RNA inhibitor for inhibiting expression of insulin-like growth factor 1 receptor gene
By designing RNA inhibitors that are complementary to IGF-1R mRNA, the systemic side effects of IGF-1R targeting inhibitors have been addressed, providing a locally administered IGF-1R siRNA therapy that alleviates thyroid eye disease and osteoarthritis, with the therapeutic advantages of long-lasting effects and low side effects.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- VISIRNA THERAPEUTICS (SUZHOU) CO LTD
- Filing Date
- 2025-12-12
- Publication Date
- 2026-06-18
AI Technical Summary
Existing IGF-1R targeting inhibitors such as Tepezza have serious side effects due to systemic administration, and locally administered IGF-1R siRNA has not yet been widely used in the treatment of thyroid eye diseases and tumors.
An RNA inhibitor of IGF-1R gene expression has been developed. By designing an antisense strand to form a complementary region with IGF-1R mRNA, the expression of IGF-1R protein is inhibited. The siRNA drug is administered topically to alleviate symptoms of thyroid ophthalmopathy and osteoarthritis, and has potential applications in cancer treatment.
It achieves strong efficacy, few side effects, long duration of efficacy, low dosage, and minimal injection reaction, improving drug accessibility and delivery efficiency, and is suitable for patients with good compliance.
Smart Images

Figure PCTCN2025142165-FTAPPB-I100001 
Figure PCTCN2025142165-FTAPPB-I100002 
Figure PCTCN2025142165-FTAPPB-I100003
Abstract
Description
RNA inhibitors used to suppress insulin-like growth factor 1 receptor gene expression Technical Field
[0001] This application relates to the field of biomedicine, specifically to an RNA inhibitor and its conjugate for inhibiting the expression of the insulin-like growth factor 1 receptor gene. Background Technology
[0002] RNA interference (RNAi) technology refers to the highly conserved evolutionary phenomenon of efficient and specific degradation of homologous mRNA induced by double-stranded RNA (dsRNA). RNA molecules inhibit gene expression by disrupting specific mRNAs. Because RNAi technology can specifically knock out or shut down the expression of specific genes, it has rapidly become one of the most popular research tools in gene function research and gene therapy, and is widely used to explore gene function and treat metabolic diseases, infectious diseases, and malignant tumors.
[0003] Thyroid ophthalmopathy (TED) is an autoimmune disease caused by hyperthyroidism. It results from the activation of IGF-1R-mediated signaling complexes on orbital cells by autoantigens, leading to the body's autoimmune system attacking the tissues surrounding and behind the eyes. Symptoms include enlargement of the extraocular muscles, adipose tissue, and connective tissue, producing symptoms such as dry eyes, bulging eyeballs, enlarged eyelids, diplopia, strabismus, gritty or stinging pain, excessive tearing, redness and swelling, and difficulty moving the eyes. In severe cases, it can lead to facial disfigurement and vision impairment.
[0004] IGF-1R (Insulin-like growth factor 1 receptor) is a tetrameric transmembrane receptor tyrosine kinase found on the surface of human cells and is the cell surface receptor for IGF-1 (the hormone insulin-like growth factor 1). Studies have shown that IGF-1R is widely expressed in normal human tissues and is highly expressed in thyroid eye disease (TED). Activation of IGF-1R can stimulate cell proliferation, survival, transformation, metastasis, and angiogenesis, while inhibition of IGF-1R can alleviate and improve the symptoms of TED. Tepezza (Teprotumumab), the world's first drug for the treatment of chronic (inactive) thyroid eye disease (TED) developed by Horizon Therapeutics, has been approved by the FDA for marketing in the United States. This drug is a fully human monoclonal antibody (mAb) and an IGF-1R targeted inhibitor. Unlike other biologics such as anti-CD20 antibodies that only reduce inflammation in the treatment of TAO, Tepezza can not only eliminate inflammation but also effectively reduce bulging of the eyeball. Patients treated with Tepezza experienced an unprecedented reduction in bulging of the eyeballs, a condition previously only treatable surgically after the active disease had subsided. However, Tepezza also has serious safety concerns, with the most common adverse reactions including muscle spasms, hearing loss, and hyperglycemia. These adverse reactions may be due to systemic administration of the drug.
[0005] Developing locally administered IGF-1R siRNAs is currently a solution to the safety concerns associated with monoclonal antibodies. siRNA-based drugs, due to their long-lasting effect, can allow for longer dosing cycles, resulting in better patient adherence. Furthermore, IGF-1R is a crucial driver of tumor growth and development, and developing IGF-1R-targeting siRNAs holds broad potential applications in cancer therapy. Summary of the Invention
[0006] This application provides an RNA inhibitor that inhibits IGF-1R gene expression, offering a novel and effective therapy for thyroid eye disease, osteoarthritis, and neuropathic pain. IGF-1R is a tetrameric transmembrane receptor tyrosine kinase found on the surface of human cells and is the cell surface receptor for IGF-1. The IGF-1R gene expression RNA inhibitor provided in this application can disrupt the function of IGF-1R mRNA as a translation template, inhibit IGF-1R protein expression, and alleviate and improve symptoms of thyroid eye disease, osteoarthritis, and neuropathic pain. The siRNA drug provided in this application has one or more of the following therapeutic advantages: strong efficacy, few side effects, long duration of action, low dosage, minimal injection reaction, and expected good patient compliance. Furthermore, siRNA drugs, through rational formulation, can improve drug accessibility and delivery efficiency.
[0007] On one hand, this application provides an RNA inhibitor that inhibits the expression of insulin-like growth factor 1 receptor (IGF-1R) gene, comprising an antisense strand, wherein the antisense strand forms a complementary region with at least 15 consecutive nucleotides in the mRNA encoding IGF-1R (SEQ ID NO:828), the complementary region having 0, 1, 2, 3, 4 or 5 mismatches, preferably the length of the complementary region is 15-30 nucleotide pairs, more preferably 17-23 nucleotide pairs.
[0008] In some embodiments, the antisense strand and the mRNA encoding IGF-1R (SEQ ID NO: 828) form a complementary region starting from any of the following positions, counted from the 5' end: 15, 16, 17, 18, 19, 20, 21, 22, or 23 consecutive nucleotides:
[0009] Nucleotide positions 1118, 1120, 1154, 1367, 1407, 1415, 1532, 1625, 1627, 1628, 1631, 3356, 3357, 3359, 3792, 4198, 4200, 4208, 4685, 5246, 5392, 5393, 6329, 6332, and 6333. Nucleotide positions 6334, 10215, 10738, 10740, 10770, 10772, 10773, 10946, 10956, 10957, 1418, 1541, 2050, 2055, 2056, 2233, 2234, 2456, 2591, 2603, 2606, 2609, 2776, and 2890. Nucleotide positions 2906, 2909, 2957, 2960, 3008, 3195, 3398, 3608, 3609, 3650, 3660, 3815, 3882, 3996, 4067, 4121, 4122, 4292, 4293, 4295, 4516, 4519, 5163, 5309, and 5310. Nucleotide positions 5377, 5380, 5381, 5663, 5700, 5711, 5712, 5721, 5896, 5898, 6203, 6236, 6237, 6240, 6245, 6288, 6299, 6305, 6309, 6310, 6343, 6363, 6365, 6366, and 6373.Nucleotide positions 6379, 6381, 6431, 6434, 6496, 6518, 6755, 6760, 6883, 6885, 6947, 6948, 6949, 6952, 6953, 6954, 7574, 7621, 7764, 7830, 7906, 8540, 8836, 8892, and 8975 (nucleotides) Acid, nucleotide at position 8977, nucleotide at position 9163, nucleotide at position 9175, nucleotide at position 9186, nucleotide at position 9265, nucleotide at position 9267, nucleotide at position 9340, nucleotide at position 9347, nucleotide at position 9352, nucleotide at position 9356, nucleotide at position 9478, nucleotide at position 9480, nucleotide at position 9606, nucleotide at position 9611, nucleotide at position 9634, nucleotide at position 9680, nucleotide at position 9681, nucleotide at position 9724, nucleotide at position 9725, nucleotide at position 9814, nucleotide at position 10015, nucleotide at position 10016, nucleotide at position 10189, nucleotide at position 10244, nucleotide at position 10 Nucleotide 266, nucleotide 10490, nucleotide 10526, nucleotide 10528, nucleotide 10534, nucleotide 10535, nucleotide 10537, nucleotide 10540, nucleotide 10541, nucleotide 10679, nucleotide 10694, nucleotide 10717, nucleotide 10728, nucleotide 10729, nucleotide 10730, nucleotide 10754, nucleotide 10763, nucleotide 10766, nucleotide 10942, nucleotide 11034, nucleotide 11078, nucleotide 11126, nucleotide 11156 Nucleotide positions 11159, 11160, 11292, 11340, 11344, 11383, 11395, 11789, 11864, 11865, 11939, 12092, 12116, 12130, 12154, 12156, 12177, 12195, 1164, 1163, 1162, 1161, and 1160.Nucleotide 1165, nucleotide 1166, nucleotide 1167, nucleotide 1168.
[0010] In some embodiments, the antisense strand and the mRNA (SEQ ID NO:828) encoding IGF-1R form a complementary region consisting of 15, 16, 17, 18, 19, 20, 21, 22 or 23 consecutive nucleotides starting from the 6366th nucleotide at the 5' end.
[0011] In some embodiments, the antisense strand and the mRNA (SEQ ID NO: 828) encoding IGF-1R, starting at nucleotide 6366 from the 5' end, have 75%, 80%, 90%, 95%, or 100% complementarity for the following 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides.
[0012] In some embodiments, the sequences between the antisense strand and the mRNA (SEQ ID NO: 828) encoding IGF-1R at positions 1160 and 1188, 6235 and 6465, or 6329 and 6455, starting from the 5' end, form complementary regions.
[0013] In some embodiments, the RNA inhibitor is ribonucleic acid (RNA), and further, the RNA inhibitor is single-stranded RNA or double-stranded RNA.
[0014] In some embodiments, the RNA inhibitor is an antisense oligonucleotide (ASO), shRNA, miRNA, or siRNA.
[0015] In some embodiments, it includes a sense strand capable of forming a complementary double strand with the antisense strand, wherein the antisense strand includes a sequence forming a double-stranded complementary region with at least 15 consecutive nucleotides in the sense strand sequence, the double-stranded complementary region having 0, 1, 2, 3, 4 or 5 mismatches, preferably the double-stranded complementary region being 15-30 nucleotide pairs in length, more preferably 17-23 nucleotide pairs.
[0016] In some embodiments, the sense and antisense strands exist on two different nucleic acid strands, and the RNA inhibitor is preferably siRNA or shRNA, more preferably siRNA.
[0017] In some embodiments, the sense and antisense strands exist on the same nucleic acid strand, and the preferred RNA inhibitor is shRNA.
[0018] In some embodiments, the total length of the positive strand is 15-50 nucleotides, preferably 16-30 nucleotides, and more preferably 17, 18, 19, 20 or 21 nucleotides.
[0019] In some embodiments, the total length of the antisense strand is 19-50 nucleotides, preferably 19-30 nucleotides, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides, and more preferably 26-30 nucleotides.
[0020] In some embodiments, the sense strand and the antisense strand are each optionally independently composed of a 3' or 5' overhang of 1, 2 or 3 nucleotides.
[0021] In some embodiments, both the sense strand and the antisense strand have a 3' overhang of 1-3 nucleotides in length, or the sense strand has a 3' or 5' overhang of 1-3 nucleotides in length, or the antisense strand has a 3' or 5' overhang of 1-3 nucleotides in length.
[0022] In some embodiments, the RNA wherein the antisense strand comprises at least 15 consecutive nucleotides of the sequence as described in any one of SEQ ID NO:199-400.
[0023] In some embodiments, the antisense strand comprises at least 15 consecutive nucleotides of the sequence shown in SEQ ID NO:296 (AAUAUCUGAACCGUAAAAAAG).
[0024] In some embodiments, the antisense strand comprises at least 19, 20, or 21 consecutive nucleotides of the sequence shown in SEQ ID NO:296 (AAUAUCUGAACCGUAAAAAAG).
[0025] In some embodiments, the antisense chain comprises the following sequence: 5'-(Z5)Z(Z1)(Z2)AUAUCUGAACCGUAAAAAAG(Z3)(Z4)-3' (SEQ ID NO 835), wherein Z5, Z, Z1, Z2, Z3 and Z4 each independently represent A, U, C or G.
[0026] In some implementations, Z is G.
[0027] In some implementations, Z2 is A or U.
[0028] In some implementations, Z1 is A or U.
[0029] In some implementations, Z5 is C.
[0030] In some implementations, Z3 and / or Z4 are C or U; optionally, both Z3 and Z4 are U.
[0031] In some embodiments, the antisense strand comprises a sequence that differs from the following sequence by no more than two or one nucleotide: 5'-CGAAAUAUCUGAACCGUAAAAAAGUU-3' (SEQ ID NO:411).
[0032] In some embodiments, the nucleotide difference is located at any position among positions 1-4, 5-24, or 25-26 starting from the 5' end of SEQ ID NO:411.
[0033] In some embodiments, the antisense strand comprises the following sequence: 5'-CGAAAUAUCUGAACCGUAAAAAAGUU-3' (SEQ ID NO:411).
[0034] In some embodiments, the antisense chain includes the sequence 5'-M(0-4)-CGAAAUAUCUGAACCGUAAAAAAGUU-3', where each M independently represents A, U, C or G.
[0035] In some embodiments, the RNA inhibitor wherein the positive strand comprises at least 15 consecutive nucleotides of the sequence as described in any one of SEQ ID NO:1-198.
[0036] In some embodiments, the RNA inhibitor comprises a double strand selected from the following: ds-n1, ds-n2, ds-n3, ds-n4, ds-n5, ds-n6, ds-n7, ds-n8, ds-n9, ds-n10, ds-n11, ds-n12, ds-n13, ds-n14, ds-n15, ds-n16, ds-n17, ds-n18, ds-n19, ds-n20, ds-n21, ds-n22, ds-n23, ds-n24, ds-n25, ds-n26, ds-n27, ds-n28, ds-n29, ds-n30, ds-n31, ds-n32, ds-n33, ds-n4, ds-n5, ds-n6, ds-n7, ds-n8, ds-n ...34, ds-n35, ds-n26, ds-n27, ds-n28, ds-n29, ds-n30, ds-n31, ds-n32, ds-n33, ds-n34, ds- s-n33, ds-n34, ds-n35, ds-n36, ds-n37, ds-n38, ds-n39, ds-n40, ds-n41, ds-n42, ds-n43, ds-n44, ds-n45, ds-n46, ds-n47, ds-n48, ds-n49, ds-n50 , ds-n51, ds-n52, ds-n53, ds-n54, ds-n55, ds-n56, ds-n57, ds-n58, ds-n5 9. ds-n60, ds-n61, ds-n62, ds-n63, ds-n64, ds-n65, ds-n66, ds-n67, ds-n6 8. ds-n69, ds-n70, ds-n71, ds-n72, ds-n73, ds-n74, ds-n75, ds-n76, ds-n 77. ds-n78, ds-n79, ds-n80, ds-n81, ds-n82, ds-n83, ds-n84, ds-n85, ds- n86, ds-n87, ds-n88, ds-n89, ds-n90, ds-n91, ds-n92, ds-n93, ds-n94, ds -n95, ds-n96, ds-n97, ds-n98, ds-n99, ds-n100, ds-n101, ds-n102, ds-n10 3. ds-n104, ds-n105, ds-n106, ds-n107, ds-n108, ds-n109, ds-n110, ds-n 111, ds-n112, ds-n113, ds-n114, ds-n115, ds-n116, ds-n117, ds-n118, ds- n119, ds-n120, ds-n121, ds-n122, ds-n123, ds-n124, ds-n125, ds-n126, d s-n127, ds-n128, ds-n129, ds-n130, ds-n131, ds-n132, ds-n133, ds-n134,ds-n135, ds-n136, ds-n137, ds-n138, ds-n139, ds-n140, ds-n141, ds-n142, ds-n 143, ds-n144, ds-n145, ds-n146, ds-n147, ds-n148, ds-n149, ds-n150, ds-n151, ds-n152, ds-n153, ds-n154, ds-n155, ds-n156, ds-n157, ds-n158, ds-n159, ds-n 160, ds-n161, ds-n162, ds-n163, ds-n164, ds-n165, ds-n166, ds-n167, ds-n168, ds-n169, ds-n170, ds-n171, ds-n172, ds-n173, ds-n174, ds-n175, ds-n176, ds-n 177, ds-n178, ds-n179, ds-n180, ds-n181, ds-n182, ds-n183, ds-n184, ds-n185, ds-n186, ds-n187, ds-n188, ds-n189, ds-n190, ds-n191, ds-n192, ds-n193, ds-n 194, ds-n195, ds-n196, ds-n197, ds-n198, ds-n201, ds-n202, ds-n203, ds-n204. ,
[0037] In some embodiments, the RNA inhibitor comprises a double strand selected from the following: ds-n17, ds-n23, ds-n31, ds-n39, ds-n45, ds-n58, ds-n60, ds-n64, ds-n67, ds-n68, ds-n73, ds-n74, ds-n76, ds-n77, ds-n80, ds-n81, ds-n83, ds-n84, ds-n86, ds-n88, ds-n89, ds-n98. , ds-n99, ds-n103, ds-n104, ds-n112, ds-n113, ds-n115, ds-n153, ds-n154, ds-n156, ds-n157, ds-n163, ds-n 164, ds-n165, ds-n188, ds-n190, ds-n191, ds-n192, ds-n193, ds-n194, ds-n195, ds-n196, ds-n197, ds-n198.
[0038] In some embodiments, the NA inhibitor comprises a double strand selected from the following: ds-n17, ds-n23, ds-n31, ds-n39, ds-n45, ds-n58, ds-n60, ds-n64, ds-n67, ds-n68, ds-n73, ds-n74, ds-n76, ds-n77, ds-n80, ds-n81, ds-n83. , ds-n84, ds-n86, ds-n88, ds-n89, ds-n98, ds-n99, ds-n103, ds-n104, ds-n112, ds-n11 3. ds-n115, ds-n153, ds-n154, ds-n156, ds-n157, ds-n163, ds-n164, ds-n165, ds-n188.
[0039] In some embodiments, the RNA inhibitor comprises a double strand selected from the following: ds-n23, ds-n58, ds-n67, ds-n86, ds-n89, ds-n98, ds-n99, ds-n103, ds-n190, ds-n198, ds-n113.
[0040] In some embodiments, the RNA inhibitor is characterized in that the antisense strand further includes region B1 at its 3' end, and the sense strand further includes region A1 at its 5' end, wherein region A1 is 0-6 nucleotides and region B1 is 0-6 nucleotides.
[0041] In some embodiments, the RNA inhibitor is characterized in that region B1 is 0, 1, 2, 3, 4, 5 or 6 nucleotides; preferably, region B1 is 0 or 2 nucleotides.
[0042] In some embodiments, the RNA inhibitor is characterized in that the region A1 is 0, 1, 2, 3, 4, 5 or 6 nucleotides; preferably, the region A1 is 0 or 2 nucleotides.
[0043] In some embodiments, the RNA inhibitor is characterized in that the antisense strand further includes region X2 at its 5' end, and the sense strand or sense nucleic acid further includes region X1 at its 3' end, with regions X1 and X2 being complementary.
[0044] In some embodiments, the RNA inhibitor is wherein X1 is A, U, modified A or modified U, and X2 is U, A, modified U or modified A.
[0045] In some embodiments, the RNA inhibitor is characterized in that the antisense strand contains X2, Y, Z and N sequentially in the 3' to 5' direction at its 5' end, wherein X2 and Y are respectively independently A, U, modified A or modified U, Z is G or modified G, and N contains at least one nucleotide.
[0046] In some embodiments, the RNA inhibitor wherein X2, Y, and Z are AAG, AUG, UUG, or UAG in the 3' to 5' directions, or the above sequences are partially or fully modified.
[0047] In some embodiments, the RNA inhibitor wherein X2, Y, and Z are AAG, AUG, UUG, or UAG in the 3' to 5' directions, or the above sequences are partially or fully modified.
[0048] In some embodiments, the RNA inhibitor is wherein N is C or a modified C.
[0049] In some embodiments, the RNA inhibitor wherein X2, Y, Z and N are AAGC and UAGC in the 3' to 5' directions, or the above sequences are partially or fully modified.
[0050] In some embodiments, the RNA inhibitor wherein the antisense strand comprises at least 15 consecutive nucleotides of the sequence as described in any one of SEQ ID NO:401-413.
[0051] In some embodiments, the RNA inhibitor is selected from ds-n190-1, ds-n191-1, ds-n192-1, ds-n193-1, ds-n194-1, ds-n195-1, ds-n196-1, ds-n197-1, ds-n198-1, ds-n201-1, ds-n202-1, ds-n203-1, and ds-n204-1.
[0052] In some embodiments, the RNA inhibitor is wherein at least one nucleotide in the RNA inhibitor is a modified nucleotide.
[0053] In some embodiments, the RNA inhibitor is wherein at least 70%, 80%, 90%, or 95% of the nucleotides in the RNA inhibitor are modified nucleotides; preferably, all nucleotides are modified nucleotides.
[0054] In some embodiments, the RNA inhibitor, wherein the modification comprises one or more combinations of the following: 2'-OMe (2'-O-methyl) modification, 2'-F (2'-deoxy-2'-fluorine) modification, 2'-O-MOE (2'-O-methoxyethyl) modification, 2'-deoxy (2'-d) modification, 5'-morpholine (5'-Mo) modification, unlocking nucleic acid (UNA) modification, glycol nucleic acid (GNA) modification, locked nucleic acid (LNA) modification, tricyclic DNA (tcDNA) modification, (S)-restricted ethyl bicyclic nucleic acid ((S)-cEt-BNA) modification, phosphate thioester (PS) modification, phosphate dithioester (PS2) modification, methylphosphonate (MP) modification, methoxypropyl methylphosphonate (MOP) modification, peptide nucleic acid (PNA) modification, 5'-(E)-vinyl phosphate (VP) modification (V Modifications include P), N6-methyladenosine (m6A), 5-methylcytidine (m5C), 3-methyluridine (m3U), 5-methylureaside (m5U), pseudoureaside, 2-thioureaside (s2U), propynouraidine (5-pU), linking the 5' or 3' end of the nucleotide to an inverted abasic nucleotide (invAB), replacing the nucleotide with an inverted abasic nucleotide (invAb), replacing the nucleotide with 2,4-difluorotolyl ribonucleotide (rF), or replacing the nucleotide with (S)-glycerol nucleic acid. Preferred modifications include 2'-OMe, 2'-F, 2'-deoxy, VP, 5'-MP, PS, PS2, MP, MOP, M06, invAb, or invAB.
[0055] In some embodiments, the RNA inhibitor includes a phosphate or phosphate mimicry at the 3' or 5' end of the antisense strand, or a phosphate or phosphate mimicry at the 3' or 5' end of the sense strand.
[0056] In some embodiments, the RNA inhibitors described herein include phosphate mimics comprising 5'-(E)-vinylphosphonate, 5'-methylphosphonate, (S)-5'-C-methyl analogs, and 5'-thiophosphate (5'-PS).
[0057] In some embodiments, the RNA inhibitor includes a (M06) modification at the 5' end of the antisense strand:
[0058] In some embodiments, the RNA inhibitor has an invAB modification at the 3' or 5' end of the antisense strand, or an invAB modification at the 3' or 5' end of the sense strand.
[0059] In some embodiments, the RNA inhibitor wherein the inverted abasic nucleotide or MO6 is linked to the 3' or 5' end of the antisense strand or the 3' or 5' end of the sense strand via a thiophosphate ester.
[0060] In some embodiments, the RNA inhibitor has the following combination of modifications.
[0061] a) The positive strand contains a first sequence of 16-21 nt in length, the first sequence including the following modifications: starting from the 5' end, the nucleotides at positions 9, 10, and 11 have 2'-F modifications;
[0062] b) The antisense strand contains a second sequence of 16-21 nt in length, the second sequence comprising the following modifications: starting from the 5' end, there is a phosphate thioester link between the 1st and 2nd nucleotides, a phosphate thioester link between the 2nd and 3rd nucleotides, and a phosphate thioester link between the 3rd and 4th nucleotides; and starting from the 3' end, there is a phosphate thioester link between the 1st and 2nd nucleotides; and starting from the 5' end, there is a 2'-F modification at the 2nd, 3rd, 4th, 12th, 14th, and 16th nucleotides.
[0063] In some embodiments, the RNA inhibitor has the following combination of modifications.
[0064] a) The positive strand contains a first sequence of 16-21 nt in length, the first sequence including the following modifications: starting from the 5' end, the nucleotides at positions 9, 10, and 11 have 2'-F modifications, and the rest have 2'-Ome modifications;
[0065] b) The antisense strand contains a second sequence of 16-21 nt in length, the second sequence comprising the following modifications: starting from the 5' end, there is a phosphate thioester link between the nucleotides at positions 1 and 2, between the nucleotides at positions 2 and 3, and between the nucleotides at positions 3 and 4; and starting from the 3' end, there is a phosphate thioester link between the nucleotides at positions 1 and 2; and starting from the 5' end, the nucleotides at positions 2, 3, 4, 12, 14, and 16 are 2'-F modified, and the rest are 2'-Ome modified.
[0066] In some embodiments, the RNA inhibitor has the following combination of modifications.
[0067] a) The positive strand contains a first sequence of 16-21 nt in length, the first sequence including the following modifications: starting from the 5' end, the nucleotides at positions 9, 10, and 11 have 2'-F modifications;
[0068] b) The antisense strand contains a second sequence of 16-21 nt in length, the second sequence comprising the following modifications: starting from the 5' end, there is a phosphate thioester link between the 1st and 2nd nucleotides, a phosphate thioester link between the 2nd and 3rd nucleotides, and a phosphate thioester link between the 3rd and 4th nucleotides; and starting from the 3' end, there is a phosphate thioester link between the 1st and 2nd nucleotides; and starting from the 5' end, there is a 2'-F modification at the 2nd, 3rd, 4th, 12th, 14th, and 16th nucleotides.
[0069] In some embodiments, the RNA inhibitor wherein the first sequence length is preferably 16nt, 17nt, 18nt, 19nt, 20nt, or 21nt, with 21nt being the most preferred.
[0070] In some embodiments, the RNA inhibitor wherein the second sequence length is preferably 16nt, 17nt, 18nt, 19nt, 20nt, or 21nt, with 21nt being the most preferred.
[0071] In some embodiments, the RNA inhibitor has the following combination of modifications.
[0072] a) The positive strand is 21 nt in length and includes the following modifications: starting from the 5' end, the nucleotides at positions 9, 10, and 11 have 2'-F modifications;
[0073] b) The antisense strand is 21 nt in length and includes the following modifications: starting from the 5' end, there is a phosphate thioester link between the 1st and 2nd nucleotides, a phosphate thioester link between the 2nd and 3rd nucleotides, and a phosphate thioester link between the 3rd and 4th nucleotides; starting from the 3' end, there is a phosphate thioester link between the 1st and 2nd nucleotides; and starting from the 5' end, the nucleotides at positions 2, 3, 4, 12, 14, and 16 have a 2'-F modification.
[0074] In some embodiments, the RNA inhibitor has the following combination of modifications.
[0075] a) The positive strand is 21 nt in length and includes the following modifications: starting from the 5' end, the nucleotides at positions 9, 10, and 11 have 2'-F modifications, and the rest have 2'-Ome modifications;
[0076] b) The antisense strand is 21 nt in length and includes the following modifications: starting from the 5' end, there is a phosphate thioester link between the nucleotides at positions 1 and 2, between the nucleotides at positions 2 and 3, and between the nucleotides at positions 3 and 4; starting from the 3' end, there is a phosphate thioester link between the nucleotides at positions 1 and 2; and starting from the 5' end, the nucleotides at positions 2, 3, 4, 12, 14, and 16 have a 2'-F modification, and the rest have a 2'-Ome modification.
