Method of treating or retarding the development of a prion or prion-related disease or condition

Abstract

Methods of treating or retarding the development of a prion or prion-related disease or condition in a subject, inhibiting cell surface expression of PrPc (cellular prion protein), and inhibiting replication of PrPSc ( scrapie isoform of the prion protein) using an inhibitor of the oligosaccharyltransferase complex, including inhibitors of STT3A and / or STT3B, and / or a Glycogen Synthase Kinase-3 inhibitor.

Description

DC0592WO PATENT METHOD OF TREATING OR RETARDING THE DEVELOPMENT OF A PRION OR PRION-RELATED DISEASE OR CONDITIONREFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority from U.S. Provisional Application Serial Numbers 63 / 887,642, filed September 25, 2025, and 63 / 730,661, filed December 11, 2024, the contents of which are incorporated herein by reference in their entireties.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (name: DC0592WO_ST26.xml; size: 28,941 bytes; and date of creation: December 4, 2025) is herein incorporated by reference in its entirety.FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT

[0003] This invention was made with government support under grant no. NS125431 awarded by the National Institutes of Health. The government has certain rights in this invention.BACKGROUND OF THE INVENTION

[0004] Prion diseases are fatal neurodegenerative diseases that uniquely occur in inherited, sporadic, and infectious forms. All forms of prion diseases are caused by autocatalytic misfolding of the prion protein ( PrP), a host-encoded glycoprotein. Inherited prion diseases such as familial Creutzfeldt- Jakob disease (fCJD), fatal familial insomnia (FFI ), and Gerstmann-Straussler-Scheinker disease (GSS) are all caused by pathogenic PrP mutations, whereas sporadic and infectious forms of prion disease are caused by the misfolding of normal wild-type PrP (PrPc) into an infectious, scrapie isoform of the prion protein ( PrPSc). Mutant prions from patients with inherited prion diseases can also be infectious;DC0592WO PATENT both FFI and fCJD prions have been experimentally transmitted to normal hosts.

[0005] Non-toxic drug treatments have been shown to prolong lifespan in mice inoculated with scrapie, an infectious form of prion disease. For instance, IND24, a 2-aminothiazole compound, and Anlel38b, a 3, 5-diphenyl-pyrazole (DPP) derivative, both extend scrapie incubation times >2-fold when administered orally immediately after prion inoculation (Heras-Garvin et al. (2019) Movement Disorders 34 (2 ): 255-63; Berry et al. (2013) Proc. Natl. Acad. Sci. USA 110(440:E4160-9; Burke et al. (2020) PLoS Pathog. 16 (5): el008581); and prophylactic subcutaneous administration of polymeric cellulose ether extends scrapie incubation times 4-fold (Teruya et al. (2016) PLoS Pathog. 12(12):e1006045 ). Despite these advances, there are difficulties in treating infectious and sporadic forms of prion diseases. First, wild-type PrPScmolecules can adapt into drug-resistant conformations during treatment, limiting drug efficacy (Berry et al. (2013) Proc. Natl. Acad. Sci. USA 110(440:E4160-9). Remarkably, even combination and alternating chemotherapy regimens cannot prevent the emergence of drug-resistant PrPScmolecules (Burke et al. (2020) PLoS Pathog. 16(5):e1008581; Beauchemin et al. (2021) J. Gen. Virol. 102(12):001705). Second, patients with sporadic and infectious forms of prion disease typically present with neurological symptoms at late clinical stages when the majority of PrPScaccumulation and irreversible neurodegeneration has already occurred. Third, some potential drug treatments appear to be inherently ineffective against specific prion strains (Cronier et al. (2007) J. Virol.81 ( 24 ): 13794-13800).

[0006] On the other hand, inherited prion diseases represent an attractive target for therapeutic intervention. For example, patients with inherited prion disease may be diagnosed by genetic testing many years before the onset ofDC0592WO PATENT clinical symptoms, and therefore treatment for inherited prion disease may be initiated much earlier than for sporadic or infectious forms of prion diseases. Although experiments using genetically engineered CRE-Lox mice have shown that, in principle, the process of neuronal dysfunction during the symptomatic phase of prion disease is reversible if PrPScproduction can be completely halted (Mallucci et al. (2003) Science 302(5646):871-4 ), other studies indicate that antiprion drug therapy is typically more effective if administered before the onset of clinical symptoms (White et al. (2003) Nature 422(6927):80-3). For instance, prophylactic administration of the 2-aminothiazole IND24 to prion-infected animals has been shown to extend lifespan ~4-fold, whereas administration of IND24 1 day after inoculation extended lifespan ~1. 7-fold (Giles et al. (2015) J. Pharmacol. Exp. Therapeut. 355(1):2-12 ).

[0007] In addition, swainsonine, an inhibitor of Golgi a-mannosidase II that causes abnormal N-glycosylation, has been shown to inhibit infection of neuroblastoma-derived N2a-PK1 cells by prion strains RML, 79A and 22F, but less so by prion strain 139A, and not at all by 22L prions. However, swainsonine does not diminish propagation of any of these strains in fibroblastic LD9 cells or central nervous system (CNS) -derived CAD5 cells. Other inhibitors of N-glycosylation, kifunensine and castanospermine, which inhibit a-mannosidase I and a-glucosidase, respectively, also inhibit prion infection in both a strain-specific and cell-specific manner (Browning et al. (2011) J. Biol. Chem. 286(47):40962-73).

[0008] Although inhibitors of prion diseases have been suggested, new therapeutic treatments are needed to treat the various strains and forms of prion disease including inherited, sporadic, and infectious forms of prion disease. The present invention meets this need in the art.DC0592WO PATENT SUMMARY OF THE INVENTION

[0009] This invention provides, in part, a method of treating or retarding the development of a prion or prion-related disease or condition, comprising administering to a subject in need of treatment an effective amount of an oligosaccharyltransferase (OST) complex and / or a Glycogen Synthase Kinase-3 (GSK3) inhibitor thereby treating or retarding the development of a prion or prion-related disease or condition in the subject.

[0010] Also provided are methods of inhibiting cell surface expression of PrPc(cellular prion protein) and inhibiting replication of PrPSc(scrapie isoform of the prion protein), comprising contacting a cell expressing PrPcwith an effective amount of at least one OST complex and / or GSK3 inhibitor.BRIEF DESCRIPTION OF DRAWINGS

[0011] FIG. 1 is a schematic of the CAD5 KO library screening for identifying genes involved in surface expression of PrPc.

[0012] FIGS. 2A-2C show protease-resistant PrPScas determined by the western blot analysis (FIG. 2A) and quantification of bands thereof ( FIGS. 2B-2C) of PrPScprotein isolated from CAD5 cells chronically infected with the RML mouse prion strain treated with either kifunensine (FIGS. 2A and 2B) or NGI-1 (FIGS. 2A and 2C).

[0013] FIGS. 3A-3C show protease-resistant PrPScas determined by the western blot analysis (FIG. 3A) and quantification of bands thereof ( FIGS. 3B-3C) of PrPScprotein isolated f rom CAD5 cells chronically infected with the 22L mouse prion strain treated with either kifunensine (FIGS. 3A and 3B) or NGI-1 (FIGS. 3A and 3C).

[0014] FIGS. 4A-4C show protease-resistant PrPScas determined by the western blot analysis (FIG. 4A) and quantification of bands thereof (FIGS. 4B-4C) of PrPScprotein isolated from CAD5 cells infected with the Hyper Hamster prion strain treatedDC0592WO PATENT with either kifunensine ( FIGS. 4A and 4B) or NGI-1 (FIGS. 4A and 4C).

[0015] FIGS. 5A-5C show protease-resistant PrPScas determined by the western blot analysis ( FIG. 5A) and quantification of bands thereof (FIGS. 5B-5C) of PrPScprotein isolated from CAD5 cells infected with the 263K Hamster prion strain treated with either kifunensine (FIGS. 5A and 5B) or NGI-1 ( FIGS. 5A and 5C).

[0016] FIGS. 6A-6C show the effect of NGI-1 on PrPScload in non-dividing cells that are chronically infected with mouse or human prions. FIG. 6A, Western blot showing the loss of PK- resistant PrPScin the lysates from non-dividing moPrP RK13 cells chronically infected with 22L prions. Cells were cultured in the presence of 1 μg / mL doxycycline for duration of experiment to induce PrP expression unless otherwise indicated. Cells were treated with 10 μM NGI-1 or DMSO equivalent for one week with no splitting. Biological triplicates are shown for each condition. FIGS. 6B-6C, Log SD50S per mg tissue of RT-QuIC seeding activity from human sC JD-inf ected cerebral organoids treated therapeutically with 10 μM NGI-1 or DMSO for 30 days (FIG. 6B) or (FIG. 6C) 60 days. Each data point represents the log SD50 from an individual organoid calculated by performing endpoint dilutions, each dilution tested in quadruplicate. Asterisks represent significance values from one-way ANOVA as follows: *p < 0.05, **p < 0.01, ns = not significant.

[0017] FIGS. 7A-7C show the effect of GSK3 inhibitor laduviglusib on PrPcsurface expression and total PrPcexpression in CAD5 cells. FIG. 7A, Quantification of flow cytometry PrPcsurface expression in undifferentiated CAD5 cells. Cells were treated with 10 μM laduviglusib or DMSO vehicle control in the culture media for 48 hours. FIG. 7B, Quantification of flow cytometry PrPcsurface expression in differentiated CAD5 cells. Cells were differentiated byDC0592WO PATENT removing serum from culture media for 4 days, then treated with 10 μM laduviglusib or DMSO vehicle equivalent (vol / vol) in the absence of serum for 48 hours. FIG. 7C, Western blot showing the effect of laduviglusib treatment on total PrPclevels (- PIPLC lanes) and internal PrPclevels (+ PIPLC lanes) in undifferentiated CAD5 cells.

[0018] FIGS. 8A-8B show the effects of GSK3 inhibitors laduviglusib and AZD1080 on PrPScload in CAD5 cells chronically infected with mouse prions or hamster prions. FIG.8A, Western blot showing the loss of PK-resistant PrPScin the lysates from CAD5 cells chronically infected with hamster Hyper prions or mouse 22L prions after laduviglusib treatment. Cells were treated with 10 μM laduviglusib or DMSO vehicle equivalent (vol / vol) in the culture media for 6 days. FIG. 8B, Western blot showing the loss of PK-resistant PrPScin the lysates from CAD5 cells chronically infected with hamster Hyper prions or mouse 22L prions after AZD1080 treatment. Cells were treated with 5 μM AZD1080, 10 μM AZD1080, or DMSO vehicle equivalent (vol / vol ) in the culture media for 72 hours.

[0019] FIG. 9 shows the effects of siRNA-mediated knockdown of GSK3A and / or GSK3B on total PrPclevels in undifferentiated CAD5 cells. Western blots show the reduction in total GSK3A and GSK3B (upper panel) and PrPc(middle panel), as compared to the control protein, beta-tubulin (lower panel), in the lysates of undifferentiated CAD5 cells after siRNA knockdown of GSK3A, GSK3B, or GSK3A and GSK3B in combination. Cells were transfected with siRNAs twice for a total time of 7 days before lysis. All blots were produced by stripping and relabeling the same PVDF membrane.DETAILED DESCRIPTION OF THE INVENTION

[0020] Prion diseases are caused by the misfolding of a normal cellular prion protein (PrPc) into an abnormal shape calledDC0592WO PATENT PrPSc. PrPcis expressed on the outer surface of brain cells and contains two linkages to glycans (complex sugars). Production, proper folding, and trafficking to the cell surface of PrPcis needed for conversion into the disease-causing PrPScshape. It has now been found that members of the oligosaccharyltransf erase (" OST") complex, localized in the endoplasmic reticulum (ER) of eukaryotic cells, are responsible for the N-linked glycosylation of PrPcand regulate expression of PrPcon the surface of neuronal-like cells. Treatment of prion-infected cells with an inhibitor of OST lowered PrPclevels on the surface of cells by >50% and completely removed PrPScfrom cells infected with four different types ( strains) of prions. In addition, treatment of prion-infected cells with a glycogen synthase kinase 3 (GSK3) inhibitor lowered PrPclevels on the surface of cells by >70% and removed PrPScfrom the infected cells.

