for formulation BI-1. In Figure 67, it was possible, once again, to verify that formulation BI-1 containing RNA with optimized sequences and modified with pseudouridine presented the best anti-S antibody responses. The same pattern was observed for formulations CP-1 and CG-1 (Figure 73), with emphasis again on formulation CP-1, which induced higher antibody titers than formulation CG-1 in all groups studied.Figure 79 shows that the CZ-1 formulation was able to induce anti-S antibodies at the three encapsulation pH levels tested (pH 4.0, 5.2, and 6.0), before and after challenge with the Gamma strain, demonstrating that the cells were successfully stimulated by the vaccine. The RNA used in this experiment was the optimized Omicron BA4 / BA5 mRNA prepared with pseudouridine.

[1190]

[0359] Figure 101 presents the immunogenicity results, by ELISA, of the CZ-1 formulation containing 1, 2 or 4 pg optimized XBB omicron mRNA prepared with pseudouridine. In the pre-challenge period, the immunized animals already showed detectable levels of IgG, indicating that the vaccine was immunogenic and induced a specific humoral response before exposure to the virus. After viral challenge (3, 6 and 14 dpi), an increase in IgG titers was observed in the vaccinated groups, suggesting activation of immunological memory and anamnestic response. In contrast, the animals in the control group (Tris buffer 100mM, pH 7.4) showed undetectable antibody levels before the challenge and a serological response compatible with primary infection after exposure to the virus.

[1191]

[0360] Similarly, the data presented in Figure 108 demonstrate that Syrian golden hamsters immunized with the CZ-1 formulation, containing 1, 2, or 4 pg of optimized XBB omicron mRNA modified with pseudouridine, already exhibited detectable levels of anti-Spike IgG in the pre-challenge period. A dose-dependent serological response was observed, with the highest titers recorded in the group that received 4 pg. After the viral challenge (3, 6, and 14 dpi), there was a further increase in IgG levels, especially on day 6. o The day after infection indicated an anamnestic response and a previously sensitized immune system capable of recognizing and reacting rapidly to the viral antigen. The control used was 100mM Tris buffer, pH 7.4.

[1192]

[0361] Finally, the humoral response induced by optimized Yellow Fever-2 or Yellow Fever-4 mRNAs, modified with pseudouridine, encapsulated in the CZ-1 nanolipid formulation, was evaluated by ELISA on plates coated with attenuated yellow fever virus (Bio-Manguinhos), using sera from C57BL / 6 mice collected 14 days after the second immunization dose, according to the immunization schedule shown in Figure 117. Figure 119 shows that the formulations, administered in doses of 1, 2 or 4 pg of optimized Yellow Fever-2 or Yellow Fever-4 mRNAs, modified with pseudouridine, encapsulated in the CZ-1 nanolipid formulation, induced serum IgG levels higher than the negative control (Tris buffer 100mM, pH 7.4), with statistically significant differences in some groups and a numerical trend of increase in the others.

[1193] Example 8 - PRNT Test

[1194]

[0362] The SARS-CoV-2 Plaque Reduction Neutralization Test (PRNT) was performed in 24-well plates prepared with Vero cells. Serum samples from K18 mice and Syrian golden hamsters immunized as described in Example 5 (Figures 59, 99, and 106) were serially diluted followed by the addition of approximately 60 SARS-CoV-2 plaque-forming units and incubated for 1 ha at 37 °C in a 5% CO2 chamber. The virus-serum mixture was added to a confluent monolayer of Vero cells (CCL-81; ATCC, USA) previously prepared overnight and incubated for 1 ha at 37 °C in a 5% CO2 chamber. After this, the inoculum was discarded and the cells were covered with 1 mL of semi-solid Medium 199 supplemented with 5% fetal bovine serum (FBS) with carboxymethylcellulose (CMC) and incubated for 3 days at 37 °C in 5% CO2 before fixation with 1.25% (vol / vol) formalin.The cells were stained with crystal violet and the plates were photographed with the Biospot® image analyzer. The plates were then manually counted. The PRNT50 titer was expressed as the reciprocal of the serum dilution capable of neutralizing viral infection by 50%. Seropositivity rates were determined considering a serum dilution greater than 1:10 as the cutoff criterion for PRNT positivity.

[0363] Seroneutralization results against SARS-CoV-2 Delta Wuhan variant sera demonstrated that the non-optimized pseudouridine-modified Delta variant mRNA sequence of the present invention was able to perform cross-neutralization in formulations BI-1, BC-1, and BK-1, with best performance for formulation BI-1 (Figure 62-A).On the other hand, a decrease in neutralization capacity was observed when SARS-CoV-2 variant Omicron serum was used (Figure 62-B), although the BI-1 formulation demonstrated good post-challenge performance. Figure 68 shows that the neutralization results against SARS-CoV-2 variant Delta Wuhan sera corroborated the results found for anti-S, confirming better performance of the optimized sequences manufactured with pseudouridine, encapsulated in the BI-1 formulation.

[1195]

[0364] Figure 74 confirms better performance of the CP-1 formulations compared to the CG-1 formulations, and better performance of the pseudouridine-modified Delta RNA for cross-neutralization of the Wuhan strain (Figure 74-A), and better performance of the pseudouridine-modified optimized BA4 / BA5 Omicron RNA for homologous neutralization with the Omicron strain (Figure 74-B). The Control 2-1 formulation used in the experiment was formulated with optimized Delta mRNA prepared with methylpseudouridine.

[1196]

[0365] Figure 80 demonstrates that the Control 2-1 formulation and the CZ-1 formulation were also able to induce neutralizing antibodies against the Wuhan strain (A) and the Omicron strain (B) in animals immunized with the optimized Omicron BA4 / BA5 mRNA prepared with pseudouridine, with no significant difference between the pH (pH 4.0, 5.2 and 6.0) used for encapsulation. Figure 102 shows that K18 mice vaccinated with the CZ-1 formulation, containing 1, 2 or 4 pg of optimized Omicron XBB variant mRNA prepared with pseudouridine, showed detectable neutralizing antibody titers in the pre-challenge period, indicating induction of a functional humoral response. After viral challenge (3-6 and 14 dpi), titers remained elevated or increased slightly in the vaccinated groups.In the control group (Tris buffer 100mM, pH 7.4), titers remained undetectable at early times, but a late response was observed on day 14 post-challenge, consistent with a primary response to infection. These findings reinforce the vaccine's efficacy in promoting early protection and a more robust response to challenge with the SARS-CoV-2 omicron XBB virus.

