Transcriptional regulatory sequences specific for immune cells and uses thereof

A synthetic expression cassette with ELF1 binding sites addresses the challenge of specific gene expression in T cells and NK cells, enhancing therapy efficacy by reducing construct size and improving specificity and safety.

WO2026123110A1PCT designated stage Publication Date: 2026-06-18VALORISATION HSJ LLP

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
VALORISATION HSJ LLP
Filing Date
2025-12-10
Publication Date
2026-06-18

AI Technical Summary

Technical Problem

Current gene therapy methods face challenges in achieving specific gene expression in targeted cell subtypes, such as T cells and NK cells, due to the use of large and non-specific transcriptional enhancer sequences, leading to potential hazards and inefficiencies in CAR immune cell therapy.

Method used

A synthetic expression cassette with a minimal promoter and a transcriptional enhancer of 150-300 nucleotides, incorporating binding sites for the ELF1 transcription factor, specifically designed for targeted expression in T cells and NK cells, reducing construct size and enhancing specificity.

🎯Benefits of technology

The designed cassette enables controlled and specific gene expression in targeted immune cells, addressing issues of T-cell exhaustion and cytokine release syndrome, while allowing continuous replenishment of CAR-modified cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CA2025051656_18062026_PF_FP_ABST
    Figure CA2025051656_18062026_PF_FP_ABST
Patent Text Reader

Abstract

New synthetic expression cassettes comprising a minimal promoter and an immune cell- specific enhancer for expression of a nucleic acid of interest in immune cells such as T cells and NK cells are disclosed. Vectors and host cells comprising such synthetic expression cassettes are also disclosed. The application also discloses methods for expressing a nucleic acid of interest, such as a nucleic acid encoding a chimeric antigen receptor (CAR), in a cell and for treating diseases or conditions such as cancers and genetic diseases using the synthetic expression cassettes, vectors and cells.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] TRANSCRIPTIONAL REGULATORY SEQUENCES SPECIFIC FOR IMMUNE CELLS AND USES THEREOF

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] The present application claims the benefit of U.S. provisional patent application serial No. 63 / 730,814, filed on December 11 , 2024, which is incorporated herein by reference in its entirety.

[0004] SEQUENCE LISTING

[0005] A sequence listing is submitted herewith as an XML file named G12810-00905_Seq Listing. xml, created on December 10, 2025, and having a size of ~ 33,793 bytes. The content of the aforementioned file is hereby incorporated by reference in its entirety.

[0006] TECHNICAL FIELD

[0007] The present disclosure generally relates to the targeted expression of genes in specific cell subtypes, and more particularly in T cells and natural killer (NK) cells, which may be used in gene therapy, hematopoietic stem cell (HSC) engineering and cell-based therapy.

[0008] BACKGROUND ART

[0009] The targeted expression of a transduced gene in a given cell subtype or tissue is challenging. With the growing fields of stem cell engineering and inducible pluripotent stem cells (iPS) research, there is a need for the ability to express a given protein only in targeted populations stemming from the parent cell. However, the use of traditional / natural promoter is faced with the technical issue of size and sometimes specificity. For example, currently, gene therapy for hematopoietic-related disorders relies on the transduction of HSC with a transgene under the control of a strong promoter1 2. With this type of construct, the cells that originate from the modified stem cells will express the new gene, irrespectively of the cell subtype, which could potentially lead to hazardous consequences.

[0010] Chimeric Antigen Receptor (CAR) immune cell therapy has emerged as a promising new therapeutic tool against various cancers. In CAR immune cell therapy, patient’s immune cells (e.g., T cells, NK cells) are engineered to express CARs that binds to tumor antigens, which permits the specific killing of tumor cells expressing the antigen. Currently, this strategy, although potent, typically does not last because of T-cell exhaustion and loss of engineered T cells in vivo. Moreover, the infusion of a large number of CAR-T cells may lead to high toxicity due to a massive release of cytokines (cytokine release syndrome). There is thus a need for an approach that permits the continuous and progressive replenishment of CAR-modified cells in the circulation, and which limits the expression of the CAR only to specific cells (e.g., T cells, NK cells). Transcriptional enhancer sequences for the specific expression of genes in immune cells such as T cells and NK cells are disclosed in PCT publication No. WO 2020 / 150832. However, the transcriptional enhancer sequences disclosed in this document are long sequences, which increases the size of constructs comprising the transcriptional enhancers.

[0011] The present description refers to a number of documents, the content of which is herein incorporated by reference in their entirety.

[0012] SUMMARY OF THE INVENTION

[0013] The present disclosure provides the following items 1 to 61 :

[0014] 1 . A synthetic expression cassette comprising:

[0015] (i) a minimal promoter; and

[0016] (ii) a transcriptional enhancer operatively coupled to the minimal promoter for expression of the nucleic acid of interest in the cell, wherein the transcriptional enhancer (a) has a length of 150 nucleotides or less and comprises at least one binding site for E74 like ETS transcription factor 1 (ELF1); or (b) has a length of 300 nucleotides or less and comprises at least two binding sites for ELF 1 .

[0017] 2. The synthetic expression cassette of item 1 , wherein the binding site for ELF1 comprises a sequence having at least 80% or 90% sequence identity with the sequence CAATACAGCAAGCGGAAG (SEQ ID NO:1) or CAATACAGCAAGX1GGAX2G (SEQ ID NO:2), wherein X1is C or A and X2is A or T.

[0018] 3. The synthetic expression cassette of item 2, wherein the binding site for ELF1 comprises the sequence CAATACAGCAAGCGGAAG (SEQ ID NO:1) or CAATACAGCAAGX1GGAX2G (SEQ ID NO:2).

[0019] 4. The synthetic expression cassette of any one of items 1 to 3, wherein the at least one binding site is at least two binding sites.

[0020] 5. The synthetic expression cassette of any one of items 1 to 3, wherein the at least one binding site or at least two binding sites is at least three binding sites.

[0021] 6. The synthetic expression cassette of any one of items 1 to 3, wherein at least one binding site or at least two binding sites is from three to nine binding sites, for example from three to six binding sites.

[0022] 7. The synthetic expression cassette of any one of items 1 to 6, wherein at least two binding sites are directly linked to each other.

[0023] 8. The synthetic expression cassette of any one of items 4 to 6, wherein at least two binding sites are separated from each other by 1 to 10 nucleotides.

[0024] 9. The synthetic expression cassette of item 8, wherein at least two binding sites are separated from each other by 1 to 5 nucleotides. 10. The synthetic expression cassette of item 9, wherein at least two binding sites are separated from each other by 2 nucleotides.

[0025] 1 1 . The synthetic expression cassette of any one of items 1 to 10, wherein the transcriptional enhancer has a length of 100 nucleotides or less.

[0026] 12. The synthetic expression cassette of any one of items 1 to 10, wherein the transcriptional enhancer has a length of 80 nucleotides or less.

[0027] 13. The synthetic expression cassette of any one of items 1 to 3, wherein the transcriptional enhancer comprises a sequence having at least 90% identity with the following sequence: TGACACCACACCCCACTTCCTCCCGCGGGCGTGTGACACTTTTCAAAGAAAATACAGTATT TGGTAGTATCAATACAGCAAGCGGAAGCA (SEQ ID NO:6).

[0028] 14. The synthetic expression cassette of item 13, wherein the transcriptional enhancer comprises the following sequence: TGACACCACACCCCACTTCCTCCCGCGGGCGTGTGACACTTTTCAAAGAAAATACAGTATT TGGTAGTATCAATACAGCAAGCGGAAGCA (SEQ ID NO:6).

[0029] 15. The synthetic expression cassette of any one of items 1 to 3, wherein the transcriptional enhancer comprises a sequence of one of the following formulas:

[0030] • (A-B1-A)n, wherein A is an ELF1 binding site, B1is a nucleotides sequence of 1 to 15 nucleotides or is absent; n is an integer from 1 to 5;

[0031] • (A1-B1-A2-B2-A3)m, wherein A1, A2and A3are each independently an ELF1 binding site, B1and B2are each independently a nucleotides sequence of 1 to 15 nucleotides or are absent; m is an integer from 1 to 3;

[0032] • (A1-B1-A2-B2-A3-B3-A4-B4-A5)p, wherein A1, A2, A3, A4and A5are each independently an ELF1 binding, B1, B2, B3and B4are each independently a nucleotides sequence of 1 to 15 nucleotides or are absent; p is 1 or 2; or

[0033] • (A1-B1-A2-B2-A3-B3-A4-B4-A5-B5-A6-B6-A7), wherein A1, A2, A3, A4, A5, A6and A7are each independently an ELF1 binding site, B1, B2, B3B4, B5and B6are each independently a nucleotides sequence of 1 to 15 nucleotides or are absent.

[0034] 16. The synthetic expression cassette of any one of items 1 to 15, wherein the minimal promoter is SCP1 , miniCMV, CMV53, minP, HSV TK (miniTK), minSV40, MLP, pJB42CAT5, or YB_TATA.

[0035] 17. The synthetic expression cassette of item 16, wherein the minimal promoter is MLP.

[0036] 18. The synthetic expression cassette of any one of items 1 to 17, wherein the transcriptional enhancer is upstream of the minimal promoter in the synthetic expression cassette.

[0037] 19. The synthetic expression cassette of any one of items 1 to 18, further comprising a polyadenylation (poly(A)) signal.

[0038] 20. The synthetic expression cassette of any one of items 1 to 19, further comprising a transcriptional termination signal. 21. The synthetic expression cassette of any one of items 1 to 20, further comprising the nucleic acid of interest operatively coupled to the minimal promoter and transcriptional enhancer.

[0039] 22. The synthetic expression cassette of any one of items 1 to 21 , further comprising a selectable marker.

[0040] 23. The synthetic expression cassette of any one of items 1 to 22, wherein the synthetic expression cassette is for expressing a nucleic acid of interest in a natural killer (NK) cell and / or T cell.

[0041] 24. The synthetic expression cassette of item 23, wherein the nucleic acid of interest encoded a chimeric antigen receptor (CAR).

[0042] 25. A vector comprising the synthetic expression cassette of any one of items 1 to 24.

[0043] 26. The vector of item 25, wherein the vector is a viral vector.

[0044] 27. A host cell comprising the synthetic expression cassette of any one of items 1 to 24 or the vector of item 25 or 26.

[0045] 28. The host cell of item 27, wherein said cell is a hematopoietic stem cell, a T cell, or a natural killer (NK) cell.

[0046] 29. A composition comprising the synthetic expression cassette of item 23 or 24, the vector of item 25 or 26, or the host cell of item 27 or 28.

[0047] 30. A method for inducing the expression of a nucleic acid of interest by a cell, the method comprising introducing the synthetic expression cassette of item 23 or 24, or the vector of item 25 or 26 in the cell.

[0048] 31 . The method of item 30, wherein said method is in vivo.

[0049] 32. The method of item 30, wherein said method is in vitro.

[0050] 33. The method of any one of items 30 to 32, wherein the synthetic expression cassette or vector is introduced into the genome of the cell.

[0051] 34. The method of item 33, wherein the synthetic expression cassette or vector is introduced into the genome of the cell by CRISPR / Cas technology.

[0052] 35. The method of any one of items 30 to 34, wherein the nucleic acid of interest encodes a protein that is absent or defective in said cell.

[0053] 36. The method of any one of items 30 to 34, wherein the nucleic acid of interest encodes a chimeric antigen receptor (CAR).

[0054] 37. The method of any one of items 33 to 36, wherein said cell is a hematopoietic stem cell, a T cell, or a natural killer (NK) cell.

[0055] 38. A method for treating a disease, condition or disorder in a subject, the method comprising administering an effective amount of the synthetic expression cassette of item 23 or 24, the vector of item 25 or 26, the cell of item 27 or 28, or the composition of item 29, to said subject. 39. The method of item 38, wherein the disease, condition or disorder is associated with the absence of expression of a protein or the expression of a defective protein, and wherein the nucleic acid of interest encodes a functional form of the protein.

[0056] 40. The method of item 38, wherein the disease, condition or disorder is associated with expression of an antigen, and wherein the nucleic acid of interest encodes a recombinant receptor that specifically binds to the antigen.

[0057] 41. The method of item 40, wherein the recombinant receptor is a chimeric antigen receptor (CAR).

[0058] 42. The method of item 40 or 41 , wherein the disease, condition or disorder is a cancer, an autoimmune or inflammatory disease, or an infectious disease.

[0059] 43. The method of item 42, wherein the disease, condition or disorder is a cancer.

[0060] 44. The method of item 43, wherein the cancer is a hematological cancer.

[0061] 45. The method of any one of items 38 to 44, wherein the method comprises introducing the synthetic expression cassette or vector into the genome of a cell from the subject.

[0062] 46. The method of item 45, wherein the synthetic expression cassette or vector is introduced into the genome of the cell by CRISPR / Cas technology.

[0063] 47. The method of any one of items 38 to 44, wherein said method comprises administering at least 1 x 102, 1 x 103or 1 x 104cells to said subject.

[0064] 48. The method of item 47, wherein said method comprises administering 1 x 106to 1 x 108cells to said subject.

[0065] 49. The method of any one of items 38 to 48, wherein said cells are autologous cells.

[0066] 50. The method of any one of items 38 to 48, wherein said cells are allogeneic cells.

[0067] 51 . The synthetic expression cassette of item 23 or 24, the vector of item 25 or 26, the cell of item 27 or 28, or the composition of item 29, for use in treating a disease, condition or disorder in a subject.

[0068] 52. The synthetic expression cassette, vector, cell or composition for use according to item 51 , wherein the disease, condition or disorder is associated with the absence of expression of a protein or the expression of a defective protein, and wherein the nucleic acid of interest encodes a functional form of the protein.

[0069] 53. The synthetic expression cassette, vector, cell or composition for use according to item 51 , wherein the disease, condition or disorder is associated with expression of an antigen, and wherein the nucleic acid of interest encodes a recombinant receptor that specifically binds to the antigen.

[0070] 54. The synthetic expression cassette, vector, cell or composition for use according to item 53, wherein the recombinant receptor is a chimeric antigen receptor (CAR). 55. The synthetic expression cassette, vector, cell or composition for use according to item 53 or 54, wherein the disease, condition or disorder is a cancer, an autoimmune or inflammatory disease, or an infectious disease.

[0071] 56. The synthetic expression cassette, vector, cell or composition for use according to item

[0072] 55, wherein the disease, condition or disorder is a cancer.

[0073] 57. The synthetic expression cassette, vector, cell or composition for use according to item

[0074] 56, wherein the cancer is a hematological cancer.

[0075] 58. The synthetic expression cassette, vector, cell or composition for use according to any one of items 51 to 57, wherein the synthetic expression cassette or vector is for introduction into the genome of a cell from the subject.

[0076] 59. The synthetic expression cassette, vector, cell or composition for use according to item 58, wherein the synthetic expression cassette or vector is introduced into the genome of the cell by CRISPR / Cas technology.

[0077] 60. The synthetic expression cassette, vector, cell or composition for use according to any one of items 51 to 57, wherein said method comprises administering at least 1 x 102, 1 x 103or 1 x 104cells to said subject.

[0078] 61. The synthetic expression cassette, vector, cell or composition for use according to item 60, wherein said method comprises administering 1 x 106to 1 x 108cells to said subject.

[0079] 62. The synthetic expression cassette, vector, cell or composition for use according to any one of items 51 to 61 , wherein said cells are autologous cells.

[0080] 63. The synthetic expression cassette, vector, cell or composition for use according to any one of items 51 to 61 , wherein said cells are allogeneic cells.

[0081] 64. The synthetic expression cassette of item 23 or 24, the vector of item 25 or 26, the cell of item 27 or 28, or the composition of item 29, for inducing the expression of a nucleic acid of interest by a cell.

[0082] 65. The synthetic expression cassette, vector, cell or composition for use according to item item 64, wherein said inducing is in vivo.

[0083] 66. The synthetic expression cassette, vector, cell or composition for use according to item item 64, wherein said inducing is in vitro.

[0084] 67. The synthetic expression cassette, vector, cell or composition for use according to any one of items 64 to 66, wherein the synthetic expression cassette or vector is for introduction into the genome of the cell.

[0085] 68. The synthetic expression cassette, vector, cell or composition for use according to item 67, wherein the synthetic expression cassette or vector is introduced into the genome of the cell by CRISPR / Cas technology. 69. The synthetic expression cassette, vector, cell or composition for use according to any one of items 64 to 68, wherein the nucleic acid of interest encodes a protein that is absent or defective in said cell.

[0086] 70. The synthetic expression cassette, vector, cell or composition for use according to any one of items 64 to 68, wherein the nucleic acid of interest encodes a chimeric antigen receptor (CAR).

[0087] 71. The synthetic expression cassette, vector, cell or composition for use according to any one of items 64 to 70, wherein said cell is a hematopoietic stem cell, a T cell, or a natural killer (NK) cell.

[0088] Other objects, advantages and features of the present invention will become more apparent upon reading of the following non-restrictive description of specific embodiments thereof, given by way of example only with reference to the accompanying drawings.

[0089] BRIEF DESCRIPTION OF DRAWINGS

[0090] In the appended drawings:

[0091] FIG. 1 depicts the normalized ATAC-seq profiles (GSE74912) of hematopoietic subsets (NK cells (CD56+), CD8 T cells (CD3+ CD8+), CD4 T cells (CD3+ CD4+), and HSCs (Lin- CD34+ CD38- CD90+ CD10-)) illustrate the specific "opening and activation" of a previously reported NK / T enhancer sequence (SEQ ID NO:24 in PCT publication No. WO 2020 / 150832), in a NK / T cell context. The dashed-line square highlights the localisation of the previously reported enhancer sequence in the protein kinase C theta (PRKCQ) locus.

[0092] FIG. 2A is a schematic illustration of the position of the 3 sgRNA in the previously reported NK / T enhancer sequence and the position of PCR primers (Forward primer 5’ TTGCCAAGGGGATGAAGTGAC3’ (SEQ ID NO:16), Reverse primer 5’ CAAACAACTGCAGCCAAGTTT3’ (SEQ ID NO:17)) used to amplify the region surrounding the previously reported NK / T enhancer sequence for assessment of genome editing with CRISPR / Cas9 protein.

[0093] FIG. 2B shows the measurement by flow cytometry of the expression of fluorescent protein (BFP) to evaluate transduction efficiency of a K562 cell line overexpressing the active Cas9 protein with different sgRNA guides targeting the previously reported NK / T enhancer sequence.

[0094] FIG. 2C shows the PCR product of the region surrounding the previously reported NK / T enhancer sequence (highlighted in FIG. 2A) from the different mentioned condition ran on a 1 .5% agarose gel (left panel), and the PCR product treated with T7 Endonuclease I and ran on a 1 .5% agarose gel showing the Cas9 editing efficiency of previously reported NK / T enhancer genomic region directed by the 3 selected sgRNA (right panel). FIGs. 2D-2F show an analysis of the PCR product DNA sequence generated from the different conditions by bioinformatic TIDE tool showing a high % of editing confirming the efficacy of picked sgRNA to direct Cas9 protein to the previously reported NK / T enhancer region.

[0095] FIG. 3 shows the results of an ATACqPCR assay performed in 4 cell lines (1- K562, 2- K562 transduced with lentivirus coding for the previously reported NK / T enhancer sequence (K562+SEQ. NO24), 3- REH (B acute lymphocytic leukemia cell line) and 4-Jurkat (T acute lymphoblastic leukemia). The ATACqPCR was performed with 4 couples of primers targeting specifically the previously reported NK / T enhancer sequence (SEQ. No24_1 , SEQ. No24_2, “SEQ. No24_3 and SEQ. No24_4) and all quantifications were normalized to permanently opened region RNP Polll promoter.

[0096] FIG. 4A is a schematic representation of the C-BERST assay (schema obtained from SA Myers et al., Discovery of proteins associated with a predefined genomic locus via dCas9- APEX-mediated proximity labeling. Nat Methods 15, 437-439 (2018)).

