Compound having WRN inhibitory effect and use thereof

By designing compounds with specific structures, the lack of WRN inhibitors in existing technologies has been addressed, enabling effective treatment of WRN-mediated diseases, particularly high microsatellite instability tumors.

WO2026124393A1PCT designated stage Publication Date: 2026-06-18HANGZHOU ZHONGMEI HUADONG PHARMACEUTICAL CO LTD

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
HANGZHOU ZHONGMEI HUADONG PHARMACEUTICAL CO LTD
Filing Date
2025-12-08
Publication Date
2026-06-18

AI Technical Summary

Technical Problem

The lack of effective WRN inhibitors in current technologies makes it difficult to develop drugs targeting WRN to treat microsatellite unstable tumors.

Method used

A series of compounds or their pharmaceutically acceptable salts or isomers with WRN inhibitory activity are provided, which achieve effective inhibition of WRN through specific chemical structure design.

🎯Benefits of technology

These compounds exhibit significant WRN inhibitory activity, enabling them to treat and prevent WRN-mediated diseases such as microsatellite instability tumors, including colorectal cancer, gastric cancer, endometrial cancer, and ovarian cancer, demonstrating good therapeutic effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025140634_18062026_PF_FP_ABST
    Figure CN2025140634_18062026_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed in the present application are a compound having a WRN inhibitory effect or a pharmaceutically acceptable salt thereof, and use thereof in the preparation of a medicament for diseases associated with abnormal WRN expression. Specifically disclosed is a compound represented by formula (I-A) or (I-B) or a pharmaceutically acceptable salt thereof.
Need to check novelty before this filing date? Find Prior Art

Description

Compounds with WRN inhibitory activity and their uses Background Technology

[0001] WRN, also known as WRN RecQ Like Helicase, is a type of DNA helicase composed of 1432 amino acid residues with a molecular weight of 160 kDa. WRN consists of an exonuclease, a helicase, and an HRDC (HRDC D-terminal domain) domain. WRN, belonging to the RecQ DNA helicase family, is essential for the survival of microsatellite instability (MSI) tumor cells. WRN plays a crucial role in DNA replication, DNA transcription, DNA repair, maintaining telomere stability, and post-transcriptional modifications.

[0002] Recent studies have shown that WRN is a synthetic lethal target for MSI-H tumors, and the development of drugs targeting WRN needs to be further promoted. Summary of the Invention

[0003] This invention provides compounds of formula (IA) or (IB) or pharmaceutically acceptable salts or isomers thereof:

[0004] in:

[0005] wavy lines Indicates forward and reverse, that is It can be

[0006] X1 and X2 are independently selected from N, CR6, or C, respectively;

[0007] X3 and X4 are independently selected from N, CR6, or C, respectively; wherein X3 and X4 are not both N at the same time;

[0008] W is selected from N, CR6, or C;

[0009] Ring A is selected from 3-7 membered carbon rings, 4-10 membered heterocycles, 5-10 membered aromatic heterocycles or 6-10 membered aromatic rings, wherein the heteroatom in the heterocycle is selected from one or more of N, O and S;

[0010] R0 is selected from hydrogen, halogen, cyano, oxo, amino, hydroxyl, C 1~3 Alkyl, C 1~3 Alkoxy, C 2~4 alkenyl, 3-6 membered cycloalkyl, 3-6 membered heterocyclic, C 1~3 Alkoxy-3 to 6-membered cycloalkyl, -CR c R d -C 1~3 Alkyl and -(CR)e R f ) m -3 to 6-membered cycloalkyl; when n is greater than or equal to 2, any two adjacent R0s can form a 3 to 7-membered carbon ring, a 4 to 7-membered heterocyclic ring, a 6-membered aromatic ring or a 5 to 6-membered heteroaromatic ring with ring A; wherein R0 can optionally be substituted by halogens 1 to 6 times;

[0011] R c and R d Together with the C atoms they are attached to form

[0012] R e and R f Selected independently from H, halogens and C respectively 1~6 alkyl;

[0013] R1 is H or L1-R w , wherein R w Selected from 3- to 8-membered cycloalkyl groups, 4- to 10-membered heterocyclic groups, C 1~6 Alkyl, phenyl, 5-10 heteroaryl, N(R) a 2. NR a R b SR a OR b And L1 is selected from single bonds, -(CR a R b ) p -、-NR a -、-O-、-C(=O-、-(CR) a R b ) p -O-、-C(=O)-、-C(=O)NR a -、-O-NR a -, -S-, -S(=O)-, -S(=O)2-, and wherein R1 may optionally be R x Replace 1 to 3 times;

[0014] R2 is selected from hydrogen, C 1~6 Alkyl, C 1~6 Alkoxy, C 2~6 Alkenyl, 3-8 membered cycloalkyl, 4-10 membered heterocyclic, 5-10 membered heteroaryl, wherein R2 may optionally be replaced by R y Replace 1 to 3 times;

[0015] L2 is selected from single bond, -(CR a R b ) p -、-NR a -、-O-、-C(=O-、-(CR) a Rb ) p -O-、-C(=O)-、-C(=O)NR a -、-O-NR a -,-S-,-S(=O)-,-S(=O)2-,wherein R in L2 a With R b Ke Cheng

[0016] Any two adjacent R0s may optionally form a ring A, provided that the valence allows, wherein ring A is selected from 3- to 10-membered carbon rings, 4- to 10-membered heterocycles, 5- to 10-membered aromatic heterocycles, or benzene rings, wherein the heteroatom in the heterocycle is optionally selected from one or more of N, O, and S, and wherein ring A may optionally be divided by R x Replace 1 to 3 times;

[0017] R3 is selected from H and C. 1~3 alkyl;

[0018] R4 is L0-R v The R v Selected from H, C 1~6 Alkyl, 3-8 membered cycloalkyl, 6-8 membered bridged cycloalkyl, 6-10 membered spirocycloalkyl, 6-10 membered fused cycloalkyl, 4-6 membered heterocyclic, 6-8 membered bridged heterocyclic, 6-10 membered bicyclic heterocyclic, 5-6 membered heteroaryl, phenyl, wherein the heteroatom in the heterocycle is selected from one or more of N, O, and S, and the C 1~6 The carbon atom in the alkyl group may optionally be replaced by a heteroatom, wherein the heteroatom is optionally selected from one or more of N, S, and O; wherein the R4 is optionally replaced by R x Replaced 1 to 3 times; the L0 is selected from single bonds, -(CR a R b ) p -、-NR a -、-O-、-S-、-(CR a R b ) p -O-、-(CR a R b ) p -S-、-(CR a R b ) p -C(=O)-, -C(=O)-, -C(=O)NR a -、-(CR a R b ) p -C(=O)NR a -、-CR a R b -NRa -;

[0019] Any two R4s may optionally form a ring D, wherein the ring D is selected from 3- to 6-membered carbon rings or 4- to 6-membered heterocycles, wherein the heteroatom in the heterocycle is optionally selected from one or more of N, O, and S, and wherein the ring D is optionally substituted with a halogen 1 to 3 times.

[0020] Optionally, R3 and R4 can form a ring E, provided that the valence allows, wherein the ring E is selected from 4- to 6-membered nitrogen-containing heterocycles;

[0021] R5 is selected from H and C. 1~3 Alkyl groups, halogens;

[0022] R6 is selected from hydrogen, halogen, cyano, oxo, amino, hydroxyl, C 1~3 Alkyl, C 1~3 Alkoxy, cyclopropyl;

[0023] R7 is selected from H and C. 1~3 Alkyl groups, halogens;

[0024] Optionally, R3 and R7 can form a ring F under the condition that the valence allows, wherein the ring F is selected from 4- to 6-membered nitrogen-containing heterocycles;

[0025] R8 is selected from C 1~3 Alkyl, C 1~3 Haloalkyl, 3-6 membered cycloalkyl, 3-6 membered heterocyclic, phenyl, 5-6 membered heteroaryl, wherein the heteroatom in the heterocycle is selected from one or more of N, O, and S;

[0026] n is selected from 1, 2, 3, or 4;

[0027] p is independently selected from 1, 2, or 3;

[0028] q is selected independently from 1, 2, or 3;

[0029] R a Independently selected from H, halogen, C 1~6 Alkyl, C 1~6 Halogenated alkyl groups;

[0030] R b Independently selected from H, halogen, C 1~6 Alkyl, 3-6 membered cycloalkyl, 4-6 membered heterocyclic;

[0031] R x Selected from halogens, OH, =O, NH2, CN, C 1~3 Alkyl, C 1~3 alkenyl, C 1~3 Alkoxy, cyclopropyl, wherein the C 1~3 Alkyl, C 1~3 alkenyl, C1~3 The alkoxy and cyclopropyl groups may optionally be substituted with halogens 1 to 3 times;

[0032] R y Selected from halogens, H, =O, NH2, CN, C 1~6 Alkyl, C 1~6 Alkoxy, 3-6 membered cycloalkyl, 3-6 membered heterocyclic group, wherein C 1~6 Alkyl groups, 3- to 6-membered cycloalkyl groups, and 3- to 6-membered heterocyclic groups may optionally be substituted with halogens 1 to 3 times.

[0033] In some implementations, R8 is selected from C 1~3 Alkyl, C 1~3 The heterocyclic alkyl group, 3- to 6-membered cycloalkyl group, or 3- to 6-membered heterocyclic alkyl group, wherein the heteroatom in the heterocycle is selected from one or more of N, O, and S. In a preferred embodiment, R8 is selected from CH3, -CHF2, -CH2F, -CF3, ... More preferably CH3, -CH2F,

[0034] In some embodiments, the present invention provides the compounds described above or pharmaceutically acceptable salts or isomers thereof, wherein the compound of (IA) is represented by formula (Ia) and the compound of (IB) is represented by formula (Ib):

[0035] in:

[0036] wavy lines Indicates forward and reverse, that is It can be

[0037] X1 and X2 are independently selected from N, CR6, or C, respectively;

[0038] X3 and X4 are independently selected from N, CR6, or C, respectively; wherein X3 and X4 are not both N at the same time;

[0039] W is selected from N, CR6, or C;

[0040] Ring A is selected from 3-7 membered carbon rings, 4-10 membered heterocycles, 5-10 membered aromatic heterocycles or 6-10 membered aromatic rings, wherein the heteroatom in the heterocycle is selected from one or more of N, O and S;

[0041] R0 is selected from hydrogen, halogen, cyano, oxo, amino, hydroxyl, C 1~3 Alkyl, C 1~3 Alkoxy, 3-6 membered cycloalkyl, 3-6 membered heterocyclic, C 1~3Alkoxy-3 to 6-membered cycloalkyl; when n is greater than or equal to 2, any two adjacent R0s can form a 3 to 7-membered carbon ring, a 4 to 7-membered heterocyclic ring, a 6-membered aromatic ring, or a 5 to 6-membered heteroaromatic ring with ring A; wherein R0 can optionally be substituted with halogens 1 to 6 times;

[0042] R1 is H or L1-R w , wherein R w Selected from 3- to 8-membered cycloalkyl groups, 4- to 10-membered heterocyclic groups, C 1~6 Alkyl, phenyl, 5-10 heteroaryl, N(R) a 2. NR a R b SR a OR b And L1 is selected from single bonds, -(CR a R b ) p -、-NR a -、-O-、-C(=O-、-(CR) a R b ) p -O-、-C(=O)-、-C(=O)NR a -、-O-NR a -, -S-, -S(=O)-, -S(=O)2-, and wherein R1 may optionally be R x Replace 1 to 3 times;

[0043] R2 is selected from hydrogen, C 1~6 Alkoxy, C 2~6 Alkenyl, 3-8 membered cycloalkyl, 4-10 membered heterocyclic, 5-10 membered heteroaryl, wherein R2 may optionally be replaced by R y Replace 1 to 3 times;

[0044] L2 is selected from single bond, -(CR a R b ) p -、-NR a -、-O-、-C(=O-、-(CR) a R b ) p -O-、-C(=O)-、-C(=O)NR a -、-O-NR a -,-S-,-S(=O)-,-S(=O)2-,wherein R in L2 a With R b Ke Cheng

[0045] Any two adjacent R0s may optionally form a ring A, provided that the valence allows, wherein ring A is selected from 3- to 10-membered carbon rings, 4- to 10-membered heterocycles, 5- to 10-membered aromatic heterocycles, or benzene rings, wherein the heteroatom in the heterocycle is optionally selected from one or more of N, O, and S, and wherein ring A may optionally be divided by R x Replace 1 to 3 times;

[0046] R3 is selected from H and C. 1~3 alkyl;

[0047] R4 is L0-R v The R v Selected from H, C 1~6 Alkyl, 3-8 membered cycloalkyl, 6-8 membered bridged cycloalkyl, 6-10 membered spirocycloalkyl, 6-10 membered fused cycloalkyl, 4-6 membered heterocyclic, 6-8 membered bridged heterocyclic, 6-10 membered bicyclic heterocyclic, 5-6 membered heteroaryl, phenyl, wherein the heteroatom in the heterocycle is selected from one or more of N, O, and S, and the C 1~6 The carbon atom in the alkyl group may optionally be replaced by a heteroatom, wherein the heteroatom is optionally selected from one or more of N, S, and O; wherein the R4 is optionally replaced by R x Replaced 1 to 3 times; the L0 is selected from single bonds, -(CR a R b ) p -、-NR a -、-O-、-S-、-(CR a R b ) p -O-、-(CR a R b ) p -S-、-(CR a R b ) p -C(=O)-, -C(=O)-, -C(=O)NR a -、-(CR a R b ) p -C(=O)NR a -、-CR a R b -NR a -;

[0048] Any two R4s may optionally form a ring D, wherein the ring D is selected from 3- to 6-membered carbon rings or 4- to 6-membered heterocycles, wherein the heteroatoms in the heterocycle are optionally selected from one or more of N, O, and S, and wherein the ring D is optionally substituted with a halogen 1 to 3 times.

[0049] Optionally, R3 and R4 can form a ring E, provided that the valence allows, wherein the ring E is selected from 4- to 6-membered nitrogen-containing heterocycles;

[0050] R5 is selected from H and C. 1~3 Alkyl groups, halogens;

[0051] R6 is selected from hydrogen, halogen, cyano, oxo, amino, hydroxyl, C 1~3 Alkyl, C 1~3 Alkoxy, cyclopropyl;

[0052] R7 is selected from H and C. 1~3 Alkyl groups, halogens;

[0053] Optionally, R3 and R7 can form a ring F under the condition that the valence allows, wherein the ring F is selected from 4- to 6-membered nitrogen-containing heterocycles;

[0054] n is selected from 1, 2, 3, or 4;

[0055] p is independently selected from 1, 2, or 3;

[0056] q is selected independently from 1, 2, or 3;

[0057] R a Independently selected from H and C 1~6 Alkyl, C 1~6 Halogenated alkyl groups;

[0058] R b Independently selected from H and C 1~6 Alkyl, 3-6 membered cycloalkyl, 4-6 membered heterocyclic;

[0059] R x Selected from halogens, OH, =O, NH2, CN, C 1~3 Alkyl, C 1~3 alkenyl, C 1~3 Alkoxy, cyclopropyl, wherein the C 1~3 Alkyl, C 1~3 alkenyl, C 1~3 The alkoxy and cyclopropyl groups may optionally be substituted with halogens 1 to 3 times;

[0060] R y Selected from halogens, H, =O, NH2, CN, C 1~6 Alkyl, C 1~6 alkoxy, 3-6 membered cycloalkyl, 3-6 membered heterocyclic group, wherein C 1~6 Alkyl groups, 3- to 6-membered cycloalkyl groups, and 3- to 6-membered heterocyclic groups may optionally be substituted with halogens 1 to 3 times.

[0061] In some embodiments, the present invention provides compounds of formula (Ia) or (Ib) described above, or pharmaceutically acceptable salts or isomers thereof, wherein:

[0062] R4 is L0-R v The R v Selected from H, C 1~6 Alkyl, 3-6 membered cycloalkyl, 4-6 membered heterocyclic, 5-6 membered heteroaryl, phenyl, wherein the heteroatom in the heterocycle is selected from one or more of N, O, and S, and the C 1~6 The carbon atom in the alkyl group may optionally be replaced by a heteroatom, wherein the heteroatom is optionally selected from one or more of N, S, and O; wherein the R4 is optionally replaced by R x Replaced 1 to 3 times; the L0 is selected from single bonds, -(CR a R b ) p -、-NR a -、-O-、-S-、-(CR a R b ) p -O-、-(CR a R b ) p -S-、-(CR a R b ) p -C(=O)-, -C(=O)-, -C(=O)NR a -、-(CR a R b ) p -C(=O)NR a -、-CR a R b -NR a -;and

[0063] R x Selected from halogens, OH, =O, NH2, CN, C 1~3 Alkyl, C 1~3 Alkoxy, cyclopropyl, wherein the C 1~3 Alkyl, C 1~3 The alkoxy and cyclopropyl groups may optionally be substituted with halogens 1 to 3 times.

[0064] In the embodiments described above according to the compound of (IB) or (Ib) or its pharmaceutically acceptable salts or isomers, preferably, R5 is not a halogen, in other words, R5 is selected from H, C 1~3 alkyl.

[0065] Further preferably, in the embodiments described above according to the compound of (IB) or its pharmaceutically acceptable salts or isomers, when X1 in the compound of (IB) is CH, W and X2 are both N, q is 1, and R1 is... R3, R5, and R7 are all H, R4 is an unsubstituted 3- to 8-membered cycloalkyl group, and R8 is an unsubstituted C. 1~3 When alkyl, the -L2-R2 moiety in the compound of (IB) is not -CF2CH3, and further not any haloalkyl; and

[0066] When R5 in the compound described in (IB) is C 1~3 Alkyl and L2 is -(CR) a R b ) p - When, then R in L2 a and R b They are not both halogens.

[0067] In some implementations, ring A is selected from... In some implementation schemes, ring A is also selected from... In a preferred embodiment, ring A is selected from...

[0068] In some embodiments, X1 is selected from N or CH. In a preferred embodiment, X1 is CH.

[0069] In some implementations, W is selected from N, CH, CF, CCl, C(CN), C(CH3), C(=O), and C(NH2).

[0070] In some embodiments, X2 is selected from N and CR6, wherein R6 is selected from halogen, cyano, amino, hydroxyl, C 1~3 Alkyl, C 1~3 Alkoxy groups, preferably halogen, cyano, amino, hydroxyl, or C... 1~3 Alkyl, C 1~3 Alkyl groups, more preferably F, Cl, cyano, amino, hydroxyl, or methoxy groups.

[0071] In some implementations, X3 is selected from N and C.

[0072] In some implementations, X4 is C.

[0073] In some implementations, the structural unit Selected from

[0074] In a preferred embodiment, the structural unit Selected from

[0075] In some embodiments, when n is greater than or equal to 2, any two adjacent R0s can form a 3-7 membered carbon ring, a 4-7 membered heterocyclic ring, a 6 membered aromatic ring, or a 5-6 membered heteroaromatic ring with ring A; wherein when two adjacent R0s replace the same carbon atom or heteroatom on ring A, the 3-7 membered carbon ring, 4-7 membered heterocyclic ring, 6 membered aromatic ring, or 5-6 membered heteroaromatic ring with ring A forms a 7-11 membered spirocyclic ring; wherein when two adjacent R0s replace adjacent carbon atoms or heteroatoms on ring A, the 3-7 membered carbon ring, 4-7 membered heterocyclic ring, 6 membered aromatic ring, or 5-6 membered heteroaromatic ring with ring A forms a 7-11 membered fused ring; wherein R0 can optionally be substituted with halogens 1 to 6 times.

[0076] In some embodiments, when n is greater than or equal to 2, when two adjacent R0 atoms substitute for the same atom, the two adjacent R0 atoms can form a 3-7 membered carbon ring, a 4-7 membered heterocyclic ring, a 6 membered aromatic ring, or a 5-6 membered heteroaromatic ring with ring A, wherein the 3-7 membered carbon ring is selected from... The 4- to 7-membered heterocycles are selected from The 6-membered aromatic ring is selected from The 5- to 6-membered aromatic heterocycles are selected from

[0077] In some implementations, when n is greater than or equal to 2, any two adjacent R0s can form a ring with ring A to form a structural unit.

[0078] In some embodiments, L1 is selected from single bonds, -CH2-, -O-, -C(=O)-, -NH-, -CH2NH-, -CH2CH2-, -CH(CH3)-, -C(CH3)2-, -CHF-, -CF2-, -CH2O-, and -O-NH-. In a preferred embodiment, L1 is -O-.

[0079] In some embodiments, L0 is selected from single bonds, -CH2-, -CH2CH2-, -CH2O-, -CH2CH2O-, -C(CH3)O-, -CH2S-, -CH2C(O)-, -CH2C(O)NH-, and -CH2C(O)N(CH3)-. In a preferred embodiment, L0 is selected from single bonds and -CH2O-.

[0080] In some implementation schemes, R w The compound is selected from phenyl, pyridyl, pyrazinyl, pyrimidinyl, cyclopentadienyl, pyrroleyl, imidazolyl, pyrazolyl, thiophene, cyclopentyl, cyclohexyl, azacyclopentyl, and azacyclohexyl. In some embodiments, R wThe compound is selected from phenyl, pyridyl, pyrazinyl, pyrimidinyl, cyclopentadienyl, pyrroleyl, imidazolyl, pyrazolyl, cyclopentyl, cyclohexyl, azacyclopentyl, and azacyclohexyl. In a preferred embodiment, R w Selected from phenyl, thienyl, cyclopentyl, and cyclohexyl.

[0081] In some implementations, R0 is selected from hydrogen, halogen, cyano, oxo, amino, hydroxyl, C 1~3 Alkyl, C 1~3 Haloalkyl, C 1~3 Alkoxy, C 2~4 alkenyl, C 2~4 Haloalkenyl, 3-6 membered cycloalkyl, 3-6 membered halocycloalkyl, 3-6 membered heterocycloalkyl, -CR c R d -C 1~3 Alkyl, -CR c R d -C 1~3 Halogenated alkyl groups and -(CR) e R f ) m -3 to 6-membered cycloalkyl groups. In some embodiments, R0 is selected from hydrogen, halogen, amino, C... 1~3 Alkyl, C 1~3 Haloalkyl, C 2~4 alkenyl, C 2~4 Haloalkenyl, 3-6 membered cycloalkyl, 3-6 membered halocycloalkyl, -CR c R d -C 1~3 Alkyl, -CR c R d -C 1~3 Halogenated alkyl groups and -(CR) e R f ) m -3 to 6-membered cycloalkyl groups. In a preferred embodiment, R0 is selected from hydrogen, F, Cl, amino, methyl, ethyl, propyl, isopropyl, -CH2F, -CHF2, -CHF3, -CH2CF3, -CH(CH3)CF3, -CH=CH2, -CH2CH=CH2, -C(CH3)=CH2, -CH2CH2CH=CH2, -CH2CH2=CHCH3, -CH2CH=CF2, -C(CH3=CF2), -C(CF3=CH2, -CH2CH2=CHCF3,

[0082] In some implementations, R0 is selected from hydrogen, halogen, cyano, oxo, amino, hydroxyl, C 1~3 Alkyl, C 1~3Alkoxy, cyclopropyl, methyl-cyclopropyl, cyclobutyl, oxecyclobutyl, cyclopentyl. In a preferred embodiment, R0 is selected from hydrogen, halogen, amino, C. 1~3 Alkyl, cyclopropyl, methyl-cyclopropyl, cyclobutyl, cyclopentyl.

[0083] In some implementations, n is 1 or 2.

[0084] In some implementation schemes, R v Selected from C 1~3 Alkyl groups and 3- to 6-membered cycloalkyl groups, preferably CH3,

[0085] In some implementations, R4 is selected from... CH3, CH2CH3, CH(CH3)2, CH2OCH3, CH2SCH3, CH(CH3)OCH3、 CH2CHF2, CH2CH2F, CH2CN, CH2OCHF2, CH2OCH2F,

[0086] In some implementations, R4 is selected from CH3, CH2CH3, CH(CH3)2, CH2OCH3, CH2SCH3, CH(CH3)OCH3、

[0087] In some implementations, R4 is also selected from

[0088] In some implementations, R4 is also selected from

[0089] In a preferred embodiment, R4 is selected from...

[0090] In some embodiments, any two R4s may optionally form a ring D, wherein the ring D is selected from 3- to 6-membered carbon rings or 4- to 6-membered heterocycles. In some embodiments, any two R4s may optionally form a ring D, wherein the ring D is selected from 3- to 6-membered carbon rings or 4- to 6-membered heterocycles.

[0091] In some implementations, L2 is selected from single bonds, -CH2-, -O-, -C(=O)-, -NH-, -N(CH3)-, -CH2NH-, -NHCH(CH3)-, -CH2CH2-, -CH(CH3)-, -C(CH3)2-, -CH(CF3)-, -CHF-, -CF2-, -CH2O-, -CH2CH2NH-, In a preferred embodiment, L2 is selected from single bond, -NH-, -N(CH3)-, -CHF-, -CF2-, and more preferably single bond, -N(CH3)-, -CF2-.

[0092] In some implementations, R2 is selected from C 1~6 Alkyl, 3- to 6-membered cycloalkyl, 4- to 6-membered heterocycloalkyl, wherein R2 may optionally be replaced by R y Replaced 1 to 3 times. In some embodiments, R2 is selected from CH3, CH2CH3, CH(CH3)2, C(CH3)3, cyclopropyl, The R2 can be optionally replaced by R y Replace 1 to 3 times.

[0093] In some implementation schemes, R y =O,C 1~3 Alkyl or C 1~3 Halogenated alkyl group, preferably =O, CH3 or CF3.

[0094] In some implementations, R1 is selected from In the preferred embodiment, R1 is selected from... More In some implementations, R1 is also selected from

[0095] In a preferred embodiment, R5 is H. In some embodiments, R3 is H. In some embodiments, R7 is H.

[0096] In some embodiments, R3 and R4 may optionally form a ring E, provided that the valence allows, wherein the ring E is selected from 4- to 6-membered nitrogen-containing heterocycles; preferably, the ring E is selected from

[0097] In some embodiments, R3 and R7 may optionally form a ring F, provided the valence allows, wherein the ring F is selected from 4- to 6-membered nitrogen-containing heterocycles; preferably, the ring F is selected from...

[0098] In some implementation schemes, R xSelected from -CH3, -CH2CH3, =O, halogen, -OH, -NH2, -CN, cyclopropyl, -CHF2, -CH2F, -CF3, =CH2, =CHF, =CF2, -OCH3, -OCHF2. In some embodiments, R x Selected from -CH3, -CH2CH3, =O, -OH, -NH2, -CN, cyclopropyl, -CHF2, -CH2F, -CF3, =CH2, =CHF, =CF2, -OCH3, -OCHF2.

[0099] In some implementation schemes, R x Selected from F, Cl, =O, =CH2, =CHF, =CF2.

[0100] In some embodiments, the present invention provides compounds of formula (I'-a) or (I'-b) or pharmaceutically acceptable salts or isomers thereof:

[0101] The rest of the definitions are the same as before.

[0102] In some embodiments, the present invention provides compounds of formula (II-a) or (II-b) or pharmaceutically acceptable salts or isomers thereof:

[0103] The rest of the definitions are the same as before.

[0104] In some embodiments, the present invention provides compounds of formula (III-a) or (III-b) or pharmaceutically acceptable salts or isomers thereof:

[0105] The rest of the definitions are the same as before.

[0106] In some embodiments, the present invention provides compounds of formula (IV-a) or (IV-b) or pharmaceutically acceptable salts or isomers thereof:

[0107] The rest of the definitions are the same as before.

[0108] In some of the implementation schemes described above, the structural unit for

[0109] In some embodiments, the present invention provides a compound of formula (I'-a) or (I'-b) or a pharmaceutically acceptable salt or isomer thereof:

[0110] The rest of the definitions are the same as before.

[0111] In some embodiments, the compound of formula (I'-a) is represented by the following formula:

[0112] In some embodiments, the compound of formula (II-a) is represented by the following formula:

[0113] In some embodiments, the compound of formula (III-a) is represented by the following formula:

[0114] In some embodiments, the compound of formula (IV-a) is represented by the following formula:

[0115] Some solutions in this invention are derived from arbitrary combinations of the above-mentioned variables.

[0116] This invention also provides compounds with the following structures or pharmaceutically acceptable salts or isomers thereof:

[0117] This invention also provides compounds with the following structures or pharmaceutically acceptable salts or isomers thereof:

[0118] This invention also provides compounds with the following structures or pharmaceutically acceptable salts or isomers thereof:

[0119] This invention also provides compounds with the following structures or pharmaceutically acceptable salts or isomers thereof:

[0120] This invention also provides compounds with the following structures or pharmaceutically acceptable salts or isomers thereof:

[0121] The present invention also provides the use of the above-described compounds or pharmaceutically acceptable salts thereof in the preparation of WRN inhibitor-related drugs.

[0122] The compounds provided by this invention are WRN inhibitors, wherein the compounds and their pharmaceutically acceptable salts possess excellent WRN receptor inhibitory activity. These WRN inhibitor compounds are capable of treating and / or preventing WRN-mediated diseases or conditions and related diseases or conditions.

[0123] The compounds and their pharmaceutically acceptable salts provided by this invention can be used alone or in combination with at least one other therapeutic agent in treatment.

[0124] The present invention also provides pharmaceutical compositions comprising the compounds described above or pharmaceutically acceptable salts thereof, and one or more other therapeutically active ingredients.

[0125] The present invention also provides pharmaceutical compositions comprising the compounds as described above or pharmaceutically acceptable salts thereof, and pharmaceutically acceptable carriers, excipients or diluents.

[0126] The pharmaceutically acceptable salts described in this article include acid addition salts and base salts.

[0127] The pharmaceutically acceptable salts described in this article can exist in both non-solvated and solvated forms.

[0128] The present invention also provides the use of compounds of Formula I as described above and pharmaceutically acceptable salts thereof in the preparation of medicaments for the treatment and / or prevention of WRN-mediated diseases or conditions and related diseases or conditions.

[0129] The present invention also provides a treatment for a disease or condition comprising administering to a patient in need a therapeutically effective amount of a compound of formula I as described above and a pharmaceutically acceptable salt thereof, wherein the disease or condition is a WRN-mediated disease or condition and related diseases or conditions.

[0130] In some embodiments of the present invention, the disease or symptom is selected from tumors and / or cancer.

[0131] In some embodiments, the tumor and / or cancer is characterized by high microsatellite instability (MSI-H) and mismatch repair deficiency (dMMR).

[0132] In some implementations, the tumors and / or cancers include, but are not limited to: colorectal cancer, gastric cancer, endometrial cancer, adrenocortical carcinoma, uterine cancer, uterine squamous cell carcinoma, cervical cancer, esophageal cancer, breast cancer, kidney cancer, clear cell renal cell carcinoma, liver cancer, biliary tract cancer, gallbladder cancer, urinary tract cancer, prostate cancer, ovarian cancer, colonic adenocarcinoma, rectal adenocarcinoma, uterine sarcoma, mesothelioma, brain cancer, and skin cancer.

[0133] In some implementations, the WRN-mediated tumors and / or cancers are preferably: colorectal cancer, gastric cancer, endometrial cancer, ovarian cancer, or cervical cancer.

[0134] The present invention also provides the use of the compound of Formula I above or a pharmaceutically acceptable salt thereof in the preparation of WRN inhibitor-related drugs.

[0135] Definitions and Explanations

[0136] Unless otherwise stated, the following terms and phrases as used herein are intended to have the following meanings. A particular term or phrase should not be considered uncertain or unclear unless specifically defined, but should be understood in its ordinary sense. When a trade name appears herein, it is intended to refer to the corresponding product or its active ingredient.

[0137] The term “pharmaceutically acceptable” as used herein refers to compounds, materials, compositions, and / or dosage forms that, within the bounds of reliable medical judgment, are suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, in proportion to a reasonable benefit / risk ratio.

[0138] The term "pharmaceutically acceptable salt" refers to a salt of the compounds of this invention, prepared by reacting a compound with a relatively non-toxic acid or base, as discovered in this invention, with a specific substituent. When the compounds of this invention contain relatively acidic functional groups, base addition salts can be obtained by contacting such compounds with a sufficient amount of base in a pure solution or a suitable inert solvent. Pharmaceutically acceptable base addition salts include sodium, potassium, calcium, ammonium, organic amine, or magnesium salts, or similar salts. When the compounds of this invention contain relatively basic functional groups, acid addition salts can be obtained by contacting such compounds with a sufficient amount of acid in a pure solution or a suitable inert solvent. Examples of pharmaceutically acceptable acid addition salts include inorganic acid salts, such as hydrochloric acid, hydrobromic acid, nitric acid, carbonic acid, bicarbonate, phosphoric acid, monohydrogen phosphate, dihydrogen phosphate, sulfuric acid, hydrogen sulfate, hydroiodic acid, phosphorous acid, etc.; and organic acid salts, such as acetic acid, propionic acid, isobutyric acid, maleic acid, malonic acid, benzoic acid, succinic acid, octanoic acid, fumaric acid, lactic acid, mandelic acid, phthalic acid, benzenesulfonic acid, p-toluenesulfonic acid, citric acid, tartaric acid, and methanesulfonic acid; as well as salts of amino acids (such as arginine) and salts of organic acids such as glucuronic acid. Certain specific compounds of the present invention contain both basic and acidic functional groups, and thus can be converted into either a base or an acid addition salt.

[0139] The pharmaceutically acceptable salts of the present invention can be synthesized from parent compounds containing acid radicals or bases by conventional chemical methods. Generally, such salts are prepared by reacting these compounds in free acid or base form with a stoichiometric amount of a suitable base or acid in water or an organic solvent or a mixture thereof.

[0140] Unless otherwise stated, the term "isomer" is intended to include geometric isomers, cis-trans isomers, stereoisomers, enantiomers, optical isomers, diastereomers, and tautomers. An example of one type of tautomer is... Unless otherwise stated, structural units They should be considered to have the same structure.