[1197]

[0366] Finally, Figure 109 presents the viral neutralization data in vaccinated hamsters, highlighting the consistent induction of neutralizing antibodies by the CZ-1 formulation containing 1, 2, or 4 pg of XBB-optimized omicron mRNA with pseudouridine. All immunized groups already exhibited high titers before the challenge, which were maintained until day 14 post-infection. In contrast, in the control group (Tris buffer 100mM, pH 7.4), neutralizing antibodies were absent in the pre-challenge period and only appeared after viral exposure, characterizing a primary immune response.

[1198] Example 9 - Viral Load

[1199]

[0367] To assess viral load, SARS-CoV-2 RNA was quantified in oropharyngeal, lung, and brain swabs from animals after challenge with the SARS-CoV-2 virus, as described in Example 5 (Figures 59, 99, and 106). Swab and organ samples were initially processed in the biosafety level 3 (BSL-3) laboratory of the Oswaldo Cruz Institute / Fiocruz, using the QIAamp Viral RNA Mini Kit (QIAGEN, Hilden, GERMANY). 140 pL of the sample were added to 560 pL of lysis buffer, mixed by vortexing, incubated for 10 min at room temperature, and stored at -80 °C for 24 h until the extraction process was continued in a biosafety level 2 (BSL-2) laboratory. Subsequent extraction steps were performed according to the manufacturer's instructions.The standard curve was constructed using a commercially cloned plasmid 2019-nCoV_N_Positive Control (Cat 10006625 IDT) with 4012 bp, containing a 1260 bp sequence of the nucleoprotein region.

[1200]

[0368] After plasmid cloning in E. coll and DNA purification, the genomic copy number was determined from nanodrop reading using Avogadro's formula. The standard curve was serially diluted ten times at 7 Log10 - 2 Log10 copies per reaction, using RT-PCR Grade Water (Cat AM9935, Invitrogen) with yeast tRNA (Ambion - 100 ng / pL), to quantify the sample by RT-qPCR assays.

[1201]

[0369] RT-qPCR assays were performed on the ABI 7500 Real Time PCR System (Applied Biosystems, Foster City, CA), targeting the nucleoprotein region of the SARS-CoV-2 virus genome (NI and N2) by the 2019-nCoV CDC RUO-Integrated DNA technologies (IDT cat. 10006713) according to the CDC protocol (2020).

[0370] The following primers and probe were used for the NI region (72 base pair amplicon): Sense - 5' GACCCCAAAATCAGC GAAAT 3' (SEQ ID NO: 114), Antisense - 5' TCTGGTTACTGCCAGTTGAATCTG 3' (SEQ ID NO: 115) and hydrolysis probes: 5' FAM-ACCCCGC ATTACGTTTGGTGGACC-BHK 3' (SEQ ID NO: 116); N2 (67 base pair amplicon): Sense - 5' TTACAAACATTGGCCGCAAA 3' (SEQ ID NO: 117); Antisense: 5' GCGCGACA TTCCGAAGAA 3' (SEQ ID NO: 118) and hydrolysis probe: FAM-ACAATTTGCCCCCA GCGCTTCAG - BHK 3' (SEQ ID NO: 119).

[1202]

[0371] Monoplex reactions for the detection of NI and N2 targets were configured with 0.5 pM of each primer, 0.125 pM of TaqMan fluorogenic probe, TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher Scientific, Massachusetts, USA) and 5 pL of template in a final 20 pL volume. The thermal conditions were 50 °C, 15 min; 95 °C, 2 min and 40 cycles of 95 °C for 15 seconds and 60 °C for 33 seconds. For statistical evaluation of the viral load results obtained, the non-parametric Kruskal-Wallis test was applied, considering significance for p<0.05.

[1203]

[0372] Regarding the K18-hACE2 mice used in the heterologous challenge with the SARS-CoV-2 Gamma strain virus, viral load quantification in the oropharynx occurred on days 3 and 5 after the challenge, and viral load quantification in the lungs and brains occurred on days 5 and 6 after the challenge. Figure 63 shows that the non-optimized delta mRNAs modified with pseudouridine encapsulated in the control formulations 2-1, BI-1, BC-1, and BK-1 induced a significant decrease in viral load in the oropharynx of these animals on day 3 post-infection (Figure 63-A), which was maintained only in animals vaccinated with the BI-1 formulation on day 5 post-infection (Figure 63-B), although we also observed a decreasing trend in animals vaccinated with the other formulations.The pulmonary viral load of these same animals (Figure 64-A) also confirmed the superior performance of the BI-1 formulation with non-optimized delta mRNA modified with pseudouridine, although the brain viral loads also demonstrated excellent performance for the BC-1 and BK-1 formulations (Figure 64-B).

[1204]

[0373] Regarding the performance of the optimized formulations, it was possible to observe greater control of the viral load in the oropharynx of animals vaccinated with the optimized and non-optimized delta sequence, Omicron BA4 / BA5 optimized or with the bivalent vaccine, fully modified with methylpseudouridine or pseudouridine in the BI-1 formulation, which makes sense, since the delta sequence neutralizes the challenge virus, Sars-Cov2 strain Gamma, better (Figure 69-A - 3 DPI and Figure 69-B - 5 DPI). The same pattern was observed in the viral loads of the lung (Figure 70-A) and brain (Figure 70-B).

[1205]

[0374] Regarding formulations CP-1 and CG-1, once again it was possible to observe better performance in controlling the viral load in the oropharynx with formulation CP-1 compared to formulation CG-1 containing the tested mRNAs, as well as better performance of optimized mRNAs compared to non-optimized mRNAs, both being fully modified with pseudouridines (Figure 75-A - 3DPI and Figure 75-B - 5 DPI). Regarding pulmonary (Figure 76-A) and cerebral (Figure 76-B) viral load, no differences were observed between formulations CP-1 and CG-1, as both were able to efficiently control the viral load in these organs. In these experiments, the Control 2-1 formulation contained non-optimized delta RNA modified with n-methyl pseudouridine.

[1206]

[0375] In Figure 81 (A-3DPI and B-5DPI) and Figure 82 (A-lung and B-brain) it was possible to observe that the optimized omicron RNA modified with pseudouridine and formulated with CZ-1 was able to control viral loads, even being a heterologous challenge (omicron RNA x gamma challenge). In this case, the control formulation 2-1 contains the optimized BA4 / BA5 omicron RNA modified with pseudouridine.