[0097] FIG. 4B depicts flow cytometry plots showing the expression of the fusion protein dCas9- APEX2 and different sgRNAs. 1 .5 to 2x107stably transduced K562 or Jurkat cells with C-BERST system (fusion dCas9-APEX2 protein / mCherry and different sgRNA / BFP), were treated overnight (ON) with dox (2 pg / ml, Sigma Aldrich) and Shield-1 (500 mM, Takara Bio #632189). Treated cells were resuspended in fresh media and incubated for 30min with Biotin-phenol (AdipoGen #CDX-B0270-M500), followed by staining with H2O2(Sigma #H1009-100ML) for 1min. After washing twice with a blocking solution and PBS, a protein extraction was performed and 200 pl of protein extract (~10-13 mg / ml of protein) was incubated overnight with 100 pl of streptavidin- equilibrated magnetic beads (Dynabeads MyOne Streptavidin T 1 (Life Technologies # 65602)).

[0098] FIG. 4C shows a Coomassie-stained SDS-PAGE gel of the biotin-labeled proteins pulled down with streptavidin beads for each condition (K562 cells with control sgRNA, K562 cells with the 3 sgRNA targeting the previously reported NK / T enhancer sequence, Jurkat cells with control sgRNA, and Jurkat cells with the 3 sgRNA targeting the previously reported NK / T enhancer sequence. Eluted protein from each condition was run in SDS-PAGE gel followed by Coomassie blue staining. Each line was cut in 4 pieces and sent for liquid chromatography-mass spectrometry (LC-MS / MS) analysis (done at the proteomics and Mass Spectrometry platform localised at I RIG - Institute for Research in Immunology, Montreal, Canada).

[0099] FIG. 5A shows a Venn Diagram analysis of identified proteins from Jurkat_ctrl (Jurkat_dCas9-APEX2 transduced with Ctrl_sgRNA), JurkatJ’SEQ. No24” (Jurkat_dCas9- APEX2 transduced with 3 sgRNAs targeting the previously reported NK / T enhancer sequence), and K562_”SEQ. No24” (K562_dCas9-APEX2 transduced with 3 sgRNAs targeting the previously reported NK / T enhancer sequence).

[0100] FIG. 5B shows a STRING network generated from the 175 unique proteins identified in the JurkatJ’SEQ. No24” condition. FIG. 5C shows the sequence, position, and motif binding of transcription factors (TFs) identified in the previously reported NK / T enhancer sequence by the C-BERST assay. The sequence depicted on top corresponds to residues 179-332 of SEQ ID NO:21.

[0101] FIG. 6A shows an SDS-PAGE gel (12%) showing four identified TFs: BCL11 A (#NB600- 261 , Novus), ELF1 (#22565-1-AP, Proteintech), SATB1 (#PA5-30163, ThermoFisher), MYBL1 (#PA5-75222, ThermoFisher), Actin (#MA1-140, ThermoFisher), and Rabbit IgG Isotype Control (#31235, ThermoFisher) in K562 and Jurkat cells.

[0102] FIG. 6B shows raw sequencing data showing the number of reads, mapping of sequenced fragments to the reference human genome (hg38), and alignment rate.

[0103] FIG. 6C shows normalized sequencing data (IgG isotype control, SATB1 , BCL11A, MYBL1 , and ELF1) from Jurkat and K562 cells visualized in the UCSC browser at the control locus (chr10:3, 132, 431-3, 182, 300).

[0104] FIG. 6D shows normalized sequencing data (IgG isotype control, SATB1 , BCL11A, MYBL1 , and ELF1) from Jurkat and K562 cells visualized in the UCSC browser at the PRKCq locus (chr10:6, 523, 874-6, 585, 165). The previously reported NK / T enhancer sequence (SEQ. NO24) is highlighted with a dashed-line square, while another region labelled "x" showed the binding of all four TFs, in contrast to the “SEQ. NO24” region, which showed significant enrichment of only ELF1 TF

[0105] FIG. 7A shows a schematic representation of the 3rd generation lentiviral vector system (LVDP: Lentivirus Dual Promoters), with a variable region upstream of ZsGreen and the hPGK promoter constantly driving DsRed-Express2 (serving as a transduction control) (Modified schema obtained from J Moharil et al. Lentivirus Live Cell Array for Quantitative Assessment of Gene and Pathway Activation during Myogenic Differentiation of Mesenchymal Stem Cells. PLoS ONE 10(10): e0141365). The variable region is cloned with different sequences (FIG. 7B).

[0106] FIG. 7B shows the different sequences cloned in the LVDP system. 1- a scrambled sequence that lacks any transcriptional activity, 2- MLP (minimal promoter) alone, 3- MLP associated with the full previously reported SEQ.NO24 sequence (Table 2), 4- MLP with the 60_149bp sequence only (Table 2), and 5- MLP with a mutated SEQ.NO24 sequence (lacking the 60_149bp sequence, Table 2).

[0107] FIG. 7C depicts flow cytometry plots showing the expression of the reporter ZsGreen in Jurkat T cells following transduction with the various sequences depicted in FIG. 7B / Table 2.

[0108] FIG. 8A is a schematic representation of the lentiviral constructs used to compare MLP alone, MLP with the full previously reported “SEQ.NO24” sequence, or «SEQ.NO24» sequences with mutations at the binding sites of the identified TFs. For the BCL11A mutant, the residues corresponding to

[0109] FIG. 8B shows a 1 .5% agarose gel of PCR products following targeted PCR amplification of the promoter region for each lentiviral construct. Jurkat T and K562 cell lines were equally transduced with the different lentiviral constructs. Genomic DNA was extracted, followed by targeted PCR amplification of the promoter region for each lentiviral construct using a forward primer in the 5' ZsGreenl region (5’-CCTCCATGCGGTACTTCATGGTC-3’, SEQ ID NO:27) and a reverse primer 5’-CAGTCGACTCCGGTACCTATGG-3’ (SEQ ID NO:28).

[0110] FIG. 8C: Sequences of the SATB1 , MYBL1 , BCL11A and ELF1 mutated sequences incorporated into the lentiviral constructs.

[0111] FIG. 8D depicts flow cytometry plots showing the expression of the reporter ZsGreen in Jurkat T cells and K562 cells following transduction with the different constructs.

[0112] FIG. 8E depicts graphs showing the transduction percentage of Jurkat and K562 human cell lines with different constructs. The DsRED+ percentage confirmed the successful transduction of the constructs in both cell lines, and the DsRED+ZsGreen1+ percentage showed a significant decrease in ZsGreenl expression after the deletion of the ELF1 binding site in the previously reported “SEQ. NO24”-synthetic specific promoter.

[0113] FIG. 9A is a schematic representation of the new lentiviral constructs that contain minimal promoter MLP associated with 1 copy of the ELF1_20nt sequence (1x ELF1_20 nt), 3 tandem copies of the ELF1_20nt sequence (3x ELF1_20nt), 1 copy of the ELF1_30nt sequence (1x ELF1_30 nt), 3 tandem copies of the ELF1_30nt sequence (3x ELF1_30nt), 1 copy of the 60_149 sequence (Ix only 60_149), or 3 tandem copies ofthe 60_149 sequence (Ixonly 60_149) (see Table 3), upstream of ZsGreenl using dual promoter lentivirus system.

[0114] FIG. 9B is a graph showing the MFI (mean fluorescence intensity) measurement of ZsGreenl and DsRED-Express2 in Jurkat human T cell line transduced with increasing concentration of different lentiviral constructs depicted in FIG. 9A.

[0115] FIG. 9C is a graph similar to FIG. 9B but with a maximum value of 10,000 for ZsGreenl to compare the values of all constructs.

[0116] FIG. 9D depicts flow cytometry plots showing the expression of ZsGreenl and DsRED- Express2 in Jurkat human T cell line transduced with the different lentiviral constructs depicted in FIG. 9A.

[0117] FIG. 10A is a schematic representation of the new lentiviral constructs that contain minimal promoter MLP associated with 1 copy of the ELF1_20nt or 30nt sequence (1x ELF1_20nt / 30nt), 2 tandem copies of the ELF1_20nt or 30nt sequence (2x ELF1_20nt / 30nt), 3 tandem copies of the ELF1_20nt or 30nt sequence (3x ELF1_20nt / 30nt), 6 tandem copies of the ELF1_20nt or 30nt sequence (6x ELF1_20nt / 30nt), or 9 tandem copies of the ELF1_20nt or 30nt sequence (9x ELF1_20nt / 30nt), upstream of ZsGreenl using dual promoter lentivirus system.

[0118] FIG. 10B depicts flow cytometry plots showing the expression of ZsGreenl and DsRED- Express2 in Jurkat human T cell line transduced with the different lentiviral constructs depicted in FIG. 10A. FIG. 10C and 10D are bar graphs showing the fold-change in ZsGreenl MFI of the different lentiviral constructs depicted in FIG. 10A relative to a scrambled sequence lacking transcriptional activity (EMPTY). FIG. 10C shows the results for the 20 nt constructs and FIG. 10D shows the results for the 30 nt constructs.

[0119] FIG. 11A shows the results of flow cytometry analysis of transduced CD34+ stem / progenitor hematopoietic cells with the designed T / NK-specific promoters: (1) a scrambled sequence lacking transcriptional activity (EMPTY), (2) MLP associated with the full previously reported “SEQ. NO24” sequence, (3) MLP associated with the 60_149bp sequence, (4) MLP associated with three tandem copies (3X) of the 60_149bp sequence, (5) MLP associated with three tandem copies (3X) of ELF1_20nt, and (6) MLP associated with three tandem copies (3X) of ELF1_30nt.

[0120] FIGs. 11B and C show the results of flow cytometry analysis of cells differentiated into distinct hematopoietic lineages (B, T, and NK cells) using the Artificial Thymic Organoid (ATO) system (https: / / www.nature.com / articles / nmeth.4237) transduced with the designed T / NK- specific promoters described for FIG. 10A.

[0121] FIGs. 11C and D: show the results of flow cytometry analysis of T and NK cells purified from peripheral blood transduced with the designed T / NK-specific promoters described for FIG. 10A.

[0122] FIG. 12 depicts microscopy images showing that the designed T / NK-specific promoters do not induce the expression of the transgene (ZsGreenl) in hepatocyte-like cells, in contrast to the constitutive EF1a promoter.

[0123] FIGs. 13A-C are schematic illustrations of the putative modes of action of transcriptional enhancers studied herein: 60_149 (FIG. 13A); 1xELF1_20nt (FIG. 13B); and 3xELF1_20nt (FIG. 13C).

[0124] FIG. 14 depicts flow cytometry plots showing the expression of a CAR-CD19 in Jurkat T cell line when the CAR-CD19 is under the control of a ubiquitous SFFV promoter (left panels), the previously reported “SEQ.No24” promoter (middle panels) or the 3xEFL_20nt promoter (right panels) in the 5’- 3’ (top) or 3’- 5’ orientation (bottom). The CAR-CD19 was stained with a PE- conjugated hCD19 protein, and transduction was assessed by the mTagBFP2 fluorescence coded in the lentiviral constructs after the CAR with a P2A self-cleaving peptide.

[0125] FIG. 15 depicts flow cytometry plots showing a cytotoxic assay in which CAR-CD19- transduced primary T cells are co-cultured with RS4;11 target cells. The top line shows co-culture at day 6 and the bottom line at day 16. The percentage indicates the proportion of target cells that are found at the end of the culture. Shown are the conditions where the CAR-CD19 is under the control of a ubiquitous SFFV promoter, the previously reported “SEQ.No24” promoter or the 3xEFL_20nt. The transduced T cells were stained with an PE-conjugated hCD3 antibody, and target cells were labelled with GFP reporter protein. FIG. 16 depicts histogram summarizing data from a cytotoxic assay in which CAR-B7H3- transduced primary T cells are co-cultured with a rhabdomyosarcoma (RH30) target cell line. The percentage indicates the proportion of target cells that were killed by CAR-B7H3 T cells at the end of the culture for 2 effector: target ratios. Shown are the conditions where the CAR-B7H3 is under the control of a ubiquitous EF1a promoter, the previously reported “SEQ.No24” promoter or the 3xEFL_20nt.

[0126] DISCLOSURE OF INVENTION

[0127] Unless otherwise defined herein, scientific and technical terms used in connection with this disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Generally, nomenclature used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. The methods and techniques of the disclosure are generally performed according to conventional methods well-known in the art and as described in various general and more specific references that are cited and discussed throughout the specification unless otherwise indicated. See, e.g. : Sambrook J. & Russell D. Molecular Cloning: A Laboratory Manual, 3rded., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2000); Ausubel et al., Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Wiley, John & Sons, Inc. (2002); Harlow and Lane Using Antibodies: A Laboratory Manual; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1998); and Coligan et al., Short Protocols in Protein Science, Wiley, John & Sons, Inc. (2003). Any enzymatic reactions or purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art or as described herein. The nomenclature used in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art.

[0128] The use of the terms "a" and "an" and "the" and similar referents in the context of describing the technology (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.

[0129] The terms "comprising", "having", "including", and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to") unless otherwise noted.

[0130] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All subsets of values within the ranges are also incorporated into the specification as if they were individually recited herein.

[0131] The use of any and all examples, or exemplary language (“e.g.”, "such as") provided herein, is intended merely to better illustrate the technology and does not pose a limitation on the scope of the claimed invention unless otherwise claimed.

[0132] No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the claimed invention.

[0133] Herein, the term "about" has its ordinary meaning. The term “about” is used to indicate that a value includes an inherent variation of error for the device or the method being employed to determine the value, or encompass values close to the recited values, for example within 10% of the recited values (or range of values).

[0134] The present inventors have designed a specific synthetic regulatory element to target the expression of a gene of interest in NK and T cells. By engineering the transduced gene to be under the control of this synthetic regulatory element, and by transducing this construct into stem cells, it has been possible to direct gene expression exclusively in a specific and targeted cell subtype (or subtypes) that derive(s) from these genetically-modified stem cells, which is a significant refinement of the actual methods. The designed human T / NK-cell specific promoter has a reduced size and showed good specificity, and are thus amenable for use in human gene therapy and HSC engineering.

[0135] Transcriptional enhancer and synthetic expression cassette

[0136] In a first aspect, the present disclosure provides a transcriptional enhancer having a length of 300 nucleotides or less and comprising at least two binding sites for E74 like ETS transcription factor 1 (ELF1).

[0137] In another aspect, the present disclosure provides a transcriptional enhancer having a length of 300 nucleotides or less and comprising at least two binding sites for ELF 1 , wherein each of said binding sites comprises a sequence having at least 80% sequence identity with the sequence CAATACAGCAAGCGGAAG (SEQ ID NO:1).

[0138] In another aspect, the present disclosure provides a synthetic expression cassette, and more particularly a synthetic expression cassette for expressing a nucleic acid (e.g., gene, gRNA, miRNA, shRNA) of interest in NK and T cells, the synthetic expression cassette comprising: a minimal promoter; and a transcriptional enhancer operatively coupled to the minimal promoter for expression of the nucleic acid of interest in the cell, wherein the transcriptional enhancer (a) has a length of 150 nucleotides or less and comprises at least one binding site for ELF1 ; or (b) has a length of 300 nucleotides or less and comprises at least two binding sites for ELF 1 .

[0139] In another aspect, the present disclosure provides a synthetic expression cassette, and more particularly a synthetic expression cassette for expressing a nucleic acid (e.g., gene, gRNA, miRNA, shRNA) of interest in NK and T cells, the synthetic expression cassette comprising: a minimal promoter; and a transcriptional enhancer operatively coupled to the minimal promoter for expression of the nucleic acid of interest in the cell, wherein the transcriptional enhancer (a) has a length of 150 nucleotides or less and comprises at least one binding site for ELF1 , wherein said binding sites comprises a sequence having at least 80% sequence identity with the sequence CAATACAGCAAGCGGAAG (SEQ ID NO:1); or (b) has a length of 300 nucleotides or less and comprises at least two binding sites for ELF1 , wherein each of said binding sites comprises a sequence having at least 80% sequence identity with the sequence CAATACAGCAAGCGGAAG (SEQ ID NO:1).

[0140] The term “enhancer” or “transcriptional enhancer” or “transcriptional regulatory element” refers to a c / s-acting sequence that comprises one or more binding sites for transcription factors or transcriptional activators and that increases the activity of a promoter (e.g. a minimal promoter) in an orientation- and position-independent manner. The transcriptional enhancer may be located upstream or downstream of the minimal promoter. In an embodiment, the transcriptional enhancer is located upstream of the promoter.

[0141] In an embodiment, the transcriptional enhancer is a cell type- or subtype-specific transcriptional enhancer, i.e. the transcriptional enhancer specifically increases the activity of the promoter (and in turn the expression of the peptide / protein, or nucleic acid (e.g., miRNA, shRNA, gRNA), of interest) in a particular cell type or subtype. The term “specifically increases” as used herein means that the increase in activity of the minimal promoter in the target cell type or subtype is higherthan that in the other cell types or subtypes. In embodiment, the transcriptional enhancer is an immune cell-specific transcriptional enhancer, i.e. it specifically increases the activity of the promoter in one or more immune cell type(s), and more particularly T cells and NK cells.

[0142] As described in the Examples presented below, the sequence CAATACAGCAAGCGGAAG is a binding site for the transcription factor ELF1 . It has been shown that the motif C / AGGAA / T is important for the binding of ELF1 (see, e.g., Thompson et al., Mol Cell Biol. 1992 Mar;12(3):1043-1053). Thus, in an embodiment, the binding site for ELF1 comprises the sequence CAATACAGCAAGX1GGAX2G (SEQ ID NO:2), wherein X1is C or A and X2is A or T. In an embodiment, X1is C. In another embodiment, X2is A.

[0143] In further embodiments, the binding site for ELF1 comprises a sequence having at least 85%, 90%, or 94% sequence identity with the sequence CAATACAGCAAGCGGAAG (SEQ ID NO:1). In further embodiments, the binding site for ELF1 comprises the sequence CAATACAGCAAGCGGAAG (SEQ ID NO:1).

[0144] As shown in the Examples presented below, stronger expression of a gene of interest in T cells was obtained using transcriptional enhancers comprising a plurality of copies of binding sites for ELF1. Thus, in an embodiment, the transcriptional enhancer comprises at least two binding sites for the transcription factor ELF1 , e.g., the sequence of SEQ ID NO:1 or SEQ ID NO:2. In a further embodiment, the transcriptional enhancer comprises from 2 to 10 binding sites for ELF1 , e.g., the sequence of SEQ ID NO:1 or SEQ ID NO:2. In a further embodiment, the transcriptional enhancer comprises from 2 to 9 binding sites for ELF1 , e.g., the sequence of SEQ ID NO:1 or SEQ ID NO:2. In various embodiments, the transcriptional enhancer comprises 2, 3, 4, 5, or 6 binding sites for ELF1 , e.g., the sequence of SEQ ID NO:1 or SEQ ID NO:2. It would be understood by the skilled person that the plurality of ELF1 binding sites may be the same or different.

[0145] The plurality of ELF1 binding sites may be contiguous, i.e., directly linked to each other in the transcriptional enhancer, or may be separated by one or more nucleotides. In an embodiment, the plurality of ELF1 binding sites are separated by one or more nucleotides, for example by 1 to 20 nucleotides, or by 1 to 15 nucleotides. In a further embodiment, the plurality of ELF1 binding sites are separated by 1 to 12 nucleotides, for example by 1 to 10 nucleotides, 1 to 8 nucleotides, or 1 to 5 nucleotides.