[0021] Accordingly, the present disclosure provides a method of treating or retarding the development of a prion or prion- related disease or condition in a subject in need thereof by administering to the subject an effective amount of an N- glycosylation pathway inhibitor, in particular an OST complex inhibitor, and / or a GSK3 inhibitor. As used herein, a "prion or prion-related disease or condition" refers to a transmissible spongiform encephalopathy (TSE) associated with the accumulation of PrPScin the central nervous system (CNS), which is accompanied by neuropathologic changes and neurological dysfunction. "prpsc«or(-he "scrapie isoform of the prion protein, " is considered necessary and sufficient for the transmission and pathogenesis of these transmissible neurodegenerative diseases of animals and humans. In the "protein-only" hypothesis, prion replication comes about by PrPSc-directed conversion of PrPcto PrPSc. "prPc" refers to the native cellular prion protein, which is naturally and widely expressed within mammals, is sensitive to proteaseDC0592WO PATENT degradation, and is not associated with a disease state, PrPccontains a highly conserved structure composed of three a- helices and little β-sheet structure. PrPcis attached to the outer surface of the plasma membrane by a glycosylphosphatidylinositol anchor and may carry two, one, or no asparagine-linked glycans (e.g., at positions 181 and 197 of PrPc), of which there are 52 or more variants. PrPSchas the same amino acid sequence as PrPc, but has converted some of the a-helix to p-sheet, is protease resistant, and is associated with a disease state.

[0022] Specific examples of prion or prion-related diseases or conditions that may be treated in accordance with the method herein include, but are not limited to, scrapie, which affects sheep and goats; bovine spongiform encephalopathy (BSE), which affects cattle; transmissible mink encephalopathy, feline spongiform encephalopathy and chronic wasting disease (CWD) of mule deer, white-tailed deer, black-tailed deer and elk and other rare TSEs of captive and experimental animals. In humans, prion or prion-related diseases or conditions may include, but are not limited to, kuru, Creutzfeldt- Jakob disease (CJD), Gerstmann-Straüssler-Scheinker Syndrome (GSS), fatal insomnia, and variant Creutzfeldt- Jakob disease (vCJD). A subject in need of treatment may be diagnosed based on the occurrence of clinical signs of the disease and may include, but are not limited to, neurological issues such as difficulty walking, jerking muscle movements, loss of coordination and balance problems; mental decline as evidenced by rapidly developing dementia, confusion, and difficulty thinking and judging; personality changes such as becoming easily upset or agitated, paranoia, and unusual emotional responses; communication problems such as difficulty speaking, slurred speech, and talking less; insomnia and trouble sleeping; and other issues such as visual problems, hallucinations, muscle stiffness, fatigue, and loss of appetite.DC0592WO PATENT

[0023] As used herein, "treatment, " "treating" or grammatical variations thereof, refers to an approach for obtaining beneficial or desired results with respect to a disease, disorder, or medical condition including, but not limited to, a therapeutic benefit. In some aspects, "treatment" or "treating" involves administering a compound or composition disclosed herein to a subject. A therapeutic benefit may include the eradication or amelioration of the underlying disease or condition being treated and / or amelioration of one or more symptoms of the disease or condition.

[0024] As used herein, "retarding the development of" a prion or prion-related disease or condition means delaying, hindering, slowing down, stabilizing and / or postponing the development of the disease or condition. This delay may be of varying periods of time, depending on the disease, history of the disease, and / or the individual being treated. As is evident to a specialist in the field, a sufficient or significant delay may effectively include prevention, because the individual does not develop the disease. Subjects benefiting from such treatment include those that may have been exposed to prion-infected animal-derived food or health products intended for animal or human consumption or applications, prion-infected human or bovine blood transfusion products, or prion-infected organs for organ transplantation or subjects diagnosed as having one or more mutations in the human prion protein gene, which result in the disease form of the protein, e. g., mutations at codons 102, 105, 117, 178, and / or 129. A method that "retards the development of" a prion or prion-related disease or condition is a method that reduces the probability of disease development in a given time frame and / or that reduces the extent of the disease in a given time frame, compared to not using the method. Such comparisons may be based on clinical studies, using a statistically significant number of subjects.DC0592WO PATENT

[0025] The term "preventing" is art-recognized, and when used in relation to a prion or prion-related disease or condition, is well understood in the art, and includes administration of a composition which reduces the frequency of, or delays the onset of, symptoms of a prion or prion-related disease or condition in a subject relative to a subj ect that does not receive the composition.

[0026] To effect treatment, an effective amount of an endoplasmic reticulum-mediated N-glycosylation pathway inhibitor, in particular an oligosaccharyltransferase (OST) complex inhibitor and / or a GSK3 inhibitor is provided or administered to a subject or contacted with a cell as described herein. The inhibitor may prevent, reduce, or inhibit cell surface expression of PrPc; prevent, reduce, or inhibit replication or conversion of PrPcto PrPSc; and / or prevent, reduce, or inhibit polymerization of PrPScby inhibiting N- linked glycosylation of PrPcthereby inhibiting attachment of the glycosylphosphatidylinositol anchor to PrPcand / or inhibiting attachment of PrPcto the outer surface of the plasma membrane.

[0027] In humans, the " OST complex" refers to a heterooligomeric structure composed of seven subunits including two ribophorin I proteins, OST48, DADI, STT3, Ost4 and N33 / Tusc3. The membrane protein STT3 (EC 2. 4. 99.18 ) is a highly conserved subunit of the oligosaccharyltransferase and contains the active site of the complex. STT3 transfers oligosaccharides onto the asparagine residues of sequons (N-X-T / S / C) in nascent glycoproteins. The two alternate STT3 proteins, STT3A (UniProtKB / Swiss-Prot: P46977) and STT3B (UniProtKB / Swiss-Prot: Q8TCJ2) are widely expressed in a variety of human tissues and are encoded by different genes. STT3A and STT3B exist in distinct OST complexes, possess different kinetic properties, and have different substrate preferences, in spite of their partially overlapping roles in glycosylation. WhileDC0592WO PATENT the STT3A complex generally promotes co-translational glycosylation, the STT3B complex generally promotes post- translational glycosylation.

[0028] As used herein, the terms " OST complex inhibitor, " "inhibitor of OST complex, " " OST inhibitor, " or "inhibitor of OST" includes any agent that inhibits or antagonizes at least one of the proteins and / or subunits of the OST complex. Examples of agents that may be used as inhibitors include, but are not limited to small molecules, nucleic acids, proteins or peptides, and antibodies or antigen binding fragments thereof. In some aspects, OST complex inhibitors such as small molecules may be identified, for example, using a biochemical assay testing the enzymatic activity of recombinant human proteins and / or protein subunits of the OST complex.

[0029] In some aspects, an OST complex inhibitor may be a STT3A / STT3B inhibitor. As used herein, the terms " STT3A / STT3B inhibitor" and "inhibitor of STT3A / STT3B" includes any agent that inhibits or antagonizes at least one of the STT3A and / or STT3B subunits. Examples of agents that may be used as inhibitors include, but are not limited to small molecules, nucleic acids, proteins or peptides, and antibodies or antigen binding fragments thereof. Such inhibitors may reduce the expression and / or activity of STT3A and / or STT3B in a cell. Small molecule STT3A / STT3B inhibitors may be identified using a biochemical assay testing the enzymatic activity of recombinant human STT3A and / or STT3B.

[0030] In some aspects, the STT3A / STT3B inhibitor is a small molecule STT3A / STT3B inhibitor. In some aspects, the STT3A / STT3B inhibitor is a proteinaceous STT3A / STT3B inhibitor. In some aspects, the STT3A / STT3B inhibitor is an anti-STT3A and / or anti-STT3B antibody or antigen binding fragment thereof. In some aspects, the STT3A / STT3B inhibitor is a nucleic acid.DC0592WO PATENT

[0031] In some aspects, STT3A / STT3B inhibition results in at least about a 10% decrease {e. g., at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% decrease) in STT3A / STT3B expression and / or activity. In some aspects, after a STT3A / STT3B inhibitor is contacted with cells, STT3A / STT3B expression and / or activity is inhibited in at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or about 100% of the cells.

[0032] In some aspects, an OST complex inhibitor is a small molecule OST complex inhibitor. In some aspects, a small molecule OST complex inhibitor may include a small molecule STT3A / STT3B inhibitor disclosed, for example, in Rinis et al. (2018 ) Cell Chem. Biol. 25 ( 10): 1231-1241; Puschnik et al. (2017 ) Cell Reports 21: 3032-3039; Lopez-Sambrooks et al. (2016) Nat. Chem. Biol. 12: 1023-1030; Lampson et al. (2024 ) Cell 187 ( 9): P2209-2223; and / or WO 2017 / 019540.