[0077] In some embodiments, the RNA inhibitor wherein the antisense strand comprises at least 15 consecutive nucleotides of a sequence as described in any one of SEQ ID NO:624-812, 829, 830.
[0078] In some embodiments, the RNA inhibitor wherein the positive strand comprises at least 15 consecutive nucleotides of the sequence as described in any one of SEQ ID NO:414-602.
[0079] In some embodiments, the RNA inhibitor is selected from:
[0080] ds-m1、ds-m2、ds-m3、ds-m4、ds-m5、ds-m6、ds-m7、ds-m8、ds-m9、ds-m10、ds-m11、ds-m12、ds-m13、ds-m14、ds-m15、ds-m16、ds-m17、ds-m18、ds-m19、ds-m20、ds-m21、ds-m22、ds-m23、ds-m24、ds-m25、ds-m26、ds-m27、ds-m28、ds-m29、ds-m30、ds-m31、ds-m32、ds-m33、ds-m34、ds-m35、ds-m36、ds-m37、ds-m38、ds-m39、ds-m40、ds-m41、ds-m42、ds-m43、ds-m44、ds-m45、ds-m46、ds-m47、ds-m48、ds-m49、ds-m50、ds-m51、ds-m52、ds-m53、ds-m54、ds-m55、ds-m56、ds-m57、ds-m58、ds-m59、ds-m60、ds-m61、ds-m62、ds-m63、ds-m64、ds-m65、ds-m66、ds-m67、ds-m68、ds-m69、ds-m70、ds-m71、ds-m72、ds-m73、ds-m74、ds-m75、ds-m76、ds-m77、ds-m78、ds-m79、ds-m80、ds-m81、ds-m82、ds-m83、ds-m84、ds-m85、ds-m86、ds-m87、ds-m88、ds-m89、ds-m90、ds-m91、ds-m92、ds-m93、ds-m94、ds-m95、ds-m96、ds-m97、ds-m98、ds-m99、ds-m100、ds-m101、ds-m102、ds-m103、ds-m104、ds-m105、ds-m106、ds-m107、ds-m108、ds-m109、ds-m110、ds-m111、ds-m112、ds-m113、ds-m114、ds-m115、ds-m116、ds-m117、ds-m118、ds-m119、ds-m120、ds-m121、ds-m122、ds-m123、ds-m124、ds-m125、ds-m126、ds-m127、ds-m128、ds-m129、ds-m130、ds-m131、ds-m132、ds-m133、ds-m134、ds-m135、ds-m136、ds-m137、ds-m138、ds-m139, ds-m140, ds-m141, ds-m142, ds-m143, ds-m144, ds-m145, ds-m146, ds-m147, ds-m148, ds-m149, ds-m150, ds-m15 1. ds-m152, ds-m153, ds-m154, ds-m155, ds-m156, ds-m157, ds-m158, ds-m159, ds-m160, ds-m161, ds-m162, ds-m163, ds-m 164, ds-m165, ds-m166, ds-m167, ds-m168, ds-m169, ds-m170, ds-m171, ds-m172, ds-m173, ds-m174, ds-m175, ds-m176, ds -m177, ds-m178, ds-m179, ds-m180, ds-m181, ds-m182, ds-m183, ds-m184, ds-m185, ds-m186, ds-m187, ds-m188, ds-m189. ,
[0081] In some embodiments, the RNA inhibitor, wherein
[0082] a) The positive strand contains a third sequence of 18-21 nt in length, the third sequence comprising the following modifications: counting from the 5' end, there is a phosphate thioester link between the 1st and 2nd nucleotides of the positive strand, a phosphate thioester link between the 2nd and 3rd nucleotides, and 2'-F modification at the 9th, 10th, 11th, and 18th nucleotides of the positive strand, with the remainder being 2'-OMe modification; counting from the 3' end, there is a phosphate thioester link between the 1st and 2nd nucleotides, and a phosphate thioester link between the 2nd and 3rd nucleotides;
[0083] b) The antisense strand contains a fourth sequence of 19-26 nt in length, the fourth sequence comprising the following modifications: starting from the 5' end, the nucleotides at positions 1, 2, 5, 9, 17, and 19 of the antisense strand are 2'-F modified, and the rest are 2'-OMe modified, with a thiophosphate link between the 4th and 5th nucleotides; starting from the 3' end, there is a thiophosphate link between the 1st and 2nd nucleotides, and a thiophosphate link between the 2nd and 3rd nucleotides.
[0084] In some embodiments, the RNA inhibitor wherein the length of the third sequence is preferably 18nt, 19nt, 20nt, 21nt, 22nt, or 21nt, with 21nt being the most preferred.
[0085] In some embodiments, the RNA inhibitor wherein the fourth sequence length is preferably 19nt, 20nt, 21nt, 22nt, 23nt, 24nt, 25nt, or 26nt, with 26nt being the most preferred.
[0086] In some embodiments, any one of the RNA inhibitors, wherein
[0087] a) The length of the positive strand is 21 nt. Starting from the 5' end, there is a phosphate thioester link between the nucleotides at positions 1 and 2, and between the nucleotides at positions 2 and 3. The nucleotides at positions 9, 10, 11, and 18 of the positive strand have 2'-F modification, and the rest have 2'-OMe modification. Starting from the 3' end, there is a phosphate thioester link between the nucleotides at positions 1 and 2, and between the nucleotides at positions 2 and 3.
[0088] b) The antisense strand is 26 nt in length. Starting from the 5' end, the nucleotides at positions 1, 2, 5, 9, 17, and 19 of the antisense strand have 2'-F modifications, and the rest have 2'-OMe modifications. There is a thiophosphate link between the 4th and 5th nucleotides. Starting from the 3' end, there is a thiophosphate link between the 1st and 2nd nucleotides, and a thiophosphate link between the 2nd and 3rd nucleotides.
[0089] In some embodiments, the RNA inhibitor wherein the antisense strand comprises at least 15 consecutive nucleotides of a sequence as described in any one of SEQ ID NO:813-827, 829, 830.
[0090] In some embodiments, the RNA inhibitor wherein the positive strand comprises at least 15 consecutive nucleotides of the sequence as described in any one of SEQ ID NO:603-617.
[0091] In some embodiments, the RNA inhibitor comprises a double strand selected from the following:
[0092] ds-m190, ds-m191, ds-m192, ds-m193, ds-m194, ds-m195, ds-m196, ds-m197, d s-m198, ds-m199, ds-m200, ds-m201, ds-m202, ds-m202-1, ds-m203 and ds-m204.
[0093] In some embodiments, the RNA inhibitor further includes a delivery system, wherein the delivery system is conjugated to the sense and / or antisense strands, and the delivery system enables the RNA inhibitor to reach the target RNA in the target tissue to produce a gene silencing effect.
[0094] In some implementations, the target tissue is eye tissue, joint tissue, central nervous system tissue, peripheral nervous system tissue, tumor, liver tissue, kidney tissue, muscle tissue, or adipose tissue.
[0095] In some embodiments, the ocular tissue includes the optic nerve, trabecular meshwork, proximal canal tissue, ganglion, external scleral vein, Schrem's canal, or peripheral ocular tissue. Preferably, the joint tissue includes cartilage tissue, joint connective tissue, and bone tissue. Preferably, the central nervous system tissue includes spinal cord tissue and brain tissue. Preferably, the peripheral nervous system tissue includes intra-articular nerve tissue and muscular nerve tissue. Preferably, the adipose tissue includes subcutaneous adipose tissue and visceral adipose tissue.
[0096] In some implementations, the ocular tissue is the retinal ganglion, endothelial cells, peripheral ocular muscles, or peripheral ocular fat.
[0097] In some implementations, the delivery system is independently coupled to one or more internal sites of the double-stranded ribonucleic acid.
[0098] In some embodiments, the internal position is located on a nucleobase, sugar ring, methylphosphonate bond, thiophosphate diester bond, or phosphate diester bond.
[0099] In some embodiments, the delivery system is a lipophilic structure comprising a lipophilic group and a linker, the lipophilic group being linked to the double-stranded ribonucleic acid via the linker.
[0100] In some embodiments, the lipophilic structure is selected from aliphatic, alicyclic, and polycyclic compounds.
[0101] In some embodiments, the lipophilic structure contains saturated or unsaturated C16 or C22.
[0102] In some embodiments, the linker is selected from single bonds, ethers, thioethers, urea, carbonates, amines, amides, maleimide-thioethers, disulfides, phosphate diesters, sulfonamide bonds, click reaction products, and carbamates.
[0103] In some embodiments, the delivery system is
[0104] In some embodiments, the delivery system is conjugated to the 5' end and / or 3' end of the antisense strand or antisense nucleic acid fragment.
[0105] In some embodiments, the delivery system is conjugated to the 5' end and / or 3' end of the positive strand or positive nucleic acid fragment.
[0106] In some embodiments, the delivery system is conjugated to the 5' end of the antisense strand or antisense nucleic acid fragment and to the 3' end of the sense strand or sense nucleic acid fragment, and the two delivery systems may be the same or different.
[0107] In some embodiments, the delivery system is conjugated to the 3' end of the antisense strand or antisense nucleic acid fragment, and the delivery system is conjugated to the 5' end of the sense strand or sense nucleic acid fragment, and the two delivery systems may be the same or different.
[0108] In some embodiments, the delivery system is conjugated to the 5' end of the antisense strand or antisense nucleic acid fragment, and the delivery system is conjugated to the 5' end of the sense strand or sense nucleic acid fragment, and the two delivery systems may be the same or different.
[0109] In some embodiments, the delivery system is conjugated to the 3' end of the antisense strand or antisense nucleic acid fragment, and the delivery system is conjugated to the 3' end of the sense strand or sense nucleic acid fragment, and the two delivery systems may be the same or different.
[0110] In some implementations, the number of delivery systems is 1, 2, 3, 4, 5, or 6.
[0111] In some embodiments, the antisense strand comprises at least 15 consecutive nucleotides in a sequence as described in any one of SEQ ID NO:822-827, 829, 830.
[0112] In some embodiments, the positive strand comprises at least 15 consecutive nucleotides of the sequence as described in any one of SEQ ID NO:618-623.
[0113] In some embodiments, the RNA inhibitor is selected from Z1, Z2, Z3, Z4, Z5, Z6, and Z7.
[0114] In some embodiments, the RNA inhibitor comprises a sense strand as shown in SEQ ID NO:98 (CUUUUUUACGGUUCAGAUAUU) and an antisense strand as shown in SEQ ID NO:411 (CGAAAUAUCUGAACCGUAAAAAAGUU).
[0115] In some embodiments, the RNA inhibitor comprises a sense strand as shown in SEQ ID NO:615(c*u*u*u*uuaCfGfGfuucagaUfa*u*u) and an antisense strand as shown in SEQ ID NO:825((invAB)*CfGfaa*AfuaucugaaccgUfaAfaaaag*u*u).
[0116] In some embodiments, the RNA inhibitor comprises a sense strand as shown in SEQ ID NO:621([D02]*c*u*u*u*uuuaCfGfGfuucagaUfa*u*u) and an antisense strand as shown in SEQ ID NO:825((invAB)*CfGfaa*AfuaucugaaccgUfaAfaaaag*u*u).
[0117] In some embodiments, the RNA inhibitor comprises a sense strand as shown in SEQ ID NO:615 (c*u*u*u*uuuaCfGfGfuucagaUfa*u*u) and an antisense strand as shown in SEQ ID NO:829 (cGfaa*AfuaucugaaccgUfaAfaaaag*u*u).
[0118] In some embodiments, the RNA inhibitor comprises a sense strand as shown in SEQ ID NO:615(c*u*u*u*uuuaCfGfGfuucagaUfa*u*u) and an antisense strand as shown in SEQ ID NO:830((invAB)*cGfaa*AfuaucugaaccgUfaAfaaaag*u*u).
[0119] In some embodiments, the RNA inhibitor comprises a sense strand as shown in SEQ ID NO:621([D02]*c*u*u*u*uuuaCfGfGfuucagaUfa*u*u) and an antisense strand as shown in SEQ ID NO:830((invAB)*cGfaa*AfuaucugaaccgUfaAfaaaag*u*u).
[0120] On the other hand, this application provides a pharmaceutical composition comprising the aforementioned RNA inhibitor, and / or physiologically acceptable excipients and / or carriers and / or diluents.
[0121] In some embodiments, the pharmaceutically acceptable carrier is characterized by comprising or being selected from aqueous carriers, liposomes, polymers, or peptides.
[0122] On the other hand, this application provides the use of an RNA inhibitor targeting IGF-1R and a pharmaceutical composition thereof in the preparation of a medicament for treating IGF-1R-related diseases or pathologies; preferably, the RNA inhibitor is siRNA; more preferably, the siRNA is administered to a local or lesion area tissue of a subject in need.
[0123] In some embodiments, the IGF-1R-related disease or pathology includes diseases or symptoms associated with elevated IGF-1R levels.
[0124] In some embodiments, the IGF-1R-related diseases or pathologies include thyroid ophthalmopathy, osteoarthritis, and neuropathic pain.
[0125] In some embodiments, the RNA inhibitor and the pharmaceutical composition thereof are either the RNA inhibitor or the pharmaceutical composition.
[0126] On the other hand, this application provides the use of an RNA inhibitor or the pharmaceutical composition thereof in the preparation of a medicament for the prevention or treatment of a disease or pathology or for reducing the risk of a disease or symptom.
[0127] On the other hand, this application provides a method for preventing or treating IGF-1R-related diseases or symptoms, including administering an effective amount of an RNA inhibitor and a pharmaceutical composition thereof to a subject in need of such treatment.
[0128] In some embodiments, the RNA inhibitor and the pharmaceutical composition thereof are either the RNA inhibitor or the pharmaceutical composition.
[0129] In some embodiments, the RNA inhibitor, its pharmaceutically acceptable salt, or the pharmaceutical composition is administered to the subject via an intraorbital injection, intra-articular injection, intrathecal injection, subcutaneous injection, intravenous injection, oral administration, rectal administration, or intraperitoneal administration route.
[0130] In some embodiments, the method includes application to local or lesion area tissue of a subject in need.
[0131] In some implementations, the required local or lesion area tissue of the subject includes ocular tissue, joint tissue, central nervous system tissue, peripheral nervous system tissue, tumor, liver tissue, kidney tissue, muscle tissue, or adipose tissue.
[0132] In some embodiments, the ocular tissue includes the optic nerve, trabecular meshwork, proximal canal tissue, ganglion, external scleral vein, Schrem's canal, or peripheral ocular tissue. Preferably, the joint tissue includes cartilage tissue, joint connective tissue, and bone tissue. Preferably, the central nervous system tissue includes spinal cord tissue and brain tissue. Preferably, the peripheral nervous system tissue includes intra-articular nerve tissue and muscular nerve tissue. Preferably, the adipose tissue includes subcutaneous adipose tissue and visceral adipose tissue.
[0133] In some embodiments, the ocular tissue is a retinal ganglion, endothelial cells, peripheral ocular muscles, or peripheral ocular fat.
[0134] In some embodiments, the IGF-1R-related disease or pathology includes diseases or symptoms associated with elevated IGF-1R levels.
[0135] In some embodiments, the IGF-1R-related diseases or pathologies include thyroid ophthalmopathy, osteoarthritis, and neuropathic pain.
[0136] Other aspects and advantages of this application will be readily apparent to those skilled in the art from the detailed description below. Only exemplary embodiments of this application are shown and described in the following detailed description. As will be appreciated by those skilled in the art, the content of this application enables them to make modifications to the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application pertains. Attached Figure Description
[0137] The specific features of the invention involved in this application are shown in the appended claims. The features and advantages of the invention can be better understood by referring to the exemplary embodiments and drawings described in detail below. A brief description of the drawings is as follows:
[0138] Figure 1 shows the PD results of intraorbital administration of the RNA inhibitor Z4 described in this application to cynomolgus monkeys.
[0139] Figure 2 shows the structure of the 3' or 5' end of the sense or antisense strand of the RNA inhibitor described in this application.
[0140] Figure 3 shows the PD results of intraorbital administration of the RNA inhibitor Z4 described in this application to cynomolgus monkeys.
[0141] Figure 4 shows the PD results of intraorbital administration of the RNA inhibitor Z7 described in this application to cynomolgus monkeys. Detailed Implementation
[0142] The following specific embodiments illustrate the implementation of the invention. Those skilled in the art can easily understand other advantages and effects of the invention from the content disclosed in this specification.
[0143] Terminology Definition
[0144] In this application, the terms "optional," "optionally," or "optionally" are equivalent in meaning, referring to the possibility or possibility that the event or condition described thereafter may or may not occur, and the description includes both the possibility that the event or condition occurs and the possibility that it does not occur. For example, "optionally substituted alkyl" or "alkyl optionally substituted" includes "alkyl" (where the H on the alkyl group is not substituted / replaced by a non-H substituent) and "substituted alkyl" (where the H on the alkyl group is substituted / replaced by a non-H substituent). As used herein, those skilled in the art will understand that for any group comprising one or more substituents, these groups are not intended to introduce any substitution or substitution pattern that is spatially impractical, synthetically infeasible, and / or inherently unstable. For example, "optionally modified" includes both unmodified and modified, and further, "nucleotide optionally modified" includes both unmodified and modified nucleotides.
[0145] In this application, when any variable (e.g., a substituent R, such as a nucleic acid being modified) appears more than once in the composition or structure of the compound, its definition is independent in each case. For example, if a group is substituted by 0-2 Rs, the group may optionally be substituted by at most two Rs, and the Rs in each case have independent options. As another example, when multiple nucleotides are modified, each nucleotide is independently and optionally modified, and the type and number of modifications to each nucleotide may be the same or different.
[0146] In this application, the terms “RNA inhibitor,” “iRNA,” “siRNA,” “RNAi agent,” “iRNA agent,” and “RNA interference agent” are used interchangeably and generally refer to agents containing RNA as defined in this application, which can mediate targeted cleavage of RNA transcripts by forming an RNA-induced silencing complex (RISC) within cells. The RNA inhibitor directs sequence-specific degradation of mRNA via a process called RNA interference (RNAi). The RNA inhibitor described in this application can regulate or inhibit gene expression of the IGF-1R gene in cells, and in some embodiments, the cells may be cells of a mammalian subject. In some embodiments, the RNA inhibitor can regulate or inhibit the mRNA sequence of the IGF-1R gene (NM_000875.5 Homo sapiens insulin-like growth factor 1 receptor), said mRNA sequence including the sequence shown in SEQ ID NO:828.
[0147] In some embodiments, the “RNA inhibitor” used in this application is a single-stranded siRNA (ssRNAi), which can be introduced into cells or organisms to inhibit target mRNA. The single-stranded RNA inhibitor can bind to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. The single-stranded RNA inhibitor is typically 15 to 30 nucleotides long and chemically modified. The design and testing of single-stranded siRNAs are described in U.S. Patent No. 8,101,348 and Lima et al. (2012) Cell 150:883-894, the full contents of which are incorporated herein by reference. Any antisense nucleotide sequence described in this application may be used as a single-stranded siRNA chemically modified by the methods described in this application or by methods described in Lima et al. (2012) Cell 150:883-894.
[0148] In some embodiments, the “RNA inhibitor” used herein is shRNA. As used herein, the term “shRNA” (i.e., short hairpin RNA) refers to an artificial single-stranded interfering RNA molecule that contains the sense and / or antisense strands of a “siRNA double strand” within a stem-loop or hairpin structure. The stem of this hairpin structure is typically 19 to 29 nucleotides in length, and the loop is typically 4 to 15 nucleotides in length (see, for example, Siolas, D. et al. (2004) Nat. Biotechnol. 23, 227-231). Typically, shRNA molecules are encoded within DNA gene expression vectors under the control of RNA polymerase III promoters (e.g., the U6 promoter).
[0149] In some embodiments, the “RNA inhibitor” used in this application is a miRNA. The term “miRNA” or “microRNA” as used herein, according to its common meaning in the art, refers to a small, non-protein-coding RNA molecule that is expressed in genes and involved in RNA-based gene regulation in a variety of eukaryotes, including mammals. A mature, fully processed miRNA is about 15 to about 30 nucleotides in length. A representative group of known endogenous miRNAs is described in the publicly available miRBase sequence database, described in Griffith-Jones et al., Nucleic Acids Research, 2004, 32:D109-D111 and Griffith-Jones et al., Nucleic Acids Research, 2006, 34:D140-D144, and is accessible on the World Wide Web of the Wellcome Trust Sanger Institute website. Mature, fully processed miRNAs publicly available in the miRBase sequence database are incorporated herein by reference. A representative group of miRNAs is also included in Table 1 below. Each mature miRNA is partially complementary to one or more messenger RNA (mRNA) molecules, which are the target of the miRNA, thereby regulating the expression of target-related genes.
[0150] In some embodiments, the “RNA inhibitor” used herein is an ASO. As used herein, the term “ASO” (i.e., antisense nucleic acid) refers to a nucleic acid molecule having a “siRNA double helix” of both a sense strand and / or an antisense strand that binds to the target RNA via RNA-RNA or RNA-DNA or RNA-PNA (protein nucleic acid; Egholm et al., 1993 Nature 365, 566) interactions and alters the activity of the target RNA through spatial interactions or through RNase H-mediated target recognition (for reviews, see Stein and Cheng, 1993 Science 261, 1004 and Woolf et al., U.S. Patent No. 5,849,902). Generally, the antisense molecule is complementary to the target sequence along a single adjacent sequence of the antisense molecule. However, in some embodiments, the antisense molecule may bind to a substrate, thereby causing the substrate molecule to form a loop, and / or the antisense molecule may bind, thereby causing the antisense molecule to form a loop. Therefore, antisense molecules can be complementary to two (or more) non-adjacent substrate sequences, or two (or more) non-adjacent sequence portions of the antisense molecule can be complementary to the target sequence or both. For a review of current antisense strategies, see Schmajuk et al., 1999, J. Biol. Chem., 274, 21783-21789; Delihas et al., 1997, Nature, 15, 751-753; Stein et al., 1997, Antisense NADrug Dev., 7, 151; Crooke, 2000, Methods Enzymol., 313, 3-45; Crooke, 1998, Biotech. Genet. Eng. Rev., 15, 121-157; Crooke, 1997, Ad. Pharmacol., 40, 1-49. Furthermore, antisense DNA or antisense molecules modified with 2'-MOE and other modifications as known in the art can target RNA via DNA-RNA interactions, thereby activating RNase H, which digests the target RNA in the duplex. Antisense oligonucleotides may contain one or more RNase H activation regions capable of activating RNase H cleavage of the target RNA. Antisense DNA can be chemically synthesized or expressed via a single-stranded DNA gene expression vector or its equivalent. The antisense molecules of the present invention can be chemically modified as generally known in the art or as described herein.
[0151] In some embodiments, the “RNA inhibitor” used in this application is double-stranded RNA, and is referred to herein as “siRNA duplex,” “double-stranded RNA inhibitor,” “double-stranded siRNA molecule,” “double-stranded siRNA,” or “dsRNA.” The term “siRNA duplex” refers to a complex of ribonucleic acid molecules having a double-stranded structure comprising two antiparallel and partially complementary nucleic acid strands, with “sense” and “antisense” orientations relative to the target RNA (i.e., the IGF-1R gene). In some embodiments, the siRNA duplex directs the specific degradation of a sequence of mRNA (such as the mRNA sequence of the IGF-1R gene) via a process called RNA interference (RNAi).
[0152] Generally, the majority of the nucleotides in each chain of an RNA inhibitor are ribonucleotides. Unless otherwise specified, they are ribonucleotides. However, as detailed herein, each or both of the two chains may also include one or more non-ribonucleotides, such as a deoxyribonucleotide and / or a modified nucleotide. Furthermore, "RNA inhibitor" may include chemically modified ribonucleotides. These modifications may include all types of modifications disclosed herein or known in the art. Any such modifications used in an RNA inhibitor molecule are encompassed by the term "RNA inhibitor" for the purposes of this specification and the claims.
[0153] The double-stranded structure can be of any length that allows for specific degradation of the desired target RNA via the RISC pathway, and can be in the length range of about 19 to 36 base pairs, for example, about 19-30 base pairs, such as about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs. The ranges and lengths between these ranges and lengths are also included in this application. In some embodiments, the RNA inhibitor of this application is a dsRNA containing 15-23 nucleotides per strand, which interacts with the target RNA sequence (e.g., the IGF-1R gene) to guide the cleavage of the target RNA. In some embodiments, the RNA inhibitor of this application is a dsRNA of 24-30 nucleotides, which interacts with the target RNA sequence (e.g., the mRNA sequence of the IGF-1R gene) to guide the cleavage of the target RNA.
[0154] Unless otherwise specified, the sequences listed in this invention are all in the 5' to 3' direction from left to right in the reading order.
[0155] In this application, the term "antisense strand" generally refers to a strand on an RNA inhibitor (e.g., double-stranded siRNA) that is substantially complementary to a target nucleic acid (e.g., the mRNA sequence of a target genomic sequence, including mRNA precursors and mRNA molecules, for example, the mRNA sequence of the IGF-1R gene). The term "complementary region" as used in this application generally refers to a region on the antisense strand that is substantially complementary to the mRNA sequence of the IGF-1R gene used in this application. When the complementary region is not perfectly complementary, mismatches can occur within the molecule or at the ends. Typically, the most permissible mismatches are at the ends, for example, within 5, 4, 3, or 2 nucleotides at the 5' and / or 3' ends.
[0156] In this application, the term "mismatch" refers to situations such as nonadenine (A) pairing with thymine (T), nonadenine (A) pairing with uracil (U), nonguanine (G) pairing with cytosine (C), the absence of hydrogen bonds between the bases of the relative nucleotides, and the absence of bases between the relative nucleotides.
[0157] In this application, the term "antisense nucleic acid fragment" refers to a continuous fragment on the antisense strand, the fragment of which may contain 15-35 nucleotides in length. For example, the antisense nucleic acid fragment may be a continuous fragment of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, or 34 nucleotides in length on the antisense strand. The antisense nucleic acid fragment is complementary to any continuous nucleotide fragment of length in the mRNA encoding IGF-1R. In some embodiments, at least three continuous nucleotide fragments on the antisense nucleic acid fragment are complementary to a corresponding continuous nucleotide fragment of length in the mRNA encoding IGF-1R.
[0158] In this application, the term "sense strand" generally refers to a strand of an RNA inhibitor that includes a region substantially complementary to the region referred to herein as the antisense strand. The "sense" strand is sometimes called the "sense" strand, the "passenger" strand, or the "antiguide" strand. With their sequence, the antisense strand targets the desired mRNA, while the sense strand targets a different target. Therefore, if the antisense strand is incorporated into a RISC, the correct target is targeted. Incorporation of the sense strand can lead to off-target effects. These off-target effects can be limited by using modifications on the sense strand or by using a 5' cap.
[0159] In this application, the term "positive nucleic acid fragment" refers to a continuous fragment on the positive strand, the fragment of which may contain 15-35 nucleotides in length. For example, the positive nucleic acid fragment may be a continuous fragment of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, or 34 nucleotides in length on the positive strand.
[0160] In this application, the term "complementarity" refers to the ability of a polynucleotide containing an RNA inhibitor antisense strand or an antisense nucleic acid fragment to hybridize (form base pair hydrogen bonds) with a polynucleotide containing an RNA inhibitor sense strand or a sense nucleic acid fragment or IGF-1R mRNA under certain conditions to form a double-stranded or double-helix structure. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and include native or modified nucleotides or nucleotide mimics, provided that the above requirements regarding their hybridization ability are met. "Complementarity" does not necessarily require complementary bases on every nucleotide; mismatches may occur in some cases.