[0146] In an embodiment, the transcriptional enhancer comprises a sequence of one of the following formulas:

[0147] • (A-B1-A)n, wherein A is an ELF1 binding site (e.g., the sequence of SEQ ID NO: 1 or SEQ ID NO:2), B1is a nucleotides sequence of 1 to 15 nucleotides or is absent; n is an integer from 1 to 5;

[0148] • (A1-B1-A2-B2-A3)m, wherein A1, A2and A3are each independently an ELF1 binding site (e.g., the sequence of SEQ ID NO:1 or SEQ ID NO:2), B1and B2are each independently a nucleotides sequence of 1 to 15 nucleotides or are absent; m is an integer from 1 to 3;

[0149] • (A1-B1-A2-B2-A3-B3-A4-B4-A5)p, wherein A1, A2, A3, A4and A5are each independently an ELF1 binding site (e.g., the sequence of SEQ ID NO: 1 or SEQ ID NO:2), B1, B2, B3and B4are each independently a nucleotides sequence of 1 to 15 nucleotides or are absent; p is 1 or 2; or

[0150] • (A1-B1-A2-B2-A3-B3-A4-B4-A5-B5-A6-B6-A7), wherein A1, A2, A3, A4, A5, A6and A7are each independently an ELF1 binding site (e.g., the sequence of SEQ ID NO:1 or SEQ ID NO:2), B1, B2, B3B4, B5and B6are each independently a nucleotides sequence of 1 to 15 nucleotides or are absent.

[0151] In an embodiment, the transcriptional enhancer comprises or consists of the sequence TCAATACAG CAAG CGG AAG CTCAATACAG CAAG CG G AAG CTCAATACAG CAAGCG G AAG C (SEQ ID NO:3).

[0152] In an embodiment, the transcriptional enhancer comprises or consists of the sequence TCAATACAG CAAG CGG AAG CTCAATACAG CAAG CG G AAG CTCAATACAG CAAGCG G AAG C TCAATACAG CAAG CGG AAG CTCAATACAG CAAG CG G AAG CTCAATACAG CAAGCG G AAG C (SEQ ID NO:4). In an embodiment, the transcriptional enhancer further comprises at least one of: one or more binding sites for BCL11a / b, one or more binding sites for MYBL1 , and / or one or more binding sites for SATB1. In an embodiment, the transcriptional enhancer further comprises at least two of: one or more binding sites for BCL11 a / b, one or more binding sites for MYBL1 , and / or one or more binding sites for SATB1. In an embodiment, the transcriptional enhancer further comprises one or more binding sites for BCL11 a / b, one or more binding sites for MYBL1 , and one or more binding sites for SATB1 .

[0153] In another embodiment, the transcriptional enhancer comprises a sequence having at least 90% identity with the following sequence: TGACACCACACCCCACTTCCTCCCGCGGGCGTGTGACACTTTTCAAAGAAAATACAGTATT TGGTAGTATCAATACAGCAAGX1GGAX2GCA (SEQ ID NO:5), wherein X1is C or A and X2is A or T.

[0154] In another embodiment, the transcriptional enhancer comprises a sequence having at least 95% identity with the following sequence: TGACACCACACCCCACTTCCTCCCGCGGGCGTGTGACACTTTTCAAAGAAAATACAGTATT TGGTAGTATCAATACAGCAAGX1GGAX2GCA (SEQ ID NO:5), wherein X1is C or A and X2is A or T.

[0155] In another embodiment, the transcriptional enhancer comprises the following sequence: TGACACCACACCCCACTTCCTCCCGCGGGCGTGTGACACTTTTCAAAGAAAATACAGTATT TGGTAGTATCAATACAGCAAGX1GGAX2GCA (SEQ ID NO:5), wherein X1is C or A and X2is A or T.

[0156] In another embodiment, the transcriptional enhancer comprises a sequence having at least 90% identity with the following sequence: TGACACCACACCCCACTTCCTCCCGCGGGCGTGTGACACTTTTCAAAGAAAATACAGTATT TGGTAGTATCAATACAGCAAGCGGAAGCA (SEQ ID NO:6).

[0157] In another embodiment, the transcriptional enhancer comprises a sequence having at least 95% identity with the following sequence: TGACACCACACCCCACTTCCTCCCGCGGGCGTGTGACACTTTTCAAAGAAAATACAGTATT TGGTAGTATCAATACAGCAAGCGGAAGCA (SEQ ID NO:6).

[0158] In another embodiment, the transcriptional enhancer comprises the following sequence: TGACACCACACCCCACTTCCTCCCGCGGGCGTGTGACACTTTTCAAAGAAAATACAGTATT TGGTAGTATCAATACAGCAAGCGGAAGCA (SEQ ID NO:6).

[0159] The term “minimal promoter” refers to a promoter that only comprises the minimal elements of a promoter, namely the TATA box (also called the Goldberg-Hogness box) and a transcription initiation site, and which is inactive (or poorly active) at inducing / driving gene expression in the absence of properly located (usually upstream) one or more regulatory elements that enhance promoter activity (transcriptional enhancers). Any minimal promoter sequence known to those of ordinary skill in the art is contemplated for inclusion in the minimal promoter sequences of the present disclosure. Minimal promoter sequences are often derived from viruses or are truncated eukaryotic promoters, and thus the minimal promoter may be a proopiomelanocortin minimal promoter (POMC), an adenoviral minimal promoter, a baculoviral minimal promoter, a CMV minimal promoter, a parvovirus minimal promoter, a herpesvirus minimal promoter, a poxvirus minimal promoter, an adeno-associated virus minimal promoter, a semiliki forest virus minimal promoter, an SV40 minimal promoter, a vaccinia virus minimal promoter, or a retrovirus minimal promoter. Examples of minimal promoters include the human simplex virus thymidine kinase (HSV TK or miniTK) minimal promoter, the cauliflower mosaic virus (CaMV) 35S minimal promoter, the human cytomegalovirus CMV minimal promoter (miniCMV), CMV53 (minCMV with the addition of an upstream GC box), the minimal simian virus 40 promoter (minSV40), MLP (the -38 to +6 region of the adenovirus major late promoter), the minP (synthetic minimal promoter composed of TATA box and transcription start site - from Promega), pJB42CAT5 (a minimal promoter derived from the human junB gene), YB_TATA, and the super core promoter 1 (SCP1) minimal promoter (see Table I below). Several minimal promoters (also sometimes referred to as “core promoters”) are described in Ede et al., ACS Synth Biol. 2016 May 20; 5(5): 395-404.

[0160] Table I: Sequences of representative minimal promoters

[0161] Bold = TATA box consensus sequence

[0162] Underlined = consensus GC box sequence

[0163] Italics = additional B-recognition element found in pJB42CAT5

[0164] Sequence identity between two nucleotide sequences may be determined by comparing each position in the aligned sequences. A degree of identity between nucleotide sequences is a function of the number of identical nucleotides at positions shared by the sequences. As used herein, a given percentage of identity between sequences denotes the degree of sequence identity in optimally aligned sequences. Optimal alignment of sequences for comparisons of identity may be conducted using a variety of algorithms and sequence alignment tools, such as the local homology algorithm of Smith and Waterman, 1981 , Adv. Appl. Math 2: 482, the homology alignment algorithm of Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443, the search for similarity method of Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. USA 85: 2444, and the computerised implementations of these algorithms (such as GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, Madison, Wl, U.S.A.). Sequence identity may also be determined using the BLAST algorithm, described in Altschul et al., 1990, J. Mol. Biol. 215: 403-10 (using the published default settings). Software / tools for performing BLAST analysis may be available through the National Center for Biotechnology Information. Other sequence alignment tools such as Needle, Stretcher, Clustal Omega and Kalign are available through the European Bioinformatics Institute (EMBL-EBI).

[0165] The terms “operatively positioned”, “operatively linked” and “operatively coupled” mean that a promoter (and / or enhancer) is in a correct functional location and orientation in relation to a nucleic acid sequence to control transcriptional initiation and expression of that nucleic acid. An enhancer is “operatively coupled” to a promoter (e.g., a minimal promoter) when it is in a correct functional location and orientation for increasing the transcriptional activity of the promoter.

[0166] The terms “synthetic” mean that the expression cassette is an artificial or recombinant construct that is not found in nature, i.e. that the combination of the minimal promoter and the transcriptional enhancer is not naturally found in the native genome of a cell. In an embodiment, the minimal promoter is heterologous with the transcriptional enhancer, i.e. it is not normally associated with the transcriptional enhancer in its natural environment, e.g., they do not control the expression of the same genes in the native genome of a cell. In an embodiment, the minimal promoter and the transcriptional enhancer are from different cell types or from different organisms (e.g., virus vs. eukaryotic cell). In an embodiment, the minimal promoter and / or the transcriptional enhancer is / are heterologous with the nucleic acid of interest, i.e. they are not normally associated with the nucleic acid of interest in its natural environment. In an embodiment, the transcriptional enhancer is of human origin. In an embodiment, the minimal promoter is of viral origin.

[0167] In an embodiment, the synthetic expression cassette further comprises a polyadenylation (poly(A)) signal. The poly(A) signal effects proper polyadenylation of the nucleic acid of interest (transcript). The nature of the poly(A) signal not believed to be crucial to the successful practice of the invention, and thus any such sequence may be employed. Examples of representative poly(A) signals include the SV40 poly(A) signal and / or the bovine growth hormone poly(A) signal, convenient and / or known to function well in various target cells. In an embodiment, the synthetic expression cassette further comprises a Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE). Such element is commonly used to increase expression of genes delivered by viral vectors, has been shown to increase mRNA stability and protein yield (see, e.g., Lee, YB, et al. 2005. Exp Physiol. 90(1): 33-7). In an embodiment, the WPRE is used in combination with the poly(A) signal. In another embodiment, the WPRE replaces the poly(A) signal.

[0168] In an embodiment, the synthetic expression cassette further comprises a transcriptional termination signal. A "termination signal" or "terminator" is comprised of the DNA sequences involved in specific termination of an RNA transcript by an RNA polymerase. Thus, in certain embodiments, a termination signal that ends the production of an RNA transcript is contemplated.

[0169] In an embodiment, the synthetic expression cassette further comprises a nucleic acid of interest. The term "nucleic acid of interest" or “gene of interest” is used to refer to a nucleic acid that encodes a functional peptide or polypeptide (protein) of interest (native or modified peptides / proteins). In an embodiment, the functional peptide or polypeptide is a therapeutic peptide or polypeptide, i.e. a peptide or polypeptide that can be administered to a subject for the purpose of treating or preventing a disease. Any nucleic acid encoding a peptide or polypeptide of interest known to those of ordinary skill in the art is contemplated for inclusion in the synthetic expression cassette. The peptide or polypeptide of interest may be an enzyme, a signaling molecule (e.g., kinase, phosphatase), a receptor, a growth factor (e.g., cytokines), a chemotactic protein (e.g., chemokines), a structural protein (cytoskeletal proteins), a transcription factor, a cell adhesion protein, an antibody or antigen-binding fragment thereof, etc. The peptide or polypeptide may be a naturally-occurring peptide or polypeptide, a fragment or variant thereof, chimeric versions thereof, etc.

[0170] In an embodiment, the nucleic acid of interest encodes a recombinant receptor, such as a chimeric antigen receptor (CAR). Such CAR typically comprises a ligand-binding domain (e.g. antibody or antibody fragment such as a single-chain variable fragment (scFv)) that provides specificity for a desired antigen (e.g., tumor antigen) linked to an activating intracellular domain portion, such as a T cell or NK cell activating domain, providing a primary activation signal, in some aspects via linkers and / or transmembrane domain(s).

[0171] In particular embodiments, the recombinant receptor (e.g., CAR) comprises an intracellular signaling domain, which includes an activating cytoplasmic signaling domain (also interchangeably called an intracellular signaling region), such as an activating cytoplasmic (intracellular) domain capable of inducing a primary activation signal in an immune cell (T cell, NK cell, for example), a cytoplasmic signaling domain of a T cell receptor (TCR) component (e.g. a cytoplasmic signaling domain of a CD3-zeta (CD3 Q chain or a functional variant or signaling portion thereof) and / or that comprises an immunoreceptor tyrosine-based activation motif (ITAM).

[0172] In some embodiments, the recombinant receptor (e.g., CAR) further comprises an extracellular ligand-binding domain that specifically binds to a ligand (e.g., antigen), such as a tumor antigen. In some embodiments, the ligand, such as an antigen, is a protein expressed on the surface of cells. In some embodiments, the CAR is a TCR-like CAR and the antigen is a processed peptide antigen, such as a peptide antigen of an intracellular protein, which is recognized on the cell surface in the context of a major histocompatibility complex (MHC) molecule.

[0173] Exemplary recombinant receptors, including CARs and recombinant TCRs, as well as methods for engineering and introducing the receptors into cells, include those described, for example, in international patent application publication numbers WO 2000 / 14257, WO 2013 / 126726, WO 2012 / 129514, WO 2014 / 031687, WO 2013 / 166321 , WO 2013 / 071154, WO 2013 / 123061 , US patent application publication numbers US 2002 / 131960, US 2013 / 287748, US 2013 / 0149337, US Patent Nos.: 6,451 ,995, 7,446,190, 8,252,592, 8,339,645, 8,398,282, 7,446,179, 6,410,319, 7,070,995, 7,265,209, 7,354,762, 7,446,191 , 8,324,353, and 8,479,118, and European patent application number EP2537416, and / or those described by Sadelain et al., Cancer Discov. 2013 April; 3(4): 388-398; Davila et al. (2013) PLoS ONE 8(4): e61338; Turtle et al., Curr. Opin. Immunol, 2012 October; 24(5): 633-39; Wu etal., Cancer, 2012 March 18(2): 160- 75. In some embodiments, the genetically engineered antigen receptors include a CAR as described in US Patent No.: 7,446,190, and those described in International Patent Application Publication No.: WO 2014 / 055668.

[0174] In some embodiments, the recombinant receptor (e.g. CAR) includes in its extracellular portion an antigen- or ligand-binding domain that binds (specifically binds) to an antigen (or a ligand), such as one or more antigen-binding fragment, domain, or portion, or one or more antibody variable domains, and / or antibody molecules. In some embodiments, the CAR includes an antigen-binding portion or portions of an antibody molecule, such as a single-chain antibody fragment (scFv) derived from the variable heavy (H) and variable light (VL) chains of a monoclonal antibody (mAb). The term "antibody" herein is used in the broadest sense and includes polyclonal and monoclonal antibodies, including intact antibodies and functional (antigen-binding) antibody fragments, including fragment antigen binding (Fab) fragments, F(ab')2fragments, Fab' fragments, Fv fragments, recombinant IgG (rlgG) fragments, variable heavy chain (VH) regions capable of specifically binding the antigen, single chain antibody fragments, including single chain variable fragments (scFv), and single domain antibodies (e.g., sdAb, sdFv, nanobody) fragments. The term encompasses genetically engineered and / or otherwise modified forms of immunoglobulins, such as intrabodies, peptibodies, chimeric antibodies, fully human antibodies, humanized antibodies, and heteroconjugate antibodies, multispecific, e.g., bispecific, antibodies, diabodies, triabodies, and tetrabodies, tandem di-scFv, tandem tri-scFv. Unless otherwise stated, the term "antibody" should be understood to encompass functional antibody fragments thereof. The term also encompasses intact or full- length antibodies, including antibodies of any class or sub-class, including IgG and sub-classes thereof, IgM, IgE, IgA, and IgD.

[0175] In some embodiments, the antigen-binding proteins, antibodies and antigen binding fragments thereof specifically recognize an antigen of a full-length antibody. In some embodiments, the heavy and light chains of an antibody can be full-length or can be an antigenbinding portion (a Fab, F(ab')2, Fv or a single chain Fv fragment (scFv)). In other embodiments, the antibody heavy chain constant region is chosen from, e.g., I gG 1 , lgG2, lgG3, lgG4, IgM, lgA1 , lgA2, IgD, and IgE, particularly chosen from, e.g., IgG 1 , lgG2, lgG3, and lgG4, more particularly, lgG1 (e.g., human lgG1). In another embodiment, the antibody light chain constant region is chosen from, e.g., kappa or lambda, particularly kappa.

[0176] The term "variable region" or "variable domain" refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to antigen. The variable domains of the heavy chain and light chain (VH and VL, respectively) of a native antibody generally have similar structures, with each domain comprising four conserved framework regions (FRs) and three CDRs. (See, e.g., Kindt et al. Kuby Immunology, 6thed., W.H. Freeman and Co., page 91 (2007). A single VHor VLdomain may be sufficient to confer antigen-binding specificity. Furthermore, antibodies that bind a particular antigen may be isolated using a VHor VLdomain from an antibody that binds the antigen to screen a library of complementary L or H domains, respectively. See, e.g., Portolano et al., J. Immunol. 150:880-887 (1993); Clarkson et al., Nature 352: 624-628 (1991).

[0177] Single-domain antibodies (sdAbs) are antibody fragments comprising all or a portion of the heavy chain variable domain or all or a portion of the light chain variable domain of an antibody. In certain embodiments, the single-domain antibody is a human single-domain antibody.

[0178] Antibody fragments can be made by various techniques, including but not limited to proteolytic digestion of an intact antibody as well as production by recombinant host cells. In some embodiments, the antibodies are recombinantly-produced fragments, such as fragments comprising arrangements that do not occur naturally, such as those with two or more antibody regions or chains joined by synthetic linkers, e.g., peptide linkers, and / or that are may not be produced by enzyme digestion of a naturally-occurring intact antibody. In some embodiments, the antibody fragment is a scFv.

[0179] A "humanized" antibody is an antibody in which all or substantially all CDR amino acid residues are derived from non-human CDRs and all or substantially all FR amino acid residues are derived from human FRs. A humanized antibody optionally may include at least a portion of an antibody constant region derived from a human antibody. A "humanized form" of a non-human antibody, refers to a variant of the non-human antibody that has undergone humanization, typically to reduce immunogenicity to humans, while retaining the specificity and affinity of the parental non-human antibody. In some embodiments, some FR residues in a humanized antibody are substituted with corresponding residues from a non-human antibody (e.g., the antibody from which the CDR residues are derived), e.g., to restore or improve antibody specificity or affinity.

[0180] In some embodiments, the CAR comprises an antibody or an antigen-binding fragment (e.g., scFv) that specifically recognizes an antigen, such as an intact antigen, expressed on the surface of a cell.

[0181] In some embodiments, the CAR comprises a TCR-like antibody, such as an antibody or an antigen-binding fragment (e.g., scFv) that specifically recognizes an intracellular antigen, such as a tumor-associated antigen, presented on the cell surface as a MHC-peptide complex. In some embodiments, an antibody or antigen-binding portion thereof that recognizes an MHC-peptide complex can be expressed on cells as part of a recombinant receptor, such as an antigen receptor. Among the antigen receptors are functional non-TCR antigen receptors, such as chimeric antigen receptors (CARs). Generally, a CAR comprising an antibody or antigen-binding fragment that exhibits TCR-like specificity directed against peptide-MHC complexes also may be referred to as a TCR-like CAR.

[0182] Exemplary recombinant receptors, including CARs and recombinant TCRs, as well as methods for engineering and introducing the receptors into cells, include those described, for example, in international patent application publication numbers WO 2000 / 14257, WO 2013 / 126726, WO 2012 / 129514, WO 2014 / 031687, WO 2013 / 166321 , WO 2013 / 071154, WO 2013 / 123061 , US patent application publication numbers US 2002 / 131960, US 2013 / 287748, US 2013 / 0149337, US Patent Nos.: 6,451 ,995, 7,446,190, 8,252,592, 8,339,645, 8,398,282, 7,446,179, 6,410,319, 7,070,995, 7,265,209, 7,354,762, 7,446,191 , 8,324,353, and 8,479,118, and European patent application number EP2537416, and / or those described by Sadelain et al., Cancer Discov. 2013 April; 3(4): 388-398; Davila et al. (2013) PLoS ONE 8(4): e61338; Turtle et al., Curr. Opin. Immunol, 2012 October; 24(5): 633-39; Wu et al., Cancer, 2012 March 18(2): 160- 75. In some embodiments, the genetically engineered antigen receptors include a CAR as described in U.S. Patent No.: 7,446,190, and those described in International Patent Application Publication No.: WO 2014 / 055668. In some embodiments, the recombinant receptors include recombinant T cell receptors (TCRs) and / or TCRs cloned from naturally occurring T cells. In some embodiments, a T cell receptor (TCR) comprises a variable a and p chains (also known as TCRa and TCR|3, respectively) or a variable y and 5 chains (also known as TCRy and TCRS, respectively), or a functional fragment thereof such that the molecule is capable of specifically binding to an antigen peptide bound to a MHC receptor. In some embodiments, the TCR is in the a|3 form. Typically, TCRs that exist in a|3 and y<5 forms are generally structurally similar, but T cells expressing them may have distinct anatomical locations or functions. A TCR can be found on the surface of a cell or in soluble form. Generally, a TCR is found on the surface of T cells (or T lymphocytes) where it is generally responsible for recognizing antigens bound to MHC molecules. In some embodiments, a TCR also can comprise a constant domain, a transmembrane domain and / or a short cytoplasmic tail (see, e.g., Janeway et al., Immunobiology: The Immune System in Health and Disease, 3rded., Current Biology Publications, p. 4:33, 1997). For example, in some embodiments, each chain of the TCR can possess one N-terminal immunoglobulin variable domain, one immunoglobulin constant domain, a transmembrane region, and a short cytoplasmic tail at the C-terminal end. In some embodiments, a TCR is associated with invariant proteins of the CD3 complex involved in mediating signal transduction.