[0033] In some aspects, a small molecule OST complex inhibitor for use in the methods described herein may include, e. g.,5- (N, N- Dimethyl sulfamoyl ) -N- ( 5-methy-lthiazol-2-yl) -2- (pyrrolidin-l-yl ) benzamide,5- (dimethylsulfamoyl) -N- (4-methyl-l, 3-thiazol-2-yl) -2-pyrrolidin-l-ylbenzamide,5- (dimethylsulfamoyl) -2-pyrrolidin-l-yl-N- ( 1, 3-thiazol-2-yl ) benzamide,5- (dimethyl sulfamoyl ) -N- (5-methyl-l, 3, 4-triadiazol-2- yl) -2-pyrrolidin-l-ylbenzamide,5- (dimethylsulfamoyl) -N- (5-methyl-lH-l, 2, 4-triazol-3-yl) -2-pyrrolidin-l-ylbenzamide,N- ( 1, 3-benzothiazol-2-yl ) -5- (dimethyl sulfamoyl ) -2-pyrrolidin-1-ylbenzamide,DC0592WO PATENT 5- (dimethylsulfamoyl) -N- ( 4 -methoxy- 1, 3-benzothiazol-2- yl) -2-pyrrolidin-l-ylbenzamide,5- (dimethylsulfamoyl) -N- (5-methoxy-l, 3-benzothiazol-2- yl) -2-pyrrolidin-l-ylbenzamide,5- (dimethylsulfamoyl) -N- ( 6-methoxy-l, 3-benzothiazol-2- yl) -2-pyrrolidin-l-ylbenzamide,5- (dimethylsulfamoyl) -N-pyridin-3-yl-2-pyrrolidin-l- ylbenzamide,5- (dimethylsulfamoyl) -N--pyridin-4-yl"2“pyrrolidin-l- ylbenzamide,5- (dimethylsulfamoyl) -N-phenyl-2-pyrrolidin-l- ylbenzamide,5- (dimethylsulfamoyl) -N- ( 2-methylphenyl ) -2-pyrrolidin-l- ylbenzamide,5- (dimethylsulfamoyl) -N- (4-methylphenyl ) -2-pyrrolidin-l- ylbenzamide,5- (dimethylsulfamoyl ) -N- ( 2 -methoxyphenyl ) -2-pyrrolidin- l-ylbenzamide,5-(dimethylsulfamoyl)-N-(4-methoxyphenyl) -2-pyrrolidin- l-ylbenzamide,5- (dimethylsulfamoyl) -N- (2-fluorophenyl) -2-pyrrolidin-l-ylbenzamide,5- (dimethylsulfamoyl) -N- ( 3-f luorophenyl ) -2-pyrrolidin-l-ylbenzamide,5- (dimethylsulfamoyl) -N- ( 2-chlorophenyl ) -2-pyrrolidin-l- ylbenzamide,5-(dimethylsulfamoyl)-N-(4-bromophenyl) -2-pyrrolidin-l-ylbenzamide,N, N-dimethyl-3- (morpholine-4-carbonyl) -4-pyrrolidin-l-ylbenzenesulf onamide,N-cyclohexyl-5- (dimethylsulfamoyl) -2-pyrrolidin-l- ylbenzamide,5- (dimethylsulfamoyl ) -N, N-dimethyl -2-pyrrolidin-l- ylbenzamide,DC0592WO PATENT 5- (dimethylsulfamoyl ) -N- (5-methyl-l, 3-thiazol-2-yl) -2-pyrro lidin- 1-ylbenzamide,5- (diethylsulfamoyl) -N- (5-methyl-l, 3-thiazol-2-yl) -2-pyrrolidin-l-ylbenzamide,N- (5-methyl-l, 3-thiazol-2-yl) -2-pyrrolidin-l-yl-5-pyrrolidin-l-yl sulfonylbenzamide,N- (5-methyl-l, 3-thiazol-2-yl ) -2-piperidine-l-yl-5-pyrrolidin-l-yl sulfonylbenzamide,N- (5-methyl-l, 3-thiazol-2-yl ) -2-morpholin-l-yl-5-pyrrolidin-l-ylsulfonylbenz amide,N- ( 5-methyl-l, 3-thiazol-2-yl ) -2-piperazin-l-yl-5-pyrro lidin- 1-yl sulfonyl benz amide,5- [methyl (phenyl) sulfamoyl] -N- ( 5-methyl-l, 3-thiazol-2-yl) -2-pyrrolidin-l-ylbenzamide,5- (benzylsulfamoyl) -N- (5-methyl-l, 3-thiazol-2-yl ) -2-pyrrolidin-l-ylbenzamide,5- (dimethylsulfamoyl) -N- (5-methyl-l, 3-thiazol-2-yl) -2-pyrro lidin- 1-ylbenzamide,5- (dimethylsulfamoyl) -N- (5-methyl-l, 3-thiazol-2-yl) -2-piperidin- 1-ylbenzamide,2- (azetidin-l-yl) -5- (dimethylsulfamoyl) -N- ( 5-methyl-l, 3-thiazol-2-yl) benzamide,5- (dimethylsulfamoyl) -N- ( 5-methyl-l, 3-thiazol-2-yl) -2-piperaz in- 1-ylbenzamide,2- (dimethylamino) -5- (dimethylsulfamoyl) -N- ( 5-methyl-l, 3-thiazol-2-yl) benzamide,2- (diethylamino) -5- (dimethylsulfamoyl) -N- (5-methyl-l, 3-thiazol-2-yl ) benzamide,2-cyclopentyl-5- (dimethylsulfamoyl ) -N- ( 5-methyl-l, 3- thiazol-2-yl) benzamide,3- (dimethylsulfamoyl) -N- ( 5-methyl-l, 3-thiazol-2-yl ) benzamide, or(E)-N- [ (2S, 3R, 4R, 5R, 6R) -2- [(2R,3R, 4R, 5S, 6R) -3-acetamido-4, 5-dihydroxy-6- (hydroxymethyl ) oxan-2-yl] oxy-6- [2-DC0592WO PATENT [(2R,3S,4R,5R) -5- ( 2, 4-dioxopyrimidin-l-yl) -3, 4-dihydroxyoxolan-2-yl] -2-hydroxyethyl] -4, 5-dihydroxyoxan-3- yl] -5-methylhex-2-enamide, or a pharmaceutically acceptable salt, analog, or prodrug of any one of the above-referenced compounds.

[0034] In some aspects, an OST complex inhibitor for use in the methods described herein may include NGI-1 or an analog, pharmaceutically acceptable salt, or prodrug thereof. As used herein, NGI-1 (also known as ML414 ) has the following structure:

[0035] In some aspects, an OST complex inhibitor for use in the methods described herein may include an analog of NGI-1 having the following structure:DC0592WO PATENTDC0592WO PATENTor a pharmaceutically acceptable salt, analog, or prodrug of any one of the above-referenced compounds.

[0036] In some aspects, an OST complex inhibitor of use in the methods herein is tunicamycin.

[0037] In some aspects, the methods herein provide for the use of an inhibitor that inhibits both STT3A and STT3B. In accordance with methods herein providing for inhibition of both STT3A and STT3B, the methods may include the use of NGI-1, or a pharmaceutically acceptable salt, analog, or prodrug thereof.

[0038] In some aspects, the methods herein provide for the use of an inhibitor that selectively inhibits STT3A, without substantially inhibiting STT3B, e. g., the inhibitor has an IC50 value for SST3A that is at least 2-fold lower or preferably at least 10-fold lower ( e. g., at least 10-, 15-, 20-, 25-, 30-, 35-, 40-, 45-, 50-, 55-, 60-, 65-, 70-, 75-, 80, 85-, 90-, 95-, 100-fold lower) than the IC50 value for SST3B. InDC0592WO PATENT accordance with methods herein providing for selective inhibition of STT3A, the methods may include the use of an NGI-1 analog having any one of the following structures:or a pharmaceutically acceptable salt, analog, or prodrug of any one of the above-referenced compounds.

[0039] In some aspects, the methods herein provide for the use of an inhibitor that selectively inhibits STT3B, without substantially inhibiting STT3A, e. g., the inhibitor has an IC50 value for SST3B that is at least 2-fold lower or preferably at least 10-fold lower ( e. g., at least 10-, 15-, 20-, 25-, 30-, 35-, 40-, 45-, 50-, 55-, 60-, 65-, 70-, 75-, 80, 85-, 90-, 95-, 100-fold lower) than the IC50 value for SST3A. InDC0592WO PATENT accordance with methods herein providing for selective inhibition of STT3B, the methods may include the use of a compound having any one of the following structures:or a pharmaceutically acceptable salt, analog, or prodrug of any one of the above-referenced compounds. See also Rinis et al. (2018 ) Cell Chem. Biol. 25 (10 ): 1231-1241.DC0592WO PATENT

[0040] In some aspects, the methods herein provide for the use of an inhibitor that selectively inhibits STT3A in combination with an inhibitor that selectively inhibits STT3B.

[0041] In some aspects, an OST complex inhibitor may be a proteinaceous inhibitor. In some aspects, an STT3A / STT3B inhibitor is an anti-STT3A and / or anti-STT3B antibody or antigen binding fragment thereof. In some aspects, an anti- STT3A and / or anti-STT3B antibody may include, for example, the antibodies disclosed in Cherepanova et al. ( 2016) Sci. Reports 6: 20946.

[0042] In some aspects, an OST complex inhibitor may be a nucleic acid-based inhibitor. In some aspects, an STT3A / STT3B inhibitor is an siRNA targeting STT3A and / or STT3B. In some aspects, an siRNA targeting STT3A may include, for example, an siRNA having the sequence TACCCTTTGGGACGAATCATTGG (SEQ ID NO: 1), GGTAAGGTGGTACGTGACGATGG (SEQ ID NO: 2 ), or ATACCCATATTTCTCGAGTAGGG (SEQ ID NO: 3). In some aspects, an siRNA targeting STT3B may include, for example, an siRNA having the sequence CGCCGCCTTGTGCGCGCACTGGG (SEQ ID NO: 4 ), CTGAGCATCAACCTACGACTTGG (SEQ ID NO: 5), or CACTCCACGGGGACGAGTTGAGG (SEQ ID NO: 6). See also, e. g., Cherepanova et al. (2016) Sci. Reports 6: 20946.

[0001] " Glucagon Synthase Kinase 3" or " GSK3" refers to a highly conserved and ubiquitously expressed serine / threonine kinase that phosphorylates proteins containing clustered serine or threonine residues that are separated by 4 amino acids. In mammals, including humans, GSK-3 exists as two isozymes encoded by two homologous genes GSK-3a (GSK3A) and GSK-3(3 (GSK3B). Although GSK3 was originally identified as a kinase that phosphorylates glycogen synthase, subsequent studies have demonstrated that it has broader range of substrates including [3-catenin, tau, myelin basic protein, cyclin DI, GATA4, c-jun, c-myc, CREB, initiation factor eIF2B, heat shock factor-1, and p53. Through the phosphorylation ofDC0592WO PATENT this diverse set of substrates, GSK3 regulates embryonic development and proliferative responses in adult tissues, and is implicated in several human disease states including tumorigenesis, Alzheimer ' s disease, and diabetes.

[0043] Examples of agents that may be used as inhibitors of GSK3 include, but are not limited to, small molecules, nucleic acids, proteins or peptides, and antibodies or antigen binding fragments thereof. In some aspects, GSK3 inhibitors such as small molecules may be identified, for example, using a biochemical assay testing the enzymatic activity of recombinant human proteins.

[0044] In some aspects, a GSK3 inhibitor may be a GSK3A / GSK3B inhibitor. As used herein, the terms " GSK3A / GSK3B inhibitor" and "inhibitor of GSK3A / GSK3B" includes any agent that inhibits or antagonizes at least one of GSK3A and / or GSK3B. Examples of agents that may be used as inhibitors include, but are not limited to small molecules, nucleic acids, proteins or peptides, and antibodies or antigen binding fragments thereof. Such inhibitors may reduce the expression and / or activity of GSK3A and / or GSK3B in a cell. Small molecule GSK3A / GSK3B inhibitors may be identified using a biochemical assay testing the enzymatic activity of recombinant human GSK3A and / or GSK3B.

[0045] In some aspects, the GSK3A / GSK3B inhibitor is a small molecule GSK3A / GSK3B inhibitor. In some aspects, the GSK3A / GSK3B inhibitor is a proteinaceous GSK3A / GSK3B inhibitor. In some aspects, the GSK3A / GSK3B inhibitor is an anti-GSK3A and / or anti-GSK3B antibody or antigen binding fragment thereof. In some aspects, the GSK3A / GSK3B inhibitor is a nucleic acid.

[0046] In some aspects, GSK3A / GSK3B inhibition results in at least about a 10% decrease (e. g., at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% decrease) in GSK3A / GSK3B expression and / or activity. In some aspects, afterDC0592WO PATENT a GSK3A / GSK3B inhibitor is contacted with cells, GSK3A / GSK3B expression and / or activity is inhibited in at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or about 100% of the cells.

[0047] In some aspects, a GSK3A / GSK3B inhibitor is a small molecule GSK3A / GSK3B inhibitor. In some aspects, a small molecule GSK3A / GSK3B inhibitor for use in the methods described herein may include, e. g., laduviglusib ( CHIR-99021 or CT99021; CAS No. 252917-06-9 ), SB 216763 (CAS No. 280744- 09-4 ), TWS119 (CAS No. 601514 -19-6), LY2090314 (CAS No.603288-22-8 ), Cromolyn (CAS No. 16110-51-3 ), AR-A014418 (CAS No. 487021-52-3 ), 9-ING-41 (CAS No. 1034895-42-5 ), SB415286 (CAS No. 264218-23-7 ), CHIR-98014 (CAS No. 252935- 94-7 ), Tideglusib (CAS No. 865854-05-3 ), TDZD-8 (CAS No. 327036-89- 5 ), AZD1080 ( CAS No. 612487 -72-6 ), 1-Azakenpaullone ( 1-Akp; CAS No. 676596-65-9 ), AZD2858 (CAS No. 486424-20- 8 ), IM-12 (CAS No. 1129669-05-1 ), Cazpaullone (CAS No. 914088 - 64-5 ), and / or BIO-Acetoxime (CAS No. 667463-85- 6 ), or a pharmaceutically acceptable salt, analog, or prodrug of any one of the above-referenced compounds.

[0048] In some aspects, a GSK3A / GSK3B inhibitor for use in the methods described herein may include laduviglusib or an analog, pharmaceutically acceptable salt, or prodrug thereof. As used herein, laduviglusib has the following structure:

[0049] In some aspects, the methods herein provide for the use of an inhibitor that inhibits both GSK3A and GSK3B. In accordance with methods herein providing for inhibition ofDC0592WO PATENT both GSK3A and GSK3B, the methods may include the use of laduviglusib, SB 216763, LY2090314, CHIR-98014, Tideglusib, AZD1080, AZD2858, BIO-Acetoxime, Cazpaullone, or a pharmaceutically acceptable salt, analog, or prodrug thereof.

