Aspartate kinase mutant and amino acid production method using same
A variant aspartate kinase with specific amino acid substitutions enhances the production of ornithine, citrulline, and arginine in Corynebacterium strains by up to 47% through optimized enzyme activity.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- CJ CHEILJEDANG CORP
- Filing Date
- 2025-08-01
- Publication Date
- 2026-06-18
AI Technical Summary
Existing methods for producing amino acids in Corynebacterium strains, such as Corynebacterium glutamicum, are limited in efficiency and yield, particularly for ornithine, citrulline, and arginine, due to the constraints of wild-type aspartate kinase activity.
Introduction of a variant aspartate kinase, where the 250th and/or 258th position in the amino acid sequence is substituted with specific amino acids, enhancing the enzyme's activity and improving amino acid production capacity.
The variant aspartate kinase increases the yield of ornithine, citrulline, and arginine by 3% to 47% compared to wild-type strains, demonstrating improved production capabilities.
Abstract
Description
Variant aspartate kinase and method for producing amino acids using the same
[0001] The present application relates to a variant aspartate kinase, an amino acid-producing microorganism modified to express the variant aspartate kinase, and a method for producing amino acids using the same.
[0002]
[0003] Glutamate is one of the proteinaceous amino acids widely found in plants, animals, and microorganisms, and is converted and metabolized into ornithine (L-ornithine), citrulline (L-citrulline), arginine (L-arginine), etc. in organs of the body.
[0004] Ornithine is used as a nutritional supplement because it is effective for muscle building and reducing body fat, and it is also used as a pharmaceutical to improve liver cirrhosis and liver dysfunction. Citrulline is known for its physiological effects, such as promoting ammonia metabolism, improving blood flow through vasodilation, lowering blood pressure, neurotransmission, boosting immunity, and scavenging free radicals. Additionally, arginine is used for medicinal purposes, such as as a liver function enhancer, brain function enhancer, and comprehensive amino acid preparation, and is also used for food purposes, such as as an additive in fish paste, health drinks, and as a salt substitute for patients with hypertension.
[0005] Microorganisms of the genus Corynebacterium, particularly Corynebacterium glutamicum, are Gram-positive microorganisms widely used for amino acid production. To produce amino acids, target-specific approaches are primarily used, such as increasing the expression of genes encoding enzymes primarily involved in amino acid biosynthesis in Corynebacterium strains or removing genes unnecessary for amino acid biosynthesis (US 9644009 B2).
[0006]
[0007] The present application provides a variant aspartate kinase in which the amino acid corresponding to the 250th and / or 258th position in the amino acid sequence of SEQ ID NO. 1 is substituted with another amino acid.
[0008]
[0009] One object of the present application is to provide a variant aspartate kinase in which the amino acid corresponding to the 250th and / or 258th position in the amino acid sequence of SEQ ID NO. 1 is substituted with another amino acid.
[0010] Another object of the present application is to provide a polynucleotide encoding a variant aspartate kinase of the present application.
[0011] Another object of the present application is to provide a microorganism comprising the variant aspartate kinase of the present application, a polynucleotide encoding the same, or a vector comprising said polynucleotide.
[0012] Another object of the present application is to provide a method for producing amino acids, comprising the step of culturing a microorganism in a medium comprising the variant aspartate kinase of the present application, a polynucleotide encoding the same, or a vector comprising said polynucleotide.
[0013] Another object of the present application is to provide a composition for producing amino acids comprising: a variant aspartate kinase of the present application; a polynucleotide encoding the same; a microorganism comprising a vector comprising said variant aspartate kinase, said polynucleotide encoding the same, or said polynucleotide; a culture of said microorganism; or a combination of two or more of these.
[0014] Another object of the present application is to provide a use for amino acid production in a microorganism comprising the variant aspartate kinase of the present application; a polynucleotide encoding the same; or a vector comprising said variant aspartate kinase, the polynucleotide encoding the same, or said polynucleotide.
[0015]
[0016] When culturing a microorganism that produces amino acids using the variant aspartate kinase of the present application, it is possible to produce amino acids including ornithine, citrulline, and arginine in high yield compared to a microorganism having the existing wild-type aspartate kinase.
[0017]
[0018] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application may be applied to other descriptions and embodiments. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application should not be considered limited by the specific descriptions provided below. Additionally, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated by reference into this specification in their entirety to more clearly explain the level of the art to which this application pertains and the content of this application.
[0019]
[0020] One aspect of the present application provides a variant aspartate kinase in which the amino acid corresponding to the 250th and / or 258th position in the amino acid sequence of SEQ ID NO. 1 is substituted with another amino acid.
[0021]
[0022] The variant aspartate kinase of the present application may be one in which the amino acid corresponding to the 250th and / or 258th position in the amino acid sequence of SEQ ID NO. 1 is substituted with an amino acid different from the amino acid before substitution. Alternatively, the variant aspartate kinase may be a variant aspartate kinase substituted with an amino acid different from the amino acid before substitution, but is not limited thereto.
[0023] The amino acid before substitution corresponding to the 250th position in the amino acid sequence of SEQ ID NO. 1 above may be valine (Valine, Val, or V), and the amino acid before substitution corresponding to the 258th position may be valine (Valine, Val, or V).
[0024] Specifically, the variant aspartate kinase may be one in which the amino acid corresponding to the 250th and / or 258th position in the amino acid sequence of SEQ ID NO. 1 is substituted with an amino acid selected from the group consisting of methionine, serine, threonine, asparagine, cysteine, histidine, lysine, aspartate, alanine, tyrosine, leucine, glutamine, glycine, proline, glutamic acid, arginine, isoleucine, phenylalanine, and tryptophan, but is not limited thereto.
[0025] More specifically, the variant aspartate kinase may be one in which the amino acid corresponding to the 250th and / or 258th position in the amino acid sequence of SEQ ID NO. 1 is substituted with an amino acid selected from the group consisting of glycine, alanine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, and glutamine.
[0026] More specifically, the variant aspartate kinase may be one in which the amino acid corresponding to the 250th and / or 258th position in the amino acid sequence of SEQ ID NO. 1 is substituted with an amino acid selected from the group consisting of glycine, alanine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, and cysteine.
[0027] More specifically, the variant aspartate kinase may be one in which the amino acid corresponding to the 250th and / or 258th position in the amino acid sequence of SEQ ID NO. 1 is substituted with leucine or isoleucine.
[0028] More specifically, the variant aspartate kinase may be one in which the amino acid corresponding to the 250th position in the amino acid sequence of SEQ ID NO. 1 is substituted with leucine, the amino acid corresponding to the 258th position in the amino acid sequence of SEQ ID NO. 1 is substituted with isoleucine, or a combination thereof.
[0029]
[0030] The protein to be introduced for the mutation of the present application may be a protein having aspartate kinase activity. Specifically, the protein may have the amino acid sequence of SEQ ID NO. 1 and may have aspartate kinase activity, but is not limited thereto.
[0031] Furthermore, meaningless addition of sequences before or after the amino acid sequence of SEQ ID NO. 1, naturally occurring mutations, or silent mutations thereof are not excluded, and if such a protein has the same or corresponding activity as the protein containing the amino acid sequence of SEQ ID NO. 1, it may be a protein subject to the introduction of mutation in this application. For example, a protein subject to the introduction of mutation in this application may be a protein composed of the amino acid sequence of SEQ ID NO. 1 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.1% or more homology or identity therewith. Additionally, it is obvious that a protein having an amino acid sequence in which some sequences are deleted, modified, substituted, or added is also included within the scope of the protein subject to mutation in this application, provided that such an amino acid sequence has such homology or identity and exhibits an efficacy corresponding to the said protein.
[0032] The variant aspartate kinase of the present application may comprise an amino acid sequence in which the amino acid corresponding to the 250th position in the amino acid sequence of SEQ ID NO. 1 is substituted with another amino acid, and which has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more homology or identity with the amino acid sequence of SEQ ID NO. 1.
[0033] The variant aspartate kinase of the present application may include an amino acid sequence in which the amino acid corresponding to the 250th position in the amino acid sequence of SEQ ID NO. 1 is an amino acid other than valine, and which has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more homology or identity with the amino acid sequence of SEQ ID NO. 1. Furthermore, it is obvious that a variant aspartate kinase having an amino acid sequence in which some sequences are deleted, modified, substituted, conservedly substituted, or added is also included within the scope of the present application, provided that such an amino acid sequence has such homology or identity and exhibits efficacy corresponding to the variant aspartate kinase of the present application.
[0034] The variant aspartate kinase of the present application may comprise an amino acid sequence in which the amino acid corresponding to the 258th position in the amino acid sequence of SEQ ID NO. 1 is substituted with another amino acid, and which has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more homology or identity with the amino acid sequence of SEQ ID NO. 1.
[0035] The variant aspartate kinase of the present application may include an amino acid sequence in which the amino acid corresponding to the 258th position in the amino acid sequence of SEQ ID NO. 1 is an amino acid other than valine, and which has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more homology or identity with the amino acid sequence of SEQ ID NO. 1. Furthermore, it is obvious that a variant aspartate kinase having an amino acid sequence in which some sequences are deleted, modified, substituted, conservedly substituted, or added is also included within the scope of the present application, provided that such an amino acid sequence has such homology or identity and exhibits efficacy corresponding to the variant aspartate kinase of the present application.
[0036] For example, this includes cases where there are sequence additions or deletions, naturally occurring mutations, silent mutations, or conservative substitutions at the N-terminus, C-terminus, and / or within the amino acid sequence that do not alter the function of the variant aspartate kinase of the present application.