[0183] In some embodiments, a TCR for a target antigen (e.g., a cancer / tumor antigen) is identified and introduced into the cells. In some embodiments, nucleic acid encoding the TCR can be obtained from a variety of sources, such as by polymerase chain reaction (PCR) amplification of publicly available TCR DNA sequences. In some embodiments, the TCR is obtained from a biological source, such as from cells, such as from a T cell (e.g., cytotoxic T cell), T cell hybridomas or other publicly available source. In some embodiments, the T-cells can be obtained from in vivo isolated cells. In some embodiments, a high-affinity T cell clone can be isolated from a patient and the TCR isolated. In some embodiments, the T cells can be a cultured T cell hybridoma or clone. In some embodiments, the TCR clone for a target antigen has been generated in transgenic mice engineered with human immune system genes (e.g., the human leukocyte antigen system, or HLA). See, e.g., tumor antigens (see, e.g., Parkhurst et al. (2009) Clin Cancer Res. 15: 169-180 and Cohen et al. (2005) J Immunol. 175:5799-5808. In some embodiments, phage display is used to isolate TCRs against a target antigen (see, e.g., Varela- Rohena et al. (2008) Nat Med. 14: 1390-1395 and Li (2005) Nat Biotechnol. 23:349-354. In some embodiments, the TCR or antigen-binding portion thereof can be synthetically generated from knowledge of the sequence of the TCR of interest.

[0184] In some embodiments, the recombinant receptor (e.g., a CAR such as an antibody or antigen-binding fragment thereof), further includes a spacer, which may be or include at least a portion of an immunoglobulin constant region or variant or modified version thereof, such as a hinge region, e.g., an lgG4 hinge region, and / or a CH1 / CL and / or Fc region. In some embodiments, the constant region or portion is of a human IgG, such as lgG4 or lgG1. In some aspects, the portion of the constant region serves as a spacer region between the antigenrecognition component, e.g., scFv, and transmembrane domain. The spacer can be of a length that provides for increased responsiveness of the cell following antigen binding, as compared to in the absence of the spacer. Exemplary spacers include those having at least about 10 to 220 amino acids, about 10 to 200 amino acids, about 10 to 175 amino acids, about 10 to 150 amino acids, about 10 to 125 amino acids, about 10 to 100 amino acids, about 10 to 75 amino acids, about 10 to 50 amino acids, about 10 to 40 amino acids, about 10 to 30 amino acids, about 10 to 20 amino acids, or about 10 to 15 amino acids, and including any integer between the endpoints of any of the listed ranges. Exemplary spacers include lgG4 hinge alone, lgG4 hinge linked to CH2 and CH3 domains, or lgG4 hinge linked to the CH3 domain. Exemplary spacers include, but are not limited to, those described in Hudecek et al. (2013) Clin. Cancer Res., 19:3153 or PCT patent publication number WO 2014 / 031687.

[0185] The antigen / ligand recognition domain generally is linked to one or more intracellular signaling components, such as signaling components that mimic activation through an antigen receptor complex, such as a TCR or NK receptor complex, in the case of a CAR, and / or signal via another cell surface receptor. Thus, in some embodiments, the antigen-binding component (e.g., antibody) is linked to one or more transmembrane and intracellular signaling domains. In some embodiments, the transmembrane domain is fused to the extracellular domain. In one embodiment, a transmembrane domain that naturally is associated with one of the domains in the receptor, e.g., CAR, is used. In some instances, the transmembrane domain is selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins to minimize interactions with other members of the receptor complex.

[0186] The transmembrane domain in some embodiments is derived either from a natural or from a synthetic source. Where the source is natural, the domain in some aspects is derived from any membrane-bound or transmembrane protein. Transmembrane regions include those derived from (i.e. comprise at least the transmembrane region(s) of) the alpha, beta or zeta chain of the TCR, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154. Alternatively, the transmembrane domain in some embodiments is synthetic. In some aspects, the synthetic transmembrane domain comprises predominantly hydrophobic residues such as leucine and valine. In some aspects, a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic transmembrane domain.

[0187] Among the intracellular signaling domains are those that mimic or approximate a signal through a natural antigen receptor, a signal through such a receptor in combination with a costimulatory receptor, and / or a signal through a costimulatory receptor alone. In some embodiments, a short oligo- or polypeptide linker, for example, a linker of between 2 and 10 amino acids in length, such as one comprising glycines and serines, e.g., glycine- serine doublet, is present and forms a linkage between the transmembrane domain and the cytoplasmic signaling domain of the CAR.

[0188] The receptor, e.g., the CAR, generally includes at least one intracellular signaling component or components. In some embodiments, the receptor includes an intracellular component of a TCR complex, such as a TCR CD3 chain that mediates T-cell activation and cytotoxicity, e.g., CD3 chain. Thus, in some aspects, the CAR is linked to one or more cell signaling modules. In some embodiments, cell signaling modules include CD3 transmembrane domain, CD3 intracellular signaling domains, and / or other CD transmembrane domains. In some embodiments, the receptor, e.g., CAR, further includes a portion of one or more additional molecules such as Fc receptor y, CD8, CD4, CD25, or CD16. In some aspects, the CAR includes a primary cytoplasmic signaling sequence that regulates primary activation of the TCR complex. Primary cytoplasmic signaling sequences that act in a stimulatory manner may comprise signaling motifs which are known as immunoreceptor tyrosine-based activation motifs or ITAMs. Examples of ITAM comprising primary cytoplasmic signaling sequences include those derived from TCR or FcR gamma or FcR beta. In some embodiments, cytoplasmic signaling molecule(s) in the CAR comprise(s) a cytoplasmic signaling domain, portion thereof, or sequence derived from CD3 in some embodiments, to promote full activation, a component for generating a secondary or co-stimulatory signal is also included in the CAR, such as the signaling domain of a costimulatory receptor such as CD28, 4-1 BB, 0X40, DAP10, and ICOS. In some aspects, an additional CAR is expressed in the same cell and provides the component for generating the secondary or costimulatory signal. In some cases, CARs are referred to as first, second, and / or third generation CARs. In some aspects, a first-generation CAR is one that solely provides an antigen-receptor (e.g., CD3-chain) induced signal upon antigen binding; in some aspects, a second-generation CARs is one that provides such a signal and costimulatory signal, such as one including an intracellular signaling domain from a costimulatory receptor such as CD28 or CD137; in some aspects, a third generation CAR in some aspects is one that includes multiple costimulatory domains of different costimulatory receptors.

[0189] In some embodiments, the CAR or other antigen receptor may further include a marker or the cell may further express a marker, such as a surrogate marker, which may be used to confirm transduction or engineering of the cell to express the receptor, such as a truncated version of a cell surface receptor, such as truncated EGFR (tEGFR). In some aspects, the marker includes all or part (e.g., truncated form) of CD34, a NGFR, or epidermal growth factor receptor (e.g., tEGFR). In some embodiments, the nucleic acid encoding the marker is operably linked to a polynucleotide encoding for a linker sequence, such as a cleavable linker sequence, e.g., T2A. See WO 2014 / 031687. In some embodiments, introduction of a construct encoding the CAR and EGFRt separated by a T2A ribosome switch can express two proteins from the same construct, such that the EGFRt can be used as a marker to detect cells expressing such construct. In some embodiments, a marker, and optionally a linker sequence, can be any as disclosed in published patent application No. WO 2014 / 031687. For example, the marker can be a truncated EGFR (tEGFR) that is, optionally, linked to a linker sequence, such as a T2A cleavable linker sequence.

[0190] Among the antigens that may be targeted by the chimeric receptors are those expressed in the context of a disease, condition, or cell type to be targeted via the adoptive cell therapy. Among the diseases and conditions are proliferative, neoplastic, and malignant diseases and disorders, including cancers and tumors, including hematologic cancers, cancers of the immune system, such as lymphomas, leukemias, and / or myelomas (e.g., B cell, T cell, and myeloid leukemias, lymphomas, and multiple myelomas).

[0191] In some embodiments, the antigen (or a ligand) is a polypeptide. In some embodiments, it is a carbohydrate or other molecule. In some embodiments, the antigen (or a ligand) is selectively expressed or overexpressed on cells of the disease or condition, e.g., the tumor / cancer or pathogenic cells, as compared to normal or non-targeted cells or tissues. In other embodiments, the antigen is expressed on normal cells and / or is expressed on the engineered cells.

[0192] In some embodiments, the antigen (or a ligand) is a tumor antigen or cancer marker. In certain embodiments, the antigen is an integrin (e.g., avPe integrin, avp3 integrin, integrin p7), B cell maturation antigen (BCMA), B7-H6, carbonic anhydrase 9 (CA9, also known as CAIX or G250), a cancer-testis antigen, cancer / testis antigen IB (CTAG, also known as NY-ESO-1 and LAGE-2), carcinoembryonic antigen (CEA), a cyclin, cyclin A2, C-C Motif Chemokine Ligand 1 (CCL-1), CD19, CD20, CD22, CD23, CD24, CD30, CD33, CD38, CD44, CD44v6, CD44v7 / 8, CD123, CD138, CD171 , epidermal growth factor protein (EGFR), truncated epidermal growth factor protein (tEGFR), type III epidermal growth factor receptor mutation (EGFR vl 11), epithelial glycoprotein 2 (EPG-2), epithelial glycoprotein 40 (EPG-40), ephrinB2, ephrin receptor A2 (EPHa2), estrogen receptor, Fc receptor like 5 (FCRL5; also known as Fc receptor homolog 5 or FCRH5), fetal acetylcholine receptor (fetal AchR), a folate binding protein (FBP), folate receptor alpha, fetal acetylcholine receptor, ganglioside GD2, O-acetylated GD2 (OGD2), ganglioside GD3, glycoprotein 100 (gp100), Her2 / neu (receptor tyrosine kinase erbB2), Her3 (erb-B3), Her4 (erb-B4), erbB dimers, Human high molecular weight-melanoma-associated antigen (HMW- MAA), hepatitis B surface antigen, Human leukocyte antigen A1 (HLA-A1), Human leukocyte antigen A2 (HLA-A2), IL-22 receptor alpha (IL-22Ra), IL-13 receptor alpha 2 (IL-13Ra2), kinase insert domain receptor (kdr), kappa light chain, L1 cell adhesion molecule (L1CAM), CE7 epitope of L1-CAM, Leucine Rich Repeat Containing 8 Family Member A (LRRC8A), Lewis Y, Melanoma- associated antigen (MAGE)-A1 , MAGE-A3, MAGE-A6, mesothelin, c-Met, murine cytomegalovirus (CMV), mucin 1 (MUC1), MUC 16, natural killer group 2 member D (NKG2D) ligands, melan A (MART-1), neural cell adhesion molecule (NCAM), oncofetal antigen, Preferentially expressed antigen of melanoma (PRAME), progesterone receptor, a prostate specific antigen, prostate stem cell antigen (PSCA), prostate specific membrane antigen (PSMA), Receptor Tyrosine Kinase Like Orphan Receptor 1 (ROR1), survivin, Trophoblast glycoprotein (TPBG also known as 5T4), tumor-associated glycoprotein 72 (TAG72), vascular endothelial growth factor receptor (VEGFR), vascular endothelial growth factor receptor 2 (VEGFR2), Wilms Tumor 1 (WT-1), galectins (galectin-1 , galectin-7) a pathogen-specific antigen, or an antigen associated with a universal tag, and / or biotinylated molecules, and / or molecules expressed by HIV, HCV, HBV or other pathogens such as bacteria and parasites. Antigens targeted by the receptors in some embodiments include antigens associated with a B cell malignancy, such as any of a number of known B cell marker. In some embodiments, the antigen targeted by the receptor is CD20, CD19, CD22, ROR1 , CD45, CD21 , CD5, CD33, Igkappa, Iglambda, CD79a, CD79b or CD30. In an embodiment, a plurality of recombinant receptors targeting a plurality of antigens are used. In a further embodiment, two recombinant receptors targeting two antigens are used.

[0193] In other embodiments, tumor antigens targeted by the CAR according to the present disclosure include GD2 / GD3 gangliosides (which may be targeted by, e.g., 3F8, Dinutuximab, Ecromeximab, Mitumomab, Naxitamab), EpCAM (which may be targeted by, e.g., Adecatumumab, Citatuzumab, Edrecolomab), Carcinoembryonic antigen (CEA) (which may be targeted by, e.g., Altumomab pentetate, Besilesomab, Labetuzumab), mesothelin (which may be targeted by, e.g., Amatuximab, Anetumab), Tumor-associated glycoprotein 72 (TAG-72) (which may be targeted by, e.g., Anatumomab mafenatox, Minretumomab), gelatinase B (which may be targeted by, e.g., Andecaliximab), activin receptor-like kinase 1 (which may be targeted by, e.g., Ascrinvacumab), EGFR (which may be targeted by, e.g., Amivantamab, Cetuximab, Depatuxizumab, Futuximab, Imgatuzumab, Matuzumab, Modotuximab, Necitumumab, Nimotuzuma, Panitumumab), VEGF (which may be targeted by, e.g., Bevacizumab, Ranibizumab), VEGFR / VEGFR2 (which may be targeted by, e.g., Icrucumab, Ramucirumab), CD44v6 (which may be targeted by, e.g., Bivatuzumab), CD30 (which may be targeted by, e.g., Brentuximab vedotin), CD52 (which may be targeted by, e.g., Alemtuzumab), CD19 (which may be targeted by, e.g., Blinatumomab, Coltuximab, Denintuzumab), B-cell maturation antigen (BCMA) (which may be targeted by, e.g., Belantamab), CD22 (which may be targeted by, e.g., Bectumomab, Moxetumomab), Notchl (which may be targeted by, e.g., Brontictuzumab), CanAg (which may be targeted by, e.g., Cantuzumab), Lewis-Y antigen (which may be targeted by, e.g., cBR96), CEACAM5 (which may be targeted by, e.g., Cibisatamab), CD221 (which may be targeted by, e.g., Cixutumumab, Dalotuzumab, Figitumumab, Ganitumab), PTK7 (which may be targeted by, e.g., Cofetuzumab), CD38 (which may be targeted by, e.g., Daratumumab, Isatuximab), DLL4 (which may be targeted by, Demcizumab), CD20 (which may be targeted by, Divozilimab, Obinutuzumab, Ofutumumab, Ibritumomab, Rituximab), ERBB3 (HER3) (which may be targeted by, Elgemtumab, Duligotuzumab, Lumretuzuma), HER2 / neu (which may be targeted by, Pertuzumab, Trastuzumab), CSF1 R (which may be targeted by, Emactuzumab), HGFR (which may be targeted by, e.g., Emibetuzumab), folate receptor 1 (which may be targeted by, e.g., Farletuzumab, Mirvetuximab), Hepatocyte growth factor (HGF) (which may be targeted by, e.g., Ficlatuzumab, Rilotumumab), TYRP1 (which may be targeted by, e.g., Flanvotumab), MUC1 (which may be targeted by, e.g., Gatipotuzumab), CD33 (which may be targeted by, e.g., Gemtuzumab, Lintuzumab), carbonic anhydrase 9 (CA-IX) (which may be targeted by, e.g., Girentuximab), GPNMB (which may be targeted by, e.g., Glembatumumab), CA-125 (which may be targeted by, e.g., Oregovoma, Sofituzumab), MUC1 (which may be targeted by, e.g., Pemtumomab), TROP-2 (which may be targeted by, e.g., Sacituzumab), RANKL (which may be targeted by, e.g., Denosumab), CD79b (which may be targeted by, e.g., Polatuzumab), and tissue factor (TF) (which may be targeted by, e.g., Tisotumab.

[0194] In an embodiment, the CAR comprises or is derived from an antibody or antibody fragment from an immunotherapeutic antitumor agent (therapeutic antibody, CAR cell, ADC, etc.) that is approved by a recognized drug regulatory agency, such as the U.S. Food and Drug Administration (FDA), the European Medicines Agency (EMA, Europe), Health Canada, the Pharmaceuticals and Medical Devices Agency (PMDA) in Japan, and the Therapeutic Goods Administration (TGA) in Australia. In another embodiment, the CAR is Abecma (idecabtagene vicleucel), Breyanzi (lisocabtagene maraleucel), Kymriah (tisagenlecleucel), Tecartus (brexucabtagene autoleucel), Yescarta (axicabtagene ciloleucel), or Carvykti (ciltacabtagene autoleucel).

[0195] CARs targeting various antigens including CD20, CD22, CD30, CD33, CD38, CD123, NKG2D, FLT3, CD5, CD7, TnMUCI , mesothelin, CEA, ROR1 , GD2, PSCA, glypican 3 (GPC3), carbonic anhydrase IX (CAIX), HER2, B7H3, GUCY2C, CD19, IL-1 RAP, and epidermal growth factor (EGFR) for the treatment of hematological and solid cancers are also being tested in clinical trials (see, e.g., Dejenie et al., Hum Vaccin Immunother. 2022 Sep 12;18(6):2114254).

[0196] In another embodiment, the nucleic acid of interest is, or encodes, an interfering nucleic acid, such as dsRNA, siRNA, shRNA, miRNA, artificial miRNA (ami-RNA), antisense oligonucleotide (ASO), RNA aptamer, etc. Such interfering nucleic acid may be used, for example, to modulate (e.g., inhibit) the expression of a protein of interest in T and / or NK cells.

[0197] Vector / plasmids

[0198] In an embodiment, the synthetic expression cassette is comprised in a plasmid or a vector. Thus, the present disclosure also relates to a vector or plasmid comprising the synthetic expression cassette described herein. The term "vector" is used to refer to a carrier into which a nucleic acid (e.g., the synthetic expression cassette defined herein) can be inserted for introduction into a cell where it can be replicated. The term "expression vector" or "nucleic acid vector" refers to a vector containing a nucleic acid or "expression cassette" coding for at least part of a gene product capable of being transcribed and "regulatory" or "control" sequences, which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host cell. In addition to control sequences that govern transcription and translation, expression vectors may contain nucleic acid sequences that serve other functions as well.

[0199] In an embodiment, the vector further comprises a nucleic acid encoding a selectable marker or reporter protein. A selectable marker or reporter is defined herein to refer to a nucleic acid encoding a polypeptide that, when expressed, confers an identifiable characteristic (e.g., a detectable signal, resistance to a selective agent) to the cell permitting easy identification, isolation and / or selection of cells containing the selectable marker from cells without the selectable marker or reporter. Any selectable marker or reporter known to those of ordinary skill in the art is contemplated for inclusion as a selectable marker in the vector of the present disclosure. For example, the selectable marker may be a drug selection marker, an enzyme, or an immunologic marker. Examples of selectable markers or reporters include, but are not limited to, polypeptides conferring drug resistance (e.g., kanamycin / geneticin resistance), enzymes such as alkaline phosphatase and thymidine kinase, bioluminescent and fluorescent proteins such as luciferase, green fluorescent protein (GFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), blue fluorescent protein (BFP), citrine and red fluorescent protein from discosoma (dsRED), membrane bound proteins to which high affinity antibodies or ligands directed thereto exist or can be produced by conventional means, and fusion proteins comprising a membranebound protein appropriately fused to an antigen tag domain from, among others, hemagglutinin (HA) or Myc. The nucleic acid encoding the selectable marker or reporter protein may be under the control of the same promoter / enhancer as the nucleic acid of interest, or may be under the control of a distinct promoter / enhancer.