[0141] The compounds of this invention can exist in specific geometric or stereoisomeric forms. This invention contemplates all such compounds, including cis and trans isomers, (-)- and (+)- enantiomers, (R)- and (S)- enantiomers, diastereomers, (D)- isomers, (L)- isomers, and racemic mixtures thereof, as well as other mixtures, such as mixtures enriched with enantiomers or diastereomers, all of which are within the scope of this invention. Additional asymmetric carbon atoms may be present in substituents such as alkyl groups. All such isomers and mixtures thereof are included within the scope of this invention.

[0142] Unless otherwise stated, the terms "enantiomer" or "optical isomer" refer to stereoisomers that are mirror images of each other.

[0143] Unless otherwise stated, the terms "cis-trans isomers" or "geometric isomers" arise because the single bonds of double bonds or cyclic carbon atoms cannot rotate freely.

[0144] Unless otherwise stated, the term "diastereomer" refers to a stereoisomer of a molecule having two or more chiral centers and being in a non-mirror relationship with each other.

[0145] Unless otherwise stated, "(+)" indicates right-handed rotation, "(-)" indicates left-handed rotation, and "(±)" indicates racemic rotation.

[0146] Unless otherwise specified, use wedge-shaped solid line keys. and wedge-shaped dashed key The absolute configuration of the center of a solid is represented by a straight solid line key. and straight dashed key The relative configuration of the center of a solid is indicated by a wavy line. Indicates wedge-shaped solid line key or wedge-shaped dashed key Or use wavy lines Indicates a straight solid line key Or straight dashed key

[0147] Unless otherwise stated, the terms "rich in one isomer," "isomer enrichment," "rich in one enantiomer," or "enantiomer enrichment" mean that the content of one isomer or enantiomer is less than 100%, and the content of the isomer or enantiomer is greater than or equal to 60%, or greater than or equal to 70%, or greater than or equal to 80%, or greater than or equal to 90%, or greater than or equal to 95%, or greater than or equal to 96%, or greater than or equal to 97%, or greater than or equal to 98%, or greater than or equal to 99%, or greater than or equal to 99.5%, or greater than or equal to 99.6%, or greater than or equal to 99.7%, or greater than or equal to 99.8%, or greater than or equal to 99.9%.

[0148] Unless otherwise stated, the terms "isomer excess" or "enantiomer excess" refer to the difference between the relative percentages of two isomers or two enantiomers. For example, if one isomer or enantiomer is 90% and the other isomer or enantiomer is 10%, then the isomer or enantiomer excess (ee value) is 80%.

[0149] Optically active (R)- and (S)- isomers, as well as D- and L- isomers, can be prepared by chiral synthesis, chiral reagents, or other conventional techniques. To obtain an enantiomer of a compound of the present invention, it can be prepared by asymmetric synthesis or derivatization with a chiral auxiliary, wherein the resulting diastereomeric mixture is separated, and the auxiliary group is cleaved to provide the desired enantiomer in pure form. Alternatively, when the molecule contains a basic functional group (such as an amino group) or an acidic functional group (such as a carboxyl group), a salt of the diastereomeric isomer is formed with a suitable optically active acid or base, followed by diastereomeric resolution using conventional methods known in the art, and then the pure enantiomer is recovered. Furthermore, the separation of enantiomers and diastereomeric isomers is typically accomplished by using chromatography employing a chiral stationary phase, optionally combined with chemical derivatization (e.g., from amines to carbamates).

[0150] The compounds of this invention may contain atomic isotopes in non-natural proportions on one or more atoms constituting the compound. For example, the compounds may be labeled with radioactive isotopes, such as tritium. 3 H), Iodine-125 125 I) or C-14 14 C). For example, deuterium can be used to replace hydrogen to form deuterated drugs. The bond between deuterium and carbon is stronger than that between ordinary hydrogen and carbon. Compared with undeuterated drugs, deuterated drugs have advantages such as reduced toxicity, increased drug stability, enhanced efficacy, and prolonged drug biological half-life. All isotopic variations of the compounds of this invention, regardless of radioactivity, are included within the scope of this invention.

[0151] The terms “optional” or “optionally” refer to events or conditions that may occur but are not required to occur as described below, and the description includes both cases where said events or conditions occur and cases where said events or conditions do not occur.

[0152] The term "substituted" means that any one or more hydrogen atoms on a particular atom are replaced by a substituent, which can include deuterium and hydrogen variants, provided that the valence state of the particular atom is normal and the substituted compound is stable. When the substituent is oxygen (i.e., =O), it means that two hydrogen atoms are replaced. Oxygen substitution does not occur on aromatic groups. The term "optionally substituted" means that it may or may not be substituted, unless otherwise specified, and the type and number of substituents can be arbitrary on a chemically feasible basis.

[0153] When any variable (e.g., R) appears more than once in the composition or structure of a compound, its definition is independent in each case. Thus, for example, if a group is substituted by 0-2 Rs, the group can optionally be substituted by at most two Rs, and the Rs in each case have independent options. Furthermore, combinations of substituents and / or their variants are only permitted if such combinations produce a stable compound.

[0154] When the number of a linking group is 0, such as -(CRR)0-, it indicates that the linking group is a single bond.

[0155] When the number of a substituent is 0, it means that the substituent does not exist. For example, -A-(R)0 means that the structure is actually -A.

[0156] When a substituent is vacant, it means that the substituent does not exist. For example, if X is vacant in AX, it means that the structure is actually A.

[0157] When one of the variables is selected as a single bond, it means that the two groups it connects to are directly connected. For example, when L in ALZ represents a single bond, it means that the structure is actually AZ.

[0158] When a substituent can be cross-linked to two or more atoms on a ring, the direction of connection of such substituent is arbitrary unless the direction of connection of the listed linking groups is specified.

[0159] Unless otherwise specified, when a group has one or more connectable sites, any one or more sites of that group can be connected to other groups by chemical bonds. When the chemical bond connection is non-directional and the connectable site contains H atoms, the number of H atoms at that site will decrease accordingly with the number of chemical bonds connected, resulting in a group with a corresponding valence. The chemical bonds connecting the site to other groups can be straight solid line bonds. Straight dashed key or wavy line express.

[0160] Unless otherwise specified, the number of atoms in a ring is usually defined as the elemental number of the ring. For example, a “5-7 elemental ring” refers to a “ring” with 5-7 atoms arranged around it.

[0161] In this invention, the terms "halogenated," "halogen," and "halogen atom" refer to fluorine atoms, chlorine atoms, bromine atoms, iodine atoms, etc. Preferably, the halogen atoms used as substituents for the aryl groups in this invention are fluorine atoms and chlorine atoms.

[0162] The term "C" in this invention 1~6 "Alkyl" refers to a straight-chain or branched alkyl group having 1 to 6 carbon atoms, including but not limited to methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, 1-methylpropyl, n-pentyl, isopentyl, 2-methylbutyl, 1,1-dimethylpropyl, 1-ethylpropyl, n-hexyl, 4-methylpentyl, and 2-ethylbutyl. The term "C"... 1~3 "Alkyl" refers to a straight-chain or branched alkyl group having 1 to 3 carbon atoms, including but not limited to methyl, ethyl, n-propyl and isopropyl.

[0163] The term "C" in this invention 1~6 "Alkoxy" refers to the carbon group. 1-6 Alkyl-O-, including but not limited to methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy, tert-butoxy, 1-methylpropoxy, n-pentyloxy, isopentyloxy, 2-methylbutoxy, 1,1-dimethylpropoxy, 1-ethylpropoxy, n-hexyloxy, 4-methylpentyloxy, and 2-ethylbutoxy. The term "C" 1~3 "Alkoxy" refers to the carbon group. 1-3 Alkyl-O-, including but not limited to methoxy, ethoxy, n-propoxy and isopropoxy.

[0164] In this invention, the term "aryl" refers to a 6- to 14-membered all-carbon monocyclic or fused polycyclic (i.e., a ring sharing adjacent carbon atom pairs) group having a conjugated π-electron system, preferably a 6- to 10-membered ring, such as phenyl and naphthyl, more preferably phenyl. The aryl ring may be fused to a heteroaryl, heterocyclic, or cycloalkyl ring, including benzo3- to 8-membered cycloalkyl and benzo3- to 8-membered heterocyclic groups, wherein the heterocyclic group is a heterocyclic group containing 1-3 heterocyclic atoms independently selected from N, O, and S; or may further comprise a three-membered nitrogen-containing fused ring containing a benzene ring.

[0165] The term "heteroaryl" or "heteroaryl ring" in this invention refers to a heteroaryl system having 5 to 14 ring atoms, wherein the heteroaryl group has 1 to 4 heterocyclic atoms independently selected from N, O, and S. The heteroaryl group is preferably 5 to 10-membered, more preferably 5- or 6-membered, such as imidazolyl, furanyl, thiophene, thiazolyl, pyrazolyl, oxazolyl, pyrroleyl, triazolyl, tetrazolyl, pyridyl, pyrimidinyl, thiadiazole, pyrazinyl, etc.

[0166] Unless otherwise specified, the terms "5-6 membered heteroaryl" and "5-6 membered heteroaryl" in this invention are used interchangeably. The term "5-6 membered heteroaryl" refers to a monocyclic group with a conjugated π-electron system consisting of 5 to 6 ring atoms, wherein 1, 2, 3, or 4 of the ring atoms are heteroatoms independently selected from O, S, and N, and the remainder are carbon atoms, wherein the nitrogen atom is optionally quaternized, and the nitrogen and sulfur heteroatoms may optionally be oxidized (i.e., NO and S(O)). p (where p is 1 or 2). 5-6-membered heteroaryl groups can be attached to the rest of the molecule via heteroatoms or carbon atoms. The 5-6-membered heteroaryl groups include both 5-membered and 6-membered heteroaryl groups.

[0167] The term "3- to 6-membered heterocyclic group" in this invention refers to a non-aromatic cyclic group having 3 to 6 ring atoms, comprising one or more heterocyclic atoms independently selected from N, O, and S, and may be fully saturated (i.e., 3- to 6-membered heterocyclic alkyl) or partially unsaturated. The heterocycle may be a 3- to 6-membered monocyclic, bicyclic, or spirocyclic ring. The heterocyclic ring may be fused to an aryl, heteroaryl, or cycloalkyl ring, wherein the ring attached to the parent structure is a heterocyclic group.

[0168] The term "C" in this invention 3~6 "Cycloalkyl" or "3- to 6-membered cycloalkyl" refers to a monovalent group obtained by removing any single hydrogen atom from a cyclic hydrocarbon having 3 to 6 carbons. It can be fully saturated (i.e., a 3 to 6-carbon cycloalkyl) or partially unsaturated.

[0169] The term "halogenated alkyl" in this invention refers to an alkyl group that has been substituted with one or more halogens.

[0170] In this invention, the term "alkenyl" refers to a straight-chain or branched monovalent aliphatic hydrocarbon group containing one or more double bonds.

[0171] The compounds of the present invention can be prepared by a variety of synthetic methods known to those skilled in the art, including the specific embodiments listed below, embodiments formed by combining them with other chemical synthetic methods, and equivalent substitutions known to those skilled in the art. Preferred embodiments include, but are not limited to, the embodiments of the present invention.

[0172] The compounds described in this invention are named according to their chemical structural formulas. If the name of a compound representing the same compound does not match its chemical structural formula, the chemical structural formula shall prevail.

[0173] The structures of the compounds of this invention can be confirmed by conventional methods well known to those skilled in the art. If this invention relates to the absolute configuration of a compound, that absolute configuration can be confirmed by conventional techniques in the art. For example, single-crystal X-ray diffraction (SXRD) is used, where the cultured single crystal is used to collect diffraction intensity data using a Bruker D8 venture diffractometer with CuKα radiation as the light source. The scanning method is as follows: After scanning and collecting relevant data, the crystal structure can be further analyzed using the direct method (Shelxs97) to confirm the absolute configuration.

[0174] The solvent used in this invention is commercially available.

[0175] Compounds are named according to conventional naming principles in the field or using Software naming conventions are used; commercially available compounds use supplier catalog names. Beneficial effects

[0176] As novel WRN inhibitors, the compounds of this invention exhibit excellent inhibitory activity against WRN and can be used for the prevention and / or treatment of WRN-mediated diseases or conditions. The compounds of this invention possess superior properties such as improved pharmacokinetic properties (e.g., improved bioavailability, improved metabolic stability, suitable half-life and duration of action), improved safety (lower toxicity (e.g., reduced cardiotoxicity) and / or fewer side effects), and less likelihood of developing drug resistance. Detailed Implementation

[0177] The present invention will be described in detail below with reference to embodiments, but this does not imply any adverse limitation on the invention. The present invention has been described in detail, and specific embodiments thereof have been disclosed. It will be apparent to those skilled in the art that various changes and modifications can be made to the specific embodiments of the present invention without departing from the spirit and scope thereof.

[0178] intermediate preparation example

[0179] intermediate int-1:

[0180] Synthesis route:

[0181] Step 1: Synthesis of compound int-1b

[0182] The starting material int-1a (10 g, 48 mmol) was dissolved in tetrahydrofuran (52 mL) under nitrogen purging three times. The reaction flask was then transferred to an ice-water bath. Under nitrogen protection, a red aluminum toluene solution (3.5 mol / L, 48 mL, 168 mmol) was slowly added dropwise. After the addition was complete, the mixture was stirred in the ice-water bath for 3 hours. After the reaction was complete, methanol (12.8 mL) was slowly added dropwise to quench the reaction. Then, a prepared sodium potassium tartrate aqueous solution (50 wt%, 200 g) was added, followed by water (200 mL) to dilute the reaction solution. The mixture was stirred at room temperature for 0.5 hours. Finally, the organic phase was separated by standing, and the aqueous phase was extracted three times with ethyl acetate (50 mL x 3). The organic phases were combined and washed successively with sodium bicarbonate aqueous solution (5 wt%, 50 mL x 2) and water (50 mL x 2). The organic phase was dried with anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain crude compound int-1b (9.6 g), which was directly added to the next step.

[0183] LCMS(ESI) m / z: 202.3 [M+H] + .

[0184] 1 H NMR(400MHz, DMSO-d6)δ6.47(d,J=8.0Hz,1H),4.53(t,J=5.6Hz,1H),3.42–3.34(m,2H),3.03–2.9 2(m,1H),1.37(s,9H),0.83–0.81(m,1H),0.40–0.33(m,1H),0.29–0.21(m,2H),0.15–0.09(m,1H).

[0185] Step 2: Synthesis of compound int-1c

[0186] To a 500 mL single-necked flask containing crude compound int-1b (9.6 g, 47.7 mmol), dichloromethane (154 mL) and Desmond reagent (40.5 g, 95.4 mmol) were added. The mixture was stirred at 25 °C for 1 hour. After the reaction was complete, the solvent was concentrated under reduced pressure, and the mixture was slurried with ethyl acetate (154 mL). After filtration to remove most of the Desmond reagent, the filtrate was concentrated again under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate: petroleum ether = 0-10%) to give compound int-ic (3.2 g, 33%).

[0187] 1H NMR (400MHz, DMSO-d6) δ9.49(s,1H),7.34(d,J=6.8Hz,1H),3.29(d,J=8.0Hz,1H),1.3 9(s,9H),1.00–0.93(m,1H),0.56–0.50(m,1H),0.45–0.38(m,2H),0.30–0.26(m,1H).

[0188] Step 3: Synthesis of compound int-1e

[0189] Sodium hydroxide (150 mg, 3.76 mmol) was dissolved in tetrahydrofuran (2.5 mL) under ultra-dry solvent and stirred in an ice-water bath under nitrogen protection. A tetrahydrofuran (5 mL) solution of compound int-1d (580 mg, 2.51 mmol) was slowly added dropwise, and stirring was continued at 0°C for 20 minutes after the addition was complete. Then, a tetrahydrofuran (5 mL) solution of crude compound int-1c (500 mg, 2.51 mmol) was slowly added dropwise, and stirring was continued at 0°C for 5 minutes. After the reaction was complete, the reaction solution was quenched with saturated ammonium chloride (1 mL), diluted with water (10 mL), and extracted three times with ethyl acetate (10 mL * 3). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain crude compound int-1e (600 mg).

[0190] LCMS(ESI) m / z: 220.2 [M+H] + .

[0191] Step 4: Synthesis of compound int-1

[0192] The crude compound int-1e (600 mg, 2.51 mmol) was dissolved in the ultra-dry solvent dichloromethane (6 mL), and trifluoroacetic acid (1.5 mL) was added with stirring in an ice-water bath. The stirring was continued for 1 hour. After the reaction was completed, the solution was concentrated under reduced pressure, dissolved in methanol (3 mL), and purified by high performance liquid chromatography to obtain compound int-1 (200 mg).

[0193] 1 H NMR (400MHz, DMSO-d6) δ8.25(s,3H),7.03(dd,J=15.2,1.2Hz,1H),6.76(dd,J=15.2,6.0Hz,1H),3.34(d,J =6.4Hz,1H),3.08(s,3H),1.10–1.01(m,1H),0.64(d,J=8.0Hz,2H),0.55–0.50(m,1H),0.45–0.40(m,1H).

[0194] intermediate int-2:

[0195] Synthesis route:

[0196] Step 1: Synthesis of compound 2c

[0197] NaH (140 mg, 3.5 mmol) was added to THF, purged three times with nitrogen, and then cooled to 0 °C. Compound 2b (806 mg, 3.5 mmol) was added, and the mixture was stirred at 0 °C for 20 min. Finally, compound 2a (500 mg, 2.92 mmol) was added. The reaction mixture was stirred at room temperature for 16 h. After the reaction was complete, the reaction was quenched with saturated ammonium chloride aqueous solution, and the mixture was extracted with ethyl acetate (10 mL x 3). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to give compound 2c (500 mg, crude product). 1 H NMR (400MHz, CDCl3) δ6.29 (s, 1H), 4.91 (d, J = 2.8Hz, 2H), 4.65 (s, 2H), 2.97 (s, 3H), 1.46 (s, 9H).

[0198] Step 2: Synthesis of compound int-2

[0199] Compound 2c (500 mg, 2.02 mmol) was dissolved in DCM, and TFA was added. The mixture was stirred at room temperature for 1 h. After the reaction was complete, the reaction solution was concentrated under reduced pressure to give compound int-2 (1.5 g, crude product). LCMS (ESI) m / z: 148.2 [M+H] + .

[0200] intermediate int-5:

[0201] Synthesis route:

[0202] Step 1: Synthesis of compound 5c

[0203] Compound 5a (2 g, 24.38 mmol) and compound 5b (5.27 g, 24.38 mmol) were added sequentially to a 100 mL single-necked flask. After purging with nitrogen three times, the reaction solution was placed in an oil bath at 125 °C and reacted for 2 hours. After 2 hours, the reaction solution was cooled to room temperature, diphenyl ether was added, and the reaction solution was heated to 260 °C and reacted at 260 °C for 2 hours. The reaction solution was purified by silica gel column chromatography, eluting with petroleum ether / ethyl acetate (0%–10%) to give compound 5c (3 g). LCMS (ESI) m / z: 207.2 [M+H] + .

[0204] Step 2: Synthesis of compound 5d

[0205] Compound 5c (3 g, 14.56 mmol) was dissolved in acetonitrile, and TEBAC (13.2 g, 58.25 mmol) and POCl3 (8.9 g, 58.25 mmol) were added sequentially. The mixture was stirred at 80 °C for 16 hours. The reaction solution was cooled to room temperature, concentrated under reduced pressure, and saturated sodium bicarbonate was slowly added. The mixture was extracted with dichloromethane and water, and the organic phase was washed twice with saturated brine. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, and eluted with petroleum ether / ethyl acetate (0-25%) to give compound 5d (2.5 g). LCMS (ESI) m / z: 225.2 [M+H] + .

[0206] Step 3: Synthesis of compound int-5

[0207] Compound 5d (1 g, 4.46 mmol) was dissolved in N,N-dimethylformamide, and phenol (504 mg, 5.36 mmol) and cesium carbonate (3.6 g, 11.15 mmol) were added. The mixture was stirred at 60 °C for 2 hours. The reaction solution was cooled to room temperature, diluted with ethyl acetate, and the organic phase was washed three times with water, followed by two washes with saturated brine. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with petroleum ether / ethyl acetate (0-25%) to give compound int-5 (800 mg). LCMS (ESI) m / z: 283.2 [M+H] + .

[0208] intermediate int-3:

[0209] Synthesis route:

[0210] Step 1: Pour 100 mL (47 wt%) of hydroiodic acid aqueous solution into a single-necked flask containing raw material 3a (20 g, 87.77 mmol) and stir at room temperature. After the reaction is complete, neutralize the reaction solution with saturated sodium bicarbonate, and then extract three times with ethyl acetate. Combine all organic phases, dry to anhydrous sodium sulfate, filter, and concentrate the filtrate under reduced pressure to obtain crude compound 3b (24 g), which is directly added to the next step. LCMS (ESI) m / z: 412.7 [M+H] + .

[0211] Step 2: Potassium carbonate (16 g, 115.77 mmol), phenol (5.5 g, 58.36 mmol), and ultra-dry solvent DMF (240 mL) were added sequentially to a 500 mL single-necked flask containing crude compound 3b (24 g, 58.36 mmol). The mixture was then stirred at room temperature for 12 hours. After the reaction was complete, the solution was diluted with water and extracted three times with ethyl acetate. All organic phases were combined and washed twice with saturated brine. The solution was then dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-5% ethyl acetate / petroleum ether) to give compound 3d (21 g). LCMS (ESI) m / z: 377.0 [M+H] + .

[0212] Step 3: Add 160 mL of ultra-dry solvent tetrahydrofuran to a 500 mL three-necked flask containing crude product 3d (16 g, 42 mmol), purge with nitrogen three times, and cool to -50 °C under nitrogen protection with stirring. Add isopropyl magnesium chloride-lithium chloride complex (1.3 mol / L, 37 mL, 46 mmol) dropwise using a syringe. After the addition is complete, continue stirring for 0.5 hours. Dissolve compound 3e (4.6 g, 65 mmol) in ultra-dry solvent tetrahydrofuran and slowly add this solution dropwise to the above-mentioned low-temperature reaction flask. After the addition is complete, transfer the reaction flask to an ice-water bath and continue stirring for 1 hour. After the reaction is complete, quench with water and dilute the reaction solution, then extract three times with ethyl acetate. Combine all organic phases, dry with anhydrous sodium sulfate, filter, and concentrate the filtrate under reduced pressure. Purify the residue by silica gel column chromatography (0-25% ethyl acetate / petroleum ether) to give compound 3f (6.5 g). LCMS(ESI) m / z: 323.0 [M+H] + .

[0213] Step 4: Dissolve 3f (6.5 g, 20 mmol) in an ultra-dry mixed solvent of dichloromethane (30 mL) and tetrahydrofuran (30 mL), then add activated manganese dioxide (26 g, 300 mmol) and stir at room temperature for 1 hour. After the reaction is complete, filter and concentrate the filtrate under reduced pressure to obtain compound 3 g (6.3 g). LCMS (ESI) m / z: 319.1 [M+H] + . 1 H NMR (400MHz, CDCl3) δ8.91 (s, 1H), 7.48–7.43 (m, 2H), 7.30 (t, J = 7.6Hz, 1H), 7.26–7.23(m,2H),2.96–2.90(m,1H),1.23–1.18(m,2H),1.03–0.97(m,2H).

[0214] Step 5: Add 3 g (1.0 g, 3.13 mmol), catalyst Pd(dppf)Cl2 (230 mg, 0.31 mmol), ultra-dry solvent methanol (35 mL), and triethylamine (634 mg, 6.27 mmol) sequentially to the high-pressure reactor. After sealing, replace with carbon monoxide three times and purge with carbon monoxide (140 psi). Heat in an oil bath to 80 °C and stir for 16 hours. After the reaction is complete, concentrate the reaction solution under reduced pressure. Purify the residue by silica gel column chromatography (0-20% ethyl acetate / petroleum ether) to give compound 3h (800 mg). LCMS (ESI) m / z: 299.2 [M+H] + . 1 H NMR(400MHz, DMSO_d6)δ9.27(s,1H),7.54–7.44(m,2H),7.36–7.26(m,3H),3.94(s,3H),2.97–2.90(m,1H),1.08-1.05(m,2H),1.02–0.98(m,2H).

[0215] Step 6: Add 6 mL of DAST to a 100 mL single-necked flask containing 3 h (800 mg, 2.68 mmol), purge with nitrogen three times, and then place in an oil bath and stir at 25 °C for 16 hours. After the reaction is complete, quench the reaction mixture by slowly adding it dropwise to a saturated sodium bicarbonate aqueous solution, and then extract three times with ethyl acetate. Combine all organic phases, dry with anhydrous sodium sulfate, filter, and concentrate the filtrate under reduced pressure. Purify the residue by silica gel column chromatography (0-15% ethyl acetate / petroleum ether) to give compound 3i (500 mg). LCMS (ESI) m / z: 321.1 [M+H] + . 1 H NMR(400MHz, DMSO-d6)δ9.22(s,1H),7.48(t,J=7.6Hz,2H),7.32(t,J=7.2Hz, 1H),7.26(d,J=8.0Hz,2H),3.92(s,3H),1.61–1.55(m,1H),0.62–0.52(m,4H).

[0216] Step 7: To a 100 mL single-necked flask containing 3i (500 mg, 1.56 mmol), add tetrahydrofuran (5 mL), water (0.5 mL), and lithium hydroxide monohydrate (98 mg, 2.34 mmol) sequentially. Stir at room temperature for one hour. After the reaction is complete, add water to the reaction solution and adjust the pH to 6-7 with dilute hydrochloric acid (1 mol / L). Lyophilize to obtain the crude compound int-3 (600 mg). LCMS (ESI) m / z: 316.0 [M+H] + . 1H NMR (400MHz, DMSO-d6) δ9.09(s,1H),7.47(t,J=8.0Hz,2H),7.30(t,J=7.6Hz,1H),7.24(d,J=7.6Hz,2H),1.53–1.59(m,1H),0.55–0.53(m,4H).

[0217] intermediate int-4:

[0218] Synthesis route:

[0219] Step 1: Compound 4a (5 g, 22.81 mmol) was dissolved in ultra-dry tetrahydrofuran (100 mL), and CDI (4.07 g, 25.09 mmol) was added. After purging with nitrogen three times, the reaction mixture was stirred at room temperature for 30 min. The reaction mixture was cooled to -70 °C, and DIBAL-H (1.5 M, 32 mL, 48 mmol) was slowly added dropwise. The reaction mixture was stirred at -70 °C for 1 h. After the reaction was complete, a saturated aqueous solution of potassium sodium tartrate was added, and the mixture was stirred for 1 h. The mixture was then extracted three times with dichloromethane. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0–30% ethyl acetate / petroleum ether) to give compound 4b (1.03 g). 1 H NMR (400MHz, DMSO-d6) δ9.47 (s, 1H), 7.26 (d, J = 7.2Hz, 1H), 4.11-4.06 (m, 1H), 3.61-3.57 (m, 2H), 3.24 (s, 3H), 1.40 (s, 9H).

[0220] Step 2: Dissolve sodium hydroxide (300 mg, 7.61 mmol) in tetrahydrofuran (10 mL), purge three times with a nitrogen balloon, cool to 0 °C, and add a tetrahydrofuran solution of compound 4c (1.16 g, 5.07 mmol) in 5 mL dropwise. After the addition is complete, stir at 0 °C for 20 min. Then add a tetrahydrofuran solution of compound 4b (1.03 g, 5.07 mmol) in 5 mL dropwise, and stir at 0 °C for 5 min. After the reaction is complete, quench the reaction with saturated ammonium chloride aqueous solution, extract with ethyl acetate, combine the organic phases, dry with anhydrous sodium sulfate, filter, and concentrate the filtrate under reduced pressure to obtain crude compound 4d (1.1 g). LCMS (ESI) m / z: 224.3 [M-56] + . 1H NMR (400MHz, CD3OD) δ6.86 (dd, J=15.2, 4.8Hz, 1H), 6.67 (d, J=15.2Hz, 1H), 4 .47–4.44(m,1H),3.49-3.46(m,2H),3.36(s,3H),2.98(s,3H),1.47(s,9H).

[0221] Step 3: The crude compound 4d (1.1 g, 4.09 mmol) was dissolved in acetonitrile (10 mL), and p-toluenesulfonic acid monohydrate (0.93 g, 4.91 mmol) was added. The mixture was stirred at 50 °C for 2 hours. After the reaction was complete, the reaction solution was filtered, and the filtrate was concentrated under reduced pressure to obtain compound INT-4 (1.2 g). LCMS (ESI) m / z: 180.3 [M+H] + . 1 H NMR(400MHz,DMSO-d6)δ7.03(d,J=15.6Hz,1H),6.65(dd,J=15.4,8.0Hz,1H), 3.91(s,1H),3.06(s,3H),2.30(s,3H),1.79-1.73(m,1H),1.68-1.61(m,1H).

[0222] intermediate int-6:

[0223] Synthesis route:

[0224] Step 1: Diethyl(methanesulfonyl)phosphine (1.11 g, 4.81 mmol) was dissolved in ultra-dry tetrahydrofuran (6.0 mL). Sodium hydroxide (231 mg, 5.77 mmol) was added at 0 °C, and the reaction was continued with stirring at 0 °C for 20 minutes. Then, compound 6a (1.0 g, 5.77 mmol) (dissolved in 4 mL of ultra-dry tetrahydrofuran) was added dropwise. After the addition was complete, the internal temperature was maintained at 0 °C–10 °C, and the reaction was continued with stirring for 1 hour. Then, the reaction was continued with stirring at room temperature for 1.5 hours. After the reaction was completed, saturated ammonium chloride was added to quench the reaction. The resulting reaction solution was extracted with ethyl acetate, and the resulting organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to remove the solvent, yielding compound 6b (1.55 g, crude product). LCMS (ESI) m / z: 194.0 [M+H-56] +

[0225] Step 2: Compound 6b (775 mg, 2.89 mmol) and p-toluenesulfonic acid monohydrate (659 mg, 3.46 mmol) were dissolved in acetonitrile (9 mL), and the mixture was stirred at 50 °C for 2 hours. After the reaction was complete, the mixture was filtered, and the filter cake was washed with ultra-dry acetonitrile (1.6 mL). The resulting solid was collected, concentrated under reduced pressure to remove residual solvent, and compound INT-6 (498 mg) was obtained. 1 H NMR (400MHz, DMSO_d6) δ8.13(s,3H),6.99(d,J=16.0Hz,1H),6.75(dd,J=15.2,6.0Hz,1H),4.14–4.08(m,1H),3.06(s,3H),1.33(d,J=6.8Hz,3H).

[0226] intermediate int-7:

[0227] Synthesis route:

[0228] Step 1: Compound 7a (10 g, 27.83 mmol) was dissolved in anhydrous dichloromethane (100 mL), and 1,8-diazobispiro[5.4.0]undec-7-ene (8.48 g, 55.66 mmol) was added. The reaction system was purged with nitrogen three times and stirred at room temperature for 10 minutes. Simultaneously, compound 7b (9.81 g, 55.66 mmol) was dissolved in anhydrous dichloromethane (20 mL) and added dropwise to the above reaction solution. The mixture was stirred overnight at room temperature. After the reaction was complete, the reaction solution was diluted with dichloromethane, washed twice with 1 M HCl aqueous solution, and three times with saturated sodium bicarbonate aqueous solution. The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-20% ethyl acetate / petroleum ether) to give compound 7c (7.5 g). LCMS (ESI) m / z: 382.2 [M+H] + . 1 H NMR(400MHz,DMSO_d6)δ8.61(s,1H),7.40-7.27(m,12H),5.04(s,2H),4.42(s,2H),4.15-4.1 2(m,1H),3.62(s,3H),3.27(s,1H),3.04-2.96(m,1H),2.91-2.87(m,1H),2.68-2.64(m,1H).

[0229] Step 2: Compound 7c (7.5 g, 19.66 mmol) was dissolved in anhydrous methanol (80 mL), and di-tert-butyl dicarbonate (5.2 g, 23.6 mmol) and wet palladium on carbon (1.9 g) were added. The reaction system was purged with hydrogen three times and stirred overnight at room temperature. After the reaction was complete, the reaction solution was used directly for the next step. LCMS (ESI) m / z: 250.2 [M+H-100] + .

[0230] Step 3: 1.9 g of wet palladium on carbon was added to the reaction solution obtained in Step 3, followed by 10 drops of glacial acetic acid. The reaction system was purged with hydrogen three times and stirred overnight at room temperature. After the reaction was complete, the palladium on carbon was removed by filtration, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-50% ethyl acetate / petroleum ether) to give compound 7e (2.2 g). LCMS (ESI) m / z: 204.2 [M+H-56] + . 1 H NMR(400MHz,DMSO-d6)δ7.17(d,J=7.6Hz,1H),4.97(s,1H),3.87-3.83(m,1H),3.62 -3.60(m,4H),2.26-2.15(m,2H),2.08-2.00(m,1H),1.95-1.87(m,2H),1.38(s,9H).

[0231] Step 4: Compound 7e (2.2 g, 8.48 mmol) was dissolved in anhydrous dichloromethane (40 mL). Desmartin reagent (4.3 g, 10.18 mmol) was added at 0 °C. The reaction mixture was purged with nitrogen three times and stirred at room temperature for 2 hours. After the reaction was complete, saturated sodium thiosulfate aqueous solution (80 mL) was added, and the mixture was stirred at room temperature for half an hour before extraction. The organic phase was washed twice with saturated sodium bicarbonate aqueous solution and dried over anhydrous sodium sulfate. The mixture was filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-25% ethyl acetate / petroleum ether) to give compound 7f (1.7 g). LCMS (ESI) m / z: 158.2 [M+H-100] + . 1 H NMR (400MHz, DMSO-d6) δ7.50(d,J=8.0Hz,1H),4.20(t,J=8.4Hz,1H),3.63(s,3H),3.08-2.88(m,4H),2.75-2.66(m,1H),1.39(s,9H).