[1207]

[0376] Regarding K18-hACE2 mice challenged with the SARS-CoV-2 virus omicron XBB strain (homologous challenge), viral load quantification in the oropharynx, lungs, and brains occurred on days 3 and 6 (3 dpi and 6 dpi) after virus challenge, as described in Example 5 (Figure 99). Figure 103 shows the protective effect of the CZ-1 formulation containing 1, 2, or 4 pg of optimized omicron XBB mRNA modified with pseudouridine. On 3 DPI (Figure 103 A), all vaccinated groups showed undetectable viral load in the upper airways, while the control group exhibited high viral replication. On 6 DPI (Figure 103 B), the immunized groups maintained significantly reduced viral load compared to the control, with most animals showing low or undetectable levels. These results indicate that vaccination was effective in limiting viral replication in the respiratory tract, contributing to local control of the infection and a possible reduction in transmissibility.

[1208]

[0377] Similar to what was observed in the oropharynx, the quantification of viral RNA in the lungs at 3 DPI (Figure 104 A) and 6 DPI (Figure 104 B) demonstrates that the CZ-1 formulation, containing 1, 2, or 4 pg of optimized XBB omicron mRNA modified with pseudouridine, was effective in containing viral replication in the lower airways. The reduced or absent detection of viral RNA in immunized animals reinforces the role of vaccination in controlling infection in different compartments of the respiratory tract.

[1209]

[0378] Figure 105 (A-3DPI and B-6DPI) reinforces the findings obtained in the respiratory compartments and demonstrates that vaccination with the CZ-1 formulation, containing 1, 2 or 4pg of optimized XBB omicron mRNA modified with pseudouridine, was effective not only in containing local virus replication, but also in preventing its detection in extrapulmonary tissues, such as the brain, contributing to the overall control of infection in the experimental model.

[1210]

[0379] Next, the results obtained with golden Syrian hamsters challenged with the SARS-CoV-2 virus omicron XBB strain (homologous challenge) are presented. The quantification of the viral load in the oropharynx and lungs of the animals occurred on days 3 and 6 (3dpi and 6 dpi) after the virus challenge, as described in Example 5 (Figure 106).

[1211]

[0380] Analysis of viral load in the oropharynx (Figure 110 A) revealed that, at 3 dpi, all CZ-1 formulations containing 1, 2, or 4 pg of optimized and pseudouridine-modified XBB omicron mRNA promoted significant reductions compared to the control group, with decreases of approximately 1.1 log10 for the formulation containing 1 pg mRNA, 1.5 log10 for the formulation containing 2 pg mRNA, and 1.2 log10 for the formulation containing 4 pg mRNA. At 6 dpi (Figure 110 B), these reductions were maintained, being 1.3 log10 for the formulation containing 1 pg of mRNA, 1.6 log10 for the formulation containing 2 pg of mRNA, and 1.1 log10 for the formulation containing 4 pg mRNA, with emphasis on the group that received the CZ-1 formulation containing 2 pg mRNA, which showed a statistically significant difference.

[1212]

[0381] These results demonstrate the effectiveness of the vaccine formulation in reducing the viral load in the upper airways of hamsters, consistent with data previously described in the literature for mRNA vaccines against SARS-CoV-2 in this model. In the study by Bernardin et al. (2024), for example, reductions of approximately 1 log10 in the oropharyngeal viral load of immunized hamsters were observed, both with the formulation developed by Afrigen Biologies and with the mRNA-1273 vaccine (Spikevax®, Moderna) used as a comparator, results that are similar to those obtained with the formulation that is the subject of this invention.

[1213]

[0382] Finally, the results obtained demonstrated that vaccination with the CZ-1 formulations, containing 1, 2, or 4 pg of optimized XBB omicron mRNA modified with pseudouridine, was effective in containing SARS-CoV-2 replication in the lungs of hamsters. The reduction in viral load was observed early, as early as 3 DPI (Figure 111 A), especially with the 2 pg and 4 pg formulations, and intensified until 6 DPI (Figure 111 B), when viral RNA became undetectable in almost all immunized animals. These findings reinforce the ability of the tested formulations to promote infection control in the lower respiratory tract, which are the main sites of SARS-CoV-2 virus replication.

[1214] Example 10 - Survival

[0383] Five (05) K18 mice from each group in each of the experiments were kept under observation for up to 14 days after inoculation with the Sars-Cov-2 virus Gamma strain (lethal challenge) to observe survival. We can observe that, despite the differences in immunogenicity of the BI-1, BC-1 and BK-1 formulations containing non-optimized delta mRNA modified with pseudouridine (Figure 65) and the BI-1 formulation containing optimized delta, non-optimized delta, optimized Omicron BA4 / BA5 or with the bivalent vaccine, all of these mRNAs being totally modified with pseudouridine or n-methylpseudouridine (Figure 71), all vaccines were able to induce 100% protection against the lethal challenge. Similarly, Figure 77 demonstrates that the CP-1 and CG-1 formulations with the mRNAs of the invention induced 100% protection, as did the CZ-1 formulations in Figure 83.

[1215]

[0384] For the homologous challenge with the SARS-COV-2 virus omicron XBB strain, no survival results were generated since this strain generates a milder infection and, therefore, the infected animals do not die.

[1216]

[0385] Thus, all the data presented in this document demonstrate that the optimized constructs performed better in terms of immunogenicity and viral load control, as well as proving the functionality of the 3' and 5' UTR elements of VEEV and the poly A tail size defined by the inventors.

[1217]

[0386] The invention therefore provides the following aspects:

[1218] 1. Platform for expression of non-replicating (conventional) messenger RNA (mRNA) comprising 5' UTR and 3' UTR regions of Venezuelan Equine Encephalitis Virus (VEEV), a short poly-A tail and at least one specific regulatory element.

[1219] 2. Platform for messenger RNA expression, according to aspect 1, wherein the short poly-A tail has approximately 30 to 80 adenine nucleotides.

[1220] 3. Platform for messenger RNA expression, according to either aspect 1 or 2, wherein the short poly-A tail has at least 40 adenine nucleotides.

[1221] 4. Platform for messenger RNA expression, according to any of aspects 1 to 3, where the regulatory element is a T7 RNA polymerase promoter.

[1222] 5. Platform for messenger RNA expression, in accordance with any of aspects 1 to 4, comprising the nucleotide sequence as defined in SEQ ID NO: 1.

[1223] 6. Platform for messenger RNA expression, in accordance with any of aspects 1 to 5, further comprising a co-transcriptional capping motif.

[1224] 7. Platform for messenger RNA expression, in accordance with any of aspects 1 to 6, comprising the nucleotide sequence as defined in SEQ ID NO: 2.