[0161] In this application, the term "fully complementary" generally means that all (100%) bases in a sequential sequence of the RNA inhibitor antisense strand or antisense nucleic acid fragment will hybridize with the same number of bases in a sequential sequence of the RNA inhibitor sense strand or sense nucleic acid fragment or IGF-1R mRNA. The sequential sequence may comprise all or a portion of the aforementioned sequence. As used herein, "partially complementary" generally means that in the hybridized nucleobase sequence pairs, at least about 70% of the bases in a sequential sequence of the RNA inhibitor antisense strand or antisense nucleic acid fragment will hybridize with the same number of bases in a sequential sequence of the RNA inhibitor sense strand or sense nucleic acid fragment or IGF-1R mRNA. The terms "complementary," "fully complementary," and "substantially complementary" as used herein may be used in relation to base matching between the RNA inhibitor sense strand or sense nucleic acid fragment and the antisense strand or antisense nucleic acid fragment, or between the RNA inhibitor antisense strand or antisense nucleic acid fragment and the IGF-1R mRNA sequence. Sequence identity or complementarity is independent of modification. For example, for the purpose of determining identity or complementarity, a and Af are complementary to U (or T) and identical to A.
[0162] As used herein, the term "nucleotide" refers to a pentose sugar (ribose or deoxyribose), a phosphate group, and a base (natural or non-natural), and is intended to include both unmodified (i.e., natural) nucleotides and modified nucleotides. In some embodiments, the nucleotide is an unmodified ribonucleotide. In some embodiments, the ribonucleotide is a 3'-ribonucleotide. In some embodiments, the ribonucleotide is a 5'-ribonucleotide. In some embodiments, the modified or unmodified nucleotide may optionally be further modified.
[0163] Natural nucleotides are composed of natural bases, natural ribose, and phosphate. The natural nucleotides used in this article refer to adenine ribonucleotides, adenine deoxyribonucleotides, guanine ribonucleotides, guanine deoxyribonucleotides, cytosine ribonucleotides, cytosine deoxyribonucleotides, uracil ribonucleotides, thymine ribonucleotides, or thymine deoxyribonucleotides. The term "ribonucleotide" refers to a nucleotide having a hydroxyl group at the 2' position of its sugar moiety. "Deoxyribonucleoside" refers to a nucleotide having a hydrogen atom at the 2' position of its sugar moiety.
[0164] The natural bases of RNA include A (adenine), G (guanine), C (cytosine), U (uracil), and T (thymine). As used herein, the prefix "d" before monomers (such as nucleotides A, U, C, G, and T) indicates that the monomer is 2'-deoxy modified. As used herein, the prefix "f" after monomers (such as nucleotides A, U, C, G, and T) indicates that the monomer is 2'-deoxy-2'-fluorinated (2'-F modification). As used herein, the prefix "GNA-" before monomers (such as nucleotides A, U, C, G, and T) indicates that the monomer is ethylene glycol modified (GNA modification). As used herein, Tgn is the abbreviation for GNA-T, with equivalent meaning. As used herein, lowercase letters (a, u, c, g, t, etc.) indicate that the corresponding uppercase letters (A, U, C, G, and T, etc.) represent nucleotides modified with 2'-O-methyl (2'-OMe).
[0165] In this invention, unless otherwise specified, "G", "C", "A", "T" and "U" refer to guanine ribonucleotide, cytosine ribonucleotide, adenine ribonucleotide, thymine ribonucleotide and uracil ribonucleotide, respectively, with the following structures:
[0166] In this invention, the prefix "d" before a nucleotide (A, U, C, G, and T, etc.) indicates that the nucleotide is 2'-deoxy modified. An exemplary nucleotide structure with 2'-deoxy modification is as follows:
[0167] In this invention, the label "f" following a nucleotide (A, U, C, G, and T, etc.) indicates that the nucleotide is modified with 2'-deoxy-2'-fluorine (2'-F modification). An exemplary nucleotide structure with 2'-F modification is as follows:
[0168] In this invention, the prefix "GNA-" before nucleotides (A, U, C, G, and T, etc.) indicates that the nucleotide has been modified with ethylene glycol nucleic acid (GNA modification). In this invention, Tgn is the code for GNA-T, and they are equivalent. An exemplary structure of a GNA-modified nucleotide is as follows:
[0169] In this invention, lowercase letters (a, u, c, g, t, etc.) indicate that the nucleotide represented by the corresponding uppercase letters (A, U, C, G, and T, etc.) is modified with 2'-O-methyl (2'-OMe). An exemplary nucleotide structure modified with 2'-OMe is as follows:
[0170] In this invention, invAB modification refers to the attachment of an inverted, baseless nucleotide to the 5' or 3' end of a nucleotide. For example, The structure modified by invAB:
[0171] In this invention, invAb modification refers to the replacement of a nucleotide with an inverted, baseless nucleotide (invAb). For example, The structure modified by invAb:
[0172] In this invention, VP modification refers to the modification of the 5' position of a nucleotide with 5'-(E)-vinyl phosphate. For example, the structures of U, u, and dU after modification are as follows:
[0173] In this invention, the marking "*" between monomers (such as nucleotides A, U, C, G and T) indicates that the two monomers are connected by a thiophosphate bond (i.e. thiophosphate diester bond), that is, modified by thiophosphate (PS).
[0174] In this invention, the absence of an asterisk (*) between monomers (such as nucleotides A, U, C, G, and T) indicates that the two nucleotides are linked by a phosphate ester bond (i.e., a phosphodiester bond).
[0175] For example, “5'-AdUgCf*dT-3'” means that the sequence starts from the 5' end, with adenine ribonucleotide at position 1, uracil deoxyribonucleotide at position 2, guanine ribonucleotide modified with 2'-methoxy at position 3, cytosine ribonucleotide modified with 2'-fluorine at position 4, and thymine deoxyribonucleotide linked to position 4 by a phosphate thioester bond at position 5.
[0176] As used herein, the terms "optional," "optionally," or "optionally" are equivalent in meaning, indicating that the event or condition described thereafter may or may not occur, and the description includes both the possibility that the event or condition occurs and the possibility that it does not occur. For example, "optionally substituted alkyl" or "alkyl optionally substituted" includes "alkyl" (where the H on the alkyl group is not substituted / replaced by a non-H substituent) and "substituted alkyl" (where the H on the alkyl group is substituted / replaced by a non-H substituent). As used herein, those skilled in the art will understand that for any group comprising one or more substituents, these groups are not intended to introduce any substitution or substitution pattern that is spatially impractical, synthetically infeasible, and / or inherently unstable. For example, "optionally modified" includes both unmodified and modified, and further, "nucleotide optionally modified" includes both unmodified and modified nucleotides.
[0177] As used herein, when any variable (e.g., a substituent R, such as a nucleic acid being modified) appears more than once in the composition or structure of a compound, its definition is independent in each case. For example, if a group is substituted by 0-2 Rs, the group may optionally be substituted by at most two Rs, and the Rs in each case have independent options. As another example, when multiple nucleotides are modified, each nucleotide is independently and optionally modified, and the type and number of modifications to each nucleotide may be the same or different.
[0178] As used herein, unless otherwise stated, “comprising,” “including,” “at least,” “having,” “having,” “containing,” or equivalents are open-ended expressions that mean that in addition to the elements, components, or steps listed, other unspecified elements, components, or steps may be included.
[0179] As used herein, "complementary" or "anti-complementary" may be used interchangeably to refer to a structural relationship between two nucleotides (e.g., on two opposing nucleic acid chains or on opposing regions of a single nucleic acid chain) that allows the two nucleotides to form base pairs with each other (e.g., a purine nucleotide of a nucleic acid complementary to a pyrimidine nucleotide of an opposing nucleic acid may form a base pair together by forming hydrogen bonds with each other). In some embodiments of this application, complementary nucleotides may form base pairs in a Watson-Crick manner or in any other manner that allows for the formation of a stable double helix. In some embodiments of this application, the two nucleic acid chains may have multiple regions forming complementary double helixes. In some embodiments of this application, in DNA, adenine (A) always pairs with thymine (T), and in RNA, adenine (A) pairs with uracil (U); guanine (G) always pairs with cytosine (C). In some embodiments of this application, the complementary nucleotide may also comprise or consist entirely of base pairs formed from non-Watson-Crick base pairs and / or from non-natural and modified nucleotides, such non-Watson-Crick base pairs including, but not limited to, G:U swing base pairs or Hoogstein base pairs. In some embodiments of this application, nucleotides containing hypoxanthine as their base may pair with nucleotide bases containing adenine, cytosine, or uracil. In some embodiments of this application, nucleotides containing uracil, guanine, or adenine may be replaced in the nucleotide sequence of this application by nucleotides containing, for example, inosine (in this application, the capital letter "I" can represent a hypoxanthine base, inosine, or an inosine-containing nucleotide, depending on the context) (this replacement is referred to as "I modification"). In some schemes of this application, adenine and cytosine anywhere in the oligonucleotide can be replaced by guanine and uracil, respectively, to form a GU swing base pair with the target mRNA.
[0180] The degree of complementarity between two oligonucleotides is called complementarity, which is measured by the percentage of bases in each strand that can form hydrogen bonds with each other, determined by established base pairing rules. Oligonucleotide sequences do not need to be "perfectly complementary" (i.e., "completely complementary") to their corresponding nucleic acid sequences. In some embodiments, a first nucleotide sequence is considered complementary to a second nucleotide sequence if the first nucleotide sequence exhibits at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence complementarity. In one exemplary embodiment, 18 of the 20 nucleobases of the first nucleotide sequence pair with corresponding regions of the second nucleotide sequence, achieving 90% complementarity. Non-complementary nucleobases, also known as "mismatches," may cluster or spread between complementary bases and do not need to be adjacent to each other or adjacent to complementary nucleobases.
[0181] The term "mismatch" as used in this article includes, but is not limited to:
[0182] 1) Two opposing (independent natural or non-natural) nucleotides (other than AT, AU, or GC) pairing;
[0183] 2) No hydrogen bonds are formed between two opposing (independent natural or non-natural) nucleotides;
[0184] 3) A base is missing between two opposing (independent natural or non-natural) nucleotides.
[0185] In some embodiments, mismatches include wobbly base pairing and Hoogstein base pairing.
[0186] The term "perfectly complementary" refers to a hybrid formed by the first and second nucleotide sequences in a perfectly complementary region consisting only of Watson-Crick base pairs. "Fully complementary" oligonucleotides may include internal regions (e.g., at least 7, 8, 9, or 10 nucleotides) that are perfectly complementary to the target RNA.
[0187] As used herein, a blocking group is a group that can, for example, conjugate to an oligonucleotide provided herein at the 5' end of the antisense strand, which can reduce or inhibit exonuclease cleavage. In some embodiments, the blocking group can reduce or inhibit the RNA interference effect of the oligonucleotide. In some embodiments, the blocking group is cleaved from the oligonucleotide before providing the RNA interference effect. Examples of blocking groups include, but are not limited to, non-basic nucleotide residues, reverse non-basic nucleotide residues, MO3, and MO6.
[0188] As used herein, the double-stranded nucleotide reagent may optionally be conjugated to one or more blocking groups. The blocking group may be attached to the sense strand, antisense strand, or both strands at the 3' end, 5' end, or both ends. In some embodiments, the blocking group is conjugated to the antisense strand, specifically to the 5' end of the antisense strand. In some embodiments, the blocking group is conjugated to an oligonucleotide (e.g., the 5' end of the antisense strand) via a nucleotide bond, and the internucleotide bond is optionally modified as described herein. In some embodiments, the blocking group is linked to the double-stranded nucleotide reagent via a phosphate thioester. In some embodiments, the blocking group is linked to the double-stranded nucleotide reagent via a phosphodiester bond.
[0189] In this invention, M06 modification refers to the bonding of monomers (such as nucleotides) to the 5' or 3' end. For example, Structure modified by M06: In this invention, (M06) It is M06 monomer The residues. In some embodiments, (M06) is through It is bonded to a nucleotide.
[0190] In this application, the terms "nucleic acid" and "polynucleotide" are used interchangeably and refer to a polymeric form of a nucleotide (deoxyribonucleotide or ribonucleotide or the like) of any length. The polynucleotide may have any three-dimensional structure and perform any function. The polynucleotide may contain one or more modifications or substitutions at one or more bases, sugars, and / or phosphate esters as described in this application or known in the art. In some embodiments, the modified nucleotide may be a methylated nucleotide or a nucleotide analog. In some embodiments, the nucleotide structure may be modified before or after the assembly of the polynucleotide polymer. The polynucleotide may be modified post-polymerization, for example, by coupling with a labeled component. The polynucleotide polymer may be blocked by a non-nucleotide component. In this application, the terms "nucleic acid" and "polynucleotide" can refer to double-stranded and single-stranded molecules. Unless otherwise stated or required, any embodiment of a polynucleotide in this application includes both double-stranded forms and each of two complementary single-stranded forms known or predicted to constitute a double-stranded form. For example, polynucleotides can include, but are not limited to: genes or gene fragments (e.g., probes, primers, EST or SAGE tags), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, siRNA, miRNA, shRNA, RNAi reagents and primers.
[0191] In this application, the term "oligonucleotide" generally refers to a polymer composed of multiple nucleotide residues (deoxyribonucleotides or ribonucleotides, or their associated structural variants or synthetic analogs) linked by phosphodiester bonds (or their associated structural variants or synthetic analogs). Therefore, while the term "oligonucleotide" generally refers to a nucleotide polymer in which the nucleotide residues and their linkages are naturally occurring, it should be understood that the scope of the term also includes various analogs, including but not limited to: peptide nucleic acids (PNAs), aminophosphates, thiophosphates, methylphosphates, 2-O-methylribonucleic acid, etc. The exact size of the molecule may depend on the specific application. Oligonucleotides are generally short in length, typically containing about 10-30 nucleotide residues, but the term can also refer to molecules of any length, although the terms "polynucleotide" or "nucleic acid" are generally used for larger oligonucleotides.
[0192] In some embodiments, the oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleotides. The term "modified oligonucleotide" generally means an oligonucleotide comprising at least one modified nucleotide and / or at least one modified nucleotide linked together.
[0193] In this application, the term "modified nucleoside" generally refers to a nucleoside that contains at least one chemical modification compared to naturally occurring RNA or DNA nucleosides. Modified nucleosides comprise modified sugar moieties and / or modified nucleobases.
[0194] In this application, the term "nucleobase" generally refers to a heterocyclic pyrimidine or purine compound, which is a component of all nucleic acids and includes adenine (a), guanine (g), cytosine (c), thymine (t), and uracil (u). Nucleotides may include modified nucleotides or nucleotide mimics, base-free sites (Ab or X), or substitute substituted portions. As used in this application, "nucleobase sequence" generally refers to a sequence of consecutive nucleobases independent of any sugar, linking, or nucleobase modification. The terms "unmodified nucleobase" or "naturally occurring nucleobase" generally refer to naturally occurring heterocyclic nucleobases in RNA or DNA: the purine bases adenine (a) and guanine (g); and thymine (t), cytosine (c) (including 5-methylc), and uracil (u). "Modified nucleobase" generally refers to any nucleobase that is not naturally occurring.
[0195] In this application, the term "sugar moiety" generally means either a naturally occurring sugar moiety or a modified sugar moiety of a nucleoside. The term "naturally occurring sugar moiety" generally means ribofuranosyl as found in naturally occurring RNA or ribofuranosyl as found in naturally occurring DNA. "Modified sugar moiety" means a substituted sugar moiety or a sugar substitute.
[0196] In this application, the term "nucleoside linkage" generally refers to a covalent linkage between adjacent nucleosides in an oligonucleotide. "Naturally occurring nucleoside linkage" refers to a 3' to 5' phosphodiester linkage. "Modified nucleoside linkage" refers to any nucleoside linkage other than a naturally occurring one.
[0197] In this application, the terms "target nucleic acid" or "target sequence" generally refer to a continuous portion of the nucleotide sequence of the mRNA molecule formed during IGF-1R gene transcription, including mRNA of the RNA processing product that is the major transcription product. The target portion of the sequence should be at least long enough to serve as a substrate for iRNA-guided cleavage at or near the location of that portion of the nucleotide sequence of the mRNA molecule formed during IGF-1R gene transcription. In one embodiment, the target sequence is located within the protein-coding region of IGF-1R. The target sequence may be about 19-36 nucleotides in length, for example, preferably about 19-30 nucleotides in length. Ranges and lengths between the above ranges and lengths also include portions of this application.
[0198] In this application, the term "IGF-1R protein" refers to a human tetrameric transmembrane tyrosine kinase, which is the cell surface receptor for the hormone insulin-like growth factor 1 (IGF-1R). IGF-1R is a hormone with a molecular structure similar to the polypeptide hormone insulin and plays an important role in growth, development, and adult anabolic metabolism. Activation of IGF-1R can stimulate cell proliferation, survival, transformation, metastasis, and angiogenesis. In this application, the term "IGF-1R gene" refers to the gene encoding the IGF-1R protein. The protein encoded by this gene has a molecular weight of approximately 320 kDa and consists of two α subunits and two β subunits. The IGF-1R gene can be regulated or inhibited by an RNA inhibitor. In some embodiments, the RNA inhibitor can regulate or inhibit the mRNA sequence of the IGF-1R gene (NM_000875.5 Homo sapiens insulin-like growth factor 1 receptor). The transcribed sequence of the IGF-1R gene is as shown in SEQ ID NO:828.
[0199] In this application, the term "blocking group" refers to a group that can selectively bind to the double-stranded siRNA or a drug containing double-stranded siRNA as described in this application, said blocking group being located on the sense strand or sense nucleic acid fragment, the antisense strand or antisense nucleic acid fragment, or both strands. The blocking group may be attached to the 3' end, 5' end, or both ends of the sense strand or sense nucleic acid fragment, the antisense strand or antisense nucleic acid fragment, or both strands. In some embodiments, the blocking group binds to the antisense strand or antisense nucleic acid fragment, particularly the 5' end of the antisense strand or antisense nucleic acid fragment. In some embodiments, the blocking group binds to an oligonucleotide (e.g., the 5' end of the antisense strand or antisense nucleic acid fragment) via an internucleotide link, and this internucleotide link may optionally be modified as described above. In some embodiments, the blocking group is linked to the double-stranded oligonucleotide drug via a phosphosulfate ester. In some embodiments, the blocking group is linked to the double-stranded oligonucleotide drug via a phosphodiester. In this application, to reduce or inhibit exonuclease degradation, a "blocking group" may bind to the 5' end of the antisense strand of the double-stranded siRNA or the antisense nucleic acid fragment described in this application. In some embodiments, the blocking group may reduce or inhibit the RNA interference effect of the oligonucleotide. In some embodiments, the blocking group is cleaved from the oligonucleotide before providing the RNA interference effect. Examples of blocking groups include, but are not limited to, baseless residues, reverse baseless residues, and (M06).
[0200] In this application, the term "delivery system" generally refers to any compound or molecule capable of covalently or otherwise chemically binding to a bioactive substance (such as an oligonucleotide). In some embodiments, the delivery system is capable of interacting directly or indirectly with another compound, such as a receptor. The receptor interacting with the delivery system may be present on the cell surface, or alternatively may be an intracellular and / or intercellular receptor. The interaction between the delivery system and the receptor may result in a biochemical reaction, or may simply be a physical interaction or binding.
[0201] In this application, "conjugation" refers to the covalent connection between two or more chemical parts, each with a specific function; correspondingly, "conjugated compound" refers to a compound formed by the covalent connection of these chemical parts. For example, "double-stranded ribonucleic acid conjugated compound" refers to a compound or complex formed by covalently linking one or more chemical parts with specific functions (such as a delivery system, ligand group, or conjugating group) to a double-stranded ribonucleic acid. In some embodiments, the delivery system, ligand group, or conjugating group may be attached to a phosphate group, sugar ring (including the delivery system, ligand group, or conjugating group covalently linked to the 3' or 5' atom of the nucleotide via a phosphodiester bond), 2'-hydroxyl group, 5'-hydroxyl group, or base of any nucleotide of the double-stranded ribonucleic acid. In some embodiments, the delivery system, ligand group, or conjugating group may also be attached to the 2' position of the nucleotide, in which case the nucleotides are connected by a 2'-5' phosphodiester bond. In some embodiments, the delivery system, ligand group, or conjugate group may also be attached to the 3' position of the nucleotide, in which case the nucleotides are linked by a 3'-5' phosphodiester bond. In some embodiments, the connection between the delivery system, ligand group, or conjugate group and the nucleotide may be further modified, such as by thiomodification (i.e., linked by a phosphothiodiester bond).
[0202] In this application, the terms “inducing,” “inhibiting,” “enhancing,” “increasing,” “reducing,” “lowering,” etc., generally refer to quantitative differences between two states. For example, “the amount of IGF-1R activity or gene expression effectively inhibited” means that the level of IGF-1R activity or gene expression in the treated sample will be lower than the level of IGF-1R activity or gene expression in the untreated sample. These terms apply, for example, to gene expression levels and activity levels. The terms “reducing” and “lowering” are used interchangeably and generally refer to any change less than the original. “Reducing” and “lowering” are relative terms and need to be compared between before and after measurement. “Reducing” and “lowering” include complete depletion.
[0203] In some embodiments, the term "reduction" refers to an overall reduction, detectable by standard methods known in the art (such as those described herein), of the gene expression level / amount of a gene, gene product (e.g., protein), or biomarker in a first sample compared to the gene expression level / amount of the corresponding gene, gene product (e.g., protein), or biomarker in a second sample by approximately 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 100%. In some embodiments, the term "reduction" refers to a reduction in the gene expression level / amount of a gene or biomarker in the first sample, wherein the reduction is at least about 0.9-fold, 0.8-fold, 0.7-fold, 0.6-fold, 0.5-fold, 0.4-fold, 0.3-fold, 0.2-fold, 0.1-fold, 0.05-fold, or 0.01-fold in the gene expression level / amount of the corresponding gene or biomarker in the second sample. In some embodiments, the first sample is a sample obtained from a subject, and the second sample is a reference sample.
[0204] In this application, the term "gene expression" generally refers to the process by which a gene ultimately produces a protein. The gene expression described includes, but is not limited to, transcription, post-transcriptional modifications (e.g., splicing, polyadenylation, addition of a 5'-cap), and translation.
[0205] In this application, the term "pharmaceutically acceptable" generally refers to one or more non-toxic substances that do not interfere with the effectiveness of the biological activity of the active ingredient. Such formulations may typically contain salts, excipients, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. These pharmaceutically acceptable formulations may also typically contain compatible solid or liquid fillers, diluents, or encapsulation materials suitable for human administration. When used in medicine, the salt should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts can be conveniently used to prepare pharmaceutically acceptable salts, and these should not be excluded from the scope of this application. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, boric acid, formic acid, malonic acid, succinic acid, etc. Pharmaceutically acceptable salts may also be prepared as alkali metal salts or alkaline earth metal salts, such as sodium, potassium, or calcium salts.
[0206] In this application, the term "prevention and / or treatment" includes not only the prevention and / or treatment of disease, but also generally includes preventing the onset of disease, slowing or reversing the progression of disease, preventing or slowing the onset of one or more symptoms associated with the disease, reducing and / or alleviating one or more symptoms associated with the disease, reducing the severity and / or duration of the disease and / or any symptoms associated with it and / or preventing a further increase in the severity of the disease and / or any symptoms associated with it, preventing, reducing or reversing any physiological damage caused by the disease, and any pharmacological effects that are generally beneficial to the patient being treated. The RNAi agents or pharmaceutical compositions of this application do not need to achieve a complete cure or eradication of any symptom or manifestation of the disease to be considered a useful therapeutic agent. As recognized in the relevant art, a medicine used as a therapeutic agent may reduce the severity of a given disease state, but does not need to eliminate every manifestation of the disease to be considered a useful therapeutic agent. Similarly, a treatment administered prophylactically constitutes a viable preventive agent and does not need to completely and effectively prevent the onset of the condition. It is sufficient to simply reduce the effects of the disease in the subject (e.g., by reducing the number or severity of its symptoms, or by increasing the effectiveness of another treatment, or by producing another beneficial effect), or reduce the likelihood of the disease occurring or worsening.
[0207] In this application, the terms "disease" or "symptom" are used interchangeably and generally refer to any deviation of a subject from a normal state, such as any change in the state of the body or certain organs, that impairs or disrupts the performance of function, and / or causes symptoms such as discomfort, dysfunction, pain, or even death in a person who is ill or in contact with such a person. Disease or symptom may also be referred to as disorder, ailing, ailment, malady, disorder, sickness, illness, or complaint.
[0208] In this application, the term "administration" generally refers to the introduction of the pharmaceutical preparation of this application into the body of a subject by any route of introduction or delivery. Any method known to those skilled in the art for contacting cells, organs, or tissues with the drug may be employed. Administration may include, but is not limited to, intravenous, intra-arterial, intranasal, intraperitoneal, intramuscular, subcutaneous transdermal, or oral administration. The daily dose may be divided into one, two, or more doses in suitable forms to be administered at one, two, or more times during a certain time period.
[0209] In this application, the term "contact" generally refers to two or more substances of different types coming into contact with each other in any order, in any manner, and for any duration. Contact can occur in vivo, ex vivo, or in vitro. In some embodiments, it may refer to direct contact of the RNAi agent or composition of this application with cells or tissues. In other embodiments, the term refers to indirect contact of the RNA inhibitor or composition of this application with cells or tissues. For example, the method of this application includes a method in which a subject is exposed to the RNA inhibitor or composition of this application, and then the RNA inhibitor or composition contacts cells or tissues by diffusion or any other active or passive transport process known in the art (through which the compound circulates in vivo).
[0210] In this application, the terms "effective amount" or "effective dose" generally refer to an amount sufficient to achieve or at least partially achieve the desired effect. A "therapeutic effective amount" or "therapeutic effective dose" of a drug or therapeutic agent generally refers to any amount of drug that, when used alone or in combination with another therapeutic agent, promotes disease remission (proven by a reduction in the severity of disease symptoms, an increase in the frequency and duration of asymptomatic periods of the disease, or prevention of damage or disability due to the disease). A "preventive effective amount" or "preventive effective dose" of a drug generally refers to an amount of drug that, when administered alone or in combination with another therapeutic agent to a subject at risk of disease progression or relapse, inhibits the development or relapse of the disease. The ability of a therapeutic agent or preventive agent to promote disease remission or inhibit disease progression or relapse can be assessed using a variety of methods known to those skilled in the art, such as in human subjects during clinical trials, predicting efficacy in humans in animal model systems, or by measuring the activity of the agent in an in vitro assay. In some embodiments, "effective amount" refers to an amount of RNA inhibitor that produces the expected pharmacological, therapeutic, or preventive outcome.
[0211] In this application, the term "subject" generally refers to a human or non-human animal (including mammals) requiring diagnosis, prognosis, improvement, prevention, and / or treatment of a disease, such as humans, non-human primates (apes, gibbons, gorillas, chimpanzees, orangutans, macaques), livestock (dogs and cats), farm animals (poultry such as chickens, ducks, horses, cattle, goats, sheep, pigs), and laboratory animals (mice, rats, rabbits, guinea pigs). Human subjects include fetuses, newborns, infants, adolescents, and adult subjects. Subjects include animal disease models.
[0212] In this application, the terms “comprising,” “including,” “having,” “may,” “containing,” and variations thereof are generally intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional actions or structures. The term “composed of” generally indicates that no other components can exist (or similarly, features, integers, steps, etc.). Unless the context clearly specifies otherwise, the singular forms such as “a,” “an,” “the” in English, and “a,” “a,” “the,” and “the” in Chinese generally include the plural form of the things referred to.
[0213] In this application, the term "about" generally means large, roughly, or around. When the term "about" is used to refer to a range of values, a cutoff value or a specific value is used to indicate that the stated value may differ from the listed value by up to 10%. Therefore, the term "about" can be used to cover variation of ±10% or less, ±5% or less, ±1% or less, ±0.5% or less, or ±0.1% or less from a specific value.
[0214] It should be understood that the term "at least" preceding a number or series of numbers includes the number adjacent to the term "at least," and all subsequent numbers or integers logically included, as is clear from the context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 19 nucleotides in a nucleic acid molecule of 21 nucleotides" means that 19, 20, or 21 nucleotides have the indicated property. When "at least" appears before a series of numbers or a range, it should be understood that "at least" can modify each number in that series or range.