[0037] The aforementioned "conservative substitution" refers to the substitution of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions can generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions have little to no effect on the activity of a protein or polypeptide.
[0038] For example, among amino acids having electrically charged side chains, positively charged (basic) amino acids include arginine, lysine, and histidine, and negatively charged (acidic) amino acids include glutamic acid and aspartic acid; amino acids having uncharged side chains include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, and glutamine.
[0039]
[0040] In this application, the terms “variant protein” or “variant” refer to a polypeptide in which one or more amino acids are conservatively substituted and / or modified, resulting in a sequence of amino acids different from that of the variant prior to modification, while retaining functions or properties. Such a variant can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the capabilities of the variant may be increased, unchanged, or decreased compared to the polypeptide prior to modification. Additionally, some variants may include variants in which one or more parts, such as an N-terminal leader sequence or a transmembrane domain, have been removed. Other variants may include variants in which a portion of the N- and / or C-terminus of a mature protein has been removed. The term "variant protein" mentioned above may be used interchangeably with terms such as variant, modification, variant polypeptide, mutated protein, mutation, and variant (in English expressions, modification, modified polypeptide, modified protein, mutant, mutein, divergent, etc.), and is not limited to any such terms as long as they are used with the meaning of being mutated.
[0041] Additionally, the variant may include deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide. For example, a signal (or leader) sequence involved in co-translational or post-translational protein translocation may be conjugated to the N-terminus of the variant. Additionally, the variant may be conjugated with another sequence or linker to enable identification, purification, or synthesis.
[0042]
[0043] In this application, the terms 'homology' or 'identity' refer to the degree of similarity between two given amino acid sequences or base sequences and may be expressed as a percentage. The terms homology and identity may often be used interchangeably.
[0044] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard arrangement algorithms, and a default gap penalty established by the program used may be utilized. Practically, homologous or identical sequences can generally be hybridized with the entire sequence or a part thereof under moderate or high stringent conditions. It is evident that hybridization also includes hybridization with polynucleotides containing common codons or codons that account for codon degeneracy.
[0045] Whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be determined using a known computer algorithm, such as the “FASTA” program, using default parameters as in, for example, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, it can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Homology, similarity, or identity can be determined using, for example, Academic Press, San Diego, 1994, and [CARILLO et al / .](1988) SIAM J Applied Math 48: 1073). For example, BLAST from the National Biotechnology Information Database Center or ClustalW can be used to determine homology, similarity, or identity.
[0046] The homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information using a GAP computer program, such as that described in, for example, Smith and Waterman, Adv. Appl. Math (1981) 2:482, or Needleman et al. (1970), J Mol Biol. 48:443. In summary, a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). The default parameters for a GAP program are (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), or Gribskov et al. (1986) Nucl. Acids Res. 14: A weighted comparison matrix of 6745 (or an EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.
[0047] As an example of the present application, the variant aspartate kinase of the present application may have an improved amino acid production capacity compared to a wild-type polypeptide having aspartate kinase activity.
[0048] As another example, the variant aspartate kinase of the present application may have an activity that increases the amino acid production capacity compared to a wild-type polypeptide having aspartate kinase activity.
[0049] In this application, the term "aspartate kinase (Aspartokinase; Aspartate kinase, AK, LysC)" refers to an enzyme having the activity of catalyzing the phosphorylation of the amino acid aspartate within microorganisms, and may be used interchangeably with LysC. The amino acid sequence of LysC can be obtained from known databases such as Genebank of NCBI.
[0050] For example, LysC of the present application may be of microbial origin, specifically may be of prokaryotic or eukaryotic origin, and more specifically may be of the genus of Corynebacterium, but it is obvious that it contains a protein having activity that catalyzes the phosphorylation of aspartic acid of various origins.
[0051] As another example, the LysC protein may be NCgl0247 (cg0306) derived from microorganisms of the genus Corynebacterium, but it is evident that it includes proteins with aspartate kinase activity from various sources.
[0052] In the present application, the amino acid before modification corresponding to the 250th and / or 258th position of SEQ ID NO. 1 in the amino acid sequence before modification of the LysC protein to be modified may be valine (V).
[0053] The variant aspartate kinase of the present application may be one in which the amino acid corresponding to the 250th and / or 258th position in the amino acid sequence of SEQ ID NO. 1 is substituted with an amino acid different from the amino acid before substitution.
[0054] In one example, the above variant aspartate kinase may be in which the amino acid corresponding to the 250th and / or 258th position in the amino acid sequence of SEQ ID NO. 1 is substituted with one or more amino acids selected from the group consisting of methionine, serine, threonine, asparagine, cysteine, histidine, lysine, aspartate, alanine, tyrosine, leucine, glutamine, glycine, proline, glutamic acid, arginine, isoleucine, phenylalanine, and tryptophan. In another example, the above variant aspartate kinase may be in which the amino acid corresponding to the 250th and / or 258th position in the amino acid sequence of SEQ ID NO. 1 is substituted with an amino acid other than an aromatic amino acid. As another example, the above variant aspartate kinase may be one in which the amino acid corresponding to the 250th and / or 258th position in the amino acid sequence of SEQ ID NO. 1 is substituted with an amino acid having a nonpolar, polar, or charged side chain.
[0055] As another example, the variant aspartate kinase of the present application may be such that the amino acid corresponding to the 250th position in the amino acid sequence of SEQ ID NO. 1 is substituted with leucine, the amino acid corresponding to the 258th position in the amino acid sequence of SEQ ID NO. 1 is substituted with isoleucine, or a combination thereof.
[0056] As another example, the variant aspartate kinase of the present application may have, include, be composed of, or essentially consist of the amino acid sequence described in SEQ ID NO. 3, SEQ ID NO. 5, or SEQ ID NO. 7.
[0057]
[0058] In this application, the term “corresponding to” refers to an amino acid residue at a position listed in the polypeptide, or an amino acid residue that is similar, identical, or homologous to a residue listed in the polypeptide. Identifying the amino acid at the corresponding position may involve determining a specific amino acid of a sequence that references a specific sequence. As used in this application, “corresponding region” generally refers to a similar or corresponding position in a related protein or a reference protein.
[0059] For example, any amino acid sequence can be aligned with sequence number 1, and based on this, each amino acid residue of the said amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue of sequence number 1. For example, a sequence alignment algorithm such as that described in the present application can identify the position of an amino acid, or the position where modifications such as substitution, insertion, or deletion occur, by comparing with a query sequence (also referred to as a "reference sequence").
[0060] For such alignment, examples such as the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) can be used, but are not limited thereto, and sequence alignment programs and pairwise sequence comparison algorithms known in the art can be appropriately used.
[0061]
[0062] Another aspect of the present application provides a polynucleotide encoding a variant aspartate kinase of the present application.
[0063] The lysC gene of the present application may include all genes known to code for proteins having LysC activity.
[0064] Specifically, the lysC gene of the present application may be a polynucleotide encoding NCgl0247 (Cg0306) derived from a microorganism of the genus Corynebacterium, but is not limited thereto. As another example, the lysC gene may be a lysC gene derived from a microorganism of the genus Corynebacterium, but is not limited thereto, and it is obvious that it includes lysC genes of various origins encoding proteins having LysC protein activity.
[0065] In this application, the term "polynucleotide" refers to a polymer of nucleotides in which nucleotide monomers are linked together in a long chain by covalent bonds, such as a DNA or RNA strand of a certain length or longer, and more specifically, to a polynucleotide fragment encoding the variant aspartate kinase.
[0066] The polynucleotide encoding a variant aspartate kinase of the present application may include a nucleotide sequence encoding a variant aspartate kinase in which the amino acid corresponding to the 250th and / or 258th position in the amino acid sequence of SEQ ID NO. 1 is substituted with another amino acid, or may include a nucleotide sequence in which the codon corresponding to the 748th and / or 772nd to 773rd position in the nucleotide sequence of SEQ ID NO. 2 is substituted with a codon encoding another amino acid. As an example, the polynucleotide of the present application may include a nucleotide sequence encoding the amino acid sequence described in SEQ ID NO. 3, SEQ ID NO. 5, or SEQ ID NO. 7. As a more specific example of the present application, the polynucleotide of the present application may have or include the sequence of SEQ ID NO. 4, SEQ ID NO. 6, or SEQ ID NO. 8. Additionally, the polynucleotide of the present application may be composed of or essentially constitute the sequence of SEQ ID NO. 4, SEQ ID NO. 6, or SEQ ID NO. 8.
[0067] The polynucleotide of the present application may have various modifications made to its coding region within a range that does not alter the amino acid sequence of the variant aspartate kinase of the present application, taking into account the degeneracy of the codons or the codons preferred in the organism intended to express the variant aspartate kinase of the present application. Specifically, the polynucleotide of the present application may have or include a nucleotide sequence having homology or identity with the sequence of SEQ ID NO. 2 of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100%, or may be composed of or essentially composed of a nucleotide sequence having homology or identity with the sequence of SEQ ID NO. 2 of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100%, but is not limited thereto. At this time, in the sequence having the above homology or identity, the codon coding for the amino acid corresponding to the 250th and / or 258th position of SEQ ID NO. 1 may be one of the codons coding for amino acids other than valine, for example, methionine, serine, threonine, asparagine, cysteine, histidine, lysine, aspartic acid, alanine, tyrosine, leucine, glutamine, glycine, proline, glutamic acid, arginine, isoleucine, phenylalanine, and tryptophan.