[1225] 8. Platform for messenger RNA expression, in accordance with any of aspects 1 to 7, further comprising a "strong gyrase site" (SGS) gene segment.

[1226] 9. Platform for messenger RNA expression, in accordance with any of aspects 1 to 8, comprising the nucleotide sequence as defined in SEQ ID NO: 3.

[1227] 10. Platform for messenger RNA expression, according to any one of aspects 1 to 9, further comprising a sequence. 11. Platform for messenger RNA expression, according to any one of aspects 1 to 10, comprising the nucleotide sequence as defined in SEQ ID NO: 4.

[1228] 12. Platform for messenger RNA expression, in accordance with any of aspects 1 to 11, further comprising at least one coding sequence of the protein of interest or fragment thereof and, optionally, additional regulatory elements.

[1229] 13. Platform for messenger RNA expression, according to aspect 12, wherein the protein of interest or a fragment thereof is preferably an antigen or a therapeutic protein or a fragment thereof.

[1230] 14. Platform for messenger RNA expression, according to aspect 13, wherein the antigen is preferably a viral, bacterial, parasitic or fungal antigen, or a fragment thereof.

[1231] 15. Platform for messenger RNA expression, according to any of aspects 13 to 14, wherein the antigen is preferably a viral antigen or a fragment thereof.

[1232] 16. Platform for messenger RNA expression, according to any of aspects 13 to 15, wherein the viral antigen is selected from the group comprising a SARS-CoV-2 or Yellow Fever protein or fragment thereof.

[1233] 17. Platform for messenger RNA expression, according to any of aspects 13 to 16, wherein the viral antigen is selected from the group comprising a SARS-CoV-2 Spike protein or structural (pre-membrane, transmembrane C protein fragment and envelope) or non-structural (NS1) proteins of the Yellow Fever virus or fragments thereof.

[1234] 18. Platform for messenger RNA expression, according to aspect 13, wherein the therapeutic protein is preferably an anti-PD-1 antibody or a fragment thereof.

[1235] 19. Platform for messenger RNA expression, according to either aspect 13 or 18, wherein therapeutic proteins are selected from the group comprising the light and heavy chains of an anti-PD1 antibody or fragments thereof.

[1236] 20. Platform for messenger RNA expression, according to any of aspects 12 to 19, in which the coding sequences or fragments thereof are optimized in silico.

[1237] 21. Platform for messenger RNA expression, as per aspect 20, wherein the in silico optimizations performed are selected from the group comprising adjustment of %GC content; use of codons for human hosts; removal of RNase splice sites; removal of Cis elements; removal of restriction enzyme sites and removal of repetitive elements.

[1238] 22. Platform for messenger RNA expression, according to any of aspects 12 to 21, wherein the additional regulatory elements are a kozak fragment and a signal peptide.

[1239] 23. Platform for messenger RNA expression, according to any of aspects 12 to 22, wherein coding sequences are selected from the group of nucleotide sequences as defined in SEQ ID NO: 57 to 66, 68 to 71 and 74 to 77 or fragments thereof.

[1240] 24. Platform for messenger RNA expression, according to any of aspects 1 to 23, comprising nucleotide sequences selected from SEQ ID NO: 20, 21, 23 to 32, 34 to 42, 44 to 52, and 88 to 111.

[1241] 25. Nucleic acid sequence comprising a coding region of a protein of interest or fragment thereof operationally linked to the 5' UTR and 3' UTR regions of Venezuelan Equine Encephalitis Virus (VEEV) and a short poly-A tail.

[1242] 26. Nucleic acid sequence, according to aspect 25, in which the short poly-A tail has about 30 to 80 adenine nucleotides.

[1243] 27. Nucleic acid sequence, according to any of aspects 25 to 26, in which the short poly-A tail has at least 40 adenine nucleotides.

[1244] 28. Nucleic acid sequence, according to any of aspects 25 to 27, in which the protein of interest or a fragment thereof is preferably an antigen or a therapeutic protein or a fragment thereof.

[1245] 29. Nucleic acid sequence, in accordance with aspect 28, wherein the antigen is preferably a viral, bacterial, parasitic or fungal antigen, or a fragment thereof.

[1246] 30. Nucleic acid sequence, according to any of aspects 28 to 29, wherein the antigen is preferably a viral antigen or a fragment thereof. 31. Nucleic acid sequence, according to any of aspects 28 to 30, wherein the viral antigen is selected from the group comprising a protein of SARS-CoV-2 or Yellow Fever or a fragment thereof.

[1247] 32. Nucleic acid sequence, according to any of aspects 29 to 31, in which the viral antigen is selected from the group comprising a SARS-CoV-2 Spike protein or structural (pre-membrane, transmembrane protein C fragment and envelope) or non-structural (NS1) proteins of the Yellow Fever virus or a fragment thereof.

[1248] 33. Nucleic acid sequence, according to aspect 28, in which the therapeutic protein is preferably an anti-PD-1 antibody or a fragment thereof.

[1249] 34. Nucleic acid sequence, according to either aspect 28 and 33, in which therapeutic proteins are selected from the group comprising the light and heavy chains of an anti-PD1 antibody or a fragment thereof.

[1250] 35. Nucleic acid sequence, according to any of aspects 25 to 34, in which the coding sequences of the protein of interest or a fragment thereof are optimized in silico.

[1251] 36. Nucleic acid sequence, according to aspect 35, wherein the in silico optimizations performed are selected from the group comprising adjustment of %GC content; use of codons for human hosts; removal of RNase splice sites; removal of Cis elements; removal of restriction enzyme sites and removal of repetitive elements. 37. Nucleic acid sequence, according to any of aspects 25 to 36, further comprising a kozak fragment and a signal peptide.

[1252] 38. Nucleic acid sequence, according to any of aspects 25 to 37, where the nucleic acid sequence is an RNA sequence.

[1253] 39. Nucleic acid sequence, according to any of aspects 25 to 38, wherein the nucleic acid sequence is a messenger RNA selected from SEQ ID NO: 7 to 18, 82 to 87, 112 and 113.

[1254] 40. Nucleic acid sequence, according to any of aspects 38 to 39, in which the messenger RNA comprises at least one uridine nucleoside substituted with n-methyl pseudouridine (m1ψ), pseudouridine (Ψ), 5-methoxyuridine (mo5U), 2-thiouridine (s2U), 5-methylcytidine (m5C) or N6-methyladenosine (m6A).