[0215] It should be understood that "not more than" or "less than" as used herein refers to the value or integer adjacent to the phrase and logically lower, such as to zero, as the context suggests. For example, a double strand with "not more than 3 nucleotides" overhangs has 3, 2, 1, or 0 nucleotide overhangs. When "not more than" appears before a series of numbers or ranges, it should be understood that "not more than" can modify each number in that series or range. The ranges used herein include both upper and lower limits.
[0216] Invention Details
[0217] Antisense strand or antisense nucleic acid fragment and sense strand or sense nucleic acid fragment
[0218] On one hand, this application provides an RNA inhibitor for inhibiting the expression of the insulin-like growth factor 1 receptor (IGF-1R) gene, comprising an antisense strand, wherein the antisense strand forms a complementary region with at least 15 consecutive nucleotides in the sequence encoding IGF-1R (SEQ ID NO: 828), the complementary region having 0, 1, 2, 3, 4, or 5 mismatches, preferably the length of the duplex complementary region is 15-30 nucleotide pairs, more preferably 17-23 nucleotide pairs. For example, the length of the duplex complementary region can be 17, 18, 19, 20, 21, 22, or 23 nucleotide pairs.
[0219] In some embodiments, the RNA inhibitor comprises a single-stranded oligonucleotide or double-stranded ribonucleic acid (dsRNA) molecule for inhibiting the expression of the IGF-1R gene in cells, such as those of a subject (e.g., a mammal). The dsRNA comprises an antisense strand or antisense nucleic acid fragment having a complementary region that is complementary to at least a portion of the mRNA formed during the expression of the IGF-1R gene. This complementary region is approximately 12-30 nucleotides in length (e.g., approximately 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, or 12 nucleotides in length).
[0220] dsRNA consists of two RNA strands that can hybridize and form a double-stranded structure (complementary region) under the conditions under which the dsRNA is used. One strand of the dsRNA (the antisense strand or antisense nucleotide segment) includes a complementary region that is substantially complementary and usually perfectly complementary to the antisense strand. This sequence can originate from the mRNA formed during IGF-1R gene expression. The other strand (the sense strand or sense nucleotide segment) includes a region complementary to the antisense strand or antisense nucleotide segment, such that when combined under appropriate conditions, the two strands can hybridize and form a double-stranded structure. Typically, the length of the double-stranded structure is 12 to 30 base pairs. Similarly, the complementary regions of and are 12 to 30 nucleotides in length, for example, at 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-2 The length between 9, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides.
[0221] In some embodiments, the dsRNA is about 19 to about 23 nucleotides in length, or about 24 to about 30 nucleotides in length. Typically, the length of the dsRNA is sufficient to serve as a substrate for the Dicer enzyme. For example, it is known in the art that dsRNA longer than about 21-23 nucleotides can be used as a substrate for Dicer. Those skilled in the art also understand that the region of RNA targeted for cleavage is typically a portion of a larger RNA molecule (typically an mRNA molecule). A “portion” of the target is a continuous nucleotide sequence of the mRNA target, long enough to allow it to be a substrate for RNAi-directed cleavage (i.e., cleavage via the RISC pathway).
[0222] Those skilled in the art will also understand that complementary regions are the main functional parts of dsRNA, for example, double-stranded regions of about 19 to about 30 base pairs, such as about 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21. 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs.
[0223] In some implementations, there is at least about 80% base complementarity between the sense strand or sense nucleic acid fragment and the antisense strand or antisense nucleic acid fragment.
[0224] In some embodiments, the sense strand or sense nucleic acid fragment and the antisense strand or antisense nucleic acid fragment are each independently 19-30 nucleotides.
[0225] In some embodiments, the sense strand or sense nucleic acid fragment and the antisense strand or antisense nucleic acid fragment are each independently 17-25 nucleotides.
[0226] In some embodiments, the sense strand or sense nucleic acid fragment and the antisense strand or antisense nucleic acid fragment are each independently 19-23 nucleotides.
[0227] In some embodiments, the total length of the positive strand is 15-30 nucleotides, preferably 16-23 nucleotides, and more preferably 19, 20, or 21 nucleotides.
[0228] In some embodiments, the total length of the antisense strand is 19-30 nucleotides, preferably 19-27 nucleotides, and more preferably 21, 22, 23, 24, 25, 26, or 27 nucleotides.
[0229] In some implementations, the positive strand or positive nucleic acid fragment is selected from any one of SEQ ID NO:1-198 or a sequence that differs from it by no more than 3 nucleotides.
[0230] In some embodiments, the sense strand or sense nucleic acid fragment of the RNA inhibitor is selected from sequences in Table 1 that differ from each other by one, two, or three nucleotides, such as 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 consecutive nucleotides.
[0231] In some implementations, the antisense strand or antisense nucleic acid fragment is selected from any one of SEQ ID NO:199-413 or at least 15 consecutive nucleotide sequences differing from it by no more than 3 nucleotides, such as 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 consecutive nucleotides.
[0232] In some embodiments, the antisense strand or antisense nucleic acid fragment of the RNA inhibitor is selected from at least 15 consecutive nucleotide sequences that differ from each of the sequences in Table 1 by zero, one, two or three nucleotides, for example, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 consecutive nucleotides.
[0233] In some implementations, the sense strand and antisense strand are each optionally independently composed of 3' or 5' overhangs of 1, 2 or 3 nucleotides.
[0234] In some embodiments, both the sense and antisense strands have a 3' overhang of 1-3 nucleotides in length, or the sense strand has a 3' or 5' overhang of 1-3 nucleotides in length, or the antisense strand has a 3' or 5' overhang of 1-3 nucleotides in length. In some embodiments, the RNA inhibitor described in this application has specific structures near its 5' and 3' ends, as shown in Figure 2.
[0235] In some embodiments, the antisense strand includes a cleavage region comprising the nucleotide sequence shown in formula (I).
[0236] Equation (I): (3'-5')X²-YZ
[0237] The cleavage occurs between X2 and Y, where X2 is the 5' end nucleotide of the second strand, and Y and Z are the two nucleotides at the 3' end of the 5' extension, where Z is guanine nucleotide (G), a natural analog of guanine nucleotide (G), a non-natural analog of guanine nucleotide (G), adenine nucleotide (A), a natural analog of adenine nucleotide (A), or a non-natural analog of adenine nucleotide (A).
[0238] In some embodiments, Z is guanine nucleotide (G), a natural analog of guanine nucleotide (G), or a non-natural analog of guanine nucleotide (G).
[0239] In some embodiments, X2 is adenine nucleotide (A), a natural analog of adenine nucleotide (A), a non-natural analog of adenine nucleotide (A), uracil nucleotide (U), a natural analog of uracil nucleotide (U), or a non-natural analog of uracil nucleotide (U).
[0240] In some embodiments, the formula (I) has a sequence (3'-5') selected from the following: UUG, UAG, AUG, AAG, UUA, UAA, AUA, AAA, UCG, UGG, ACG, AGG, UCA, UGA, ACA and AGA, or natural or non-natural analogues thereof.
[0241] In some embodiments, Y is adenine nucleotide (A), a natural analog of adenine nucleotide (A), a non-natural analog of adenine nucleotide (A), uracil nucleotide (U), a natural analog of uracil nucleotide (U), or a non-natural analog of uracil nucleotide (U).
[0242] In some embodiments, the formula (I) has a sequence (3'-5') selected from the following: UUG, UAG, AUG, AAG, UUA, UAA, AUA and AAA.
[0243] In some embodiments, the cleavage region further comprises nucleotide N1, which is the third nucleotide from the 3' end of the 5' extension, and the cleavage region comprises the nucleotide sequence shown in formula (II).
[0244] Equation (II): (3'-5')X2-YZ-N1.
[0245] In some embodiments, the cleavage region further comprises fragment N, which contains at least one nucleotide, wherein the nucleotide at the 3' end of fragment N is N1, and the cleavage region comprises the nucleotide sequence shown in formula (III).
[0246] Equation (III): (3'-5')X2-YZN,
[0247] The length of fragment N is 1-10 nucleotides, preferably 1-5 nucleotides, and more preferably 1 nucleotide.
[0248] In some embodiments, N is adenine nucleotide (A), guanine nucleotide (G), cytosine nucleotide (C), uracil nucleotide (U), their natural analogs or their non-natural analogs; preferably, N1 is cytosine nucleotide (C), a natural analog of cytosine nucleotide (C) or a non-natural analog of cytosine nucleotide (C).
[0249] In some embodiments, the formula (III) has a sequence (3'-5') selected from the following: AAGC and UAGC.
[0250] In some embodiments, the sense strand or sense nucleic acid fragment and the antisense strand of the RNA inhibitor are selected from at least 15 consecutive nucleotide sequences that differ from each of the sequences in Table 1 by zero, one, two or three nucleotides, for example, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 consecutive nucleotides.
[0251] Table 1. siRNA sense and antisense strand sequences
[0252] On the other hand, this application provides an RNA inhibitor for inhibiting the expression of insulin-like growth factor 1 receptor (IGF-1R) gene, comprising an antisense strand, wherein the antisense strand forms a complementary region with at least 15 consecutive nucleotides in the mRNA encoding IGF-1R, starting from nucleotide 6366 at the 5' end, wherein the complementary region has 0, 1, 2, 3, 4 or 5 mismatches, preferably the length of the complementary region is 15-30 nucleotide pairs, more preferably 17-23 nucleotide pairs.
[0253] In some embodiments, the antisense strand and the mRNA encoding IGF-1R (SEQ ID NO:828) form a complementary region consisting of 15, 16, 17, 18, 19, 20, 21, 22 or 23 consecutive nucleotides starting from the 6366th nucleotide at the 5' end.
[0254] In some embodiments, the antisense strand and the mRNA (SEQ ID NO: 828) encoding IGF-1R, starting from nucleotide 6366 at the 5' end, have at least 75%, 80%, 90%, 95%, or 100% complementarity for the following 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides.
[0255] In some embodiments, the antisense strand and the mRNA (SEQ ID NO:828) encoding IGF-1R, starting from nucleotide 6366 at the 5' end, have at least 85% or 90% complementarity for the following 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides.
[0256] In some embodiments, the antisense strand comprises at least 15 consecutive nucleotides of the sequence shown in SEQ ID NO:296 (AAUAUCUGAACCGUAAAAAAG).
[0257] In some embodiments, the antisense strand comprises at least 19, 20, or 21 consecutive nucleotides of the sequence shown in SEQ ID NO:296 (AAUAUCUGAACCGUAAAAAAG).
[0258] In some embodiments, the RNA inhibitor comprises a sense strand capable of forming a complementary double helix with the antisense strand, wherein the antisense strand comprises a sequence forming a double-stranded complementary region with at least 15 consecutive nucleotides in the sense strand sequence, the double-stranded complementary region having 0, 1, 2, 3, 4 or 5 mismatches, preferably having 0, 1 or 2 mismatches, and preferably the length of the double-stranded complementary region is 15-30 nucleotide pairs, more preferably 17-23 nucleotide pairs.
[0259] In some embodiments, the positive strand comprises at least 15 consecutive nucleotides of the sequence shown in SEQ ID NO:98 (CUUUUUUACGGUUCAGAUAUU), with a difference of no more than 3, preferably 19, 20, or 21 consecutive nucleotides with a difference of no more than 0, 1, 2, or 3.
[0260] In some embodiments, the RNA inhibitor comprises a sense strand as shown in SEQ ID NO:98 (CUUUUUUACGGUUCAGAUAUU) and an antisense strand as shown in SEQ ID NO:296 (AAUAUCUGAACCGUAAAAAAG).
[0261] In some embodiments, the antisense strand of the RNA inhibitor includes the following sequence:
[0262] 5'-(Z5)Z(Z1)(Z2)AUAUCUGAACCGUAAAAAAG(Z3)(Z4)-3'(SEQ ID NO 835),
[0263] Z5, Z, Z1, Z2, Z3 and Z4 each independently represent A, U, C or G.
[0264] In some implementations, Z is G.
[0265] In some implementations, Z2 is A or U.
[0266] In some implementations, Z1 is A or U.
[0267] In some implementations, Z5 is C.
[0268] In some implementations, Z3 and / or Z4 are C or U; optionally, both Z3 and Z4 are U.
[0269] In some embodiments, the antisense strand comprises a sequence that differs from the following sequences by no more than two or one nucleotide:
[0270] 5'-CGAAAAUAUCUGAACCGUAAAAAAGUU-3' (SEQ ID NO: 411).
[0271] In some embodiments, the nucleotide difference is located at any position among positions 1-4, 5-24, or 25-26 starting from the 5' end of SEQ ID NO:411.
[0272] In some implementations, the antisense chain includes the following sequence:
[0273] 5'-CGAAAAUAUCUGAACCGUAAAAAAGUU-3' (SEQ ID NO: 411).
[0274] In some embodiments, the antisense strand of the said RNA inhibitor includes the following sequence
[0275] 5'-M (0-4) -CGAAAUAUCUGAACCGUAAAAAAGUU-3' (SEQ ID NO:411 when M is 0, SEQ ID NO:836 when M is 1, SEQ ID NO:837 when M is 2, SEQ ID NO:838 when M is 3, and SEQ ID NO:839 when M is 4), where each M independently represents A, U, C, or G.
[0276] In some embodiments, the antisense strand of the said RNA inhibitor comprises at least 15 consecutive nucleotides of the sequence shown in SEQ ID NO:398(AAUAUCUGAACCGUAAAAAAGUU).
[0277] In some embodiments, the antisense strand of the said RNA inhibitor comprises 19, 20, 21, 22 or 23 consecutive nucleotides of the sequence shown in SEQ ID NO:398(AAUAUCUGAACCGUAAAAAAGUU).
[0278] In some embodiments, the RNA inhibitor comprises a sense strand as shown in SEQ ID NO:98 (CUUUUUUACGGUUCAGAUAUU) and an antisense strand as shown in SEQ ID NO:398 (AAUAUCUGAACCGUAAAAAAGUU).
[0279] In some embodiments, the RNA inhibitor comprises a sense strand as shown in SEQ ID NO:98 (CUUUUUUACGGUUCAGAUAUU) and an antisense strand as shown in SEQ ID NO:411 (CGAAAUAUCUGAACCGUAAAAAAGUU).
[0280] In some embodiments, the RNA inhibitor is single-stranded or double-stranded.
[0281] In some embodiments, the sense and antisense strands exist on the same nucleic acid strand, and the preferred RNA inhibitor is shRNA.
[0282] In some embodiments, the sense and antisense strands exist on two different nucleic acid strands, and the RNA inhibitor is preferably siRNA, miRNA, or shRNA, with siRNA being more preferred.
[0283] In some embodiments, the total length of the positive strand is 15-50 nucleotides, preferably 16-30 nucleotides, and more preferably 16, 17, 18, 19, 20, 21, 22 or 23 nucleotides.
[0284] In some embodiments, the total length of the antisense strand is 15-50 nucleotides, preferably 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides, and more preferably 26-30 nucleotides.
[0285] In some embodiments, the sense strand and antisense strand exist on two different nucleic acid strands, the sense strand having a total length of 16, 17, 18, 19, 20, 21, 22 or 23 nucleotides, and the antisense strand having a total length of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides, and the sense strand and antisense strand each independently and optionally contain 0, 1, 2 or 3 nucleotides of 3' or 5' overhang.
[0286] In some embodiments, both the sense strand and the antisense strand have a 3' overhang of 1-3 nucleotides in length, or the sense strand has a 3' or 5' overhang of 1-3 nucleotides in length, or the antisense strand has a 3' or 5' overhang of 1-3 nucleotides in length.
[0287] In some embodiments, the 3' or 5' end of the antisense strand comprises a phosphate or a phosphate analogue, or the 3' or 5' end of the sense strand comprises a phosphate or a phosphate analogue.
[0288] In some embodiments, the phosphate analogues include 5'-(E)-vinylphosphonate, 5'-methylphosphonate, (S)-5'-C-methyl analogue and 5'-thiophosphate (5'-PS).
[0289] Modified nucleotides
[0290] To enhance the stability of the aforementioned RNA inhibitors in vivo, without affecting or even enhancing their activity, the sense and antisense strands of the RNA inhibitors can be modified. The nucleotides may have modifying groups, and the entire strand or parts of the strand may be modified. In some embodiments, one or more nucleotides on the sense and / or antisense strands are modified to form modified nucleotides.
[0291] As used herein, the term "nucleotide" refers to a pentose sugar (ribose or deoxyribose), a phosphate group, and a base (natural or non-natural), and is intended to include both unmodified (i.e., natural) nucleotides and modified nucleotides. In some embodiments, the nucleotide is an unmodified ribonucleotide. In some embodiments, the ribonucleotide is a 3'-ribonucleotide. In some embodiments, the ribonucleotide is a 5'-ribonucleotide. In some embodiments, the modified or unmodified nucleotide may optionally be further modified.
[0292] Natural nucleotides are composed of natural bases, natural ribose, and phosphate. The natural nucleotides used in this article refer to adenine ribonucleotides, adenine deoxyribonucleotides, guanine ribonucleotides, guanine deoxyribonucleotides, cytosine ribonucleotides, cytosine deoxyribonucleotides, uracil ribonucleotides, thymine ribonucleotides, or thymine deoxyribonucleotides. "Ribonucleotide" refers to a nucleotide having a hydroxyl group at the 2' position of its sugar moiety. "Deoxyribonucleoside" refers to a nucleotide having a hydrogen atom at the 2' position of its sugar moiety.
[0293] The natural bases of RNA include A (adenine), G (guanine), C (cytosine), U (uracil), and T (thymine).
[0294] As used in this article, the "d" prefix before monomers (such as nucleotides A, U, C, G, and T) indicates that the monomer is 2'-deoxygenated.
[0295] As used in this article, the label “f” after monomers (such as nucleotides A, U, C, G, and T) indicates that the monomer is modified by 2'-deoxy-2'-fluorine (2'-F modification).
[0296] As used herein, the prefix "GNA-" before monomers (such as nucleotides A, U, C, G, and T) indicates that the monomer has been modified with ethylene glycol nucleic acid (GNA modification). As used herein, Tgn is the code for GNA-T, with the same meaning.
[0297] As used in this article, lowercase letters (a, u, c, g, t, etc.) indicate that the nucleotide represented by the corresponding uppercase letters (A, U, C, G, and T, etc.) is modified by 2'-O-methyl (2'-OMe).
[0298] As used herein, invAB modification refers to the attachment of an inverted, baseless nucleotide to the 5' or 3' end of a nucleotide. For example, The structure modified by invAB:
[0299] As used in this article, M06 modification refers to the bonding of a linker at the 5' or 3' end of a monomer (such as a nucleotide). For example, The structure modified by M06 via phosphate bonds: In this invention, (M06) It is M06 monomer The residues. In some embodiments, (M06) is through It is bonded to a nucleotide.
[0300] As used in this article, marking "*" between monomers (such as nucleotides A, U, C, G, and T) indicates that the two monomers are linked by a thiophosphate bond (i.e., a thiophosphate diester bond), meaning they are modified by thiophosphate (PS).
[0301] As used in this article, the absence of an asterisk (*) between nucleotides (A, U, C, G, and T, etc.) indicates that the two nucleotides are linked by a phosphate ester bond (i.e., a phosphodiester bond).
[0302] For example, "5'-Phosphorothioate-invAB" means that (invAB) is linked to the 5' end of the monomer via a phosphate thioester bond. Similarly, "5'-Phosphorothioate-M06" means that (M06) is linked to the 5' end of the monomer via a phosphate thioester bond.
[0303] All nucleotides in the small inhibitory nucleic acid molecule described herein may be natural or unmodified nucleotides, or at least one nucleotide may be a modified nucleotide, wherein the modification is one or a combination of the following modifications:
[0304] (1) Modification of the phosphodiester bonds of nucleotides in the nucleotide sequence of the small inhibitory nucleic acid molecule;
[0305] (2) Modification of the 2'-OH of the ribose in the nucleotide sequence of the small inhibitory nucleic acid molecule;
[0306] (3) Modification of the bases in the nucleotide sequence of the small inhibitory nucleic acid molecule.
[0307] The chemical modifications of this invention are well known to those skilled in the art. The modification of the phosphodiester bond refers to the modification of the oxygen in the phosphodiester bond, including thiophosphate modification and boronyl phosphate modification. Both modifications can stabilize the siRNA structure and maintain high specificity and high affinity of base pairing.
[0308] The ribose modification refers to the modification of the 2'-OH group in the pentose of the nucleotide, that is, the introduction of certain substituents at the hydroxyl position of the ribose, such as 2'-fluoro modification, 2'-oxymethyl modification, 2'-oxyethylidene methoxy modification, 2,4'-dinitrophenol modification, locked nucleic acid (LNA), 2'-amino modification, and 2'-deoxy modification.
[0309] The base modification refers to the modification of the bases of nucleotides, such as 5'-bromouracil modification, 5'-iodouracil modification, N-methyluracil modification, and 2,6-diaminopurine modification.
[0310] In some embodiments, the modification of the ribose includes fluorine substitution and / or methoxy substitution of the 2'-OH.
[0311] In some embodiments, the modification of the ribose further includes modification with UNA, LNA, or GNA.
[0312] The term "LNA" refers to a bicyclic nucleoside analog containing a C2*-C4* bibase (bridge) and is called a "locked nucleic acid". It can refer to an LNA monomer, or, when used in the context of "LNA oligonucleotide", LNA refers to an oligonucleotide containing one or more such bicyclic nucleotide analogs. In some respects, bicyclic nucleoside analogs are LNA nucleotides, and these terms are therefore used interchangeably, and in such embodiments, both are characterized by the presence of a linking group (such as a bridge) between the C2' and C4' of the ribose ring.
[0313] UNA (unlocked nucleic acid) has a structure similar to RNA, but lacks the C2 and C3 chemical bonds of the ribose ring. Its structure is shown below:
[0314] B is a base.
[0315] GNA (glycerol-containing nucleic acid) is a chemical substance similar to DNA or RNA, but with a different composition and does not exist in any currently known living organisms in nature. GNA contains an acyclic, three-carbon propylene glycol (1,2-propanediol) backbone that replaces the (deoxy)ribose sugar of DNA and RNA, forming the simplest structure of chemically stable nucleic acids. The S-(GNA) structure is shown below.
[0316] B is a base.
[0317] In some embodiments, the RNA inhibitor is wherein at least one nucleotide in the RNA inhibitor is a chemically modified nucleotide.
[0318] In some embodiments, the RNA inhibitor is wherein all nucleotides in the RNA inhibitor are chemically modified nucleotides.
[0319] In some embodiments, the RNA inhibitor, wherein the modification comprises one or more combinations of the following: 2'-OMe (2'-O-methyl) modification, 2'-F (2'-deoxy-2'-fluorine) modification, 2'-O-MOE (2'-O-methoxyethyl) modification, 2'-deoxy (2'-d) modification, 5'-morpholine (5'-Mo) modification, unlocking nucleic acid (UNA) modification, glycol nucleic acid (GNA) modification, locked nucleic acid (LNA) modification, tricyclic DNA (tcDNA) modification, (S)-restricted ethyl bicyclic nucleic acid ((S)-cEt-BNA) modification, phosphate thioester (PS) modification, phosphate dithioester (PS2) modification, methylphosphonate (MP) modification, methoxypropyl methylphosphonate (MOP) modification, peptide nucleic acid (PNA) modification, 5'-(E)-vinyl phosphate (VP) modification. Modifications include VP, N6-methyladenosine (m6A), 5-methylcytidine (m5C), 3-methyluridine (m3U), 5-methylureaside (m5U), pseudoureaside, 2-thioureaside (s2U), propynouraidine (5-pU), linking the 5' or 3' end of the nucleotide to an inverted abasic nucleotide (invAB), replacing the nucleotide with an inverted abasic nucleotide (invAb), replacing the nucleotide with 2,4-difluorotolyl ribonucleotide (rF), or replacing the nucleotide with (S)-glycerol nucleic acid. Preferred modifications include 2'-OMe, 2'-F, 2'-deoxy, VP, 5'-MP, PS, PS2, MP, MOP, invAb, and invAB.
[0320] In some embodiments, the RNA inhibitor, when the sense strand length is 21 nt, has a 2'-F modification at the 9th nucleotide position of the sense strand, starting from the 5' end.
[0321] In some embodiments, the RNA inhibitor, when the sense strand length is 21 nt, has a 2'-F modification at the 10th nucleotide position of the sense strand, starting from the 5' end.
[0322] In some embodiments, the RNA inhibitor, when the sense strand length is 21 nt, has a 2'-F modification at the 11th nucleotide position of the sense strand, starting from the 5' end.
[0323] In some embodiments, the RNA inhibitor, when the sense strand length is 21 nt, has 2'-F modifications at positions 9, 10, and 11 of the sense strand, counted from the 5' end, with the remainder being 2'-OMe modifications.
[0324] In some embodiments, the RNA inhibitor is used in a manner where, when the sense strand length is 21 nt, counting begins from the 5' end, wherein the 5' end of the first nucleotide of the sense strand is modified with invAB.
[0325] In some embodiments, the RNA inhibitor wherein the inverted abase-free nucleotide is linked to the 5' end of the first nucleotide of the sense strand via a phosphate thioester.
[0326] In some embodiments, the RNA inhibitor, when the antisense strand length is 21 nt, is counted starting from the 5' end, with a phosphate thioester link between the first and second nucleotides of the antisense strand.
[0327] In some embodiments, the RNA inhibitor, when the antisense strand length is 21 nt, is counted starting from the 5' end, with a phosphate thioester link between the second and third nucleotides of the antisense strand.
[0328] In some embodiments, the RNA inhibitor, when the antisense strand length is 21 nt, is counted starting from the 5' end, with a phosphate thioester link between the 3rd and 4th nucleotides of the antisense strand.
[0329] In some embodiments, the RNA inhibitor, when the antisense strand length is 21 nt, is counted starting from the 3' end, with a phosphate thioester link between the first and second nucleotides of the antisense strand.
[0330] In some embodiments, the RNA inhibitor, when the antisense strand length is 21 nt, has a phosphate thioester link between the first and second nucleotides of the antisense strand, a phosphate thioester link between the second and third nucleotides, and a phosphate thioester link between the third and fourth nucleotides, starting from the 5' end; and has a phosphate thioester link between the first and second nucleotides of the antisense strand, starting from the 3' end.
[0331] In some embodiments, the RNA inhibitor, when the antisense strand length is 21 nt, is counted starting from the 5' end, with the nucleotide at position 2 of the antisense strand having a 2'-F modification.
[0332] In some embodiments, the RNA inhibitor, when the antisense strand length is 21 nt, has a 2'-F modification at the 3rd position of the antisense strand, starting from the 5' end.
[0333] In some embodiments, the RNA inhibitor, when the antisense strand length is 21 nt, has a 2'-F modification at the 4th position of the antisense strand, starting from the 5' end.
[0334] In some embodiments, the RNA inhibitor, when the antisense strand length is 21 nt, has a 2'-F modification at the 12th position of the antisense strand, starting from the 5' end.
[0335] In some embodiments, the RNA inhibitor, when the antisense strand length is 21 nt, has a 2'-F modification at position 14 of the antisense strand, starting from the 5' end.
[0336] In some embodiments, the RNA inhibitor, when the antisense strand length is 21 nt, has a 2'-F modification at position 16 of the antisense strand, starting from the 5' end.
[0337] In some embodiments, the RNA inhibitor, when the antisense strand is 21 nt in length, has nucleotides at positions 2, 3, 4, 12, 14, and 16 of the antisense strand modified with 2'-F, and the remainder modified with 2'-OMe, starting from the 5' end.