[0200] In embodiments, the vector may comprise additional elements, such as one or more origins of replication sites (often termed “ori”), restriction endonuclease recognition sites (multiple cloning sites, MCS) and / or internal ribosome entry site (IRES) elements.

[0201] In an embodiment, the vector is a viral vector. The term "viral vector" as used herein refers to a recombinant virus capable of transducing cells and introducing their genetic material into the cells. In an embodiment, the viral vector is suitable for use in gene therapy applications. Examples of viral vectors that may be used in gene therapy include retroviruses (lentiviruses), adenoviruses, adeno-associated viruses (AAV), herpesviruses (herpes simplex viruses), alphaviruses, and vaccinia viruses (Poxviruses). In an embodiment, the viral vector is a lentiviral vector. As will be evident to one of skill in the art, the term "lentiviral vector" is used to refer to a lentiviral particle that mediates nucleic acid transfer. Lentiviral particles will typically include various viral components and sometimes also host cell components in addition to nucleic acid(s). In particular aspects, the terms "lentiviral vector," "lentiviral expression vector" are used to refer to lentiviral transfer plasmids and / or infectious lentiviral particles.

[0202] In an embodiment, the lentiviral vector is a pseudotyped lentiviral vector. Pseudotyped lentiviral vectors consist of vector particles bearing enveloped proteins (glycoproteins, GP) derived from other enveloped viruses. Such particles possess the tropism of the virus from which the enveloped proteins are derived. One of the widely used glycoproteins for pseudotyping lentiviral vectors is the vesicular stomatitis virus GP (VSV-G), due to the very broad tropism and stability of the resulting pseudotypes. Pseudotyped lentiviral vectors are well known in the art, and several examples are described, for example, in Cronin et al., Curr. Gene Ther. 5(4):387- 398. It includes lentiviral vectors pseudotyped with lyssavirus GPs, lymphocytic choriomeningitis virus (LCMV) GPs, alphavirus GPs (e.g., Ross River virus (RRV), Semliki Forest virus (SFV) and Sindbis virus GPs), Filovirus GPs (e.g., Marburg virus and Ebola Zaire virus GPs), gammaretrovirus GPs (e.g., ecotropic MLV, amphotropic 4070A MLV, 10A1 MLV, xenotropic NZB MLV, mink cell focus-forming virus, gibbon ape leukemia (GALV) virus, RD1 14 GPs), Vesicular Stomatitis Virus type-G (VSV-G), Measles- Virus Lentiviral vector (MV-LV), Baboon envelop (BaEV)-LVs and baculovirus GPs (GP64).

[0203] In an embodiment, the vector is an episomally-maintained viral vector or non-integrating vector, such as a Sendai virus or vector. Such vectors are not integrated into the genome, but are maintained episomally with cell division due to scaffold / matrix attachment region presence inside vector (see, e.g., Giannakopoulos A et al., J Mol Biol. 2009 Apr 17;387(5):1239-49; and Haase et al., BMC Biotechnol. 2010; 10: 20).

[0204] In another embodiment, the vector is a non-viral vector, for example nude DNA, a liposome, a polymerizer or a molecular conjugate.

[0205] Cells

[0206] In another aspect, the present disclosure provides a cell (host cell, engineered cell) comprising the synthetic expression cassette or vector / plasmid described herein. In an embodiment, the cell is a primary cell, for example a peripheral blood cell (e.g., a T lymphocyte, an NK cell), a cord blood cell, or a bone marrow cell. In an embodiment, the cell is a bone marrow cell, peripheral blood cell or cord blood cell. In a further embodiment, the cell is an immune cell, such as a T cell (e.g., a CD8+T cell), or an NK cell.

[0207] In an embodiment, the cell is a stem cell. The term "stem cell" as used herein refers to a cell that has pluripotency which allows it to differentiate into a functional mature cell. It includes primitive hematopoietic cells, progenitor cells, as well as adult stem cells that are undifferentiated cells found in various tissue within the human body, which can renew themselves and give rise to specialized cell types and tissue from which the cells came (e.g., muscle stem cells, skin stem cells, brain or neural stem cells, mesenchymal stem cell, lung stem cells, liver stem cells). In an embodiment, the cell is a primitive hematopoietic cell. As used herein, the term "primitive hematopoietic cell” is used to refers to cells having pluripotency which allows them to differentiate into functional mature blood cells of the myeloid and lymphoid lineages such as T cells, B cells, NK cells, granulocytes (e.g., promyelocytes, neutrophils, eosinophils, basophils), erythrocytes (e.g., reticulocytes, erythrocytes), thrombocytes (e.g., megakaryoblasts, platelet producing megakaryocytes, platelets), and monocytes (e.g., monocytes, macrophages), and that may or may not the ability to regenerate while maintaining their pluripotency (self-renewal). It encompasses "hematopoietic stem cells" or "HSCs", which are cells having both pluripotency which allows them to differentiate into functional mature cells such as granulocytes, erythrocytes, thrombocytes, and monocytes, and the ability to regenerate while maintaining their pluripotency (self-renewal), as well as pluripotent hematopoietic cells that do not have self-renewal capacity. It also encompasses embryonic stem cells (ESCs), which are pluripotent stem cells derived from the inner cell mass of a blastocyst, an early-stage pre-implantation embryo. In an embodiment, the population of cells comprises ESCs. In another embodiment, the population of cells comprises HSCs. HSCs may be obtained from the body or an organ of the body containing cells of hematopoietic origin. Such sources include un-fractionated bone marrow (from femurs, hip, ribs, sternum, and other bones), umbilical cord blood, peripheral blood, liver, thymus, lymph and spleen. All of the aforementioned crude or un-fractionated blood products can be enriched for cells having HSC characteristics in ways known to those of skill in the art. HSCs are phenotypically identified by their small size, lack of lineage (lin) markers, low staining (side population) with vital dyes such as rhodamine 123 (rhodamineDULL, also called rho °) or Hoechst 33342, and presence / absence of various antigenic markers on their surface many of which belongs to the cluster of differentiation series, such as: CD34, CD38, CD90, CD133, CD105, CD45 and c-kit.

[0208] In an embodiment, the stem cell is an induced pluripotent stem cell (iPSC). The term iPSC refers to a pluripotent stem cell that can be generated directly from adult cells using appropriate factors to “reprogram” the cells.

[0209] In an embodiment, the cell is a mammalian cell, for example a human cell.

[0210] The synthetic expression cassette or vector / plasmid described herein may be introduced into the cell using standard techniques for introducing nucleic acids into a cell, e.g., transfection, transduction or transformation. In an embodiment, the vector is a viral vector, and the cell is transduced with the vector. As used herein, the term "transduction" refers to the stable transfer of genetic material from a viral particle (e.g., lentiviral) to a cell genome (e.g., hematopoietic cell genome). It also encompasses the introduction of non-integrating viral vectors into cells, which leads to the transient or episomal expression of the gene of interest present in the viral vector.

[0211] Viruses may be used to infect cells in vivo, ex vivo, or in vitro using techniques well known in the art. For example, when cells, for instance CD34+cells or stem cells are transduced ex vivo, the vector particles may be incubated with the cells using a dose generally in the order of between 1 to 100 or 1 to 50 multiplicities of infection (MOI) which also corresponds to 1x105to 100 or 50 x 105transducing units of the viral vector per 105cells. This, of course, includes amount of vector corresponding to 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, and 50 MOI.

[0212] Prior to, during, and / or following transduction, the cells may be cultured in media suitable for the maintenance, growth, or proliferation of the cells. The culture conditions of the population of cells will vary depending on different factors, notably, the starting cell population. Suitable culture media and conditions are well known in the art. The culture may be carried out in natural medium, a semi-synthetic medium or a synthetic medium in terms of composition, and may be a solid medium, a semisolid medium or a liquid medium in terms of shape, and any nutrient medium used for cell culture, such as stem cell culture, which may be supplemented with one or more of growth factors. Such medium typically comprises sodium, potassium, calcium, magnesium, phosphorus, chlorine, amino acids, vitamins, cytokines, hormones, antibiotics, serum, fatty acids, saccharides or the like. In the culture, other chemical components or biological components may be incorporated singly or in combination, as the case requires. Such components to be incorporated in the medium may be fetal calf serum, human serum, horse serum, insulin, transferrin, lactoferrin, cholesterol, ethanolamine, sodium selenite, monothioglycerol, 2- mercaptoethanol, bovine serum albumin, sodium pyruvate, polyethylene glycol, various vitamins, various amino acids, agar, agarose, collagen, methylcellulose, various cytokines, various growth factors or the like. Examples of such basal medium appropriate for a method of expanding stem cells include, without limitation, StemSpan™ Serum-Free Expansion Medium (SFEM) (StemCell Technologies®, Vancouver, Canada), StemSpan™ H3000-Defined Medium (StemCell Technologies®, Vancouver, Canada), CellGro™, SCGM (CellGenix™, Freiburg Germany), StemPro™-34 SFM (Invitrogen®), Dulbecco's Modified Eagle's Medium (DMEM), Ham's Nutrient Mixture H12 Mixture F12, McCoy's 5A medium, Eagle's Minimum Essential Medium (EMEM), MEM medium (alpha Modified Eagle's Minimum Essential Medium), RPMI 1640 medium, Isocove's Modified Dulbecco's Medium (IMDM), StemPro34™ (Invitrogen®), X-VIVO™ 10 (Cambrex®), X-VIVO™ 15 (Cambrex®) and Stemline™ II (Sigma-Aldrich®).

[0213] Following transduction, the transduced cells may be cultured under conditions suitable for their maintenance, growth and / or proliferation. In particular aspects, the transduced cells are cultured for about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13 or 14 days before transplantation.

[0214] Culture conditions for maintaining and / or expanding stem cells are well known in the art. Typically, the culturing conditions comprise the use of factors like cytokines and growth factors, generally known in the art for stem cell expansion. Such cytokines and growth factors can be biologies or small molecules and they include without limitation IL-1 , IL-3, IL-6, IL-11 , G-CSF, GM- CSF, SCF, FIT3-L, thrombopoietin (TPO), erythropoietin, and analogs thereof. As used herein, "analogs" include any structural variants of the cytokines and growth factors having the biological activity as the naturally occurring forms, including without limitation, variants with enhanced or decreased biological activity when compared to the naturally occurring forms or cytokine receptor agonists such as an agonist antibody against the TPO receptor (for example, VB22B sc(Fv)2 as detailed in patent publication WO 2007 / 145227, and the like). Cytokine and growth factor combinations are chosen to maintain / expand stem cells while limiting the production of terminally differentiated cells. In one specific embodiment, one or more cytokines and growth factors are selected from the group consisting of SCF, Flt3-L and TPO.

[0215] Human IL-6 or interleukin-6, also known as B-cell stimulatory factor 2 has been described by (Kishimoto, Ann. review of Immunol. 23:1 , 2005) and is commercially available. Human SCF or stem cell factor, also known as c-kit ligand, mast cell growth factor or Steel factor has been described (Smith, MA et al., ACTA Haematologica, 105(3): 143, 2001) and is commercially available. Flt3-L or FLT-3 Ligand, also referred to as FL, is a factor that binds to flt3-receptor. It has been described (Hannum C, Nature 368(6472): 643-8) and is commercially available. TPO or thrombopoietin, also known as megakarayocyte growth factor (MGDF) or c-MpI ligand has been described (Kaushansky K (2006). N. Engl. J. Med. 354 (19): 2034-45) and is commercially available.

[0216] The chemical components and biological components mentioned above may be used not only by adding them to the medium but also by immobilizing them onto the surface of the substrate or support used for the culture, specifically speaking, by dissolving a component to be used in an appropriate solvent, coating the substrate or support with the resulting solution and then washing away an excess of the component. Such a component to be used may be added to the substrate or support preliminarily coated with a substance which binds to the component.

[0217] Stem cells may be cultured in a culture vessel generally used for animal cell culture such as a Petri dish, a flask, a plastic bag, a Teflon™ bag, optionally after preliminary coating with an extracellular matrix or a cell adhesion molecule. The material for such a coating may be collagens I to XIX, fibronectin, vitronectin, laminins 1 to 12, nitrogen, tenascin, thrombospondin, von Willebrand factor, osteoponin, fibrinogen, various elastins, various proteoglycans, various cadherins, desmocolin, desmoglein, various integrins, E-selectin, P-selectin, L-selectin, immunoglobulin superfamily, Matrigel®, poly-D-lysine, poly-L-lysine, chitin, chitosan, Sepharose®, alginic acid gel, hydrogel or a fragment thereof. Such a coating material may be a recombinant material having an artificially modified amino acid sequence. The stem cells may be cultured by using a bioreactor which can mechanically control the medium composition, pH and the like and obtain high density culture (Schwartz R M, Proc. Natl. Acad. Sci. U.S.A., 88:6760, 1991 ; Koller M R, Bone Marrow Transplant, 21 : 653, 1998; Koller, M R, Blood, 82: 378, 1993; Astori G, Bone Marrow Transplant, 35(1) 101 , 2005).

[0218] The cell population may then be washed to remove the compound or composition of invention and / or any other component of the cell culture and resuspended in an appropriate cell suspension medium for short term use or in a long-term storage medium, for example a medium suitable for cryopreservation, for example DMEM with 40% FCS and 10% DMSO. Other methods for preparing frozen stocks for cultured cells also are available to those skilled in the art.

[0219] In an embodiment, the synthetic expression cassette or vector / plasmid described herein may be introduced into cells in vitro or ex vivo using gene-editing techniques (e.g., nuclease- based modifications). As used herein, “a nuclease-based modification” refers to a modification in a polynucleotide, e.g., an endogenous gene locus or genomic sequence, which involves the introduction of a cut (e.g., a double-stranded break in the polynucleotide) which ultimately will trigger a repair mechanism by the cell involving non-homologous-end-joining (NHEJ) or homologous recombination (HDR). The nuclease-based modification is made by site-specific nucleases targeting the polynucleotide of interest ( / .e., an endogenous gene locus or genomic sequence). Site-specific nucleases (engineered) are well known and include (but are not limited to) transposons (Sleeping Beauty and PiggyBac systems), zinc finger nucleases (ZFNs), meganucleases, Mega-Tals, CRISPR nucleases, transcription activator-like effector nucleases (TALENs), etc.).

[0220] In an embodiment, the CRISPR / Cas9 system is used to introduce the synthetic expression cassette or vector / plasmid described herein in a cell in vitro or in vivo. In such a case, the method comprises providing the target cell (stem cell, T cell, NK cell) with a CRISPR nuclease and one or more gRNAs comprising one or more guide sequences having one or more target sequences in the targeted location in the genome, such that the one or more gRNAs direct the cleavage of the targeted location to introduce the synthetic expression cassette or vector / plasmid. In embodiments, the modification may also be introduced using methods such as base editing and prime editing. The target sequence is contiguous to a protospacer adjacent motif (PAM) recognized by the CRISPR nuclease.

[0221] Nucleic acids encoding gRNAs, pegRNAs and CRISPR nucleases (e.g., Cas9) of the present disclosure may be delivered into cells in vivo or in vitro) using one or more various vectors such as viral vectors. Accordingly, preferably, the vector is a viral vector for introducing the sgRNA and / or nuclease of the present disclosure in a target cell. Non-limiting examples of viral vectors include retrovirus, lentivirus, herpesvirus, adenovirus, or adeno-associated virus (AAV), as well known in the art. In an embodiment, the nuclease-based modification is made in vivo, by administering the gene-editing components (e.g., gRNAs, pegRNAs and CRISPR nucleases) to a subject.

[0222] Compositions

[0223] In another aspect, the present disclosure provides a composition comprising the synthetic expression cassette, vector or cell described herein. The composition may comprise one or more carrier or excipient, e.g. a buffer, a saline solution, a preservative, etc. In an embodiment, the composition is a pharmaceutical composition comprising at least one pharmaceutically acceptable carrier or excipient. An "excipient," as used herein, has its normal meaning in the art and is any ingredient that is not an active ingredient (drug) itself. Excipients include for example binders, lubricants, diluents, fillers, thickening agents, disintegrants, plasticizers, coatings, barrier layer formulations, lubricants, stabilizing agent, release-delaying agents and other components. "Pharmaceutically acceptable excipient" as used herein refers to any excipient that does not interfere with effectiveness of the biological activity of the active ingredients and that is not toxic to the subject, i.e., is a type of excipient and / or is for use in an amount which is not toxic to the subject. Excipients are well known in the art (see, e.g., Remington: The Science and Practice of Pharmacy, by Loyd Allen, Jr, 2012, 22ndedition, Pharmaceutical Press; Handbook of Pharmaceutical Excipients, by Rowe et al., 2012, 7thedition, Pharmaceutical Press). Pharmaceutical compositions may be prepared using standard methods known in the art by mixing the active ingredient having the desired degree of purity with one or more optional pharmaceutically acceptable carriers, excipients and / or stabilizers. The excipient may be selected for administration of the composition by any routes, for example, for intravenous, parenteral, subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraspinal, intrathecal, epidural, intracisternal, intraperitoneal, intranasal or pulmonary (e.g., aerosol) administration. In an embodiment, the pharmaceutical composition is formulated for injection, e.g. as a solution, suspension, or emulsion, including localized injection, catheter administration, systemic injection, intravenous injection, intraperitoneal injection, subcutaneous injection or parenteral administration.

[0224] Pharmaceutical compositions in some embodiments are provided as sterile liquid preparations, e.g., isotonic aqueous solutions, suspensions, emulsions, dispersions, or viscous compositions, which may in some aspects be buffered to a selected pH. Liquid preparations are normally easier to prepare than gels, other viscous compositions, and solid compositions. Additionally, liquid compositions are somewhat more convenient to administer, especially by injection. Viscous compositions, on the other hand, can be formulated within the appropriate viscosity range to provide longer contact periods with specific tissues. Liquid or viscous compositions can comprise carriers, which can be a solvent or dispersing medium comprising, for example, water, saline, phosphate buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol) and suitable mixtures thereof.

[0225] Sterile injectable solutions can be prepared by incorporating the cells in a solvent, such as in admixture with a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose, dextrose, or the like. The compositions can also be lyophilized. The compositions can comprise auxiliary substances such as wetting, dispersing, or emulsifying agents (e.g., methylcellulose), pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired. Standard texts may in some aspects be consulted to prepare suitable preparations.

[0226] Various additives which enhance the stability and sterility of the compositions, including antimicrobial preservatives, antioxidants, chelating agents, and buffers, can be added. Prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0227] Sustained-release preparations may be prepared. Suitable examples of sustained- release preparations include semipermeable matrices of solid hydrophobic polymers comprising the antibody, which matrices are in the form of shaped articles, e.g. films, or microcapsules.

[0228] The formulations to be used for in vivo administration are generally sterile. Sterility may be readily accomplished, e.g., by filtration through sterile filtration membranes.

[0229] Genome editing systems such as CRISPR-Cas9 systems may also be delivered using viral (AAV or lentivirus-based) and non-viral delivery vectors (e.g., direct delivery of Cas9 / sgRNA ribonucleoprotein (RNP) complexes, plasmid DNA, or mRNA). The CRISPR-Cas9 components may be encapsulated in suitable vehicles including lipid nanoparticles, polymer nanoparticles, peptide nanoparticles, or inorganic nanoparticles, for example (see, e.g., Behr et al., In vivo delivery of CRISPR-Cas9 therapeutics: Progress and challenges, Acta Pharm Sin B. 2021 May 26;11 (8):2150-2171).