[0050] In some aspects, the methods herein provide for the use of an inhibitor that selectively inhibits GSK3A, without substantially inhibiting GSK3B, e. g., the inhibitor has an IC50 value for GSK3A that is at least 2-fold lower or preferably at least 10-fold lower ( e. g., at least 10-, 15-, 20-, 25-, 30-, 35-, 40-, 45-, 50-, 55-, 60-, 65-, 70-, 75-, 80, 85-, 90-, 95-, 100-fold lower) than the IC50 value for GSK3B. In accordance with methods herein providing for selective inhibition of GSK3A, the methods may include the use of SB415286, or a pharmaceutically acceptable salt, analog, or prodrug of the above-referenced compound.

[0051] In some aspects, the methods herein provide for the use of an inhibitor that selectively inhibits GSK3B, without substantially inhibiting GSK3A, e. g., the inhibitor has an IC50 value for GSK3B that is at least 2-fold lower or preferably at least 10-fold lower ( e. g., at least 10-, 15-, 20-, 25-, 30-, 35-, 40-, 45-, 50-, 55-, 60-, 65-, 70-, 75-, 80, 85-, 90-, 95-, 100-fold lower) than the IC50 value for GSK3A. In accordance with methods herein providing for selective inhibition of GSK3B, the methods may include the use of TWS119, Cromolyn, AR-A014418, 9-ING-41, TDZD-8, 1-Akp, and / or IM-12, or a pharmaceutically acceptable salt, analog, or prodrug of any one of the above-referenced compounds.

[0052] In some aspects, the methods herein provide for the use of an inhibitor that selectively inhibits GSK3A in combination with an inhibitor that selectively inhibits GSK3B.

[0053] In some aspects, a GSK3 inhibitor may be a protein inhibitor. In some aspects, a GSK3 inhibitor is an anti-GSK3A and / or anti-GSK3B antibody or antigen binding fragment thereof. In some aspects, a GSK3 inhibitor may be an inhibitoryDC0592WO PATENT peptide such as L803-mts (CAS No. 706785-93-5 ) or L807 -mts. See, e. g., WO 2014 / 207743 A2.

[0054] In some aspects, an GSK3 inhibitor may be a nucleic acid-based inhibitor. In some aspects, an GSK3 inhibitor is an siRNA targeting GKS3A and / or GSK3B. Sequences of GSK3a siRNA duplexes may include, e. g., 5 ' -GUACUACCGUGCUCCAGAATT-3 ' ( forward; SEQ ID NO: 7 ); 5 ' -UUCUGGAGCACGGUAGUACTT-3 ' (reverse; SEQ ID NO:8 ); 5 ' -CGUGACAGCGGGAAGGUGATT-3 ' ( forward; SEQ ID NO: 9 ); 5 ' -UCACCUUCCCGCUGUCACGTT-3 ' ( reverse; SEQ ID NO: 10 ); 5 ' -GAUUACACCUCGUCCAUCGTT-3 ' ( forward; SEQ ID NO: 11 ); 5 ' - CGAUGGACGAGGUGUAAUCTT-3 ' ( reverse; SEQ ID NO: 12 ); 5 ' - GUGGUCGGCUGGCUGUGUATT-3 ' ( forward; SEQ ID NO:13 ); and / or 5 ' - UACACAGCCAGCCGACCACTT-3 ' ( reverse; SEQ ID NO: 14 ). Sequences of GSK3β siRNA duplexes may include, e. g., 5 ' - GGACCCAAAUGUCAACUATT-3 ' ( forward; SEQ ID NO: 15 ); 5 ' - UAGUUUGACAUUUGGGUCCTT-3 ' ( reverse; SEQ ID NO: 16 ); 5 ' - CCACAGGAAGUCAGUUAUATT-3 ' ( forward; SEQ ID NO: 17 ); 5 ’ - UAUAACUGACUUCCUGUGGTT-3 ' ( reverse; SEQ ID NO: 18 ); 5 ' - UCAGAAGUCUAGCCUAUAUTT-3 ' ( forward; SEQ ID NO: 19 ); 5 ' - AUAUAGGCUAGACUUCUGATT-3 ' ( reverse; SEQ ID NO: 20 ); 5 ' - GAUUACACGUCCAGUAUAGTT-3 ' ( forward; SEQ ID NO:21 ); and / or 5 ' - CUAUACUGGACGUGUAAUCTT-3 ' ( reverse; SEQ ID NO: 22 ). See also, e. g., Ma et al. ( 2017 ) Front. Mol. Neurosci. 10:391.

[0055] The term "pharmaceutically acceptable salt" refers to salts derived from a variety of organic and inorganic counter ions well known in the art. Pharmaceutically acceptable acid addition salts can be formed with inorganic acids and organic acids. Pharmaceutically acceptable base addition salts can be formed with inorganic and organic bases.

[0056] An "analog" refers to a molecule that has a similar chemical structure to another molecule, but with a slight difference in one or more atoms or functional groups, essentially meaning it is a chemically related compound withDC0592WO PATENT a comparable structure but not identical to the original molecule.

[0057] Compounds described herein may also exist in prodrug form. Since prodrugs are known to enhance numerous desirable qualities of pharmaceuticals, e. g., solubility, bioavailability, manufacturing, etc., compounds of use in the methods herein may, if desired, be delivered in prodrug form. Prodrugs of a compound may be prepared by modifying functional groups present in the compound in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to the parent compound. Accordingly, prodrugs include, for example, compounds described herein in which a hydroxy, amino, or carboxy group is bonded to any group that, when the prodrug is administered to a patient, cleaves to form a hydroxy, amino, or carboxylic acid, respectively. For example, a compound having a hydroxy group may be administered as an ester that is converted by hydrolysis in vivo to the hydroxy compound. Suitable esters that may be converted in vivo into hydroxy compounds include acetates, citrates, lactates, phosphates, tartrates, malonates, oxalates, salicylates, propionates, succinates, fumarates, maleates, methylene-bis-[3-hydroxynaphthoate, gentisates, isethionates, di-p-toluoyltartrates, methane-sulfonates, ethane-sulf onates, benzenesulfonates, p-toluene-sulfonates, cyclohexylsulfamates, quinates, esters of amino acids, and the like.

[0058] The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.DC0592WO PATENT

[0059] The OST complex inhibitors, STT3A / STT3B inhibitors, and / or GSK3 inhibitors, described herein may be used in the preparation of medicaments for the treatment or retardation of the development of a prion or prion-related disease or condition. In addition, a method for treating or retarding the development of a prion or prion-related disease or condition described herein in a subject in need of such treatment involves administration of pharmaceutical compositions containing at least one compound described herein, or a pharmaceutically acceptable salt, pharmaceutically acceptable prodrug, or pharmaceutically acceptable solvate thereof, in therapeutically effective amounts to said subject.

[0060] In some aspects, an OST complex inhibitor and / or GSK3 inhibitor used herein is brain-permeable. The term "brain- permeable" refers to the ability of a drug to cross the blood brain barrier. In some embodiments, animal pharmacokinetic (pK) studies, such as mouse pharmacokinetic / blood-brain barrier studies, may be used to determine or predict brain permeability. For example, various concentrations of a compound, or pharmaceutical composition containing the same, may be administered and various pK properties are measured in an animal model. In some aspects, dose-related plasma and brain levels are determined. In some aspects, good brain permeability refers to a brain / plasma ratio of >2, >5, or >10. In other aspects, good brain penetration is about 0. 1%, about 1%, more than 5%, more than about 10%, and preferably about 15% of the dose that crosses the blood brain barrier after a given period of time.

[0061] A composition, e. g., a pharmaceutical composition, containing at least one OST complex inhibitor ( e. g., an STT3A / STT3B inhibitor) and / or at least one GSK3 inhibitor described herein may be administered for prophylactic and / or therapeutic treatments. In therapeutic applications, the composition may be administered to a patient already sufferingDC0592WO PATENT from a prion or prion-related disease or condition, in an amount sufficient to cure or at least partially arrest the symptoms of the disease or condition. Amounts effective for this use may depend on the severity and course of the disease or condition, previous therapy, the patient ' s health status, weight, and response to the drugs, and the judgment of the treating physician.

[0062] In prophylactic applications, a composition, e. g., a pharmaceutical composition containing the at least one OST complex inhibitor (e. g., a STT3A / STT3B inhibitor) and / or at least one GSK3 inhibitor described herein may be administered to a patient susceptible to or otherwise at risk of developing a prion or prion-related disease or condition. Such an amount is defined to be a "prophylactically effective amount or dose." In this use, the precise amounts may also depend on the patient ' s state of health, weight, previous therapy, the patient ' s health status and response to the drugs, and the judgment of the treating physician.

[0063] In some aspects, the present disclosure provides a method treating or retarding the development of a prion or prion-related disease or condition described herein in a subj ect in need of such treatment comprising administering at least one OST complex inhibitor, e. g., at least one STT3A / STT3B inhibitor, and / or at least one GSK3 inhibitor to the subj ect in need thereof. In some aspects, the disease is an inherited, sporadic, or infectious form of a prion disease. In some aspects, the method comprises administering a therapeutically effective amount of the OST complex inhibitor and / or the GSK3 inhibitor. In some aspects, the subject is a mammal. In some aspects, the subj ect is a human.

[0064] In some aspects, the present disclosure provides a method of inhi bi ting cell surface expression of PrPc, comprising contacting a cell expressing PrPcwith an effective amount of an OST complex inhibitor and / or GSK3 inhibitor. AsDC0592WO PATENT used herein, "cell surface expression of PrPc" refers to the detectable presence of PrPcon the outer surface of the plasma membrane. In some aspects, contact of a cell expressing PrPcwith an effective amount of an OST complex inhibitor and / or GSK3 inhibitor provides for at least about a 10% decrease ( e. g., at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% decrease) in cell surface expression of PrPcas compared to a cell that has not been contacted with the OST complex inhibitor and / or GSK3 inhibitor. The presence and / or amount of PrPcon the outer surface of the plasma membrane may be determined by conventional methods, e. g., western blot analysis, immunohistochemical staining, fluorescent activated cell sorting, and the like. In some aspects, cell surface expression of PrPcis determined by further contacting the cell with PrPScand determining whether replication of PrPScoccurs. Low or no replication of PrPScis indicative of a decrease or no cell surface expression of PrPc.

[0065] As demonstrated herein, OST complex inhibition and / or GSK3 inhibition blocks cell surface expression of PrPcthereby inhibiting the replication of PrPSc. Accordingly, another aspect of the present disclosure provides a method of inhibiting replication of PrPSc, comprising contacting a cell expressing PrPcwith an effective amount of an OST complex inhibitor and / or GSK3 inhibitor. In some aspects, contact of a cell expressing PrPcwith an effective amount of an OST complex inhibitor and / or GSK3 inhibitor provides for at least about a 10% decrease (e. g., at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% decrease) in conversion or replication of PrPScas compared to a cell that has not been contacted with the OST complex inhibitor and / or GSK3 inhibitor. The presence and / or amount of PrPScmay be determined by conventional methods, e. g., western blot analysis, immunohistochemical staining, fluorescent activatedDC0592WO PATENT cell sorting, and the like. In some aspects, the PrPScis an inherited, sporadic, or infectious form of PrPSc.

[0066] In some aspects, a cell expressing PrPcmay be a cell of the central nervous system. In some aspects, a cell expressing PrPcmay be a brain cell. In some aspects, the cell is an mammalian cell. In some aspects, the cell is a human cell. In some aspects, a cell expressing PrPcmay be a neuron, including a postmitotic neuron, glial cell or astrocyte. In some aspects, the cell may endogenously express PrPc. In some aspects, the cell may express a recombinant PrPc. In some aspects, the cell may express a mutant PrPc. In some aspects, the cell may express a PrPcprotein having a mutation at codon 102, 105, 117, 178, and / or 129. In some aspects, the cell may be transiently or chronically infected with PrPSc.