[0338] In some embodiments, the RNA inhibitor, when the antisense strand length is 21 nt, has a phosphate thioester link between the first and second nucleotides of the antisense strand, a phosphate thioester link between the second and third nucleotides, and a phosphate thioester link between the third and fourth nucleotides, starting from the 5' end; and has a phosphate thioester link between the first and second nucleotides of the antisense strand, starting from the 3' end; and has 2'-F modification on the nucleotides at positions 2, 3, 4, 12, 14, and 16 of the antisense strand, with the remainder being 2'-OMe modification.
[0339] In some embodiments, the RNA inhibitor,
[0340] a) When the length of the sense strand is 21 nt, the sense strand includes the following modifications: starting from the 5' end, the nucleotides at positions 9, 10, and 11 have a 2'-F modification, and the rest have a 2'-OMe modification; starting from the 5' end, the 5' end of position 1 has an invAB modification.
[0341] b) When the antisense strand is 21 nt in length, the antisense strand includes the following modifications: counting from the 5' end, there is a phosphate thioester link between the 1st and 2nd nucleotides, a phosphate thioester link between the 2nd and 3rd nucleotides, and a phosphate thioester link between the 3rd and 4th nucleotides; and counting from the 3' end, there is a phosphate thioester link between the 1st and 2nd nucleotides; and the nucleotides at positions 2, 3, 4, 12, 14, and 16 have a 2'-F modification, and the rest have a 2'-OMe modification.
[0342] In some embodiments, the RNA inhibitor, when the sense strand length is 21 nt, has a 2'-F modification at position 18, starting from the 5' end.
[0343] In some embodiments, the RNA inhibitor, when the sense strand length is 21 nt, has nucleotides at positions 9, 10, 11, and 18 having a 2'-F modification, and the remainder having a 2'-OMe modification, starting from the 5' end.
[0344] In some embodiments, the RNA inhibitor, when the positive strand length is 21 nt, has a phosphate thioester linker between the first and second nucleotides, starting from the 5' end.
[0345] In some embodiments, the RNA inhibitor, when the positive strand length is 21 nt, has a phosphate thioester link between the 2nd and 3rd nucleotides, starting from the 5' end.
[0346] In some embodiments, the RNA inhibitor, when the positive strand length is 21 nt, has a phosphate thioester linker between the first and second nucleotides, starting from the 3' end.
[0347] In some embodiments, the RNA inhibitor, when the positive strand length is 21 nt, has a phosphate thioester linker between the 2nd and 3rd nucleotides, starting from the 3' end.
[0348] In some embodiments, the RNA inhibitor, when the sense strand length is 21 nt, counting from the 5' end, has a phosphate thioester link between the 1st and 2nd nucleotides of the sense strand, a phosphate thioester link between the 2nd and 3rd nucleotides of the sense strand, and 2'-F modification at the 9th, 10th, 11th, and 18th nucleotides of the sense strand, with the remainder being 2'-OMe modification; counting from the 3' end, has a phosphate thioester link between the 1st and 2nd nucleotides of the sense strand, and a phosphate thioester link between the 2nd and 3rd nucleotides of the sense strand.
[0349] In some embodiments, the RNA inhibitor, when the antisense strand length is 26 nt, is counted starting from the 5' end, with the nucleotide at position 1 of the antisense strand having a 2'-F modification.
[0350] In some embodiments, the RNA inhibitor, when the antisense strand length is 26 nt, is counted starting from the 5' end, with the nucleotide at position 2 of the antisense strand having a 2'-F modification.
[0351] In some embodiments, the RNA inhibitor, when the antisense strand length is 26 nt, has a 2'-F modification at the 5' end when counting from the 5' end.
[0352] In some embodiments, the RNA inhibitor, when the antisense strand length is 26 nt, has a 2'-F modification at the 9th position of the antisense strand, starting from the 5' end.
[0353] In some embodiments, the RNA inhibitor, when the antisense strand length is 26 nt, has a 2'-F modification at position 17 of the antisense strand, starting from the 5' end.
[0354] In some embodiments, the RNA inhibitor, when the antisense strand length is 26 nt, has a 2'-F modification at position 19 of the antisense strand, starting from the 5' end.
[0355] In some embodiments, the RNA inhibitor, when the antisense strand is 26 nt in length, has nucleotides at positions 1, 2, 5, 9, 17, and 19 of the antisense strand modified with 2'-F, and the remainder modified with 2'-OMe, starting from the 5' end.
[0356] In some embodiments, the RNA inhibitor, when the antisense strand length is 26 nt, is counted starting from the 5' end, with a phosphate thioester link between the 4th and 5th nucleotides.
[0357] In some embodiments, the RNA inhibitor, when the antisense strand length is 26 nt, is counted starting from the 3' end, with a phosphate thioester link between the 1st and 2nd nucleotides.
[0358] In some embodiments, the RNA inhibitor, when the antisense strand length is 26 nt, is counted starting from the 3' end, with a phosphate thioester link between the 2nd and 3rd nucleotides.
[0359] In some embodiments, the RNA inhibitor, when the antisense strand length is 26 nt, is characterized by the following: starting from the 5' end, the nucleotides at positions 1, 2, 5, 9, 17, and 19 of the antisense strand are 2'-F modified, the remainder are 2'-OMe modified, and there is a thiophosphate link between the 4th and 5th nucleotides; starting from the 3' end, there is a thiophosphate link between the 1st and 2nd nucleotides, and a thiophosphate link between the 2nd and 3rd nucleotides.
[0360] In some embodiments, the RNA inhibitor, when the antisense strand length is 26 nt, is characterized by the following: starting from the 5' end, the nucleotides at positions 1, 2, 5, 17, and 19 of the antisense strand are 2'-F modified, the remainder are 2'-OMe modified, and there is a thiophosphate link between the 4th and 5th nucleotides; starting from the 3' end, there is a thiophosphate link between the 1st and 2nd nucleotides, and a thiophosphate link between the 2nd and 3rd nucleotides.
[0361] In some embodiments, the RNA inhibitor, wherein
[0362] a) When the length of the sense strand is 21 nt, counting from the 5' end, there is a phosphate thioester link between the 1st and 2nd nucleotides of the sense strand, and a phosphate thioester link between the 2nd and 3rd nucleotides of the sense strand. The nucleotides at positions 9, 10, 11, and 18 of the sense strand have 2'-F modification, and the rest have 2'-OMe modification. Counting from the 3' end, there is a phosphate thioester link between the 1st and 2nd nucleotides of the sense strand, and a phosphate thioester link between the 2nd and 3rd nucleotides of the sense strand.
[0363] b) When the antisense strand is 26 nt in length, counting from the 5' end, the nucleotides at positions 1, 2, 5, 9, 17, and 19 of the antisense strand have 2'-F modifications, and the rest have 2'-OMe modifications. There is a thiophosphate link between the 4th and 5th nucleotides. Counting from the 3' end, there is a thiophosphate link between the 1st and 2nd nucleotides, and a thiophosphate link between the 2nd and 3rd nucleotides.
[0364] In some embodiments, the RNA inhibitor, wherein
[0365] a) When the length of the positive strand is 21 nt, counting from the 5' end, there is a phosphate thioester link between the 1st and 2nd nucleotides of the positive strand, a phosphate thioester link between the 2nd and 3rd nucleotides, a phosphate thioester link between the 3rd and 4th nucleotides of the positive strand, a phosphate thioester link between the 4th and 5th nucleotides of the positive strand, and 2'-F modification at the 9th, 10th, 11th, and 18th nucleotides of the positive strand, with the remainder being 2'-OMe modification; counting from the 3' end, there is a phosphate thioester link between the 1st and 2nd nucleotides of the positive strand, and a phosphate thioester link between the 2nd and 3rd nucleotides of the positive strand;
[0366] b) When the antisense strand is 26 nt in length, counting from the 5' end, the nucleotides at positions 1, 2, 5, 17, and 19 of the antisense strand have 2'-F modifications, the rest have 2'-OMe modifications, and there is a thiophosphate link between the 4th and 5th nucleotides; counting from the 3' end, there is a thiophosphate link between the 1st and 2nd nucleotides, and there is a thiophosphate link between the 2nd and 3rd nucleotides.
[0367] In some embodiments, the RNA inhibitor includes a phosphate or phosphate mimicry at the 5' end of the antisense strand.
[0368] In some embodiments, the RNA inhibitors include phosphate mimics comprising 5'-(E)-vinylphosphonate, 5'-methylphosphonate, (S)-5'-C-methyl analog, and 5'-thiophosphate (5'-PS).
[0369] In some embodiments, the RNA inhibitor wherein the 5'-end of the antisense strand includes (M06):
[0370] In some embodiments, the RNA inhibitor (M06) is linked to the 5' end of the antisense strand via a phosphate ester or thiophosphate bond.
[0371] In some embodiments, the RNA inhibitor has an invAB modification at the 5' end of the first nucleotide of the antisense strand.
[0372] In some embodiments, the RNA inhibitor wherein the inverted abase-free nucleotide is linked to the 5' end of the first nucleotide of the antisense strand via a phosphate thioester.
[0373] The modified sequences are shown in Table 2.
[0374] Table 2 Modified bistrands
[0375] In this context, lowercase letters "g", "c", "a", and "u" represent nucleotides modified with a 2'-methoxy group; uppercase letters "Gf", "Cf", "Af", and "Uf" represent nucleotides modified with a 2'-fluoride group; and * indicates that the two nucleotides adjacent to * are linked by a phosphate thioester group. (D02)*, (invAB)*, (M06)*, *(D02), *(invAB), and *(M06) represent D02, invAB, and M06 linked to the nucleotide via a phosphate thioester. invAB refers to an inverted, non-base nucleotide linked at the 5' or 3' end of the nucleotide. (M06) refers to a structure as described below linked at the 5' or 3' end of a monomer (such as a nucleotide):
[0376] (M06) It can be linked to nucleotides via phosphate or thiophosphate.
[0377] [D02] refers to a structure as described below, where the 5' or 3' end is bonded together:
[0378] It can be linked to nucleotides via phosphate or thiophosphate. Taking 5'-[DO2]*A-3' as an example, in some embodiments, its structure is as follows:
[0379] RNA inhibitors coupled with delivery systems
[0380] Another aspect of the RNA inhibitors in this application relates to a method of coupling interfering nucleic acids with a delivery system to enhance the stability, activity, cellular distribution, or cellular uptake of the RNAi agent.
[0381] In some implementations, the distribution, targeting, or stability of RNA inhibitors is altered by introducing a delivery system for the target tissue receptor. For example, a specific delivery system can provide enhanced affinity for selected targets (e.g., molecules, cells or cell types, compartments (e.g., cellular or organ compartments, body tissues, organs, or regions)) compared to species without such a system.
[0382] Delivery systems can include naturally occurring substances such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulins); carbohydrates (e.g., dextran, styrax, chitosan, chitin, inulin, cyclodextrin, N-acetylglucosamine, N-acetylglucosamine, or hyaluronic acid); or lipids. Delivery systems can also be recombinant or synthetic molecules, such as synthetic polymers, like synthetic polyamino acids.
[0383] The delivery system may also include a targeting group, such as a cell or tissue target that binds to a specific cell type, such as kidney cells, for example, a lectin, glycoprotein, lipid, or protein, such as an antibody. The targeting group may be thyroid-stimulating hormone, melanocyte-stimulating hormone, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, polygalactose, polygalactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polymannose, polyfucose, glycosylated polyamino acids, polygalactose, transferrin, bisphosphate, polyglutamic acid, polyaspartic acid, lipids, cholesterol, steroids, bile acids, folic acid, vitamin B12, vitamin A, biotin, or RGD peptide or RGD peptide mimics. In some embodiments, the delivery system is a polygalactose, for example, N-acetyl-galactosamine.
[0384] The sense and antisense strands contained in the RNA inhibitor of this application can be conveniently and routinely prepared using well-known solid-phase synthesis techniques. Other methods known in the art for such synthesis, such as liquid-phase synthesis or fermentation, can be used alternatively or as an alternative. The preparation of other oligonucleotides (such as phosphate thioides and alkylated derivatives) using similar techniques is also known.
[0385] In some embodiments, in addition to commercially available and standard nucleoside phosphoramide monomers and non-standard nucleoside phosphoramide monomers commonly used in oligonucleotide synthesis, the oligonucleotides or linked nucleotides of this application can be synthesized by an automated synthesizer using a phosphoramide method derived from a self-delivery system of nucleoside phosphoramide monomers.
[0386] In some embodiments, the delivery system of the present invention is coupled in such a manner as to the 5' end and / or 3' end of the antisense chain, and / or the 5' end and / or 3' end of the justice chain via a delivery system structure.
[0387] For example, the delivery system structure may be coupled to the 5' end and / or the 3' end of the justice chain; or the delivery system structure may be coupled to the 5' end of the antisense chain and the delivery system structure may be coupled to the 3' end of the justice chain; or the delivery system structure may be coupled to the 3' end of the antisense chain and the delivery system may be coupled to the 5' end of the justice chain; or the delivery system structure may be coupled to both the 5' end and the 3' end of the justice chain; or the delivery system structure may be coupled to the 3' end of the justice chain.
[0388] In some embodiments, the delivery system described in this application is [L96], as shown in the following structural formula:
[0389] In some embodiments, the delivery system described in this application is [D02], as shown in the following structural formula:
[0390] In this invention, [DO2] represents a residue of the DO2 monomer. In some embodiments, the DO2 monomer structure is as follows: In some implementations, [D02] is through It is bonded to a nucleotide.
[0391] Taking 5'-[D02]*A-3' as an example, in some implementations, its structure is as follows:
[0392] Pharmaceutical Composition
[0393] This application also includes pharmaceutical compositions comprising the RNA inhibitor of this application or a pharmaceutically acceptable salt thereof.
[0394] In one embodiment, this document provides a pharmaceutical composition comprising the RNA inhibitor described herein and a pharmaceutically acceptable pharmaceutical excipient.
[0395] Pharmaceutical compositions containing RNA inhibitors can be used to prevent and / or treat IGF-1R-related disorders, such as thyroid ophthalmopathy, osteoarthritis, and neuropathic pain. These pharmaceutical compositions are formulated according to a delivery mode. One example formulation is a composition for systemic administration via parenteral delivery, such as subcutaneous (SC), intramuscular (IM), or intravenous (IV) delivery. The pharmaceutical compositions of this application can be administered at doses sufficient to inhibit IGF-1R gene expression.
[0396] Pharmaceutically acceptable "excipients" or "components" are pharmaceutically acceptable solvents, suspending agents, or any other pharmaceutically inert media for delivering one or more nucleic acids to animals. Excipients may be liquids or solids and are selected with consideration for the planned administration method to provide the required volume, consistency, etc., when combined with the nucleic acid and other components in a given pharmaceutical composition. RNA inhibitors may be delivered in a manner that targets specific tissues (e.g., hepatocytes).
[0397] In some embodiments, the pharmaceutical composition further comprises a delivery medium (such as nanoparticles, dendritic polymers, polymers, liposomes, or cationic delivery systems).
[0398] In some embodiments, the delivery medium includes liposomes.
[0399] In some embodiments, the delivery medium includes nanolipids capable of forming liposome-nucleic acid nanoparticles with nucleic acid molecules.
[0400] use
[0401] On the other hand, this application provides the use of the aforementioned RNA inhibitor that inhibits IGF-1R gene expression or a pharmaceutically acceptable salt thereof in the preparation of a pharmaceutical composition thereof, wherein the pharmaceutical composition is used to prevent or treat a disease or pathology or to reduce the risk of a disease or pathology.
[0402] In some embodiments, the disease or pathology includes diseases or pathologies associated with normal or elevated IGF-1R levels.
[0403] In some embodiments, the disease or pathology includes thyroid ophthalmopathy, osteoarthritis, and neuropathic pain.
[0404] On the other hand, this application provides a method for preventing or treating a disease, symptom, or syndrome, the method comprising administering to a subject in need an effective amount of an RNA inhibitor comprising the aforementioned inhibitory IGF-1R gene expression, a pharmaceutically acceptable salt thereof, or the aforementioned pharmaceutical composition.
[0405] In some embodiments, the RNA inhibitor that inhibits IGF-1R gene expression, its pharmaceutically acceptable salt, or the pharmaceutical composition is administered to the subject via intraorbital injection, intra-articular injection, intrathecal injection, subcutaneous injection, intravenous injection, oral administration, rectal administration, or intraperitoneal administration.
[0406] In some embodiments, the method includes application to local or lesion area tissue of a subject in need.
[0407] In some implementations, the required local or lesion area tissue of the subject includes ocular tissue, joint tissue, central nervous system tissue, peripheral nervous system tissue, tumor, liver tissue, kidney tissue, muscle tissue, or adipose tissue.
[0408] In some embodiments, the ocular tissue is the optic nerve, trabecular meshwork, proximal canal tissue, ganglion, external scleral vein, Schrem's canal, or peripheral ocular tissue. Preferably, the joint tissue includes cartilage tissue, joint connective tissue, and bone tissue. Preferably, the central nervous system tissue includes spinal cord tissue and brain tissue. Preferably, the peripheral nervous system tissue includes intra-articular nerve tissue and muscular nerve tissue. Preferably, the adipose tissue includes subcutaneous adipose tissue and visceral adipose tissue.
[0409] In some embodiments, the ocular tissue is a retinal ganglion, endothelial cells, peripheral ocular muscles, or peripheral ocular fat.
[0410] On the other hand, this application provides a method for inhibiting IGF-1R mRNA or gene expression in cells, tissues or subjects, comprising administering to a subject in need an effective amount of an RNA inhibitor containing the aforementioned inhibitory IGF-1R gene expression, a pharmaceutically acceptable salt thereof, or the aforementioned pharmaceutical composition.
[0411] Cells suitable for treatment using the method of this application can be any cells expressing the IGF-1R gene. Cells suitable for use in the method of this application can be mammalian cells that, when contacted with cells expressing the IGF-1R gene, inhibit the expression of the IGF-1R gene (e.g., human, primate, non-primate, or rat IGF-1R gene) by at least about 50%, for example by PCR or branched DNA (bDNA) based methods, or by protein-based methods such as immunofluorescence assay, Western blotting, or flow cytometry.
[0412] The term “inhibition” as used herein may be used interchangeably with “reduction,” “lowering,” “silencing,” “downregulation,” “suppression,” and other similar terms, and includes any level of inhibition. IGF-1R gene expression may be assessed based on the level or change in the level of any variable associated with IGF-1R gene expression, such as IGF-1R mRNA levels or IGF-1R protein levels. This level may be analyzed in a single cell or in a cell population (including, for example, samples derived from a subject). Inhibition may be assessed by a decrease in the absolute or relative level of one or more variables associated with IGF-1R gene expression compared to a control level. A control level may be any type of control level used in the art, such as baseline levels before administration or levels measured in similar subjects, cells, or samples that have never been treated or have received a control (e.g., a buffer-only control or an active agent-free control).
[0413] Inhibition of IGF-1R gene expression can be manifested by the reduction in the amount of mRNA expressed by a first cell or cell population (such cells may be present, for example, in a sample derived from a subject) in which IGF-1R gene expression is transcribed and treated (e.g., by contacting one or more cells with the RNA inhibitor of this application, or by administering the RNA inhibitor of this application to a subject in which the cells are present) that inhibits IGF-1R gene expression, compared to a second cell or cell population that is substantially the same as the first cell or cell population but not so treated (control cells not treated with the RNA inhibitor or not treated with an RNA inhibitor targeting the target gene). In a preferred embodiment, inhibition is evaluated in cell lines with high IGF-1R gene expression using appropriate concentrations of siRNA as provided in the examples, and the mRNA level in the intervened cells is expressed as a percentage of the mRNA level in the uninterrupted control cells.
[0414] In other embodiments, inhibition of IGF-1R gene expression can be evaluated by a decrease in a parameter functionally associated with IGF-1R gene expression, such as the level of IGF-1R protein in the subject's blood or serum. IGF-1R gene silencing can be performed in any IGF-1R-expressing cells (endogenous or exogenous from a gene expression construct) and can be determined by any analytical method known in the art.
[0415] Inhibition of IGF-1R protein expression can be represented by a decrease in the level of IGF-1R protein expressed in cells or cell populations or in a subject sample (e.g., protein levels in a blood sample derived from a subject). As described above, for the evaluation of mRNA inhibition, inhibition of protein expression levels in treated cells or cell populations can similarly be expressed as a percentage of protein levels in control cells or cell populations, or a change in protein levels in a subject sample (e.g., blood or serum derived from it).
[0416] Control cells, cell populations, or subject samples that can be used to evaluate IGF-1R gene inhibition include cells, cell populations, or subject samples that have not been exposed to the RNAi agent of this application. For example, control cells, cell populations, or subject samples may be derived from a single subject (e.g., a human or animal subject) prior to treatment with the RNAi agent or from an appropriately matched population of controls.
[0417] The level of IGF-1R expressed in cells or cell populations can be determined using any method known in the art for evaluating mRNA gene expression. For example, qRT-PCR can be used to evaluate a decrease in gene expression. A decrease in protein production can be evaluated using any method known in the art, such as ELISA. In some embodiments, a liver biopsy sample is used as tissue material to monitor decreased expression of the IGF-1R gene or protein gene. In other embodiments, a blood sample is used as a subject sample to monitor decreased IGF-1R protein expression.
[0418] The embodiments described below are not intended to be limited by any theory, but are merely for illustrating the fusion protein, preparation method and use of this application, and are not intended to limit the scope of the invention.
[0419] This application provides the following implementation methods:
[0420] 1. An RNA inhibitor for inhibiting the expression of insulin-like growth factor 1 receptor (IGF-1R) gene, comprising an antisense strand, said antisense strand forming a complementary region with at least 15 consecutive nucleotides in mRNA encoding IGF-1R (SEQ ID NO: 828), said complementary region having 0, 1, 2, 3, 4 or 5 mismatches, preferably said complementary region being 15-30 nucleotide pairs in length, more preferably 17-23 nucleotide pairs.
[0421] 2. The RNA inhibitor according to Embodiment 1, wherein the antisense strand and the mRNA (SEQ ID NO: 828) encoding IGF-1R form a complementary region consisting of any one of the following positions starting from the 5' end:
[0422] Nucleotide positions 1118, 1120, 1154, 1367, 1407, 1415, 1532, 1625, 1627, 1628, 1631, 3356, 3357, 3359, 3792, 4198, 4200, 4208, 4685, 5246, 5392, 5393, 6329, 6332, and 6333. Nucleotide positions 6334, 10215, 10738, 10740, 10770, 10772, 10773, 10946, 10956, 10957, 1418, 1541, 2050, 2055, 2056, 2233, 2234, 2456, 2591, 2603, 2606, 2609, 2776, and 2890. Nucleotide positions 2906, 2909, 2957, 2960, 3008, 3195, 3398, 3608, 3609, 3650, 3660, 3815, 3882, 3996, 4067, 4121, 4122, 4292, 4293, 4295, 4516, 4519, 5163, 5309, and 5310. Nucleotide positions 5377, 5380, 5381, 5663, 5700, 5711, 5712, 5721, 5896, 5898, 6203, 6236, 6237, 6240, 6245, 6288, 6299, 6305, 6309, 6310, 6343, 6363, 6365, 6366, and 6373.Nucleotide positions 6379, 6381, 6431, 6434, 6496, 6518, 6755, 6760, 6883, 6885, 6947, 6948, 6949, 6952, 6953, 6954, 7574, 7621, 7764, 7830, 7906, 8540, 8836, 8892, and 8975 (nucleotides) Acid, nucleotide at position 8977, nucleotide at position 9163, nucleotide at position 9175, nucleotide at position 9186, nucleotide at position 9265, nucleotide at position 9267, nucleotide at position 9340, nucleotide at position 9347, nucleotide at position 9352, nucleotide at position 9356, nucleotide at position 9478, nucleotide at position 9480, nucleotide at position 9606, nucleotide at position 9611, nucleotide at position 9634, nucleotide at position 9680, nucleotide at position 9681, nucleotide at position 9724, nucleotide at position 9725, nucleotide at position 9814, nucleotide at position 10015, nucleotide at position 10016, nucleotide at position 10189, nucleotide at position 10244, nucleotide at position 10 Nucleotide 266, nucleotide 10490, nucleotide 10526, nucleotide 10528, nucleotide 10534, nucleotide 10535, nucleotide 10537, nucleotide 10540, nucleotide 10541, nucleotide 10679, nucleotide 10694, nucleotide 10717, nucleotide 10728, nucleotide 10729, nucleotide 10730, nucleotide 10754, nucleotide 10763, nucleotide 10766, nucleotide 10942, nucleotide 11034, nucleotide 11078, nucleotide 11126, nucleotide 11156 Nucleotide positions 11159, 11160, 11292, 11340, 11344, 11383, 11395, 11789, 11864, 11865, 11939, 12092, 12116, 12130, 12154, 12156, 12177, 12195, 1164, 1163, 1162, 1161, and 1160.Nucleotide 1165, nucleotide 1166, nucleotide 1167, nucleotide 1168.
[0423] 3. The RNA inhibitor according to any one of embodiments 1-2, wherein the antisense strand and the sequence between nucleotides 1160 and 1188, nucleotides 6235 and nucleotide 6465, counting from the 5' end of the mRNA (SEQ ID NO: 828) encoding IGF-1R, form a complementary region, or the sequence between nucleotides 6329 and nucleotide 6455 forms a complementary region.
[0424] 4. The RNA inhibitor according to any one of embodiments 1-3, wherein the RNA inhibitor is ribonucleic acid, and further, the RNA inhibitor is single-stranded ribonucleic acid or double-stranded ribonucleic acid.
[0425] 5. The RNA inhibitor according to any one of embodiments 1-4, wherein the RNA inhibitor is an antisense oligonucleotide (ASO), shRNA, miRNA or siRNA.
[0426] 6. The RNA inhibitor according to any one of embodiments 1-5, comprising a sense strand capable of forming a complementary double strand with the antisense strand, wherein the antisense strand comprises a sequence forming a double-stranded complementary region with at least 15 consecutive nucleotides in the sense strand sequence, the double-stranded complementary region having 0, 1, 2, 3, 4 or 5 mismatches, preferably the length of the double-stranded complementary region being 15-30 nucleotide pairs, more preferably 17-23 nucleotide pairs.
[0427] 7. The RNA inhibitor according to embodiment 6, wherein the sense strand and antisense strand exist on two different nucleic acid strands, preferably the RNA inhibitor is siRNA or shRNA, more preferably the RNA inhibitor is siRNA.
[0428] 8. The RNA inhibitor according to any one of embodiments 6-7, wherein the sense strand and the antisense strand exist on the same nucleic acid strand, and the preferred RNA inhibitor is shRNA.
[0429] 9. The RNA inhibitor according to any one of embodiments 6-8, wherein the total length of the positive strand is 15-50 nucleotides, preferably 16-30 nucleotides, and more preferably 17, 18, 19, 20 or 21 nucleotides.
[0430] 10. The RNA inhibitor according to any one of embodiments 6-9, wherein the total length of the antisense strand is 19-50 nucleotides, preferably 19-30 nucleotides, and more preferably 21, 22, 23, 24, 25, 26 or 27 nucleotides.
[0431] 11. The RNA inhibitor according to any one of embodiments 6-10, wherein the sense strand and the antisense strand each optionally independently comprise a 3' or 5' overhang of 1, 2 or 3 nucleotides.
[0432] 12. The RNA inhibitor according to embodiment 11, wherein both the sense strand and the antisense strand have a 3' overhang of 1-3 nucleotides in length, or the sense strand has a 3' or 5' overhang of 1-3 nucleotides in length, or the antisense strand has a 3' or 5' overhang of 1-3 nucleotides in length.
[0433] 13. The RNA according to any one of embodiments 1-12, wherein the antisense strand comprises at least 15 consecutive nucleotides in the sequence as described in any one of SEQ ID NO:199-400.
[0434] 14. The RNA inhibitor according to any one of embodiments 6-13, wherein the positive strand comprises at least 15 consecutive nucleotides in the sequence as described in any one of SEQ ID NO:1-198.