[0230] For example, the synthetic expression cassettes and vectors / plasmids provided herein, in some embodiments, are formulated in lipid-based nanoparticles or liposomes. In some embodiments, the nanoparticles or liposomes comprise one or more moieties which are selectively transported into specific cells (e.g., stem cells or immune cells such as T cells and / or NK cells), tissues or organs, thus enhancing targeted delivery (see, e.g., Ranade V.V., J. Clin. Pharmacol. 29:685 (1989)). In an embodiment, the synthetic expression cassettes and vectors / plasmids provided herein are formulated to be delivered to stem cells and / or immune cells, such as T cells (e.g., CD4 and / or CD8 T cells) and / or NK cells. Biodegradable, biocompatible polymers used in some embodiments, such as lipids, ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Many methods for the preparation of such formulations are patented or generally known to those skilled in the art. See, e.g., Sustained and Controlled Release Drug Delivery Systems, J.R. Robinson, ed., Marcel Dekker, Inc., New York, 1978. In some embodiments, therapeutic compositions are administered with medical devices known in the art.

[0231] Methods / uses The present disclosure also relates to a method for inducing the expression of a gene of interest by a cell (e.g., a T cell and / or NK cell), the method comprising introducing the synthetic expression cassette or vector described herein in the cell and / or a precursor of the cell. The present disclosure also relates to a use of the synthetic expression cassette or vector described herein for inducing the expression of a gene of interest by a cell (e.g., a T cell and / or NK cell). In an embodiment, the cell is a primary cell, for example a peripheral blood cell (e.g., a T lymphocyte, or a NK cell), a cord blood cell, or a bone marrow cell. In an embodiment, the cell is a bone marrow cell, peripheral blood cell or cord blood cell. In a further embodiment, the cell is an immune cell, such as a T cell (e.g., a CD8+T cell), or a NK cell.

[0232] In an embodiment, the gene of interest encodes a protein that is defective or absent in the cell. In an embodiment, the gene of interest encodes a recombinant receptor, such as a recombinant TCR or chimeric antigen receptor (CAR), as described above. In an embodiment, the gene of interest encodes a differentiation factor (for cell reprogramming).

[0233] The present disclosure also relates to a method for treating a disease, condition or disorder in a subject, the method comprising administering the synthetic expression cassette or vector described herein or a cell comprising the synthetic expression cassette or vector described herein. The present disclosure also relates to the use of the synthetic expression cassette or vector described herein or a cell comprising the synthetic expression cassette or vector described herein for treating a disease, condition or disorder in a subject. The present disclosure also relates to the use of the synthetic expression cassette or vector described herein or a cell comprising the synthetic expression cassette or vector described herein for the manufacture of a medicament for treating a disease, condition or disorder in a subject.

[0234] In an embodiment, the disease, condition or disorder is associated with the absence of expression of a protein or the expression of a defective (e.g., mutated) protein, and the synthetic expression cassette or vector comprises a nucleic acid encoding a functional (e.g., native) protein (e.g., gene therapy).

[0235] Examples of diseases / disorders associated with the absence of expression of a protein, or the expression of a defective (e.g., mutated) protein (e.g., genetic diseases / disorders), include certain hematologic and lysosomal storage diseases such as Wiskott-Aldrich syndrome (WAS) (Aiuti et al., Science 341 (6148)), metachromatic leukodystrophy (MLD) (Biffi et al., Science 341 (6148)), Leukocyte adherence deficiency, X-linked CGD, Fanconi anemia, adrenoleukodystrophy, Mucopolysaccharidosis IIIA, as well as immunodeficiencies such as severe combined immunodeficiency (SCID) and adenosine deaminase (ADA) deficiency.

[0236] The disease or condition that is treated can be any in which expression of an antigen is associated with and / or involved in the etiology of a disease condition or disorder, e.g. causes, exacerbates or otherwise is involved in such disease, condition, or disorder. Exemplary diseases and conditions can include diseases or conditions associated with malignancy or transformation of cells (e.g., cancer), autoimmune or inflammatory disease (e.g., arthritis, rheumatoid arthritis (RA), Type I diabetes, systemic lupus erythematosus (SLE), inflammatory bowel disease, psoriasis, scleroderma, autoimmune thyroid disease, Grave's disease, Crohn's disease, multiple sclerosis, asthma, and / or a disease or condition associated with transplant), or an infectious disease, e.g. caused by a bacterial, viral or other pathogen. In particular embodiments, the recombinant receptor, e.g., the CAR, specifically binds to the antigen associated with the disease or condition. In an embodiment, the disease, condition or disorder is cancer or an infectious disease, and the nucleic of interest present in the synthetic expression cassette or vector encodes a recombinant receptor, such as a TCR or CAR, that recognizes an antigen expressed by the tumor cell or infected cell. The infectious disease may be a disease caused by any pathogenic infection, such as a viral, bacterial, parasitic (e.g., protozoal) or fungal infection, for example human immunodeficiency virus (HIV) or cytomegalovirus (CMV) infection.

[0237] As used herein, the term "cancer" has its general meaning in the art and includes, but is not limited to, solid tumors and blood cancers. The term cancer includes diseases of the skin, tissues, organs, bone, cartilage, blood and vessels. The term "cancer" further encompasses both primary and metastatic cancers. In an embodiment, the cancer is a solid cancer. In a further embodiment, the solid cancer is a metastatic solid cancer.

[0238] The cancer may be any type of cancer, including a primary (or original) cancer, a relapsing cancer or a metastatic cancer. Examples of cancers include heart sarcoma, lung cancer, small cell lung cancer (SOLO), non-small cell lung cancer (NSCLC), bronchogenic carcinoma (squamous cell, undifferentiated small cell, undifferentiated large cell, adenocarcinoma), alveolar (bronchiolar) carcinoma, bronchial adenoma, sarcoma (e.g., Ewing’s sarcoma, Karposi's sarcoma), lymphoma, chondromatous hamartoma, mesothelioma; cancer of the gastrointestinal system, for example, esophagus (squamous cell carcinoma, adenocarcinoma, leiomyosarcoma, lymphoma), stomach (carcinoma, lymphoma, leiomyosarcoma), gastric, pancreas (ductal adenocarcinoma, insulinoma, glucagonoma, gastrinoma, carcinoid tumors, vipoma), small bowel (adenocarcinoma, lymphoma, carcinoid tumors, Karposi's sarcoma, leiomyoma, hemangioma, lipoma, neurofibroma, fibroma), large bowel (adenocarcinoma, tubular adenoma, villous adenoma, hamartoma, leiomyoma); cancer of the genitourinary tract, for example, kidney cancer (adenocarcinoma, Wilm's tumor [nephroblastoma], lymphoma, leukemia), bladder and / or urethra cancer (squamous cell carcinoma, transitional cell carcinoma, adenocarcinoma), prostate cancer (adenocarcinoma, sarcoma), testis cancer (seminoma, teratoma, embryonal carcinoma, teratocarcinoma, choriocarcinoma, sarcoma, interstitial cell carcinoma, fibroma, fibroadenoma, adenomatoid tumors, lipoma); liver cancer, for example, hepatoma (hepatocellular carcinoma, HOC), cholangiocarcinoma, hepatoblastoma, angiosarcoma, hepatocellular adenoma, hemangioma, pancreatic endocrine tumors (such as pheochromocytoma, insulinoma, vasoactive intestinal peptide tumor, islet cell tumor and glucagonoma); bone cancer, for example, osteogenic sarcoma (osteosarcoma), fibrosarcoma, malignant fibrous histiocytoma, chondrosarcoma, malignant lymphoma (reticulum cell sarcoma), multiple myeloma, malignant giant cell tumor chordoma, osteochronfroma (osteocartilaginous exostoses), benign chondroma, chondroblastoma, chondromyxofibroma, osteoid osteoma and giant cell tumors; cancer of the nervous system, for example, neoplasms of the central nervous system (CNS), primary CNS lymphoma, skull cancer (osteoma, hemangioma, granuloma, xanthoma, osteitis deformans), meninges (meningioma, meningiosarcoma, gliomatosis), brain cancer (astrocytoma, medulloblastoma, glioma, ependymoma, germinoma [pinealoma], glioblastoma multiform, oligodendroglioma, schwannoma, retinoblastoma, congenital tumors), spinal cord neurofibroma, meningioma, glioma, sarcoma); cancer of the reproductive system, for example, gynecological cancer, uterine cancer (endometrial carcinoma), cervical cancer (cervical carcinoma, pre-tumor cervical dysplasia), ovarian cancer (ovarian carcinoma [serous cystadenocarcinoma, mucinous cystadenocarcinoma, unclassified carcinoma], granulosa-thecal cell tumors, Sertoli-Leydig cell tumors, dysgerminoma, malignant teratoma), vulvar cancer (squamous cell carcinoma, intraepithelial carcinoma, adenocarcinoma, fibrosarcoma, melanoma), vaginal cancer (clear cell carcinoma, squamous cell carcinoma, botryoid sarcoma (embryonal rhabdomyosarcoma), fallopian tube cancer (carcinoma); placenta cancer, penile cancer, prostate cancer, testicular cancer; cancer of the hematologic system, for example, blood cancer (acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), myeloproliferative diseases, multiple myeloma, myelodysplastic syndrome), Hodgkin's disease, non-Hodgkin's lymphoma [malignant lymphoma]; cancer of the oral cavity, for example, lip cancer, tongue cancer, gum cancer, palate cancer, oropharynx cancer, nasopharynx cancer, sinus cancer; skin cancer, for example, malignant melanoma, cutaneous melanoma, basal cell carcinoma, squamous cell carcinoma, Karposi's sarcoma, moles dysplastic nevi, lipoma, angioma, dermatofibroma, and keloids; adrenal gland cancer: neuroblastoma; and cancers of other tissues including connective and soft tissue, retroperitoneum and peritoneum, eye cancer, intraocular melanoma, and adnexa, breast cancer (e.g., ductal breast cancer), head or / and neck cancer (head and neck squamous cell carcinoma), anal cancer, thyroid cancer, parathyroid cancer; secondary and unspecified malignant neoplasm of lymph nodes, secondary malignant neoplasm of respiratory and digestive systems and secondary malignant neoplasm of other sites.

[0239] In an embodiment, the cancer is a hematologic cancer, such as a lymphoma, a leukemias, and / or a myeloma (e.g., B-cell, T-cell, and myeloid leukemias, lymphomas, and multiple myelomas).

[0240] The synthetic expression cassette, vector or cells (e.g., engineered cells comprising the synthetic expression cassette or vector described herein) or compositions comprising same may administered to a subject or patient having the particular disease or condition to be treated. As noted above, the synthetic expression cassette or vector, in some embodiments, is delivered to cells in vivo using methods well known in the art (such as direct injection of nucleic acid, receptor-mediated nucleic acid uptake, viral-mediated transfection or non-viral transfection and lipid- based transfection), all of which often involve the use of gene therapy vectors. Direct injection has been used to introduce naked or chemically modified nucleic acid into cells in vivo. In some embodiments, a delivery apparatus (e.g., a "gene gun") for injecting nucleic acid into cells in vivo is used. In some embodiments, such an apparatus is commercially available (e.g., from BioRad). In some embodiments, naked or chemically modified nucleic acid is introduced into cells by complexing the nucleic acid to a cation, such as polylysine, which is coupled to a ligand for a cell-surface receptor. Binding of the nucleic acid-ligand complex to the receptor, in some embodiments, facilitates uptake of the nucleic by receptor-mediated endocytosis. A nucleic acidligand complex linked to adenovirus capsids which disrupt endosomes, thereby releasing material into the cytoplasm, in some embodiments, is used to avoid degradation of the complex by intracellular lysosomes.

[0241] Defective retroviruses are well characterized for use as gene therapy vectors (for a review see Miller, A. D., Blood 76:271 (1990)). Protocols for producing recombinant retroviruses and for infecting cells in vitro or in vivo with such viruses are found in Current Protocols in Molecular Biology, Ausubel, F. M. et al. (eds.) Greene Publishing Associates, (1989), Sections 9.10-9.14 and other standard laboratory manuals. Examples of suitable retroviruses include pLJ, pZIP, pWE and pEM which are well known to those skilled in the art. Examples of suitable packaging virus lines include psiCrip, psiCre, psi2 and psiAm. Retroviruses have been used to introduce a variety of genes into many different cell types, including epithelial cells, endothelial cells, lymphocytes, myoblasts, hepatocytes, bone marrow cells, in vitro and / or in vivo.

[0242] For use as a gene therapy vector, the genome of an adenovirus, in some embodiments, is manipulated so that includes the synthetic expression cassette but is inactivated in terms of its ability to replicate in a normal lytic viral life cycle. Suitable adenoviral vectors derived from the adenovirus strain Ad type 5 dl324 or other strains of adenovirus (e.g., Ad2, Ad3, Ad7 etc.) are well known to those skilled in the art. Recombinant adenoviruses are advantageous in that they do not require dividing cells to be effective gene delivery vehicles and are often used to infect a wide variety of cell types, including airway epithelium, endothelial cells, hepatocytes, and muscle cells.

[0243] In some embodiments, adeno-associated virus (AAV) is used as a gene therapy vector for delivery of DNA for gene therapy purposes. AAV is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle. In some embodiments, AAV is used to integrate DNA into non-dividing cells. In some embodiments, lentiviral gene therapy vectors are adapted for use in methods provided herein. Genome editing systems such as CRISPR-Cas9 systems may also be delivered using viral (AAV or lentivirus-based) and non-viral delivery vectors (e.g., direct delivery of Cas9 / sgRNA ribonucleoprotein (RNP) complexes, plasmid DNA, or mRNA). The CRISPR-Cas9 components may be encapsulated in suitable vehicles including lipid nanoparticles, polymer nanoparticles, peptide nanoparticles, or inorganic nanoparticles, for example (see, e.g., Behr et al., In vivo delivery of CRISPR-Cas9 therapeutics: Progress and challenges, Acta Pharm Sin B. 2021 May 26;11 (8):2150-2171).

[0244] The amount of synthetic expression cassette, vector or cells (e.g., CAR T cells), to be combined with a carrier material to produce a single dosage form will vary depending upon the subject being treated, and the particular mode of administration. The amount of active ingredient combined with a carrier material to produce a single dosage form will generally be that amount of the composition which produces a therapeutic effect. Generally, out of one hundred percent, this amount will range from about 0.01 per cent to about ninety-nine percent of active ingredient, from about 0.1 per cent to about 70 per cent, or from about 1 percent to about 30 percent of active ingredient in combination with a pharmaceutically acceptable carrier.

[0245] Dosage regimens are adjusted to provide the optimum desired response (e.g., a therapeutic response). For example, in some embodiments, a single bolus is administered. In some embodiments, several divided doses are administered over time. In some embodiments, the dose is proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subjects to be treated; each unit contains a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the synthetic expression cassette, vector or cells provided herein are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of sensitivity in individuals.

[0246] In an embodiment, a cell comprising the synthetic expression cassette or vector may be administered to a subject in need thereof using methods known in the art, e.g., via adoptive cell therapy such as adoptive T cell therapy, or stem cell therapy. Methods for administration of engineered cells for adoptive cell therapy are known and may be used in connection with the provided methods and compositions. For example, adoptive T cell therapy methods are described, e.g., in U.S. Patent Application Publication No. 2003 / 0170238 to Gruenberg et ai, U.S. Patent No. 4,690,915 to Rosenberg; Rosenberg (2011) Nat Rev Clin Oncol. 8(10): 577-85). See, e.g., Themeli et al. (2013) Nat Biotechnol. 31(10): 928-933; Tsukahara et al. (2013) Biochem Biophys Res Commun 438(1): 84-9; Davila et al. (2013) PLoS ONE 8(4): e61338. As used herein, "treatment" (and grammatical variations thereof such as "treat" or "treating") refers to complete or partial amelioration or reduction of a disease or condition or disorder, or a symptom, adverse effect or outcome, or phenotype associated therewith. Desirable effects of treatment include, but are not limited to, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis. The terms do not imply complete curing of a disease or complete elimination of any symptom or effect(s) on all symptoms or outcomes.

[0247] In some embodiments, the cell therapy, e.g., adoptive T cell therapy or stem cell therapy, is carried out by autologous transfer, in which the cells are isolated and / or otherwise prepared from the subject who is to receive the cell therapy, or from a sample derived from such a subject. Thus, in some aspects, the cells are derived from a subject, e.g., patient, in need of a treatment and the cells, following isolation and processing are administered to the same subject.

[0248] In some embodiments, the cell therapy, e.g., adoptive T cell therapy or stem cell therapy, is carried out by allogeneic transfer, in which the cells are isolated and / or otherwise prepared from a subject other than a subject who is to receive or who ultimately receives the cell therapy, e.g., a first subject. In such embodiments, the cells then are administered to a different subject, e.g., a second subject, of the same species. In some embodiments, the first and second subjects are genetically identical. In some embodiments, the first and second subjects are genetically similar. In some embodiments, the second subject expresses the same HLA class or super type as the first subject. The cells can be administered by any suitable means. Dosing and administration may depend in part on whether the administration is brief or chronic. Various dosing schedules include but are not limited to single or multiple administrations over various time-points, bolus administration, and pulse infusion.

[0249] In certain embodiments, the cells, or individual populations of sub-types of cells, are administered to the subject at a range of about one million to about 100 billion cells and / or that amount of cells per kilogram of body weight, such as, e.g., 1 million to about 50 billion cells (e.g., about 5 million cells, about 25 million cells, about 500 million cells, about 1 billion cells, about 5 billion cells, about 20 billion cells, about 30 billion cells, about 40 billion cells, or a range defined by any two of the foregoing values), such as about 10 million to about 100 billion cells (e.g., about 20 million cells, about 30 million cells, about 40 million cells, about 60 million cells, about 70 million cells, about 80 million cells, about 90 million cells, about 10 billion cells, about 25 billion cells, about 50 billion cells, about 75 billion cells, about 90 billion cells, or a range defined by any two of the foregoing values), and in some cases about 100 million cells to about 50 billion cells (e.g., about 120 million cells, about 250 million cells, about 350 million cells, about 450 million cells, about 650 million cells, about 800 million cells, about 900 million cells, about 3 billion cells, about 30 billion cells, about 45 billion cells) or any value in between these ranges and / or per kilogram of body weight. Dosages may vary depending on attributes particular to the disease or disorder and / or patient and / or other treatments.

[0250] In some embodiments, for example, where the subject is a human, the dose of recombinant receptor (e.g., CAR)-expressing cells, stem cells, T cells, or peripheral blood mononuclear cells (PBMCs), is at least 1 x 102, 1 x 103, 1 x 104or 1 x 105cells, for example in the range of about 1 x 106to 1 x 108such cells, such as 2 x 106, 5 x 106, 1 x 107, 5 x 107, or 1 x 108or total such cells, or the range between any two of the foregoing values.

[0251] In some embodiments, the cells are administered as part of a combination treatment, such as simultaneously with or sequentially with, in any order, another therapeutic intervention, such as an antibody or engineered cell or receptor or agent, such as a cytotoxic or therapeutic agent. The cells in some embodiments are co-administered with one or more additional therapeutic agents or in connection with another therapeutic intervention, either simultaneously or sequentially in any order. In some contexts, the cells are co-administered with another therapy sufficiently close in time such that the cell populations enhance the effect of one or more additional therapeutic agents, or vice versa. In some embodiments, the cells are administered prior to the one or more additional therapeutic agents. In some embodiments, the cells are administered after the one or more additional therapeutic agents. In some embodiments, the one or more additional agents include a cytokine, such as IL-2, for example, to enhance persistence. In some embodiments, the methods comprise administration of a chemotherapeutic agent.