[0232] Step 5: Compound 7f (1.5 g, 5.83 mmol) and difluoromethyl (2-pyridyl) sulfone (1.35 g, 7 mmol) were dissolved in anhydrous N,N-dimethylformamide (15 mL). The reaction system was purged with nitrogen three times. The temperature of the reaction solution was lowered to -60 °C. A solution of potassium tert-butoxide (1.2 g, 10.49 mmol) in N,N-dimethylformamide (15 mL) was slowly added dropwise to the reaction solution. After the addition was complete, the reaction solution was transferred to an ice-water bath and stirred for 1 hour. Then, concentrated hydrochloric acid (3 mL) was added, and stirring was continued in the ice-water bath for another 1 hour. After the reaction was completed, the reaction solution was quenched with water, extracted with ethyl acetate, washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-5% ethyl acetate / petroleum ether) to give compound 7 g (900 mg). LCMS(ESI) m / z: 236.2 [M+H-56] + . 1 H NMR (400MHz, DMSO-d6) δ7.37(d,J=8.0Hz,1H),4.05(t,J=8.0Hz,1H),3.62(s,3H),2.73-2.66(m,4H),2.55-2.54(m,1H),1.39(s,9H).

[0233] Step 6: Dissolve 7 g (900 mg, 3.09 mmol) of the compound in anhydrous tetrahydrofuran (9 mL) using a three-necked flask. Purge the reaction system three times with nitrogen. Add lithium chloride (393 mg, 9.27 mmol) and sodium borohydride (351 mg, 3.09 mmol) to the reaction solution, followed by anhydrous ethanol. After the reaction is complete, dilute the reaction solution with water, adjust the pH to 4–5 with 2 M dilute hydrochloric acid, and extract with ethyl acetate. Wash the organic phase with saturated brine (10 mL * 2), dry with anhydrous sodium sulfate, filter, and concentrate the filtrate under reduced pressure to obtain compound 7h (750 mg). LCMS (ESI) m / z: 208.2 [M+H-56] + . 1 H NMR(400MHz,DMSO-d6)δ6.61(d,J=9.6Hz,1H),4.56(s,1H),3.51-3.46(m,1H),3.32(s, 1H),3.27(m,2H),2.66-2.62(m,1H),2.60-2.53(m,2H),2.46-2.40(m,1H),1.39(s,9H).

[0234] Step 7: Compound 7h (750 mg, 2.85 mmol) was dissolved in anhydrous dichloromethane (15 mL), and Desmartin reagent (1448 mg, 3.42 mmol) was added at 0 °C. The reaction system was purged with nitrogen three times and stirred at room temperature for 1 hour. After the reaction was complete, saturated sodium thiosulfate aqueous solution was added, and the mixture was stirred at room temperature for half an hour before extraction. The organic phase was washed twice with saturated sodium bicarbonate aqueous solution and dried over anhydrous sodium sulfate. The mixture was filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-20% ethyl acetate / petroleum ether) to give compound 7i (330 mg). 1 H NMR (400MHz, DMSO-d6) δ9.42(s,1H),7.47(d,J=7.6Hz,1H),3.99(t,J=7.6Hz,1H),2.75-2.66(m,4H),2.59-2.54(m,1H),1.40(s,9H).

[0235] Step 8: Dissolve sodium hydride (23 mg, 0.57 mmol) in anhydrous tetrahydrofuran (1 mL). Cool the reaction solution to 0 °C. Under nitrogen protection, slowly add a tetrahydrofuran solution of diethyl(methylsulfonyl)phosphine (88 mg, 0.38 mmol) (1 mL). After the addition is complete, stir at 0 °C for 20 minutes. Then, slowly add a tetrahydrofuran solution of compound 7i (100 mg, 0.38 mmol) (1 mL). Continue stirring at 0 °C for 5 minutes. After the reaction is complete, quench the reaction with saturated ammonium chloride (2 mL). Extract three times with ethyl acetate. Combine the organic phases, dry with anhydrous sodium sulfate, filter, and concentrate the filtrate under reduced pressure to obtain crude compound 7j (110 mg). LCMS (ESI) m / z: 355.1 [M+18] + .

[0236] Step 9: Dissolve crude compound 7j (110 mg, 0.33 mmol) in anhydrous dichloromethane (1 mL), add trifluoroacetic acid (0.2 mL) under ice-water bath conditions, and stir at room temperature for 1 hour. After the reaction is complete, concentrate under reduced pressure to obtain crude compound INT-7 (110 mg). LCMS (ESI) m / z: 238.0 [M+H] + .

[0237] intermediate int-8:

[0238] Synthesis route:

[0239] Step 1: Compound 8a (25 g, 135.88 mmol) was dissolved in DMF (250 mL). Sodium methanethiol (14.3 g, 203.82 mmol) was added to the reaction solution under ice bath conditions. After purging with nitrogen three times, the reaction solution was allowed to react at room temperature for 16 hours. After the reaction was complete, saturated brine (300 mL) was added to the reaction solution. The solution was extracted with methyl tert-butyl ether (300 mL × 5) and washed with saturated brine (500 mL × 3). All organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain crude compound 8b (6 g).

[0240] Step 2: Compound 8b (6 g, 57.60 mmol) was dissolved in dioxane / water (360 mL / 120 mL). Oxone (70.8 g, 115.20 mmol) was added to the reaction solution under ice bath conditions. After purging with nitrogen three times, the reaction solution was allowed to react at room temperature for 16 hours. After the reaction was complete, the reaction solution was filtered, and the filtrate was quenched with saturated sodium thiosulfate solution. Extraction was performed with dichloromethane / methanol (10:1), and the organic phase was washed with saturated brine. All organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain crude compound 8c (2.1 g). 1 H NMR (400MHz, CDCl3) δ5.04–4.85(m,4H),4.44–4.37(m,1H),2.93(s,3H).

[0241] Step 3: Compound 8c (2.1 g, 15.42 mmol) was dissolved in ultra-dry tetrahydrofuran (30 mL), purged three times with nitrogen, and the reaction solution was cooled to -70 °C. Butyllithium (7.4 mL, 18.50 mmol) was slowly added to the reaction solution, and the reaction was allowed to proceed at this temperature for 30 minutes. Then, a tetrahydrofuran solution (10 mL) of compound 8d (4.1 g, 15.42 mmol) was slowly added to the reaction solution. After the addition was complete, the reaction solution was heated to 0 °C and the reaction continued for 3.5 hours. After the reaction was complete, a saturated ammonium chloride solution was added to quench the reaction, and the mixture was extracted with ethyl acetate. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain the crude compound. This crude compound was then subjected to silica gel column chromatography (ethyl acetate / petroleum ether = 0-50%) to obtain compound 8e (980 mg, yield: 17.2%), a yellow oil. LCMS(ESI) m / z: 369.1 [M+H] + . 1H NMR (400MHz, DMSO-d6) δ7.42(t,J=7.6Hz,4H),7.26(t,J=7.2Hz,2H),7.19(d,J=8.4Hz,4H),4.99–4.91(m,1H),4.89–4.74(m,6H).

[0242] Step 4: Dissolve sodium hydroxide (32 mg, 0.81 mmol) in ultra-dry tetrahydrofuran (2 mL), purge three times with nitrogen, and cool the reaction solution to 0°C. Then, slowly add a tetrahydrofuran solution (2 mL) of compound 8e (200 mg, 0.54 mmol) to the reaction solution. React at this temperature for 30 minutes. Next, slowly add a tetrahydrofuran solution (2 mL) of compound 8f (108 mg, 0.54 mmol) to the reaction solution, maintaining the reaction temperature at 0°C for 1 hour. After the reaction is complete, quench the reaction with saturated ammonium chloride solution, extract with ethyl acetate, and wash the organic phase with saturated brine. Combine all organic phases, dry with anhydrous sodium sulfate, filter, and concentrate the filtrate under reduced pressure to obtain the crude compound. Purify the crude compound by silica gel column chromatography (ethyl acetate / petroleum ether = 0-40%) to obtain 8 g (60 mg) of compound. LCMS (ESI) m / z: 335.3 [M + H₂O] + . 1 H NMR (400MHz, DMSO-d6) δ7.31–7.12(m,1H),6.86–6.64(m,1H),6.53–6.29(m,1H),4.83–4. 72(m,3H),4.69–4.59(m,2H),1.37(d,J=2.4Hz,9H),0.99–0.88(m,1H),0.53–0.24(m,4H).

[0243] Step 5: Dissolve 8 g (60 mg, 0.19 mmol) of the compound in 2 mL of dichloromethane. Add 0.4 mL of trifluoroacetic acid to the reaction solution and react at room temperature for 2 hours. After the reaction is complete, concentrate the reaction solution under reduced pressure at low temperature to obtain crude compound INT-8 (80 mg). LCMS (ESI) m / z: 218.2 [M+H] + .

[0244] intermediate int-9:

[0245] Synthesis route:

[0246] Step 1: Pour hydroiodic acid aqueous solution (100 mL, 47 wt%) into a single-necked flask containing raw material 9a (20 g, 87.77 mmol) and stir at room temperature for 16 hours. After the reaction is complete, neutralize the reaction solution with saturated sodium bicarbonate, and then extract three times with ethyl acetate (100 mL * 3). Combine all organic phases, dry with anhydrous sodium sulfate, filter, and concentrate the filtrate under reduced pressure to obtain crude compound 9b (24 g), which is directly added to the next step. LCMS (ESI) m / z: 412.7 [M + H] + .

[0247] Step 2: Potassium carbonate (16 g, 115.77 mmol), phenol (5.5 g, 58.36 mmol), and ultra-dry solvent DMF (240 mL) were added sequentially to a 500 mL single-necked flask containing crude compound 9b (24 g, 58.36 mmol). The mixture was then stirred at room temperature for 12 hours. After the reaction was complete, the solution was diluted with water and extracted three times with ethyl acetate. All organic phases were combined and washed twice with saturated brine. The solution was then dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-5% ethyl acetate / petroleum ether) to give compound 9c (21 g). LCMS (ESI) m / z: 377.0 [M+H] + .

[0248] Step 3: Add 160 mL of ultra-dry solvent tetrahydrofuran to a 500 mL three-necked flask containing crude compound 9c (16 g, 42 mmol), purge with nitrogen three times, and cool to -50 °C under nitrogen protection with stirring. Add isopropyl magnesium chloride-lithium chloride complex (1.3 mol / L, 37 mL, 46 mmol) dropwise using a syringe. After the addition is complete, continue stirring for 0.5 hours. Dissolve compound 9d (4.6 g, 65 mmol) in ultra-dry solvent tetrahydrofuran (46 mL) and slowly add this solution dropwise to the aforementioned low-temperature reaction flask. After the addition is complete, transfer the reaction flask to an ice-water bath and continue stirring for 1 hour. After the reaction is complete, quench and dilute the reaction solution with water (160 mL), then extract three times with ethyl acetate. Combine all organic phases, dry with anhydrous sodium sulfate, filter, and concentrate the filtrate under reduced pressure. Purify the residue by silica gel column chromatography (0-25% ethyl acetate / petroleum ether) to obtain compound 9e (6.5 g). LCMS(ESI) m / z: 323.0 [M+H] + .

[0249] Step 4: Dissolve compound 9e (6.5 g, 20 mmol) in an ultra-dry mixed solvent of dichloromethane (30 mL) and tetrahydrofuran (30 mL), then add activated manganese dioxide (26 g, 300 mmol) and stir at room temperature for 1 hour. After the reaction is complete, filter and concentrate the filtrate under reduced pressure to obtain compound 9f (6.3 g). LCMS (ESI) m / z: 319.1 [M+H] + . 1 H NMR (400MHz, CDCl3) δ8.91 (s, 1H), 7.48–7.43 (m, 2H), 7.30 (t, J = 7.6Hz, 1H), 7.26–7.23(m,2H),2.96–2.90(m,1H),1.23–1.18(m,2H),1.03–0.97(m,2H).

[0250] Step 5: Compound 9f (1.0 g, 3.13 mmol), catalyst Pd(dppf)Cl2 (230 mg, 0.31 mmol), ultra-dry solvent methanol (35 mL), and triethylamine (634 mg, 6.27 mmol) were added sequentially to the high-pressure reactor. After sealing, carbon monoxide was used to replace the solution three times and carbon monoxide was introduced (140 psi). The mixture was heated in an oil bath to 80 °C and stirred for 16 hours. After the reaction was completed, the reaction solution was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-20% ethyl acetate / petroleum ether) to give 9 g (800 mg) of compound. LCMS (ESI) m / z: 299.2 [M+H] + . 1 H NMR(400MHz, DMSO_d6)δ9.27(s,1H),7.54–7.44(m,2H),7.36–7.26(m,3H),3.94(s,3H),2.97–2.90(m,1H),1.08-1.05(m,2H),1.02–0.98(m,2H).

[0251] Step 6: Add 6 mL of DAST to a 100 mL single-necked flask containing 9 g (800 mg, 2.68 mmol) of the compound. After purging with nitrogen three times, place the flask in an oil bath and stir at 25 °C for 16 hours. After the reaction is complete, quench the reaction mixture by slowly adding it dropwise to a saturated sodium bicarbonate aqueous solution (200 mL), and then extract three times with ethyl acetate (50 mL * 3). Combine all organic phases, dry with anhydrous sodium sulfate, filter, and concentrate the filtrate under reduced pressure. Purify the residue by silica gel column chromatography (0-15% ethyl acetate / petroleum ether) to give compound 9 h (500 mg). LCMS (ESI) m / z: 321.1 [M+H] + . 1H NMR(400MHz, DMSO-d6)δ9.22(s,1H),7.48(t,J=7.6Hz,2H),7.32(t,J=7.2Hz, 1H),7.26(d,J=8.0Hz,2H),3.92(s,3H),1.61–1.55(m,1H),0.62–0.52(m,4H).

[0252] Step 7: To a 100 mL single-necked flask containing compound 9h (500 mg, 1.56 mmol), add tetrahydrofuran (5 mL), water (0.5 mL), and lithium hydroxide monohydrate (98 mg, 2.34 mmol) sequentially. Stir at room temperature for one hour. After the reaction is complete, add water (15 mL) to the reaction solution and adjust the pH to 6-7 with dilute hydrochloric acid (1 mol / L). Lyophilize to obtain the crude compound INT-9 (600 mg). LCMS (ESI) m / z: 316.0 [M+H] + .1H NMR (400MHz, DMSO-d6) δ9.09(s,1H),7.47(t,J=8.0Hz,2H),7.30(t,J=7.6Hz,1H),7.24(d,J=7.6Hz,2H),1.53–1.59(m,1H),0.55–0.53(m,4H).

[0253] intermediate int-10:

[0254] Synthesis route:

[0255] Step 1: Compound 10a (25 g, 135.88 mmol) was dissolved in DMF (250 mL). Sodium methanethiol (14.3 g, 203.82 mmol) was added to the reaction solution under ice bath conditions. After purging with nitrogen three times, the reaction solution was allowed to react at room temperature for 16 hours. After the reaction was complete, saturated brine (300 mL) was added to the reaction solution. The solution was extracted with methyl tert-butyl ether (300 mL × 5) and washed with saturated brine (500 mL × 3). All organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain crude compound 10b (6 g). 1 H NMR (400MHz, CDCl3) δ5.15 (dd, J=7.6, 6.8Hz, 2H), 4.82 (t, J=6.4Hz, 2H), 4.35–4.14 (m, 1H), 2.36 (s, 3H).

[0256] Step 2: Compound 10b (6 g, 57.60 mmol) was dissolved in dioxane / water (360 mL / 120 mL). Under ice bath conditions, Oxone (70.8 g, 115.20 mmol) was added to the reaction solution. After purging with nitrogen three times, the reaction solution was reacted at room temperature for 16 hours. After the reaction was completed, the reaction solution was filtered, and the filtrate was quenched with saturated sodium thiosulfate solution. The solution was extracted with dichloromethane / methanol (10:1, 200 mL × 5) and washed with saturated brine (300 mL × 3). All organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain crude compound 10c (2.1 g). 1 H NMR (400MHz, CDCl3) δ5.04–4.85(m,4H),4.44–4.37(m,1H),2.93(s,3H).

[0257] Step 3: Compound 10c (2.1 g, 15.42 mmol) was dissolved in ultra-dry tetrahydrofuran (30 mL), purged three times with nitrogen, and the reaction solution was cooled to -70°C. Butyllithium (7.4 mL, 18.50 mmol) was slowly added to the reaction solution, and the reaction was allowed to proceed at this temperature for 30 minutes. Then, a tetrahydrofuran solution (10 mL) of compound 10d (4.1 g, 15.42 mmol) was slowly added to the reaction solution. After the addition was complete, the reaction solution was heated to 0°C and the reaction continued for 3.5 hours. After the reaction was complete, a saturated ammonium chloride solution was added to quench the reaction, and the mixture was extracted with ethyl acetate. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain the crude compound. Compound 10e (980 mg) was obtained by silica gel column chromatography (ethyl acetate / petroleum ether = 0-50%). LCMS (ESI) m / z: 369.1 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ7.42(t,J=7.6Hz,4H),7.26(t,J=7.2Hz,2H),7.19(d,J=8.4Hz,4H),4.99–4.91(m,1H),4.89–4.74(m,6H).

[0258] Step 4: Dissolve sodium hydroxide (32 mg, 0.81 mmol) in ultra-dry tetrahydrofuran (2 mL), purge three times with nitrogen, and cool the reaction solution to 0°C. Then, slowly add a tetrahydrofuran solution (2 mL) of compound 10e (200 mg, 0.54 mmol) to the reaction solution. React at this temperature for 30 minutes. Next, slowly add a tetrahydrofuran solution (2 mL) of compound 10f (108 mg, 0.54 mmol) to the reaction solution, maintaining the reaction temperature at 0°C for 1 hour. After the reaction is complete, quench the reaction with saturated ammonium chloride solution, extract with ethyl acetate, and wash the organic phase with saturated brine. Combine all organic phases, dry with anhydrous sodium sulfate, filter, and concentrate the filtrate under reduced pressure to obtain the crude compound. Purify the crude compound by silica gel column chromatography (ethyl acetate / petroleum ether = 0-40%) to obtain 10 g (60 mg) of compound. LCMS (ESI) m / z: 335.3 [M + H₂O] + . 1 H NMR (400MHz, DMSO-d6) δ7.31–7.12(m,1H),6.86–6.64(m,1H),6.53–6.29(m,1H),4.83–4. 72(m,3H),4.69–4.59(m,2H),1.37(d,J=2.4Hz,9H),0.99–0.88(m,1H),0.53–0.24(m,4H).

[0259] Step 5: Dissolve 10 g (60 mg, 0.19 mmol) of the compound in dichloromethane (2 mL), add 0.4 mL of trifluoroacetic acid to the reaction solution, and react at room temperature for 2 hours. After the reaction is complete, concentrate the reaction solution under reduced pressure at low temperature to obtain crude compound INT-10 (80 mg). LCMS (ESI) m / z: 218.2 [M+H] + .

[0260] Example 1

[0261] Synthesis route:

[0262] Step 1: Synthesis of compound D002-1c

[0263] Compound D002-1a (3 g, 12.7 mmol) was dissolved in ethanol, and sodium hydroxide aqueous solution (15.5 mL, 1 M) was added. The mixture was reacted at 90 °C for 30 minutes. After the reaction solution cooled to room temperature, 1 mL of acetic acid solution was added, and the mixture was reacted at 90 °C for another 30 minutes. After cooling the reaction solution to room temperature again, compound D001-1b (2.61 mL, 12.7 mmol) was added, and the mixture was reacted at 25 °C. LCMS analysis showed that the reaction was complete and the target product was observed. The reaction solution was quenched with 150 mL of water, and the mixture was filtered. The resulting filter cake was dried to obtain compound D001-2c (4.1 g).

[0264] LCMS(ESI): m / z = 347.9 [M+H] + .

[0265] 1 H NMR (400MHz, DMSO-d6) δ10.86(d,J=13.6Hz,1H),8.37(d,J=13.6Hz,1H),7.85(d,J=3.2Hz, 1H),7.67(d,J=3.2Hz,1H),4.22(q,J=7.2Hz,2H),4.14(q,J=7.2Hz,2H),1.36–1.15(m,6H).

[0266] Step 2: Synthesis of compound D002-1d

[0267] Diphenyl ether-biphenyl (20 mL) was heated to reflux at 260 °C, and compound D002-1c (4.1 g, 11.78 mmol) was added. The reaction was carried out at 260 °C for 45 minutes. The reaction solution was cooled to 90 °C, and n-heptane was added. The mixture was further cooled to room temperature. The filter cake was filtered and slurried with ethyl acetate. The filter cake was filtered again to obtain compound D002-1d (2.8 g, yield: 75.6%), a gray solid.

[0268] LCMS(ESI): m / z = 303.9 [M+H] + .

[0269] 1 H NMR (400MHz, DMSO-d6) δ12.69(s,1H),8.43(s,1H),8.0(s,1H),4.31–4.20(m,2H),1.31–1.25(m,3H).

[0270] Step 3: Synthesis of compound D002-1e

[0271] Compound D002-1d (2.8 g, 9.27 mmol) was dissolved in chloroform (28 mL), and catalytic amounts of N,N-dimethylformamide and thionyl chloride (0.812 mL, 11.12 mmol) were added. The mixture was stirred at 60 °C for 40 hours. The reaction mixture was cooled to room temperature, and saturated sodium bicarbonate (80 mL) was slowly added. The mixture was extracted with dichloromethane and water, and the organic phase was washed twice with saturated brine. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography and eluted with petroleum ether / ethyl acetate (0%–25%) to give compound D002-1e (2.56 g).

[0272] LCMS(ESI) m / z: 321.9 [M+H] + .

[0273] 1 H NMR (400MHz, DMSO-d6) δ9.17 (s, 1H), 8.67 (s, 1H), 4.43 (q, J = 7.2Hz, 2H), 1.38 (t, J = 7.2Hz, 3H).

[0274] Step 4: Synthesis of compound D002-1f

[0275] Compound D002-1e (2.46 g, 7.67 mmol) was dissolved in N,N-dimethylformamide (25 mL), and phenol (866 mg, 9.2 mmol) and cesium carbonate (3.75 g, 11.5 mmol) were added. The mixture was stirred at 80 °C for 2 hours. The reaction solution was cooled to room temperature, diluted with ethyl acetate (100 mL), and the organic phase was washed three times with water, followed by two washes with saturated brine. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, and eluted with petroleum ether / ethyl acetate (0%–25%) to give compound D002-1f (2.1 g).

[0276] LCMS(ESI) m / z: 380.0 [M+H] + .

[0277] 1 H NMR(400MHz,DMSO-d6)δ9.13(s,1H),8.48(s,1H),7.45–7.36(m,2H),7.27–7 .19(m,1H),7.15–7.08(m,2H),4.18(q,J=7.2Hz,2H),1.14(t,J=7.2Hz,3H).

[0278] Step 5: Synthesis of compound D002-1g

[0279] Compound D002-1f (500 mg, 1.32 mmol), methylboronic acid (796 mg, 13.2 mmol), cesium carbonate (935 mg, 3.96 mmol), and tetraphenylphosphine palladium (150 mg, 0.132 mmol) were dissolved in 1,4-dioxane (5 mL). After purging with nitrogen three times, the reaction was carried out in an oil bath at 100 °C for 3 hours. After the reaction was completed, water was added to the mixture, and the mixture was extracted with ethyl acetate (10 mL x 3). The organic phase was washed with saturated brine and dried with anhydrous sodium sulfate. The mixture was then filtered. The organic solvent was removed by concentration under reduced pressure. The residue was adsorbed onto silica gel and purified by silica gel column chromatography (0-5% methanol / dichloromethane) to give compound D002-1g (300 mg).

[0280] LCMS: m / z = 314.0 [M+H] + .

[0281] Step 6: Synthesis of compound D002-1h

[0282] Compound D002-1 g (300 mg, 0.96 mmol) was dissolved in tetrahydrofuran (3.0 mL), methanol (1 mL), and water (1 mL), and lithium hydroxide (121 mg, 2.87 mmol) was added. The reaction mixture was stirred at 25 °C for 1 h. After the reaction was complete, the pH was adjusted to 4 with hydrochloric acid (3.0 M), and the organic solvent was removed by concentration under reduced pressure. A solid precipitated and was filtered. The solid was collected to give compound D002-1 h (170 mg).

[0283] LCMS: m / z = 286.1[M+H]+.

[0284] Step 7: Synthesis of compound D002

[0285] Compounds D002-1h (100 mg, 0.32 mmol), INT-1 (174 mg, 0.38 mmol), N-methylimidazole (157 mg, 1.92 mmol), and tetramethylchlorourea hexafluorophosphate (269 mg, 0.96 mmol) were dissolved in N,N-dimethylformamide (1.5 mL). The reaction was carried out under nitrogen protection at room temperature for 1 h. After the reaction was complete, the mixture was filtered, and the filtrate was purified by high-performance liquid chromatography (using ammonia) to obtain the target product D002 (79.20 mg).

[0286] LCMS: m / z = 443.1 [M+H] + .

[0287] 1H NMR(400MHz,CD3OD)δ8.87(s,1H),7.67(d,J=1.2Hz,1H),7.42–7.38(m,2H) ,7.26–7.22(m,1H),7.15–7.08(m,2H),6.87(dd,J=15.2Hz,4.8Hz,1H),6.6 6(dd,J=15.2Hz,1.6Hz,1H),4.07–4.04(m,1H),2.86(s,3H),2.49(s,3H),1 .08–1.01(m,1H),0.68–0.62(m,1H),0.55–0.428(m,1H),0.45–0.32(m,2H).

[0288] Example 2

[0289] Synthesis route:

[0290] Step 1: Synthesis of compound D001-1c

[0291] Compound D001-1a (10 g, 63.62 mmol) was dissolved in ethanol (30 mL), and sodium hydroxide aqueous solution (40 mL, 1 M) was added. The reaction was carried out at 90 °C. After cooling to room temperature, 4.8 mL of acetic acid solution was added, and the mixture was allowed to continue reacting at 90 °C. After cooling the reaction solution to room temperature again, compound D002-1b (14 g, 69.23 mmol) was added, and the reaction was carried out at 25 °C for 16 hours. LCMS analysis showed that the reaction was complete and the target product was observed. The reaction solution was quenched with water, and the mixture was filtered and the resulting filter cake was dried to obtain compound D001-1c (8 g). LCMS (ESI): m / z = 270.1 [M+H] + .

[0292] Step 2: Synthesis of compound D001-1d

[0293] Diphenyl ether (20 mL) was heated to reflux at 260 °C, and D001-1c (3.6 g, 13.36 mmol) was added. The reaction mixture was reacted at 260 °C for 60 minutes. The reaction solution was cooled to 90 °C, and n-heptane was added. The mixture was further cooled to room temperature, and the resulting filter cake was slurried with ethyl acetate. The filter cake was filtered again to obtain compound D001-1d (1.5 g). LCMS (ESI): m / z = 224.1 [M+H] + .

[0294] Step 3: Synthesis of compound D001-1e

[0295] D001-1d (1.5 g, 6.72 mmol) was dissolved in phosphorus oxychloride (15 mL). The mixture was stirred at 110 °C for 2 hours. The reaction mixture was cooled to room temperature, concentrated under reduced pressure, and saturated sodium bicarbonate was slowly added. The mixture was extracted with dichloromethane and water, and the organic phase was washed with saturated brine. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, and eluted with petroleum ether / ethyl acetate (0%–25%) to give compound D001-1e (900 mg). LCMS (ESI) m / z: 242.0 [M+H] + .

[0296] Step 4: Synthesis of compound D001-1f

[0297] D001-1e (900 mg, 3.72 mmol) was dissolved in N,N-dimethylformamide (10 mL), and phenol (420 mg, 4.46 mmol) and potassium carbonate (1.03 g, 7.44 mmol) were added. The mixture was stirred at 80 °C. The reaction solution was cooled to room temperature, diluted with ethyl acetate, and the organic phase was washed three times with water, followed by washing with saturated brine. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with petroleum ether / ethyl acetate (0%–25%) to give D001-1f (400 mg, yield: 35.9%). LCMS (ESI) m / z: 300.1 [M+H] + and 286.1[M+H] + (methyl ester)

[0298] Step 5: Synthesis of compound D001-1g

[0299] D001-1f (400 mg, 1.34 mmol) was dissolved in tetrahydrofuran (4 mL) and water (1 mL), then lithium hydroxide (563 mg, 13.40 mmol) was added, and the mixture was stirred at 50 °C. The target product was detected by LCMS. After the reaction was complete, the pH was adjusted to acidic with 4 M hydrochloric acid aqueous solution, and the product precipitated. The mixture was filtered to obtain crude D001-1 g (250 mg). LCMS (ESI) m / z: 272.1 [M+H] + .

[0300] Step 6: Synthesis of compound D001

[0301] To a single-necked flask containing 1 g (100 mg, 0.37 mmol) of D001, compound INT-1 (78 mg, 0.44 mmol), TCFH (123 mg, 0.44 mmol), NMI (178 mg, 2.22 mmol), and ultra-dry solvent N,N-dimethylformamide (2.0 mL) were added sequentially. The mixture was purged with nitrogen three times and stirred at room temperature for 2 hours. After the reaction was complete, the reaction solution was purified by high-performance liquid chromatography (HPLC) to obtain compound D001 (71.95 mg). LCMS (ESI) m / z: 429.2 [M+H] + .

[0302] Example 3

[0303] Synthesis route:

[0304] Step 1: Synthesis of compound D007-1b

[0305] D007-1a (500 mg, 2.48 mmol), phenol (1.17 g, 12.4 mmol), and cesium carbonate (2.42 g, 7.44 mmol) were dissolved in ultradry N,N-dimethylformamide (5.0 mL) and stirred in a 90 °C oil bath, then heated to 100 °C with stirring. After the reaction was complete, the two small-scale compounds D007-1a (15 mg, 0.071 mmol) were combined and treated together. Water was added to the reaction system, and the mixture was extracted with ethyl acetate. The organic phases were combined, washed successively with water and saturated brine, dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure to remove the solvent, and the residue was adsorbed onto silica gel and purified by silica gel column chromatography (0–60% ethyl acetate / petroleum ether, followed by 0–20% methanol / dichloromethane) to give D007-1b (422 mg, crude product). LCMS (ESI) m / z: 269.2 [M+H] + .

[0306] Step 2: Synthesis of compound D007-1c

[0307] D007-1b (100 mg, 0.3 mmol) and potassium hydroxide (209 mg, 3.73 mmol) were dissolved in tetrahydrofuran (1.5 mL), methanol (0.4 mL), and water (0.4 mL), and the mixture was stirred at room temperature for 16 hours. After the reaction was complete, the small-scale compound D007-1b (20 mg, 0.075 mmol) was combined and treated together. The pH was adjusted to 1, and the solvent was removed by concentration under reduced pressure. The residue was adsorbed onto silica gel and purified by silica gel column chromatography (8%–20% methanol / dichloromethane) to obtain D007-1c (129 mg, crude product). LCMS (ESI) m / z: 255.1 [M+H]+ .

[0308] Step 3: Synthesis of compound D007

[0309] D007-1c (115 mg, 0.45 mmol), INT-1 (213 mg, 0.54 mmol), NMI (304.4 mg, 3.62 mmol), and TCFH (190.4 mg, 0.68 mmol) were dissolved in ultradry N,N-dimethylformamide (2.5 mL), and the mixture was stirred at room temperature for 1 hour. After the reaction was complete, the reaction solution was preparatively separated by high-performance liquid chromatography (HPLC) (ammonia-alkali method) to obtain compound D007 (54.89 mg, three-step yield: 12.6%). LCMS (ESI) m / z: 412.2 [M+H] + .

[0310] Example 4

[0311] Synthesis route:

[0312] Step 1: Synthesis of compound D008-1a

[0313] D007-1b (402 mg, 1.5 mmol), di-tert-butyl dicarbonate (393 mg), 4-dimethylaminopyridine (18.3 mg, 0.15 mmol), and triethylamine (0.52 mL, 3.75 mmol) were dissolved in ultradry dichloromethane (4.0 mL), and the mixture was stirred at room temperature for 16 hours. 4-Dimethylaminopyridine (240 mg, 1.96 mmol) was added, and the mixture was stirred at room temperature for another 2 hours. The solvent was removed by concentration under reduced pressure, and the residue was adsorbed onto silica gel and purified by silica gel column chromatography (0–10% ethyl acetate / petroleum ether) to give D008-1a. 1 H NMR(400MHz,DMSO_d6)δ8.81(s,1H),7.70(d,J=4.0Hz,1H),7.43–7.35(m,2H),7.19(t ,J=7.2Hz,1H),7.04(d,J=8.0Hz,2H),5.91(d,J=4.0Hz,1H),3.75(s,3H),1.60(s,9H).

[0314] Step 2: Synthesis of compound D008-1b

[0315] In a 250 mL autoclave, D008-1a (326 mg, 0.89 mmol) and palladium on carbon (190 mg, 1.79 mmol) were dissolved in ultradry methanol (12 mL), and hydrogen was purged three times. The reaction system was pressurized to 3 MPa and stirred at room temperature. The mixture was filtered through diatomaceous earth, and the filter cake was rinsed with chloroform:isopropanol = 3:1 (100 mL). The solvent was removed by concentration under reduced pressure, and the residue was adsorbed onto silica gel and purified by silica gel column chromatography (0–13% ethyl acetate / petroleum ether) to obtain D008-1b (230 mg). LCMS (ESI) m / z: 371.1 [M+H] +

[0316] Step 3: Synthesis of compound D008-1c

[0317] D008-1b (216 mg, 0.58 mmol) was dissolved in dioxane hydrochloride (10 mL, 4 M). The reaction was stirred at room temperature for 18 hours. After the reaction was completed, the solvent was removed by concentration under reduced pressure to obtain D008-1c (217 mg, crude product). 1 H NMR(400MHz, DMSO_d6)δ8.31(s,1H),7.37(t,J=7.6Hz,2H),7.13(t,J=7.2Hz,1H),7.01( d,J=8.8Hz,2H),3.85(s,1H),3.62(s,3H),3.59(d,J=9.0Hz,2H),2.59(t,J=8.4Hz,2H).