[0435] 15. The RNA inhibitor according to any one of embodiments 1-14, comprising a double strand selected from the following: ds-n1, ds-n2, ds-n3, ds-n4, ds-n5, ds-n6, ds-n7, ds-n8, ds-n9, ds-n10, ds-n11, ds-n12, ds-n13, ds-n14, ds-n15, ds-n16, ds-n17, ds-n18, ds-n19, ds-n20, ds-n21, ds-n22, ds-n23, ds-n24, ds-n25, ds-n26, ds-n27, ds-n28, ds-n29, ds-n30, ds-n31. ds-n32, ds-n33, ds-n34, ds-n35, ds-n36, ds-n37, ds-n38, ds-n39, ds-n40 , ds-n41, ds-n42, ds-n43, ds-n44, ds-n45, ds-n46, ds-n47, ds-n48, ds-n4 9. ds-n50, ds-n51, ds-n52, ds-n53, ds-n54, ds-n55, ds-n56, ds-n57, ds-n 58. ds-n59, ds-n60, ds-n61, ds-n62, ds-n63, ds-n64, ds-n65, ds-n66, ds-n 67. ds-n68, ds-n69, ds-n70, ds-n71, ds-n72, ds-n73, ds-n74, ds-n75, ds- n76, ds-n77, ds-n78, ds-n79, ds-n80, ds-n81, ds-n82, ds-n83, ds-n84, ds -n85, ds-n86, ds-n87, ds-n88, ds-n89, ds-n90, ds-n91, ds-n92, ds-n93, d s-n94, ds-n95, ds-n96, ds-n97, ds-n98, ds-n99, ds-n100, ds-n101, ds-n10 2. ds-n103, ds-n104, ds-n105, ds-n106, ds-n107, ds-n108, ds-n109, ds-n 110, ds-n111, ds-n112, ds-n113, ds-n114, ds-n115, ds-n116, ds-n117, ds- n118, ds-n119, ds-n120, ds-n121, ds-n122, ds-n123, ds-n124, ds-n125, d s-n126, ds-n127, ds-n128, ds-n129, ds-n130, ds-n131, ds-n132, ds-n133,ds-n134, ds-n135, ds-n136, ds-n137, ds-n138, ds-n139, ds-n140, ds-n141, ds-n1 42. ds-n143, ds-n144, ds-n145, ds-n146, ds-n147, ds-n148, ds-n149, ds-n150, ds -n151, ds-n152, ds-n153, ds-n154, ds-n155, ds-n156, ds-n157, ds-n158, ds-n159 , ds-n160, ds-n161, ds-n162, ds-n163, ds-n164, ds-n165, ds-n166, ds-n167, ds-n 168, ds-n169, ds-n170, ds-n171, ds-n172, ds-n173, ds-n174, ds-n175, ds-n176, d s-n177, ds-n178, ds-n179, ds-n180, ds-n181, ds-n182, ds-n183, ds-n184, ds-n18 5. ds-n186, ds-n187, ds-n188, ds-n189, ds-n190, ds-n191, ds-n192, ds-n193, ds- n194, ds-n195, ds-n196, ds-n197, ds-n198, ds-n201, ds-n202, ds-n203, ds-n204. ,
[0436] 16. The RNA inhibitor according to embodiment 15, comprising a double strand selected from the following: ds-n17, ds-n23, ds-n31, ds-n39, ds-n45, ds-n58, ds-n60, ds-n64, ds-n67, ds-n68, ds-n73, ds-n74, ds-n76, ds-n77, ds-n80, ds-n81, ds-n83, ds-n84, ds-n86, ds-n88, ds-n89, ds-n 98. ds-n99, ds-n103, ds-n104, ds-n112, ds-n113, ds-n115, ds-n153, ds-n154, ds-n156, ds-n157, ds-n163, ds- n164, ds-n165, ds-n188, ds-n190, ds-n191, ds-n192, ds-n193, ds-n194, ds-n195, ds-n196, ds-n197, ds-n198.
[0437] 17. The RNA inhibitor according to embodiment 15, comprising a double strand selected from the following: ds-n17, ds-n23, ds-n31, ds-n39, ds-n45, ds-n58, ds-n60, ds-n64, ds-n67, ds-n68, ds-n73, ds-n74, ds-n76, ds-n77, ds-n80, ds-n81, ds- n83, ds-n84, ds-n86, ds-n88, ds-n89, ds-n98, ds-n99, ds-n103, ds-n104, ds-n112, ds-n1 13. ds-n115, ds-n153, ds-n154, ds-n156, ds-n157, ds-n163, ds-n164, ds-n165, ds-n188.
[0438] 18. The RNA inhibitor according to embodiment 16, comprising a double strand selected from the following: ds-n23, ds-n58, ds-n67, ds-n86, ds-n89, ds-n98, ds-n99, ds-n103, ds-n190, ds-n198, ds-n113.
[0439] 19. The RNA inhibitor according to any one of embodiments 1-18, characterized in that the antisense strand further includes region B1 at the 3' end, and the sense strand further includes region A1 at the 5' end, wherein region A1 is 0-6 nucleotides and region B1 is 0-6 nucleotides.
[0440] 20. The RNA inhibitor according to embodiment 19, characterized in that region B1 is 0, 1, 2, 3, 4, 5 or 6 nucleotides; preferably, region B1 is 0 or 2 nucleotides.
[0441] 21. The RNA inhibitor according to any one of embodiments 16-20, characterized in that the region A1 is 0, 1, 2, 3, 4, 5 or 6 nucleotides; preferably the region A1 is 0 or 2 nucleotides.
[0442] 22. The RNA inhibitor according to embodiment 21, characterized in that the antisense strand further includes region X2 at the 5' end, and the sense strand or sense nucleic acid further includes region X1 at the 3' end, with region X1 and region X2 being complementary.
[0443] 23. The RNA inhibitor according to embodiment 22, wherein X1 is A, U, modified A or modified U, and X2 is U, A, modified U or modified A.
[0444] 24. The RNA inhibitor according to any one of embodiments 19-23, characterized in that the antisense strand contains X2, Y, Z and N sequentially in the 3' to 5' direction at its 5' end, wherein X2 and Y are respectively independently A, U, modified A or modified U, Z is G or modified G, and N contains at least one nucleotide.
[0445] 25. The RNA inhibitor according to any one of embodiments 19-24, wherein X2, Y, and Z are AAG, AUG, UUG, or UAG in the 3' to 5' directions, or the above sequences are partially or completely modified.
[0446] 26. The RNA inhibitor according to any one of embodiments 21-25, wherein X2, Y, and Z are AAG, AUG, UUG, or UAG in the 3' to 5' directions, or the above sequences are partially or completely modified.
[0447] 27. The RNA inhibitor according to any one of embodiments 21-26, wherein N is C or modified C.
[0448] 28. The RNA inhibitor according to any one of embodiments 21-27, wherein X2, Y, Z and N are AAGC and UAGC in the 3' to 5' directions, or the above sequences are partially or completely modified.
[0449] 29. An RNA inhibitor according to any one of embodiments 16-28, wherein the antisense strand comprises at least 15 consecutive nucleotides in the sequence as described in any one of SEQ ID NO:401-413.
[0450] 30. The RNA inhibitor according to any one of embodiments 1-29, wherein the RNA inhibitor is selected from ds-n190-1, ds-n191-1, ds-n192-1, ds-n193-1, ds-n194-1, ds-n195-1, ds-n196-1, ds-n197-1, ds-n198-1, ds-n201-1, ds-n202-1, ds-n203-1, and ds-n204-1.
[0451] 31. The RNA inhibitor according to any one of embodiments 1-30, wherein at least one nucleotide in the RNA inhibitor is a modified nucleotide.
[0452] 32. The RNA inhibitor according to any one of embodiments 1-31, wherein at least 70%, 80%, 90%, or 95% of the nucleotides in the RNA inhibitor are modified nucleotides; preferably, all nucleotides are modified nucleotides.
[0453] 33. The RNA inhibitor according to any one of embodiments 31-32, wherein the modification comprises one or more combinations of the following: 2'-OMe (2'-O-methyl) modification, 2'-F (2'-deoxy-2'-fluorine) modification, 2'-O-MOE (2'-O-methoxyethyl) modification, 2'-deoxy (2'-d) modification, 5'-morpholine (5'-Mo) modification, unlocking nucleic acid (UNA) modification, ethylene glycol nucleic acid (GNA) modification, locked nucleic acid (LNA) modification, tricyclic DNA (tcDNA) modification, (S)-restricted ethyl bicyclic nucleic acid ((S)-cEt-BNA) modification, phosphate thioester (PS) modification, phosphate dithioester (PS2) modification, methylphosphonate (MP) modification, methoxypropyl methylphosphonate (MOP) modification, peptide nucleic acid (PNA) modification, 5'-(E)-vinyl phosphate (VP) modification. Modifications include VP, N6-methyladenosine (m6A), 5-methylcytidine (m5C), 3-methyluridine (m3U), 5-methylureaside (m5U), pseudoureaside, 2-thioureaside (s2U), propynouraidine (5-pU), linking the 5' or 3' end of the nucleotide to an inverted abasic nucleotide (invAB), replacing the nucleotide with an inverted abasic nucleotide (invAb), replacing the nucleotide with 2,4-difluorotolyl ribonucleotide (rF), or replacing the nucleotide with (S)-glycerol nucleic acid. Preferred modifications include 2'-OMe, 2'-F, 2'-deoxy, VP, 5'-MP, PS, PS2, MP, MOP, M06, invAb, or invAB.
[0454] 34. The RNA inhibitor according to any one of embodiments 31-33, wherein the 3' or 5' end of the antisense strand comprises a phosphate or a phosphate mimic, or the 3' or 5' end of the sense strand comprises a phosphate or a phosphate mimic.
[0455] 35. The RNA inhibitor according to embodiment 34, wherein the phosphate mimic includes 5'-(E)-vinylphosphonate, 5'-methylphosphonate, (S)-5'-C-methyl analog and 5'-thiophosphate (5'-PS).
[0456] 36. The RNA inhibitor according to any one of embodiments 31-35, wherein the 5'-end of the antisense strand includes a (M06) modification:
[0457] 37. The RNA inhibitor according to any one of embodiments 31-36, wherein the 3' or 5' end of the antisense strand is modified with invAB, or the 3' or 5' end of the sense strand is modified with invAB.
[0458] 38. The RNA inhibitor according to any one of embodiments 31-37, wherein the inverted abasic nucleotide or MO6 is linked to the 3' or 5' end of the antisense strand or the 3' or 5' end of the sense strand via a thiophosphate ester.
[0459] 39. The RNA inhibitor according to any one of embodiments 31-38, having the following combination of modifications.
[0460] a) The positive strand contains a first sequence of 16-21 nt in length, the first sequence including the following modifications: starting from the 5' end, the nucleotides at positions 9, 10, and 11 have 2'-F modifications;
[0461] b) The antisense strand contains a second sequence of 16-21 nt in length, the second sequence comprising the following modifications: starting from the 5' end, there is a phosphate thioester link between the 1st and 2nd nucleotides, a phosphate thioester link between the 2nd and 3rd nucleotides, and a phosphate thioester link between the 3rd and 4th nucleotides; and starting from the 3' end, there is a phosphate thioester link between the 1st and 2nd nucleotides; and starting from the 5' end, there is a 2'-F modification at the 2nd, 3rd, 4th, 12th, 14th, and 16th nucleotides.
[0462] 40. The RNA inhibitor according to embodiment 39, wherein the length of the first sequence is preferably 16nt, 17nt, 18nt, 19nt, 20nt, or 21nt, and more preferably 21nt.
[0463] 41. The RNA inhibitor according to embodiment 39, wherein the length of the second sequence is preferably 16nt, 17nt, 18nt, 19nt, 20nt, or 21nt, and more preferably 21nt.
[0464] 42. The RNA inhibitor according to any one of embodiments 39-41, having the following combination of modifications.
[0465] a) The positive strand is 21 nt in length and includes the following modifications: starting from the 5' end, the nucleotides at positions 9, 10, and 11 have 2'-F modifications;
[0466] b) The antisense strand is 21 nt in length and includes the following modifications: starting from the 5' end, there is a phosphate thioester link between the 1st and 2nd nucleotides, a phosphate thioester link between the 2nd and 3rd nucleotides, and a phosphate thioester link between the 3rd and 4th nucleotides; starting from the 3' end, there is a phosphate thioester link between the 1st and 2nd nucleotides; and starting from the 5' end, the nucleotides at positions 2, 3, 4, 12, 14, and 16 have a 2'-F modification.
[0467] 43. The RNA inhibitor according to any one of embodiments 28-42, wherein the antisense strand comprises at least 15 consecutive nucleotides in the sequence as described in any one of SEQ ID NO:624-812, 829, 830.
[0468] 44. An RNA inhibitor according to any one of embodiments 28-42, wherein the positive strand comprises at least 15 consecutive nucleotides of the sequence as described in any one of SEQ ID NO:414-602.
[0469] 45. The RNA inhibitor according to any one of embodiments 28-44, wherein the RNA is selected from: ds-m1, ds-m2, ds-m3, ds-m4, ds-m5, ds-m6, ds-m7, ds-m8, ds-m9, ds-m10, ds-m11, ds-m12, ds-m13, ds-m14, ds-m15, ds-m16, ds-m17, ds-m18, ds-m19, ds-m20, ds-m21, ds-m22, ds-m23, ds-m24, ds-m25, ds-m26, ds-m27, ds-m28, ds-m29, ds-m30, ds-m31, ds-m32, ds -m33, ds-m34, ds-m35, ds-m36, ds-m37, ds-m38, ds-m39, ds-m40, ds-m41, d s-m42, ds-m43, ds-m44, ds-m45, ds-m46, ds-m47, ds-m48, ds-m49, ds-m50, ds-m51, ds-m52, ds-m53, ds-m54, ds-m55, ds-m56, ds-m57, ds-m58, ds-m59 , ds-m60, ds-m61, ds-m62, ds-m63, ds-m64, ds-m65, ds-m66, ds-m67, ds-m68 , ds-m69, ds-m70, ds-m71, ds-m72, ds-m73, ds-m74, ds-m75, ds-m76, ds-m7 7. ds-m78, ds-m79, ds-m80, ds-m81, ds-m82, ds-m83, ds-m84, ds-m85, ds-m 86. ds-m87, ds-m88, ds-m89, ds-m90, ds-m91, ds-m92, ds-m93, ds-m94, ds- m95, ds-m96, ds-m97, ds-m98, ds-m99, ds-m100, ds-m101, ds-m102, ds-m103 , ds-m104, ds-m105, ds-m106, ds-m107, ds-m108, ds-m109, ds-m110, ds-m1 11. ds-m112, ds-m113, ds-m114, ds-m115, ds-m116, ds-m117, ds-m118, ds- m119, ds-m120, ds-m121, ds-m122, ds-m123, ds-m124, ds-m125, ds-m126, d s-m127, ds-m128, ds-m129, ds-m130, ds-m131, ds-m132, ds-m133, ds-m134,ds-m135, ds-m136, ds-m137, ds-m138, ds-m139, ds-m140, ds-m141, ds-m142, ds-m143, ds-m144, ds-m145, ds-m146, ds-m147, ds-m14 8. ds-m149, ds-m150, ds-m151, ds-m152, ds-m153, ds-m154, ds-m155, ds-m156, ds-m157, ds-m158, ds-m159, ds-m160, ds-m161, ds-m 162, ds-m163, ds-m164, ds-m165, ds-m166, ds-m167, ds-m168, ds-m169, ds-m170, ds-m171, ds-m172, ds-m173, ds-m174, ds-m175, ds -m176, ds-m177, ds-m178, ds-m179, ds-m180, ds-m181, ds-m182, ds-m183, ds-m184, ds-m185, ds-m186, ds-m187, ds-m188, ds-m189. ,
[0470] 46. The RNA inhibitor according to any one of embodiments 28-39, wherein...
[0471] a) The positive strand contains a third sequence of 18-21 nt in length, the third sequence comprising the following modifications: counting from the 5' end, there is a phosphate thioester link between the 1st and 2nd nucleotides of the positive strand, a phosphate thioester link between the 2nd and 3rd nucleotides, a phosphate thioester link between the 3rd and 4th nucleotides of the positive strand, a phosphate thioester link between the 4th and 5th nucleotides, 2'-F modification at the 9th, 10th, 11th, and 18th nucleotides of the positive strand, and 2'-OMe modification for the remainder; counting from the 3' end, there is a phosphate thioester link between the 1st and 2nd nucleotides, and a phosphate thioester link between the 2nd and 3rd nucleotides;
[0472] b) The antisense strand contains a fourth sequence of 19-26 nt in length, the fourth sequence comprising the following modifications: starting from the 5' end, the nucleotides at positions 1, 2, 5, 17, and 19 of the antisense strand are 2'-F modified, the rest are 2'-OMe modified, and there is a thiophosphate link between the 4th and 5th nucleotides; starting from the 3' end, there is a thiophosphate link between the 1st and 2nd nucleotides, and there is a thiophosphate link between the 2nd and 3rd nucleotides.
[0473] 47. The RNA inhibitor according to embodiment 46, wherein the length of the third sequence is preferably 18nt, 19nt, 20nt, 21nt, 22nt, or 21nt, and more preferably 21nt.
[0474] 48. The RNA inhibitor according to embodiment 47, wherein the length of the fourth sequence is preferably 19nt, 20nt, 21nt, 22nt, 23nt, 24nt, 25nt, or 26nt, and more preferably 26nt.
[0475] 49. The RNA inhibitor according to any one of embodiments 46-48, wherein
[0476] a) The length of the positive strand is 21 nt. Starting from the 5' end, there is a phosphate thioester link between the 1st and 2nd nucleotides, a phosphate thioester link between the 2nd and 3rd nucleotides, a phosphate thioester link between the 3rd and 4th nucleotides, and a phosphate thioester link between the 4th and 5th nucleotides. The nucleotides at positions 9, 10, 11, and 18 of the positive strand have 2'-F modification, and the rest have 2'-OMe modification. Starting from the 3' end, there is a phosphate thioester link between the 1st and 2nd nucleotides, and a phosphate thioester link between the 2nd and 3rd nucleotides.
[0477] b) The antisense strand is 26 nt in length. Starting from the 5' end, the nucleotides at positions 1, 2, 5, 17, and 19 of the antisense strand have 2'-F modifications, and the rest have 2'-OMe modifications. There is a thiophosphate link between the 4th and 5th nucleotides. Starting from the 3' end, there is a thiophosphate link between the 1st and 2nd nucleotides, and a thiophosphate link between the 2nd and 3rd nucleotides.
[0478] 50. An RNA inhibitor according to any one of embodiments 31-49, wherein the antisense strand comprises at least 15 consecutive nucleotides of the sequence as described in any one of SEQ ID NO:813-827, 830.
[0479] 51. An RNA inhibitor according to any one of embodiments 31-50, wherein the positive strand comprises at least 15 consecutive nucleotides in the sequence as described in any one of SEQ ID NO:603-617.
[0480] 52. The RNA inhibitor according to any one of embodiments 31-51, comprising a double strand selected from the following: ds-m190, ds-m191, ds-m192, ds-m193, ds-m194, ds-m195, ds-m196, ds-m197, ds-m198, ds-m199, ds-m200, ds-m201, ds-m202, ds-m202-1, ds-m203, and ds-m204.
[0481] 53. The RNA inhibitor according to any one of embodiments 1-52 further comprises a delivery system, wherein the delivery system is conjugated to the sense strand and / or the antisense strand, and the delivery system enables the RNA inhibitor to reach the target RNA of the target tissue to produce a gene silencing effect.
[0482] 54. The RNA inhibitor according to embodiment 53, wherein the target tissue is eye tissue, joint tissue, central nervous system tissue, peripheral nervous system tissue, tumor, liver tissue, kidney tissue, muscle tissue, or adipose tissue.
[0483] 55. The RNA inhibitor according to embodiment 54, wherein the ocular tissue is the optic nerve, trabecular meshwork, juxtacanthal tissue, ganglion, external scleral vein, Schrem's canal, or peripheral ocular tissue; preferably, the joint tissue includes cartilage tissue, joint connective tissue, and bone tissue; preferably, the central nervous system tissue includes spinal cord tissue and brain tissue; preferably, the peripheral nervous system tissue includes intra-articular nerve tissue and muscular nerve tissue; preferably, the adipose tissue includes subcutaneous adipose tissue and visceral adipose tissue.
[0484] 56. The RNA inhibitor according to embodiment 55, wherein the ocular tissue is a retinal ganglion, endothelial cells, peripheral ocular muscle, or peripheral ocular fat.
[0485] 57. The RNA inhibitor according to any one of embodiments 53-56, wherein the delivery system is independently conjugated to one or more internal sites of the double-stranded ribonucleic acid.
[0486] 58. The RNA inhibitor according to embodiment 57, wherein the internal position is on a nucleobase, sugar ring, methylphosphonate bond, thiophosphate diester bond or phosphodiester bond.
[0487] 59. The RNA inhibitor according to any one of embodiments 53-58, wherein the delivery system is a lipophilic structure, the lipophilic structure comprising a lipophilic group and a linker, the lipophilic group being linked to the double-stranded ribonucleic acid via the linker.
[0488] 60. The RNA inhibitor according to embodiment 59, wherein the lipophilic structure is selected from aliphatic, alicyclic, and polycyclic compounds.
[0489] 61. The RNA inhibitor according to embodiment 60, wherein the lipophilic structure contains saturated or unsaturated C16 or C22.
[0490] 62. The RNA inhibitor according to any one of embodiments 59-61, wherein the linker is selected from single bonds, ethers, thioethers, urea, carbonates, amines, amides, maleimide-thioethers, disulfides, phosphate diesters, sulfonamide bonds, click reaction products, and carbamates.
[0491] 63. The RNA inhibitor according to embodiments 53-62, wherein the delivery system is
[0492] 64. The RNA inhibitor according to any one of embodiments 53-63, wherein the delivery system is conjugated to the 5' end and / or 3' end of the antisense strand or antisense nucleic acid fragment.
[0493] 65. The RNA inhibitor according to any one of embodiments 53-64, wherein the delivery system is conjugated to the 5' end and / or 3' end of the positive strand or positive nucleic acid fragment.
[0494] 66. An RNA inhibitor according to any one of embodiments 53-65, wherein the delivery system is conjugated to the 5' end of the antisense strand or antisense nucleic acid fragment, and the delivery system is conjugated to the 3' end of the sense strand or sense nucleic acid fragment, wherein the two delivery systems are the same or different.
[0495] 67. An RNA inhibitor according to any one of embodiments 53-66, wherein the delivery system is conjugated to the 3' end of the antisense strand or antisense nucleic acid fragment, and the delivery system is conjugated to the 5' end of the sense strand or sense nucleic acid fragment, wherein the two delivery systems are the same or different.
[0496] 68. An RNA inhibitor according to any one of embodiments 53-67, wherein the delivery system is conjugated to the 5' end of the antisense strand or the antisense nucleic acid fragment, and the delivery system is conjugated to the 5' end of the sense strand or the sense nucleic acid fragment, wherein the two delivery systems are the same or different.
[0497] 69. An RNA inhibitor according to any one of embodiments 53-68, wherein the delivery system is conjugated to the 3' end of the antisense strand or the antisense nucleic acid fragment, and the delivery system is conjugated to the 3' end of the sense strand or the sense nucleic acid fragment, wherein the two delivery systems are the same or different.
[0498] 70. The RNA inhibitor according to any one of embodiments 53-69, wherein the number of delivery systems is 1, 2, 3, 4, 5 or 6.
[0499] 71. An RNA inhibitor according to any one of embodiments 53-70, wherein the antisense strand comprises at least 15 consecutive nucleotides of the sequence as described in any one of SEQ ID NO:822-827, 830.
[0500] 72. An RNA inhibitor according to any one of embodiments 53-71, wherein the positive strand comprises at least 15 consecutive nucleotides of the sequence as described in any one of SEQ ID NO:618-623.
[0501] 73. The RNA inhibitor according to any one of embodiments 53-72, comprising Z1, Z2, Z3, Z4, Z5, Z6 or Z7.
[0502] 74. A pharmaceutical composition comprising the RNA inhibitor described in any one of embodiments 1-73, and / or a physiologically acceptable excipient and / or carrier and / or diluent.
[0503] 75. The composition according to embodiment 74, wherein the pharmaceutically acceptable carrier comprises or is selected from aqueous carriers, liposomes, polymers or peptides.
[0504] 76. Use of an RNA inhibitor targeting IGF-1R and a pharmaceutical composition thereof in the preparation of a medicament for treating IGF-1R-related diseases or pathologies; preferably, the RNA inhibitor is siRNA; more preferably, the siRNA is administered to a local or lesion area tissue of a subject in need.
[0505] 77. The use according to embodiment 76, wherein the IGF-1R-related disease or pathology includes diseases or symptoms associated with elevated IGF-1R levels.
[0506] 78. The use according to any one of embodiments 76-77, wherein the IGF-1R-related diseases or pathologies include thyroid ophthalmopathy, osteoarthritis, and neuropathic pain.
[0507] 79. The use according to any one of embodiments 76-78, wherein the RNA inhibitor and the pharmaceutical composition thereof are the RNA inhibitors of any one of embodiments 1-73 or the pharmaceutical compositions of any one of embodiments 74-75.
[0508] 80. Use in the preparation of a medicament according to any one of embodiments 1-73 or any one of embodiments 74-75, wherein the medicament is used to prevent or treat a disease or pathology or to reduce the risk of a disease or symptom.
[0509] 81. The use according to embodiment 80, wherein the disease or pathology includes diseases or symptoms associated with elevated IGF-1R levels.
[0510] 82. The use according to any one of embodiments 80-81, wherein the disease or pathology includes thyroid eye disease, osteoarthritis, and neuropathic pain.
[0511] 83. A method for preventing or treating IGF-1R-related diseases or symptoms, comprising administering an effective amount of an RNA inhibitor and a pharmaceutical composition thereof to a subject in need of such treatment.
[0512] 84. The method according to embodiment 83, wherein the RNA inhibitor and the pharmaceutical composition thereof are the RNA inhibitors of any one of embodiments 1-73 or the pharmaceutical compositions of any one of embodiments 74-75.
[0513] 85. The method according to embodiments 83-84, wherein the RNA inhibitor, its pharmaceutically acceptable salt, or the pharmaceutical composition is administered to the subject via an intraorbital injection, intra-articular injection, intrathecal injection, subcutaneous injection, intravenous injection, oral administration, rectal administration, or intraperitoneal administration route.
[0514] 86. The method according to any one of embodiments 83-85 includes application to a local or lesion area tissue of a subject in need.
[0515] 87. The method according to embodiment 86, wherein the required local or lesion area tissue of the subject includes ocular tissue, joint tissue, central nervous system tissue, peripheral nervous system tissue, tumor, liver tissue, kidney tissue, muscle tissue, or adipose tissue.
[0516] 88. The method according to embodiment 87, wherein the ocular tissue is the optic nerve, trabecular meshwork, proximal canal tissue, ganglion, external scleral vein, Schrem's canal, or peripheral ocular tissue; preferably, the joint tissue includes cartilage tissue, joint connective tissue, and bone tissue; preferably, the central nervous system tissue includes spinal cord tissue and brain tissue; preferably, the peripheral nervous system tissue includes intra-articular nerve tissue and muscular nerve tissue; preferably, the adipose tissue includes subcutaneous adipose tissue and visceral adipose tissue.
[0517] 89. The method according to embodiment 88, wherein the ocular tissue is a retinal ganglion, endothelial cells, peripheral ocular muscles, or peripheral ocular fat.
[0518] 90. The method according to any one of embodiments 83-89, wherein the IGF-1R-related disease or pathology includes diseases or symptoms associated with elevated IGF-1R levels.
[0519] 91. The method according to any one of embodiments 83-90, wherein the IGF-1R-related disease or pathology includes thyroid ophthalmopathy, osteoarthritis, and neuropathic pain.