[0067] In some aspects, the present disclosure provides a pharmaceutical composition comprising at least one OST complex inhibitor, e. g., at least one STT3A / STT3B inhibitor, and / or at least one GSK3 inhibitor and at least one pharmaceutically acceptable excipient. The phrase "pharmaceutically acceptable excipient" or "pharmaceutically acceptable carrier" as used herein means a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not inj urious to the patient.

[0068] An OST complex inhibitor and / or GSK3 inhibitor may be formulated in any suitable pharmaceutical formulation. A pharmaceutical formulation of the present disclosure typically contains an active ingredient (e. g., an OST complex inhibitor and / or GSK3 inhibitor), and one or more pharmaceutically acceptable excipients or carriers, including but not limited to, inert solid diluents and fillers, diluents, sterile aqueous solution and various organic solvents, permeationDC0592WO PATENT enhancers, antioxidants, solubilizers, and adjuvants. Preparations for such pharmaceutical composition are well- known in the art. See, e. g., Anderson et al., eds., Handbook of Clinical Drug Data, Tenth Edition, McGraw-Hill, 2002; Pratt & Taylor, eds., Principles of Drug Action, Third Edition, Churchill Livingston, New York, 1990; Katzung, ed., Basic and Clinical Pharmacology, Ninth Edition, McGraw Hill, 2003; Goodman & Gilman, eds., The Pharmacological Basis of Therapeutics, Tenth Edition, McGraw Hill, 2001; Remington 's Pharmaceutical Sciences, 20th Ed., Lippincott Williams & Wilkins, 2000; Martindale, The Extra Pharmacopoeia, Thirty- Second Edition (The Pharmaceutical Press, London, 1999).

[0069] In some aspects, a pharmaceutical compositions may be intended for parenteral, topical, oral or local administration. In some aspects, a pharmaceutical compositions may be administered parenterally, for example, intravenously, subcutaneously, intradermally, intranasally or intramuscularly. In some aspects, a pharmaceutical compositions may be administered locally, e. g., intracranially or intracerebrally. In some aspects, a pharmaceutical compositions may be provided in a suitable dosage form including, e. g., tablets, capsules, suppositories, gels, creams, ointments, lotions, solutions / suspensions for inj ection ( e. g., depot ), aerosols for inhalation and solutions / suspensions for oral ingestion. Thus, provided herein are compositions for administration that comprise a solution of the agents described above dissolved or suspended in an acceptable carrier, e. g., an aqueous carrier. A variety of aqueous carriers may be used, for example, water, buffered water, 0. 4% saline, 0.3% glycine, hyaluronic acid, fibrin sealant and the like. These compositions may be sterilized by conventional, well-known sterilization techniques, or may be sterile filtered. The resulting aqueous solutions may be packaged for use as is, or lyophilized, the lyophilizedDC0592WO PATENT preparation being combined with a sterile solution prior to administration. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, wetting agents and the like, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, etc.

[0070] For solid compositions, conventional nontoxic solid carriers may be used which include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like. For oral administration, a pharmaceutically acceptable nontoxic composition may be formed by incorporating any of the normally employed excipients, such as those carriers previously listed, and generally approximately 1% to 95% of active ingredient, e. g., at a concentration of approximately 25% to 75%.

[0071] For aerosol administration, a compound described herein may be supplied in finely divided form along with a surfactant and propellant. The surfactant must, of course, be nontoxic, and soluble in the propellant. Representative of such agents are the esters or partial esters of fatty acids containing from 6 to 22 carbon atoms, such as caproic, octanoic, lauric, palmitic, stearic, linoleic, linolenic, olesteric and oleic acids with an aliphatic polyhydric alcohol or its cyclic anhydride. Mixed esters, such as mixed or natural glycerides may be employed. A carrier may also be included, as desired, as with, for example, lecithin for intranasal delivery.

[0072] In some aspects, the OST complex inhibitor and / or GSK3 inhibitor is selectively delivered to the brain. As used herein, "selective delivery to the brain" or "selectively delivered to the brain" is intended to mean that the agent is administeredDC0592WO PATENT directly to the brain of the subj ect ( e. g., by a shunt or catheter; see, e. g., U. S. Patent Application No. 20080051691 ), to the perispinal space of the subj ect without direct intrathecal inj ection ( see, e. g., U. S. Patent No. 7, 214, 658 ), or in a form which facilitates delivery across the blood brain barrier thereby reducing potential side effects associated with OST complex inhibition and / or GSK3 inhibitor in other organs or tissues. In some aspects, formulation of the OST complex inhibitor and / or GSK3 inhibitor into a nanoparticle made by polymerization of a monomer ( e. g., a methylmethacrylate, polylactic acid, polylactic acid-polyglycolic acid-copolymer, or polyglutaraldehyde) in the presence of a stabilizer may allow passage of the blood brain barrier without affecting other organs with the OST complex inhibitor and / or GSK3 inhibitor. See, e. g., U. S. Patent No. 7, 402, 573, incorporated herein by reference in its entirety. Furthermore, an exemplary system for selectively delivering siRNAs to the brain is the Adeno- Associated Virus (AAV) vector system. See, e. g., Cearley & Wolfe (2007 ) J. Neurosci. 27 ( 37 ): 9928-9940.

[0073] It has been shown that exosomes ( i. e., natural transport nanovesicles in the range of 40-100 nm), which express Lamp2b fused to the neuron-specific rabies viral glycoprotein (RVG) peptide, can deliver siRNA specifically to neurons, microglia and oligodendrocytes in the brain, thereby resulting in specific gene knockdown (Alvarez-Erviti, et al. ( 2011 ) Nature Biotechnol. 29: 341-345 ). Accordingly, in one aspect, an OST complex inhibitor and / or GSK3 inhibitor is delivered to the brain via an exosome, in particular an exosome modified with a moiety that targets cells of the brain. Exosomes of use herein may be prepared by conventional methods, see, e. g., Sun, et al. ( 2010 ) Mol. Ther. 18: 1606-1614. Li kewise, therapeutic agents may be encapsulated within exosomes by conventional methods, e. g., incubating the therapeutic agent with an exosome preparation in saline at room temperature forDC0592WO PATENT several minutes, and separating the exosomes from unencapsulated drug and debris, e. g., by sucrose gradient separation. As described in the art, moieties that target cells of the brain include peptides that target cells of the brain (e. g., neurons, microglia and / or oligodendrocytes) as well as other targeting agents such as lipopolysaccharide, which has a high affinity for surface markers on microglia (Chow, et al. (1999 ) J. Biol. Chem. 274: 10689-10692 ). Targeting peptides include, e. g., the RVG peptide, which may be fused to membrane bound proteins, e. g., Lamp2b (Lysosome- associated membrane protein 2b) to facilitate integration into the exosome. Moreover, when the agent is a nucleic acid (e. g., siRNA or miRNA), the targeting peptide may be fused with a polyarginine peptide (e. g., nine D-arginines) so that the nucleic acid is electrostatically bound to the targeting moiety. In addition to using exosomes for delivery of the compositions, one of skill would understand that untargeted or brain-targeted liposome has been used successfully to facilitate delivery of the siRNA or small molecule inhibitors to brain tissue (Pardridge (2007 ) Adv. Drug Deliv. Rev. 59: 141- 152; Pulford et al. (2010) PLoS ONE 5: e11085). As a result, some aspects of the methods herein include the use of liposomes that are either targeted or untargeted.

[0074] In another aspect, an OST complex inhibitor and / or GSK3 inhibitor may be delivered intranasally via an exosome. Curcumin or Stat3 inhibitor, JSI-124 ( cucurbitacin I ), delivered via exosomes to the brain via the nasal route have been shown to accumulate in microglia and inhibit lipopolysaccharide (LPS ) -induced microglial cell activation, delay experimental autoimmune encephalomyelitis (EAE) disease, and inhibit tumor growth in vivo (Zhuang, et al. (2011) Mol. Ther. 19: 1769-17 9). It is posited that transport occurs along the olfactory pathway and likely involves extracellular bulk flow along perineuronal and / or perivascularDC0592WO PATENT channels, which allows for delivering drugs directly to the brain parenchyma. Delivery along the extraneuronal pathway is likely not receptor-mediated and requires only minutes for a drug to reach the brain; whereas delivery via an intraneuronal pathway along the primary olfactory sensory neurons involves axonal transport and requires several days for the drug to reach different areas of the brain. Therefore, in some aspects, an OST complex inhibitor and / or GSK3 inhibitor as described herein is delivered to the brain by encapsulation within exosomes and intranasal administration.

[0075] A 1, 2-distearoyl-sn-glycero-3-phosphoethanolamine-N- [amino (polyethylene glycol) -2000] (DSPE-PEG2000)- and phosphatidylcholine (PC) -based nanoparticle has been shown to incorporate a high concentration of ACAT1 inhibitor, provide a high level of ACAT1 inhibitor in the blood, enter the CNS, and inhibited ACAT1 in the brain significantly for a long time (longer than 8 hours) ( see, e. g., WO 2022 / 115207 Al ). Thus, in some aspects, an OST complex inhibitor and / or GSK3 inhibitor is encapsulated in a DSPE-PEG2000- and phosphatidylcholine-based nanoparticle.

[0076] The following non-limiting examples are provided to further illustrate the present invention.Example 1: Materials and Methods

[0002] Cell lines and cell culture. CAD5 and HEK293FT cell lines were kindly provided by Charles Weissmann (Scripps Florida, Jupiter, FL) and Michael Cole (Geisel School of Medicine at Dartmouth, Lebanon, NH), respectively.

[0003] CAD5 cells were maintained in OPTI-MEM™ I Reduced-Serum Media with GLUTAMAX™ (Gibco, Waltham, MA) supplemented with 10% HYCLONE™ Bovine Growth Serum (BGS) (Cytiva, Marlborough, MA) and IX penicillin / streptomycin (Corning, Corning, NY).DC0592WO PATENT

[0004] HEK293FT cells were cultured in IMDM (Gibco) supplemented with 10% HYCLONE™ Fetal Bovine Serum (FBS) (Cytiva), 6 mM L-glutamine (Corning), and IX non-essential amino-acids (MilliporeSigma, Burlington, MA) for the first 24 hours following thawing. After 24 hours, G418 (MilliporeSigma) was added to the growth medium to a final concentration of 500 pg / mL. Cell lines were maintained at 37°C, 5% CO2.

[0005] Cell lines were routinely monitored for mycoplasma contamination using the LOOKOUT® Mycoplasma PCR Detection Kit (Sigma-Aldrich, St. Louis, MO, USA).

[0006] Plasmids. All plasmids were obtained from Addgene (Cambridge, MA). Mouse Brie CRISPR knockout in lentiGuide-Puro pooled library was a gift from David Root and John Doench (Addgene). LentiCas9-Blast was a gift from Feng Zhang (Addgene) and lentiGuide-Puro was a gift from Feng Zhang (Addgene). pMD2. G was a gift from Didier Trono (Addgene) and psPAX2 was a gift from Didier Trono (Addgene).

[0007] Antibodies and reagents. Blasticidin and puromycin were purchased from Gibco (Thermo Fisher Scientific, Waltham, MA), IX phosphate-buff ered saline ( PBS) without calcium or magnesium was obtained from Corning; polybrene was obtained as a 10 mg / mL stock from MilliporeSigma.

[0008] The primary antibodies used in this paper were: anti- PrP 6D11 (mouse monoclonal, 1: 20, 000) (Covance), anti-CD59: PC (recombinant rabbit monoclonal, 2. 5 pL per IxlO6cells) (Sino Biological). Rat anti-mouse IgG2a: PE ( 1 pL per 1x10scells) (Thermo Fisher) was used as a secondary antibody.