[0068] Additionally, the polynucleotide of the present application may be included without limitation as long as it is a probe that can be prepared from known gene sequences, for example, a sequence that can be hybridized under stringent conditions with a sequence that is complementary to all or part of the polynucleotide sequence of the present application. The "stringent condition" means a condition that enables specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, conditions may be listed in which polynucleotides with high homology or identity are hybridized with each other, with homology or identity of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, and polynucleotides with lower homology or identity are not hybridized with each other, or conditions in which the polynucleotides are washed once, specifically two to three times, at a salt concentration and temperature equivalent to the washing conditions of conventional southern hybridization, which are 60°C, 1 χSSC, 0.1% SDS, specifically 60°C, 0.1 χSSC, 0.1% SDS, more specifically 68°C, 0.1 χSSC, 0.1% SDS.
[0069] Hybridization requires that two nucleic acids have complementary sequences, even though a mismatch between bases may be possible depending on the degree of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, regarding DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Accordingly, the polynucleotides of this application may also include isolated nucleic acid fragments that are complementary to the entire sequence, as well as substantially similar nucleic acid sequences.
[0070] Specifically, a polynucleotide having homology or identity with the polynucleotide of the present application can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. Additionally, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and can be appropriately adjusted by a person skilled in the art according to the purpose.
[0071] The appropriate strictness for hybridizing the above polynucleotides depends on the length and degree of complementarity of the polynucleotides, and the variables are well known in the art (e.g., J. Sambrook et al., i.e.).
[0072]
[0073] Another aspect of the present application provides a vector comprising the polynucleotide of the present application.
[0074] The above vector may be an expression vector for expressing the above polynucleotide in a host cell, but is not limited thereto.
[0075] The vector of the present application may comprise a DNA product comprising a sequence of a polynucleotide encoding said target polypeptide, which is operably linked to a suitable expression control region (or expression control sequence) to enable the expression of said target polypeptide within a suitable host. The expression control region may comprise a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence coding for a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After being transformed into a suitable host cell, the vector may replicate or function independently of the host genome and may be incorporated into the genome itself.
[0076] The vectors used in this application are not particularly limited, and any vector known in the art may be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors may be used as plasmid vectors. Specifically, pDZ, pDC, pDC24, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors may be used.
[0077] For example, a polynucleotide encoding a target polypeptide can be inserted into a chromosome using a vector for intracellular chromosome insertion. The insertion of said polynucleotide into the chromosome may be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker may be additionally included to confirm whether the chromosome insertion has occurred. The selection marker is intended to select cells transformed by the vector, that is, to confirm whether the target nucleic acid molecule has been inserted, and markers conferring selectable phenotypes such as drug resistance, nutritional requirements, resistance to cytotoxic agents, or expression of surface polypeptides may be used. Since only cells expressing the selection marker survive or exhibit other phenotypes in an environment treated with a selective agent, the transformed cells can be selected.
[0078] In this application, the term "transformation" means introducing a vector containing a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoded by said polynucleotide can be expressed within the host cell. The transformed polynucleotide may include both inserted into and located within the chromosomes of the host cell and extrachromosomally, as long as it can be expressed within the host cell. Additionally, said polynucleotide includes DNA and / or RNA encoding the target polypeptide. said polynucleotide may be introduced in any form that can be introduced into and expressed within the host cell. For example, said polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic structure containing all the elements necessary for self-expression. said expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal operably linked to said polynucleotide. said expression cassette may be in the form of a self-replicating expression vector. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
[0079] In addition, the term "operably connected" above means that a promoter sequence and a polynucleotide sequence are functionally connected to initiate and mediate the transcription of a polynucleotide encoding a variant aspartate kinase, which is the subject of this application.
[0080]
[0081] Another aspect of the present application provides a microorganism comprising a variant aspartate kinase of the present application or a polynucleotide encoding said variant aspartate kinase.
[0082] The strain of the present application may include the variant aspartate kinase of the present application, a polynucleotide encoding the variant aspartate kinase, or a vector comprising the polynucleotide of the present application.
[0083] In this application, the term “microorganism (or strain)” includes both wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification, and may be microorganisms in which specific mechanisms are weakened or strengthened due to causes such as the insertion of external genes or the enhancement or inactivation of the activity of endogenous genes, and may be microorganisms that include genetic modification for the production of a desired polypeptide, protein, or product.
[0084] The strain of the present application may be a strain that naturally possesses the ability to produce amino acids, or a microorganism in which the ability to produce amino acids is conferred upon a strain that lacks the ability to produce amino acids. For example, it may be a microorganism in which the variant aspartate kinase of the present application or a polynucleotide encoding it is introduced to increase the ability to produce amino acids, but is not limited thereto.
[0085] In this application, the term "amino acid" may include all L-amino acids that can be biosynthesized using glutamic acid as a precursor, including glutamic acid. For example, L-amino acids that can be produced through the glutamic acid biosynthetic pathway using glutamic acid as a precursor include glutamine, ornithine, citrulline, and arginine, and any other L-amino acid that can be biosynthesized using glutamic acid as a precursor may be included within the scope of this application. Furthermore, glutamic acid that can be produced with the involvement of the aspartate kinase of this application and substances synthesized using it as a precursor may be included without limitation.
[0086] Meanwhile, in this application, the term "L-amino acid" includes both proteinaceous and non-proteinaceous amino acids.
[0087] The strain of the present application may be a microorganism with increased amino acid production capacity compared to a parent strain or a wild-type Corynebacterium strain that does not contain the variant aspartate kinase of the present application. The said microorganism may have improved amino acid production capacity through the introduction of the variant aspartate kinase of the present application.
[0088] For example, the aspartate kinase-free microorganism, which is a control strain for comparing whether the above amino acid production capacity is increased, may be the Corynebacterium glutamicum ATCC 13869 strain, the ornithine-producing C. gl::argF*_argR* strain, the citrulline-producing C. gl::argR*_argG* strain, or the arginine-producing CJR100 strain, but is not limited thereto.
[0089] For example, the recombinant strain with increased production capacity may be increased by about 3% or more compared to the amino acid production capacity of the parent strain before mutation or the non-modified microorganism, specifically by about 3% or more, about 4% or more, about 5% or more, about 6% or more, about 7% or more, about 9% or more, or about 11% or more (there is no special limit on the upper limit, for example, it may be about 200% or less, about 150% or less, about 100% or less, or about 50% or less), but is not limited thereto as long as it has a positive increase amount compared to the production capacity of the parent strain before mutation, the non-modified microorganism, or the aspartate kinase non-modified microorganism. In another example, the recombinant strain with increased amino acid production capacity may have an amino acid production capacity that is increased by about 1.01 times or more, about 1.05 times or more, about 1.10 times or more, about 1.15 times or more, about 1.20 times or more, about 1.25 times or more, about 1.30 times or more, about 1.325 times or more, about 1.35 times or more, about 1.375 times or more, about 1.40 times or more, about 1.425 times or more, about 1.45 times or more, about 1.46 times or more, or about 1.47 times or more (there is no specific limit on the upper limit, and it may be, for example, about 10 times or less, about 5 times or less, about 3 times or less, or about 2 times or less), but is not limited thereto.
[0090] In this application, the term "non-modified microorganism" does not exclude strains containing mutations that may naturally occur in microorganisms, and may refer to wild-type or natural-type strains themselves, or strains prior to genetic mutations caused by natural or artificial factors. Additionally, the term "aspartate kinase non-modified microorganism" in this application may refer to strains in which the aspartate kinase variant described herein has not been introduced or prior to its introduction. The aspartate kinase non-modified microorganism in this application does not exclude strains containing modifications to proteins or other genes other than modifications to aspartate kinase or the polynucleotide encoding it.
[0091] In this application, the term "non-mutated microorganism" may be used interchangeably with "pre-mutation strain," "pre-mutation microorganism," "non-mutated strain," "non-mutated strain," "non-mutated microorganism," or "reference microorganism."
[0092] The microorganisms of the present application may be, but are not limited to, microorganisms comprising a variant aspartate kinase or a polynucleotide encoding the same; or microorganisms genetically modified to include a variant aspartate kinase, a polynucleotide encoding the same, or a vector comprising said polynucleotide (e.g., recombinant microorganisms). The term "intrinsic activity" refers to the activity of a specific polypeptide originally possessed by the parent strain, wild-type, or non-modified microorganism prior to the change in traits caused by genetic mutation due to natural or artificial factors. This term may be used interchangeably with "activity prior to modification."
[0093]
[0094] In another example of the present application, the microorganisms of the present application include Corynebacterium glutamicum, Corynebacterium stationis, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium pollutisoli, and Corynebacterium It may be Corynebacterium imitans, Corynebacterium testudinoris, or Corynebacterium flavescens, and specifically may be Corynebacterium glutamicum, but is not limited thereto.
[0095]
[0096] As another example of the present application, the recombinant microorganism of the present application may be a microorganism in which the activity of a portion of a protein in the amino acid biosynthesis pathway is further enhanced, or the activity of a portion of a protein in the amino acid degradation pathway is further weakened, thereby increasing the amino acid production capacity.
[0097] As another example of the present application, the recombinant microorganism of the present application may be a strain with increased production capacity of ornithine, one of the amino acids.
[0098] In any one of the embodiments described above, the recombinant microorganism of the present application comprises one or more selected from the group consisting of acetylglutamate synthase that converts glutamate to acetylglutamate (N-acetylglutamate), ornithine acetyltransferase (ArgJ) that converts acetylornithine to ornithine, acetylglutamate kinase (ArgB) that converts acetylglutamate to acetylglutamyl phosphate (N-acetylglutamyl phosphate), acetyl gamma glutamyl phosphate reductase (ArgC) that converts acetylglutamate semialdehyde (N-acetylglutamate semialdehyde), and acetylornithine aminotransferase (ArgD) that converts acetylglutamate semialdehyde to acetylornithine (N-acetylornithine). It is possible that the ornithine production capacity has been enhanced by modification so that the activity is strengthened relative to the intrinsic activity.