[1255] 41. Nucleic acid sequence, according to any of aspects 38 to 40, in which at least one uridine nucleoside is replaced by n-methyl pseudouridine or by pseudouridine (Ψ).

[1256] 42. Nucleic acid sequence, according to any of aspects 38 to 41, in which at least one uridine nucleoside is replaced by pseudouridines (Ψ).

[1257] 43. Pharmaceutical composition comprising a pharmaceutically effective amount of the nucleic acid sequence as defined in any of aspects 25 to 42 encapsulated in lipid nanoparticles.

[1258] 44. Pharmaceutical composition, according to aspect 43, wherein the lipid nanoparticles comprise a combination of structural lipids, sterol, cationic or ionizable lipids and pegylated lipids.

[1259] 45. Pharmaceutical composition, according to any of aspects 43 to 44, in which the lipid nanoparticles comprise:

[1260] - between 10 and 75% structural lipids,

[1261] - between 10 and 60% sterol,

[1262] between 5 and 60% of cationic or ionizable lipids and

[1263] - between 1.0 and 5.0% pegylated lipids.

[1264] 46. ​​Pharmaceutical composition, according to any one of aspects 43 to 45, in which the lipid nanoparticles comprise:

[1265] - between 10 and 45% structural lipids,

[1266] - between 10 and 60% sterol,

[1267] between 35 and 60% cationic or ionizable lipids and

[1268] - between 1.0 and 5.0% pegylated lipids.

[1269] 47. Pharmaceutical composition, according to any one of aspects 43 to 46, wherein the lipid nanoparticles comprise one of the following formulations:

[1270] a) Formulation G

[1271] - Between 10 and 45% of DSPC,

[1272] - between 10 and 60% cholesterol,

[1273] between 35 and 60% cationic or ionizable lipids (BP-LIPID-103) and

[1274] - between 1.0 and 5.0% of pegylated lipids (DMG-PEG (2000));

[1275] b) Formulation I

[1276] - Between 10 and 45% DSPC, - Between 10 and 60% cholesterol,

[1277] between 35 and 60% cationic or ionizable lipids (BP-LIPID-217) and

[1278] - between 1.0 and 5.0% of pegylated lipids (DMG-PEG (2000));

[1279] c) BI Formulation

[1280] - between 10 and 45% DOPE,

[1281] - between 10 and 60% cholesterol,

[1282] between 35 and 60% cationic or ionizable lipids (BP-LIPID-103) and

[1283] - between 1.0 and 5.0% of pegylated lipids (DMG-PEG (2000));

[1284] d) BC Formulation

[1285] - between 10 and 45% DOPE,

[1286] - between 10 and 60% cholesterol,

[1287] between 35 and 60% cationic or ionizable lipids (DODMA) and

[1288] - between 1.0 and 5.0% of pegylated lipids (DMG-PEG (2000));

[1289] e) BK Formulation

[1290] - between 10 and 45% DOPE,

[1291] - between 10 and 60% cholesterol,

[1292] between 35 and 60% cationic or ionizable lipids (BP-LIPID-217) and

[1293] - between 1.0 and 5.0% of pegylated lipids (DMG-PEG (2000));

[1294] f) CG Formulation

[1295] - between 10 and 45% DOPE,

[1296] - between 10 and 60% cholesterol, between 35 and 60% cationic or ionizable lipids (CERTEST-A) and

[1297] - between 1.0 and 5.0% of pegylated lipids (DMG-PEG (2000));

[1298] g) CP Formulation

[1299] - between 10 and 45% DOPE,

[1300] - between 10 and 60% cholesterol,

[1301] between 35 and 60% cationic or ionizable lipids (CERTEST-B) and

[1302] - between 1.0 and 5.0% of pegylated lipids (DMG-PEG (2000));

[1303] h) CZ Formulation

[1304] - between 10 and 45% DOPE,

[1305] - between 10 and 60% cholesterol,

[1306] between 35 and 60% cationic or ionizable lipids (JK-102-CA) and

[1307] - between 1.0 and 5.0% of pegylated lipids (DMG-PEG (2000)).

[1308] 48. Pharmaceutical composition, according to any one of aspects 43 to 47, wherein the lipid nanoparticles comprise one of the following formulations:

[1309] a) Gl Formulation

[1310] - 10% DSPC,

[1311] - 48% cholesterol,

[1312] - 40% of BP-LIPID-103 and

[1313] - 2.0% DMG-PEG (2000);

[1314] b) Formulation 1-1

[1315] - 40.7% DSPC,

[1316] - 14.5% cholesterol,

[1317] - 42.8% BP-LIPID-217 and - 2.0% DMG-PEG (2000); c) BI-1 Formulation

[1318] - 10% DOPE,

[1319] - 48% cholesterol,

[1320] - 40% BP-LIPID-103 and - 2.0% DMG-PEG (2000); d) BC-1 Formulation

[1321] - 10% DOPE,

[1322] - 48% cholesterol,

[1323] - 40% DODMA and

[1324] - 2.0% DMG-PEG (2000); e) BK-1 Formulation

[1325] - 10% DOPE,

[1326] - 48% cholesterol,

[1327] - 40% BP-LIPID-217 and - 2.0% DMG-PEG (2000); f) CG-1 Formulation

[1328] - 10% DOPE,

[1329] - 48% cholesterol,

[1330] - 40% of CERTEST-A and

[1331] - 2.0% DMG-PEG (2000); g) CP-1 Formulation

[1332] - 10% DOPE,

[1333] - 48% cholesterol,

[1334] - 40% of CERTEST-B and

[1335] - 2.0% DMG-PEG (2000); h) CZ-1 Formulation

[1336] - 10% DOPE,

[1337] - 48% cholesterol,

[1338] - 40% JK-102-CA and - 2.0% DMG-PEG (2000).

[1339] 49. Pharmaceutical composition, according to any of aspects 43 to 48, wherein the nanoparticles are stabilized in Tris-HCl buffer of 50 to 200 mM, pH 7.0 to 7.4 and wherein the composition further comprises a preservative / stabilizer in a concentration range of about 0 to 35%.

[1340] 50. Pharmaceutical composition, according to aspect 49, wherein the nanoparticles are stabilized in 100mM Tris-HCl buffer, pH 7.4, and wherein the composition further includes 10% sucrose.

[1341] 51. Pharmaceutical composition, according to any of aspects 43 to 50, wherein the composition is an immunogenic composition.

[1342] 52. Pharmaceutical composition, according to any of aspects 43 to 51, wherein the composition is a bivalent or monovalent vaccine.