[0009] Generation of Cas9-expressing CAD5 monoclonal lines. HEK293FT cells were used for lentiviral packaging of LentiCas9-Blast. HEK293FT cells were seeded in 6-well plate (Corning) to achieve 80% confluence on the day of transfection. Media was changed 1 hour before transfection to media containing 2 mM caffeine (Sigma-Aldrich, St. Louis, MO). Transfection was performed using 1 pg lentiCas9-Blast, 3 pLDC0592WO PATENT LIPOD293™ (Signagen, Rockville, MD), and the plasmids pMD2. G and psPAX. The next day, the media was changed to include 2% FBS and 2 mM caffeine. The following day, the supernatant was collected and 0.45 pM filtered (MilliporeSigma).

[0010] The resulting lentiCas9-blast lentiviral stock was used immediately to transduce a 100 mm plate of wild-type CAD5 cells with 10 pg / mL polybrene. The following day, viruscontaining media was replaced with complete media and cells were allowed to recover. Blasticidin selection occurred for the next 6 days, with the addition of media containing 5 pg / mL blasticidin every other day (total of 3 treatments ). Individual clones were ringed and grown out as monoclonal lines.

[0011] Amplification of pooled lentiviral library. The Mouse Brie CRISPR knockout pooled library plasmid library was amplified in ENDURA™ electrocompetent cells per the manufacturer' s protocol (Lucigen, Middleton, WI ). Library was electroporated two times and recovery reactions were rotated at 250 rpm for 1 hour at 37 °C. Transformations were pooled and a dilution plate was prepared to calculate transformation efficiency and ensure that each sgRNA construct was represented at least 50x in the amplified library. Aliquots ( 1 mL) of the pooled reactions were plated on 4 x 500cm2LB-Ampicillin ( 100 pg / mL) agar bioassay plates (Thermo Fisher Scientific, Waltham, MA). Plates were incubated at 32 °C for 14 hours. Colonies were harvested by washing each plate with 15 mL LB medium twice using a cell scraper and pooled. Endotoxin Free Plasmid Maxi Kit (Qiagen, Germantown, MD) was used to isolate DNA per the manufacturer' s protocol. Next generation sequencing was used to check for sgRNA representation and evenness.

[0012] Lentivirus production in HEK293FT cells. HEK293FT cells were seeded 24 hours before transfection in 15-cm plates to allow for ~60% confluence on the day of transfection. MediumDC0592WO PATENT containing G418 was removed 30 minutes before transfection and replaced with 25 mL of IMDM supplemented with 10% FBS, 6 mM L-glutamine, and lx non-essential amino acids (transfection medium), with 12.5 pg Brie library DNA, 7.5 pg psPAX2, and 5pg pMD2. G and gently vortexed. LIPOD293™ (Signagen) (75 pL) was added to 1.25 mL of the transfection medium and gently vortexed. This diluted LIPOD293™ was immediately added to the DNA mixture, gently vortexed, and incubated for 10 minutes at room temperature. The L IPO 0293™ / DNA mixture was added slowly to the cells with swirling for distribution, then incubated for 24 hours at 37 °C, 5% CO2. The medium was then replaced with IMDM supplemented with 2% FBS, 6 mM L-glutamine, lx non- essential amino acids, and 2 mM caffeine and incubated for an additional 24 hours. Lentiviral particles were harvested by filtration through a 0. 45-pm filter and concentrated lOx using AMICON® Ultra-15 lOkDa Centrifugal Filter units (MilliporeSigma).

[0013] Lentivirus titering and transduction into wild-type CAD5 cells. The Brie CRISPR knockout pooled library was designed to target 19, 674 genes in total. Within the library, each gene is targeted by up to four unique sgRNAs. One copy of the library was defined as a 500-fold representation per sgRNA, so a copy of the library was approximately 40 million cells. During culture, passage, and cryopreservation, no fewer than 1 copy with 500-fold representation was always maintained to protect representation.

[0014] CAD5 wild-type cells were seeded 24 hours before transduction in 6-well plates (Corning) to allow for ~60% confluence on the day of transduction. Serial dilutions (5-fold) of lentiviral particles ranging from 10"1to 5"3were prepared in growth medium containing 8 pg / mL polybrene and 2 mL of the diluted lentiviral particles were added to the cells. After 24 hours, virus and polybrene-containing medium was replaced with growth medium. After 24 hours, selection wasDC0592WO PATENT initiated by addition of puromycin ( 3.5 pg / mL final concentration) to the growth medium. Medium was replaced every 48 hours with fresh medium containing 3. 5 pg / mL puromycin for a total of 5 days.

[0015] The lentivirus titer was calculated using the formula: Titer = ( (number of cells remaining after puromycin selection) x (dilution f actor ) ) / (volume of diluted lentivirus used) = transduction units / mL - TU / mL

[0016] A monoclonal line of CAD5 cells constitutively expressing Cas9 were seeded in 150 mm plates 24 hours before transduction to allow for -60% confluence on the day of transduction. Cells were transduced with lentivirus at an MOI of 0.3 in the presence of 8 pg / mL polybrene. The total number of cells that were transduced ensured 500x representation of each single-guide RNA (sgRNA) construct in the Brie library. The medium was replaced with growth medium after 24 hours of incubation at 37 °C, 5% CO2, and 24 hours later, 3. 5 pg / mL puromycin was added for selection of transduced cells. Cells were grown under selection for 5 days with medium renewal every 48 hours. CRISPR / Cas9-modif ied CAD5 cells were expanded, and to ensure maintenance of adequate representation, library cells were frozen down at 1000x-1500x representation of each sgRNA construct in the library. Library was stored in liquid nitrogen until use. Genomic DNA was extracted from 4 x 107cells (500x representation) using the Blood and Cell Culture DNA Midi Kit (Qiagen) to check the library for sgRNA representation through next generation sequencing, as detailed below.

[0017] FACS for cell surface PrP°. For each replicate in the genome-wide screen, library was thawed at 1000x-1500x representation and cultured for 1 week to allow for recovery from freeze / thaw. For undifferentiated screens, the day before screening, a minimum of 4 x 107CAD5 CRISPR / Cas9 KO library cells were counted and seeded for growth overnight. ForDC0592WO PATENT differentiated screens, a minimum of 4 x 107cells were plated to achieve -60% confluence the next day. The following day, cells were gently rinsed 2X with PBS, and medium was replaced with DMEM: F12 containing 50 ng / mL sodium selenite (protein- free media, PFM). Cells were cultured in PFM for a total of 4 days, with a media refresh at 48 hours. In both the undifferentiated and differentiated screens, the day of sorting, cells were gently rinsed IX with PBS, lifted with CellStripper (Corning), and transferred to a tube containing an equal volume of complete growth medium. 4 x 107cells were aliquoted into one tube and three additional aliquots of 1 x 106cells each were used for staining controls. Cells were spun at 150 x g for 5 minutes at room temperature. The pellet was resuspended in PBS supplemented with 2% FBS (staining buffer). Spinning and resuspension were repeated once more to ensure removal of all media and lifting agent.

[0018] 4 x 107library cells were suspended in 5 mL staining buffer and stained with anti-PrP (6D11) antibody at a 1: 20, 000 dilution. Cells were next stained with rat anti-mouse IgG2a: PE antibody at a concentration of 1 pL of stock antibody per 1 x 106cells. Finally, cells were stained with anti-CD59: APC antibody at a concentration of 2.5 pL stock antibody per 1 x 106cells. Each sequential staining step included at 45-minute incubation at 4 °C in the dark with brief vortexing every 15 minutes. Following each antibody incubation step, cells were pelleted at 150 x g for 5 minutes at 4 °C, then resuspended in 10 mL staining buffer. The spin and rinse steps were repeated for a total of three spins, and the final resuspension volume was 5 mL staining buffer, except for the final resuspension pre-sorting, which was 3 mL. Cells were filtered through a 40-micron cell strainer (Falcon Plastics, Brookings, SD) and stored in the dark, on ice, until sorting.

[0019] A FACSAria III Cell Sorter (BD Biosciences, Franklin Lakes, NJ, USA) with a 70 pM nozzle and 488 nm and 635 nmDC0592WO PATENT excitation lasers was used for FACS. For each replicate, 4 x 107viable cells were sorted at a rate of approximately 3000 events / sec. Cells were gated based first on FSC and SSC characteristics to isolate single cells. Next, cells were gated based on CD59 (APC) fluorescence (middle 90% fluorescence), then subgated based on PrP ( PE) fluorescence. Cells within the lowest 20% and highest 20% PrP fluorescence were collected and called " PrP Low" and " PrP High", respectively. Selection with this gating strategy yielded approximately 4 x 106output cells in each subset (PrP Low and PrP High) per screening replicate, which were immediately processed for genomic DNA extraction.

[0020] Sequencing and analysis of sgRNA enrichment. Genomic DNA was isolated from cells collected via FACS using the Blood and Cell Culture DNA Midi Kit (Qiagen) per manufacturer' s instructions. Three subsequent rounds of PCR were performed to amplify the gDNA region containing the sgRNA lentiviral cassette, to attach Illumina sequencing adaptors and barcodes, and to clean up PCR products.

[0021] All PCR reactions were performed using Q5 Hot Start High Fidelity 2x Master Mix (NEB, Ipswich, MA) as per manufacturer' s recommendations with a reaction volume of 50 pL and 25 amplification cycles.

[0022] PCR1 amplified sgRNA sequences from genomic DNA using common flanking sequences. PCR1 reactions were performed to consume all genomic DNA, using 1. 5 pg gDNA per reaction. PCR1 products were pooled and purified using a QIAQUICK® PCR Purification Kit (Qiagen).

[0023] PCR2 attached Illumina adaptors and barcodes. Uniquely barcoded forward primers were used for each sample for facile sample identification and a pooled mix of twelve PCR2 reverse primers were used for each sample to increase diversity. Eight reactions were performed per sample containing 10 pL of pooled and purified PCR1 product as input.DC0592WO PATENT

[0024] PCR3 cleaned up amplicon ends to improve clustering on the sequencer. Eight reactions were performed per sample using 150 ng of pooled and purified PCR2 product as input. PCR3 product was pooled and run on a 1. 5% OMNIPUR® agarose (MilliporeSigma) gel prior to gel extraction using a QIAQUICK® Gel Extraction Kit (Qiagen). Gel extracted product was concentrated using a QIAQUICK®PCR Purification Kit (Qiagen).

[0025] Next Generation Sequencing (NGS). All sequencing was performed by the Dartmouth Genomics Shared Resource core facility. Fragment Analyzer (Agilent Technologies, Santa Clara, CA) and DNA quantification via QUBIT™ Flex ( Invitrogen, Waltham, MA) were run as quality control measures prior to NGS runs. An Illumina NEXTSEQ® 500 (Illumina Inc., San Diego, CA), high output 75 run with single end reads was used for the undifferentiated genome-wide samples and library control, an Illumina NEXTSEQ® 2000 P2 1 x 100 run was used for the differentiated genome-wide screening samples and library control, while an Illumina MINISEQ® high output 1 x 150 cycle run was used for the secondary library samples. All runs contained a 10% Phi-X (Illumina Inc. ) spike in to increase diversity. Read count was minimally 50 reads per sgRNA. Samples were deconvoluted to FASTQ files for subsequent analysis.

[0026] Data Processing and Analysis. Deconvoluted FASTQ files were analyzed using the MAGeCK-VISPR and MAGeCKFlute pipelines. For the primary genome wide screens, samples were analyzed as biological replicates, comparing enrichment of sgRNAs between the PrP Low and PrP High subsets for each replicate.

[0027] To formulate a list of the strongest candidate genes for validation, data from the three genome-wide replicate screens (undifferentiated and differentiated) were analyzed as described above. Genes with an FDR of d 0.5 were prioritized for validation. Additionally, KEGG analysis was performed andDC0592WO PATENT a hand-curated list of genes involved in pathways exhibiting enrichment were selected for inclusion in the secondary library.

[0028] The secondary library contained eight unique sgRNAs targeting each gene. To account for the discrepancy between the number of sgRNAs for targeting genes and individual sgRNAs for non-targeting controls for MAGeCK analysis, non-targeting control sgRNAs were randomly assigned gene names, with 10 nontargeting guides per non-targeting gene name. The secondary screens in undifferentiated cells had three replicate sorts and the screens in differentiated cells had five replicate sorts. Both the undifferentiated and differentiated screens were analyzed using MAGeCK-VISPR and MAGeCKFlute as paired replicates to compare the PrP Low and PrP High samples directly.