[0318] Step 4: Synthesis of compound D008-1d

[0319] D008-1c (60 mg, 0.22 mmol) was dissolved in N,N-dimethylformamide (1.0 mL), and sodium hydride (26.6 mg, 0.67 mmol) was added at room temperature. The mixture was stirred at room temperature for 30 minutes, and then 2-iodopropane (75.5 mg, 0.44 mmol) was added. The reaction apparatus was then stirred at room temperature for 2 hours. After the reaction was complete, water was added to quench the reaction, and the pH was adjusted to 1 with hydrochloric acid. The solvent was removed by concentration under reduced pressure to obtain D008-1d (280 mg, crude product). LCMS (ESI) m / z: 313.2 [M+H] + .

[0320] Step 5: Synthesis of compound D008-1e

[0321] D008-1d (280 mg, 0.896 mmol) and potassium hydroxide (204 mg, 3.64 mmol) were dissolved in tetrahydrofuran (3 mL), methanol (0.6 mL), and water (0.6 mL). The mixture was stirred at room temperature for 8 hours. After the reaction was complete, the pH was adjusted to 1 with 1 M hydrochloric acid, the solvent was removed by concentration under reduced pressure, the residue was adsorbed onto silica gel, and purified by silica gel column chromatography (0–6% methanol / dichloromethane) to give D008-1e (97 mg, crude product). LCMS (ESI) m / z: 299.2 [M+H] + .

[0322] Step 6: Synthesis of compound D008

[0323] D008-1e (97 mg, 0.33 mmol), INT-1 (157 mg, 0.39 mmol), NMI (219 mg, 2.6 mmol), and TCFH (137 mg, 0.49 mmol) were dissolved in ultradry N,N-dimethylformamide (2 mL), and the mixture was stirred at room temperature. After the reaction was complete, the reaction solution was preparatively separated by high-performance liquid chromatography (HPLC) (ammonia-alkali method) to give compound D008 (8.55 mg, four-step yield: 11.1%). LCMS (ESI) m / z: 456.3 [M+H] + .

[0324] Example 5

[0325] Synthesis route:

[0326] Step 1: Synthesis of compound D009-1a

[0327] D007-1b (147 mg, 0.55 mmol) and potassium carbonate (227.2 mg, 1.64 mmol) were dissolved in ultradry acetonitrile (4 mL). Iodomethane (720 mg, 5.07 mmol) was added, and the mixture was stirred at room temperature. Potassium carbonate (500 mg, 3.52 mmol) and iodomethane (540 mg, 3.8 mmol) were added, and the mixture was stirred at room temperature for 5 hours. Iodomethane (360 mg, 2.54 mmol) was added again, and the mixture was stirred at room temperature for 4 hours. After the reaction was completed, the solvent was removed by concentration under reduced pressure. The residue was adsorbed onto silica gel and purified by silica gel column chromatography (0–13% ethyl acetate / petroleum ether) to obtain D009-1a (28 mg). 1H NMR(400MHz, DMSO_d6)δ8.73(s,1H),7.42(d,J=3.6Hz,1H),7.41–7.36(m,2H),7.19( t,J=7.6Hz,1H),7.05–7.03(m,2H),5.65(d,J=3.6Hz,1H),3.82(s,3H),3.75(s,3H).

[0328] Step 2: Synthesis of compound D009-1b

[0329] D009-1a (25 mg, 0.089 mmol) and potassium hydroxide (49.7 mg, 0.89 mmol) were dissolved in tetrahydrofuran (2.5 mL), methanol (0.5 mL), and water (0.5 mL). The mixture was stirred at room temperature for 18 hours. After the reaction was complete, the pH was adjusted to 1 with 1 M HCl, the solvent was removed by concentration under reduced pressure, the residue was adsorbed onto silica gel, and purified by silica gel column chromatography (0–20% methanol / dichloromethane) to obtain D009-1b (25 mg, crude product). LCMS (ESI) m / z: 269.2 [M+H] + .

[0330] Step 3: Synthesis of compound D009

[0331] D009-1b (25 mg, 0.093 mmol), INT-1 (44 mg, 0.11 mmol), NMI (62.7 mg, 0.75 mmol), and TCFH (39.2 mg, 0.14 mmol) were dissolved in ultradry N,N-dimethylformamide (1.0 mL), and the mixture was stirred at room temperature for 50 minutes. After the reaction was complete, the reaction solution was preparatively separated by high-performance liquid chromatography (HPLC) (ammonia-alkali method) to give compound D009 (8.13 mg, three-step yield: 21.6%). LCMS (ESI) m / z: 426.3 [M+H] + .

[0332] Example 6

[0333] Synthesis route:

[0334] Step 1: Synthesis of compound D013-1b

[0335] D013-1a (10.0 g, 58.02 mmol, 1 eq.) was dissolved in anhydrous methanol, and sodium methoxide solution (16.3 mL, 88.23 mmol, 1.5 eq., 5.4 M) was added. The reaction mixture was kept in a sealed flask at 120 °C. The reaction mixture was cooled to room temperature, concentrated under reduced pressure to remove excess solvent, and the residue was adjusted to pH less than 1 by adding hydrochloric acid methanol solution dropwise. The mixture was concentrated again under reduced pressure, and the residue was dissolved in dichloromethane. After filtration, the residue obtained by concentrated under reduced pressure was D013-1b (7.0 g). LCMS (ESI) m / z: 166.2 [M+H] + .

[0336] Step 2: Synthesis of compound D013-1c

[0337] D013-1b (7.5 g, 45.45 mmol, 1 eq.) was dissolved in anhydrous dichloromethane, and then activated manganese dioxide (39.5 g, 454.55 mmol, 10 eq.) was added. The reaction solution was reacted at room temperature for 16 hours. After the reaction was completed, the reaction solution was filtered through diatomaceous earth, and the filtrate was concentrated under reduced pressure to obtain the residue D013-1c (3.5 g). LCMS (ESI) m / z: 164.2 [M+H] + .

[0338] Step 3: Synthesis of compound D013-1d

[0339] Methyltriphenylphosphine bromide (60.45 g, 169.33 mmol, 3.0 eq.) and potassium tert-butoxide (18.96 g, 169.33 mmol, 3.0 eq.) were dissolved in ultra-dry tetrahydrofuran, purged three times with nitrogen, and reacted at 0 °C for 1 hour. Then, D013-1c (9.2 g, 56.44 mmol, 1.0 eq.) was dissolved in tetrahydrofuran (500 mL) and added dropwise to the reaction solution. The reaction solution was then brought to room temperature and reacted at room temperature for 16 hours. After the reaction was complete, excess solvent was removed by concentration under reduced pressure. The residue was dissolved in water, extracted with ethyl acetate, washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the residue obtained by concentration under reduced pressure was purified by silica gel column chromatography (0%–30% petroleum ether / ethyl acetate) to give D013-1d (6.0 g). LCMS (ESI) m / z: 162.1 [M+H] + .

[0340] Step 4: Synthesis of compound D013-1e

[0341] A solution of diethylzinc in n-hexane (111.8 mL, 111.80 mmol, 3.0 eq.) was dissolved in 100 mL of ultra-dry dichloromethane, purged three times with nitrogen, and then a solution of trifluoroacetic acid (12.75 g, 111.80 mmol, 3.0 eq.) in dichloromethane (40 mL) was added dropwise at -5 °C, and the reaction was maintained at -5 °C for 1 hour. Then, a solution of diiodomethane (29.96 g, 111.80 mmol, 3.0 eq.) dissolved in dichloromethane (20 mL) was added dropwise to the reaction solution, and the reaction was maintained at a constant temperature for 1 hour. Finally, a solution of D013-1d (6.0 g, 37.27 mmol, 1.0 eq.) dissolved in dichloromethane (40 mL) was added dropwise to the reaction solution, and the reaction was gradually brought to room temperature, where it was reacted for 16 hours. After the reaction was completed, the reaction solution was concentrated under reduced pressure. The residue was dissolved in dilute hydrochloric acid (50 mL, 1 M), extracted with ethyl acetate, washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The crude product was purified by silica gel column chromatography (0%–30% petroleum ether / ethyl acetate) to give D013-1e (3.5 g). LCMS (ESI) m / z: 176.1 [M+H] + .

[0342] Step 5: Synthesis of compound D013-1f

[0343] D013-1e (3.0 g, 17.05 mmol, 1 eq.) and sodium methanethiol (11.9 g, 170.45 mmol, 10 eq.) were dissolved in anhydrous N,N-dimethylformamide (50 mL). The reaction mixture was reacted at 100 °C for 1 hour. After the reaction was complete, excess solvent was removed by concentration under reduced pressure. The residue was dissolved in methanol, and hydrochloric acid solution was added dropwise to adjust the pH to less than 7. The mixture was concentrated under reduced pressure, and the residue was dissolved in dichloromethane. The mixture was filtered, and the filtrate was concentrated under reduced pressure to give D013-1f (2.0 g). LCMS (ESI) m / z: 162.1 [M+H] + .

[0344] Step 6: Synthesis of compound D013-1g

[0345] D013-1f (2.0 g, 12.42 mmol, 1.0 eq.) was dissolved in anhydrous N,N-dimethylformamide (30 mL), and N-bromosuccinimide (2.65 g, 14.91 mmol, 1.2 eq.) was added at 0 °C. The reaction was maintained at 0 °C for 40 minutes. After the reaction was completed, the reaction solution was quenched dropwise with saturated sodium thiosulfate solution, followed by the addition of water and extraction with ethyl acetate. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (triethylamine alkalization) (0%–50% petroleum ether / ethyl acetate) to obtain D013-1g (1.2 g). LCMS (ESI) m / z: 240.0, 242.0 [M+H] +1 H NMR (400MHz, DMSO-d6) δ7.96(s,1H),2.73(t,J=7.2Hz,2H),2.06(t,J=7.6Hz,2H),1.14–1.07(m,2H),0.95-0.92(m,2H).

[0346] Step 7: Synthesis of compound D013-1h

[0347] D013-1 g (600 mg, 2.5 mmol, 1.0 eq.) and benzyltriethylammonium chloride (2.84 g, 12.5 mmol, 5.0 eq.) were dissolved in phosphorus oxychloride (10 mL) and reacted at 70 °C for 16 hours. After the reaction, the reaction solution was concentrated under reduced pressure to remove excess phosphorus oxychloride. The residue was slowly added to a saturated sodium bicarbonate aqueous solution under ice bath conditions to quench the reaction. The solution was extracted with ethyl acetate, washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the residue obtained by concentration under reduced pressure was purified by silica gel column chromatography (0%–30% petroleum ether / ethyl acetate) to give D013-1 h (350 mg). LCMS (ESI) m / z: 258.0 & 260.0 [M+H] + .

[0348] Step 8: Synthesis of compound D013-1i

[0349] D013-1h (350 mg, 1.36 mmol, 1.0 eq.), phenol (383 mg, 4.07 mmol, 3.0 eq.), and cesium carbonate (1.33 g, 4.07 mmol, 3.0 eq.) were dissolved sequentially in N,N-dimethylformamide (5 mL), purged three times with nitrogen, and reacted at 90 °C for 5 hours. After the reaction, the reaction solution was diluted with water, extracted with ethyl acetate, washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the residue obtained by concentration under reduced pressure was purified by silica gel column chromatography (0%-30% petroleum ether / ethyl acetate) to give D013-1i (120 mg). LCMS (ESI) m / z: 316.3 & 318.3 [M+H] + .

[0350] Step 9: Synthesis of compound D013-1j

[0351] D013-1i (150 mg, 0.47 mmol, 1.0 eq.), 1,1'-bis(diphenylphosphine)ferrocene palladium dichloromethane complex (70 mg, 0.094 mmol, 0.2 eq.), and sodium acetate (116 mg, 1.41 mmol, 3.0 eq.) were dissolved sequentially in anhydrous ethanol (10 mL). The mixture was purged three times with nitrogen, followed by three purgings with carbon monoxide. The reaction was carried out at 80 °C for 16 hours under a carbon monoxide atmosphere (1.5 MPa). After the reaction, the reaction solution was concentrated under reduced pressure. The residue was dissolved in water, extracted with ethyl acetate, washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0%–30% petroleum ether / ethyl acetate) to obtain D013-1j (80 mg). LCMS (ESI) m / z: 310.4 [M+H] + .

[0352] Step 10: Synthesis of compound D013-1k

[0353] D013-1j (80 mg, 0.26 mmol, 1.0 eq.) and lithium hydroxide (62 mg, 2.58 mmol, 10.0 eq.) were dissolved in a mixed solvent of methanol (0.5 mL), tetrahydrofuran (2 mL), and water (0.5 mL). The reaction was carried out at room temperature for 1 hour. After the reaction was completed, dilute hydrochloric acid was added dropwise to adjust the pH to 5-6. The mixture was concentrated under reduced pressure, and the residue was dissolved in water, extracted with ethyl acetate, washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain D013-1k (50 mg, crude product), which was used directly in the next step. LCMS (ESI) m / z: 282.2 [M+H] + .

[0354] Step 11: Synthesis of compound D013

[0355] D013-1k (50 mg, 0.178 mmol, 1.0 eq.), INT-1 (97 mg, 0.214 mmol, 1.2 eq.), N,N,N',N'-tetramethylchloroformamidin hexafluorophosphate (100 mg, 0.356 mmol, 2.0 eq.), and N-methylimidazole (88 mg, 1.07 mmol, 6.0 eq.) were dissolved sequentially in anhydrous N,N-dimethylformamide and reacted at room temperature for 1 hour. After the reaction was completed, the reaction solution was purified by high-performance liquid chromatography to obtain compound D013 (9.92 mg, yield 12.73%). LCMS (ESI) m / z: 439.3 [M+H] + .

[0356] Example 7

[0357] Synthesis route:

[0358] Step 1: Synthesis of compound D014-1b

[0359] D014-1a (5.0 g, 32.7 mmol) was dissolved in methanol, and sodium methoxide (5.4 M, 30 mL, 162 mmol) was added. The mixture was stirred at 110 °C for 12 h. After the reaction was complete, the mixture was diluted with water, extracted with ethyl acetate, and the organic phases were combined. The organic phase was washed twice with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain D014-1b (4.8 g). 1 H NMR (400MHz, DMSO_d6) δ8.20(d,J=5.6Hz,1H),6.79(d,J=Hz,1H),3.83(s,3H),2.86(t,J=7.6Hz,2H),2.78(t,J=7.6Hz,2H),2.05-1.98(m,2H).

[0360] Step 2: Synthesis of compound D014-1c

[0361] D014-1b (4.8 g, 32.2 mmol) was dissolved in concentrated sulfuric acid, and NBS (9.2 g, 51.5 mmol) was added. The mixture was stirred at 60 °C for 5 h. After the reaction was complete, the mixture was diluted with water, the pH was adjusted to 7 with 20% sodium hydroxide, and the mixture was extracted with ethyl acetate. The organic phases were combined. The organic phases were dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0–50% ethyl acetate / petroleum ether) to give D014-1c (5 g). 1H NMR (400MHz, DMSO_d6) δ8.30 (s, 1H), 4.03 (s, 3H), 3.21 (t, J = 7.2Hz, 2H), 2.82 (t, J = 7.6Hz, 2H), 2.08-2.01 (m, 2H).

[0362] Step 3: Synthesis of compound D014-1d

[0363] D014-1c (5 g, 21.9 mmol) was dissolved in ethanol, and Pd(dppf)Cl2 (1.6 g, 2.2 mmol) and NaOAc (9 g, 109.6 mmol) were added. The reaction mixture was stirred at 85 °C for 16 h under carbon monoxide balloon protection. After the reaction was completed, the reaction mixture was concentrated under reduced pressure, diluted with water, and extracted with dichloromethane. The organic phases were combined. The organic phase was dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0–30% ethyl acetate / petroleum ether) to give D014-1d. 1 H NMR(400MHz, DMSO_d6)δ8.46(s,1H),4.28(q,J=7.2Hz,2H),3.95(s,3H),3.11(t ,J=7.6Hz,2H),2.90(t,J=7.6Hz,2H),2.09–2.01(m,2H),1.29(t,J=7.2Hz,3H).

[0364] Step 4: Synthesis of compound D014-1e

[0365] D014-1d (1.2 g, 5.4 mmol) was dissolved in THF, purged three times with nitrogen, and then cooled to -60 °C. LDA (6.8 mL, 13.6 mmol) was added, and the mixture was stirred at -60 °C for 1 hour. CH3I (4.6 g, 32.6 mmol) was diluted with 20 mL of THF and added dropwise to the reaction mixture. The mixture was stirred at -60 °C until the reaction was complete. The reaction was quenched with saturated NH4Cl aqueous solution, extracted with dichloromethane, and the organic phases were combined. The organic phases were dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0–50% ethyl acetate / petroleum ether) to give D014-1e (490 mg). 1 H NMR(400MHz, DMSO_d6)δ8.46(s,1H),4.28(q,J=7.2Hz,2H),3.95(s,3H),3.11(t ,J=7.6Hz,2H),2.90(t,J=8.0Hz,2H),2.09–2.01(m,2H),1.30(t,J=7.2Hz,3H).

[0366] Step 5: Synthesis of compound D014-1f

[0367] D014-1e (490 mg, 2.1 mmol) was dissolved in ultradry dichloromethane (3.0 mL), and boron tribromide (1 M, 6 mL, 6 mmol) was added dropwise at 0 °C. The reaction mixture was stirred at 25 °C for 2 h. After the reaction was completed, the reaction mixture was quenched with methanol. The reaction mixture was concentrated under reduced pressure to obtain crude D014-1f (490 mg) (a mixture of methyl and ethyl esters). LCMS (ESI) m / z: 208.1, 222.2 [M+H] + .

[0368] Step 6: Synthesis of compound D014-1g

[0369] D014-1f (490 mg, 2.2 mmol) was dissolved in phosphorus oxychloride (10 mL), and the reaction mixture was stirred at 110 °C for 4 h. After the reaction was complete, the reaction mixture was concentrated under reduced pressure, the concentrate was diluted with saturated sodium bicarbonate, and extracted with ethyl acetate. The organic phases were combined. The organic phase was dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0–30% ethyl acetate / petroleum ether) to give D014-1 g (370 mg) (a mixture of methyl and ethyl esters). LCMS (ESI) m / z: 226.1, 240.2 [M+H] + .

[0370] Step 7: Synthesis of compound D014-1h

[0371] D014-1 g (370 mg, 1.5 mmol) was dissolved in DMF (5 mL), and phenol (175 mg, 1.9 mmol) and cesium carbonate (755 mg, 2.3 mmol) were added. The reaction mixture was stirred at 80 °C for 2 h. After the reaction was complete, the mixture was diluted with water and extracted with ethyl acetate. The organic phases were combined. The organic phase was washed twice with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0–30% ethyl acetate / petroleum ether) to give D014-1 h (320 mg). LCMS (ESI) m / z: 284.1, 298.1 [M+H] + .

[0372] Step 8: Synthesis of compound D014-1i

[0373] D014-1h (320 mg, 1.1 mmol) was dissolved in THF (4.0 mL), and LiOH (453 mg, 11 mmol) and H2O (0.4 mL) were added. The reaction mixture was stirred at room temperature for 2 h. After the reaction was complete, the pH was adjusted to 4 with hydrochloric acid (2.0 M), and the mixture was extracted three times with ethyl acetate. The organic phases were combined. The organic phase was dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain crude D014-1i (320 mg). LCMS (ESI) m / z: 270.1 [M+H] + .

[0374] Step 9: Synthesis of compound D014

[0375] D014-1i (200 mg, 0.74 mmol) was dissolved in DMF (2.0 mL), and then INT-1 (440 mg, 0.90 mmol), TCFH (420 mg, 1.5 mmol), and NMI (360 mg, 4.39 mmol) were added. The reaction mixture was stirred at room temperature for 1 h. After the reaction was completed, water was added to quench the reaction, and the mixture was extracted three times with ethyl acetate. The organic phases were combined. The organic phase was washed twice with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by high performance liquid chromatography to obtain compound D014 (120 mg), a white solid. D014 was chirally resolved to prepare D014-P1 / D014-P2 (55.05 mg and 59.87 mg).

[0376] Example 8

[0377] Synthesis route:

[0378] Step 1: Synthesis of compound D028-1b

[0379] D028-1a (10 g, 58.40 mmol) was dissolved in ultra-dry acetonitrile (200 mL). The reaction solution was heated to 50 °C, and NBS (12.5 g, 70.08 mmol) was added in portions. After the addition was complete, the reaction solution was reacted at 50 °C for 1 hour. After the reaction was complete, water was added to the reaction solution at 0 °C, and the mixture was extracted three times with ethyl acetate. The organic phase was washed with saturated brine and dried over anhydrous sodium sulfate. The mixture was filtered, and the residue obtained by concentration under reduced pressure was purified by silica gel column chromatography (0–20% ethyl acetate / petroleum ether) to give D028-1b (10.5 g). LCMS (ESI) m / z: 252.0 [M+3] + .

[0380] Step 2: Synthesis of compound D028-1c

[0381] DO28-1b (5 g, 20.00 mmol) was dissolved in ethanol (20 mL), and 1 M sodium hydroxide solution (24 mL, 24.00 mmol) was added to the mixture. The mixture was reacted at 90 °C for 2 hours, then cooled to 0 °C, and acetic acid solution (1.7 mL, 30.00 mmol) was added dropwise. The mixture was then reacted at 90 °C for 1.5 hours, then cooled to room temperature. Diethyl ethoxymethylene malonate (4 mL, 20.00 mmol) was added to the reaction mixture, and the reaction was allowed to proceed overnight at room temperature. After the reaction was complete, the reaction mixture was filtered, the filter cake was washed with ethanol, and dried to obtain DO28-1c (6.4 g). LCMS (ESI) m / z: 362.0 [M+H] + .

[0382] Step 3: Synthesis of compound D028-1d

[0383] D028-1c (2 g, 5.52 mmol) was dissolved in diphenyl ether (20 mL). The mixture was reacted at 250 °C. After the reaction was complete, the reaction solution was cooled to room temperature, and petroleum was added to the solution. The mixture was filtered, and the filter cake was concentrated under reduced pressure to obtain the crude product D028-1d (920 mg). LCMS (ESI) m / z: 318.0 [M+3] + .

[0384] Step 4: Synthesis of compound D028-1e

[0385] D028-1d (920 mg, 2.91 mmol), thionyl chloride (0.41 mL, 5.82 mmol), and DMF (1 drop) were dissolved in chloroform (16 mL), and the reaction mixture was reacted overnight at 80 °C. After the reaction was complete, water was added to the reaction mixture, and the mixture was extracted three times with dichloromethane. The organic phase was washed with saturated brine and dried over anhydrous sodium sulfate. The mixture was filtered, and the residue was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate 0–10% ethyl acetate / petroleum ether) to give D028-1e (550 mg). LCMS (ESI) m / z: 335.9 [M+H] + .

[0386] Step 5: Synthesis of compound D028-1f

[0387] D028-1e (640 mg, 1.91 mmol) was dissolved in DMF (2 mL / 0.5 mL), and phenol (198 mg, 2.10 mmol) and cesium carbonate (1.24 g, 3.82 mmol) were added to the reaction solution. The reaction solution was reacted at 80 °C for 2 hours. After the reaction was completed, water was added to the reaction solution, and the mixture was extracted three times with ethyl acetate. The organic phase was washed with saturated brine and dried over anhydrous sodium sulfate. The mixture was filtered, and the residue was concentrated under reduced pressure and purified by silica gel column chromatography (0-30% ethyl acetate / petroleum ether) to give D028-1f (410 mg). LCMS (ESI) m / z: 394.0 [M+H] + .

[0388] Step 6: Synthesis of compound D028-1g

[0389] D028-1f (390 mg, 0.99 mmol) was dissolved in dioxane (7 mL), and methylboric acid (296 mg, 4.95 mmol), tetraphenylphosphine palladium (114 mg, 0.099 mmol), and potassium carbonate (410 mg, 2.97 mmol) were added to the reaction solution. The reaction solution was reacted overnight at 80 °C. After the reaction was completed, water was added to the reaction solution, and the mixture was extracted three times with ethyl acetate. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0–10% ethyl acetate / petroleum ether) to give D028-1g (280 mg, yield: 86.0%). LCMS (ESI) m / z: 328.1 [M+H] + .

[0390] Step 7: Synthesis of compound D028-1h

[0391] DO28-1 g (50 mg, 0.15 mmol) was dissolved in tetrahydrofuran / water (1 mL / 0.2 mL), and lithium hydroxide (63 mg, 1.50 mmol) was added to the reaction solution. The reaction solution was allowed to react overnight at room temperature. After the reaction was completed, the pH of the reaction solution was adjusted to 7 with 1 M hydrochloric acid solution, and then concentrated under reduced pressure to obtain the crude product DO28-1 h (90 mg). LCMS (ESI) m / z: 300.1 [M+H] + .

[0392] Step 8: Synthesis of compound D028

[0393] D028-1h (80 mg, crude), INT-1 (145 mg, 0.32 mmol), N-methylimidazole (133 mg, 1.62 mmol), and tetramethylchlorourea hexafluorophosphonate (151 mg, 0.54 mmol) were dissolved in N,N-dimethylformamide (1.5 mL). The reaction was carried out under nitrogen protection at room temperature for 1 hour. After the reaction, the mixture was filtered, and the filtrate was purified by high-performance liquid chromatography (HPLC) to obtain the target product D028 (16.31 mg, two-step yield: 23.8%). LCMS (ESI) m / z: 457.3 [M+H] + .

[0394] Example 9

[0395] Synthesis route:

[0396] Step 1: Synthesis of compound D046-1c

[0397] D046-1a (5 g, 51.546 mmol) and D046-1b (11.1 g, 51.546 mmol) were added to a 100 mL single-necked flask. The reaction system was purged with nitrogen three times and reacted at 100 °C for 1 hour. After the reaction was complete, the reaction solution was directly dried under vacuum to obtain D046-1c (10.0 g). LCMS (ESI): m / z = 268.1 [M+H] + .

[0398] Step 2: Synthesis of compound D046-1d

[0399] Diphenyl ether-biphenyl (20 mL) was heated to reflux at 260 °C, and D046-1c (1.1 g, 4.119 mmol) was added. The mixture was reacted at 260 °C for 45 minutes. The reaction solution was cooled to room temperature, and petroleum ether was added to the reaction solution. The resulting filter cake was filtered and washed twice with petroleum ether to obtain D046-1d (370 mg). 1 H NMR (400MHz, DMSO_d6) δ12.18(s,1H),8.75(s,1H),8.26(s,1H),4.38(q,J=7.2Hz,2H),4.01(s,3H),1.36(t,J=7.2Hz,3H).

[0400] Step 3: Synthesis of compound D046-1e

[0401] D046-1d (200 mg, 0.905 mmol) was dissolved in chloroform (3 mL). Thionyl chloride (0.12 mL, 1.809 mmol) was added to the reaction mixture, followed by two drops of N,N-dimethylformamide. The reaction system was purged with nitrogen three times. The reaction mixture was heated to 70 °C and stirred at 70 °C for 2 hours. After the reaction was complete, the reaction mixture was cooled to room temperature, and saturated sodium bicarbonate was slowly added. Ethyl acetate was then added to the reaction mixture for separation. The aqueous phase was extracted three times with ethyl acetate, washed with saturated brine, dried over anhydrous sodium sulfate, and filtered. The solution was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0–10% ethyl acetate / petroleum ether) to give D046-1e (110 mg). 1 H NMR (400MHz, DMSO-d6) δ8.98(s,1H),8.41(s,1H),4.39(q,J=7.2Hz,2H),4.11(s,3H),1.37(t,J=7.2Hz,3H).

[0402] Step 4: Synthesis of compound D046-1f

[0403] D046-1e (110 mg, 0.460 mmol) was dissolved in N,N-dimethylformamide (2 mL), and phenol (52 mg, 0.552 mmol) and cesium carbonate (299 mg, 0.920 mmol) were added. The reaction system was purged with nitrogen three times and stirred at room temperature for 2 hours. After the reaction was complete, the reaction solution was diluted with water, extracted three times with ethyl acetate, the organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0–10% ethyl acetate / petroleum ether) to give D046-1f (110 mg). 1 H NMR(400MHz, DMSO_d6)δ8.93(s,1H),7.52(t,J=8.0Hz,2H),7.40(t,J=7.6Hz,1H),7.29( d,J=8.0Hz,2H),6.58(s,1H),4.29(q,J=7.2Hz,2H),4.00(s,3H),1.27(t,J=7.2Hz,3H).

[0404] Step 5: Synthesis of compound D046-1g

[0405] D046-1f (60 mg, 0.202 mmol) was dissolved in tetrahydrofuran (2 mL), methanol, and water. Then, potassium hydroxide (169 mg, 3.03 mmol) was added, and the mixture was stirred at room temperature for 1 hour. After the reaction was complete, 1 M hydrochloric acid was added to adjust the pH to 4–5, and then water was added. The crude product D046-1g (60 mg) was obtained by freeze-drying and used directly in the next reaction. LCMS (ESI): m / z = 270.1 [M+H] + .

[0406] Step 6: Synthesis of compound D046

[0407] 1 g of D046-1 (40 mg, 0.148 mmol), compound INT-1 (83 mg, 0.178 mmol), N-methylimidazole (73 mg, 0.892 mmol), and tetramethylchlorourea hexafluorophosphonate (83 mg, 0.297 mmol) were dissolved in N,N-dimethylformamide (2.0 mL). The mixture was reacted at room temperature under nitrogen protection for 16 hours. After the reaction was completed, the reaction solution was filtered, and the filtrate was purified by high-performance liquid chromatography (HPLC) to obtain the target product D046 (2.68 mg, yield 4.2%). LCMS (ESI): m / z = 427.1 [M+H] + .

[0408] Example 10

[0409] Synthesis route:

[0410] Step 1: Synthesis of compound D038-1b

[0411] D002-1f (100 mg, 0.26 mmol) was dissolved in dioxane / water (2 mL / 0.4 mL), and D038-1a (52 mg, 0.31 mmol), RuPhos-Pd-G3 (22 mg, 0.026 mmol), and potassium phosphate (166 mg, 0.78 mmol) were added. The reaction mixture was reacted at 60 °C for 2 h under nitrogen protection. The reaction solution was cooled to room temperature, water was added, and the mixture was extracted with ethyl acetate. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0%–20% ethyl acetate / petroleum ether) to give D038-1b (80 mg). LCMS: m / z = 340.1 [M+H] + .

[0412] Step 2: Synthesis of compound D038-1c

[0413] D038-1b (70 mg, 0.21 mmol) was dissolved in methanol (2 mL), and wet palladium on carbon (80 mg) was added. The reaction mixture was reacted at room temperature for 2 h under hydrogen protection. The reaction solution was filtered, and the filter cake was washed with methanol. The filtrate was concentrated under reduced pressure to give D038-1c (50 mg). LCMS: m / z = 342.1 [M+H] + .

[0414] Step 3: Synthesis of compound D038-1d

[0415] D038-1c (50 mg, 0.15 mmol) was dissolved in tetrahydrofuran / water (2 mL / 0.5 mL), and lithium hydroxide (63 mg, 1.50 mmol) was added. The reaction mixture was reacted at room temperature for 16 h. 1 M hydrochloric acid solution was added to the reaction solution to adjust the pH to 3. The mixture was concentrated under reduced pressure, and the resulting white solid was the crude product D038-1d (90 mg). LCMS: m / z = 314.2 [M+H] + .

[0416] Step 4: Synthesis of compound D038

[0417] D038-1d (90 mg, 0.29 mmol), INTC (158 mg, 0.35 mmol), N-methylimidazole (143 mg, 1.74 mmol), and tetramethylchlorourea hexafluorophosphonate (163 mg, 0.58 mmol) were dissolved in DMF (2.0 mL). The reaction was carried out under nitrogen protection at room temperature for 1 hour. After the reaction, the mixture was filtered, and the filtrate was purified by high-performance liquid chromatography (HPLC) to obtain the target product D038 (26.97 mg). LCMS: m / z = 471.1 [M+H] + .

[0418] Example 11

[0419] Synthesis route:

[0420] Step 1: Synthesis of compound D041-1a

[0421] D007-1b (200 mg, 0.74 mmol), cyclopropylboronic acid (191 mg, 2.22 mmol), 2',2-bipyridine (139 mg, 0.89 mmol), copper acetate (162 mg, 0.89 mmol), and sodium carbonate (235 mg, 2.22 mmol) were dissolved in DCE (15 mL). The mixture was reacted overnight at 95 °C under oxygen protection. The reaction solution was cooled to room temperature, water was added, and the mixture was extracted with dichloromethane. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0%–20% petroleum ether / ethyl acetate) to give product D041-1a (100 mg). LCMS: m / z = 309.1 [M+H] + .

[0422] Step 2: Synthesis of compound D041-1b

[0423] D041-1a (50 mg, 0.16 mmol) was dissolved in tetrahydrofuran / methanol / water (1 mL / 0.5 mL / 0.2 mL), and lithium hydroxide (67 mg, 1.60 mmol) was added. The reaction mixture was reacted at room temperature for 16 h. Then, 1 M hydrochloric acid solution was added to the reaction solution to adjust the pH to 3, and the mixture was concentrated under reduced pressure to obtain crude product D041-1b (100 mg). LCMS: m / z = 295.1 [M+H] + .