[1343] 53. Pharmaceutical composition, according to aspect 52, wherein the monovalent vaccine comprises from 1 to 100 pg of a nucleic acid sequence as defined in either aspect 25 to 42 and the bivalent vaccine comprises from 0.5 to 50 pg of a first nucleic acid sequence as defined in either aspect 25 to 42 and 0.5 to 50 pg of a second nucleic acid sequence as defined in either aspect 25 to 42.

[1344] 54. Pharmaceutical composition, according to any of aspects 43 to 53, in which it is a therapeutic composition.

[1345] 55. Pharmaceutical composition, according to aspect 54, wherein said therapeutic composition contains a pharmaceutically effective dose concentration of mRNA. 56. Pharmaceutical composition, according to any of aspects 43 to 55, wherein it is administered intranasally, sublingually, orally or parenterally, which includes subcutaneous, transcutaneous, intravenous, epidural, intramuscular, delivery pumps, or infusion.

[1346] 57. Pharmaceutical composition, according to any of aspects 43 to 56, wherein the composition is administered by the intramuscular or intravenous route.

[1347] 58. Use of the nucleic acid sequence as defined in any of aspects 25 to 42 or of the pharmaceutical composition as defined in any of aspects 43 to 57 to prepare a medicament for preventing and / or treating diseases.

[1348] 59. Use, according to aspect 58, where the disease is preferably a viral, bacterial, parasitic, fungal or neoplastic disease.

[1349] 60. Use, in accordance with any of aspects 58 to 59, wherein the disease is selected from the group comprising severe acute respiratory syndrome caused by coronavirus (SARS-CoV-2), yellow fever virus infections or neoplasms sensitive to PD-1 / PD-L1 axis blockade.

[1350] 61. A method for preventing and / or treating diseases comprising administering an effective amount of at least one nucleic acid sequence, as defined in any one of aspects 25 to 42, or a pharmaceutical composition as defined in any one of aspects 43 to 57, to an individual in need thereof.

[1351] 62. Method, according to aspect 61, in which the disease is preferably a viral, bacterial, parasitic, fungal, or neoplastic disease. 63. Method, according to either aspect 61 or 62, in which the disease is selected from the group comprising severe acute respiratory syndrome caused by coronavirus (SARS-CoV-2), yellow fever virus infections, or neoplasms sensitive to PD-1 / PD-L1 axis blockade.

[1352] 64. Method for preparing the pharmaceutical composition as defined in any one of aspects 43 to 57, comprising encapsulating a nucleic acid sequence as defined in any one of aspects 25 to 42 in lipid nanoparticles as defined in any one of aspects 43 to 57 by a microfluidic process.

[1353]

[0387] Thus, the embodiments and aspects presented in the present invention do not limit the totality of possibilities, it being understood that various omissions, substitutions and alterations may be made by a person skilled in the art, without departing from the spirit and scope of the present invention.

[1354]

[0388] It is expressly provided that all combinations of elements that perform the same function substantially in the same way to achieve the same results are within the scope of the invention. Substitutions of elements from one described embodiment for another are also fully intended and contemplated.

[1355]

[0389] It is also necessary to understand that the drawings are not necessarily to scale, but that they are merely conceptual in nature.

[1356]

[0390] Skilled individuals will appreciate the knowledge presented here and will be able to reproduce the invention in the embodiments shown and in other variants covered by the scope of the claims.

Claims

1. CLAIMS 1. Platform for expression of non-replicating (conventional) messenger RNA (mRNA) characterized by comprising 5' UTR and 3' UTR regions of Venezuelan Equine Encephalitis Virus (VEEV), a short poly-A tail and at least one specific regulatory element.

2. Platform for messenger RNA expression, according to claim 1, characterized in that the short poly-A tail has about 30 to 80 adenine nucleotides.

3. Platform for messenger RNA expression, according to any one of claims 1 to 2, characterized in that the short poly-A tail has at least 40 adenine nucleotides.

4. Platform for messenger RNA expression, according to any one of claims 1 to 3, characterized in that the regulatory element is a T7 RNA polymerase promoter.

5. Platform for messenger RNA expression, according to any one of claims 1 to 4, characterized in that it comprises the nucleotide sequence as defined in SEQ ID NO:

1.

6. Platform for messenger RNA expression, according to any one of claims 1 to 5, characterized in that it further comprises a motif for co-transcriptional capping.

7. Platform for messenger RNA expression, according to any one of claims 1 to 6, characterized in that it comprises the nucleotide sequence as defined in SEQ ID NO:

2.

8. Platform for messenger RNA expression, according to any one of claims 1 to 7, characterized in that it further comprises a "strong gyrase site" (SGS) gene segment.

9. Platform for messenger RNA expression, according to any one of claims 1 to 8, characterized in that it comprises the nucleotide sequence as defined in SEQ ID NO:

3.

10. Platform for messenger RNA expression, according to any one of claims 1 to 9, characterized in that it further comprises a cer sequence.

11. Platform for messenger RNA expression, according to any one of claims 1 to 10, characterized in that it comprises the nucleotide sequence as defined in SEQ ID NO:

4.

12. Platform for messenger RNA expression, according to any one of claims 1 to 11, characterized in that it further comprises at least one coding sequence of the protein of interest or a fragment thereof and, optionally, additional regulatory elements.

13. Platform for messenger RNA expression, according to claim 12, characterized in that the protein of interest or a fragment thereof is preferably an antigen or a therapeutic protein or a fragment thereof.

14. Platform for messenger RNA expression, according to claim 13, characterized in that that the antigen is preferably a viral, bacterial, parasitic, or fungal antigen, or a fragment thereof.

15. Platform for messenger RNA expression, according to any one of claims 13 to 14, characterized in that the antigen is preferably a viral antigen or a fragment thereof.

16. Platform for messenger RNA expression, according to any one of claims 13 to 15, characterized in that the viral antigen is selected from the group comprising a SARS-CoV-2 or Yellow Fever protein or fragment thereof.

17. Platform for messenger RNA expression, according to any one of claims 13 to 16, characterized in that the viral antigen is selected from the group comprising a SARS-CoV-2 Spike protein or structural (pre-membrane, transmembrane protein C fragment and envelope) or non-structural (NS1) proteins of the Yellow Fever virus or fragments thereof.

18. Platform for messenger RNA expression, according to claim 13, characterized in that the therapeutic protein is preferably an anti-PD-1 antibody or a fragment thereof.