[0252] The cells may be used in combination with other therapy such as other chemotherapy, immunotherapy, radiotherapy, or surgery, according to the disease to be treated. In an embodiment, the immunotherapy, such as an immune checkpoint inhibitor (ICI)-based therapy. The term “immune checkpoint inhibitor” (ICI) or “immune checkpoint blocker” (ICB) as used herein refers to an agent that block or inhibit the activity of a negative regulator of the immune response. In an embodiment, the ICI blocks or inhibits the activity of T cells (e.g., CTLs and / or CD4 helper T cells) and / or of NK cells. Examples of such negative regulators of the immune response (i.e., immune checkpoint) include Adenosine A2A receptor (A2AR), B7-H3 (CD276), B7-H4 (VTCN1), B and T Lymphocyte Attenuator (BTLA or CD272), Cytotoxic T-Lymphocyte-Associated protein 4 (CTLA-4, CD152), CD47 / SIRPa, Indoleamine 2,3-dioxygenase (IDO), Killer-cell Immunoglobulin- like Receptor (KIR), Lymphocyte Activation Gene-3 (LAG3), nicotinamide adenine dinucleotide phosphate NADPH oxidase isoform 2 (NOX2), poliovirus receptor-related immunoglobulin (PVRIG), carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1), Programmed Death 1 (PD-1) receptor, PD-L1 , PD-L2, T-cell Immunoglobulin domain and Mucin domain 3 (TIM- 3), V-domain Ig suppressor of T cell activation (VISTA), and Sialic acid-binding immunoglobulin- type lectin 7 (SIGLEC7 or CD328) and SIGLEC9 (CD329). In an embodiment, the immune checkpoint inhibitor is an inhibitor of CTLA-4, PD-1 or PD-L1. Examples of immune checkpoint inhibitors includes anti-PD-1 antibodies / blockers (e.g., Tislelizumab, Penpulimab, Pidilizumab, Sintilimab, Toripalimab, Retifanlimab, Dostarlimab, Nivolumab, Cemiplimab, Pembrolizumab, Spartalizumab, Camrelizumab, JTX-4014, INCMGA00012 (MGA012), AMP-224, AMP-514), anti- PD-L1 antibodies / blockers (e.g., Durvalumab, Avelumab, Atezolizumab, KN035, CK-301 , AUNP12, CA-170, BMS-986189), anti-CTLA-4 antibodies (e.g., Tremelimumab, Ipilimumab), anti- LAG-3 antibodies (e.g., Relatlimab, LAG525 (IMP701), REGN3767 (R3767), Bl 754,091 , tebotelimab (MGD013), eftilagimod alpha (IMP321), FS118), anti-TIM-3 antibodies (MBG453, Sym023, TSR-022), anti-B7-H3 / H4 antibodies (e.g., MGC018, FPA150), adenosine signaling pathway inhibitors including A2AR inhibitors (e.g., Inupadenant (EGS100850), Etrumadenant (AB928), Imaradenant (AZD4635), Ciforadenant, NIR178, CS3005, PBF-999, INCB106385, CPI- 444), CD73 antagonists / anti-CD73 antibodies (e.g., Mupadolimab (CPI-006), Oleclumab (MEDI9447), Uliledlimab, AB680, BMS-986179, NZV930, AK119, SYM024, INCA00186, ORIC- 533, IPH5301 , PSB-1248937), and CD39 antagonists (TTX-030, IPH5201 , SRF617), anti-NKG2A antibodies (Monalizumab), anti-PVRIG (e.g., COM701), anti-CEACAM1 antibodies (e.g., CM24), and CD47 blockers / inhibitors (Evorpacept (ALX148), Hu5F9-G4 (5F9), TTI-662, RRx-001) (see, e.g., Marin-Acevedo et al., Next generation of immune checkpoint inhibitors and beyond, Journal of Hematology & Oncology, volume 14, Article number: 45 (2021); Xia et al., CD39 / CD73 / A2AR pathway and cancer immunotherapy, Molecular Cancer, volume 22, Article number: 44 (2023)). The chemical structures and sequences of the above-noted immune checkpoint inhibitors are incorporated herein by reference.

[0253] As used herein, the term "subject" or “patient” denotes a mammal, such as a rodent, a feline, a canine, and a primate. Preferably a subject or patient according to the disclosure is a human.

[0254] In some embodiments, the synthetic expression cassette is used as a research tool, for example as reporter tool or in a commercial detection method (assay development). For example, the synthetic expression cassette may be operably linked to a nucleic acid encoding a reporter protein, which may be used for the detection of the expression of a gene of interest in a specific cell type, e.g., to confirm that the gene of interest has been taken up by and is expressed by the cell. The term “reporter protein” refers to a protein that may be easily identified and measured such as fluorescent and luminescent proteins (e.g., GFP, YFP), as well as enzymes that are able to generate a detectable product from a substrate (e.g., luciferase). The synthetic expression cassette may also be used for the cell-specific expression of a gene of interest in vitro, e.g., to assess the effect of the expression of the gene of interest in the targeted cells.

[0255] MODE(S) FOR CARRYING OUT THE INVENTION

[0256] The present invention is illustrated in further details by the following non-limiting examples. Example 1: Characterization of a previously reported NK / T Cis-regulatory element (Enhancer genomic region)

[0257] A candidate Cis-regulatory element (enhancer) sequence specific for T and NK cells was previously reported in PCT application No. PCT / CA2020 / 050084 (designated as “SEQ. No24” or SEQ. NO24 herein). The sequence of this enhancer is: GTGAGCTGTCGCCCTTGGGTACACCAGTAGCAAAAACACTCCTGTCCTCCTATGCTGCTGT GACACCACACCCCACTTCCTCCCGCGGGCGTGTGACACTTTTCAAAGAAAATACAGTATTT

[0258] GGTAGTATCAATACAGCAAGCGGAAGCAGCAGTGCTCAGTCCGCAGTGAGCTAACAGTTT

[0259] T (SEQ ID NO:24).

[0260] To further investigate the biology of this Cis-regulatory element and enhance its characterization, published data and publicly available ATAC-seq datasets were analyzed (M

[0261] Corces Nature genetics, 2016) visualized through the UCSC Genome Browser

[0262] (https: / / qenome.ucsc.edu / ). These datasets assess the dynamic activity ("opening" and "closing") of genomic regulatory elements across various hematopoietic cell types. As shown in FIG. 1 , the previously reported enhancer is specifically "open and active" in NK and T cells, indicating that this genomic region plays a role in gene expression specifically within these two cell types.

[0263] Example 2: Identification of binding site fortranscription factors (TFs) in vivo

[0264] The open or active enhancer region in T / NK cells can drive gene expression specifically in these cell types by recruiting transcription factors (TFs) and their co-factors, such as epigenetic regulators. Identifying these TFs would permit to have a better understanding and characterization of the previously reported enhancer. The main challenge lies in identifying these TFs in vivo while they are bound to the enhancer region. To overcome this, the C-BERST assay, a technique that uses dCas9-APEX2-mediated proximity labelling to identify key TFs and their co-factors interacting with enhancer sequences in vivo (SA Myers et al, 2018, Nature methods, DOI: 10.1038 / S41592-018-0007-1), was employed.

[0265] To identify the TFs interacting with the previously reported enhancer region in vivo, three sgRNAs were designed (by using the Broad Institute’s sgRNA design tool) and validated (see Table 1 for information on the sgRNAs). These sgRNAs were used to guide the dCas9-APEX2 fusion protein (an engineered ascorbate peroxidase) to rapidly biotin-label proteins (TFs and cofactors) at the target genomic region.

[0266] Table 1: sgRNA sequences details used to target “SEQ. No24” sequence endogenously with Ca9 protein, chose based on several well used algorithms.

[0267] To test the selected sgRNAs, a hematopoietic cell line overexpressing active Cas9 protein was efficiently transduced with three lentiviruses, each expressing one of the sgRNAs targeting the previously reported enhancer genomic region (cloned in Addgene plasmid #108650, constitutively expressing BFP fluorescent protein). Three to seven days post-transduction, transduction efficiency was confirmed by flow cytometry (~95%) (FIG. 2B) and genomic DNAwas extracted according to the manufacturer’s protocol (using a Qiagen kit, Cat. No. 69504). PCR was performed following the manufacturer’s protocol (using Platinum SuperFi II DNA Polymerase-High-Fidelity PCR Enzyme, Cat. No. 12368010) to specifically amplify the targeted enhancer genomic region for each sgRNA.

[0268] Following the manufacturer’s protocol, the T7 Endonuclease I assay (NEB, M0302) was used to assess the efficiency of Cas9-mediated cleavage at the previously reported enhancer genomic region (FIG. 2C). Bioinformatic analysis using TIDE (Tracking of Indels by Decomposition) (https: / / tide.nki.nl) showed a cut efficiency ranging from 76% to 86% for the three selected sgRNAs (FIG. 2D).

[0269] As observed in FIG. 1 , the AT AC seq data showed that the previously reported enhancer region is opened / active specifically in NK / T cell context, and thus the C-BERST assay should be performed in cell context where this region is opened / active to be able to identify specific TFs interacting with this region. Before transducing the cell lines with different lentivirus for the C- BERST assay, they were tested for the activity of the previously reported enhancer genomic region using ATACqPCR (DOI: 10.1016 / j.celrep.2020.107983). As shown in FIG. 3, the Jurkat cell line, a mature human T lymphocyte cells (Clone# E6-1), that is used as model for human resting T cells (DOI: 10.1186 / s12865-020-00377-6) showed opened and active enhancer region relative to other tested cell lines (FIG. 3). Therefore, the Jurkat cell line was selected to perform the C-BERST assay and the K562 (erythroleukemia cell line, DOI: 10.1002 / ijc.2910230202) was used as negative control to improve TFs identification and specificity.

[0270] To perform the c-BERST assay (FIG. 4A), Jurkat and K562 cell lines efficiently expressing protein fusion dCas9-APEX2 (engineered ascorbate peroxidase, expressed by using lentivirus the plasmid 108570 from Addgene) were generated with different tested sgRNAs, which can rapidly biotin label proteins in the desired genomic region (FIG. 4A). Upon addition of hydrogen peroxide to cells preloaded with a biotin-phenol substrate, the APEX2 generates biotin- phenoxyl radicals that covalently label proximal endogenous proteins. Biotin-labeled proteins are then pulled down with streptavidin beads, enriched and identified by liquid chromatography-mass spectrometry (LC-MS / MS) (FIG. 4B-C).

[0271] The mass spectrometry raw data was analyzed with scaffolds software

[0272] (https: / / www.proteomesoftware.com / products / scaffold-5), and results showed that more than 175 identified proteins were unique to Jurkat cells expressing the previously reported enhancer region (Jurkat sgRNA_SEQ. NO24) (FIG. 5A). A string analysis (https: / / strinq-db.orq) confirmed the strong interaction between the identified proteins and that they constitute protein networks highly involved in gene transcription (FIG. 5B). Since the primary focus is to identify TFs interacting with the previously reported enhancer region, from the 11 TFs identified only 4 (BCL11a / b, MYBL1 , SATB1 , and ELF1) present motif binding the previously reported enhancer region as identified with the JASPAR 2023 database of transcription factor binding profiles (Rauluseviciute et al.,

[0273] Nucleic Acids Research, Volume 52, Issue D1 , 5 January 2024, Pages D174-D18, (FIGS. 5C-D).

[0274] To confirm the interaction of TFs identified by the C-BERST assay, the CUT&Tag assay

[0275] (an epigenomic profiling strategy) (https: / / www.nature.com / articles / s41596-020-0373-x) was used. In this method, antibodies bind to transcription factors in permeabilized nuclei and tether the Tn5 transposase. Activation of Tn5 cleaves the DNA and adds adapters for paired-end sequencing. The SDS-PAGE gel confirmed the expression of TFs identified by C-BERST in the Jurkat human T cell line compared to the K562 cell line (FIG. 6A). Additionally, the sequencing data showed the correct sequence and alignment rates for each sample (FIG. 6B). Notably, visualization of these normalized data (using https: / / qenome.ucsc.edu / ) revealed enrichment of the ELF1 TF in the previously reported enhancer genomic region (FIGs. 6C-D).

[0276] Example 3: Role of identified TFs in the transcriptional activity driven by the enhancer

[0277] To explore the role of the identified TFs in the transcriptional activity driven by the previously reported enhancer, a dual promoter system (https: / / pubmed.ncbi.nlm.nih.gov / 26505747 / ) was first utilized. The following constructs were cloned upstream of ZsGreenl (FIG. 7A): 1) a scrambled sequence (named also EMPTY), 2) MLP (minimal promoter alone) (https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC2757179 / ), 3) MLP associated with the full previously reported «SEQ.NO24» sequence, 4) MLP with a truncated «SEQ.NO24» sequence comprising nucleotides 60 to 149 that contains the binding sites of the four identified TFs, referred to as "only region 60_149bp" of «SEQ.NO24», and 5) MLP with a truncated «SEQ.NO24» sequence, referred to as "mutated 60_149bp," which lack nucleotides 60 to 149 (see Table 2, FIG. 7B).

[0278] Table 2: Sequences used to generate synthetic promoters (highlighted in FIG. 7B) to investigate the transcriptional role of the 60_149 bp region in Full_SEQ.NO24.

[0279] Interestingly, the "only region 60_149bp" construct yielded the same expression level as the "Full «SEQ.NO24»" construct, confirming that the region comprising the TF binding sites (60_149bp) within «SEQ.NO24» contains all the transcriptional activity driven by the previously reported enhancer sequence (FIG. 7C).

[0280] To gain further insight into the involvement of the 4 identified TFs in the transcriptional activity of «SEQ.NO24», the binding site corresponding to each TF within the previously reported enhancer sequence (FIGs. 8A-C) were specifically deleted. Jurkat human T cell line transduced with the various lentiviral constructs (FIGs. 8B-C) revealed that the deletion of the ELF1 TF binding site (18nt) alone was sufficient to completely abolish the transcriptional activity driven by the enhancer (FIG. 8D). This finding corroborates the previous CUT&Tag assay results (FIGs. 6C-D), where, of the four TFs tested, only ELF1 showed significant binding to the previously reported enhancer genomic region in situ.

[0281] Example 4: Development of new synthetic expression cassettes for NK / T cell-specific expression based on the identified ELF1 binding site sequence

[0282] Based on the above findings, new synthetic expression cassettes comprising a minimal promoter and transcriptional enhancers based on the sequences surrounding the ELF1 binding site were designed and tested (Table 3).

[0283] Table 3: Sequences used to generate new specific promoters. Deleted sequence of ELF1 binding site is underlined, (nt = nucleotide). To test the efficiency of the new transcriptional enhancers highlighted in FIG. 9A in driving the expression of the ZsGreenl transgene, various lentiviral constructs were transduced into the Jurkat human T cell line, and the expression potential of each construct was assessed using flow cytometry (FIGs. 9B-C). Several newly designed synthetic expression cassettes based on sequences surrounding the ELF1 binding site efficiently induced expression of the ZsGreenl transgene, notably 1x60_149, 3x60_149, 1xELF1_20nt, and 3xELF1_20nt, highlighted in FIG. 9D). This finding confirms that the ELF1 binding site sequence is not only structurally important in the previously reported enhancer sequence, but also transcriptionally active, providing modulable expression proportional to the number of ELF1 binding site repeats, as evidenced by the increased MFI signal between 1xELF1_20nt and 3xELF1_20nt, and between 1xELF1_30nt and 3xELF1_30nt (FIG. 9C). It was also observed that the distance between the different ELF1 binding sites could influence the transcriptional activity of the enhancer. For instance, 3xELF1_20nt (in which the ELF1 binding sites are separated by 2 nucleotides) results in higher transgene expression than 3xELF1_30nt (in which the ELF1 binding sites are separated by 12 nucleotides (FIG. 9C-D).

[0284] Additional experiments were conducted in the same model using other transcriptional enhancers comprising various numbers of repeats of the ELF1_20nt and ELF1_30nt sequences (FIG. 10A). Consistent with the results depicted in FIGs 9C-D, the ELF1_20nt constructs resulted in higher transgene expression than the ELF1_30nt constructs (FIGs. 10B-D). Increased expression of the transgenes was obtained with transcriptional enhancers comprising 2, 3, 6 or 9 repeats of the ELF1_20nt or ELF1_30nt sequences, the maximal expression being observed for the 6xELF1 constructs (FIGs. 10B-D).

[0285] Example 5: Assessment of the transcriptional activity of the new synthetic expression cassettes in primary T / NK cells

[0286] To assess the potential of the newly designed synthetic expression cassettes in driving targeted transgene expression in T / NK cells, CD34+CD3_hematopoietic stem / progenitor cells, isolated from cord blood, were transduced with various constructs: EMPTY, FulIJ’SEQ. NO24”, 1X60_149, 3X60_149, 3XELF1_20nt, and 3XELF1_30nt. After 3 weeks of differentiation toward the B lymphocyte lineage, the cells from each condition were analyzed by flow cytometry, using mature B-cell surface markers (CD19, CD20, CD22). Notably, all specific promoters, except 3X60_149, did not induce ZsGreenl expression, indicating minimal promoter activity in B-cell lineage (FIG. 11B). Similar results were obtained in cultured (3 weeks) and undifferentiated CD34+cells (FIG. 11 A).

[0287] For T lymphocyte lineage differentiation, after 7 weeks, enhanced ZsGreenl expression driven by specific promoters, particularly 1X60_149, 3X60_149, and 3XELF1_20nt, was observed. This expression increased progressively with T-cell maturity; in fully differentiated T cells (purified from peripheral blood), all DsRED-positive cells expressed ZsGreenl , showing robust and consistent expression. This result was significantly higher than that of the FulIJ’SEQ. NO24” condition, where only 50-75% of DsRED-positive cells expressed ZsGreenl (FIG. 11C, lower panel). A similar pattern was observed in mature NK cells transduced with the specific promoters, with ZsGreenl expression surpassing that of the FulIJ’SEQ. NO24” enhancer (FIG. 11D). These results underscore the potential of specific enhancers, particularly 1X60_149, 3XELF1_20nt, and 3XELF1_30nt configurations, to drive lineage-specific transgene expression in T and NK cells.

[0288] To further investigate the specificity of these new synthetic expression cassettes, hepatocyte-like cells derived from human iPS cells (16 days post-differentiation) were transduced. Whereas the constitutive EF1a promoter induced transgene expression in the hepatocyte-like cells, no ZsGreenl expression was observed when the transgene was put under the control of any of the new synthetic enhancers, further demonstrating their T / NK specificity (FIG. 12).

[0289] Without wishing to be bound by any theory, it is believed that the ELF1 binding site in the 60_149 sequence is primarily responsible for the recruitment and binding of the transcriptional machinery in NK and T cells, but that the remaining sequences are involved in the stabilization of the transcriptional machinery at the promoter, leading to low / basal expression of the gene (FIG. 13A). An enhancer comprising a single copy of the ELF1 binding site only, in the absence of other sequences stabilizing the transcriptional machinery at the promoter, results in no or very low gene expression (FIG. 13B). However, the presence of multiple copies of the ELF1 binding site in the enhancer leads to the effective recruitment and stabilization of the transcriptional machinery at the promoter, leading to strong gene expression (FIG. 13C).

[0290] Example 6: Assessment of the transcriptional activity of the new synthetic expression cassettes in both orientations

[0291] The “promoter”-CAR-anti-CD19-P2A-mTagBFP2 expression cassette was cloned in both the 5’ -> 3’ or 3’ -> 5’ orientations to evaluate orientation-dependent effects on expression. The full ”SEQ. NO24” and 3xELF_20nt enhancers were cloned to drive the CAR-CD19, the ubiquitous SFFV promoter was used as a control. Lentiviral particles were produced and Jurkat cells were transduced. Four days post-transduction, the expression of the CAR by transduced cells was analyzed by flow cytometry. The results depicted in FIG. 14 show that all promoters can induce protein expression in both orientations, confirming the enhancer properties of the full ”SEQ. NO24” and 3xELF_20nt sequences.