[0424] Step 3: Synthesis of compound D041

[0425] D041-1b (100 mg, 0.34 mmol), INT-1 (186 mg, 0.41 mmol), N-methylimidazole (168 mg, 2.04 mmol), and tetramethylchlorourea hexafluorophosphonate (191 mg, 0.68 mmol) were dissolved in DMF (2.0 mL). The reaction mixture was reacted at room temperature for 1 hour under nitrogen protection. After the reaction, the mixture was filtered, and the filtrate was purified by high-performance liquid chromatography (HPLC) to obtain the target product D041 (30.92 mg). LCMS: m / z = 452.1 [M+H] + .

[0426] Example 12

[0427] Synthesis route:

[0428] Step 1: Synthesis of compound D042-1b

[0429] D007-1b (200 mg, 0.74 mmol) and sodium hydroxide (44 mg, 1.11 mmol) were dissolved in DMF (2 mL). The mixture was reacted at room temperature for 30 minutes. Then, D042-1a (400 mg, 2.96 mmol) was added to the mixture, and the reaction was carried out at room temperature for 2 hours. The reaction solution was cooled to 0 °C, water was added, and the pH was adjusted to 3 with 1 M hydrochloric acid solution. The mixture was concentrated under reduced pressure, and the residue was purified by reversed-phase column chromatography to give product D042-1b (60 mg). LCMS: m / z = 309.2 [M+H] + .

[0430] Step 2: Synthesis of compound D042-

[0431] D042-1b (60 mg, 0.19 mmol), INTC (104 mg, 0.23 mmol), N-methylimidazole (94 mg, 1.14 mmol), and tetramethylchlorourea hexafluorophosphonate (107 mg, 0.38 mmol) were dissolved in DMF (2.0 mL). The reaction was carried out at room temperature for 1 hour under nitrogen protection. After the reaction was complete, the mixture was filtered, and the filtrate was purified by high-performance liquid chromatography (HPLC) to obtain the target product D042 (30.81 mg). LCMS: m / z = 466.2 [M+H] + .

[0432] Example 13

[0433] Synthesis route:

[0434] Step 1: Synthesis of compound D051-b

[0435] Int-5 (500 mg, 1.77 mmol) was dissolved in acetonitrile. The reaction system was purged with nitrogen three times. Selectfluor reagent (691 mg, 1.95 mmol) was added, and the reaction mixture was stirred overnight at room temperature. After the reaction was complete, the reaction solution was diluted with water, extracted three times with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-8% ethyl acetate / petroleum ether) to give compound D041-b (390 mg). LCMS (ESI) m / z: 301.1 [M+H] + .

[0436] Step 2: Synthesis of compound D051-c

[0437] D041-b (390 mg, 1.3 mmol) was dissolved in tetrahydrofuran and water, and the reaction mixture was stirred at room temperature for 48 h. After the reaction was complete, the reaction mixture was diluted with water, and the pH of the mixture was adjusted to acidic by adding 1 M HCl solution dropwise under ice bath conditions. The solution was then lyophilized to obtain crude D041-c (470 mg). LCMS (ESI) m / z: 273.2 [M+H] + .

[0438] Step 3: Synthesis of compound D051

[0439] D041-c (50 mg, 0.18 mmol), int-2 (32 mg, 0.22 mmol), N-methylimidazole (77 mg, 0.28 mmol), and tetramethylchlorourea hexafluorophosphonate (90 mg, 1.08 mmol) were dissolved in N,N-dimethylformamide. The mixture was reacted at room temperature for 2 hours under nitrogen protection. After the reaction was complete, the reaction solution was filtered, and the filtrate was purified by high-performance liquid chromatography (HPLC) to obtain the target product D041 (9.28 mg). LCMS (ESI) m / z: 402.2 [M+H] + .

[0440] Example 14

[0441] Synthesis route:

[0442] Step 1: Synthesis of compound D052-b

[0443] Int-5 (230 mg, 0.81 mmol) was dissolved in DMF, and N-chlorosuccinimide (108 mg, 0.81 mmol) was added. The reaction mixture was stirred at 65 °C for 3 h. After the reaction was complete, the mixture was diluted with water and extracted with ethyl acetate (5 mL x 3). The organic phases were combined. The organic phase was washed three times with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-10% ethyl acetate / petroleum ether) to give compound D052-b (200 mg). LCMS (ESI) m / z: 317.3 [M+H] + .

[0444] Step 2: Synthesis of compound D052-c

[0445] D052-b (200 mg, 0.63 mmol) was dissolved in THF (4 mL), and LiOH (133 mg, 3.15 mmol) and H2O were added. The reaction mixture was stirred at room temperature for 16 h. After the reaction was complete, the pH was adjusted to 4 with hydrochloric acid (2.0 M), and the mixture was extracted twice with ethyl acetate. The organic phases were combined. The organic phase was dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain crude D052-c (115 mg). LCMS (ESI) m / z: 289.1 [M+H] + .

[0446] Step 3: Synthesis of compound D052

[0447] D052-c (50 mg, 0.17 mmol) was dissolved in DMF (1.0 mL), followed by the sequential addition of compound int-2 (30 mg, 0.2 mmol), TCFH (97 mg, 0.34 mmol), and NMI (85 mg, 1.02 mmol). The reaction mixture was stirred at room temperature for 1 h. After the reaction was complete, the reaction mixture was filtered through a membrane filter, and the filtrate was purified by high-performance liquid chromatography to obtain compound D052 (29.54 mg).

[0448] Example 15

[0449] Synthesis route:

[0450] Step 1: Int-5 (800 mg, 2.84 mmol) was dissolved in tetrahydrofuran (10 mL) and water (2 mL), and then lithium hydroxide monohydrate (1.2 g, 28.40 mmol) was added. The mixture was stirred at room temperature for 16 hours. The target product was detected by LCMS. After the reaction was completed, the pH was adjusted to acidic with 4 M hydrochloric acid aqueous solution, and the product precipitated. The mixture was filtered to obtain crude compound D053-a (500 mg).

[0451] Step 2: To a single-necked flask containing D053-a (100 mg, 0.39 mmol), compound int-1 (163.1 mg, 0.47 mmol), TCFH (164 mg, 0.59 mmol), NMI (98 mg, 1.17 mmol), and ultra-dry solvent N,N-dimethylformamide (2.0 mL) were added sequentially. After purging with nitrogen three times, the mixture was stirred at room temperature for 2 hours. After the reaction was complete, the reaction solution was purified by high-performance liquid chromatography (HPLC) to obtain compound D053 (29.74 mg). LCMS (ESI) m / z: 412.2 [M+H] + .

[0452] Example 16

[0453] Synthesis route:

[0454] Step 1: Compound D054-a (15 g, 41.7 mmol) was dissolved in anhydrous dichloromethane (150 mL), and 1,8-diazobisspirocyclic [5.4.0]undec-7-ene (12.7 g, 83.5 mmol) was added. The reaction system was purged with nitrogen three times and stirred at room temperature for 10 minutes. Simultaneously, compound D054-b (26.07 g, 167.0 mmol) was dissolved in anhydrous dichloromethane and added dropwise to the above reaction solution. The mixture was stirred overnight at room temperature. After the reaction was complete, the reaction solution was diluted with dichloromethane, washed twice with 1 M HCl aqueous solution, and three times with saturated sodium bicarbonate aqueous solution. The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-30% ethyl acetate / petroleum ether) to give compound D054-c (12 g). LCMS (ESI) m / z: 362.2 [M+H] + . 1 H NMR (400MHz, CDCl3) δ7.40–7.31(m,5H),6.03(s,1H),5.14(s,2H),3.98–3.95 (m,4H),3.75(s,3H),2.91–2.83(m,2H),2.55–2.41(m,2H),1.81–1.71(m,4H).

[0455] Step 2: Dissolve D054-c (12 g, 33.2 mmol) in anhydrous methanol, add di-tert-butyl dicarbonate (8.7 g, 39.9 mmol) and palladium hydroxide on carbon (3 g), purge the reaction mixture three times with hydrogen, and stir overnight at room temperature. After the reaction is complete, filter the reaction solution to remove palladium hydroxide, and concentrate the filtrate under reduced pressure. Purify the residue by silica gel column chromatography (0-30% ethyl acetate / petroleum ether) to give compound D054-d (12 g, crude product). 1 H NMR (400MHz, CDCl3) δ5.03(d,J=8.8Hz,1H),4.29(dd,J=8.8,5.2Hz,1H),3.93(s,4H),3.74(s,3H),1.87–1.73(m,3H),1.67–1.46(m,5H),1.43(s,9H).

[0456] Step 3: Dissolve D054-d (4.6 g, 12.2 mmol) in water (10 mL), acetic acid (30 mL), tetrahydrofuran (5 mL), and dichloroacetic acid (3 mL). Stir the reaction mixture overnight at room temperature. After the reaction is complete, add water (5 mL) to the reaction mixture and stir for 10 minutes. Add solid sodium carbonate to the mixture until no more bubbles are produced, then add saturated sodium bicarbonate solution. Extract with dichloromethane. Dry the organic phase with anhydrous sodium sulfate, filter, and concentrate under reduced pressure. Purify the residue by silica gel column chromatography (0-20% ethyl acetate / petroleum ether) to give compound D054-e (2.4 g). 1 H NMR(400MHz,DMSO-d6)δ7.33(d,J=8.0Hz,1H),4.03–3.99(m,1H),3.64(s,3H),2.43 –2.29(m,2H),2.19–2.16(m,3H),1.86–1.83(m,2H),1.60–1.42(m,2H),1.38(s,9H).

[0457] Step 4: Dissolve D054-e (1.94 g, 6.81 mmol) and compound D054-f (1.57 g, 8.17 mmol) in anhydrous N,N-dimethylformamide. Purge the reaction system three times with nitrogen. Cool the reaction solution to -50°C. Slowly add 1 M potassium tert-butoxide solution in tetrahydrofuran (12.3 mL, 12.3 mmol) to the reaction solution. After the addition is complete, bring the reaction solution to room temperature and stir for 2 hours. After the reaction is complete, quench the reaction solution with water, extract with ethyl acetate, wash the organic phase with saturated brine, dry with anhydrous sodium sulfate, filter, and concentrate under reduced pressure. Purify the residue by silica gel column chromatography (0-15% ethyl acetate / petroleum ether) to give compound D054-g (1.2 g). 1 H NMR (400MHz, DMSO-d6) δ7.23(d,J=8.4Hz,1H),3.92(t,J=7.2Hz,1H),3.62(s,3H),2.37 –2.34(m,2H),1.80–1.71(m,3H),1.65(d,J=8.4Hz,2H),1.37(s,9H),1.20–0.99(m,2H).

[0458] Step 5: A 2.5M lithium aluminum hydride solution in tetrahydrofuran (0.26 mL, 0.66 mmol) was added dropwise to anhydrous tetrahydrofuran. The reaction system was purged with nitrogen three times. The solution temperature was lowered to 0°C, and a tetrahydrofuran solution of D054-g (140 mg, 0.44 mmol) was added dropwise. After the addition was complete, the reaction solution was moved to room temperature and stirred for 1 hour. After the reaction was complete, saturated ammonium chloride was added to the reaction solution, and the mixture was extracted with ethyl acetate. The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-25% ethyl acetate / petroleum ether) to give compound D054-h (120 mg). 1 H NMR(400MHz, DMSO-d6)δ6.45(d,J=8.8Hz,1H),4.50(t,J=5.2Hz,1H),3.40–3.30(m,2H),3.30–3.2 7(m,1H),2.37–2.34(m,2H),1.81–1.71(m,4H),1.57–1.37(m,1H),1.37(s,9H),1.10–0.99(m,2H).

[0459] Step 6: Dissolve D054-h (120 mg, 0.41 mmol) in anhydrous dichloromethane (4 mL), add Desmartin reagent (350 mg, 0.82 mmol) at 0 °C, purge the reaction system with nitrogen three times, and stir at room temperature for 1 hour. After the reaction is complete, concentrate the solvent under reduced pressure at low temperature, slurry with ethyl acetate (2 mL), filter to remove most of the Desmartin reagent, and concentrate the filtrate again under reduced pressure. Purify the residue by silica gel column chromatography (0-10% petroleum ether / ethyl acetate) to obtain compound D054-i (60 mg). 1 H NMR(400MHz, DMSO-d6)δ9.46(d,J=1.2Hz,1H),7.30(d,J=8.0Hz,1H),3.91–3.74(m,1H),2.37–2.3 3(m,2H),1.93–1.92(m,1H),1.85–1.71(m,3H),1.63–1.60(m,1H),1.39(s,9H),1.18–1.05(m,2H).

[0460] Step 7: Dissolve sodium hydride (12 mg, 0.31 mmol) in anhydrous tetrahydrofuran. Cool the reaction solution to 0°C and, under nitrogen protection, slowly add a 1 mL solution of tetrahydrofuran containing compound D054-j (48 mg, 0.21 mmol). After the addition is complete, stir at 0°C for 20 minutes. Then, slowly add a 1 mL solution of tetrahydrofuran containing D054-i (60 mg, 0.21 mmol), and continue stirring at 0°C for 5 minutes. After the reaction is complete, quench the reaction with saturated ammonium chloride (1 mL), dilute with water, and extract three times with ethyl acetate. Combine the organic phases, dry with anhydrous sodium sulfate, filter, and concentrate under reduced pressure to obtain the crude compound D054-k (76 mg). LCMS (ESI) m / z: 631.0 [2M+H-100] + .

[0461] Step 8: Dissolve crude D054-k (76 mg, 0.21 mmol) in anhydrous dichloromethane (1 mL), add trifluoroacetic acid (0.2 mL) under ice-water bath conditions, and stir at room temperature for 2 hours. After the reaction is complete, concentrate under reduced pressure to obtain crude compound D054-l (55 mg). LCMS (ESI) m / z: 266.2 [M+H] + .

[0462] Step 9: Crude product D054-l (55 mg, 0.21 mmol) was dissolved in anhydrous N,N-dimethylformamide (1 mL), and compound int-3 (53 mg, 0.17 mmol), N,N,N',N'-tetramethylchloroformamidin hexafluorophosphate (73 mg, 0.26 mmol), and N-methylimidazole (85 mg, 1.04 mmol) were added. The reaction system was purged with nitrogen three times and stirred at room temperature for 2 hours. After the reaction was completed, the reaction solution was extracted with ethyl acetate, the organic phase was washed three times with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. Crude product compound D054 (150 mg) was obtained. The crude product was then subjected to high performance liquid chromatography (FA) to obtain the target product D054 (26.65 mg, yield 27.8%). LCMS (ESI) m / z: 554.4 [M+H] + .

[0463] Example 17

[0464] Synthesis route:

[0465] Step 1: Compound D055-a (10 g, 27.83 mmol) was dissolved in anhydrous dichloromethane (100 mL), and 1,8-diazabispyrocyclo[5.4.0]undec-7-ene (8.48 g, 55.66 mmol) was added. The reaction system was purged with nitrogen three times and stirred at room temperature for 10 minutes. Simultaneously, compound D055-b (9.81 g, 55.66 mmol) was dissolved in anhydrous dichloromethane and added dropwise to the above reaction solution. The mixture was stirred overnight at room temperature. After the reaction was complete, the reaction solution was diluted with dichloromethane, washed twice with 1M HCl aqueous solution, and three times with saturated sodium bicarbonate aqueous solution. The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-20% ethyl acetate / petroleum ether) to give compound D055-c (7.5 g). LCMS(ESI) m / z: 382.2 [M+H] + . 1 H NMR(400MHz,DMSO_d6)δ8.61(s,1H),7.40-7.27(m,12H),5.04(s,2H),4.42(s,2H),4.15-4.1 2(m,1H),3.62(s,3H),3.27(s,1H),3.04-2.96(m,1H),2.91-2.87(m,1H),2.68-2.64(m,1H).

[0466] Step 2: Dissolve D055-c (7.5 g, 19.66 mmol) in anhydrous methanol (80 mL), add di-tert-butyl dicarbonate (5.2 g, 23.6 mmol) and wet palladium on carbon (1.9 g), purge the reaction system three times with hydrogen, and stir overnight at room temperature. The reaction solution (D055-d) is then used directly for the next step. LCMS (ESI) m / z: 250.2 [M+H-100] + .

[0467] Step 3: 1.9 g of wet palladium on carbon was added to the reaction solution obtained from D055-c, followed by 10 drops of glacial acetic acid. The reaction system was purged with hydrogen three times and stirred overnight at room temperature. After the reaction was complete, the palladium on carbon was removed by filtration, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-50% ethyl acetate / petroleum ether) to give compound D055-e (2.2 g). LCMS (ESI) m / z: 204.2 [M+H-56] + . 1H NMR(400MHz,DMSO-d6)δ7.17(d,J=7.6Hz,1H),4.97(s,1H),3.87-3.83(m,1H),3.62 -3.60(m,4H),2.26-2.15(m,2H),2.08-2.00(m,1H),1.95-1.87(m,2H),1.38(s,9H).

[0468] Step 4: Dissolve D055-e (2.2 g, 8.48 mmol) in anhydrous dichloromethane. Add Desmartin reagent (4.3 g, 10.18 mmol) at 0 °C. Purge the reaction system three times with nitrogen and stir at room temperature for 2 hours. After the reaction is complete, add saturated sodium thiosulfate aqueous solution, stir at room temperature for half an hour, and extract. Wash the organic phase twice with saturated sodium bicarbonate aqueous solution, dry with anhydrous sodium sulfate, filter, and concentrate the filtrate under reduced pressure. Purify the residue by silica gel column chromatography (0-25% ethyl acetate / petroleum ether) to give compound D055-f (1.7 g). LCMS (ESI) m / z: 158.2 [M+H-100] + . 1 H NMR (400MHz, DMSO-d6) δ7.50(d,J=8.0Hz,1H),4.20(t,J=8.4Hz,1H),3.63(s,3H),3.08-2.88(m,4H),2.75-2.66(m,1H),1.39(s,9H).

[0469] Step 5: Dissolve D055-f (1.5 g, 5.83 mmol) and compound D055-g (1.35 g, 7 mmol) in anhydrous N,N-dimethylformamide. Purge the reaction system three times with nitrogen. Lower the reaction temperature to -60°C. Slowly add a solution of potassium tert-butoxide (1.2 g, 10.49 mmol) in N,N-dimethylformamide to the reaction solution. After the addition is complete, transfer the reaction solution to an ice-water bath and stir for 1 hour. Then add concentrated hydrochloric acid and continue stirring in an ice-water bath for 1 hour. After the reaction is complete, quench the reaction solution with water, extract with ethyl acetate, wash the organic phase with saturated brine, dry with anhydrous sodium sulfate, filter, and concentrate the filtrate under reduced pressure. Purify the residue by silica gel column chromatography (0-5% ethyl acetate / petroleum ether) to give compound D055-h (900 mg). LCMS (ESI) m / z: 236.2 [M+H-56] + . 1H NMR (400MHz, DMSO-d6) δ7.37(d,J=8.0Hz,1H),4.05(t,J=8.0Hz,1H),3.62(s,3H),2.73-2.66(m,4H),2.55-2.54(m,1H),1.39(s,9H).

[0470] Step 6: Dissolve D055-h (900 mg, 3.09 mmol) in anhydrous tetrahydrofuran (9 mL) in a three-necked flask. Purge the reaction system three times with nitrogen. Add lithium chloride (393 mg, 9.27 mmol) and sodium borohydride (351 mg, 3.09 mmol) to the reaction solution, followed by anhydrous ethanol. After the reaction is complete, dilute the reaction solution with water, adjust the pH to 4–5 with 2 M dilute hydrochloric acid, and extract with ethyl acetate. Wash the organic phase with saturated brine, dry with anhydrous sodium sulfate, filter, and concentrate the filtrate under reduced pressure to obtain compound D055-i (750 mg). LCMS (ESI) m / z: 208.2 [M+H-56] + . 1 H NMR(400MHz,DMSO-d6)δ6.61(d,J=9.6Hz,1H),4.56(s,1H),3.51-3.46(m,1H),3.32(s, 1H),3.27(m,2H),2.66-2.62(m,1H),2.60-2.53(m,2H),2.46-2.40(m,1H),1.39(s,9H).

[0471] Step 7: Dissolve D055-i (750 mg, 2.85 mmol) in anhydrous dichloromethane. Add Desmartin reagent (1448 mg, 3.42 mmol) at 0 °C. After purging the reaction system with nitrogen three times, stir at room temperature for 1 hour. After the reaction is complete, add saturated sodium thiosulfate aqueous solution, stir at room temperature for half an hour, and extract. Wash the organic phase twice with saturated sodium bicarbonate aqueous solution, dry with anhydrous sodium sulfate, filter, and concentrate the filtrate under reduced pressure. Purify the residue by silica gel column chromatography (0-20% ethyl acetate / petroleum ether) to give compound D055-j (330 mg). 1 H NMR (400MHz, DMSO-d6) δ9.42(s,1H),7.47(d,J=7.6Hz,1H),3.99(t,J=7.6Hz,1H),2.75-2.66(m,4H),2.59-2.54(m,1H),1.40(s,9H).

[0472] Step 8: Dissolve sodium hydride (23 mg, 0.57 mmol) in anhydrous tetrahydrofuran. Cool the reaction solution to 0°C and, under nitrogen protection, slowly add a tetrahydrofuran solution of D055-k (88 mg, 0.38 mmol). After the addition is complete, stir at 0°C for 20 minutes. Then, slowly add a tetrahydrofuran solution of D055-j (100 mg, 0.38 mmol), and continue stirring at 0°C for 5 minutes. After the reaction is complete, quench the reaction with saturated ammonium chloride and extract three times with ethyl acetate. Combine the organic phases, dry with anhydrous sodium sulfate, filter, and concentrate the filtrate under reduced pressure to obtain the crude compound D055-l (110 mg). LCMS (ESI) m / z: 355.1 [M+18] + .

[0473] Step 9: Dissolve crude D055-l (110 mg, 0.33 mmol) in anhydrous dichloromethane (1 mL), add trifluoroacetic acid (0.2 mL) under ice-water bath conditions, and stir at room temperature for 1 hour. After the reaction is complete, concentrate under reduced pressure to obtain crude compound D055-m (110 mg). LCMS (ESI) m / z: 238.0 [M+H] + .

[0474] Step 10: Crude product D055-m (110 mg, 0.33 mmol) was dissolved in anhydrous N,N-dimethylformamide (1 mL), and compound int-3 (67 mg, 0.22 mmol), N,N,N',N'-tetramethylchloroformamidin hexafluorophosphate (123 mg, 0.44 mmol), and N-methylimidazole (108 mg, 1.32 mmol) were added. The reaction system was purged with nitrogen three times and stirred at room temperature for 1 hour. After the reaction was completed, the reaction solution was filtered, and the filtrate was subjected to high-performance liquid chromatography (HPLC) (ammonium bicarbonate) to obtain the target product C055 (25.46 mg). LCMS (ESI) m / z: 526.3 [M+H] + .

[0475] Example 18

[0476] Synthesis route:

[0477] Step 1: Compound D017-1a (2 g, 24.38 mmol) and diethyl ethoxymethylene malonate (5.27 g, 24.38 mmol) were added sequentially to a 100 mL single-necked flask. After purging with nitrogen three times, the reaction solution was placed in an oil bath at 125 °C and reacted for 2 hours. After 2 hours, the reaction solution was cooled to room temperature, and diphenyl ether (60 mL) was added. The reaction solution was heated to 260 °C and reacted at 260 °C for 2 hours. The reaction solution was purified by silica gel column chromatography, eluting with petroleum ether / ethyl acetate (0%-10%) to obtain compound D017-1b (3 g). LCMS (ESI) m / z: 207.2 [M+H] + .

[0478] Step 2: Compound D017-1b (3 g, 14.56 mmol) was dissolved in acetonitrile (50 mL), and TEBAC (13.2 g, 58.25 mmol) and POCl3 (8.9 g, 58.25 mmol) were added sequentially. The mixture was stirred at 80 °C for 16 hours. The reaction solution was cooled to room temperature, concentrated under reduced pressure, and saturated sodium bicarbonate was slowly added. The mixture was extracted with dichloromethane and water, and the organic phase was washed twice with saturated brine. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, and eluted with petroleum ether / ethyl acetate (0%–25%) to give compound D017-1c (2.5 g). LCMS (ESI) m / z: 225.2 [M+H] + .

[0479] Step 3: Compound D017-1c (1 g, 4.46 mmol) was dissolved in DMF (10 mL), and phenol (504 mg, 5.36 mmol) and cesium carbonate (3.6 g, 11.15 mmol) were added. The mixture was stirred at 60 °C for 2 hours. The reaction solution was cooled to room temperature, diluted with ethyl acetate, and the organic phase was washed three times with water, followed by two washes with saturated brine. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with petroleum ether / ethyl acetate (0%-25%) to give compound D017-1d (800 mg). LCMS (ESI) m / z: 283.2 [M+H] + .

[0480] Step 4: Compound D017-1d (800 mg, 2.84 mmol) was dissolved in tetrahydrofuran (10 mL) and water (2 mL), then lithium hydroxide monohydrate (1.2 g, 28.40 mmol) was added, and the mixture was stirred at room temperature for 16 hours. The target product was detected by LCMS. After the reaction was complete, the pH was adjusted to acidic with 4 M hydrochloric acid aqueous solution, and the product precipitated. The mixture was filtered to obtain crude compound D017-1e (500 mg). LCMS (ESI) m / z: 255.1 [M+H] + .

[0481] Step 5: To a single-necked flask containing compound D017-1e (100 mg, 0.39 mmol), compounds INT-1 (163.1 mg, 0.47 mmol), TCFH (164 mg, 0.59 mmol), NMI (98 mg, 1.17 mmol), and ultra-dry solvent N,N-dimethylformamide (2.0 mL) were added sequentially. After purging with nitrogen three times, the mixture was stirred at room temperature for 2 hours. After the reaction was complete, the reaction solution was purified by high-performance liquid chromatography (HPLC) to obtain compound D017 (29.74 mg). LCMS (ESI) m / z: 412.2 [M+H] + .

[0482] Example 19

[0483] Synthesis route:

[0484] Step 1: Compound D007-1a (500 mg, 2.37 mmol), phenol (1.17 g, 12.4 mmol), and cesium carbonate (2.42 g, 7.44 mmol) were dissolved in ultradry N,N-dimethylformamide (5.0 mL) and stirred in a 90°C oil bath for 6 hours, then heated to 100°C and stirred for 16.5 hours. After the reaction was complete, water was added to the reaction system, and the mixture was extracted with ethyl acetate. The organic phases were combined, washed successively with water and saturated brine, dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure to remove the solvent, and the residue was adsorbed onto silica gel and purified by silica gel column chromatography (0–60% ethyl acetate / petroleum ether, followed by 0–20% methanol / dichloromethane) to give compound D040-1a (422 mg). LCMS (ESI) m / z: 269.2 [M+H] +

[0485] Step 2: Compound D040-1a (300 mg, 1.18 mmol) was dissolved in N,N-dimethylformamide (3.0 ml). Sodium hydroxide (67.1 mg, 1.68 mmol) was added at room temperature, and the mixture was stirred for 20 minutes at room temperature. Then, 2-iodopropane (804 mg, 4.73 mmol) was added, and the reaction apparatus was stirred at room temperature for 2.5 hours. After the reaction was completed, water was added to quench the reaction, and then the pH was adjusted to 1 using hydrochloric acid (1 M). The solvent was removed by concentration under reduced pressure to obtain compound D040-1b (1.18 g). LCMS (ESI) m / z: 311.1 [M+H] +

[0486] Step 3: Compound D040-1b (1.18 g, 3.8 mmol) and potassium hydroxide (600 mg, 10.69 mmol) were dissolved in tetrahydrofuran (4 ml), methanol (2.0 ml), and water (2.0 ml). The mixture was stirred at room temperature for 18 hours. After the reaction was complete, the pH was adjusted to 1, and the solvent was removed by concentration under reduced pressure. The residue was adsorbed onto silica gel and purified by silica gel column chromatography (dichloromethane:methanol = 99:1) to give compound D040-1c (140 mg). LCMS (ESI) m / z: 297.2 [M+H] +

[0487] Step 4: Compound D040-1c (60 mg, 0.20 mmol), INT-1 (98 mg, 0.24 mmol), NMI (136 mg, 1.62 mmol), and TCFH (85.2 mg, 0.30 mmol) were dissolved in ultra-dry N,N-dimethylformamide (1.5 mL). The mixture was then stirred at room temperature for 60 minutes. After the reaction was complete, the reaction solution was preparatively separated by high-performance liquid chromatography (ammonia-alkali method) to obtain compound D040 (31.87 mg). LCMS (ESI) m / z: 454.3 [M+H] + .

[0488] Example 20

[0489] Synthesis route:

[0490] Step 1: Compound D007-1b (200 mg, 0.75 mmol) was dissolved in N,N-dimethylformamide (2.0 mL). Sodium hydroxide (44 mg, 1.13 mmol) was added at room temperature, and the mixture was stirred for 20 minutes at room temperature. Iodoethane (466 mg, 3 mmol) was then added, and the reaction mixture was stirred at room temperature for 16 hours. After the reaction was complete, water was added to quench the reaction, and the mixture was extracted with ethyl acetate. The organic phases were combined. The organic phases were washed twice with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0–30% ethyl acetate / petroleum ether) to give compound D043-1a (45 mg). LCMS (ESI) m / z: 297.1 [M+H] + .

[0491] Step 2: Compound D043-1a (45 mg, 0.15 mmol) was dissolved in THF (1 mL), and LiOH (64 mg, 1.6 mmol), methanol (0.1 mL), and H2O (0.1 mL) were added. The reaction mixture was stirred at room temperature for 16 h. After the reaction was complete, the pH was adjusted to 4 with hydrochloric acid (2.0 M), and the mixture was extracted three times with ethyl acetate (2 mL). The organic phases were combined. The organic phase was dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain crude compound D043-1b (40 mg). LCMS (ESI) m / z: 283.1 [M+H] + .

[0492] Step 3: Compound D043-1b (24 mg, 0.08 mmol) was dissolved in DMF (1.0 mL), followed by the addition of compound INT-1 (55 mg, 0.1 mmol), TCFH (48 mg, 0.16 mmol), and NMI (42 mg, 0.48 mmol). The reaction mixture was stirred at room temperature for 1 h. After the reaction was complete, the reaction mixture was filtered through a membrane filter, and the filtrate was purified by high-performance liquid chromatography (HPLC) to obtain compound D043 (10.95 mg). LCMS (ESI) m / z: 440.3 [M+H] + .

[0493] Example 21

[0494] Synthesis route:

[0495] Step 1: Add NaH (140 mg, 3.5 mmol) to THF (10 mL), purge with nitrogen three times, cool to 0 °C, add compound D047-1b (806 mg, 3.5 mmol), and stir at 0 °C for 20 min. Finally, add compound D047-1a (500 mg, 2.92 mmol). Stir the reaction mixture at room temperature for 16 h. After the reaction is complete, quench the reaction with saturated ammonium chloride aqueous solution, extract with ethyl acetate, combine the organic phases, dry the organic phase with anhydrous sodium sulfate, filter, and concentrate the filtrate under reduced pressure to obtain crude compound D047-1c (500 mg). 1 H NMR (400MHz, CDCl3) δ6.29 (s, 1H), 4.91 (d, J = 2.8Hz, 2H), 4.65 (s, 2H), 2.97 (s, 3H), 1.46 (s, 9H).

[0496] Step 2: Compound D047-1c (500 mg, 2.02 mmol) was dissolved in DCM (5 mL), and TFA (0.5 mL) was added. The mixture was stirred at room temperature for 1 h. After the reaction was complete, the reaction solution was concentrated under reduced pressure to obtain crude compound D047-1d (1.5 g). LCMS (ESI) m / z: 148.2 [M+H] + .

[0497] Step 3: Compound D047-1d (200 mg, 0.71 mmol) was dissolved in THF (2 mL), and LiOH (297 mg, 7.1 mmol), methanol (0.1 mL), and H2O (0.1 mL) were added. The reaction mixture was stirred at room temperature for 3 h. After the reaction was complete, the pH was adjusted to 4 with hydrochloric acid, and the mixture was extracted twice with ethyl acetate. The organic phases were combined. The organic phase was dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain crude compound D047-1e (160 mg). LCMS (ESI) m / z: 255.0 [M+H] + .

[0498] Step 4: Dissolve compound D047-1e (50 mg, 0.2 mmol) in DMF (1.0 mL), then add compound D007-1b (35 mg, 0.24 mmol), TCFH (110 mg, 0.4 mmol), and NMI (97 mg, 1.2 mmol). Stir the reaction mixture at room temperature for 1 h. After the reaction is complete, filter the solution through a membrane filter. Purify the filtrate using high-performance liquid chromatography (HPLC) to obtain compound D047 (32.08 mg). LCMS (ESI) m / z: 384.1 [M+H] + .

[0499] Example 22

[0500] Synthesis route:

[0501] Compound D061-1b (50 mg, 0.19 mmol) was dissolved in ultradry N'N-dimethylformamide (1 mL), and compound D047-1d (55 mg, 0.22 mmol), N,N,N',N'-tetramethylchloroformamidine hexafluorophosphate (78 mg, 0.28 mmol), and N-methylimidazole (92 mg, 1.12 mmol) were added. The reaction system was purged with nitrogen three times and stirred at room temperature for 1 hour. After the reaction was complete, the reaction solution was diluted with dichloromethane, washed three times with water, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude compound was then subjected to high performance liquid chromatography (FA) to obtain the target product D048 (17.32 mg). LCMS (ESI) m / z: 398.2 [M+H] + .

[0502] Example 23

[0503] Synthesis route:

[0504] Synthesis of compound D049

[0505] Compound D057-1e (50 mg, 0.17 mmol) was dissolved in ultra-dry N'N-dimethylformamide (1 mL), and compound D047-1d (50 mg, 0.20 mmol), N,N,N',N'-tetramethylchloroformamidin hexafluorophosphate (71 mg, 0.25 mmol), and N-methylimidazole (83 mg, 1.01 mmol) were added. The reaction system was purged with nitrogen three times and stirred at room temperature for 1 hour. After the reaction was completed, the reaction solution was filtered and subjected to high-performance liquid chromatography (FA) to obtain the target product D049 (18.85 mg). LCMS (ESI) m / z: 426.2 [M+H] + .