[0099] However, not limited to this, ornithine production capacity can be enhanced by gene expression regulation methods known in the industry.
[0100] As another example of the present application, the recombinant microorganism of the present application may be a strain with increased production capacity of citrulline among amino acids.
[0101] In any one of the embodiments described above, the recombinant microorganism of the present application may be modified such that the activity of ornithine carbamoyltransferase (ArgF), which converts ornithine to citrulline, is enhanced relative to its intrinsic activity, thereby improving the production capacity of citrulline. Alternatively, the recombinant microorganism of the present application may have improved production capacity of citrulline by enhancing the production capacity of ornithine, which is a precursor of citrulline, as described above.
[0102] However, not limited to this, the production capacity of citrulline can be enhanced by gene expression regulation methods known in the industry.
[0103] As another example of the present application, the recombinant microorganism of the present application may be a strain with increased production capacity of arginine, one of the amino acids.
[0104] In any one of the embodiments described above, the recombinant microorganism of the present application may be modified such that one or more activities selected from the group consisting of argininosuccinate synthase (ArgG), argininosuccinate degradase (ArgH), aspartate ammonia lyase (AspA), and aspartate aminotransferase (AspB) are enhanced relative to the intrinsic activity, thereby improving the production capacity of arginine. Alternatively, the recombinant microorganism of the present application may have improved arginine production capacity by enhancing the production capacity of ornithine, which is a precursor of citrulline, as described above.
[0105] However, not limited to this, arginine production capacity can be enhanced by gene expression regulation methods known in the industry.
[0106]
[0107] In this application, the term "weakening" of the activity of a polypeptide (including, for example, proteins specified by the name of each enzyme) is a concept that encompasses both a decrease in activity and the absence of activity relative to the intrinsic activity. The term "weakening" may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, and attenuation.
[0108] The above weakening may include cases where the activity of the polypeptide itself is reduced or eliminated compared to the polypeptide activity originally possessed by the microorganism due to mutations in the polynucleotide encoding the polypeptide, etc.; cases where the overall degree and / or concentration (expression amount) of polypeptide activity within the cell is lower than that of the natural strain due to inhibition of gene expression of the polynucleotide encoding it or inhibition of translation into polypeptide, etc.; cases where the expression of the polynucleotide does not occur at all; and / or cases where there is no polypeptide activity even if the polynucleotide is expressed. The statement that the polypeptide activity is "inactivated, deficient, reduced, downregulated, lowered, or attenuated" compared to the intrinsic activity means that it has become lower than the activity of a specific polypeptide originally possessed by the parent strain or the non-modified microorganism prior to transformation.
[0109] The attenuation of the activity of such polypeptides can be performed by any method known in the art, but is not limited thereto, and can be achieved by the application of various methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012 et al.).
[0110]
[0111] Specifically, the weakening of the activity of the polypeptide of the present application is
[0112] 1) Deletion of all or part of a gene encoding a polypeptide;
[0113] 2) Modification of the expression regulatory region (or expression regulatory sequence) to reduce the expression of the gene encoding the polypeptide;
[0114] 3) Modification of the amino acid sequence constituting the polypeptide so as to remove or weaken the activity of the polypeptide (e.g., deletion / substitution / addition of one or more amino acids in the amino acid sequence);
[0115] 4) Modification of the gene sequence encoding the polypeptide so as to remove or weaken the activity of the polypeptide (e.g., deletion / substitution / addition of one or more nucleotides on the nucleotide sequence of the polypeptide gene to code for a polypeptide modified so as to remove or weaken the activity of the polypeptide);
[0116] 5) A modification of the nucleotide sequence encoding the start codon or the 5'-UTR region of the gene transcript encoding the polypeptide;
[0117] 6) Introduction of an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to the transcript of the gene encoding the polypeptide;
[0118] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence to the upstream end of the Shine-Dalgarno sequence of a polypeptide-coding gene to form a secondary structure incapable of ribosome attachment;
[0119] 8) Addition of a reverse-transcribed promoter to the 3' end of the ORF (open reading frame) of a gene sequence encoding a polypeptide (Reverse transcription engineering, RTE);
[0120] 9) Regulation of cellular localization of proteins (polypeptides); or
[0121] 10) It may be a combination of two or more selected from 1) to 9) above, but is not specifically limited thereto.
[0122] for example,
[0123] The deletion of part or all of the gene encoding the polypeptide mentioned above 1) may be the removal of the entire polynucleotide encoding the intrinsic target polypeptide within the chromosome, the replacement with a polynucleotide in which some nucleotides have been deleted, or the replacement with a marker gene.
[0124] Additionally, modification of the expression regulatory region (or expression regulatory sequence) described in 2) above may be a deletion, insertion, non-conservative or conservative substitution, or a combination thereof, resulting in a mutation on the expression regulatory region (or expression regulatory sequence), or replacement with a sequence having weaker activity. The expression regulatory region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.
[0125] The modification of the amino acid sequence or polynucleotide sequence of 3) and 4) above may be a sequence variation occurring by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to weaken the activity of the polypeptide, or a replacement with an amino acid sequence or polynucleotide sequence modified to have weaker activity or an amino acid sequence or polynucleotide sequence modified to have no activity, but is not limited thereto. For example, gene expression may be inhibited or weakened by introducing a variation within the polynucleotide sequence to form a stop codon, but is not limited thereto.
[0126] The above 5) modification of the nucleotide sequence encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide may, for example, be a substitution with a nucleotide sequence encoding another start codon that has a lower polypeptide expression rate compared to the intrinsic start codon, but is not limited thereto.
[0127] For the introduction of an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to the transcript of the gene encoding the polypeptide 6) mentioned above, refer to the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].
[0128] 7) Adding a sequence complementary to the Shine-Dalgarno sequence to the front of the Shine-Dalgarno sequence of a polypeptide-coding gene to form a secondary structure in which ribosome attachment is impossible may make mRNA translation impossible or slow it down.
[0129] Reverse transcription engineering (RTE) of a promoter that is transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide above may weaken the activity by creating an antisense nucleotide complementary to the transcript of the gene encoding the polypeptide.
[0130] In addition, the regulation of the intracellular location of the protein (polypeptide) mentioned in 9) above may involve targeting the protein (polypeptide) to a specific intracellular organelle or a specific intracellular space. For example, it may involve targeting to the periplasm or cytoplasm through the addition or removal of a leader sequence that functions for the targeting of the protein (polypeptide), but is not limited thereto.
[0131]
[0132] In this application, the term "enhancement" of the activity of a polypeptide means that the activity of the polypeptide is increased relative to its intrinsic activity. The term enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may include exhibiting activity that was not originally possessed, or exhibiting improved activity compared to the intrinsic activity or activity prior to modification. The statement that the activity of a polypeptide is "enhanced," "up-regulated," "overexpressed," or "increased" relative to its intrinsic activity means that it is improved compared to the activity and / or concentration (expression amount) of a specific polypeptide originally possessed by the parent strain or non-modified microorganism prior to transformation.
[0133] The above enhancement can be achieved by introducing an exogenous polypeptide or by enhancing the activity and / or concentration (expression amount) of the intrinsic polypeptide. Whether the activity of the polypeptide is enhanced can be confirmed by an increase in the activity level, expression amount, or amount of product released from the polypeptide.
[0134] The enhancement of the activity of the above polypeptide may be achieved by applying various methods well known in the art, and is not limited to, as long as the activity of the target polypeptide can be enhanced compared to that of the microorganism before modification. Specifically, it may utilize, but is not limited to, gene engineering and / or protein engineering known to a person skilled in the art, which are routine methods of molecular biology (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
[0135] Specifically, the enhancement of the activity of the polypeptide of the present application is
[0136] 1) Increase in the intracellular copy number of polynucleotides encoding polypeptides;
[0137] 2) Replace the chromosomal gene expression regulatory region encoding a polypeptide with a potent sequence;
[0138] 3) A modification of the nucleotide sequence encoding the start codon or the 5'-UTR region of the gene transcript encoding the polypeptide;
[0139] 4) Modification of the amino acid sequence of the polypeptide to enhance polypeptide activity;
[0140] 5) Modification of the polynucleotide sequence encoding the polypeptide to enhance polypeptide activity (e.g., modification of the polynucleotide sequence of the polypeptide gene to code for a polypeptide modified to enhance polypeptide activity);
[0141] 6) Introduction of an exogenous polypeptide exhibiting polypeptide activity or an exogenous polynucleotide encoding the same;
[0142] 7) Codon optimization of polynucleotides encoding polypeptides;
[0143] 8) Analyze the tertiary structure of the polypeptide to select and modify or chemically modify the exposed sites;
[0144] 9) Regulation of cellular localization of proteins (polypeptides); or
[0145] 10) It may be a combination of two or more selected from 1) to 9) above, but is not specifically limited thereto.
[0146] More specifically,
[0147] The increase in the intracellular copy number of the polynucleotide encoding the above 1) polypeptide may be achieved by introducing into a host cell a vector to which the polynucleotide encoding the said polypeptide is operably linked, which can replicate and function independently of the host. Alternatively, it may be achieved by introducing one or more copies of the polynucleotide encoding the said polypeptide into the chromosomes within the host cell. The introduction into the chromosomes may be performed by introducing into the host cell a vector capable of inserting said polynucleotide into the chromosomes within the host cell, but is not limited thereto. The said vector is as described above.