[0292] Example 7: New synthetic expression cassettes lead to effective cytotoxic functions when driving a CAR expression The performance of the two synthetic enhancer-derived promoters, full SEQ.No24 and 3xELF-20nt, was assessed for driving expression of second-generation chimeric antigen receptors (CARs) targeting CD19 or B7-H3 in primary T cells. CAR expression was linked to a fluorescent reporter to enable selection of cell populations exhibiting comparable transcriptional output across promoter conditions. It is demonstrated that synthetic promoters, particularly 3xELF-20nt, provided stable and functional CAR expression, resulting in cytotoxic activity comparable to that achieved with strong constitutive promoters such as SFFV (FIG. 15).

[0293] In an in vitro solid tumor model of rhabdomyosarcoma (RH30) (FIG. 16), the 3xELF-20nt promoter maintained robust cytotoxicity despite moderate expression levels, indicating that this promoter facilitates efficient antitumor activity while mitigating excessively high CAR expression achieved with constitutive promoters such as EF1a. These results support the implementation of synthetic enhancer-based promoters as an approach for fine-tuning CAR expression to enhance performance in challenging tumor.

[0294] Although the present invention has been described hereinabove by way of specific embodiments thereof, it can be modified, without departing from the spirit and nature of the subject invention as defined in the appended claims. In the claims, the word "comprising" is used as an open-ended term, substantially equivalent to the phrase "including, but not limited to". The singular forms "a", "an" and "the" include corresponding plural references unless the context clearly dictates otherwise.

[0295] REFERENCES

[0296] 1 . Hacein-Bey-Abina S, Hauer J, Lim A, et al. Efficacy of gene therapy for X-linked severe combined immunodeficiency. N Engl J Med 2010;363:355-64.

[0297] 2. Hacein-Bey-Abina S, Pai SY, Gaspar HB, et al. A modified gamma-retrovirus vector for X- linked severe combined immunodeficiency. N Engl J Med 2014;371 :1407-17.

[0298] 3. Lizio M, Harshbarger J, Shimoji H, et al. Gateways to the FANTOM5 promoter level mammalian expression atlas. Genome Biol 2015; 16:22.

[0299] 4. Andersson R, Gebhard C, Miguel-Escalada I, et al. An atlas of active enhancers across human cell types and tissues. Nature 2014;507:455-461.

[0300] 5. Boshart M, Weber F, Jahn G, et al. A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus. Cell 1985;41 :521-30.

[0301] 6. Ede C, Chen X, Lin MY, et al. Quantitative Analyses of Core Promoters Enable Precise Engineering of Regulated Gene Expression in Mammalian Cells. ACS Synth Biol 2016;5:395-404.

[0302] 7. Matsuda K, Mikami T, Oki S, et al. ChlP-seq analysis of genomic binding regions of five major transcription factors highlights a central role for ZIC2 in the mouse epiblast stem cell gene regulatory network. Development 2017;144:1948-1958. 8. Levy C, Amirache F, Costa C, et al. Lentiviral vectors displaying modified measles virus gp overcome pre-existing immunity in in vivo-like transduction of human T and B cells. Mol Ther 2012;20:1699-712.

[0303] 9. Humbert JM, Frecha C, Amirache Bouafia F, et al. Measles virus glycoproteinpseudotyped lentiviral vectors are highly superior to vesicular stomatitis virus G pseudotypes for genetic modification of monocyte-derived dendritic cells. J Virol 2012;86:5192-203.

[0304] 10. Girard-Gagnepain A, Amirache F, Costa C, et al. Baboon envelope pseudotyped LVs outperform VSV-G-LVs for gene transfer into early-cytokine-stimulated and resting HSCs. Blood 2014; 124: 1221 -31.

[0305] 11 . Lowe E, Truscott LC, De Oliveira SN. In Vitro Generation of Human NK Cells Expressing Chimeric Antigen Receptor Through Differentiation of Gene-Modified Hematopoietic Stem Cells. Methods Mol Biol 2016;1441 :241-51.

[0306] 12. Huang J, Nguyen-McCarty M, Hexner EO, et al. Maintenance of hematopoietic stem cells through regulation of Wnt and mTOR pathways. Nat Med 2012; 18: 1778-85.

[0307] 13. Markert ML, Devlin BH, McCarthy EA. Thymus transplantation. Clin Immunol 2010;135:236-46.

[0308] 14. Kalscheuer H, Danzl N, Onoe T, et al. A model for personalized in vivo analysis of human immune responsiveness. Sci Transl Med 2012;4:125ra30.

[0309] 15. Laing AA, Harrison CJ, Gibson BES, et al. Unlocking the potential of anti-CD33 therapy in adult and childhood acute myeloid leukemia. Exp Hematol 2017;54:40-50.

[0310] 16. La Motte-Mohs RN, Herer E, Zuniga-Pflucker JC. Induction of T-cell development from human cord blood hematopoietic stem cells by Delta-like 1 in vitro. Blood 2005; 105: 1431- 9.

[0311] 17. Halkias J, Melichar HJ, Taylor KT, et al. Tracking migration during human T cell development. Cell Mol Life Sc / 2014;71 :3101-17.

[0312] 18. Kurd N, Robey EA. T-cell selection in the thymus: a spatial and temporal perspective. Immunol Rev 2016;271 :114-26.

[0313] 19. Poulin JF, Sylvestre M, Champagne P, et al. Evidence for adequate thymic function but impaired naive T-cell survival following allogeneic hematopoietic stem cell transplantation in the absence of chronic graft-versus-host disease. Blood 2003; 102:4600-7.

[0314] 20. Dion ML, Poulin JF, Bordi R, et al. HIV infection rapidly induces and maintains a substantial suppression of thymocyte proliferation. Immunity 2004;21 :757-68.

[0315] 21. Sportes C, Hakim FT, Memon SA, et al. Administration of rhlL-7 in humans increases in vivo TCR repertoire diversity by preferential expansion of naive T cell subsets. J Exp Med 2008;205:1701-14. 22. Kershaw MH, Westwood JA, Darcy PK. Gene-engineered T cells for cancer therapy. Nat Rev Cancer 2013; 13:525-41.

[0316] 23. Porter DL, Hwang WT, Frey NV, et al. Chimeric antigen receptor T cells persist and induce sustained remissions in relapsed refractory chronic lymphocytic leukemia. Sci Transl Med 2015;7:303ra139.

[0317] 24. Savoldo B, Ramos CA, Liu E, et al. CD28 costimulation improves expansion and persistence of chimeric antigen receptor-modified T cells in lymphoma patients. J Clin Invest 2011 ;121 :1822-6.

[0318] 25. Maude SL, Teachey DT, Porter DL, et al. CD19-targeted chimeric antigen receptor T-cell therapy for acute lymphoblastic leukemia. Blood 2015; 125:4017-23.

[0319] 26. Maude SL, Frey N, Shaw PA, et al. Chimeric antigen receptor T cells for sustained remissions in leukemia. N Engl J Med 2014;371 :1507-17.

[0320] 27. Grupp SA, Kalos M, Barrett D, et al. Chimeric antigen receptor-modified T cells for acute lymphoid leukemia. N Engl J Med 2013;368:1509-18.

[0321] 28. Haso W, Lee DW, Shah NN, et al. Anti-CD22-chimeric antigen receptors targeting B-cell precursor acute lymphoblastic leukemia. Blood 2013; 121 : 1165-74.

[0322] 29. Lee DW, Kochenderfer JN, Stetler-Stevenson M, et al. T cells expressing CD19 chimeric antigen receptors for acute lymphoblastic leukaemia in children and young adults: a phase 1 dose-escalation trial. Lancet 2015;385:517-28.

[0323] 30. Fitzgerald JC, Weiss SL, Maude SL, et al. Cytokine Release Syndrome After Chimeric Antigen Receptor T Cell Therapy for Acute Lymphoblastic Leukemia. Crit Care Med 2017;45:e124-e131.

[0324] 31. Teachey DT, Lacey SF, Shaw PA, et al. Identification of Predictive Biomarkers for Cytokine Release Syndrome after Chimeric Antigen Receptor T-cell Therapy for Acute Lymphoblastic Leukemia. Cancer Discov 2016;6:664-79.

[0325] 32. Jena B, Maiti S, Huis H, et al. Chimeric antigen receptor (CAR)-specific monoclonal antibody to detect CD19-specific T cells in clinical trials. PLoS One 2013;8:e57838.

Claims

WHAT IS CLAIMED IS:1 . A synthetic expression cassette comprising:(i) a minimal promoter; and(ii) a transcriptional enhancer operatively coupled to the minimal promoter for expression of the nucleic acid of interest in the cell, wherein the transcriptional enhancer (a) has a length of 150 nucleotides or less and comprises at least one binding site for E74 like ETS transcription factor 1 (ELF1); or (b) has a length of 300 nucleotides or less and comprises at least two binding sites for ELF 1 .

2. The synthetic expression cassette of claim 1 , wherein the binding site for ELF1 comprises a sequence having at least 80% or 90% sequence identity with the sequence CAATACAGCAAGCGGAAG (SEQ ID NO:1) or CAATACAGCAAGX1GGAX2G (SEQ ID NO:2), wherein X1is C or A and X2is A or T.

3. The synthetic expression cassette of claim 2, wherein the binding site for ELF 1 comprises the sequence CAATACAGCAAGCGGAAG (SEQ ID NO:1) or CAATACAGCAAGX1GGAX2G (SEQ ID NO:2).

4. The synthetic expression cassette of any one of claims 1 to 3, wherein the at least one binding site is at least two binding sites.

5. The synthetic expression cassette of any one of claims 1 to 3, wherein the at least one binding site or at least two binding sites is at least three binding sites.

6. The synthetic expression cassette of any one of claims 1 to 3, wherein at least one binding site or at least two binding sites is from three to nine binding sites, for example from three to six binding sites.

7. The synthetic expression cassette of any one of claims 1 to 6, wherein at least two binding sites are directly linked to each other.

8. The synthetic expression cassette of any one of claims 4 to 6, wherein at least two binding sites are separated from each other by 1 to 10 nucleotides.

9. The synthetic expression cassette of claim 8, wherein at least two binding sites are separated from each other by 1 to 5 nucleotides.

10. The synthetic expression cassette of claim 9, wherein at least two binding sites are separated from each other by 2 nucleotides.11 . The synthetic expression cassette of any one of claims 1 to 10, wherein the transcriptional enhancer has a length of 100 nucleotides or less.

12. The synthetic expression cassette of any one of claims 1 to 10, wherein the transcriptional enhancer has a length of 80 nucleotides or less.

13. The synthetic expression cassette of any one of claims 1 to 3, wherein the transcriptional enhancer comprises a sequence having at least 90% identity with the following sequence:TGACACCACACCCCACTTCCTCCCGCGGGCGTGTGACACTTTTCAAAGAAAATACAGTATT TGGTAGTATCAATACAGCAAGCGGAAGCA (SEQ ID NO:6).

14. The synthetic expression cassette of claim 13, wherein the transcriptional enhancer comprises the following sequence:TGACACCACACCCCACTTCCTCCCGCGGGCGTGTGACACTTTTCAAAGAAAATACAGTATT TGGTAGTATCAATACAGCAAGCGGAAGCA (SEQ ID NO:6).

15. The synthetic expression cassette of any one of claims 1 to 3, wherein the transcriptional enhancer comprises a sequence of one of the following formulas:• (A-B1-A)n, wherein A is an ELF1 binding site, B1is a nucleotides sequence of 1 to 15 nucleotides or is absent; n is an integer from 1 to 5;• (A1-B1-A2-B2-A3)m, wherein A1, A2and A3are each independently an ELF1 binding site, B1and B2are each independently a nucleotides sequence of 1 to 15 nucleotides or are absent; m is an integer from 1 to 3;• (A1-B1-A2-B2-A3-B3-A4-B4-A5)p, wherein A1, A2, A3, A4and A5are each independently an ELF1 binding, B1, B2, B3and B4are each independently a nucleotides sequence of 1 to 15 nucleotides or are absent; p is 1 or 2; or• (A1-B1-A2-B2-A3-B3-A4-B4-A5-B5-A6-B6-A7), wherein A1, A2, A3, A4, A5, A6and A7are each independently an ELF1 binding site, B1, B2, B3B4, B5and B6are each independently a nucleotides sequence of 1 to 15 nucleotides or are absent.

16. The synthetic expression cassette of any one of claims 1 to 15, wherein the minimal promoter is SCP1 , miniCMV, CMV53, minP, HSV TK (miniTK), minSV40, MLP, pJB42CAT5, or YB_TATA.

17. The synthetic expression cassette of claim 16, wherein the minimal promoter is MLP.

18. The synthetic expression cassette of any one of claims 1 to 17, wherein the transcriptional enhancer is upstream of the minimal promoter in the synthetic expression cassette.

19. The synthetic expression cassette of any one of claims 1 to 18, further comprising a polyadenylation (poly(A)) signal.

20. The synthetic expression cassette of any one of claims 1 to 19, further comprising a transcriptional termination signal.

21. The synthetic expression cassette of any one of claims 1 to 20, further comprising the nucleic acid of interest operatively coupled to the minimal promoter and transcriptional enhancer.

22. The synthetic expression cassette of any one of claims 1 to 21 , further comprising a selectable marker.

23. The synthetic expression cassette of any one of claims 1 to 22, wherein the synthetic expression cassette is for expressing a nucleic acid of interest in a natural killer (NK) cell and / or T cell.

24. The synthetic expression cassette of claim 23, wherein the nucleic acid of interest encoded a chimeric antigen receptor (CAR).

25. A vector comprising the synthetic expression cassette of any one of claims 1 to 24.

26. The vector of claim 25, wherein the vector is a viral vector.

27. A host cell comprising the synthetic expression cassette of any one of claims 1 to 24 or the vector of claim 25 or 26.

28. The host cell of claim 27, wherein said cell is a hematopoietic stem cell, a T cell, or a natural killer (NK) cell.

29. A composition comprising the synthetic expression cassette of claim 23 or 24, the vector of claim 25 or 26, or the host cell of claim 27 or 28.

30. A method for inducing the expression of a nucleic acid of interest by a cell, the method comprising introducing the synthetic expression cassette of claim 23 or 24, or the vector of claim 25 or 26 in the cell.31 . The method of claim 30, wherein said method is in vivo.

32. The method of claim 30, wherein said method is in vitro.

33. The method of any one of claims 30 to 32, wherein the synthetic expression cassette or vector is introduced into the genome of the cell.

34. The method of claim 33, wherein the synthetic expression cassette or vector is introduced into the genome of the cell by CRISPR / Cas technology.

35. The method of any one of claims 30 to 34, wherein the nucleic acid of interest encodes a protein that is absent or defective in said cell.

36. The method of any one of claims 30 to 34, wherein the nucleic acid of interest encodes a chimeric antigen receptor (CAR).

37. The method of any one of claims 30 to 36, wherein said cell is a hematopoietic stem cell, a T cell, or a natural killer (NK) cell.

38. A method for treating a disease, condition or disorder in a subject, the method comprising administering an effective amount of the synthetic expression cassette of claim 23 or 24, the vector of claim 25 or 26, the cell of claim 27 or 28, or the composition of claim 29, to said subject.

39. The method of claim 38, wherein the disease, condition or disorder is associated with the absence of expression of a protein or the expression of a defective protein, and wherein the nucleic acid of interest encodes a functional form of the protein.

40. The method of claim 38, wherein the disease, condition or disorder is associated with expression of an antigen, and wherein the nucleic acid of interest encodes a recombinant receptor that specifically binds to the antigen.41 . The method of claim 40, wherein the recombinant receptor is a chimeric antigen receptor (CAR).

42. The method of claim 40 or 41 , wherein the disease, condition or disorder is a cancer, an autoimmune or inflammatory disease, or an infectious disease.

43. The method of claim 42, wherein the disease, condition or disorder is a cancer.

44. The method of claim 43, wherein the cancer is a hematological cancer.

45. The method of any one of claims 38 to 44, wherein the method comprises introducing the synthetic expression cassette or vector into the genome of a cell from the subject.

46. The method of claim 45, wherein the synthetic expression cassette or vector is introduced into the genome of the cell by CRISPR / Cas technology.

47. The method of any one of claims 38 to 44, wherein said method comprises administering at least 1 x 102, 1 x 103or 1 x 104cells to said subject.

48. The method of claim 47, wherein said method comprises administering 1 x 106to 1 x 108cells to said subject.

49. The method of any one of claims 38 to 48, wherein said cells are autologous cells.

50. The method of any one of claims 38 to 48, wherein said cells are allogeneic cells.51 . The synthetic expression cassette of claim 23 or 24, the vector of claim 25 or 26, the cell of claim 27 or 28, or the composition of claim 29, for use in treating a disease, condition or disorder in a subject.

52. The synthetic expression cassette, vector, cell or composition for use according to claim 51 , wherein the disease, condition or disorder is associated with the absence of expression of a protein or the expression of a defective protein, and wherein the nucleic acid of interest encodes a functional form of the protein.

53. The synthetic expression cassette, vector, cell or composition for use according to claim 51 , wherein the disease, condition or disorder is associated with expression of an antigen, and wherein the nucleic acid of interest encodes a recombinant receptor that specifically binds to the antigen.

54. The synthetic expression cassette, vector, cell or composition for use according to claim 53, wherein the recombinant receptor is a chimeric antigen receptor (CAR).

55. The synthetic expression cassette, vector, cell or composition for use according to claim 53 or 54, wherein the disease, condition or disorder is a cancer, an autoimmune or inflammatory disease, or an infectious disease.

56. The synthetic expression cassette, vector, cell or composition for use according to claim55, wherein the disease, condition or disorder is a cancer.

57. The synthetic expression cassette, vector, cell or composition for use according to claim56, wherein the cancer is a hematological cancer.

58. The synthetic expression cassette, vector, cell or composition for use according to any one of claims 51 to 57, wherein the synthetic expression cassette or vector is for introduction into the genome of a cell from the subject.

59. The synthetic expression cassette, vector, cell or composition for use according to claim 58, wherein the synthetic expression cassette or vector is introduced into the genome of the cell by CRISPR / Cas technology.

60. The synthetic expression cassette, vector, cell or composition for use according to any one of claims 51 to 57, wherein said method comprises administering at least 1 x 102, 1 x 103or 1 x 104cells to said subject.

61. The synthetic expression cassette, vector, cell or composition for use according to claim 60, wherein said method comprises administering 1 x 106to 1 x 108cells to said subject.

62. The synthetic expression cassette, vector, cell or composition for use according to any one of claims 51 to 61 , wherein said cells are autologous cells.

63. The synthetic expression cassette, vector, cell or composition for use according to any one of claims 51 to 61 , wherein said cells are allogeneic cells.

64. The synthetic expression cassette of claim 23 or 24, the vector of claim 25 or 26, the cell of claim 27 or 28, or the composition of claim 29, for inducing the expression of a nucleic acid of interest by a cell.

65. The synthetic expression cassette, vector, cell or composition for use according to claim claim 64, wherein said inducing is in vivo.

66. The synthetic expression cassette, vector, cell or composition for use according to claim claim 64, wherein said inducing is in vitro.

67. The synthetic expression cassette, vector, cell or composition for use according to any one of claims 64 to 66, wherein the synthetic expression cassette or vector is for introduction into the genome of the cell.

68. The synthetic expression cassette, vector, cell or composition for use according to claim 67, wherein the synthetic expression cassette or vector is introduced into the genome of the cell by CRISPR / Cas technology.

69. The synthetic expression cassette, vector, cell or composition for use according to any one of claims 64 to 68, wherein the nucleic acid of interest encodes a protein that is absent or defective in said cell.

70. The synthetic expression cassette, vector, cell or composition for use according to any one of claims 64 to 68, wherein the nucleic acid of interest encodes a chimeric antigen receptor (CAR).

71. The synthetic expression cassette, vector, cell or composition for use according to any one of claims 64 to 70, wherein said cell is a hematopoietic stem cell, a T cell, or a natural killer (NK) cell.