[0520] 92. A method for inhibiting IGF-1R gene expression in cells, tissues or subjects, comprising administering to the cells, tissues or subjects an effective amount of the RNA inhibitor of any one of embodiments 1-73 or the pharmaceutical composition of any one of embodiments 74-75.
[0521] 93. The method according to embodiment 92, wherein the disease or pathology includes diseases or symptoms associated with elevated IGF-1R levels.
[0522] 94. The method according to embodiment 93, wherein the disease or pathology includes thyroid ophthalmopathy, osteoarthritis, and neuropathic pain.
[0523] 95. A method for preventing or treating a disease or symptom, the method comprising administering to a subject in need an effective amount of an RNA inhibitor according to any one of embodiments 1-73 or a pharmaceutical composition according to any one of embodiments 74-75.
[0524] 96. The method according to embodiment 95, wherein the RNA inhibitor, its pharmaceutically acceptable salt, or the pharmaceutical composition is administered to the subject via an intraorbital injection, intra-articular injection, intrathecal injection, subcutaneous injection, intravenous injection, oral administration, rectal administration, or intraperitoneal administration route.
[0525] 97. The method according to any one of embodiments 95-96 includes application to a local or lesion area tissue of a subject in need.
[0526] 98. The method according to embodiment 97, wherein the required local or lesion area tissue of the subject includes ocular tissue, joint tissue, central nervous system tissue, peripheral nervous system tissue, tumor, liver tissue, kidney tissue, muscle tissue, or adipose tissue.
[0527] 99. The method according to embodiment 98, wherein the ocular tissue is the optic nerve, trabecular meshwork, juxtacanthal tissue, ganglion, external scleral vein, Schrem's canal, or peripheral ocular tissue; preferably, the joint tissue includes cartilage tissue, joint connective tissue, and bone tissue; preferably, the central nervous system tissue includes spinal cord tissue and brain tissue; preferably, the peripheral nervous system tissue includes intra-articular nerve tissue and muscular nerve tissue; preferably, the adipose tissue includes subcutaneous adipose tissue and visceral adipose tissue.
[0528] 100. The method according to embodiment 99, wherein the ocular tissue is a retinal ganglion, endothelial cells, peripheral ocular muscles, or peripheral ocular fat.
[0529] Example
[0530] Example 1: Design and Synthesis of siRNA Molecules
[0531] We obtained the human transcript of the IGF-1R gene (source: NCBI website, transcript number: NM_000875.5) and designed the original siRNA sequence targeting the IGF-1R gene based on the full-length region of human IGF-1R mRNA (including 5'-UTR, CDS, and 3'-UTR).
[0532] Oligonucleotides were synthesized using a phosphoramide solid-phase synthesis technique. Synthesis was performed on a general-purpose controlled porous glass CPG. All 2'-modified RNA phosphoramides and auxiliary reagents were commercially available. All phosphoramides were dissolved in anhydrous acetonitrile and added to a molecular sieve, with a coupling time of 1.0 min using 5-ethylthio-1H-tetrazole as an activator. Thiophosphate bonds were generated using a 50 mM solution of 3-((dimethylamino-methylene)amino)-3H-1,2,4-dithiazol-3-thione in anhydrous acetonitrile / pyridine (v / v = 1 / 1) for 1.8 min. All sequences were synthesized after the final removal of the DMT group.
[0533] Cleavage and deprotection of oligomers bound to CPG: After termination of solid-phase synthesis, the protecting group was removed by treatment with an acetonitrile solution containing 20% diethylamine for 30 minutes without cleaving the oligonucleotide from the CPG. Subsequently, the dried CPG was treated with concentrated ammonia at 40°C for 18 hours. After centrifugation, the supernatant was transferred to a new tube and the CPG was washed with ammonia. The combined solutions were concentrated to obtain a solid mixture.
[0534] Purification of single-stranded oligonucleotides: Oligomers were purified by HPLC using NanoQ anion exchange. Buffer A consisted of 10 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4, and 20% acetonitrile; buffer B consisted of 500 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4, and 20% acetonitrile. The target product was isolated and desalted using a reverse-phase C18 column.
[0535] Annealing of single-stranded oligonucleotides to produce siRNA: The single-stranded oligonucleotides to be annealed were prepared to 200 μM using sterile, RNase-free water. The annealing reaction system was set up as follows: 100 μL of the mixture was placed in a 95°C water bath for 10 minutes (for amounts ≥100 nmol, a high-temperature bath of 20 minutes is required) → immediately placed in a 60°C water bath for natural cooling → the annealed solution should not be stored at high temperatures. Equimolar amounts of the single-stranded oligonucleotide solutions were combined to form complementary strands. The unmodified siRNA sequences are shown in Table 1.
[0536] The siRNA duplex was sequence modified and optimized. In this code, lowercase letters “g”, “c”, “a” and “u” represent nucleotides modified with 2’-methoxy groups; uppercase letters “Gf”, “Cf”, “Af” and “Uf” represent nucleotides modified with 2’-fluoride groups; and * indicates that the two monomers (such as two nucleotides) adjacent to the * are linked by thiophosphate groups.
[0537] invAB refers to a non-base nucleotide that is inverted and linked to the 5' or 3' end of a nucleotide.
[0538] In this invention, (M06) It is M06 monomer The residues. In some embodiments, (M06) is through It is bonded to a nucleotide.
[0539] In some implementations, [D02] Through It is bonded to a nucleotide.
[0540] The modified siRNA sequences are shown in Table 2.
[0541] Example 2: In vitro effect of chemically modified double-stranded siRNA on SY5Y cells
[0542] The in vitro inhibitory effect of the double-stranded siRNA selected in Example 1 on SY5Y cells was further verified.
[0543] 1) SY5Y cell transfection
[0544] SY5Y cells were cultured in DMEM medium containing 10% fetal bovine serum, 1% glutamine, 1% NEAA, and 1% penicillin-streptomycin at 37°C with 5% CO2. Transfection was performed when the cells were in the logarithmic growth phase and in good condition. SY5Y cells were seeded into 96-well cell culture plates, and siRNA was transfected into the cells using RNAiMAX according to the manufacturer's instructions. The final siRNA concentrations used in this experiment were 30 nM and 0.1 nM. A control group containing RNAiMAX but without the compound was also included.
[0545] 2) RNA extraction and reverse transcription
[0546] 24 hours after transfection, remove the culture medium and collect the cells for RNA extraction. Use according to the kit instructions. Total RNA was extracted using a 96-kit (QIAGEN-74182). cDNA was synthesized using the FastKing RT Kit (With gDNase) (Tiangen-KR116-02) according to the manufacturer's instructions.
[0547] 3) qPCR detection of target gene mRNA expression levels
[0548] The target cDNA will be detected using SYBR Green qPCR, with GAPDH cDNA detected simultaneously as an internal control for parallel testing. 8 μL of prepared PCR reaction solution and 2 μL of sample cDNA will be added to each 384 well. The qPCR program is as follows: heat at 50°C for 2 min, heat at 95°C for 10 min, then cycle at 95°C for 15 sec, followed by 1 min at 60°C, for a total of 40 cycles.
[0549] 4) Results Analysis
[0550] The expression level of the target gene mRNA in each sample was calculated using the ΔΔCt relative quantification method. The relative amount of the target gene was expressed as 2-ΔΔCT.
[0551] The calculation formula is as follows:
[0552] ΔCT = Average Ct value of target gene - Average Ct value of internal reference gene
[0553] ΔΔCT = ΔCT (drug-treated group) - ΔCT (RNAiMAX control group)
[0554] Relative expression level of target gene IGF-1R = 2 - ΔΔCT
[0555] IGF-1R inhibition rate % = (1 - value of sample / Ave. value of RNAiMAX Control) * 100
[0556] The results are shown in Table 3.
[0557] Table 3. Inhibition results of double-stranded siRNA on SY5Y (percentage inhibition rate)
[0558] The results showed that the above-mentioned double-stranded siRNA could significantly inhibit the level of IGF-1R mRNA in SY5Y cells.
[0559] Example 3: In vitro effect of chemically modified double-stranded siRNA on HeLa cells
[0560] The double-stranded siRNA selected in Example 1 was further verified to have an in vitro inhibitory effect on HeLa cells.
[0561] 1) HeLa cell transfection
[0562] HeLa cells were cultured in DMEM medium containing 10% fetal bovine serum and 1% penicillin-streptomycin at 37°C with 5% CO2. Transfection was performed when the cells were in the logarithmic growth phase and in good condition. HeLa cells were seeded into 96-well cell culture plates and transfected with double-stranded siRNA using lipofectamine RNAiMAX and Opti-MEM according to the manufacturer's instructions. The final siRNA concentrations used in this assay were 30 nM, 5 nM, and 0.5 nM.
[0563] 2) RNA extraction, reverse transcription and qPCR
[0564] Total RNA was extracted using the EZ 96 Total RNA Kit (Omega, R1034-02) according to the kit instructions. cDNA was synthesized using the FastKing RT Kit (With gDNase) (Tiangen-KR116-02) according to the kit instructions.
[0565] 3) qPCR detection of target gene mRNA expression levels
[0566] The experimental procedure is the same as in Example 2.
[0567] 4) Results Analysis
[0568] The experimental results analysis process is the same as in Example 2.
[0569] The results are shown in Table 4.
[0570] Table 4. Inhibition results of double-stranded siRNA on HeLa (percentage inhibition rate)
[0571] The results showed that the above-mentioned double-stranded siRNA could significantly inhibit the level of IGF-1R mRNA in HeLa cells.
[0572] Example 4: In vitro effect of chemically modified double-stranded siRNA on ARPE cells
[0573] The in vitro inhibitory effect of the double-stranded siRNA selected in Example 1 on ARPE cells was further verified.
[0574] 1) ARPE cell transfection
[0575] ARPE-19 cells were cultured in DMEM medium containing 10% fetal bovine serum at 37°C with 5% CO2. Transfection was performed when the cells were in the logarithmic growth phase and in good condition. ARPE-19 cells were seeded into 96-well cell culture plates and transfected with double-stranded siRNA into HeLa cells using lipofectamine RNAiMAX and Opti-MEM according to the manufacturer's instructions. The final siRNA concentrations used in this assay were 30 nM, 0.5 nM, and 0.05 nM.
[0576] 2) RNA extraction, reverse transcription and qPCR
[0577] The experimental procedure is the same as in Example 2.
[0578] 3) qPCR detection of target gene mRNA expression levels
[0579] The experimental procedure is the same as in Example 2.
[0580] 4) Results Analysis
[0581] The experimental results analysis process is the same as in Example 2.
[0582] The results are shown in Table 5.
[0583] Table 5. Inhibition results of double-stranded siRNA on ARPE (percentage inhibition rate)
[0584] The results showed that the above-mentioned double-stranded siRNA could significantly inhibit the level of IGF-1R mRNA in ARPE cells.
[0585] Example 5: IC50 of chemically modified double-stranded siRNA on human primary mature adipocytes 50 Detection
[0586] The double-stranded siRNA selected in Example 1 was further verified to have an IC50 effect on mature human adipocytes.
[0587] 5) Transfection of primary mature human adipocytes
[0588] Human primary mature adipocytes were cultured in adipocyte-specific medium at 37°C with 5% CO2 until they were in the logarithmic growth phase and in good condition, at which point transfection was performed. Mature adipocytes were seeded into 24-well cell culture plates, and double-stranded siRNA was transfected into the mature adipocytes using lipofectamine RNAiMAX and Opti-MEM according to the manufacturer's instructions.
[0589] 6) RNA extraction, reverse transcription, and qPCR
[0590] The experimental procedure is the same as in Example 2.
[0591] 7) qPCR detection of target gene mRNA expression levels
[0592] The experimental procedure is the same as in Example 2.
[0593] 8) Results Analysis
[0594] The results are shown in Table 6.
[0595] Table 6. Inhibition results of double-stranded siRNA in human primary mature adipocytes
[0596] The results showed that the above-mentioned double-stranded siRNA could significantly inhibit the level of IGF-1R mRNA in human primary mature adipocytes.
[0597] Example 6: Intraorbital drug delivery study in cynomolgus monkeys
[0598] Group design
[0599] Six female cynomolgus macaques were divided into two groups. Before drug administration, a biopsy was performed on the left eye to collect small amounts of extraocular muscle and peribulbar fat. The collected samples were placed separately in homogenized tubes containing 0.5 mL of RNAlater (2 tubes for extraocular muscle, 1 tube for fat) and stored at 2°C–8°C for approximately 22–26 hours, after which the RNAlater was completely removed. The homogenized tubes containing the tissue were temporarily frozen on dry ice and then placed at <-60°C. On the first day of the experiment, the left eye was administered PBS, and the right eye was administered different doses (2 mg / kg, 10 mg / kg) of the test sample Z4.
[0600] Test Procedure
[0601] 1. Clinical observation
[0602] All animals underwent at least one detailed clinical observation before the experiment, and then another detailed clinical observation at 2, 7, 14, 21 and 28 days after administration.
[0603] 2 weight
[0604] All animals were weighed at least once before the experiment and again on day 28 or the day of the planned necropsy.
[0605] 3. Ophthalmological examination
[0606] All animals underwent at least one ophthalmological examination before the experiment, and another ophthalmological examination at 2, 7, 14, 21 and 28 days after drug administration.
[0607] 4 intraocular pressure
[0608] Intraocular pressure (IOP) was measured in all animals using a TonoVet tonometer before administration, and again on days 2 and 7 after administration.
[0609] 5. Fundus photography (FP)
[0610] Fundus photography (FP) was performed on both eyes of all animals at least once before the experiment and at week 4 to collect images.
[0611] 6. Flash visual evoked potentials (fVEP)
[0612] Perform a single fVEP examination on both eyes of all animals during week 4. Animals will be anesthetized by intramuscular injection of ketamine (10–30 mg / kg) and celazine (0.5–1.0 mg / kg). Mydriasis will be performed on the animals using an appropriate mydriatic agent. Flash VEP will be performed following these steps:
[0613] Select the FVEP protocol and enter the animal information;
[0614] Place the animal prone on the lifting platform and connect the relevant electrodes;
[0615] Check the resistance of each electrode. Once it meets the requirements, click Start to collect electrophysiological signals.
[0616] After assessing the inspection results, save the inspection report.
[0617] 7. Cytokine Analysis
[0618] Blood samples were collected from all available animals for serum cytokine analysis. Samples were collected twice, once before drug administration and once 24 hours after drug administration. Serum cytokine levels of IL-2, IL-4, IL-5, IL-6, IL-10, IL-13, TNF-α, and IFN-γ were analyzed using a validated flow cytometry method.
[0619] Endpoint Anatomy
[0620] All experimental animals were euthanized on day 29, and tissues were collected. During tissue collection, gross observations were performed on the eyeball, extraocular muscles (including the superior rectus, superior oblique, medial rectus, lateral rectus, inferior oblique, and inferior rectus muscles), and peribulbar fat.
[0621] For all experimental animals, ocular muscles (including superior rectus, superior oblique, medial rectus, lateral rectus, inferior oblique, and inferior rectus) and periglottic fat were collected from both eyes.
[0622] IGF1R mRNA qPCR analysis
[0623] IGF1R mRNA expression in cynomolgus monkey tissues was detected using RT-qPCR with a dye-based method. The CT values of the target gene (IGF1R) and the internal reference gene (CypA) were measured, and the expression changes of the target gene were calculated. Tissue types included periorbital muscle and periorbital fat.
[0624] Table 7 Key Primers and Reagents
[0625] 2 key equipment
[0626] qPCR thermal cycler, PCR thermal cycler, biosafety cabinet, homogenizer, freeze grinder, electronic balance
[0627] CyBio-SELMA liquid handling workstation, UV spectrophotometer, TECAN liquid handling workstation
[0628] 3. RNA extraction
[0629] Add 1000 μL of TRNzol Universal RNA Reagent to each tissue sample, followed by 3 grinding beads (3 mm). The homogenizer program was set to: 65 Hz, 45 s / cycle, 4 cycles, with a 30 s pause between cycles (or 5.65 m / s, 1 min / cycle, 3 cycles, with a 30 s pause between cycles) to obtain tissue lysis buffer. Centrifuge each tissue lysis buffer (centrifugation conditions: room temperature, 12000 × g, 5 min), and transfer all supernatant to a new Eppendorf tube. Incubate at room temperature for 5 min to allow complete dissociation of the nucleoprotein complex. Add 200 μL of chloroform to each tissue lysis buffer, vortex to mix, briefly centrifuge, and incubate at room temperature for 3 min. Centrifuge again (centrifugation conditions: 4℃, 12000 × g, 5 min). After centrifugation, the tissue lysis buffer separated into three aqueous phases (upper, middle, and lower). Transfer 450 μL of the upper aqueous phase to a new Eppendorf tube for each sample. Add 45 μL of 3M Sodium Acetate Sol (pH 5.2) to each sample, vortex to mix, and incubate at room temperature for 1 min. After incubation, add 500 μL of isopropanol (pre-cooled), vortex to mix, and incubate at -30°C to -10°C for 30 min. After incubation, centrifuge (4°C, 12000×g, 15 min). RNA precipitate will be visible at the bottom of the tube after centrifugation; discard the supernatant. After discarding the supernatant, add 1000 μL of 75% ethanol solution (pre-cooled), vortex to mix, and centrifuge (4°C, 12000×g, 10 min). After centrifugation, discard the supernatant, air dry at room temperature for 10 min, then add 40 μL of DEPC-treated water (pre-warmed at 55°C), vortex to mix, and obtain RNA. Use a UV spectrophotometer to detect and record the purity and concentration of A260 / A280. RNA can be used directly for RT-qPCR or stored at <-60℃. The RNA has a shelf life of 1 year.
[0630] 4. qPCR analysis
[0631] RNA was processed using a genomic DNA removal program to obtain an "RNA template (after DNA removal)," which was then processed using a PCR thermal cycler to obtain cDNA products, which were used as "qPCR templates." All cDNA samples were analyzed using qPCR in 384-well plates, with triplet analysis. Relative expression data were acquired using QuantStudio7 Flex PCR, and the acquired data included: mean Ct, ΔCt, and ΔΔCt. The KD% of all IGF1R mRNA samples was calculated after normalization with the biopsy samples.
[0632] Experimental results:
[0633] 1. Clinical observation, body weight, intraocular pressure, fundus photography, flash visual evoked potential (fVEP), and cytokine analysis showed no abnormalities;
[0634] 2. KD% Experimental Results: As shown in Figure 1.
[0635] Experimental conclusion: Orbital administration of the double-stranded compound Z4 has good safety and significantly inhibits the expression of IGF1R mRNA in target tissues.
[0636] Example 7: Acute Exophthalmos Model in Mice
[0637] Objective: To evaluate the efficacy of mouse IGF1R siRNA administered via the orbital cavity in a BALB / c mouse model of thyroid ophthalmopathy.
[0638] 1. Group dosing regimen
[0639] On Day 5, after anesthetizing animals with Saltazone (25-50 mg / kg, ip) and xylazine hydrochloride (5 mg / kg, ip), mouse IGF1R siRNA was injected once into each eye socket, 100 μL / eye.
[0640] 2. Modeling
[0641] On Day 0 and Day 6, animals were anesthetized with Saltamol (25-50 mg / kg, ip) and Xylazine hydrochloride (5 mg / kg, ip), and mouse IGF-1 protein was injected around both eyes to establish the model, 5 μg / eye. After injection, the animals' eyes were treated with levofloxacin eye drops and ofloxacin eye ointment, once in the morning and once in the afternoon, for three consecutive days.
[0642] 3. Detection Indicators
[0643] 3.1 Clinical observation
[0644] Observe the animal's condition, mental state, behavior, and eating once a day near its cage.
[0645] 3.2 Graves' Ophthalmopathy (GO) score
[0646] GO scores were calculated on Day 0 (before modeling), Day 3, Day 6 (before modeling), and Day 9 to continuously monitor bulging eye symptoms.
[0647] 3.3 Eye examination
[0648] On Day 5 (before and after drug administration), Day 0, Day 3, Day 7, and Day 14, perform ocular surface and fundus examinations using a slit lamp. Record any abnormalities by photograph.
[0649] 3.4 Collection of materials
[0650] On Day 9, four animals from each group were euthanized, and the periorbital tissue, retina, scleral complex, liver, skeletal muscle, and ovarian fat were isolated and immediately preserved in RNAprotect tissue reagent.
[0651] 3.5 qPCR detection
[0652] RNA was extracted from periorbital tissue and analyzed by reverse transcription and qPCR.
[0653] 3.6 Pathology
[0654] On Day 9, four mouse eyeballs (with surrounding tissue) were taken from each group, fixed, and paraffin-embedded to quantify periorbital tissue proliferation and cell infiltration (H&E staining, UCPI and CD3 staining).
[0655] Intraorbital administration of mouse IGF1R siRNA significantly inhibited the expression of IGF1R mRNA and relieved exophthalmos symptoms, suggesting that intraorbital administration of the compounds involved in this application in humans can effectively treat thyroid eye disease.
[0656] Experimental Example 8: A surgically induced osteoarthritis model in rats
[0657] Ten weeks after birth, 24 rats underwent transection of the anterior cruciate ligament (ACL), medial collateral ligament (MCL), and medial meniscus condyle ligament (CMC) (ACL rupture and partial medial meniscectomy model; ACLT+pMMx). One week post-surgery, all rats were randomly assigned to receive intra-articular injection of mouse IGF1R siRNA or a control solution (n=12 per group). Thirteen weeks post-surgery, the knee joint was dissected, fixed in 10% formalin, decalcified, and embedded in a paraffin block. Anterior sections (5 μm thick, 100 μm spaced between sections to ensure reproducibility) were taken from different levels and stained with safranin and fast green. At least 12 sections were taken from each rat and imaged using an optical microscope.
[0658] Osteoarthritis Research Society International (OARSI) score, cartilage protection and regeneration
[0659] Histological evaluation was performed by two blinded observers. Images were scored according to the OARSI cartilage histology scoring system, assessing the degree (depth of cartilage damage) and stage (degree of joint involvement) of cartilage lesions. Briefly, the femur and tibia were evaluated separately, with each site scored according to the grade of cartilage lesion (0–6, 0 for intact surface, 6 for severe deformity) and the stage of cartilage lesion (0–4, 0 for normal joint, 4 for more than 50% joint damage). The total score was the product of grade and stage (0 for normal joint; 24 for severe osteoarthritis). Twelve slides were taken from each rat for scoring, and no rats were excluded. After scoring, the study was unblinded, and the four lowest-scoring slides from each rat (representing the least damaged cartilage) were excluded for further analysis. The mean OARSI score for each rat was the average of the scores from the two blinded observers. In addition, histological evaluations were repeated by four independent blinded observers based on a revised objective quantitative histology OARSI scoring system. Safranin O staining intensity and cartilage thickness were measured using ImageJ.
[0660] Intra-articular administration of mouse IGF1R siRNA significantly inhibited the expression of IGF1R mRNA and reduced OARSI scores, suggesting that intra-articular administration of the compounds involved in this invention in humans can effectively treat osteoarthritis.
[0661] Example 9: Spinal Nerve Ligation (SNL) Model
[0662] Animals were first anesthetized with 5% isoflurane and maintained at a 2% isoflurane concentration. The L5 transverse process was removed to expose the L3 and L4 spinal nerves. The L4 spinal nerve was then dissected and tightly ligated with 6-0 silk sutures. In the sham-operated group, the L4 spinal nerve was exposed but not ligated. Under isoflurane anesthesia, mouse IGF1R siRNA or a control solution was injected via lumbar puncture, and subsequent behavioral tests were performed.
[0663] Behavioral testing
[0664] 50% foot retraction mechanical threshold (PWT):
[0665] Adaptation period: Rats were allowed at least three days to adapt to the test area before measurement. Vertical stimulation of the lateral plantar surface was applied using von Frey fibers of varying intensities (0.6g, 1.0g, 1.4g, 2.0g, 4.0g, 6.0g, 8.0g, 10.0g, and 15.0g). Measurements were taken one day before surgery and on days 4, 7, 10, and 14 post-surgery. A 4.0g fiber was initially selected, and the 50% PWT threshold was calculated using the "up-down method." The paw withdrawal rate in response to increased mechanical stimulation was measured. Three groups of rats were evaluated sequentially, with five measurements performed on each side (5-minute intervals). Finally, the five-times paw withdrawal response rate was calculated, representing the proportion of paw withdrawal produced by a 6.0g mechanical stimulus.
[0666] Cold pain hypersensitivity threshold:
[0667] To assess foot sensitivity to cold, the paw response to acetone was measured in rats. While the rats were at rest, pre-cooled acetone (100 μL) was applied to the sole of their paws. The time for positive responses (leg lifting, shaking, licking, etc.) was recorded for 30 seconds. Each foot was tested three times (5 minutes apart), and the average of the three measurements was recorded as the response time for that side.
[0668] Intrathecal administration of mouse IGF1R siRNA significantly inhibited the expression of IGF1R mRNA, while improving PWT and cold hyperalgesia threshold scores and suppressing pain response, suggesting that intrathecal administration of the compounds involved in this invention in humans can effectively treat neuropathic pain.
[0669] Example 10: Study on the long-term effect of intraorbital administration of PD in cynomolgus monkeys
[0670] Group design
[0671] Female cynomolgus monkeys were grouped according to the drug. Before administration, a biopsy was performed on the left eye, collecting small amounts of ocular muscle and peribulbar fat. The collected samples were placed separately in homogenized tubes containing 0.5 mL of RNAlater (2 tubes for ocular muscle, 1 tube for fat), and stored at 2℃–8℃ for approximately 22–26 hours, after which the RNAlater was completely removed. The homogenized tubes containing the tissue were temporarily frozen on dry ice and then placed at <-60℃. On the first day of the experiment, the left eye was administered PBS, and the right eye was administered different doses (25 mg, 50 mg, 10 mmg) of the test sample Z4. Tissue samples were collected and analyzed at different time points for IGF1R mRNA knockout in each dose group.
[0672] Table 8. Dosage Group Details
[0673] Test Procedure
[0674] 1. Clinical observation
[0675] All animals underwent at least one detailed clinical observation before the experiment, and then another detailed clinical observation at 2, 7, 14, 21 and 28 days after administration.
[0676] 2 weight
[0677] All animals were weighed at least once before the experiment and again on day 28 or the day of the planned necropsy.
[0678] 3. Ophthalmological examination
[0679] All animals underwent at least one ophthalmological examination before the experiment, and another ophthalmological examination at 2, 7, 14, 21 and 28 days after drug administration.
[0680] 4 intraocular pressure
[0681] Intraocular pressure (IOP) was measured in all animals using a TonoVet tonometer before administration, and again on days 2 and 7 after administration.
[0682] 5. Fundus photography (FP)
[0683] Fundus photography (FP) was performed on both eyes of all animals at least once before the experiment and at week 4 to collect images.
[0684] 6. Flash visual evoked potentials (fVEP)
[0685] Perform a single fVEP examination on both eyes of all animals during week 4. Animals will be anesthetized by intramuscular injection of ketamine (10–30 mg / kg) and celazine (0.5–1.0 mg / kg). Mydriasis will be performed on the animals using an appropriate mydriatic agent. Flash VEP will be performed following these steps:
[0686] Select the FVEP protocol and enter the animal information;
[0687] Place the animal prone on the lifting platform and connect the relevant electrodes;
[0688] Check the resistance of each electrode. Once it meets the requirements, click Start to collect electrophysiological signals.
[0689] After assessing the inspection results, save the inspection report.
[0690] 7. Cytokine Analysis
[0691] Blood samples were collected from all available animals for serum cytokine analysis. Samples were collected twice, once before drug administration and once 24 hours after drug administration. Serum cytokine levels of IL-2, IL-4, IL-5, IL-6, IL-10, IL-13, TNF-α, and IFN-γ were analyzed using a validated flow cytometry method.