[0148] Replacing the gene expression regulatory region (or expression regulatory sequence) on the chromosome encoding the polypeptide mentioned in 2) above with a sequence having potent activity may, for example, involve deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to further enhance the activity of the expression regulatory region, or may involve a sequence mutation, or replacement with a sequence having stronger activity. The expression regulatory region may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, the original promoter may be replaced with a potent promoter, but is not limited thereto.
[0149] Examples of known strong promoters include, but are not limited to, CJ1 to CJ7 promoters (US Patent No. 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13(sm3) promoter (US Patent No. 10584338 B2), O2 promoter (US Patent No. 10273491 B2), tkt promoter, yccA promoter, etc.
[0150] The above 3) modification of the nucleotide sequence encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide may, for example, be a substitution with a nucleotide sequence encoding another start codon that has a higher polypeptide expression rate compared to the intrinsic start codon, but is not limited thereto.
[0151] The modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above may be a sequence variation occurring by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide, or a replacement with an amino acid sequence or polynucleotide sequence modified to have stronger activity or an amino acid sequence or polynucleotide sequence modified to increase activity, but is not limited thereto. Specifically, the replacement may be performed by inserting the polynucleotide into the chromosome by homologous recombination, but is not limited thereto. The vector used in this case may additionally include a selection marker to confirm whether the chromosome is inserted.
[0152] The introduction of an exogenous polynucleotide exhibiting the activity of the polypeptide mentioned in 6) above may be the introduction into a host cell of an exogenous polynucleotide encoding a polypeptide that exhibits the same or similar activity as the polypeptide. As long as the exogenous polynucleotide exhibits the same or similar activity as the polypeptide, there are no restrictions on its origin or sequence. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the polypeptide may be generated and its activity increased by the expression of the introduced polynucleotide within the host cell.
[0153] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be a codon optimization of the intrinsic polynucleotide such that transcription or translation increases within the host cell, or a codon optimization of the extrinsic polynucleotide such that optimized transcription or translation occurs within the host cell.
[0154] 8) Analyzing the tertiary structure of the polypeptide above to select and modify or chemically modify an exposed site may, for example, involve determining a template protein candidate based on the degree of sequence similarity by comparing the sequence information of the polypeptide to be analyzed with a database in which sequence information of known proteins is stored, and confirming the structure based on this to select and modify or chemically modify an exposed site.
[0155] In addition, the regulation of the intracellular location of the protein (polypeptide) mentioned in 9) above may involve targeting the protein (polypeptide) to a specific intracellular organelle or a specific intracellular space. For example, it may involve targeting to the periplasm or cytoplasm through the addition or removal of a leader sequence that functions for the targeting of the protein (polypeptide), but is not limited thereto.
[0156] Such enhancement of polypeptide activity may involve increasing the activity or concentration of the corresponding polypeptide based on the activity or concentration of the polypeptide expressed in the wild-type or pre-modification microbial strain, or increasing the amount of the product produced from said polypeptide, but is not limited thereto.
[0157]
[0158] Modification of part or all of a polynucleotide in the microorganism of the present application may be induced by (a) homologous recombination using a vector for chromosome insertion within the microorganism or genome editing using engineered nucleases (e.g., CRISPR-Cas9) and / or (b) treatment by light and / or chemicals such as ultraviolet rays and radiation, but is not limited thereto. The method of modifying part or all of the gene may include methods using DNA recombination technology. For example, deletion of part or all of the gene may be achieved by inducing homologous recombination by injecting a nucleotide sequence or vector containing a nucleotide sequence homologous to the target gene into the microorganism. The injected nucleotide sequence or vector may include a dominant selection marker, but is not limited thereto.
[0159] In the microorganism of the present application, the variant aspartate kinase, polynucleotide, and amino acid, etc., are as described in the other embodiment above.
[0160]
[0161] Another aspect of the present application provides a method for producing amino acids, comprising the step of culturing a microorganism in a medium that comprises the variant aspartate kinase of the present application or a polynucleotide encoding said variant aspartate kinase.
[0162] The amino acid production method of the present application may include the step of culturing a microorganism comprising the variant aspartate kinase of the present application, the polynucleotide of the present application, or the vector of the present application in a medium.
[0163] In this application, the term "culture" means growing the microorganism of this application under appropriately controlled environmental conditions. The culture process of this application may be carried out according to suitable media and culture conditions known in the art. Such a culture process can be easily adjusted and used by those skilled in the art depending on the microorganism selected. Specifically, the culture may be batch, continuous, and / or fed-batch, but is not limited thereto.
[0164] In this application, the term "medium" refers to a substance mixed with nutrients as the main component required to culture the microorganism of this application, and supplies nutrients and growth factors, including water, which is indispensable for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganism of this application may be any medium used for culturing ordinary microorganisms without special limitations; however, the microorganism of this application may be cultured under aerobic conditions while controlling the temperature, pH, etc., in a conventional medium containing a suitable carbon source, nitrogen source, phosphorus, inorganic compounds, amino acids, and / or vitamins.
[0165] Specifically, culture media for microorganisms of the genus Corynebacterium can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981)].
[0166] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvate, lactic acid, citric acid, etc.; and amino acids such as glutamic acid, methionine, lysine, etc. Additionally, natural organic nutrient sources such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane residue, and corn steeping liquid may be used. Specifically, carbohydrates such as glucose and sterilized pre-treated molasses (i.e., molasses converted into reducing sugars) may be used, and other carbon sources in appropriate amounts may be used without limitation. These carbon sources may be used individually or in combination of two or more types, but are not limited thereto.
[0167] The above nitrogen sources may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; and organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc., peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquid, casein hydrolysate, fish or its decomposition products, defatted soybean cake or its decomposition products, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.
[0168] The above ingredients may include monopotassium phosphate, dipotassium phosphate, or corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc., and may also include amino acids, vitamins, and / or suitable precursors. These components or precursors may be added to the culture medium in a batch or continuous manner. However, they are not limited thereto.
[0169] In addition, during the cultivation of the microorganism of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc., may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during cultivation, an antifoaming agent such as fatty acid polyglycol ester may be used to suppress the formation of bubbles. Furthermore, to maintain an aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection to maintain an anaerobic and microaerobic state, but is not limited thereto.
[0170] In the culture of the present application, the culture temperature may be maintained at 20 to 45°C, specifically 25 to 40°C, and culture may be carried out for about 10 to 160 hours, but is not limited thereto.
[0171] The amino acids produced by the culture of the present application may be secreted into the culture medium or remain within the cell. In this case, the said amino acids are as described above.
[0172]
[0173] The amino acid production method of the present application may additionally include, for example, the step of preparing a microorganism of the present application, the step of preparing a medium for culturing said microorganism, or a combination thereof (in any order), prior to the culturing step.
[0174] The amino acid production method of the present application may further include a step of recovering amino acids from a culture medium (a culture medium in which the culture is performed) or a Corynebacterium glutamicum strain. The recovery step may be additionally included after the culture step.
[0175] The above recovery may involve collecting the desired amino acid using a suitable method known in the art according to the culture method of the microorganism of the present application, such as a batch, continuous, or fed-batch culture method. For example, various chromatographs such as centrifugation, filtration, treatment with a crystallizing protein precipitating agent (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC, or a combination thereof may be used, and the desired amino acid may be recovered from the culture medium or microorganism using a suitable method known in the art.
[0176] In addition, the amino acid production method of the present application may additionally include a purification step. The purification may be performed using a suitable method known in the art. In one example, where the amino acid production method of the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed continuously or discontinuously regardless of the order, or simultaneously or integrated into a single step, but are not limited thereto.
[0177] In the method of the present application, the variant aspartate kinase, polynucleotide, vector, strain, and amino acid, etc. are as described in the other embodiments above.
[0178]
[0179] Another aspect of the present application provides a composition for producing amino acids comprising: a variant aspartate kinase of the present application; a polynucleotide encoding said variant aspartate kinase; a microorganism comprising said variant aspartate kinase or said polynucleotide encoding said variant aspartate kinase; a culture of said microorganism; or a combination of two or more of these.
[0180] The composition of the present application may further include any suitable excipients commonly used in compositions for producing L-amino acids, and such excipients may be, for example, preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers, or isotonic agents, but are not limited thereto.
[0181]
[0182] Another aspect of the present application provides a use of a microorganism for amino acid production comprising: a variant aspartate kinase of the present application; a polynucleotide encoding said variant aspartate kinase; or the variant aspartate kinase of the present application or a polynucleotide encoding said variant aspartate kinase.
[0183] The above aspartate kinase, variant aspartate kinase, polynucleotide, vector, strain, medium, and amino acid, etc. are as described in the other embodiments above.
[0184]
[0185] The present application will be explained in more detail below through examples. However, the following examples are merely preferred embodiments for illustrating the present application and are therefore not intended to limit the scope of the rights of the present application. Meanwhile, technical matters not described in this specification can be fully understood and easily implemented by a person skilled in the art who is proficient in the technical field of the present application or a similar technical field.
[0186]
[0187] Example 1: Construction of a recombinant vector for the introduction of a variant aspartate kinase
[0188]
[0189] We constructed vectors to introduce V250L, V258I, and V250L+V258I variants into the lysC gene encoding aspartate kinase in wild-type Corynebacterium glutamicum.
[0190] To construct vectors for introducing each variant, the homologous recombinant A arm and homologous recombinant B arm were amplified using the genome of wild-type Corynebacterium glutamicum ATCC 13869 as a template, and the primer pairs for each variant are as shown in Table 1 below.