[0506] Example 24

[0507] Synthesis route:

[0508] Step 1: Compound D007-1b (233 mg, 0.87 mmol), ethyl difluorobromoacetate (881.5 mg, 4.34 mmol), and potassium tert-butoxide (292.4 mg, 2.61 mmol) were dissolved in ultradry acetonitrile (9.0 mL), and the mixture was stirred at 80 °C for 5.5 hours. After the reaction was complete, the products from the same batch (15 mg, 0.056 mmol) were combined and purified using silica gel ablation (petroleum ether:ethyl acetate = 3:1) to give compound D044-1a (41 mg). LCMS (ESI) m / z: 319.2 [M+H] + .

[0509] Step 2: Compound D044-1a (41 mg, 0.13 mmol) and potassium carbonate (89 mg, 0.64 mmol) were dissolved in tetrahydrofuran (2 mL), methanol (2 mL), and water (2 mL). The mixture was stirred at room temperature for 2 hours. Potassium carbonate (173 mg, 1.25 mmol) was added, and the mixture was stirred at room temperature for another 3.5 hours. Potassium carbonate (240 mg, 1.74 mmol) was added, and the mixture was stirred at room temperature for another 4 hours. After the reaction was complete, the pH of the solution was adjusted to 6–7 with hydrochloric acid (1 M in H₂O). The solvent was removed using a lyophilizer to obtain crude compound D044-1b (600 mg). LCMS (ESI) m / z: 305.1 [M+H] + .

[0510] Step 3: Compound D044-1b (600 mg, 0.077 mmol), INT-1 (50.2 mg, 0.093 mmol), NMI (52.1 mg, 0.62 mmol), and TCFH (32.6 mg, 0.12 mmol) were dissolved in ultra-dry N,N-dimethylformamide (3.0 mL). The mixture was then stirred at room temperature for 1 hour. After the reaction was complete, the mixture was filtered, and the filtrate was preparatively separated by high-performance liquid chromatography (formic acid method) to obtain compound D044 (8.06 mg). LCMS (ESI) m / z: 462.3 [M+H] + .

[0511] Example 25

[0512] Synthesis route:

[0513] Step 1: Compound 5d (1 g, 4.46 mmol) and dichloromethane (10 mL) were added sequentially to a 100 mL three-necked flask. After purging with nitrogen three times, the reaction solution was placed in dry ice and ethanol at -20 °C. NBS (793.88 mg, 4.46 mmol) was dissolved in acetonitrile (5 mL), and the solution was added dropwise to the reaction solution. The reaction was carried out at -20 °C for 1 hour. The reaction solution was brought to room temperature, diluted with ethyl acetate, and the organic phase was washed three times with water and then twice with saturated brine. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0%-25% ethyl acetate / petroleum ether) to give compound D057-1a (800 mg). LCMS (ESI) m / z: 303.0 [M+H] + .

[0514] Step 2: Compound D057-1a (800 mg, 2.65 mmol) was dissolved in N,N-dimethylformamide (10 mL), and phenol (274 mg, 2.92 mmol) and cesium carbonate (2.15 g, 6.63 mmol) were added. The mixture was stirred at 60 °C for 2 hours. The reaction solution was cooled to room temperature, diluted with ethyl acetate, and the organic phase was washed three times with water, followed by two washes with saturated brine. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0%-25% ethyl acetate / petroleum ether) to give compound D057-1b (600 mg). LCMS (ESI) m / z: 361.1 [M+H] + .

[0515] Step 3: Compound D057-1b (200 mg, 0.56 mmol) was dissolved in 1,4-dioxane (10 mL) and water (2 mL). Pinaryl isopropenylborate (141.1 mg, 0.84 mmol), RuPhos-Pd-G3 (46.8 mg, 0.056 mmol), and potassium carbonate (193.2 mg, 1.4 mmol) were added. The mixture was stirred in an oil bath at 60 °C for 2 hours under nitrogen protection. The reaction solution was cooled to room temperature, diluted with ethyl acetate (50 mL), and the organic phase was washed three times with water, followed by two washes with saturated brine. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0%-25% ethyl acetate / petroleum ether) to give compound D057-1c (120 mg). LCMS (ESI) m / z: 323.1 [M+H] + .

[0516] Step 4: Compound D057-1c (120 mg, 0.37 mmol) was dissolved in ethyl acetate (10 mL), then palladium on carbon (10%, 12 mg) was added. After three hydrogen purgings, the mixture was stirred at room temperature (15 psi) for 2 hours. The target product was detected by LCMS. After the reaction was complete, the reaction solution was filtered, and the filtrate was concentrated under reduced pressure to obtain compound D057-1d (90 mg). LCMS (ESI) m / z: 325.1 [M+H] + .

[0517] Step 5: Compound D057-1d (90 mg, 0.28 mmol) was dissolved in tetrahydrofuran (10 mL), water (2 mL), and methanol (2 mL). Lithium hydroxide (117.6 mg, 2.8 mmol) was then added, and the mixture was stirred at room temperature for 2 hours. The target product was detected by LCMS. After the reaction was complete, the pH was adjusted to acidic with 4 M hydrochloric acid solution, causing the product to precipitate. The mixture was filtered to obtain crude compound D057-1e (70 mg). LCMS (ESI) m / z: 297.3 [M+H] + .

[0518] Step 6: To a single-necked flask containing compound D057-1e (70 mg, 0.24 mmol), compounds INT-1 (100.7 mg, 0.29 mmol), TCFH (100.8 mg, 0.36 mmol), NMI (118.08 mg, 1.44 mmol), and the ultra-dry solvent N,N-dimethylformamide (2.0 mL) were added sequentially. After purging with nitrogen three times, the mixture was stirred at room temperature for 2 hours. After the reaction was complete, the reaction solution was purified by high-performance liquid chromatography (HPLC) to obtain compound D057 (7.26 mg, two-step yield: 5.8%). LCMS (ESI) m / z: 454.3 [M+H] + .

[0519] Example 26

[0520] Synthesis route:

[0521] Step 1: Compound D057-1a (200 mg, 0.56 mmol) was dissolved in 1,4-dioxane (10 mL) and water (2 mL). Methylboric acid (168 mg, 2.8 mmol), Pd2(pph3)4 (64.7 mg, 0.056 mmol), and potassium carbonate (193.2 mg, 1.4 mmol) were added. The mixture was stirred in an oil bath at 80 °C for 2 hours under nitrogen protection. The reaction solution was cooled to room temperature, diluted with ethyl acetate, and the organic phase was washed three times with water, followed by two washes with saturated brine. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0%-25% ethyl acetate / petroleum ether) to give compound D061-1a (100 mg). LCMS (ESI) m / z: 297.1 [M+H] + .

[0522] Step 2: Compound D061-1a (100 mg, 0.34 mmol) was dissolved in tetrahydrofuran (10 mL), water (2 mL), and methanol (2 mL). Lithium hydroxide (142.8 mg, 3.4 mmol) was then added, and the mixture was stirred at room temperature for 2 hours. The target product was detected by LCMS. After the reaction was complete, the pH was adjusted to acidic with 4 M hydrochloric acid solution, causing the product to precipitate. The mixture was filtered to obtain crude compound D061-1b (80 mg). LCMS (ESI) m / z: 269.1 [M+H] + .

[0523] Step 3: To a single-necked flask containing compound D061-1b (80 mg, 0.30 mmol), compounds INT-1 (125 mg, 0.36 mmol), TCFH (126 mg, 0.45 mmol), NMI (147.6 mg, 1.8 mmol), and the ultra-dry solvent N,N-dimethylformamide (2.0 mL) were added sequentially. After purging with nitrogen three times, the mixture was stirred at room temperature for 2 hours. After the reaction was complete, the reaction solution was purified by high-performance liquid chromatography (HPLC) to obtain compound D061 (21.55 mg). LCMS (ESI) m / z: 426.3 [M+H] + .

[0524] Example 27

[0525] Synthesis route:

[0526] Step 1: Compound D063-1a (3.0 g, 13.64 mmol) was dissolved in methanol (30 mL), and concentrated sulfuric acid (10 mL) was added. The mixture was stirred at 70 °C for 1 h. After the reaction was complete, the mixture was diluted with water, extracted with ethyl acetate, the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-18% ethyl acetate / petroleum ether) to give compound D063-1b (2.4 g). 1 H NMR (400MHz, CDCl3) δ8.32 (d, J = 4.8Hz, 1H), 7.72 (t, J = 4.8Hz, 1H), 3.99 (s, 3H).

[0527] Step 2: Compound D063-1b (1 g, 4.27 mmol) was dissolved in THF (15 mL), and compound 1-trimethylsilyl-1-butyne (0.81 g, 6.41 mmol), Pd(PPh3)Cl2 (0.6 g, 0.85 mmol), CuI (0.16 g, 0.85 mmol), and TEA (2.16 g, 21.35 mmol) were added. After purging with nitrogen three times, TBAF (5.2 mL, 5.2 mmol) was added. The mixture was stirred at 30 °C for 16 h. After the reaction was complete, the mixture was filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-15% ethyl acetate / petroleum ether) to give compound D063-1c (680 mg). 1 H NMR (400MHz, CDCl3) δ8.44 (d, J = 4.8Hz, 1H), 7.65 (t, J = 5.2Hz, 1H), 3.98 (s, 3H), 2.56-2.50 (m, 2H), 1.29 (t, J = 7.6Hz, 3H).

[0528] Step 3: Synthesis of compound D063-1d

[0529] Compound D063-1c (680 mg, 3.28 mmol) was dissolved in DMA (7 mL), and CuCl (487 mg, 4.92 mmol) and TEA (995 mg, 9.85 mmol) were added. The mixture was stirred at 130 °C for 16 h. After the reaction was complete, the mixture was diluted with water, extracted with ethyl acetate, and the organic phases were combined. The organic phases were washed three times with saturated brine and dried over anhydrous sodium sulfate. The mixture was filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-5% ethyl acetate / petroleum ether) to give compound D063-1d (340 mg). 1H NMR (400MHz, CD3OD) δ7.70 (d, J = 7.2 Hz, 1H), 6.96 (t, J = 7.2 Hz, 1H), 6.83 (d, J = 4.0 Hz, 1H), 6.66 (d, J = 4.0 Hz, 1H), 3.89 (s, 3H), 2.49 (s, 3H).

[0530] Step 4: Compound D063-1d (340 mg, 1.64 mmol) was dissolved in DMF (4 mL), and phenol (185 mg, 1.97 mmol) and cesium carbonate (1.07 g, 3.28 mmol) were added. The reaction mixture was stirred at 80 °C for 1 h. After the reaction was complete, the mixture was diluted with water and extracted with ethyl acetate. The organic phases were combined. The organic phase was washed three times with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-18% ethyl acetate / petroleum ether) to give compound D063-1e (300 mg). LCMS (ESI) m / z: 282.2 [M+H] + .

[0531] Step 5: Compound D063-1e (40 mg, 0.14 mmol) was dissolved in THF (1 mL), and LiOH (60 mg, 1.4 mmol), H2O (0.1 mL), and methanol (0.1 mL) were added. The reaction mixture was stirred at room temperature for 16 h. After the reaction was complete, the pH was adjusted to 4 with hydrochloric acid (2.0 M), and the mixture was extracted twice with ethyl acetate. The organic phases were combined. The organic phase was dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain crude compound D063-1f (38 mg). LCMS (ESI) m / z: 268.1 [M+H] + .

[0532] Step 6: Dissolve compound D063-1f (38 mg, 0.14 mmol) in DMF (1.0 mL), then add INTC (64 mg, 0.17 mmol), TCFH (80 mg, 0.28 mmol), and NMI (70 mg, 0.84 mmol). Stir the reaction mixture at room temperature for 1 h. After the reaction is complete, filter the solution through a membrane filter. The filtrate is purified by high performance liquid chromatography to obtain compound D063 (25.94 mg).

[0533] Example 28

[0534] Synthesis route:

[0535] Step 1: Compound D057-1b (150 mg, 0.416 mmol) was dissolved in dioxane (2 mL) and water (0.4 mL). Cyclopropylboronic acid (54 mg, 0.625 mmol), Pd(PPh3)4 (21 mg, 0.0416 mmol), and potassium carbonate (114 mg, 0.832 mmol) were added sequentially. The reaction system was purged with nitrogen three times, heated to 60 °C, and stirred at 60 °C for 2 hours. After the reaction was complete, the reaction solution was diluted with water, extracted three times with ethyl acetate, the organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-50% ethyl acetate / petroleum ether) to give compound D067-1a (90 mg). LCMS (ESI) m / z: 323.1 [M+H] + .

[0536] Step 2: Compound D067-1a (90 mg, 0.279 mmol) was dissolved in tetrahydrofuran (2 mL), followed by the addition of methanol (0.1 mL) and LiOH (2 M) (0.1 mL). The mixture was stirred at room temperature for 1 hour. After the reaction was complete, 1 M HCl was added to adjust the pH to 4-5, and then water was added and freeze-dried to obtain the crude product compound D067-1b (65 mg). LCMS (ESI) m / z: 295.1 [M+H] + .

[0537] Step 3: Synthesis of compound D067

[0538] Compound D067-1b (65 mg, 0.221 mmol), compound INT-1 (120 mg, 0.265 mmol), N-methylimidazole (108 mg, 1.326 mmol), and tetramethylchlorourea hexafluorophosphonate (123 mg, 0.442 mmol) were dissolved in N,N-dimethylformamide (1.0 mL). The reaction was carried out under nitrogen protection at room temperature for 1 hour. After the reaction was complete, the mixture was filtered, and the filtrate was purified by high-performance liquid chromatography (HPLC) to obtain the target product D067 (12.64 mg). LCMS (ESI) m / z: 452.1 [M+H] + .

[0539] Example 29

[0540] Synthesis route:

[0541] Compound D061-1b (50 mg, 0.19 mmol) was dissolved in ultradry N'N-dimethylformamide (1 mL), and compound INT-6 (72 mg, 0.22 mmol), N,N,N',N'-tetramethylchloroformamidine hexafluorophosphate (78 mg, 0.28 mmol), and N-methylimidazole (92 mg, 1.12 mmol) were added. The reaction system was purged with nitrogen three times and stirred at room temperature for 1 hour. After the reaction was complete, the reaction solution was diluted with dichloromethane, washed three times with water, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude compound was then subjected to high performance liquid chromatography (FA) to obtain the target product D068 (9.82 mg). LCMS (ESI) m / z: 400.2 [M+H] + .

[0542] Example 30

[0543] Synthesis route:

[0544] Compound D061-1b (50 mg, 0.19 mmol) was dissolved in ultradry N'N-dimethylformamide (1 mL), and compound INT-7 (89 mg, 0.22 mmol), N,N,N',N'-tetramethylchloroformamidine hexafluorophosphate (78 mg, 0.28 mmol), and N-methylimidazole (92 mg, 1.12 mmol) were added. The reaction system was purged with nitrogen three times and stirred at room temperature for 1 hour. After the reaction was complete, the reaction solution was diluted with dichloromethane, washed three times with water, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude compound was then subjected to high performance liquid chromatography (FA) to obtain the target product D069 (12.75 mg). LCMS (ESI) m / z: 400.2 [M+H] + .

[0545] Example 31

[0546] Synthesis route:

[0547] The crude compound D070-1a (100 mg, 0.35 mmol) was dissolved in anhydrous N,N-dimethylformamide (2 mL), and compound INT-1 (145 mg, 0.42 mmol), N,N,N',N'-tetramethylchloroformamidin hexafluorophosphate (146 mg, 0.52 mmol), and N-methylimidazole (171 mg, 2.08 mmol) were added. The reaction system was purged with nitrogen three times and stirred at room temperature for 1 hour. After the reaction was completed, the reaction solution was filtered, and the filtrate was subjected to high-performance liquid chromatography (HPLC) to obtain the target product D070 (19.56 mg). LCMS (ESI) m / z: 446.2 [M+H] + .

[0548] Example 32

[0549] Synthesis route:

[0550] Step 1: Compound D014-1b (2.0 g, 13.41 mmol) was dissolved in ultra-dry tetrahydrofuran (20 ml), purged with nitrogen three times, and then LDA (24.4 ml, 26.81 mmol) was added at -63 °C. The mixture was then stirred at -60 °C for 0.5 h. At the same temperature, diethyl carbonate (6.3 g, 53.62 mmol) (dissolved in ultra-dry tetrahydrofuran (6 ml)) was added, and the mixture was stirred at -60 °C for 1.5 h. Diethyl carbonate (5.8 g, 49.1 mmol) was then added, and the mixture was stirred at -60 °C for 2.5 h. After the reaction was completed, the reaction was quenched with saturated ammonium chloride solution. The reaction solution was extracted with ethyl acetate (80 ml x 3). The organic phases were combined and washed with saturated brine. The resulting organic phase was dried with anhydrous sodium sulfate, filtered, concentrated under reduced pressure to remove the solvent, and the residue was adsorbed onto silica gel and purified by silica gel column chromatography (petroleum ether:ethyl acetate = 80:20 to 58:42) to obtain a mixture of crude products D014-1b and D071-1a (1.66 g).

[0551] The mixture obtained from the initial reaction was used as reactants for a second reaction to completely convert compound D014-1b. The specific procedure was as follows: Compound D014-1b (1.73 g, 11.6 mmol) and diethyl carbonate (3.4 g, 28.99 mmol) were dissolved in ultra-dry tetrahydrofuran (17 ml). After purging with nitrogen three times, LDA (21.1 ml, 23.2 mmol) was added at -63 °C, and the mixture was stirred at -60 °C for 2.5 hours. After the reaction was complete, the reaction was quenched with saturated ammonium chloride solution. The reaction solution was extracted with ethyl acetate, and the combined organic phases were washed with saturated brine. The resulting organic phase was dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure to remove the solvent, and the residue was adsorbed onto silica gel and purified by silica gel column chromatography (petroleum ether:ethyl acetate = 75:50 to 58:42) to obtain compound D071-1a (4.74 g). 1 H NMR (400MHz, CDCl3) δ8.33(d,J=5.6Hz,1H),6.64(d,J=5.6Hz,1H),4.25–4.20(m,2H),4.09(dd,J=8.4,6 .4Hz,1H),3.87(s,3H),3.09–3.00(m,1H),2.91–2.81(m,1H),2.45–2.36(m,2H),1.28(t,J=6.8Hz,3H).

[0552] Step 2: Dissolve compound D071-1a (2.0 g, 9.04 mmol) in ultra-dry tetrahydrofuran (20 ml), purge with nitrogen three times, then add LDA (16.43 ml, 18.08 mmol) at -63 °C and stir at -60 °C for 50 minutes. Then add iodomethane (7.7 g, 54.23 mmol) (dissolved in ultra-dry tetrahydrofuran) at this temperature, stir at -60 °C for 100 minutes, then add iodomethane (11.4 g, 80.3 mmol), stir at -60 °C for 130 minutes, then add iodomethane (3.88 g, 27.3 mmol), stir at -60 °C for 90 minutes, and then stop the reaction. After the reaction was completed, the reaction was quenched with saturated ammonium chloride solution, extracted with ethyl acetate, the organic phases were combined, washed with saturated brine, dried with anhydrous sodium sulfate, filtered, concentrated under reduced pressure to remove the solvent, the residue was adsorbed onto silica gel and purified by silica gel column chromatography (petroleum ether:ethyl acetate = 100:0 to 77:23) to give compound D071-1b (882 mg). 1H NMR(400MHz, CDCl3)δ8.35(d,J=6.0Hz,1H),6.64(d,J=5.6Hz,1H),4.18–4.09(m,2H),3.88(s,3 H),3.03–2.82(m,2H),2.71–2.64(m,1H),2.03–1.95(m,1H),1.58(s,3H),1.20(t,J=7.2Hz,3H).

[0553] Step 3: Compound D071-1b (878 mg, 3.73 mmol) was dissolved in ultra-dry tetrahydrofuran (8 ml). After purging with nitrogen three times, lithium aluminum hydride (3.73 ml, 9.33 mmol) was added at room temperature. After the addition was complete, the reaction system was stirred at room temperature for 2 hours. After the reaction was completed, the reaction was quenched with saturated sodium potassium tartrate solution. The resulting reaction solution was extracted with chloroform:isopropanol = 3:1. The resulting organic phase was directly dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to remove the solvent, yielding compound D071-1c (760 mg). 1 H NMR (400MHz, CDCl3) δ8.28(d,J=6.0Hz,1H),6.67(d,J=6.0Hz,1H),3.90(s,3H),3.79(d,J=10.4Hz ,1H),3.71(d,J=10.4Hz,1H),2.90–2.83(m,2H),2.10–1.98(m,1H),1.93–1.83(m,1H),1.35(s,3H)

[0554] Step 4: Compound D071-1c (754 mg, 3.9 mmol), triphenylphosphine (2.05 g, 7.80 mmol), and imidazole (531.3 mg, 7.80 mmol) were dissolved in ultra-dry toluene (8.0 mL), and elemental iodine (1.7 g, 6.63 mmol) was added at room temperature. After purging with nitrogen three times, the reaction system was stirred at 70 °C for 2 hours. After the reaction was completed, water was added to the reaction solution and extracted with ethyl acetate. The organic phase was washed with saturated sodium thiosulfate solution and saturated brine, respectively. Then, the organic phase was dried with anhydrous sodium sulfate, filtered, concentrated under reduced pressure to remove the solvent, and the residue was adsorbed onto silica gel and purified by silica gel column chromatography (petroleum ether:ethyl acetate = 100:0 to 81:19) to obtain compound D071-1d (907 mg). LCMS (ESI) m / z: 304.0 [M+H] + .

[0555] Step 5: Compound D071-1d (907 mg, 2.99 mmol), palladium on carbon (382.1 mg, 3.59 mmol), and triethylamine (1.25 ml, 8.98 mmol) were dissolved in ultradry methanol (10 ml). After purging with hydrogen three times, the mixture was stirred at 50 °C for 41 hours. After the reaction was complete, the reaction solution was filtered through diatomaceous earth. The filter cake was rinsed with chloroform:isopropanol = 3:1 (250 ml), concentrated under reduced pressure to remove the solvent, and purified by silica gel column chromatography (petroleum ether:ethyl acetate = 100:0 to 81:19) to obtain compound D071-1e (277 mg). 1 H NMR (400MHz, CDCl3) δ8.34(d,J=6.0Hz,1H),6.61(d,J=6.0Hz,1H),3.88(s,3H),2.80(t,J=7.2Hz,2H),1.97(t,J=7.2Hz,2H),1.31(s,6H).

[0556] Step 6: Dissolve compound D071-1e (175 mg, 0.99 mmol) in concentrated sulfuric acid (2.5 ml), then add NBS (281.2 mg, 1.58 mmol) at room temperature. The reaction mixture is then stirred at 60 °C for 5 hours. The reaction solution is poured into a saturated sodium bicarbonate solution to adjust the pH to 7-8. The aqueous phase is then extracted with ethyl acetate. The combined organic phases are washed with saturated brine. The resulting organic phase is dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to remove the solvent. The residue is adsorbed onto silica gel and purified by silica gel column chromatography (petroleum ether:ethyl acetate = 100:0 to 88:12) to obtain compound D071-1f (210 mg). 1 H NMR (400MHz, CDCl3) δ8.45 (s, 1H), 4.14 (s, 3H), 3.19–3.07 (m, 2H), 2.03 (t, J = 6.8Hz, 2H), 1.37 (s, 6H).

[0557] Step 7: Compound D071-1f (200 mg, 0.78 mmol), Pd(dppf)Cl2 (228.6 mg, 0.31 mmol), and triethylamine (474.1 mg, 4.69 mmol) were dissolved in ultradry methanol (20.0 ml). After purging with carbon monoxide gas three times, the reaction was carried out in an oil bath at 70 °C with stirring for 70.5 hours. After the reaction was completed, the solvent was removed by concentration under reduced pressure. The residue was adsorbed onto silica gel and purified by silica gel column chromatography (petroleum ether:ethyl acetate = 100:0 to 89:11) to obtain compound D071-1 g (174 mg). 1H NMR (400MHz, CDCl3) δ8.74(s,1H),4.09(s,3H),3.91(s,3H),3.10(t,J=6.8Hz,2H),2.03(t,J=7.2Hz,2H),1.37(s,6H).

[0558] Step 8: Compound D071-1 g (150 mg, 0.64 mmol) was dissolved in ultradry dichloromethane (7.5 ml), and boron tribromide (1.9 ml, 1.9 mmol) was added at 0 °C. The reaction was then stirred at room temperature for 2.5 hours. After the reaction was complete, methanol was added to quench the reaction, and the mixture was stirred at room temperature for 10 minutes. The solvent was removed by concentration under reduced pressure, and the product was then purified by silica gel plate preparation (petroleum ether: ethyl acetate = 5:1) to obtain crude compound D071-1 h (231 mg). LCMS (ESI) m / z: 222.2 [M+H] + .

[0559] Step 9: Compound D071-1h (200 mg, 0.904 mmol), phosphorus oxychloride (831.5 mg, 5.42 mmol), and diisopropylethylamine (140.2 mg, 1.08 mmol) were dissolved in ultra-dry acetonitrile (8 ml) and stirred at 80 °C for 2 hours. After the reaction was complete, the reaction solution was poured into 30 ml of ice water, and sodium bicarbonate solid was added to adjust the pH of the solution to 7-8. The reaction solution was stirred at room temperature for 30 minutes. The resulting reaction solution was extracted with ethyl acetate, the organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure to remove the solvent, and then purified by silica gel plate preparation (petroleum ether:ethyl acetate = 10:1) to obtain compound D071-1i (97 mg). 1 H NMR (400MHz, CDCl3) δ8.86 (s, 1H), 3.95 (s, 3H), 2.99 (t, J = 7.2Hz, 2H), 2.06 (t, J = 7.2Hz, 2H), 1.35 (s, 6H).

[0560] Step 10: Compound D071-1i (82 mg, 0.34 mmol), phenol (64.3 mg, 0.68 mmol), and cesium carbonate (122.6 mg, 0.38 mmol) were dissolved in ultradry N,N-dimethylformamide (5 ml), and the mixture was stirred at 80 °C for 2.7 h. The reaction solution was diluted with ethyl acetate, and the organic phases were combined and washed with water and saturated brine, respectively. The resulting organic phase was dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure to remove the solvent, and then purified by silica gel plate preparation (petroleum ether:ethyl acetate = 7:1) to obtain crude compound D071-1j (89 mg). LCMS (ESI) m / z: 298.3 [M+H]+ .

[0561] Step 11: Compound D071-1j (72 mg, 0.24 mmol) and lithium hydroxide monohydrate (80.3 mg, 1.91 mmol) were dissolved in tetrahydrofuran (3.0 ml) and water (0.75 ml), and the mixture was stirred at 30 °C for 7 hours. After the reaction was complete, hydrochloric acid (1 M in H2O) was added to the reaction system to adjust the pH of the solution to 1-2, and then the solution was dehydrated using a lyophilizer to obtain crude compound D071-1k (200 mg). LCMS (ESI) m / z: 284.3 [M+H] + .

[0562] Step 12: Compound D071-1k (200 mg, 0.24 mmol), NMI (201.6 mg, 2.46 mmol), INT-1 (117 mg, 0.32 mmol), and TCFH (142 mg, 0.51 mmol) were dissolved in ultradry N,N-dimethylformamide (1.5 mL), and the mixture was stirred at 30 °C for 1.5 h. After the reaction was complete, compound D071 (61.3 mg) was preparatively separated by high performance liquid chromatography (formic acid method). LCMS (ESI) m / z: 441.4 [M+H] + .

[0563] Example 33

[0564] Synthesis route:

[0565] Step 1: Compound D057-1b (1 g, 2.77 mmol), pinacol isopropenylborate (699 mg, 4.16 mmol), potassium carbonate (1.1 g, 8.31 mmol), and Ruphos-Pd-G3 (225.7 mg, 0.27 mmol) were dissolved in 1,4-dioxane (10 ml) and water (2 ml). After purging with nitrogen three times, the reaction was carried out in an oil bath at 60 °C for 2 hours. After the reaction was completed, water was added to the mixture, and the mixture was extracted with ethyl acetate. The organic phase was washed with saturated brine and dried with anhydrous sodium sulfate. The mixture was then filtered. The organic solvent was removed by concentration under reduced pressure. The residue was adsorbed onto silica gel and purified by silica gel column chromatography (dichloromethane:methanol = 100:0 to 95:5) to obtain crude compound D073-1a (850 mg). LCMS (ESI) m / z: 323.2 [M+H] + .

[0566] Step 2: Dissolve compound D073-1a (100 mg, 0.31 mmol) in tetrahydrofuran / methanol / water (1 mL / 0.2 mL / 0.2 mL), add lithium hydroxide (74.4 mg, 3.1 mmol), and react the reaction mixture at room temperature for 2 hours. Then add 1 M hydrochloric acid solution to the reaction solution to adjust the pH to 6. Lyophilize the mixture to obtain crude product D073-1b (30 mg). LCMS (ESI) m / z: 295.0 [M+H] +

[0567] Step 3: Dissolve compound D073-1b (20 mg, 0.07 mmol), INT-C (38.0 mg, 0.08 mmol), N-methylimidazole (34.4 mg, 0.42 mmol), and tetramethylchlorourea hexafluorophosphonate (58.8 mg, 0.21 mmol) in DMF (0.5 mL). Under nitrogen protection, the reaction solution was reacted at room temperature for 2 hours. After the reaction, the mixture was filtered, and the filtrate was separated by high-performance liquid chromatography (formic acid method) to obtain a yellow solid, which was the target product D073 (5.20 mg). LCMS (ESI) m / z: 452.3 [M+H] +

[0568] Example 34

[0569] Synthesis route:

[0570] Step 1: Compound D075-1a (120 mg, 0.32 mmol) and palladium on carbon (36 mg, 0.34 mmol) were dissolved in ultradry ethyl acetate (11 ml) and ultradry methanol (11 ml). After purging with hydrogen three times, the mixture was stirred at room temperature for 4 hours. After the reaction was completed, the mixture was filtered through a syringe filter, and the solvent was removed by concentration under reduced pressure to obtain crude compound 075-1b (150 mg). 1 H NMR (400MHz, CDCl3) δ8.61(s,1H),7.37–7.29(m,2H),7.18–7.12(m,1H),7.06–7.01(m,2H),6.77(d,J=4.4Hz,1H ),6.31(d,J=4.8Hz,1H),4.59–4.34(m,1H),4.23(q,J=7.2Hz,2H),1.55(d,J=7.2Hz,3H),1.20(t,J=7.2Hz,3H). 19 F NMR(377MHz, CDCl3)δ-71.42(s,3F).

[0571] Step 2: Compound D075-1b (145 mg, 0.39 mmol) and lithium hydroxide monohydrate (161.7 mg, 3.85 mmol) were dissolved in tetrahydrofuran (3.0 ml) and water (1.5 ml), and the mixture was stirred at room temperature for 17 hours. After the reaction was complete, the pH was adjusted to 2 with hydrochloric acid (1 M in H2O), and the solvent was removed using a lyophilizer to obtain crude compound D075-1c (368 mg). LCMS (ESI) m / z: 351.4 [M+H] +

[0572] Step 3: Compound D075-1c (184 mg, 0.19 mmol), INTC (86.2 mg, 0.23 mmol), NMI (158.5 mg, 1.93 mmol), and TCFH (81.2 mg, 0.29 mmol) were dissolved in ultra-dry N,N-dimethylformamide (1.5 ml). The mixture was then stirred at room temperature for 1 hour. After the reaction was complete, the product was preparatively separated by high-performance liquid chromatography (formic acid method) to obtain compound D075 (38.91 mg). LCMS (ESI) m / z: 508.3 [M+H] + .

[0573] Example 35

[0574] Synthesis route:

[0575] Step 1: Phosphorus oxychloride (815 mg, 5.31 mmol) was placed in a 100 mL three-necked flask. The system was cooled to 0 °C, and N,N-dimethylformamide (518 mg, 7.08 mmol) was added dropwise. The reaction solution was stirred at 0 °C until a glassy solid formed. Compound D007-1b (1 g, 3.54 mmol) was dissolved in anhydrous 1,2-dichloroethane (20 mL) and slowly added dropwise to the reaction solution. After the addition was complete, the reaction system was purged with nitrogen three times and stirred at room temperature for 6 hours. After the reaction was complete, sodium acetate aqueous solution was added to the reaction solution and stirring was continued for 2 hours. The reaction solution was diluted with ethyl acetate, washed three times with water, and the organic phase was dried over anhydrous sodium sulfate. The mixture was filtered, concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (0-50% ethyl acetate / petroleum ether) to obtain compound D077-1a (700 mg). LCMS (ESI) m / z: 311.2 [M+H] + .

[0576] Step 2: Compound D077-1a (100 mg, 0.32 mmol) was dissolved in diethylaminosulfur trifluoride (3 mL), and the reaction mixture was stirred at room temperature for 2 hours. After the reaction was complete, the pH of the reaction mixture was adjusted to weakly alkaline by adding sodium bicarbonate aqueous solution, and dilute with dichloromethane for extraction. The organic phases were combined and dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-50% ethyl acetate / petroleum ether) to give compound D077-1b (80 mg). LCMS (ESI) m / z: 333.2 [M+H] + .

[0577] Step 3: Compound D077-1b (80 mg, 0.24 mmol) was dissolved in tetrahydrofuran (4 mL) and water (1 mL), and lithium hydroxide (101 mg, 2.41 mmol) was added. The reaction mixture was stirred at room temperature for 16 hours. After the reaction was complete, dilute hydrochloric acid was added to adjust the pH to acidic, and a solid precipitated. The mixture was filtered, and the filter cake was dried to obtain compound D077-1c (60 mg). LCMS (ESI) m / z: 305.2 [M+H] + .