19. Platform for messenger RNA expression, according to any one of claims 13 and 18, characterized in that the therapeutic proteins are selected from the group comprising the light and heavy chains of an anti-PD1 antibody or fragments thereof.

20. Platform for messenger RNA expression, according to any one of claims 12 to 19, characterized by the fact that the coding sequences or fragments thereof are optimized in silico.

21. Messenger RNA expression platform according to claim 20, characterized in that the in silico optimizations performed are selected from the group comprising adjustment of %GC content; use of codons for human hosts; removal of RNase splicing sites; removal of Cis elements; removal of restriction enzyme sites and removal of repetitive elements.

22. Platform for messenger RNA expression, according to any one of claims 12 to 21, characterized in that the additional regulatory elements are a kozak fragment and a signal peptide.

23. Platform for messenger RNA expression, according to any one of claims 12 to 22, characterized in that coding sequences are selected from the group of nucleotide sequences as defined in SEQ ID NO: 57 to 66, 68 to 71 and 74 to 77 or fragments thereof.

24. Platform for messenger RNA expression, according to any one of claims 1 to 23, characterized in that it comprises nucleotide sequences selected from SEQ ID NO: 20, 21, 23 to 32, 34 to 42, 44 to 52, and 88 to 111.

25. Nucleic acid sequence characterized in that it comprises a coding region for a protein of interest or a fragment thereof operationally linked to the 5' UTR and 3' UTR regions of Venezuelan Equine Encephalitis Virus (VEEV) and a short poly-A tail.

26. Nucleic acid sequence according to claim 25, characterized in that the short poly-A tail has about 30 to 80 adenine nucleotides.

27. Nucleic acid sequence, according to any one of claims 25 to 26, characterized in that the short poly-A tail has at least 40 adenine nucleotides.

28. Nucleic acid sequence, according to any one of claims 25 to 27, characterized in that the protein of interest or a fragment thereof is preferably an antigen or a therapeutic protein or a fragment thereof.

29. Nucleic acid sequence according to claim 28, characterized in that the antigen is preferably a viral, bacterial, parasitic or fungal antigen, or a fragment thereof.

30. Nucleic acid sequence, according to any one of claims 28 to 29, characterized in that the antigen is preferably a viral antigen or a fragment thereof.

31. Nucleic acid sequence, according to any one of claims 28 to 30, characterized in that the viral antigen is selected from the group comprising a protein of SARS-CoV-2 or Yellow Fever or fragments thereof.

32. Nucleic acid sequence, according to any one of claims 29 to 31, characterized in that the viral antigen is selected from the group comprising a SARS-CoV-2 Spike protein or proteins Structural (pre-membrane, transmembrane protein C fragment and envelope) or non-structural (NS1) components of the Yellow Fever virus, or a fragment thereof.

33. Nucleic acid sequence according to claim 28, characterized in that the therapeutic protein is preferably an anti-PD-1 antibody or a fragment thereof.

34. Nucleic acid sequence, according to any one of claims 28 and 33, characterized in that the therapeutic proteins are selected from the group comprising the light and heavy chains of an anti-PD1 antibody or a fragment thereof.

35. Nucleic acid sequence, according to any one of claims 25 to 34, characterized in that the coding sequences of the protein of interest or a fragment thereof are optimized in silico.

36. Nucleic acid sequence, according to claim 35, characterized in that the optimizations performed in silico are selected from the group comprising adjustment of %GC content; use of codons for human hosts; removal of RNase splicing sites; removal of Cis elements; removal of restriction enzyme sites and removal of repetitive elements.

37. Nucleic acid sequence, according to any one of claims 25 to 36, characterized in that it further comprises a kozak fragment and a signal peptide.

38. Nucleic acid sequence, according to any one of claims 25 to 37, characterized by The fact that the nucleic acid sequence is an RNA sequence.

39. Nucleic acid sequence, according to any one of claims 25 to 38, characterized in that the nucleic acid sequence is a messenger RNA selected from SEQ ID NO: 7 to 18, 82 to 87, 112 and 113.

40. Nucleic acid sequence, according to any one of claims 38 to 39, characterized in that the messenger RNA comprises at least one uridine nucleoside substituted with n-methyl pseudouridine (m1ψ), pseudouridine (Ψ), 5-methoxyuridine (mo5U), 2-thiouridine (s2U), 5-methylcytidine (m5C) or N6-methyladenosine (m6A).

41. Nucleic acid sequence, according to any one of claims 38 to 40, characterized in that at least one uridine nucleoside is substituted for n-methyl pseudouridine or for pseudouridine (Ψ).

42. Nucleic acid sequence, according to any one of claims 38 to 41, characterized in that at least one uridine nucleoside is replaced by pseudouridines (Ψ).

43. Pharmaceutical composition characterized in that it comprises a pharmaceutically effective amount of the nucleic acid sequence as defined in any one of claims 25 to 42 encapsulated in lipid nanoparticles.

44. Pharmaceutical composition, according to claim 43, characterized in that the lipid nanoparticles comprise a combination of Structural lipids, sterols, cationic or ionizable lipids, and pegylated lipids.

45. Pharmaceutical composition, according to any one of claims 43 to 44, characterized in that the lipid nanoparticles comprise: 45.- between 10 and 75% structural lipids, 46.- between 10 and 60% sterol, 47.- between 5 and 60% cationic or ionizable lipids and - between 1.0 and 5.0% pegylated lipids.

46. ​​Pharmaceutical composition, according to any one of claims 43 to 45, characterized in that the lipid nanoparticles comprise: 49.- between 10 and 45% of structural lipids, 50.- between 10 and 60% sterol, 51.- between 35 and 60% of cationic or ionizable lipids and 52.- between 1.0 and 5.0% pegylated lipids.