[0191]
[0192] Names: Homologous recombinant A arm (5'→3'), Homologous recombinant B arm (5'→3') V250L Sequence Nos. 9 and 10, Sequence Nos. 11 and 12 V258I Sequence Nos. 9 and 13, Sequence Nos. 12 and 14 V250L+V258I Sequence Nos. 9 and 15, Sequence Nos. 12 and 16
[0193] The PCR conditions involved denaturation at 95°C for 5 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute, followed by polymerization at 72°C for 5 minutes. Subsequently, PCR fragments were extracted using a gel purification kit (QIAGEN). The homologous recombinant A arm and B arm gene fragments obtained above were linked to the vector pDC24 (SEQ No. 19), which had been cleaved with BamHI and SalI restriction enzymes, using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix). These were each transformed into E. coli DH5α and plated on LB solid medium containing 25 mg / L of kanamycin. PCR was performed using the primer pair of SEQ ID NOs 17 and 18 to select transformed colonies. Plasmids were obtained from the selected colonies using a commonly known plasmid extraction method, and the obtained plasmids were named pDC24-lysC(V250L), pDC24-lysC(V258I), and pDC24-lysC(V250L+V258I), respectively.
[0194] The primer sequences used here are as shown in Table 2 below.
[0195]
[0196] Sequence number name sequence (5'→3') 9primer 1TCGGTACCCGGGGATCCGTGGCCCCTGGTCGTACAG10primer 2ACTGCTTCTTCCAAAGGAATATCCTCCATAGAGCC11primer 3CCTTTGGAAGAAGCAGTCCTTACCGGTATCGCAAC12primer 4CATGCCTGCAGGTCGACCAGAGAAACAACGCAACGTC13primer 5TTGTCGGTTGCGATACCGGTAAGGACTGCTTCTTCC14primer 6GGTATCGCAACCGACAAGTCCGAAGCCAAAGTAAC15primer 7GGTAAGGACTGCTTCTTCCAAAGGAATATCCTCCATAG16primer 8AGAAGCAGTCCTTACCGGTATCGCAACCGACAAGTCC17primer 9TATTACGCCAGCTGGCGAAA18primer 10GCTTTACACTTTATGCTTCC
[0197]
[0198] Example 2: Evaluation of L-citrulline production capacity
[0199]
[0200] 2-1. Preparation of the Control Group
[0201] To construct a control strain for the L-citrulline production capacity evaluation experiment, a vector was constructed by substituting glutamic acid at protein sequence 47 of argR (ANU33619.1) with a stop codon. Using the genome of wild-type C. glutamicum ATCC 13869 as a template, the homologous recombinant A arm was amplified using the primer pair of SEQ ID NOs 20 and 21, and the homologous recombinant B arm was amplified using the primer pair of SEQ ID NOs 22 and 23. Subsequently, a plasmid was obtained in the same manner as in Example 1, and this plasmid was named pDC24-argR(E47*).
[0202] In addition, a vector was constructed to replace the phenylalanine located at protein sequence 68 of argG (ANU33620.1) with a stop codon. Using the genome of C. glutamicum ATCC13869 as a template, the homologous recombinant A arm was amplified using primers SEQ ID NOs 24 and 25, and the homologous recombinant B arm was amplified using primers SEQ ID NOs 26 and 27. Subsequently, a plasmid was obtained using the method described in Example 1, and this plasmid was named pDC24-argG(F68*).
[0203] The primer sequences used here are as shown in Table 3 below.
[0204]
[0205] Sequence number name sequence (5'→3') 20primer 11CGGTACCCGGGGATCCCTCGTGCGGAATTCGTGGAG21primer 12ATCCAGCAGCAATTCAGACA22primer 13CTGAATTGCTGCTGGATTAAGGCATCGATATCACCCA23primer 14ATGCCTGCAGGTCGACCCTTCATTTTAAGTTCCTTG24primer 15CGGTACCCGGGGATCCTTCATCGATAGGGTGGG25primer 16GTACTCCTCAGCTTACTCATCCTTTGCATCAACA26primer 17AGTAAGCTGAGGAGTACTGCCTGCCAACCATCAA27primer 18ATGCCTGCAGGTCGACCGACTGGCTTGCCACCCT
[0206] Using the constructed pDC24-argR(E47*) vector, wild-type C. glutamicumATCC 13869 was transformed by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and a secondary crossover was performed to obtain a strain in which the 139th nucleotide of argR was replaced from guanine (g) to thymine (t) and the 47th protein sequence was replaced with a stop codon. PCR and sequencing analysis were performed using primer pairs of SEQ ID NOs 20 and 23, which can amplify adjacent regions including the site where the gene was inserted, and the genetic modification was confirmed. The microorganism obtained in this way was named C. gl::argR*.
[0207] Microorganisms were obtained by transforming the above-mentioned C. gl::argR* in the same way using the pDC24-argG(F68*) vector to further delete argG. PCR and sequencing analysis were performed using the primer pair of SEQ ID NOs 24 and 27, which can amplify adjacent regions including the site where the gene was inserted, and the genetic manipulation was confirmed. The microorganisms obtained in this way were named C. gl::argR*_argG*.
[0208]
[0209] 2-2. Production of Variant Aspartate Kinase-Expressing Strains
[0210] In order to produce a mutant strain in which a mutation was introduced into the aspartate kinase based on the C. gl::argR*_argG* strain obtained in Example 2-1 above, the C. gl::argR*_argG* strain was transformed by electroporation using pDC24-lysC(V250L), pDC24-lysC(V258I), and pDC24-lysC(V250L+V258I) of Example 1, and then through a secondary crossover process, a mutant strain in which valine, the 250th amino acid from the N-terminus of the aspartate kinase, was substituted with leucine, a mutant strain in which valine, the 258th amino acid, was substituted with isoleucine, or a strain in which the 250th amino acid was substituted with leucine and the 258th amino acid was simultaneously substituted with isoleucine was obtained. DNA fragments containing the intrachromosomal lysC gene were PCR amplified from the strain genome obtained above using the primer pair of SEQ ID NOs. 9 and 12. The PCR conditions involved denaturation at 95°C for 10 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 10 minutes. Analysis of the nucleotide sequences of the amplified genes confirmed that a mutation was introduced into the nucleotide sequence coding for the 250th and / or 258th amino acid downstream from the ORF start codon of the lysC gene in each strain (Table 4).
[0211]
[0212] Amino acid (base sequence) before substitution Amino acid (base sequence) after substitution 250th Val(GTG)Leu(TTG) 258th Val(GTC)Ile(ATC)
[0213] Accordingly, based on the C. gl::argR*_argG* strain, a mutant strain in which valine, the 250th amino acid from the N-terminus of aspartate kinase, was substituted with leucine, a mutant strain in which valine, the 258th amino acid, was substituted with isoleucine, or a strain in which the 250th amino acid was substituted with leucine and the 258th amino acid was simultaneously substituted with isoleucine was obtained, and the obtained mutant strains were named C. gl::argR*_argG*_lysC(V250L), C. gl::argR*_argG*_lysC(V258I), and C. gl::argR*_argG*_lysC(V250L+V258I), respectively.
[0214]
[0215] 2-3. Evaluation of Citrulline Production Capacity
[0216] The L-citrulline production capacity of the strains C. gl::argR*_argG*_lysC(V250L), C. gl::argR*_argG*_lysC(V258I), and C. gl::argR*_argG*_lysC(V250L+V258I) from Example 2-2 above and the control strain C. gl::argR*_argG* was compared by culturing them in the production medium as described below. Each strain was inoculated into a 250 mL corner-baffle flask containing 25 mL of production medium and cultured at 33°C for 48 hours with shaking at 200 rpm. After the culture was completed, the concentration of citrulline was measured using HPLC, and the results are shown in Table 5 below.
[0217]
[0218] Production Medium
[0219] Raw sugar 50 g, (NH4)2SO4 30 g, yeast extract 1 g, KH2PO4 1.1 g, MgSO4·7H2O 1.2 g, L-arginine 0.2 g, biotin 1 mg, thiamine hydrochloride 5 mg, calcium-pantothenic acid 5 mg, nicotinamide 15 mg, MnSO4 10 mg, FeSO4 10 mg, ZnSO4 0.5 mg, CuSO4 0.5 mg, CaCO3 30 g, pH 7.2 (based on 1 liter of distilled water)
[0220]
[0221] Strain L-Citrline Concentration (g / L) Percentage (%) C. gl::argR*_argG*3.07100 C. gl::argR*_argG*_lysC(V250L)3.35109 C. gl::argR*_argG*_lysC(V258I)3.29107 C. gl::argR*_argG*_lysC(V250L+V258I)3.42111
[0222] As a result, as shown in Table 5 above, the mutant strain in which valine, the 250th amino acid from the N-terminus of aspartate kinase, was substituted with leucine, the mutant strain in which valine, the 258th amino acid, was substituted with isoleucine, or the strain in which the 250th amino acid was substituted with leucine and the 258th amino acid was simultaneously substituted with isoleucine all showed increased citrulline production and yield compared to the control strain C. gl::argR*_argG*.
[0223]
[0224] Example 3: Evaluation of L-Ornithine Production Capacity
[0225]
[0226] 3-1. Preparation of the Control Group
[0227] To construct a control strain for the L-ornithine production capacity evaluation experiment, a vector was constructed by replacing the serine located at protein sequence 55 of ArgF (ANU33618.1) with a stop codon. Using the genome of wild-type C. glutamicum ATCC13869 as a template, the homologous recombinant A arm was amplified using the primer pair of SEQ ID NOs 28 and 29, and the homologous recombinant B arm was amplified using the primer pair of SEQ ID NOs 30 and 31. Subsequently, a plasmid was obtained in the same manner as in Example 1 and named pDC24-argF(S55*).