[0578] Step 4: Compound D077-1c (50 mg, 0.16 mmol) was dissolved in ultra-dry N'N-dimethylformamide (1 mL), and compound INT-1 (74 mg, 0.20 mmol), N,N,N',N'-tetramethylchloroformamidine hexafluorophosphate (69 mg, 0.25 mmol), and N-methylimidazole (81 mg, 0.99 mmol) were added. The reaction system was purged with nitrogen three times and stirred at room temperature for 1 hour. After the reaction was complete, the reaction solution was diluted with dichloromethane, washed three times with water, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude compound was then subjected to high performance liquid chromatography (FA) to obtain the target product D077 (13.50 mg). LCMS (ESI) m / z: 462.3 [M+H] + ...

[0579] Example 36

[0580] Synthesis route:

[0581] Step 1: Compound D083-1a (3.0 g, 13.64 mmol) was dissolved in methanol (30 mL), and concentrated sulfuric acid (10 mL) was added. The mixture was stirred at 70 °C for 1 h. After the reaction was complete, the mixture was diluted with water, extracted with ethyl acetate, the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-18% ethyl acetate / petroleum ether) to give compound D083-1b (2.4 g).1 H NMR (400MHz, CDCl3) δ8.32 (d, J = 4.8Hz, 1H), 7.72 (t, J = 4.8Hz, 1H), 3.99 (s, 3H).

[0582] Step 2: Compound D083-1b (1 g, 4.27 mmol) was dissolved in THF (15 mL), and Pd(PPh3)Cl2 (0.6 g, 0.85 mmol), CuI (0.16 g, 0.85 mmol), and TEA (2.16 g, 21.35 mmol) were added. After purging with nitrogen three times, propyne (6.4 mL, 6.4 mmol) was added. The mixture was stirred at 30 °C for 16 h. After the reaction was complete, the mixture was filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0–20% ethyl acetate / petroleum ether) to give compound D083-1c (700 mg). 1 H NMR (400MHz, CDCl3) δ8.44(d,J=5.2Hz,1H),7.66(t,J=5.2Hz,1H),3.98(s,3H),2.17(s,3H).

[0583] Step 3: Compound D083-1c (700 mg, 3.62 mmol) was dissolved in DMA (7 mL), and CuCl (538 mg, 5.44 mmol) and TEA (1099 mg, 10.86 mmol) were added. The mixture was stirred at 130 °C for 16 h. After the reaction was complete, the mixture was diluted with water, extracted with ethyl acetate, and the organic phases were combined. The organic phases were washed three times with saturated brine and dried over anhydrous sodium sulfate. The mixture was filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0–20% ethyl acetate / petroleum ether) to give compound D083-1d (150 mg). 1 H NMR (400MHz, CDCl3) δ7.70(dd,J=7.2,0.8Hz,1H),7.45-7.43(m,1H),6.95(t,J=6.8Hz,1H),6.89(d,J=4.4Hz,1H),6.85 -6.83(m,1H),3.93(s,3H).

[0584] Step 4: Compound D083-1d (150 mg, 0.78 mmol) was dissolved in DMF (2 mL), and phenol (88 mg, 0.93 mmol) and cesium carbonate (506 mg, 1.55 mmol) were added. The reaction mixture was stirred at 80 °C for 1 h. After the reaction was complete, the mixture was diluted with water and extracted with ethyl acetate. The organic phases were combined. The organic phase was washed three times with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-5% ethyl acetate / petroleum ether) to give compound D083-1e (150 mg). 1 H NMR(400MHz, DMSO-d6)δ8.25(dd,J=7.2,0.8Hz,1H),7.79(dd,J=2.4,1.2Hz,1H),7.32-7.28(m,2H),7.04(t,J=7 .2Hz,1H),6.97(d,J=7.2Hz,1H),6.91-6.88(m,2H),6.80(dd,J=4.0,2.4Hz,1H),6.40-6.39(m,1H),3.64(s,3H).

[0585] Step 5: Dissolve compound D083-1e (100 mg, 0.37 mmol) in DMF (1 mL), add NCS (75 mg, 0.55 mmol), and stir the reaction mixture at 80 °C for 16 h. After the reaction is complete, dilute the mixture with water, extract with ethyl acetate, and combine the organic phases. Wash the organic phase three times with saturated brine, dry with anhydrous sodium sulfate, filter, concentrate the filtrate under reduced pressure, and purify the residue by silica gel column chromatography (0-5% ethyl acetate / petroleum ether) to obtain compound D083-1f (80 mg). 1 H NMR (400MHz, DMSO-d6) δ8.11(d,J=7.2Hz,1H),7.31(t,J=8Hz,2H),7.18(d,J=7.2Hz,1H),7.05(t ,J=7.6Hz,1H),6.95(d,J=4.4Hz,1H),6.91(d,J=8.4Hz,2H),6.53(d,J=4.4Hz,1H),3.65(s,3H).

[0586] Step 6: Compound D083-1f (80 mg, 0.27 mmol) was dissolved in THF (1 mL), and LiOH (63 mg, 2.7 mmol), H2O (0.1 mL), and methanol (0.1 mL) were added. The reaction mixture was stirred at room temperature for 16 h. After the reaction was complete, the pH was adjusted to 4 with hydrochloric acid (2.0 M), and the mixture was extracted twice with ethyl acetate. The organic phases were combined. The organic phase was dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain crude compound D083-1 g (70 mg). LCMS (ESI) m / z: 288.1 [M+H] + .

[0587] Step 7: Dissolve 1 g (50 mg, 0.17 mmol) of compound D083 in DMF (1.0 mL), then add INT-1 (78 mg, 0.2 mmol), TCFH (98 mg, 0.34 mmol), and NMI (86 mg, 1.02 mmol). Stir the reaction mixture at room temperature for 1 h. After the reaction is complete, filter the solution through a membrane filter. The filtrate is purified by high performance liquid chromatography to obtain compound D083 (12.98 mg).

[0588] Example 37

[0589] Synthesis route:

[0590] Compound D051-1c (150 mg, 0.55 mmol) was dissolved in ultradry N'N-dimethylformamide (4 mL), and compound INT-1 (247 mg, 0.66 mmol), N,N,N',N'-tetramethylchloroformamidine hexafluorophosphate (232 mg, 0.83 mmol), and N-methylimidazole (271 mg, 3.31 mmol) were added. The reaction system was purged with nitrogen three times and stirred at room temperature for 1 hour. After the reaction was complete, the reaction solution was diluted with dichloromethane, washed three times with water, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude compound was then subjected to high performance liquid chromatography (FA) to obtain the target product D084 (63.47 mg). LCMS (ESI) m / z: 430.2 [M+H] + .

[0591] Example 38

[0592] Synthesis route:

[0593] To a single-necked flask containing compound D057-1e (50 mg, 0.17 mmol), compound INT-6 (65 mg, 0.20 mmol), N,N,N',N'-tetramethylchloroformamidin hexafluorophosphate (71 mg, 0.25 mmol), N-methylimidazole (83 mg, 1.01 mmol), and ultradry solvent N,N-dimethylformamide (1.0 mL) were added sequentially. After purging with nitrogen three times, the mixture was stirred at room temperature for 2 hours. After the reaction was complete, the reaction solution was filtered, and the filtrate was subjected to high-performance liquid chromatography (HPLC) to obtain the target product D085 (11.10 mg). LCMS (ESI) m / z: 428.2 [M+H] + .

[0594] Example 39

[0595] Synthesis route:

[0596] To a single-necked flask containing compound D057-1e (50 mg, 0.17 mmol), compound INT-7 (80 mg, 0.20 mmol), N,N,N',N'-tetramethylchloroformamidin hexafluorophosphate (71 mg, 0.25 mmol), N-methylimidazole (83 mg, 1.01 mmol), and ultradry solvent N,N-dimethylformamide (1.0 mL) were added sequentially. After purging with nitrogen three times, the mixture was stirred at room temperature for 2 hours. After the reaction was complete, the reaction solution was filtered, and the filtrate was subjected to high-performance liquid chromatography (HPLC) to obtain the target product D086 (9.27 mg). LCMS (ESI) m / z: 504.3 [M+H] + .

[0597] Example 40

[0598] Synthesis route:

[0599] Step 1: Compound D087-1a (50 mg, 0.19 mmol) was dissolved in THF (1 mL), and LiOH (49 mg, 1.9 mmol), H2O (0.1 mL), and methanol (0.1 mL) were added. The reaction mixture was stirred at room temperature for 16 h. After the reaction was complete, the pH was adjusted to 4 with hydrochloric acid (2.0 M), and the mixture was extracted twice with ethyl acetate. The organic phases were combined. The organic phase was dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain compound D087-1b (40 mg). LCMS (ESI) m / z: 254.2 [M+H] + .

[0600] Step 2: Compound D087-1b (40 mg, 0.16 mmol) was dissolved in DMF (1.0 mL), followed by the addition of compound INT-1 (71 mg, 0.19 mmol), TCFH (89 mg, 0.32 mmol), and NMI (78 mg, 0.96 mmol). The reaction mixture was stirred at room temperature for 1 h. After the reaction was complete, the mixture was filtered through a membrane filter, and the filtrate was purified by high-performance liquid chromatography to obtain compound D087 (31.16 mg).

[0601] Example 41

[0602] Synthesis route:

[0603] Step 1: Synthesis of compound D088-1c

[0604] Compounds D088-1a (1 g, 3.31 mmol), D088-1b (662 mg, 6.62 mmol), potassium carbonate (913.6 mg, 6.62 mmol), and DMF (10 mL) were purged with nitrogen three times and reacted at room temperature for 2 hours. After the reaction was complete, water was added to the mixture, and the mixture was extracted with ethyl acetate. The organic phase was washed with saturated brine and dried with anhydrous sodium sulfate. The mixture was then filtered. The organic solvent was removed by concentration under reduced pressure. The residue was adsorbed onto silica gel and purified by silica gel column chromatography (dichloromethane:methanol = 100:0 to 95:5). The solid obtained by elution was product D088-1c (240 mg). LCMS (ESI) m / z: 367.1 [M+H] +

[0605] Step 2: Compound D088-1c (240 mg, 0.66 mmol), pinacol isopropenylborate (165 mg, 0.98 mmol), potassium carbonate (273.2 mg, 1.98 mmol), and Pd(dppf)Cl2 (44 mg, 0.066 mmol) were dissolved in 1,4-dioxane (3 ml) and water (0.6 ml). After purging with nitrogen three times, the reaction was carried out in an oil bath at 50 °C for 2 hours. After the reaction was completed, water was added to the mixture, and the mixture was extracted with ethyl acetate. The organic phase was washed with saturated brine and dried with anhydrous sodium sulfate. The mixture was then filtered. The organic solvent was removed by concentration under reduced pressure. The residue was adsorbed onto silica gel and purified by silica gel column chromatography (dichloromethane:methanol = 100:0 to 95:5) to obtain compound D088-1d (140 mg). LCMS (ESI) m / z: 329.2 [M+H] +

[0606] Step 3: After replacing the hydrogen gas three times in a mixture of compound D088-1d (140 mg, 0.43 mmol), palladium on carbon (20 mg), and EA (3 ml), the reaction was carried out in an ice bath for 0.5 hours. After the reaction was complete, the mixture was filtered. The organic solvent was removed by concentration under reduced pressure, and the remaining white solid was the crude product D088-1e (110 mg). LCMS (ESI) m / z: 331. [M+H] +

[0607] Step 4: Dissolve compound D088-1e (70 mg, 0.16 mmol) in acetonitrile (2 mL), add (CH3)3SnOH (146.6 mg, 0.81 mmol), and react in an oil bath at 65 °C for 48 hours. After the reaction is complete, add water to the mixture, extract with ethyl acetate, wash the organic phase with saturated brine, dry the organic phase with anhydrous sodium sulfate, and filter. Concentrate under reduced pressure to remove the organic solvent; the resulting solid is the crude product D088-1f (90 mg). LCMS (ESI) m / z: 303.3 [M+H] +

[0608] Step 5: Dissolve compound D088-1f (90 mg, 0.30 mmol), INT-1 (134.3 mg, 0.36 mmol), N-methylimidazole (147.6 mg, 1.8 mmol), and tetramethylchlorourea hexafluorophosphonate (252 mg, 0.9 mmol) in DMF (0.5 mL). Under nitrogen protection, the reaction solution was reacted at room temperature for 2 hours. After the reaction, the mixture was filtered, and the filtrate was separated by high-performance liquid chromatography (formic acid method) to obtain a yellow solid, which was the target product D088 ​​(17.05 mg). LCMS: m / z = 460.3 [M+H] + .

[0609] Example 42

[0610] Synthesis route:

[0611] Compound D051-1c (50 mg, 0.18 mmol) was dissolved in ultra-dry N'N-dimethylformamide (1 mL), and compound INT-1 (80 mg, 0.22 mmol), N,N,N',N'-tetramethylchloroformamidine hexafluorophosphate (77 mg, 0.28 mmol), and N-methylimidazole (90 mg, 1.10 mmol) were added. The reaction system was purged with nitrogen three times and stirred at room temperature for 1 hour. After the reaction was complete, the reaction solution was diluted with dichloromethane, washed three times with water, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude compound was then subjected to high-performance liquid chromatography (FA) to obtain the target product D090 (27.73 mg). LCMS (ESI) m / z: 444.3 [M+H] + .

[0612] Example 43

[0613] Synthesis route:

[0614] Compound D057-1e (150 mg, 0.51 mmol) was dissolved in DMF (3 mL), and compound INT-4 (109 mg, 0.61 mmol), TCFH (283 mg, 1.02 mmol), and NMI (250 mg, 3.06 mmol) were added. The reaction mixture was stirred at room temperature for 1 h. After the reaction was complete, the solution was filtered through a membrane filter, and the filtrate was purified by high performance liquid chromatography (HPLC) to obtain compound D092 (50 mg). D092 was separated by semi-precipitated chromatographic column: IA (250*30mm 10μm); mobile phases A (CO2) and B (methanol, containing 0.1% 7mol / L ammonia methanol solution); gradient: B% = 35%, purified to give D092-P1 (21.67mg, yield: 9.36%) and D092-P2 (20.93mg, yield: 9.04%). LCMS (ESI) m / z:

[0615] Example 44

[0616] Synthesis route:

[0617] Step 1: The crude compound INT-9 (70 mg, 0.25 mmol) was dissolved in anhydrous N,N-dimethylformamide (2 mL). Compound INT-7 (168 mg, 0.50 mmol), N,N,N',N'-tetramethylchloroformamidin hexafluorophosphate (140 mg, 0.50 mmol), and N-methylimidazole (123 mg, 1.5 mmol) were added. The reaction system was purged with nitrogen three times and stirred at room temperature for 1 hour. After the reaction was complete, the reaction solution was filtered, and the filtrate was subjected to high-performance liquid chromatography (HPLC) (ammonium bicarbonate) to obtain the target product D094 (38.49 mg). LCMS (ESI) m / z: 500.3 [M+H] + .

[0618] Example 45

[0619] Synthesis route:

[0620] Step 1: Compound 7e (8 g, 30.85 mmol) was dissolved in ultradry dichloromethane (80 mL), and imidazole (5.26 g, 77.13 mmol) was added. The reaction system was cooled to 0°C, and tert-butyldimethylchlorosilane (6.98 g, 46.28 mmol) was added. The mixture was heated to room temperature and stirred for 16 hours. After the reaction was completed, the reaction was quenched with water, extracted with dichloromethane, and the organic phases were combined. The organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-5% ethyl acetate / petroleum ether) to give compound D095-1a (7 g). LCMS (ESI) m / z: 274.2 [M+H-100] + . 1 H NMR (400MHz, CDCl3) δ4.25-4.21(m,1H),4.09-4.01(m,1H),3.70-3.69(m,3H),2. 32-2.15(m,2H),2.09-1.99(m,1H),1.87-1.67(m,2H),1.42(s,9H),0.85(s,9H).

[0621] Step 2: Compound D095-1a (7 g, 18.74 mmol) was dissolved in ultra-dry tetrahydrofuran (70 mL), purged three times with a nitrogen balloon, cooled to 0°C, and then lithium aluminum hydride (24.6 mL, 24.56 mmol) was added. The mixture was heated to room temperature and stirred for 1 hour. After the reaction was complete, the reaction solution was quenched dropwise in ice water, extracted with ethyl acetate, and the organic phases were combined. The organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain compound D095-1b (6 g). LCMS (ESI) m / z: 246.3 [M+H-100] + . 1 H NMR (400MHz, DMSO-d6) δ6.48-6.46(m,1H),4.47-4.43(m,1H),4.05-3.98(m,1H),3.38-3.34(m,1H),3. 20(t,J=4.0Hz,1H),2.20-2.06(m,2H),1.84-1.75(m,1H),1.68-1.49(m,2H),1.38(s,9H),0.84(s,9H).

[0622] Step 3: Compound D095-1b (6 g, 17.36 mmol) was dissolved in anhydrous dichloromethane (120 mL), and Dysmartin reagent (8.8 g, 20.83 mmol) was added at 0 °C. The mixture was stirred at room temperature for 1 hour. After the reaction was complete, saturated sodium thiosulfate aqueous solution was added, and the mixture was stirred at room temperature for half an hour. The mixture was then extracted with dichloromethane. The organic phases were combined, washed twice with saturated sodium bicarbonate aqueous solution, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-20% ethyl acetate / petroleum ether) to give compound D095-1c (4 g. LCMS (ESI) m / z: 244.3 [M+H-100]). + . 1 H NMR (400MHz, CDCl3) δ9.51 (s, 1H), 4.19 (d, J = 6.4Hz, 1H), 4.14-4.07 (m, 1H), 2.4 3-2.24(m,2H),2.13-2.04(m,1H),1.89-1.69(m,2H),1.42(s,9H),0.84(s,9H).

[0623] Step 4: Dissolve sodium hydride (35 mg, 0.87 mmol) in anhydrous tetrahydrofuran (2 mL). Cool the reaction solution to 0°C. Under nitrogen protection, slowly add a tetrahydrofuran solution of diethyl(methanesulfonyl)phosphine (134 mg, 0.58 mmol) (1 mL). After the addition is complete, stir at 0°C for 20 minutes. Then, slowly add a tetrahydrofuran solution of compound D095-1c (200 mg, 0.58 mmol) (1 mL). Continue stirring at 0°C for 5 minutes. After the reaction is complete, add saturated ammonium chloride and water to quench the reaction. Extract three times with ethyl acetate. Combine the organic phases, dry with anhydrous sodium sulfate, filter, and concentrate the filtrate under reduced pressure to obtain the crude compound D095-1d (230 mg). LCMS (ESI) m / z: 437.1 [M + H₂O] + .

[0624] Step 5: Dissolve crude compound D095-1d (230 mg, 0.55 mmol) in anhydrous dichloromethane (3 mL), add trifluoroacetic acid (0.75 mL) under ice-water bath conditions, and stir at room temperature for 1 hour. After the reaction is complete, concentrate the reaction solution under reduced pressure to obtain crude compound D095-1e (260 mg). LCMS (ESI) m / z: 206.2 [M+H] + .

[0625] Step 6: The crude compound INT-9 (260 mg, 0.86 mmol) was dissolved in anhydrous N,N-dimethylformamide (3 mL). Compound INT-7 (131 mg, 0.43 mmol), N,N,N',N'-tetramethylchloroformamidin hexafluorophosphate (180 mg, 0.65 mmol), and N-methylimidazole (210 mg, 2.58 mmol) were added. The reaction mixture was purged with nitrogen three times and stirred at room temperature for 1 hour. After the reaction was complete, water was added to the reaction solution, and the mixture was extracted with ethyl acetate. The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain compound D095-1f (180 mg). LCMS (ESI) m / z: 494.0 [M+H] + .

[0626] Step 7: Compound D095-1f (180 mg, 0.36 mmol) was dissolved in anhydrous dichloromethane (4 mL). Desmartin reagent (185 mg, 0.43 mmol) was added at 0 °C, and the mixture was stirred at room temperature for 1 hour. After the reaction was complete, saturated sodium thiosulfate aqueous solution was added, and the mixture was stirred at room temperature for half an hour. The mixture was then extracted with dichloromethane. The organic phases were combined, washed twice with saturated sodium bicarbonate aqueous solution, dried over anhydrous sodium sulfate, and filtered. The filtrate was subjected to high-performance liquid chromatography (HPLC) to obtain the target product D095 (20.21 mg). LCMS (ESI) m / z: 492.3 [M+H] + .

[0627] Example 46

[0628] Synthesis route:

[0629] Step 1: Compound D096-1a (3 g, 9.12 mmol) was dissolved in anhydrous tetrahydrofuran (30 mL) in a three-necked flask. The reaction system was purged with nitrogen three times. Lithium chloride (1.16 g, 27.4 mmol) and sodium borohydride (1.03 g, 27.4 mmol) were added to the reaction solution, followed by anhydrous ethanol. After the reaction was complete, the reaction solution was diluted with water and extracted with dichloromethane. The organic phase was washed with saturated brine and dried over anhydrous sodium sulfate. The solution was filtered, and the filtrate was concentrated under reduced pressure to obtain compound D096-1b (2.44 g). 1 H NMR(400MHz, CDCl3)δ4.71(s,1H),3.94(s,4H),3.75–3.61(m,2H),3.53–3.44 (m,1H),1.82–1.70(m,4H),1.58–1.51(m,2H),1.45(s,9H),1.42–1.33(m,2H).

[0630] Step 2: Compound D096-1b (2.44 g, 8.11 mmol) was dissolved in ultradry dichloromethane (40 mL). The solution temperature was lowered to 0 °C. Desmartin reagent (5.16 g, 12.2 mmol) was added to the reaction solution. The reaction system was purged with nitrogen three times and stirred at room temperature for 1 hour. Saturated sodium thiosulfate aqueous solution was added, and the mixture was stirred at room temperature for half an hour before extraction. The organic phase was washed twice with saturated sodium bicarbonate aqueous solution and dried over anhydrous sodium sulfate. The mixture was filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-30% ethyl acetate / petroleum ether) to give compound D096-1c (1.03 g). 1H NMR (400MHz, CDCl3) δ9.66 (s, 1H), 5.13 (d, J = 6.8Hz, 1H), 4.29 (dd, J = 7.6, 4.4Hz, 1H), 3.93 (t, J = 2. 2Hz,4H),2.02–1.96(m,2H),1.82–1.77(m,4H),1.64–1.60(m,2H),1.57–1.52(m,2H),1.45(s,9H).

[0631] Step 3: Dissolve sodium hydride (40 mg, 1.00 mmol) in ultra-dry tetrahydrofuran (2 mL). Under nitrogen protection, cool the mixture to 0°C. Slowly add a tetrahydrofuran solution of diethyl(methanesulfonyl)phosphine (154 mg, 0.67 mmol) in 3 mL, stirring at 0°C for 20 minutes after the addition is complete. Then slowly add a tetrahydrofuran solution of compound D096-1c (200 mg, 0.67 mmol) in 3 mL, stirring at 0°C for another 5 minutes. After the reaction is complete, quench the reaction with saturated ammonium chloride, dilute with water, and extract three times with dichloromethane. Combine the organic phases, dry with anhydrous sodium sulfate, filter, and concentrate under reduced pressure to obtain crude compound D096-1d (250 mg). LCMS (ESI) m / z: 276.2 [M+H-100] + .

[0632] Step 4: Dissolve crude compound D096-1d (250 mg, 0.67 mmol) in ultra-dry dichloromethane (2 mL), add trifluoroacetic acid (0.5 mL) while stirring in an ice-water bath, and stir at room temperature for 2 hours. After the reaction is complete, concentrate under reduced pressure to obtain crude compound D096-1e (154 mg), which can be used directly in the next reaction. LCMS (ESI) m / z: 232.2 [M+H] + .

[0633] Step 5: The crude compound D096-1e (154 mg, 0.67 mmol) was dissolved in ultra-dry N,N-dimethylformamide (5 mL), and compound INT-9 (170 mg, 0.56 mmol), N,N,N',N'-tetramethylchloroformamidine hexafluorophosphate (253 mg, 0.67 mmol), and N-methylimidazole (273 mg, 3.33 mmol) were added. The reaction system was purged with nitrogen three times and stirred at room temperature for 2 hours. After the reaction was completed, the reaction solution was extracted with ethyl acetate, the organic phase was washed three times with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude compound was obtained, and the crude compound was subjected to high performance liquid chromatography (FA) to obtain the target product D096 (90.47 m). LCMS (ESI) m / z: 520.3 [M+H] + .

[0634] Example 47

[0635] Synthesis route:

[0636] Compound INT-10 (50 mg, 0.17 mmol), compound D044-1b (82 mg, 0.26 mmol), TCFH (95 mg, 0.34 mmol), and NMI (84 mg, 1.02 mmol) were dissolved in DMF (1 mL). The reaction mixture was reacted at room temperature for 1 hour under nitrogen protection. After the reaction was complete, the reaction mixture was filtered, and the filtrate was purified by high-performance liquid chromatography (HPLC) to obtain D097 (23.55 mg). LCMS (ESI) m / z: 496.3 [M+H] + .

[0637] Example 48

[0638] Synthesis route:

[0639] Step 1: Compound 8e (2 g, 5.43 mmol) was dissolved in ultra-dry solvent tetrahydrofuran (20 mL). Under nitrogen protection, the reaction system was cooled to 0 °C, and a solution of diisopropylaminolithium-tetrahydrofuran (2 M, 4.07 mL, 8.14 mmol) was slowly added dropwise. After the addition was complete, the reaction mixture was stirred at 0 °C for 20 minutes, and then a solution of compound D098-1a (1.87 g, 5.43 mmol) in tetrahydrofuran (20 mL) was slowly added dropwise. The reaction was stirred for another 2 hours. After the reaction was complete, a saturated ammonium chloride solution was added to quench the reaction. After dilution with water, the mixture was extracted with dichloromethane, the organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0%-50% ethyl acetate / petroleum ether) to give product D098-1b (1.8 g). LCMS (ESI) m / z: 362.2 [M+H] + .

[0640] Step 2: Compound D098-1b (1.8 g, 3.90 mmol) was dissolved in ultradry dichloromethane (16 mL), and TFA (4 mL) was added. The mixture was stirred at room temperature for 1 hour. After the reaction was complete, water was added to extract the organic phase. All aqueous phases were combined and lyophilized. The resulting crude compound D098-1c (2.0 g) was used directly in the next step. LCMS (ESI) m / z: 248.2 [M+H] + .

[0641] Step 3: Synthesis of compound D098-1d

[0642] The crude compound D098-1c (2.0 g, 3.90 mmol) was dissolved in ultradry N,N-dimethylformamide (20 mL), and compound INT-9 (0.80 g, 2.6 mmol), N,N,N',N'-tetramethylchloroformamidin hexafluorophosphate (1.7 g, 3.90 mmol), and N-methylimidazole (2 g, 15.6 mmol) were added. The reaction system was purged with nitrogen three times and stirred at room temperature for 2 hours. After the reaction was completed, the reaction solution was extracted with ethyl acetate, the organic phase was washed three times with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude compound was obtained, and the crude compound was prepared by high performance liquid chromatography (NH4HCO3) to obtain the target product D098-1d (200 mg). LCMS (ESI) m / z: 536.1 [M+H] + .

[0643] Step 4: Compound D098-1d (80 mg) was separated by SFC. Chromatographic column: AD (250*30mm 10μm); mobile phase A (CO2) and B (isopropanol, containing 0.1% 7mol / L ammonia methanol solution); gradient: B% = 20%, purified to give compound D098-1e (35mg, yield: 7.05%) and compound D098-1f (35mg, yield: 7.05%).

[0644] Step 5: Synthesis of compound D098-P1

[0645] To a 25 mL single-necked flask containing compound D098-1e (35 mg, 0.065 mmol), add 3 mL of ultra-dry solvent dichloromethane. Then, in an ice-water bath, add 33.26 mg (0.078 mmol) of Desmartin reagent in portions, followed by three purgings with nitrogen. The reaction mixture was stirred at room temperature for 1 hour. After the reaction was complete, sodium thiosulfate solution was added to the reaction mixture, and after stirring for half an hour, the organic phase was separated. The aqueous phase was then extracted three times with dichloromethane (2 mL each time), and all organic phases were combined. The organic phase was dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-25% ethyl acetate / petroleum ether) to give compound D098-P1 (1.05 mg). LCMS (ESI) m / z: 534.2 [M+H] + .

[0646] Step 6: Synthesis of compound D098-P2

[0647] To a 25 mL single-necked flask containing compound D098-1f (35 mg, 0.065 mmol), add 3 mL of ultra-dry solvent dichloromethane. Then, in an ice-water bath, add 33.26 mg (0.078 mmol) of Desmartin reagent in portions, followed by three purgings with nitrogen. The reaction mixture was stirred at room temperature for 1 hour. After the reaction was complete, sodium thiosulfate solution was added to the reaction mixture, and after stirring for half an hour, the organic phase was separated. The aqueous phase was then extracted three times with dichloromethane (2 mL each time), and all organic phases were combined. The organic phase was dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-25% ethyl acetate / petroleum ether) to give compound D098-P2 (1.00 mg). LCMS (ESI) m / z: 534.2 [M+H] + .

[0648] Example 49

[0649] Synthesis route:

[0650] Compound D099-1a (45.1 mg, 0.153 mmol), TCFH (64.4 mg, 0.23 mmol), NMI (75.3 mg, 0.918 mmol), and the ultra-dry solvent N,N-dimethylformamide (2.0 mL) were added sequentially to a single-necked flask containing compound INT-10 (40 mg, 0.184 mmol). After purging with nitrogen three times, the mixture was stirred at room temperature for 2 hours. After the reaction was complete, the reaction solution was purified by high-performance liquid chromatography (HPLC) to obtain compound D099 (10.4 mg, two-step yield: 11.1%). LCMS (ESI) m / z: 494.3 [M+H] + .

[0651] Example 50

[0652] Synthesis route:

[0653] Step 1: Dissolve D100-1a (500 mg, 1.34 mmol) in ultra-dry tetrahydrofuran (5 mL), add compound 8e (400 mg, 1.34 mmol) and potassium carbonate (461 mg, 3.40 mmol), and heat the reaction solution to 80 °C for 3 hours. Extract with ethyl acetate and wash the organic phase with saturated brine. Combine all organic phases, dry with anhydrous sodium sulfate, filter, and concentrate the filtrate under reduced pressure to obtain the crude compound. Purify the crude compound by silica gel column chromatography (ethyl acetate / petroleum ether = 0-30%) to obtain compound D100-1b (400 mg). LCMS (ESI) m / z: 318.2 [M-56] +.

[0654] Step 2: Compound D100-1b (400 mg, 1.07 mmol) was dissolved in dichloromethane (6 ml), and then added to trifluoroacetic acid (1.5 ml). The mixture was stirred at room temperature for 16 hours. After the reaction was completed, the solution was concentrated under reduced pressure to obtain crude compound D100-1c (400 mg). LCMS (ESI) m / z: 274.2 [M+H] + .

[0655] Step 3: Compound D100-1c (200 mg, 0.71 mmol) was dissolved in ultra-dry N'N-dimethylformamide (2 mL), and compound D094-1a (280 mg, 0.59 mmol), N,N,N',N'-tetramethylchloroformamidine hexafluorophosphate (260 mg, 0.88 mmol), and N-methylimidazole (289 mg, 3.53 mmol) were added. The reaction system was purged with nitrogen three times and stirred at room temperature for 1 hour. After the reaction was completed, the reaction solution was diluted with dichloromethane (10 mL), washed three times with water (10 mL * 3), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude compound was then subjected to high performance liquid chromatography (FA) to obtain the target product D100 (10.34 mg). LCMS (ESI) m / z: 562.3

[0656] [M+H] + .

[0657] Example 51

[0658] Synthesis route:

[0659] Compound D057-1e (80 mg, 0.27 mmol) was dissolved in ultradry N,N-dimethylformamide (1.5 mL), and crude compound INT-8 (128 mg, 0.40 mmol), N,N,N',N'-tetramethylchloroformamidine hexafluorophosphate (114 mg, 0.40 mmol), and N-methylimidazole (133 mg, 1.62 mmol) were added. The reaction system was purged with nitrogen three times and stirred at room temperature for 2 hours. After the reaction was complete, the reaction solution was extracted with ethyl acetate, the organic phases were combined and washed three times with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain the crude compound. The crude compound was then subjected to high performance liquid chromatography (FA) to obtain the target product D104 (16.87 mg, yield 12.61%). LCMS (ESI) m / z: 496.0 [M+H] + .

[0660] Example 52

[0661] Synthesis route:

[0662] Compound D073-1b (80 mg, 0.27 mmol) was dissolved in ultradry N,N-dimethylformamide (1.5 mL), and crude compound INT-8 (128 mg, 0.40 mmol), N,N,N',N'-tetramethylchloroformamidine hexafluorophosphate (114 mg, 0.40 mmol), and N-methylimidazole (133 mg, 1.62 mmol) were added. The reaction system was purged with nitrogen three times and stirred at room temperature for 2 hours. After the reaction was complete, the reaction solution was extracted with ethyl acetate, the organic phase was washed three times with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain the crude compound. The crude compound was then subjected to high performance liquid chromatography (FA) to obtain the target product D105 (6.79 mg). LCMS (ESI) m / z: 494.0 [M+H] + .

[0663] Example 53

[0664] Synthesis route:

[0665] Step 1: Compound 7l (1g, 3.82mmol) was dissolved in anhydrous tetrahydrofuran (15mL). The reaction solution was cooled to 0℃, and LDA (2.9mL) was slowly added dropwise under nitrogen protection. After the addition was complete, the mixture was stirred at 0℃ for 20 minutes. Then, a tetrahydrofuran solution of compound D107-1a (1.4g, 3.82mmol) (5mL) was slowly added dropwise, and the mixture was stirred at 0℃ for another 30 minutes. After the reaction was complete, saturated ammonium chloride was added to quench the reaction, and the mixture was extracted three times with ethyl acetate. The combined organic phases were dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to obtain the crude compound. The crude compound was purified by silica gel column chromatography (0-20% ethyl acetate / petroleum ether) to obtain compound D107-1b (1g). LCMS (ESI) m / z: 397.2 [M+18] + .