[0029] Secondary Library Creation. Non-targeting and targeting secondary libraries were synthesized, amplified, packaged, and transduced into target cells separately. The resulting non-targeting and targeting secondary libraries were mixed 1: 1 for use in secondary validation screening.

[0030] Custom sgRNA libraries were synthesized as oligo pools by Twist Bioscience (South San Francisco, CA). The oligo pools were amplified as two PCR reactions per library. Each reaction used Q5 Hot Start High Fidelity 2x Master Mix, approximately 13 ng of DNA, 12. 5 ng forward, 12.5 ng reverse primers. Ten amplification cycles were used to prevent overamplification, per manufacturer' s recommendations. PCR product was pooled and purified using QIAQUICK® PCR Purification Kits.

[0031] Golden Gate Assembly was performed using the Golden Gate Bsmbl Assembly Kit (NEB) to ligate amplified library oligos into the lentiGuide-Puro vector (Addgene). Resulting plasmids were transformed into One Shot MAX Efficiency DH5alpha-Tl chemically competent cells (Thermo Fisher) and incubated overnight at 37 °C. Colonies were collected, pooled,DC0592WO PATENT and plasmids were purified using an EndoFree Plasmid Maxi Kit (Qiagen). Aliquoted plasmid was stored at -80 °C.

[0032] Secondary library plasmid was packaged into lentivirus using the same HEK239FT packaging system and titered into CAD5 cells as described for the Brie whole-genome library. The same monoclonal line of CAD5 cells constitutively expressing Cas9 was transduced at an MOI of 0.3, as above, and NGS was used to ensure adequate representation and evenness of sgRNAs.

[0033] Secondary library FACS for cell surface PrPC. For each replicate in the secondary validation, library was thawed at 1000x representation and cultured for 1 week to allow for recovery from freeze / thaw. Differentiated and undifferentiated cells were handled as described for the genome-wide FACS screens. On the day of sorting, cells were gently rinsed IX with PBS, lifted with Cellstripper, and transferred to a tube containing and equal volume of complete media for counting. 1.5 x 107cells were used for each replicate sort, as well as 1 x 106cells for staining controls. Cells were spun at 150 x g for 5 minutes at room temperature. The pellets were resuspended in PBS supplemented with 2% FBS (staining buffer). Spinning and resuspension were repeated once more to ensure removal of all media and lifting agent.

[0034] 1.5 x 107secondary library cells were suspended in 1.875 mL staining buffer and stained with anti-PrP (6D11) antibody at a 1: 20, 000 dilution. Next, cells were stained with rat anti-mouse IgG2a: PE antibody at a concentration of 1 pL stock antibody per 1 x 106cells. Each sequential staining step included a 45-minute incubation at 4 °C in the dark with brief vortexing every 15 minutes. Following each antibody incubation step, cells were pelleted at 150 x g for 5 minutes at 4 °C, then resuspended in 10 mL staining buffer. The spin and rinse steps were repeated for a total of 3 spins, and the final resuspension volume was 5 mL staining buffer, except for the final resuspension pre-sorting, which was 3 mL. Cells wereDC0592WO PATENT filtered through a 40-micron cell strainer ( Falcon Plastics, Brookings, SD) and stored in the dark, on ice, until sorting.

[0035] An SH800 cell sorter (Sony Biotechnology, San Jose, CA) with a 488 nm excitation laser was used for each replicate sort of the secondary library. For each replicate, 1 x 107viable cells were sorted at a rate of approximately 2000 events / sec through a 100 pm sorting chip. Cells were gated first based on FSC and SSC characteristics to isolate single cells. Next, cells were gated based on PrP (PE) fluorescence. Cells within the lowest 20% and highest 20% PrP fluorescence were collected and called " PrP Low" and " PrP High", respectively. Selection with this gating strategy yielded approximately 2 x 106output cells in each subset (PrP Low and PrP High) per screening replicate, which were immediately processed for genomic DNA extraction.

[0036] Flow cytometry for surface Prp. All flow cytometry experiments were performed on a CytoFLEX flow cytometer (Beckman Coulter, Brea, CA).

[0037] To detect surface PrPcin CAD5 cells, the following primary antibodies were used: 6D11 (1: 250 dilution or 0.08 pg per sample), D13 ( 1 pg per sample), D18 ( 1 pg per sample), EP1802Y (0.5 pg per sample). Each sample contained approximately 500, 000 cells in 100 pL PBS / 2% FBS. Primary incubations were performed at 4C for 1 hour, followed by three washes in PBS, with final resuspension to 100 pL in PBS / 2% FBS.

[0038] The following secondary antibodies were used: Rat anti-Mouse IgG2a Secondary Antibody: PE ( Invitrogen), Goat anti-Human IgG Fc: PE ( Invitrogen), Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody: PE ( Invitrogen) at the manufacturer' s recommended dilutions. Secondary incubations were performed at 4 °C for 30 minutes, followed by three washes in PBS, with final resuspension in 250 pL PBS / 2% FBS.DC0592WO PATENT

[0039] FlowJo software (BD Biosciences) was used for all flow cytometry analysis. Sequential gating was performed to identify single cell populations. Median fluorescence intensities were used for calculation of percent reduction in surface PrPcexpression.

[0040] Inhibitor treatments. Unless otherwise noted, all experiments involving cell treatment with inhibitors underwent treatment at the indicated final concentration in complete cell culture media, with media / drug refreshes every 48-72 hours.Example 2: Genome-wide knockout screens reveal genes involved in the regulation of PrPcsurface expression in undifferentiated CAD5 cells

[0041] To identify genes responsible for the regulation of cell-surface PrPcin a prion-susceptible cell type, genome¬ wide pooled CRISPR / Cas9 knockout (KO) library screens were performed in the mouse neuronal-like cell line, CAD5. The CRISPR / Cas9-modif ied CAD5 KO library was generated by first transducing Cas9 into wild-type CAD5 cells and isolating monoclonal lines (CAD5-Cas9). Subsequently, the Brie mouse whole-genome pooled KO sgRNA library was transduced into CAD5-Cas9 monoclonal cells at a low multiplicity of infection to generate the genome-wide CAD5 KO library.

[0042] Whole-genome KO screens were performed in biological triplicate. For each replicate screen, the genome-wide CAD5 KO library was doubly stained with antibodies directed at the GPI-anchored cell surface proteins CD59 and PrP and cells were sorted by fluorescence activated cell sorting (FACS). Relative cell surface levels of CD59 were measured via the median fluorescence intensity (MFI ) within the allophycocyanin (APC) channel, while relative cell surface levels of PrPcwere measured via the MFI within the phycoerythrin (PE) channel. To identify genes specific to PrPccell surface expression,DC0592WO PATENT rather than the expression of all GPI-anchored proteins, CAD5 KO library cells were first gated to exclude cells with exceptionally low or high CD59 expression. Cells within the middle 90% of the CD59 fluorescence histogram were sorted on the basis of cell surface PrPc. Cells with the lowest or highest 20% of the PrPcfluorescence histogram were sorted into separate populations (PrPclow and PrPchigh, respectively) and retained for DNA isolation and next-generation sequencing (NGS).

[0043] The MAGeCK-VISPR bioinformatic pipeline was used to identify gene hits from the NGS dataset. MAGeCK-VISPR compared the relative sgRNA abundance between the PrPchigh and PrPclow populations, resulting in a ranked list of genes based on a robust ranking aggregation (RRA) score with associated significance scores (p values) and false discovery rate (FDR) values. The RRA score assigned by MAGeCK-VISPR encompasses the strength of enrichment of individual sgRNAs, degree of consistency seen in enrichment of multiple sgRNAs targeting a specific gene, and agreement across replicate screens.

[0044] The screen identified 119 genes as positive regulators of CAD5 PrPcsurface expression and 29 genes were identified as negative regulators of PrPcsurface expression. Inclusion criteria for hits required a log-fold change that fell outside three standard deviations of the mean-2. 9 or h 2. 9) and a p value less than or equal to 0. 01. Prnp, the gene encoding PrPc, was a high-ranking positive regulator (hit #2 ), lending confidence to the screening dataset.

[0045] To validate the hits identified in the whole-genome KO screens, a custom secondary KO library was created comprised of sgRNAs targeting the highest-ranking positive and negative regulators of PrPcsurface expression from the whole-genome screens as identi fied by MAGeCK-VISPR analysis of biological replicates (~1100 genes total). Also included were sgRNAs targeting a hand-curated list of genes including gene hitsDC0592WO PATENT from published PrPcscreens and genes which fell within identified enriched pathways from MAGeCKFlute analysis, as well as 2000 non-targeting control guides. To increase the power of the secondary screens, each gene was targeted by eight unique sgRNAs. Targeting sgRNAs for each gene included the same four sgRNAs found in the Brie genome-wide library, two from another genome-wide targeting library called Gouda, and two randomly selected from the GeCKO mouse v2 library. The custom secondary sgRNA library was transduced into CAD5-Cas9 cells and the resulting secondary KO library was sorted in biological triplicate based on PrPccell surface expression using FACS ( FIG. 1).

[0046] Analysis of the resulting NGS data was performed using MAGeCK-VISPR. Hit inclusion criteria for validation of target genes in the secondary library required a log fold change that fell two standard deviations outside of the mean (< -0.75 or 0. 75) and a p value of less than or equal 0.01. This analysis validated 54 positive regulators and 35 negative regulators of PrPcsurface expression. The secondary validation screens identified Prnp as the #1 positive regulator of PrPcsurface expression. Taken together, the genome-wide CRISPR / Cas9 KO screens provided a comprehensive list of genes involved in regulation of PrPcat the cell surface of CAD5 cells.Example 3: Bioinf ormatic analyses identify biosynthetic pathways involved in the regulation of PrPC surface expression

[0047] To further dissect the regulation of PrPcutilizing the whole-genome and validation library datasets, the pathway analysis function of MAGeCKFlute was used including KEGG, GOBP, REACTOME, and Complex databases.

[0048] Unexpectedly, the N-glycan biosynthetic pathway was identified as a positive regulator of PrPcsurface expression in the genome-wide screen and seven N-glycosylation biosynthetic pathway genes were validated via secondaryDC0592WO PATENT library screening. The GPI-anchor biosynthetic pathway was also identified and validated as an impressive regulator of PrPcsurface expression. These results pinpoint and underscore the importance of key pathways in PrPccell surface regulation.Example 4: N-linked glycosylation biosynthetic pathway inhibitors reduce PrPC surface expression in undifferentiated CAD5 cells

[0049] To further validate the previously unreported role of the N-glycosylation biosynthetic pathway as a positive regulator of PrPcsurface expression, an orthogonal approach was used. The N-linked glycosylation biosynthetic pathway includes several residue modification steps which are carried out by distinct enzymes and can be inhibited by small molecules. CAD5 cells were treated by adding small molecule inhibitors of N-glycosylation enzymes to the culture media and the impact on PrPcsurface expression was measured via flow cytometry.

[0050] Incubation of undifferentiated CAD5 cells with varying doses of the a-glucosidase I / II inhibitor 1-deoxyno j irimycin (1-DNJ) or the ER-specific a-mannosidase I inhibitor 1-deoxymannoj irimycin (1-DMJ) resulted in a dose-dependent decrease in PrPcat the cell surface. Treatment with 1-DNJ, 1-DMJ, or the Golgi-specific a-mannosidase II inhibitor swainsonine (SWA) had similar effects, resulting in approximately 30% reduction in cell surface PrPc. This data confirms the genetic findings and shows that interfering with the proper N-glycosylation of PrPcand / or other N-glycosylated proteins reduces cell surface levels of PrPcin CAD5 cells.