[0228] In addition, a vector was constructed to replace the glutamic acid located at protein sequence 47 of ArgR (ANU33619.1) with a stop codon. Using the genome of wild-type C. glutamicumATCC 13869 as a template, the homologous recombinant A arm was amplified using the primer pair of SEQ ID NOs 20 and 21, and the homologous recombinant B arm was amplified using the primer pair of SEQ ID NOs 22 and 23. Subsequently, a plasmid was obtained in the same manner as in Example 1, and this plasmid was named pDC24-argR(E47*).
[0229] The primer sequences used here are as shown in Table 6 below.
[0230]
[0231] Sequence number name sequence (5'→3') 20primer 11CGGTACCCGGGGATCCCTCGTGCGGAATTCGTGGAG21primer 12ATCCAGCAGCAATTCAGACA22primer 13CTGAATTGCTGCTGGATTAAGGCATCGATATCACCCA23primer 14ATGCCTGCAGGTCGACCCTTCATTTTAAGTTCCTTG28primer 19CGGTACCGGGGATCCTGACCCCAGGCAAGCACGG29primer 20GAAGCGAGTACGAGTTTAAGTCTTATC30primer 21AAACTCGTACTCGCTTCTCC31primer 22ATGCCTGCAGGTCGACCGGCGCCGGCAACCTCGTC
[0232] Using the constructed pDC24-argF(S55*) vector, wild-type C. glutamicumATCC 13869 was transformed by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and after a second crossover process, microorganisms were obtained in which the 164th nucleotide sequence of argF was substituted from cytosine (c) to adenine (a) and the 55th protein sequence was substituted with a stop codon. PCR and sequencing analysis were performed using primer pairs of SEQ ID NOs 28 and 31, which can amplify adjacent regions including the site where the gene was inserted, and the genetic modification was confirmed. The microorganism obtained in this way was named C. gl::argF*.
[0233] To further delete argR from the C. gl::argF* obtained above, microorganisms were obtained through the transformation described above using the pDC24-argR(E47*) vector. PCR and sequencing analysis were performed using the primer pair of SEQ ID NOs 20 and 23, which can amplify adjacent regions including the site where the gene was inserted, and the argR deletion genetic manipulation was confirmed. The microorganism obtained in this way was named C. gl::argR*_argF*.
[0234]
[0235] 3-2. Production of Variant Aspartate Kinase-Expressing Strains
[0236] In order to produce a mutant strain in which a mutation was introduced into the aspartate kinase based on the C. gl::argR*_argF* strain obtained in Example 3-1 above, the C. gl::argR*_argF* strain was transformed by electroporation using pDC24-lysC(V250L), pDC24-lysC(V258I), and pDC24-lysC(V250L+V258I) of Example 1 above, and then through a secondary crossover process, a mutant strain in which valine, the 250th amino acid from the N-terminus of the aspartate kinase, was substituted with leucine, a mutant strain in which valine, the 258th amino acid, was substituted with isoleucine, or a strain in which the 250th amino acid was substituted with leucine and the 258th amino acid was simultaneously substituted with isoleucine was obtained. DNA fragments containing the intrachromosomal lysC gene were PCR amplified from the strain genome obtained above using the primer pair of SEQ ID NOs. 9 and 12. The PCR conditions involved denaturation at 95°C for 10 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 10 minutes. Analysis of the nucleotide sequences of the amplified genes confirmed that mutations were introduced into the nucleotide sequences encoding the 250th and 258th amino acids downstream from the ORF start codon of the lysC gene in each strain (Table 4).
[0237]
[0238] Accordingly, based on the C. gl::argR*_argF* strain, a mutant strain in which valine, the 250th amino acid from the N-terminus of aspartate kinase, is substituted with leucine, a mutant strain in which valine, the 258th amino acid, is substituted with isoleucine, or a strain in which the 250th amino acid is substituted with leucine and the 258th amino acid is simultaneously substituted with isoleucine were obtained, and the obtained mutant strains were named C. gl::argR*_argF*_lysC(V250L), C. gl::argR*_argF*_lysC(V258I), and C. gl::argR*_argF*_lysC(V250L+V258I), respectively.
[0239]
[0240] 3-3. Evaluation of Ornithine Production Capacity
[0241] The L-ornithine production capacity of the strains C. gl::argR*_argF*_lysC(V250L), C. gl::argR*_argF*_lysC(V258I), and C. gl::argR*_argF*_lysC(V250L+V258I) from Example 3-2 above and the control strain C. gl::argR*_argF* was compared by culturing them in the production medium as described below. Each strain was inoculated into a 250 mL corner-baffle flask containing 25 mL of production medium and cultured at 32°C for 48 hours with shaking at 200 rpm. After the culture was completed, the concentration of ornithine was measured using HPLC, and the results are shown in Table 7 below.
[0242]
[0243] Production Medium
[0244] Raw sugar 50 g, (NH4)2SO4 30 g, yeast extract 1 g, KH2PO4 1.1 g, MgSO4·7H2O 1.2 g, L-arginine 0.2 g, biotin 1 mg, thiamine hydrochloride 5 mg, calcium-pantothenic acid 5 mg, nicotinamide 15 mg, MnSO4 10 mg, FeSO4 10 mg, ZnSO4 0.5 mg, CuSO4 0.5 mg, CaCO3 30 g, pH 7.2 (based on 1 liter of distilled water)
[0245]
[0246] Strain L-ornithine production (g / L) Percentage (%) C. gl::argR*_argF*15.1100 C. gl::argR*_argF*_lysC(V250L)15.8105 C. gl::argR*_argF*_lysC(V258I)15.5103 C. gl::argR*_argF*_lysC(V250L+V258I)15.7104
[0247] As a result, as shown in Table 9 above, all of the mutant strains in which valine, the 250th amino acid from the N-terminus of aspartate kinase, was substituted with leucine, the mutant strain in which valine, the 258th amino acid, was substituted with isoleucine, or the strain in which the 250th amino acid was substituted with leucine and the 258th amino acid was simultaneously substituted with isoleucine showed increased ornithine production and yield compared to the control strain C. gl::argR*_argF*.
[0248]
[0249] Example 4: Evaluation of L-arginine production capacity
[0250]
[0251] 4-1. Preparation of the Control Group
[0252] To evaluate the production capacity of L-arginine, a strain of Corynebacterium glutamicum CJR2 was constructed by introducing ΔargR and argB (M54V) mutations into wild-type Corynebacterium glutamicum ATCC13869 (Ikeda, Masato et al., Applied and environmental microbiology 75(6)1635-41, 2009). First, vectors for introducing argR deletion and argB (M54V) mutations were constructed. Using the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template, PCR was performed using primer pairs of SEQ ID NOs 32 and 33 and SEQ ID NOs 34 and 35, and overlapping PCR was performed using primer pairs of SEQ ID NOs 32 and 35 to obtain homologous recombination fragments containing argR deletion mutation sequences. In the same way, to prepare homologous recombination fragments with argB(M54V) mutations, PCR was performed using primer pairs of SEQ ID NOs. 36 and 37 and SEQ ID NOs. 38 and 39, and overlapping PCR was performed using SEQ ID NOs. 36 and 39. The PCR reaction was performed by repeating denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 2 minutes 28 times, followed by polymerization at 72°C for 5 minutes. The fragments obtained above underwent a purification process, and then a plasmid was obtained by fusion cloning with a pDC24 vector (SEQ ID NO. 19) treated with SmaI restriction enzyme using the In-Fusion® HD Cloning Kit (Clontech) according to the manual. The fabricated vectors were named pDC24-ΔargR and pDC24-argB(M54V), respectively.
[0253] Next, an argR deletion mutation was introduced into wild-type Corynebacterium glutamicum ATCC13869. Transformation was performed using the electro-pulse method with the pDC24-ΔargR plasmid constructed above (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Then, secondary recombination was performed on solid plate media containing 4% sucrose, and PCR was performed as described above on the transformed strain after secondary recombination using the primer pair of SEQ ID NOs. 32 and 35, confirming that a deletion mutation had been introduced into the chromosomal argR gene. The transformed strain was named CJR1.
[0254]
[0255] Solid Plate Medium (pH 7.0)
[0256] Glucose 10 g, Peptone 10 g, Beef extract 5 g, Yeast extract 5 g, Brain Heart Infusion 18.5 g, NaCl 2.5 g, Urea 2 g, Sorbitol 91 g, Agar 20 g (based on 1 liter of distilled water)
[0257]
[0258] The argB(M54V) mutation was introduced into the above Corynebacterium glutamicum CJR1 using the same method as above. The above-constructed pDC24-argB(M54V) plasmid was used, and PCR was performed on the transformed line after the second recombination was completed using the primer pair of SEQ ID NOs 36 and 39 to confirm that the M54V mutation was introduced into the chromosomal argB gene, and the transformed line was named CJR2.
[0259] Based on the produced CJR2 strain, a CJR100 strain was produced with an enhanced N-acetyl-gamma-glutamyl-phosphate reductase (hereinafter argC) gene.