[0666] Step 2: Compound D107-1b (800 mg, 2.10 mmol) was dissolved in anhydrous dichloromethane (16 mL). Trifluoroacetic acid (4.0 mL) was added under ice-water bath conditions, and the mixture was stirred at room temperature for 1 hour. After the reaction was complete, the mixture was extracted with water, and the aqueous phase was lyophilized to obtain crude compound D107-1c (900 mg). LCMS (ESI) m / z: 280.0 [M+H] + .

[0667] Step 3: The crude compound D107-1c (300 mg, 0.762 mmol) was dissolved in anhydrous dichloromethane (5 mL). Compound INT-9 (107 mg, 0.381 mmol), HATU (217 mg, 0.571 mmol), and triethylamine (463 mg, 4.576 mmol) were added. The reaction system was purged with nitrogen three times and stirred at room temperature for 1 hour. After the reaction was complete, the reaction solution was filtered, and the filtrate was subjected to high-performance liquid chromatography (HPLC) (formic acid) to obtain the target product D107 (20 mg, yield 5%). LCMS (ESI) m / z: 542.3 [M+H] + .

[0668] Example 54

[0669] Synthesis route:

[0670] Compound D051-1c (73 mg, 0.27 mmol) was dissolved in ultradry N'N-dimethylformamide (2 mL), and compound INT-9 (70 mg, 0.32 mmol), N,N,N',N'-tetramethylchloroformamidine hexafluorophosphate (113 mg, 0.40 mmol), and N-methylimidazole (132 mg, 1.61 mmol) were added. The reaction system was purged with nitrogen three times and stirred at room temperature for 1 hour. After the reaction was complete, the reaction solution was diluted with dichloromethane, washed three times with water, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude compound was then subjected to high performance liquid chromatography (FA) to obtain the target product D108 (12.92 mg, yield 10.22%). LCMS (ESI) m / z: 472.2 [M+H] + .

[0671] Example 55

[0672] Synthesis route:

[0673] Compound D052-c (66 mg, 0.23 mmol) was dissolved in ultra-dry dichloromethane (3 mL). Compound INT-9 (60 mg, 0.28 mmol), N,N,N′,N′-tetramethyl-O-(7-azabenzotriazol-1-yl)hexafluorophosphate urea (130 mg, 0.34 mmol), and triethylamine (139 mg, 1.38 mmol) were added. The reaction mixture was purged with nitrogen three times and stirred at room temperature for 2 hours. After the reaction was complete, the reaction solution was extracted with dichloromethane (5 mL). The organic phase was washed three times with saturated brine (5 mL * 3), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude compound was then subjected to high-performance liquid chromatography (FA) to obtain the target product D109 (8.46 mg, yield 7.58%). LCMS (ESI) m / z: 488.2 [M+H] + .

[0674] Various embodiments 1 The H NMR and MS data are shown in Table 1 below:

[0675] Table 1: 1 H NMR and MS data

[0676] Biological testing

[0677] Experimental Example 1: Detection of WRN ATPase Activity Inhibition

[0678] 1.1 Testing instruments and reagents:

[0679] hWRN (Aisiyipu, S2212T-H56HZ, Uniprot: Q14191; N517-P1238, N-terminus contains 6×His and zz tags); ATP (Ark Pharm, Ak-54737); Capture DNA (Genscript), sequence information GAACGAACACATCGGGTACG (SEQ.ID.No.1); DNA duplex TAMRA (Genscript), the sequence information is OligoA-BHQ2: TTTTTTTTTTTTTTTTTTTTTTTTTTCGTACCCGATGTGTTCGTTC-BHQ2 (SEQ.ID.No.2), OligoB-TA MRA: TAMRA-GAACGAACACATCGGGTACGTTTTTTTTTTTTTTTTTTTTTTTTTTTT (SEQ.ID.No.3); 96-well plate (Nunc, 249944); 384-well plate (Corning, 4514); 655 ultrasonic pipetting system (Labcyte, 655); centrifuge (Hunan Xiangyi, TDZ5-WS); microplate reader (BMG Labtech, CLARIO Star Plusacu).

[0680] 1.2 Experimental Methods:

[0681] To evaluate the in vitro inhibitory activity of the compounds in this invention, the test compounds were first serially diluted at a ratio of 1:4 to prepare 10 different concentrations of dilution (3.81 nM to 1 mM). 0.15 μL of each dilution was transferred to a 384-well plate (Corning, 4514) with two replicates. The control group consisted of DMSO without the test compound. 5 μL of hWRN (N517-P1238) working solution containing 0.2 mM ATP was added, and the mixture was centrifuged at 1000 rpm for 1 min and incubated at 25°C for 4 h. Subsequently, 5 μL of working solution containing DNA duplex TAMRA and Capture DNA, along with 5 μL of ATP solution, were added. At this point, the compound concentration ranged from 0.0381 nM to 10 μM, and the concentrations of hWRN, ATP, DNA duplex TAMRA, and Capture DNA were 5 nM, 4 mM, 100 nM, and 1 μM, respectively. After centrifugation at 1000 rpm for 1 min, the reaction was carried out at 25 °C for 30 min, and the fluorescence value was detected using a microplate reader (Ex 620 nm, Em 685, BMG Labtech, CLARIO Star Plusacu).

[0682] For data analysis, wells without hWRN (N517-P1238) were used as negative controls, and wells treated with DMSO were used as positive controls. The formula for calculating the % inhibition rate was: % inhibition rate = (Data positive control - Data sample) / (Data positive control - Data negative control) × 100. The IC50 of the compound was calculated using Graphpad Prism nonlinear fitting.

[0683] 1.3 Experimental Results: The IC50 of the compound of this invention was measured in this experiment. 50 The values ​​are shown in Table 2.

[0684] Table 2. Results of in vitro activity tests

[0685] 1.4 Experimental Conclusion: The compound of this invention has excellent inhibitory activity against WRN.

[0686] Experimental Example 2: HCT116 Cell Proliferation Inhibition Detection

[0687] 2.1 Testing instruments and reagents:

[0688] HCT116 cells (ATCC, CCL-247); McCoy's 5A medium (Gibco, 16600-082); 0.25% trypsin-EDTA (Gibco, 25200072); penicillin-streptomycin antibiotics (Gibco, 15140-122); fetal bovine serum (Avantor, 76294-180); phosphate-buffered saline (Solarbio, P1020); CellCounting-Lite 2.0 Cell viability assay reagent (Vazyme, DD1101-03); T75 culture flask (Corning, 430641); 96-well plate (Corning, 3603); CO2 incubator (ESCO, CLM-240B-8-TC); cell counter (Invitrogen, AMQAX1000); centrifuge (Hunan Xiangyi, TDZ5-WS); microplate reader (BMG Labtech, PHERAstar FSX).

[0689] 2.2 Experimental methods: HCT116 cells were derived from ATCC and cultured in a 37℃, 5% CO2 incubator. The growth medium consisted of McCoy's 5A (Gibco, 16600-082), 10% FBS (Avantor, 76294-180), and 1× penicillin-streptomycin (Gibco, 15140-122).

[0690] HCT116 cells were digested with trypsin (Gibco, 25200072) and seeded at a density of 300 cells / well in 96-well black transparent plates (Corning, 3603), with 195 μL of cell suspension per well, and incubated overnight at 37°C in a 5% CO2 incubator. The test compound was serially diluted with DMSO at a ratio of 1:4 to prepare nine different concentrations (0.15 μM–10 mM). 3 μL of each serially diluted compound was added to 22 μL of cell culture medium for a second dilution. Then, 5 μL of the second dilution was added to each cell culture well, bringing the final compound concentration to 0.45 nM–30 μM and the DMSO concentration to 0.3%. Each concentration was used in triplicate. The cell culture plates were then incubated in a CO2 incubator for 5 days. After incubation, 100 μL of cell supernatant was discarded, and 80 μL of CTG (Vazyme, DD1101-03) was added to each well. The cells were incubated at room temperature with shaking at 200 rpm for 30 min. The Luminescence signal value was then detected using a microplate reader (BMG, PHERAstar FSX).

[0691] For data analysis, wells treated with DMSO served as negative controls, and wells containing only culture medium served as positive controls. The calculation formula was: % Inhibition Rate = (Data...) 阴性对照 -Data 样品 ) / (Data 阴性对照 -Data 阳性对照 The IC of the compound was calculated using Graphpad Prism nonlinear fitting with a value of 100. 50 .

[0692] Experimental conclusion: The compound of this invention has excellent inhibitory activity against HCT-116 cells.

[0693] Experiment Example 3: Liver Microsomal Stability Experiment

[0694] Experimental materials

[0695] Liver microsomes (Corning, #1237001&38296), NADPH (Aladdin, #A2305348), PBS (Feijing Biotechnology Co., Ltd., #PH1822), MgCl2 (Sinopharm Group, #20201110).

[0696] Experimental methods:

[0697] With or without the addition of NADPH, the test compound was co-incubated with liver microsomes from humans and mice. The final concentrations of the test compound, NADPH, and liver microsomes in the experimental system were 1 μM, 1 mM, and 0.5 mg / mL, respectively. The concentrations of the compound in the supernatant at different time points within 45 minutes were measured, and pharmacokinetic parameters were calculated.

[0698] The results are summarized in the table below.

[0699] This document uses examples to illustrate the principles and implementation methods of the present invention. These examples are merely illustrative and not intended to limit the scope of the invention. It should be noted that those skilled in the art can make various improvements and modifications to the invention without departing from its principles, and these improvements and modifications also fall within the scope of the claims.

Claims

1. A compound represented by formula (IA) or (IB) or a pharmaceutically acceptable salt or isomer thereof: in: wavy lines Indicates forward and reverse, that is It can be X1 and X2 are independently selected from N, CR6, or C, respectively; X3 and X4 are independently selected from N, CR6, or C, respectively; wherein X3 and X4 are not both N at the same time; W is selected from N, CR6, or C; Ring A is selected from 3-7 membered carbon rings, 4-10 membered heterocycles, 5-10 membered aromatic heterocycles or 6-10 membered aromatic rings, wherein the heteroatom in the heterocycle is selected from one or more of N, O and S; R0 is selected from hydrogen, halogen, cyano, oxo, amino, hydroxyl, C 1~3 Alkyl, C 1~3 Alkoxy, C 2~4 alkenyl, 3-6 membered cycloalkyl, 3-6 membered heterocyclic, C 1~3 Alkoxy-3 to 6-membered cycloalkyl, -CR c R d -C 1~3 Alkyl and -(CR) e R f ) m -3 to 6-membered cycloalkyl; when n is greater than or equal to 2, any two adjacent R0s can form a 3 to 7-membered carbon ring, a 4 to 7-membered heterocyclic ring, a 6-membered aromatic ring or a 5 to 6-membered heteroaromatic ring with ring A; wherein R0 can optionally be substituted by halogens 1 to 6 times; R c and R d Together with the C atoms they are attached to form R e and R f Selected independently from H, halogens and C respectively 1~6 alkyl; R1 is H or L1-R w , wherein R w Selected from 3- to 8-membered cycloalkyl groups, 4- to 10-membered heterocyclic groups, C 1~6 Alkyl, phenyl, 5-10 heteroaryl, N(R) a 2. NR a R b SR a OR b And L1 is selected from single bonds, -(CR a R b ) p -、-NR a -、-O-、-C(=O-、-(CR) a R b ) p -O-、-C(=O)-、-C(=O)NR a -、-O-NR a -, -S-, -S(=O)-, -S(=O)2-, and wherein R1 may optionally be R x Replace 1 to 3 times; R2 is selected from hydrogen, C 1~6 Alkyl, C 1~6 Alkoxy, C 2~6 Alkenyl, 3-8 membered cycloalkyl, 4-10 membered heterocyclic, 5-10 membered heteroaryl, wherein R2 may optionally be replaced by R y Replace 1 to 3 times; L2 is selected from single bond, -(CR a R b ) p -、-NR a -、-O-、-C(=O-、-(CR) a R b ) p -O-、-C(=O)-、-C(=O)NR a -、-O-NR a -,-S-,-S(=O)-,-S(=O)2-,wherein R in L2 a With R b Ke Cheng Any two adjacent R0s may optionally form a ring A, provided that the valence allows, wherein ring A is selected from 3- to 10-membered carbon rings, 4- to 10-membered heterocycles, 5- to 10-membered aromatic heterocycles, or benzene rings, wherein the heteroatom in the heterocycle is optionally selected from one or more of N, O, and S, and wherein ring A may optionally be divided by R x Replace 1 to 3 times; R3 is selected from H and C. 1~3 alkyl; R4 is L0-R v The R v Selected from H, C 1~6 Alkyl, 3-8 membered cycloalkyl, 6-8 membered bridged cycloalkyl, 6-10 membered spirocycloalkyl, 6-10 membered fused cycloalkyl, 4-6 membered heterocyclic, 6-8 membered bridged heterocyclic, 6-10 membered bicyclic heterocyclic, 5-6 membered heteroaryl, phenyl, wherein the heteroatom in the heterocycle is selected from one or more of N, O, and S, and the C 1~6 The carbon atom in the alkyl group may optionally be replaced by a heteroatom, wherein the heteroatom is optionally selected from one or more of N, S, and O; wherein the R4 is optionally replaced by R x Replaced 1 to 3 times; the L0 is selected from single bonds, -(CR a R b ) p -、-NR a -、-O-、-S-、-(CR a R b ) p -O-、-(CR a R b ) p -S-、-(CR a R b ) p -C(=O)-, -C(=O)-, -C(=O)NR a -、-(CR a R b ) p -C(=O)NR a -、-CR a R b -NR a -; Any two R4s may optionally form a ring D, wherein the ring D is selected from 3- to 6-membered carbon rings or 4- to 6-membered heterocycles, wherein the heteroatoms in the heterocycle are optionally selected from one or more of N, O, and S, and wherein the ring D is optionally substituted with a halogen 1 to 3 times. Optionally, R3 and R4 can form a ring E, provided that the valence allows, wherein the ring E is selected from 4- to 6-membered nitrogen-containing heterocycles; R5 is selected from H and C. 1~3 Alkyl groups, halogens; R6 is selected from hydrogen, halogen, cyano, oxo, amino, hydroxyl, C 1~3 Alkyl, C 1~3 Alkoxy, cyclopropyl; R7 is selected from H and C. 1~3 Alkyl groups, halogens; Optionally, R3 and R7 can form a ring F under the condition that the valence allows, wherein the ring F is selected from 4- to 6-membered nitrogen-containing heterocycles; R8 is selected from C 1~3 Alkyl, C 1~3 Haloalkyl, 3-6 membered cycloalkyl, 3-6 membered heterocyclic, phenyl, 5-6 membered heteroaryl, wherein the heteroatom in the heterocycle is selected from one or more of N, O, and S; n is selected from 1, 2, 3, or 4; p is independently selected from 1, 2, or 3; q is selected independently from 1, 2, or 3; R a Independently selected from H, halogen, C 1~6 Alkyl, C 1~6 Halogenated alkyl groups; R b Independently selected from H, halogen, C 1~6 Alkyl, 3-6 membered cycloalkyl, 4-6 membered heterocyclic; R x Selected from halogens, OH, =O, NH2, CN, C 1~3 Alkyl, C 1~3 alkenyl, C 1~3 Alkoxy, cyclopropyl, wherein the C 1~3 Alkyl, C 1~3 alkenyl, C 1~3 The alkoxy and cyclopropyl groups may optionally be substituted with halogens 1 to 3 times; R y Selected from halogens, H, =O, NH2, CN, C 1~6 Alkyl, C 1~6 alkoxy, 3-6 membered cycloalkyl, 3-6 membered heterocyclic group, wherein C 1~6 Alkyl groups, 3- to 6-membered cycloalkyl groups, and 3- to 6-membered heterocyclic groups may optionally be substituted with halogens 1 to 3 times; The conditions are: R5 in the compound described in (IB) is not a halogen; as well as When X1 in the compound described in (IB) is CH, W and X2 are both N, q is 1, and R1 is R3, R5, and R7 are all H, R4 is an unsubstituted 3- to 8-membered cycloalkyl group, and R8 is an unsubstituted C. 1~3 When alkyl, the -L2-R2 moiety in the compound of (IB) is not -CF2CH3, and further not any haloalkyl; and When R5 in the compound described in (IB) is C 1~3 Alkyl and L2 is -(CR) a R b ) p - When, then R in L2 a and R b They are not both halogens.

2. The compound according to claim 1 or a pharmaceutically acceptable salt or isomer thereof, wherein R8 is selected from C 1~3 Alkyl, C 1~3 Haloalkyl, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, wherein the heteroatom in the heterocycle is selected from one or more of N, O, and S; Preferably, R8 is selected from CH3, -CHF2, -CH2F, -CF3, More preferably CH3, -CH2F, 3. The compound according to claim 1 or 2, or a pharmaceutically acceptable salt or isomer thereof, wherein the compound of claim (IA) is represented by formula (Ia), and the compound of claim (IB) is represented by formula (Ib): in: wavy lines Indicates forward and reverse, that is It can be X1 and X2 are independently selected from N, CR6, or C, respectively; X3 and X4 are independently selected from N, CR6, or C, respectively; wherein X3 and X4 are not both N at the same time; W is selected from N, CR6, or C; Ring A is selected from 3-7 membered carbon rings, 4-10 membered heterocycles, 5-10 membered aromatic heterocycles or 6-10 membered aromatic rings, wherein the heteroatom in the heterocycle is selected from one or more of N, O and S; R0 is selected from hydrogen, halogen, cyano, oxo, amino, hydroxyl, C 1~3 Alkyl, C 1~3 Alkoxy, 3-6 membered cycloalkyl, 3-6 membered heterocyclic, C 1~3 Alkoxy-3 to 6-membered cycloalkyl; when n is greater than or equal to 2, any two adjacent R0s can form a 3 to 7-membered carbon ring, a 4 to 7-membered heterocyclic ring, a 6-membered aromatic ring, or a 5 to 6-membered heteroaromatic ring with ring A; wherein R0 can optionally be substituted with halogens 1 to 6 times; R1 is H or L1-R w , wherein R w Selected from 3- to 8-membered cycloalkyl groups, 4- to 10-membered heterocyclic groups, C 1~6 Alkyl, phenyl, 5-10 heteroaryl, N(R) a 2. NR a R b SR a OR b And L1 is selected from single bonds, -(CR a R b ) p -、-NR a -、-O-、-C(=O-、-(CR) a R b ) p -O-、-C(=O)-、-C(=O)NR a -、-O-NR a -, -S-, -S(=O)-, -S(=O)2-, and wherein R1 may optionally be R x Replace 1 to 3 times; R2 is selected from hydrogen, C 1~6 Alkoxy, C 2~6 Alkenyl, 3-8 membered cycloalkyl, 4-10 membered heterocyclic, 5-10 membered heteroaryl, wherein R2 may optionally be replaced by R y Replace 1 to 3 times; L2 is selected from single bond, -(CR a R b ) p -、-NR a -、-O-、-C(=O-、-(CR) a R b ) p -O-、-C(=O)-、-C(=O)NR a -、-O-NR a -,-S-,-S(=O)-,-S(=O)2-,wherein R in L2 a With R b Ke Cheng Any two adjacent R0s may optionally form a ring A, provided that the valence allows, wherein ring A is selected from 3- to 10-membered carbon rings, 4- to 10-membered heterocycles, 5- to 10-membered aromatic heterocycles, or benzene rings, wherein the heteroatom in the heterocycle is optionally selected from one or more of N, O, and S, and wherein ring A may optionally be divided by R x Replace 1 to 3 times; R3 is selected from H and C. 1~3 alkyl; R4 is L0-R v The R v Selected from H, C 1~6 Alkyl, 3-8 membered cycloalkyl, 6-8 membered bridged cycloalkyl, 6-10 membered spirocycloalkyl, 6-10 membered fused cycloalkyl, 4-6 membered heterocyclic, 6-8 membered bridged heterocyclic, 6-10 membered bicyclic heterocyclic, 5-6 membered heteroaryl, phenyl, wherein the heteroatom in the heterocycle is selected from one or more of N, O, and S, and the C 1~6 The carbon atom in the alkyl group may optionally be replaced by a heteroatom, wherein the heteroatom is optionally selected from one or more of N, S, and O; wherein the R4 is optionally replaced by R x Replaced 1 to 3 times; the L0 is selected from single bonds, -(CR a R b ) p -、-NR a -、-O-、-S-、-(CR a R b ) p -O-、-(CR a R b ) p -S-、-(CR a R b ) p -C(=O)-, -C(=O)-, -C(=O)NR a -、-(CR a R b ) p -C(=O)NR a -、-CR a R b -NR a -; Any two R4s may optionally form a ring D, wherein the ring D is selected from 3- to 6-membered carbon rings or 4- to 6-membered heterocycles, wherein the heteroatoms in the heterocycle are optionally selected from one or more of N, O, and S, and wherein the ring D is optionally substituted with a halogen 1 to 3 times. Optionally, R3 and R4 can form a ring E, provided that the valence allows, wherein the ring E is selected from 4- to 6-membered nitrogen-containing heterocycles; R5 is selected from H and C. 1~3 Alkyl groups, halogens; R6 is selected from hydrogen, halogen, cyano, oxo, amino, hydroxyl, C 1~3 Alkyl, C 1~3 Alkoxy, cyclopropyl; R7 is selected from H and C. 1~3 Alkyl groups, halogens; Optionally, R3 and R7 can form a ring F under the condition that the valence allows, wherein the ring F is selected from 4- to 6-membered nitrogen-containing heterocycles; n is selected from 1, 2, 3, or 4; p is independently selected from 1, 2, or 3; q is selected independently from 1, 2, or 3; R a Independently selected from H and C 1~6 Alkyl, C 1~6 Halogenated alkyl groups; R b Independently selected from H and C 1~6 Alkyl, 3-6 membered cycloalkyl, 4-6 membered heterocyclic; R x Selected from halogens, OH, =O, NH2, CN, C 1~3 Alkyl, C 1~3 alkenyl, C 1~3 Alkoxy, cyclopropyl, wherein the C 1~3 Alkyl, C 1~3 alkenyl, C 1~3 The alkoxy and cyclopropyl groups may optionally be substituted with halogens 1 to 3 times; R y Selected from halogens, H, =O, NH2, CN, C 1~6 Alkyl, C 1~6 alkoxy, 3-6 membered cycloalkyl, 3-6 membered heterocyclic group, wherein C 1~6 Alkyl groups, 3- to 6-membered cycloalkyl groups, and 3- to 6-membered heterocyclic groups may optionally be substituted with halogens 1 to 3 times.

4. The compound according to any one of claims 1-3, or a pharmaceutically acceptable salt or isomer thereof, wherein: R x Selected from halogens, OH, =O, NH2, CN, C 1~3 Alkyl, C 1~3 Alkoxy, cyclopropyl, wherein the C 1~3 Alkyl, C 1~3 The alkoxy and cyclopropyl groups may optionally be substituted with halogens 1 to 3 times; and R y Selected from halogens, H, =O, NH2, CN, C 1~6 Alkyl, C 1~3 alkenyl, C 1~6 alkoxy, 3-6 membered cycloalkyl, 3-6 membered heterocyclic group, wherein C 1~6 Alkyl, C 1~3 Alkenyl, 3- to 6-membered cycloalkyl and 3- to 6-membered heterocyclic groups may optionally be substituted with halogens 1 to 3 times.

5. The compound according to any one of claims 1-4, or a pharmaceutically acceptable salt or isomer thereof, wherein: R4 is L0-R v The R v Selected from H, C 1~6 Alkyl, 3-6 membered cycloalkyl, 4-6 membered heterocyclic, 5-6 membered heteroaryl, phenyl, wherein the heteroatom in the heterocycle is selected from one or more of N, O, and S, and the C 1~6 The carbon atom in the alkyl group may optionally be replaced by a heteroatom, wherein the heteroatom is optionally selected from one or more of N, S, and O; wherein the R4 is optionally replaced by R x Replaced 1 to 3 times; the L0 is selected from single bonds, -(CR a R b ) p -、-NR a -、-O-、-S-、-(CR a R b ) p -O-、-(CR a R b ) p -S-、-(CR a R b ) p -C(=O)-, -C(=O)-, -C(=O)NR a -、-(CR a R b ) p -C(=O)NR a -、-CR a R b -NR a -;and R x Selected from halogens, OH, =O, NH2, CN, C 1~3 Alkyl, C 1~3 Alkoxy, cyclopropyl, wherein the C 1~3 Alkyl, C 1~3 The alkoxy and cyclopropyl groups may optionally be substituted with halogens 1 to 3 times.

6. The compound according to any one of claims 1-5, or a pharmaceutically acceptable salt or isomer thereof, wherein: R1 is selected from Preferred And / or, X1 is selected from N or CH, preferably CH; and / or, W is selected from N, CH, CF, CCl, C(CN), C(CH3), C(=O), C(NH2); and / or, L1 is selected from single bonds, -CH2-, -O-, -C(=O)-, -NH-, -CH2NH-, -CH2CH2-, -CH(CH3)-, -C(CH3)2-, -CHF-, -CF2-, -CH2O-, -O-NH-, preferably -O-; and / or, X2 is selected from N and CR6, where R6 is selected from halogen, cyano, amino, hydroxyl, C 1~3 Alkyl, C 1~3 Alkoxy groups, preferably halogen, cyano, amino, hydroxyl, or C... 1~3 Alkyl, C 1~3 Alkyl groups, more preferably F, Cl, cyano, amino, hydroxyl, or methoxy groups; and / or, X3 is selected from N and C; and / or, X4 is C; and / or, L0 is selected from single bonds, -CH2-, -CH2CH2-, -CH2O-, -CH2CH2O-, -C(CH3)O-, -CH2S-, -CH2C(O)-, -CH2C(O)NH-, -CH2C(O)N(CH3)-, preferably single bonds and -CH2O-; and / or, R w Selected from phenyl, pyridyl, pyrazinyl, pyrimidinyl, cyclopentadienyl, pyrroleyl, imidazolyl, pyrazolyl, thienyl, cyclopentyl, cyclohexyl, azacyclopentyl, azacyclohexyl, preferably phenyl, thienyl, cyclopentyl, cyclohexyl; and / or, R0 is selected from hydrogen, halogen, cyano, oxo, amino, hydroxyl, C 1~3 Alkyl, C 1~3 Haloalkyl, C 1~3 Alkoxy, C 2~4 alkenyl, C 2~4 Haloalkenyl, 3-6 membered cycloalkyl, 3-6 membered halocycloalkyl, 3-6 membered heterocycloalkyl, -CR c R d -C 1~3 Alkyl, -CR c R d -C 1~3 Halogenated alkyl groups and -(CR) e R f ) m -3 to 6-membered cycloalkyl groups, preferably hydrogen, halogen, cyano, oxo, amino, hydroxyl, C 1~3 Alkyl, C 1~3 Alkoxy, cyclopropyl, methyl-cyclopropyl, cyclobutyl, oxecyclobutyl, cyclopentyl.

7. The compound according to any one of claims 1-6, or a pharmaceutically acceptable salt or isomer thereof, wherein: R0 is selected from hydrogen, halogen, amino group, C 1~3 Alkyl, C 1~3 Haloalkyl, C 2~4 alkenyl, C 2~4 Haloalkenyl, 3-6 membered cycloalkyl, 3-6 membered halocycloalkyl, -CR c R d -C 1~3 Alkyl, -CR c R d -C 1~3 Halogenated alkyl groups and -(CR) e R f ) m -3 to 6-membered cycloalkyl groups, preferably hydrogen, F, Cl, amino, methyl, ethyl, propyl, isopropyl, -CH2F, -CHF2, -CHF3, -CH2CF3, -CH(CH3)CF3, -CH=CH2, -CH2CH=CH2, -C(CH3)=CH2, -CH2CH2CH=CH2, -CH2CH2=CHCH3, -CH2CH=CF2, -C(CH3=CF2), -C(CF3=CH2, -CH2CH2=CHCF3. And / or, n is 1 or 2; and / or, R v Selected from C 1~3 Alkyl groups and 3- to 6-membered cycloalkyl groups, preferably CH3, 8. The compound of formula (Ia) or (Ib) according to any one of claims 1-7, or a pharmaceutically acceptable salt or isomer thereof, wherein: The ring A is selected from Preferred And / or, Structural unit Selected from Preferred And / or, When n is greater than or equal to 2, any two adjacent R0s can form 3-7 membered carbon rings, 4-7 membered heterocyclic rings, 6 membered aromatic rings, or 5-6 membered heteroaromatic rings with ring A; wherein R0s can optionally be substituted with halogens 1-6 times; and / or, When n is greater than or equal to 2, when two adjacent R0 atoms replace the same atom, any two adjacent R0 atoms can form a 3-7 membered carbon ring, a 4-7 membered heterocyclic ring, a 6 membered aromatic ring, or a 5-6 membered heteroaromatic ring with ring A, wherein the 3-7 membered carbon ring is selected from... The 4- to 7-membered heterocycles are selected from The 6-membered aromatic ring is selected from The 5- to 6-membered aromatic heterocycles are selected from And / or, When n is greater than or equal to 2, any two adjacent R0s can form a ring with ring A to form a structural unit. And / or, L2 is selected from single bonds, -CH2-, -O-, -C(=O)-, -NH-, -N(CH3)-, -CH2NH-, -NHCH(CH3)-, -CH2CH2-, -CH(CH3)-, -C(CH3)2-, -CH(CF3)-, -CHF-, -CF2-, -CH2O-, -CH2CH2NH-, Preferred single bonds, -NH-, -N(CH3)-, -CHF-, -CF2-, more preferably single bonds, -N(CH3)-, -CF2-; and / or, R2 is selected from C 1~6 Alkyl, 3-6 membered cycloalkyl, 4-6 membered heterocycloalkyl, preferably CH3, CH2CH3, CH(CH3)2, C(CH3)3, cyclopropyl, The R2 can be optionally replaced by R y Replace 1 to 3 times; and / or, R y =O,C 1~3 Alkyl or C 1~3 Halogenated alkyl group, preferably =O, CH3 or CF3.

9. The compound of formula (Ia) or (Ib) according to any one of claims 1-8, or a pharmaceutically acceptable salt or isomer thereof, wherein, The R4 mentioned is selected from CH3, CH2CH3, CH(CH3)2, CH2OCH3, CH2SCH3, CH(CH3)OCH3、 CH2CHF2, CH2CH2F, CH2CN, CH2OCHF2, CH2OCH2F, Preferably selected from And / or, Any two R4s may optionally form a ring D, wherein the ring D is selected from 3- to 6-membered carbon rings or 4- to 6-membered heterocycles, and the ring D is selected from And / or, R5 is H; and / or, R3 is H; and / or, R7 is H; and / or, R3 and R4 may optionally form a ring E, provided that the valence allows, wherein the ring E is selected from 4- to 6-membered nitrogen-containing heterocycles, and preferably selected from... And / or, R3 and R7 may optionally form ring F, provided that the valence allows, wherein ring F is selected from 4- to 6-membered nitrogen-containing heterocycles, and preferably selected from... And / or, R x The components are selected from -CH3, -CH2CH3, =O, halogen, -OH, -NH2, -CN, cyclopropyl, -CHF2, -CH2F, -CF3, =CH2, =CHF, =CF2, -OCH3, -OCHF2, with F, Cl, =O, =CH2, =CHF, and =CF2 being preferred.

10. The compound according to any one of claims 1-9, or a pharmaceutically acceptable salt or isomer thereof, wherein: The compound has a structure as shown in formula (I'-a) or (I'-b): The remaining definitions are as described in any one of claims 1 to 9; and / or, The compound has a structure as shown in formula (II-a) or formula (II-b): The remaining definitions are as described in any one of claims 1 to 9; and / or, The compound has a structure as shown in formula (III-a) or (III-b): The remaining definitions are as described in any one of claims 1 to 9; and / or, The compound has a structure as shown in formula (IV-a) or (IV-b): The remaining definitions are as described in any one of claims 1 to 9.

11. The compound of claim 1 or a pharmaceutically acceptable salt or isomer thereof, wherein the compound has the following structure: Preferably, the compound is selected from:

12. A pharmaceutical composition comprising a compound as described in any one of claims 1 to 11 or a pharmaceutically acceptable salt or isomer thereof, and a pharmaceutically acceptable carrier, excipient or diluent.

13. Use of the compound of any one of claims 1 to 11 or a pharmaceutically acceptable salt or isomer thereof in the preparation of a WRN inhibitor-related medicament; and / or use of the compound of any one of claims 1 to 11 or a pharmaceutically acceptable salt or isomer thereof in the preparation of a medicament for the treatment and / or prevention of WRN-mediated diseases or conditions and related diseases or conditions.

14. A method for preventing and / or treating an individual's WRN-mediated disease or condition and related diseases or conditions, comprising administering to the individual a therapeutically effective amount of the compound according to any one of claims 1 to 11 or a pharmaceutically acceptable salt or isomer thereof.

15. The use according to claim 13 or the method according to claim 14, wherein the WRN-mediated disease or condition and related diseases or conditions are cancer or tumors, wherein the cancer or tumor is characterized by high microsatellite instability (MSI-H) and mismatch repair defect (dMMR).

16. The use according to claim 13 or the method according to claim 14, wherein the WRN-mediated disease or condition and related diseases or conditions are cancer or tumors, wherein the cancer or tumor is selected from colorectal cancer, gastric cancer, endometrial cancer, adrenocortical carcinoma, uterine cancer, uterine squamous cell carcinoma, cervical cancer, esophageal cancer, breast cancer, kidney cancer, clear cell renal cell carcinoma, liver cancer, biliary tract cancer, gallbladder cancer, colonic adenocarcinoma, rectal adenocarcinoma, urinary tract cancer, prostate cancer, ovarian cancer, uterine sarcoma, mesothelioma, brain cancer, and skin cancer.