47. Pharmaceutical composition, according to any one of claims 43 to 46, characterized in that the lipid nanoparticles comprise one of the following formulations: 54.a) Formulation G 55.- between 10 and 45% of DSPC, 56.- between 10 and 60% cholesterol, 57.- between 35 and 60% of cationic or ionizable lipids (BP-LIPID- 103) and 58. between 1.0 and 5.0% of pegylated lipids (DMG-PEG (2000)); 59.b) Formulation I 60. - Between 10 and 45% of DSPC, - Between 10 and 60% of cholesterol, 61.- between 35 and 60% cationic or ionizable lipids (BP-LIPID-217) and 62. between 1.0 and 5.0% of pegylated lipids (DMG-PEG (2000)); 63.c) BI Formulation 64.- between 10 and 45% DOPE, 65.- between 10 and 60% cholesterol, 66.- between 35 and 60% cationic or ionizable lipids (BP-LIPID- 103 ) and 67. between 1.0 and 5.0% of pegylated lipids (DMG-PEG (2000)); 68.d) BC Formulation 69.- between 10 and 45% DOPE, 70.- between 10 and 60% cholesterol, 71.- between 35 and 60% cationic or ionizable lipids (DODMA) and 72. between 1.0 and 5.0% of pegylated lipids (DMG-PEG (2000)); 73.e) BK Formulation 74.- between 10 and 45% DOPE, 75.- between 10 and 60% cholesterol, 76.- between 35 and 60% cationic or ionizable lipids (BP-LIPID-217) and 77. between 1.0 and 5.0% of pegylated lipids (DMG-PEG (2000)); 78.f) CG Formulation 79.- between 10 and 45% DOPE, 80.- between 10 and 60% cholesterol, - between 35 and 60% cationic or ionizable lipids (CERTEST-A) and 81. between 1.0 and 5.0% of pegylated lipids (DMG-PEG (2000)); 82.g) CP Formulation 83.- between 10 and 45% DOPE, 84.- between 10 and 60% cholesterol, 85.- between 35 and 60% cationic or ionizable lipids (CERTEST-B) and 86. between 1.0 and 5.0% of pegylated lipids (DMG-PEG (2000)); 87.h) CZ Formulation 88.- between 10 and 45% DOPE, 89.- between 10 and 60% cholesterol, 90.- between 35 and 60% cationic or ionizable lipids (JK-102-CA) and 91. between 1.0 and 5.0% of pegylated lipids (DMG-PEG (2000)).

48. Pharmaceutical composition, according to any one of claims 43 to 47, characterized in that the lipid nanoparticles comprise one of the following formulations: 93.a) Gl Formulation 94.- 10% DSPC, 95.- 48% cholesterol, 96.- 40% of BP-LIPID-103 and 97.- 2, 0% DMG-PEG (2000); 98.b) Formulation 1-1 99.- 40.7% DSPC, 100.- 14.5% cholesterol, -42.8% BP-LIPID-217 and -2.0% DMG-PEG (2000); c) BI-1 Formulation 101.- 10% DOPE, 102.- 48% cholesterol, 103.- 40% BP-LIPID-103 and - 2.0% DMG-PEG (2000); d) BC-1 Formulation 104.- 10% DOPE, 105.- 48% cholesterol, 106.- 40% of DODMA and 107.- 2.0% DMG-PEG (2000); e) BK-1 Formulation 108.- 10% DOPE, 109.- 48% cholesterol, 110.- 40% BP-LIPID-217 and - 2.0% DMG-PEG (2000); f) CG-1 Formulation 111.- 10% DOPE, 112.- 48% cholesterol, 113.- 40% of CERTEST-A and 114.- 2.0% DMG-PEG (2000); g) CP-1 Formulation 115.- 10% DOPE, 116.- 48% cholesterol, 117.- 40% of CERTEST-B and 118.- 2.0% DMG-PEG (2000); h) CZ-1 Formulation 119.- 10% DOPE, 120.- 48% cholesterol, - 40% JK-102-CA and 121.- 2.0% from DMG-PEG (2000).

49. Pharmaceutical composition, according to any one of claims 43 to 48, characterized in that the nanoparticles are stabilized in Tris-HCl buffer of 50 to 200 mM, pH of 7.0 to 7.4 and in that the composition further comprises a preservative / stabilizer in a concentration range of about 0 to 35%.

50. Pharmaceutical composition, according to claim 49, characterized in that the nanoparticles are stabilized in 100mM Tris-HCl buffer, pH 7.4, and in that the composition further comprises 10% sucrose.

51. Pharmaceutical composition, according to any one of claims 43 to 50, characterized in that it is an immunogenic composition.

52. Pharmaceutical composition, according to any one of claims 43 to 51, characterized in that the composition is a bivalent or monovalent vaccine.

53. Pharmaceutical composition, according to claim 52, characterized in that the monovalent vaccine comprises from 1 to 100 pg of a nucleic acid sequence as defined in any one of claims 25 to 42 and the bivalent vaccine comprises from 0.5 to 50 pg of a first nucleic acid sequence as defined in any one of claims 25 to 42 and 0.5 to 50 pg of a second nucleic acid sequence as defined in any one of claims 25 to 42.

54. Pharmaceutical composition, according to any one of claims 43 to 53, characterized in that it is a therapeutic composition.

55. Pharmaceutical composition, according to claim 54, characterized in that the therapeutic composition contains a pharmaceutically effective concentration of mRNA per dose.

56. Pharmaceutical composition, according to any one of claims 43 to 55, characterized in that it is administered intranasally, sublingually, orally, or parenterally, which includes subcutaneous, transcutaneous, intravenous, epidural, intramuscular, delivery pumps, or infusion.

57. Pharmaceutical composition, according to any one of claims 43 to 56, characterized in that it is administered intramuscularly or intravenously.

58. Use of the nucleic acid sequence as defined in any one of claims 25 to 42 or of the pharmaceutical composition as defined in any one of claims 43 to 57, characterized in that it is for preparing a medicament to prevent and / or treat diseases.

59. Use according to claim 58, characterized in that the disease is preferably a viral, bacterial, parasitic, fungal or neoplastic disease.

60. Use, according to any of claims 58 to 59, characterized in that the disease is selected from the group comprising severe acute respiratory syndrome caused by coronavirus (SARS-CoV-2) infections caused by the Yellow Fever virus or neoplasms sensitive to blockade of the PD-1 / PD-L1 axis.

61. A method for preventing and / or treating diseases, characterized in that it comprises administering an effective amount of at least one nucleic acid sequence, as defined in any one of claims 25 to 42, or a pharmaceutical composition as defined in any one of claims 43 to 57, to an individual in need thereof.

62. Method according to claim 61, characterized in that the disease is preferably a viral, bacterial, parasitic, fungal or neoplastic disease.

63. Method, according to any one of claims 61 to 62, characterized in that the disease is selected from the group comprising severe acute respiratory syndrome caused by coronavirus (SARS-CoV-2), yellow fever virus infections or neoplasms sensitive to PD-1 / PD-L1 axis blockade.

64. Method for preparing the pharmaceutical composition as defined in any one of claims 43 to 57, characterized in that it comprises encapsulating a nucleic acid sequence as defined in any one of claims 25 to 42 in lipid nanoparticles as defined in any one of claims 43 to 57 by a microfluidic process.