[0260] To enhance the activity of N-acetyl-gamma-glutamyl-phosphorylate reductase argC (NCBI registration number BBD29_RS07530), a plasmid was constructed to enhance argC activity by replacing the wild-type promoter of the argC gene with Po2, using the Po2 promoter (US 10273491 B), which is known as a strong promoter. Specifically, to construct a strain into which argC with the Po2 promoter was introduced, PCR was performed using the chromosomal DNA of Corynebacterium glutamicum ATCC13869 as a template to amplify gene fragments of the upstream region of the argC gene using primers of SEQ ID NO. 40 and SEQ ID NO. 41, and the downstream region of the argC gene using primers of SEQ ID NO. 42 and SEQ ID NO. 43. In addition, Po2 promoter fragments were obtained using SEQ ID NO. 44 and SEQ ID NO. 45 with the synthesized Po2 promoter as a template. Pfu Ultra was used as the polymerase for the PCR reaction. TMHigh-reliability DNA polymerase (Stratagene) was used, and the PCR conditions were denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute, repeated 28 times, followed by polymerization at 72°C for 5 minutes. As a result, an 86 bp DNA fragment of the Po2 promoter region, a 610 bp DNA fragment of Corynebacterium glutamicum ATCC13869 argC upstream, and a 1086 bp DNA fragment of the downstream were obtained, respectively. PCR was performed using primers of SEQ ID NO. 40 and SEQ ID NO. 43 with the amplified promoter and DNA fragments as templates. The PCR conditions were denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; After repeating polymerization at 72°C for 2 minutes 28 times, the polymerization reaction was performed at 72°C for 5 minutes. The two fragments obtained above underwent DNA purification and were then fused with a pDC24 plasmid treated with SmaI restriction enzyme using the In-Fusion® HD Cloning Kit (Clontech). The resulting vector was named pDC24-Po2-argC.
[0261] Next, the previously prepared CJR2 strain was transformed by the electro-pulse method using the pDC24-Po2-argC plasmid prepared above (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Then, secondary recombination was performed on a solid plate medium containing 4% sucrose, and PCR was performed on the transformed strain after secondary recombination using primers of SEQ ID NOs. 40 and 45 to confirm that the chromosomal argC gene was reinforced to a Po2 promoter. At this time, the PCR reaction was performed using the same reinforcement method as above, and the transformed strain obtained in this way was named CJR100.
[0262] The primer sequences used here are as shown in Table 8 below.
[0263]
[0264] Sequence number name sequence (5'→3') 32primer 23TGAATTCGAGCTCGGTACCCCACTGGTGAACTCCTTGTCC33primer 24TTGAACTAGGGGCGCTTTAAAAGTTTTCCGGTGTTGACGG34primer 25CCGTCAACACCGGAAAACTTTTAAAGCGCCCCTAGTTCAA35primer 26GTCGACTCTAGAGGATCCCCCGTTGAACTGCTTGCCAGCC36primer 27TGAATTCGAGCTCGGTACCCTGCGGCTCGCACGGTTGCTC37primer 28ACGGTGCGCAAGAAGACCACGTCGGCAGCAAAAGCAGCCT38primer 29GGCTGCTTTTGCTGCCGACGTGGTCTTCTTGCGCACCGTG39primer 30GTCGACTCTAGAGGATCCCCCTCTTATCAGGCCAATCGGT40primer 31GTGAATTCGAGCTCGGTACCCGCCCCGAAAAGCCGTTAAAAG41primer 32TGCCAAAATTCACGATTATTGCCCACCTACAGCTAAAACTGC42primer 33TTATTGGAGGAGATCAAACAATGACAATCAAGGTTGCAATC43primer 34CAGGTCGGCGTCGCACCTTAAGGGGATCCTCTAGAGTCGACC44primer 35CAATAATCGGTGAATTTTGGCA45primer 36TGTTTTGATCTCCTCCAATAA
[0265]
[0266] 4-2. Production of Variant Aspartate Kinase-Expressing Strains
[0267] In order to produce a mutant strain in which a point mutation was introduced into the aspartate kinase based on the CJR100 strain obtained in Example 4-1 above, the CJR100 strain was transformed by electroporation using pDC24-lysC (V250L), pDC24-lysC (V258I), and pDC24-lysC (V250L+V258I) of Example 1 above, and then through a secondary crossover process, a mutant strain in which valine, the 250th amino acid from the N-terminus of the aspartate kinase, was substituted with leucine, a mutant strain in which valine, the 258th amino acid, was substituted with isoleucine, or a strain in which the 250th amino acid was substituted with leucine and the 258th amino acid was simultaneously substituted with isoleucine was obtained. DNA fragments containing the intrachromosomal lysC gene were PCR amplified from the strain genome obtained above using the primer pair of SEQ ID NOs. 9 and 12. The PCR conditions involved denaturation at 95°C for 10 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 10 minutes. Analysis of the nucleotide sequences of the amplified genes confirmed that mutations were introduced into the nucleotide sequences encoding the 250th and 258th amino acids downstream from the ORF start codon of the lysC gene in each strain (Table 4).
[0268]
[0269] Accordingly, based on the CJR100 strain, a mutant strain in which valine, the 250th amino acid from the N-terminus of aspartate kinase, is substituted with leucine, a mutant strain in which valine, the 258th amino acid, is substituted with isoleucine, or a strain in which the 250th amino acid is substituted with leucine and the 258th amino acid is simultaneously substituted with isoleucine were obtained, and the obtained mutant strains were named CJR100_lysC(V250L), CJR100_lysC(V258I), and CJR100_lysC(V250L+V258I), respectively.
[0270]
[0271] 4-3. Evaluation of Arginine Production Capacity
[0272] The L-arginine production capacity of the CJR100_lysC(V250L), CJR100_lysC(V258I), and CJR100_lysC(V250L+V258I) strains of Example 4-2 above and the control strain CJR100 was compared by culturing them in the production medium as described below. Each strain was inoculated into a 250 mL corner-barrel flask containing 25 mL of production medium and cultured at 32°C for 48 hours with shaking at 200 rpm. After the culture was completed, the concentration of arginine was measured using HPLC, and the results are shown in Table 9 below.
[0273]
[0274] Production Medium
[0275] Raw sugar 50 g, (NH4)2SO4 30 g, yeast extract 1 g, KH2PO4 1.1 g, MgSO4·7H2O 1.2 g, L-arginine 0.2 g, biotin 1 mg, thiamine hydrochloride 5 mg, calcium-pantothenic acid 5 mg, nicotinamide 15 mg, MnSO4 10 mg, FeSO4 10 mg, ZnSO4 0.5 mg, CuSO4 0.5 mg, CaCO3 30 g, pH 7.2 (based on 1 liter of distilled water)
[0276]
[0277] Strain Name L-Arginine Concentration (g / L) Percentage (%) CJR100 5.90 100 CJR100_lysC(V250L) 6.23 106 CJR100_lysC(V258I) 6.17 105 CJR100_lysC(V250L+V258I) 6.21 105
[0278] As a result, as shown in Table 11 above, all of the mutant strains in which valine, the 250th amino acid from the N-terminus of aspartate kinase, was substituted with leucine, the mutant strain in which valine, the 258th amino acid, was substituted with isoleucine, or the strain in which the 250th amino acid was substituted with leucine and the 258th amino acid was simultaneously substituted with isoleucine showed increased arginine production and yield compared to the control strain CJR100.
[0279]
[0280] From the foregoing description, those skilled in the art to which this application pertains will understand that this application may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of this application should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.
Claims
1. A variant aspartate kinase in which the amino acid corresponding to the 250th and / or 258th position in the amino acid sequence of SEQ NO. 1 is substituted with another amino acid.
2. In claim 1, the amino acid corresponding to the 250th position in the amino acid sequence of SEQ ID NO. 1 is substituted with leucine, or The amino acid corresponding to the 258th position in the amino acid sequence of SEQ ID NO. 1 is substituted with isoleucine, or A variant aspartate kinase that is the combination of the above.
3. The variant aspartate kinase according to claim 1, wherein the variant aspartate kinase has at least 80% sequence identity with the amino acid sequence of SEQ ID NO.
1.
4. The variant aspartate kinase according to claim 1, wherein the variant aspartate kinase is composed of the amino acid sequence of SEQ ID NO. 3, SEQ ID NO. 5, or SEQ ID NO.
7.
5. A polynucleotide encoding a variant aspartate kinase of any one of paragraphs 1 to 4.
6. A microorganism comprising a variant aspartate kinase in which the amino acid corresponding to the 250th and / or 258th position in the amino acid sequence of SEQ ID NO. 1 is substituted with another amino acid, or a polynucleotide encoding said variant aspartate kinase.
7. In claim 6, the microorganism is one having increased amino acid production capacity compared to a microorganism comprising a wild-type aspartate kinase having the amino acid sequence of SEQ ID NO. 1 or a polynucleotide encoding said wild-type aspartate kinase.
8. A microorganism according to claim 7, wherein the amino acid is one or more selected from the group consisting of glutamic acid, citrulline, glutamine, ornithine, and arginine.
9. In paragraph 6, the microorganism is a microorganism of the genus Corynebacterium.
10. In paragraph 9, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.
11. A method for producing amino acids, comprising the step of culturing a microorganism in a medium comprising a variant aspartate kinase in which the amino acid corresponding to the 250th and / or 258th position in the amino acid sequence of SEQ ID NO. 1 is substituted with another amino acid, or a polynucleotide encoding said variant aspartate kinase.
12. A method for producing amino acids according to claim 11, wherein the amino acid is one or more selected from the group consisting of glutamic acid, citrulline, glutamine, ornithine, and arginine.
13. A method for producing amino acids according to claim 11, further comprising the step of recovering amino acids from the cultured microorganism, the culture of the microorganism, the fermented product of the microorganism, or the culture medium.
14. A variant aspartate kinase of any one of claims 1 to 4; a polynucleotide encoding said variant aspartate kinase; a microorganism comprising said variant aspartate kinase or said polynucleotide encoding said variant aspartate kinase; a culture of said microorganism; or a combination of two or more of these.
15. A variant aspartate kinase of any one of claims 1 to 4; a polynucleotide encoding said variant aspartate kinase; or a microorganism used for amino acid production comprising said variant aspartate kinase or said polynucleotide encoding said variant aspartate kinase.