[0692] Endpoint Anatomy
[0693] All experimental animals were euthanized at the specified time points during the experiment, and tissues were collected. During tissue collection, gross observations were performed on the eyeball, extraocular muscles (including the superior rectus, superior oblique, medial rectus, lateral rectus, inferior oblique, and inferior rectus muscles), and peribulbar fat.
[0694] For all experimental animals, ocular muscles (including superior rectus, superior oblique, medial rectus, lateral rectus, inferior oblique, and inferior rectus) and periglottic fat were collected from both eyes.
[0695] IGF1R mRNA qPCR analysis
[0696] IGF1R mRNA expression in cynomolgus monkey tissues was detected using RT-qPCR with a dye-based method. The CT values of the target gene (IGF1R) and the internal reference gene (CypA) were measured, and the expression changes of the target gene were calculated. Tissue types included periorbital muscle and periorbital fat.
[0697] Table 9 Key Primers and Reagents
[0698] 2 key equipment
[0699] qPCR thermal cycler, PCR thermal cycler, biosafety cabinet, homogenizer, freeze grinder, electronic balance
[0700] CyBio-SELMA liquid handling workstation, UV spectrophotometer, TECAN liquid handling workstation
[0701] 3. RNA extraction
[0702] Add 1000 μL of TRNzol Universal RNA Reagent to each tissue sample, followed by 3 grinding beads (3 mm). The homogenizer program was set to: 65 Hz, 45 s / cycle, 4 cycles, 30 s pause between cycles (or 5.65 m / s, 1 min / cycle, 3 cycles, 30 s pause between cycles) to obtain tissue lysis buffer. Centrifuge each tissue lysis buffer (centrifugation conditions: room temperature, 12000 × g, 5 min), and transfer all supernatant to a new Eppendorf tube. Incubate at room temperature for 5 min to allow complete dissociation of the nucleoprotein complex. Add 200 μL of chloroform to each tissue lysis buffer, vortex to mix, briefly centrifuge, and incubate at room temperature for 3 min. Centrifuge again (centrifugation conditions: 4 °C, 12000 × g, 5 min). After centrifugation, the tissue lysis buffer separated into three aqueous phases (upper, middle, and lower). Transfer 450 μL of the upper aqueous phase to a new Eppendorf tube for each sample. Add 45 μL of 3M Sodium Acetate Sol (pH 5.2) to each sample, vortex to mix, and incubate at room temperature for 1 min. After incubation, add 500 μL of isopropanol (pre-cooled), vortex to mix, and incubate at -30℃ to -10℃ for 30 min. After incubation, centrifuge (4℃, 12000×g, 15 min). RNA precipitate will be visible at the bottom of the tube after centrifugation; discard the supernatant. After discarding the supernatant, add 1000 μL of 75% ethanol solution (pre-cooled), vortex to mix, and centrifuge (4℃, 12000×g, 10 min). After centrifugation, discard the supernatant, air dry at room temperature for 10 min, then add 40 μL of DEPC-treated water (pre-warmed at 55℃), vortex to mix, and obtain RNA. Use a UV spectrophotometer to detect and record the purity and concentration of A260 / A280. RNA can be used directly for RT-qPCR or stored at <-60℃. The RNA has a shelf life of 1 year.
[0703] 4. qPCR analysis
[0704] RNA was processed using a genomic DNA removal program to obtain an "RNA template (after DNA removal)," which was then processed using a PCR thermal cycler to obtain cDNA products, which were used as "qPCR templates." All cDNA samples were analyzed using qPCR in 384-well plates, with triplet analysis. Relative expression data were acquired using QuantStudio7 Flex PCR, and the acquired data included: mean Ct, ΔCt, and ΔΔCt. All IGF1R mRNAKD% values were calculated after normalization with those of biopsy samples.
[0705] The experimental results are shown in Figure 3. Z4 administered via the orbital site significantly inhibited IGF1R in orbital fat and muscle, and maintained a prolonged efficacy (>3 months).
[0706] Experimental Example 11: Study on the Stability of Compounds
[0707] Experimental steps:
[0708] Take an appropriate amount of the compound and place it in a low-density polyethylene vial. Add an appropriate amount of diluent (physiological saline + 0.5 mmol / L sodium dihydrogen phosphate + 0.5 mmol / L disodium hydrogen phosphate) to dissolve it and dilute it to prepare a solution of approximately 1 mg / mL. Tightly cap the vial to obtain the sample solution. Incubate the sample solution at 40°C for 10 days to allow it to degrade before performing high-performance liquid chromatography (HPLC). Prepare another fresh sample solution using the same method as a non-degraded control and perform HPLC analysis simultaneously.
[0709] The chromatographic detection method is as follows: Ultra-high performance liquid chromatography (UHPLC) was used with octadecylsilane-bonded silica gel as the packing material (Waters Acquity UPLC BEH C18 column, 2.1 mm × 150 mm, 1.7 μm or equivalent column). Gradient elution was performed using an aqueous solution of 90–110 mmol / L hexafluoroisopropanol and 15–25 mmol / L triethylamine as mobile phase A and acetonitrile as mobile phase B. The flow rate was 0.3 mL per minute, the column temperature was 80 °C, and the detection wavelength was 260 nm.
[0710] The impurity detection results of the sample damaged at 40℃ were compared with those of the undamaged sample to calculate the impurity growth value. The RNA inhibitor of this invention exhibits good chemical stability.
[0711] Example 12: Study on the long-term effect of intraorbital administration of PD in cynomolgus monkeys
[0712] Group design
[0713] Female cynomolgus monkeys were grouped according to the drug. Before administration, a biopsy was performed on the left eye, collecting small amounts of ocular muscle and peribulbar fat. The collected samples were placed separately in homogenized tubes containing 0.5 mL of RNAlater (2 tubes for ocular muscle, 1 tube for fat), and stored at 2℃–8℃ for approximately 22–26 hours, after which the RNAlater was completely removed. The homogenized tubes containing the tissue were temporarily frozen on dry ice and then placed at <-60℃. On the first day of the experiment, the left eye was administered PBS, and the right eye was administered different doses of the test substance Z7. Tissue samples were collected and analyzed at different time points for IGF1R mRNA knockout in each dose group.
[0714] Table 10
[0715] Test Procedure
[0716] 1. Clinical observation
[0717] All animals underwent at least one detailed clinical observation before the experiment, and then another detailed clinical observation at 2, 7, 14, 21 and 28 days after administration.
[0718] 2 weight
[0719] All animals were weighed at least once before the experiment and again on day 28 or the day of the planned necropsy.
[0720] 3. Ophthalmological examination
[0721] All animals underwent at least one ophthalmological examination before the experiment, and another ophthalmological examination at 2, 7, 14, 21 and 28 days after drug administration.
[0722] 4 intraocular pressure
[0723] Intraocular pressure (IOP) was measured in all animals using a TonoVet tonometer before administration, and again on days 2 and 7 after administration.
[0724] 5. Fundus photography (FP)
[0725] Fundus photography (FP) was performed on both eyes of all animals at least once before the experiment and at week 4 to collect images.
[0726] 6. Flash visual evoked potentials (fVEP)
[0727] Perform a single fVEP examination on both eyes of all animals during week 4. Animals will be anesthetized by intramuscular injection of ketamine (10–30 mg / kg) and celazine (0.5–1.0 mg / kg). Mydriasis will be performed on the animals using an appropriate mydriatic agent. Flash VEP will be performed following these steps:
[0728] Select the FVEP protocol and enter the animal information;
[0729] Place the animal prone on the lifting platform and connect the relevant electrodes;
[0730] Check the resistance of each electrode. Once it meets the requirements, click Start to collect electrophysiological signals.
[0731] After assessing the inspection results, save the inspection report.
[0732] 7. Cytokine Analysis
[0733] Blood samples were collected from all available animals for serum cytokine analysis. Samples were collected twice, once before drug administration and once 24 hours after drug administration. Serum cytokine levels of IL-2, IL-4, IL-5, IL-6, IL-10, IL-13, TNF-α, and IFN-γ were analyzed using a validated flow cytometry method.
[0734] Endpoint Anatomy
[0735] All experimental animals were euthanized at the specified time points during the experiment, and tissues were collected. During tissue collection, gross observations were performed on the eyeball, extraocular muscles (including the superior rectus, superior oblique, medial rectus, lateral rectus, inferior oblique, and inferior rectus muscles), and peribulbar fat.
[0736] For all experimental animals, ocular muscles (including superior rectus, superior oblique, medial rectus, lateral rectus, inferior oblique, and inferior rectus) and periglottic fat were collected from both eyes.
[0737] IGF1R mRNA qPCR analysis
[0738] IGF1R mRNA expression in cynomolgus monkey tissues was detected using RT-qPCR with a dye-based method. The CT values of the target gene (IGF1R) and the internal reference gene (CypA) were measured, and the expression changes of the target gene were calculated. Tissue types included periorbital muscle and periorbital fat.
[0739] Table 11 Key Primers and Reagents
[0740] 2 key equipment
[0741] qPCR thermal cycler, PCR thermal cycler, biosafety cabinet, homogenizer, freeze grinder, electronic balance
[0742] CyBio-SELMA liquid handling workstation, UV spectrophotometer, TECAN liquid handling workstation
[0743] 3. RNA extraction
[0744] Add 1000 μL of TRNzol Universal RNA Reagent to each tissue sample, followed by 3 grinding beads (3 mm). The homogenizer program was set to: 65 Hz, 45 s / cycle, 4 cycles, 30 s pause between cycles (or 5.65 m / s, 1 min / cycle, 3 cycles, 30 s pause between cycles) to obtain tissue lysis buffer. Centrifuge each tissue lysis buffer (centrifugation conditions: room temperature, 12000 × g, 5 min), and transfer all supernatant to a new Eppendorf tube. Incubate at room temperature for 5 min to allow complete dissociation of the nucleoprotein complex. Add 200 μL of chloroform to each tissue lysis buffer, vortex to mix, briefly centrifuge, and incubate at room temperature for 3 min. Centrifuge again (centrifugation conditions: 4 °C, 12000 × g, 5 min). After centrifugation, the tissue lysis buffer separated into three aqueous phases (upper, middle, and lower). Transfer 450 μL of the upper aqueous phase to a new Eppendorf tube for each sample. Add 45 μL of 3M Sodium Acetate Sol (pH 5.2) to each sample, vortex to mix, and incubate at room temperature for 1 min. After incubation, add 500 μL of isopropanol (pre-cooled), vortex to mix, and incubate at -30°C to -10°C for 30 min. After incubation, centrifuge (4°C, 12000×g, 15 min). RNA precipitate will be visible at the bottom of the tube after centrifugation; discard the supernatant. After discarding the supernatant, add 1000 μL of 75% ethanol solution (pre-cooled), vortex to mix, and centrifuge (4°C, 12000×g, 10 min). After centrifugation, discard the supernatant, air dry at room temperature for 10 min, then add 40 μL of DEPC-treated water (pre-warmed at 55°C), vortex to mix, and obtain RNA. Use a UV spectrophotometer to detect and record the purity and concentration of A260 / A280. RNA can be used directly for RT-qPCR or stored at <-60℃. The RNA has a shelf life of 1 year.
[0745] 4. qPCR analysis
[0746] RNA was processed using a genomic DNA removal program to obtain an "RNA template (after DNA removal)," which was then processed using a PCR thermal cycler to obtain cDNA products, which were used as "qPCR templates." All cDNA samples were analyzed using qPCR in 384-well plates, with triplet analysis. Relative expression data were acquired using QuantStudio7 Flex PCR, and the acquired data included: mean Ct, ΔCt, and ΔΔCt. All IGF1R mRNAKD% values were calculated after normalization with those of biopsy samples.
[0747] Experimental Results: As shown in Figure 4, Z7 administered via the orbital site significantly inhibited IGF1R in the orbital fat and maintained a prolonged efficacy (>3 months).
Claims
1. An RNA inhibitor for inhibiting the expression of insulin-like growth factor 1 receptor (IGF-1R) gene, comprising an antisense strand, wherein the antisense strand forms a complementary region with at least 15 consecutive nucleotides in the mRNA encoding IGF-1R, starting from nucleotide 6366 at the 5' end, wherein the complementary region has 0, 1, 2, 3, 4 or 5 mismatches, preferably the complementary region is 15-30 nucleotide pairs in length, more preferably 17-23 nucleotide pairs.
2. The RNA inhibitor according to claim 1, wherein the antisense strand and the mRNA (SEQ ID NO:828) encoding IGF-1R form a complementary region consisting of 15, 16, 17, 18, 19, 20, 21, 22 or 23 consecutive nucleotides starting from the 6366th nucleotide at the 5' end.
3. The RNA inhibitor according to any one of claims 1-2, wherein the antisense strand and the mRNA (SEQ ID NO: 828) encoding IGF-1R, starting from nucleotide 6366 at the 5' end, have at least 75%, 80%, 90%, 95%, or 100% complementarity for the following 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides.
4. The RNA inhibitor according to any one of claims 1-3, wherein the antisense strand and the mRNA (SEQ ID NO:828) encoding IGF-1R, starting from nucleotide 6366 at the 5' end, have at least 85% or 90% complementarity for the following 15, 16, 17, 18, 19, 20, 21, 22 or 23 nucleotides.
5. The RNA inhibitor according to any one of claims 1-4, wherein the antisense strand comprises at least 15 consecutive nucleotides of the sequence shown in SEQ ID NO:296(AAUAUCUGAACCGUAAAAAAG).
6. The RNA inhibitor according to any one of claims 1-5, wherein the antisense strand comprises at least 19, 20, or 21 consecutive nucleotides of the sequence shown in SEQ ID NO:296(AAUAUCUGAACCGUAAAAAAG).
7. The RNA inhibitor according to any one of claims 1-6, comprising a sense strand capable of forming a complementary double strand with the antisense strand, wherein the antisense strand comprises a sequence forming a double-stranded complementary region with at least 15 consecutive nucleotides in the sense strand sequence, the double-stranded complementary region having 0, 1, 2, 3, 4 or 5 mismatches, preferably having 0, 1 or 2 mismatches, and preferably the length of the double-stranded complementary region being 15-30 nucleotide pairs, more preferably 17-23 nucleotide pairs.
8. The RNA inhibitor of claim 7, wherein the sense strand comprises at least 15 consecutive nucleotides of the sequence shown in SEQ ID NO:98 (CUUUUUUACGGUUCAGAUAUU), with a difference of no more than 3, preferably 19, 20 or 21 consecutive nucleotides with a difference of no more than 0, 1, 2 or 3.
9. The RNA inhibitor according to claim 7, comprising the sense strand as shown in SEQ ID NO:98 (CUUUUUUACGGUUCAGAUAUU) and the antisense strand as shown in SEQ ID NO:296 (AAUAUCUGAACCGUAAAAAAG).
10. The RNA inhibitor according to any one of claims 1-9, wherein the antisense strand comprises the following sequence: 5'-(Z5)Z(Z1)(Z2)AUAUCUGAACCGUAAAAAAG(Z3)(Z4)-3'(SEQ ID NO 835), Z5, Z, Z1, Z2, Z3 and Z4 each independently represent A, U, C or G.
11. The RNA inhibitor of claim 10, wherein Z is G.
12. The RNA inhibitor according to claim 10 or 11, wherein Z2 is A or U.
13. The RNA inhibitor according to any one of claims 10-12, wherein Z1 is A or U.
14. The RNA inhibitor according to any one of claims 10-13, wherein Z5 is C.
15. The RNA inhibitor according to any one of claims 10-14, wherein Z3 and / or Z4 are C or U; optionally, Z3 and Z4 are both U.
16. The RNA inhibitor according to claims 1-15, wherein the antisense strand comprises a sequence differing from the following sequences by no more than two or one nucleotides: 5'-CGAAAAUAUCUGAACCGUAAAAAAGUU-3' (SEQ ID NO: 411).
17. The RNA inhibitor according to claim 16, wherein the nucleotide difference is located at any position among positions 1-4, 5-24, or 25-26 from the 5' end of SEQ ID NO:
411.
18. The RNA inhibitor according to claims 1-16, wherein the antisense strand comprises the following sequence: 5'-CGAAAAUAUCUGAACCGUAAAAAAGUU-3' (SEQ ID NO: 411).
19. The RNA inhibitor according to claims 1-18, wherein the antisense strand comprises the following sequence 5'-M(0-4)-CGAAAUAUCUGAACCGUAAAAAAGUU-3' (SEQ ID NO:411 when M is 0, SEQ ID NO:836 when M is 1, SEQ ID NO:837 when M is 2, SEQ ID NO:838 when M is 3, and SEQ ID NO:839 when M is 4), where each M independently represents A, U, C, or G.
20. The RNA inhibitor according to any one of claims 1-19, wherein the antisense strand comprises at least 15 consecutive nucleotides of the sequence shown in SEQ ID NO:398(AAUAUCUGAACCGUAAAAAAGUU).
21. The RNA inhibitor according to any one of claims 1-20, wherein the antisense strand comprises 19, 20, 21, 22 or 23 consecutive nucleotides of the sequence shown in SEQ ID NO:398(AAUAUCUGAACCGUAAAAAAGUU).
22. The RNA inhibitor of claim 21, comprising the sense strand as shown in SEQ ID NO:98 (CUUUUUUACGGUUCAGAUAUU) and the antisense strand as shown in SEQ ID NO:398 (AAUAUCUGAACCGUAAAAAAGUU).
23. The RNA inhibitor of claim 22, comprising a sense strand as shown in SEQ ID NO:98 (CUUUUUUACGGUUCAGAUAUU) and an antisense strand as shown in SEQ ID NO:411 (CGAAAUAUCUGAACCGUAAAAAAGUU).
24. The RNA inhibitor according to any one of claims 1-13, wherein the RNA inhibitor is single-stranded or double-stranded.
25. The RNA inhibitor according to any one of claims 7-24, wherein the sense strand and the antisense strand exist on the same nucleic acid strand, and the preferred RNA inhibitor is shRNA.
26. The RNA inhibitor according to any one of claims 7-25, wherein the sense and antisense strands exist on two different nucleic acid strands, preferably the RNA inhibitor is siRNA, miRNA or shRNA, and more preferably the RNA inhibitor is siRNA.
27. The RNA inhibitor according to any one of claims 7-26, wherein the total length of the positive strand is 15-50 nucleotides, preferably 16-30 nucleotides, and more preferably 16, 17, 18, 19, 20, 21, 22 or 23 nucleotides.
28. The RNA inhibitor according to any one of claims 1-27, wherein the total length of the antisense strand is 15-50 nucleotides, preferably 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides, and more preferably 26-30 nucleotides.
29. The RNA inhibitor according to any one of claims 7-28, wherein the sense strand and the antisense strand exist on two different nucleic acid strands, the total length of the sense strand is 16, 17, 18, 19, 20, 21, 22 or 23 nucleotides, the total length of the antisense strand is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides, and the sense strand and the antisense strand each independently optionally contain 0, 1, 2 or 3 nucleotides of 3' or 5' overhang.
30. The RNA inhibitor of claim 29, wherein both the sense strand and the antisense strand have a 3' overhang of 1-3 nucleotides in length, or the sense strand has a 3' or 5' overhang of 1-3 nucleotides in length, or the antisense strand has a 3' or 5' overhang of 1-3 nucleotides in length.
31. The RNA inhibitor according to any one of claims 1-30, wherein the 3' or 5' end of the antisense strand comprises a phosphate or a phosphate mimic, or the 3' or 5' end of the sense strand comprises a phosphate or a phosphate mimic.
32. The RNA inhibitor of claim 31, wherein the phosphate mimic comprises 5'-(E)-vinylphosphonate, 5'-methylphosphonate, (S)-5'-C-methyl analog and 5'-thiophosphate (5'-PS).
33. The RNA inhibitor according to any one of claims 1-32, wherein at least one nucleotide in the RNA inhibitor is a modified nucleotide.
34. The RNA inhibitor according to any one of claims 1-33, wherein at least 70%, 80%, 90%, or 95% of the nucleotides in the RNA inhibitor are modified nucleotides; preferably, all nucleotides are modified nucleotides.
35. The RNA inhibitor according to any one of claims 33-34, wherein the modification comprises one or more combinations of the following: 2'-OMe (2'-O-methyl) modification, 2'-F (2'-deoxy-2'-fluorine) modification, 2'-O-MOE (2'-O-methoxyethyl) modification, 2'-deoxy (2'-d) modification, 5'-morpholine (5'-Mo) modification, unlocking nucleic acid (UNA) modification, ethylene glycol nucleic acid (GNA) modification, locked nucleic acid (LNA) modification, tricyclic DNA (tcDNA) modification, (S)-restricted ethyl bicyclic nucleic acid ((S)-cEt-BNA) modification, phosphate thioester (PS) modification, phosphate dithioester (PS2) modification, methylphosphonate (MP) modification, methoxypropyl methylphosphonate (MOP) modification, peptide nucleic acid (PNA) modification, 5'-(E)-vinyl phosphate (VP) modification. Modifications include VP, N6-methyladenosine (m6A), 5-methylcytidine (m5C), 3-methyluridine (m3U), 5-methylureaside (m5U), pseudoureaside, 2-thioureaside (s2U), propynouraidine (5-pU), linking the 5' or 3' end of the nucleotide to an inverted abasic nucleotide (invAB), replacing the nucleotide with an inverted abasic nucleotide (invAb), replacing the nucleotide with 2,4-difluorotolyl ribonucleotide (rF), or replacing the nucleotide with (S)-glycerol nucleic acid. Preferred modifications include 2'-OMe, 2'-F, 2'-deoxy, VP, 5'-MP, PS, PS2, MP, MOP, M06, invAb, or invAB.
36. The RNA inhibitor according to any one of claims 1-35, wherein the 3' or 5' end of the antisense strand is modified with invAB, preferably, the invAB modification is linked to the antisense strand via a phosphate thioester.
37. The RNA inhibitor according to any one of claims 33-36, wherein the RNA inhibitor comprises a sense strand as shown in SEQ ID NO:615(c*u*u*u*uuaCfGfGfuucagaUfa*u*u) and an antisense strand as shown in SEQ ID NO:825((invAB)*CfGfaa*AfuaucugaaccgUfaAfaaaag*u*u).
38. The RNA inhibitor according to any one of claims 33-37, wherein the RNA inhibitor comprises a sense strand as shown in SEQ ID NO:615(c*u*u*u*uuuaCfGfGfuucagaUfa*u*u) and an antisense strand as shown in SEQ ID NO:830((invAB)*cGfaa*AfuaucugaaccgUfaAfaaaag*u*u).
39. The RNA inhibitor according to any one of claims 1-38, further comprising a delivery system, wherein the delivery system is conjugated to a sense strand and / or an antisense strand, the delivery system being capable of delivering the RNA inhibitor to target RNA in a target tissue to produce a gene silencing effect.
40. The RNA inhibitor according to claim 39, wherein, The target tissue is eye tissue.
41. The RNA inhibitor according to claim 40, wherein, The ocular tissues mentioned are the optic nerve, trabecular meshwork, proximal canal tissue, ganglion, external scleral vein, Schrem's canal, or peripheral ocular tissues.
42. The RNA inhibitor according to claim 41, wherein, The ocular tissues are retinal ganglia, endothelial cells, peripheral ocular muscles, or peripheral ocular fat.
43. The RNA inhibitor according to any one of claims 39-42, wherein, The delivery system is independently coupled to internal or external locations of the justice chain and / or antisense chain.
44. The RNA inhibitor according to claim 43, wherein, The internal or external location is on a nucleobase, sugar ring, methylphosphonate bond, thiophosphate diester bond, or phosphate diester bond.
45. The RNA inhibitor according to any one of claims 39-44, wherein, The delivery system is a lipophilic structure, which includes a lipophilic group and a linker, wherein the lipophilic group is linked to the double-stranded ribonucleic acid via the linker.
46. The RNA inhibitor according to claim 45, wherein, The lipophilic structure is selected from aliphatic, alicyclic, and polycyclic compounds.
47. The RNA inhibitor according to claim 46, wherein, The lipophilic structure contains saturated or unsaturated C16 or C22.
48. The RNA inhibitor according to any one of claims 45-47, wherein, The linker is selected from single bonds, ethers, thioethers, urea, carbonates, amines, amides, maleimide-thioethers, disulfides, phosphate diesters, sulfonamide bonds, click reaction products, and carbamates.
49. The RNA inhibitor according to any one of claims 45-48, wherein, The delivery system is (D02).
50. The RNA inhibitor according to any one of claims 45-49, wherein the delivery system is conjugated to the 5' end and / or 3' end of the antisense strand.
51. The RNA inhibitor according to any one of claims 45-50, wherein the delivery system is conjugated to the 5' end and / or 3' end of the positive strand.
52. The RNA inhibitor according to any one of claims 45-51, wherein the delivery system is conjugated to the 5' end of the antisense strand and the delivery system is conjugated to the 3' end of the sense strand, and the two delivery systems may be the same or different.
53. The RNA inhibitor according to any one of claims 45-52, wherein the delivery system is conjugated to the 3' end of the antisense strand and the delivery system is conjugated to the 5' end of the sense strand, and the two delivery systems may be the same or different.
54. The RNA inhibitor according to any one of claims 45-53, wherein the delivery system is conjugated to the 5' end of the antisense strand or the antisense nucleic acid fragment, and the delivery system is conjugated to the 5' end of the sense strand or the sense nucleic acid fragment, wherein the two delivery systems are the same or different.
55. The RNA inhibitor according to any one of claims 45-54, wherein the delivery system is conjugated to the 3' end of the antisense strand or the antisense nucleic acid fragment, and the delivery system is conjugated to the 3' end of the sense strand or the sense nucleic acid fragment, wherein the two delivery systems are the same or different.
56. The RNA inhibitor according to any one of claims 45-55, comprising a sense strand as shown in SEQ ID NO:621([D02]*c*u*u*u*uuuaCfGfGfuucagaUfa*u*u) and an antisense strand as shown in SEQ ID NO:825((invAB)*CfGfaa*AfuaucugaaccgUfaAfaaaag*u*u).
57. The RNA inhibitor according to any one of claims 45-56, comprising a sense strand as shown in SEQ ID NO:621([D02]*c*u*u*u*uuuaCfGfGfuucagaUfa*u*u) and an antisense strand as shown in SEQ ID NO:830((invAB)*cGfaa*AfuaucugaaccgUfaAfaaaag*u*u).
58. A pharmaceutical composition comprising an RNA inhibitor as described in any one of claims 1-57, and / or a physiologically acceptable excipient and / or carrier and / or diluent.
59. The composition according to embodiment 58, characterized in that... The pharmaceutically acceptable carriers include or are selected from aqueous carriers, liposomes, polymers, or peptides.
60. Use of the RNA inhibitor according to any one of claims 1-57 and the pharmaceutical composition according to any one of claims 58-59 in the preparation of a medicament for the prevention or treatment of a disease or pathology or for reducing the risk of a disease or symptom.
61. The use according to claim 60, wherein the disease or pathology includes diseases or symptoms associated with elevated IGF-1R levels.
62. The use according to any one of claims 60-61, wherein the disease or pathology includes thyroid ophthalmopathy, osteoarthritis, and neuropathic pain.
63. A method for preventing or treating a disease or symptom, the method comprising administering to a subject in need an effective amount of any one of claims 1-57, a pharmaceutically acceptable salt thereof, or a pharmaceutical composition of any one of claims 58-59.
64. The method of claim 63, wherein the RNA inhibitor, its pharmaceutically acceptable salt, or the pharmaceutical composition is administered to the subject via a subcutaneous, intravenous, oral, rectal, or intraperitoneal route.
65. A method for inhibiting IGF-1R expression in cells, tissues or subjects, comprising administering to the cells, tissues or subjects an effective amount of any one of claims 1-57, a pharmaceutically acceptable salt thereof, or a pharmaceutical composition of any one of claims 58-59.
66. The method of claim 65, wherein the disease or pathology includes a disease or symptom associated with elevated IGF-1R levels.
67. The method of claim 65, wherein the disease or pathology includes thyroid ophthalmopathy, osteoarthritis, or neuropathic pain.