[0051] Surface expression of PrPcin the presence of an OST complex inhibitor (NGI-1) as compared to a mannosidase I inhibitor ( kifunensine) was also determined in several different cells lines including human induced pluripotent stem cells that had been differentiated into neurons. The resultsDC0592WO PATENT of this analysis (Table 1 ) showed that kifunensine and NGI-1 had an effect on surface PrPC levels in each of the different cell types.TABLE 1N- Inhibitor O, glycosylatio Concentratio Treatmen Reductio Cell line n Inhibitor n t Time n in PrPcKifunensine 5 pM 72 hours 48% CAD 5NGI-1 5 pM 72 hours 54% CAD 5 Kifunensine 5 pM 48 hours 57% differentiate NGI-1 5 pM 48 hours 41% dKifunensine 50 pM 24 hours 41% BE (2) -CNGI-1 5 pM 24 hours 55% BE (2) -C Kifunensine 20 pM 48 hours 33% differentiate NGI-1 5 pM 48 hours 51% di3 5 pM 72 hours 43%N NGI-1

[0052] The impact of OST complex inhibition on surface expression of different strains of PrPcwas also assessed. CAD5 cells chronically infected with the RML mouse prion strain were treated with either kifunensine or NGI-1. Proteins were extracted from the cells and subjected to proteinase K treatment to determine the presence / amount of PrPScvia western blot analysis. The blot shown in FIG. 2A indicated that while kifunensine changed migration of PrPSc, this compound but did not significantly impact amount (FIG. 2B). By comparison, NGI-1 cured the CAD5 cells of the RML mouse prion strain (FIGS.2A and 2C). Similar results were obtained when CAD5 cells were infected with the 22L mouse prion strain ( FIGS. 3A-3C). To further determine specificity, CAD5 cells chronically infected with the Hyper or 263K hamster prion strains were treated with either kifunensine or NGI-1. This analysis likewise demonstrated that NGI-1 could cure the CAD5 cells of the Hyper or 263K hamster prion strains ( FIGS. 4A-4C and FIGS. 5A-5C).

[0053] Non-dividing RK13 cells expressing mouse PrP, MoPrP, were also tested. These cells were simultaneously treated with 22L-infected brain homogenate and either carrier (DMSO) orDC0592WO PATENT NGI-1. Medium was refreshed every 2-3 days and 2 weeks after treatment, the cells were lysed, subjected to proteinase K treatment, and western blot analysis for 22L was carried out. This analysis indicated that cells infected with 22L at same time as NGI-1 treatment did not harbor PrPScafter 2 weeks in the absence of cell division. Likewise, RK13 cells chronically infected with 22L did not harbor PrPScafter 2 weeks of NGI-1 treatment in the absence of cell division.

[0054] To determine whether NGI-1 had any direct impact on PrPSc, Protein misfolding cyclic amplification ( PMCA) analysis was carried out. PMCA reactions are composed of two alternating steps: sonication and incubation. Sonication fragments PrPScparticles or fibrils into smaller pieces, a process that is believed to result in the multiplication of active centers of PrPScgrowth. During the incubation step, small PrPScparticles grow by recruiting and converting the normal, cellular form of the prion protein ( PrPc) into PrPSc. Notably, addition of NGI-1 directly to amplification reaction still allowed for conversion of PrPcto PrPSc. Therefore, NGI- 1 inhibition of PrPScis via a cellular pathway.

[0055] NGI-1 is known to inhibit both STT3A and STT3B. It has been suggested that PrP glycosylation is via STT3B (Hirata et al. (2022) J. Biol. Chem. 298 ( 10): 102444 ). To determine whether an STT3B inhibitor could be used to inhibit surface expression of PrPC, CAD5 HaPrP cells chronically-infected with Hyper (hamster strain) were treated with 10 pM or 20 pM indocyanine green, an STT3B inhibitor (Wang et al. (2023) Nature Commun. 14: 2241). Cells were split every 2-3 days, lysed after 1 week, subjected to proteinase K treatment, and western blot analysis for Hyper was carried out. As with NGI-1 treatment, this analysis indicated that CAD5 did not harbor PrPScafter 1 week of treatment with indocyanine green.

[0056] To determine whether the reduction in PrPScobserved in CAD5 cells upon NGI-1 treatment could be due to loss ofDC0592WO PATENT PrPScvia cell division, a non-dividing cell line, RK13, was used. RK13 cells exhibit contact-dependent inhibition of division and stop dividing at full confluence. RK13 cells expressing mouse PrP (moRK13) under the Tet-On system were infected with the mouse prion strain, 22L, in the presence of doxycycline. Then, cells were split, grown to full confluence, and maintained at full confluence with addition of NGI-1 or DMSO to the growth media for one week. As with the dividing CAD5 cells, a dramatic decrease in PK-resistant PrPScwas observed via western blot in the lysate of NGI-l-treated moRK13 cells (FIG. 6A, compare NGI-1 treated biological triplicates in lanes 13-15 to DMSO-treated biological triplicates in lanes 10-12). Additionally, the western blot revealed that while DMSO-treated cells or untreated cells continued to form PrPScthroughout the treatment week (FIG.6A, compare untreated and DMSO-treated biological triplicates in lanes 7-9 and 10-12 to untreated T=0 biological triplicates in lanes 1-3), NGI-l-treated cells appeared to have lost PrPScthroughout the same treatment period (FIG. 6A, compare NGI-1 treated biological triplicates in lanes 13-15 to untreated T=0 biological triplicates in lanes 1-3 ). The effects of NGI-1 in human iPSCs that were fully differentiated into non-dividing neurons was subsequently examined. The results of this analysis showed a decrease in surface PrPcexpression of approximately 50%

[0057] Human cerebral organoids have recently emerged as a valuable tool for studying sporadic Creutzfeldt Jakob disease (sCJD) prions. Since NGI-1 was successful in treating non¬ dividing cells, the effectiveness of NGI-1 as a therapeutic treatment for sCJD prions was assessed using this system. Uninfected human cerebral organoids were treated with varying doses of NGI-1 ( 1 pM, 5 pM, or 10 pM) or DMSO equivalent (0. 01%, 0.05%, 0. 1%) for 4 weeks. No overt changes in cell viability or toxicity were observed at any dose. Western blotDC0592WO PATENT analysis showed that NGI-1 treatment decreased the total amount of PrP in the organoids and altered its glycosylation pattern. Human cerebral organoids infected with the MV2 subtype of sCJD were maintained for 60- or 90-days post infection, then treated for either 30 days (FIG. 6B) or 60 days ( FIG. 6C) with 10 μM NGI-1 or DMSO equivalent. NGI-1 treatment caused a significant decrease in the seeding potential (logSD50 / mg tissue) in both 30-day (FIG. 6B) and 60- day (FIG. 6C) therapeutic regimes compared to untreated or DMSO-treated controls. Taken together, these results demonstrate that NGI-1 can inhibit prions in non-dividing cells and can inhibit human sCJD prions.Example 5: Genome-wide knockout screens in differentiated cells reveal shared and unique hits between cell states

[0058] CAD5 cells can be reversibly differentiated into a more neuron-like state by the removal of serum from the cell culture medium. It was of interest to see whether the genes responsible for regulating surface PrPcin CAD5 cells would differ in their undifferentiated and differentiated states. Thus, the same genome-wide and secondary library validation screens described above were performed in differentiated CAD5 cells.

[0059] In the differentiated state, genome-wide KO screening (in biological triplicate) identified 55 positive regulators of PrPcsurface expression and 44 negative regulators of PrPcsurface expression ( inclusion criteria of log fold change outside three standard deviations of the mean (^ -2. 94 or2. 94 ) and a p value less than or equal to 0. 01 ). As in the undifferentiated screens, Prnp was a top hit (#3). Secondary screening using the custom KO sub-library in differentiated cells validated 40 positive and 13 negative regulators of PrPcDC0592WO PATENT cell surface expression (using inclusion criteria of log fold change outside two standard deviations of the mean-1. 58 or > 1. 58 ) and p value of less than or equal 0.01). Once again, Prnp was highly ranked (#2 ).

[0060] Top-ranking positive regulators of PrPcsurface expression in the undifferentiated and differentiated states were shared, with eight genes in common between the genomewide KO screens. Interestingly, no negative regulators of PrPcsurface expression were shared between the undifferentiated and differentiated genome-wide screens. Similarly, a greater number of positive regulators of PrPcwere shared between the undifferentiated and differentiated cell states during secondary library validation (20 genes) compared to negative regulators (2 genes).

[0061] Secondary validation screening revealed that most genetic regulators of cell surface PrPcwere dependent on cell state, including the N-linked glycosylation pathway genes which were unique to the undifferentiated state. However, these studies also identified core regulatory genes and pathways which were shared between the undifferentiated and differentiated cell states, including many GPI-anchor biosynthesis pathway genes and genes related to transcription.

[0062] Two of the 13 GPI-anchor biosynthetic genes identified, Pigf and Pgap2, were validated as positive regulators of cell surface PrPcexpression in the undifferentiated and differentiated CAD5s screens but have been previously identified as genes unique to the regulation of CD59 cell surface expression (not regulators of PrPccell surface expression) in HAP1 cells.

[0063] Interestingly, Hspa5 was validated as a positive regulator of PrPccell surface expression in the differentiated cell state, but was not identified in either of the previously published genome-wide screens for PrPcregulators. Hspa5 encodes for the Hspa5 protein which serves as a molecularDC0592WO PATENT chaperone in many contexts. Hspa5 facilitates Sec61 gating for PrP entry to the ER lumen for cotranslational translocation. It also promotes the correct folding of PrPc. Thus, the identification of Hspa5 as a positive regulator of cell surface PrPchighlights its multiple roles in PrPcbiosynthesis. Interestingly, Hspa5 also plays a role in prion pathogenesis, as reduced expression of Hspa5 has been shown to accelerate prion pathogenesis in vitro and in vivo. This acceleration of prion pathogenesis may relate to its key role in maintaining protein homeostasis via activation of the unfolded protein response (UPR), illustrating the complexities of secretory protein biosynthesis, folding, and protein homeostasis in relation to prion disease.

[0064] In undifferentiated CAD5 cells, several genes related to the N-glycosylation biosynthetic pathway (including Mgatl, Alg5, AlglOb) were validated as positive regulators of cell surface PrPc. The finding that N-glycosylation influences cell surface expression of PrPcis novel and that these N-glycosylation genes were identified in the undifferentiated state may reflect differences in the N-glycome between undifferentiated and differentiated cells as well as differences in protein quality control and homeostasis mechanisms between cell states.

[0065] In differentiated CAD5 cells, unique positive regulators of the cell surface expression of PrPclargely related to cellular processes downstream of transcription, including genes related to protein trafficking (Copzl, Aplm2, Tmedl O) and protein folding in response to cellular stress (Hspa5, Gsta2). Several genes related to synaptic function were also validated as positive regulators of cell surface PrPcexpression in the differentiated state (including Sival and Thoc3). Interestingly, Uncl3a and Gsk3b, both of which have previously been implicated in neurodegenerative diseases, were validated positive regulators in the differentiated cellDC0592WO PATENT state. Uncl3a encodes a key regulator of synaptic vesicle priming and neurotransmitter release and variants in Uncl3a are linked to ALS and frontotemporal dementia (FTD). Gsk3b encodes a serine / threonine kinase implicated in Alzheimer ' s disease.

[0066] To determine the role of GSK3 cell surface PrPcexpression, CAD5 cells were treated GSK-3(3 inhibitor, Laduviglusib. This analysis indicated that Laduviglusib could reduce PrPclevels on the surface of cells by >70% as determined by flow cytometry ( FIGS. 7A-7B). In addition, the total amount of PrPcwithin the cell was reduced as determined by western blot analysis (FIG. 7C).

[0067] The effect of GSK3 inhibitors laduviglusib and AZD1080 on PrPScload in CAD5 cells chronically infected with mouse prions or hamster prions was also determined. This analysis showed that laduviglusib ( FIG. 8A) and AZD1080 (FIG. 8B) reduced PrPScload in chronically infected CAD5 cells.

[0068] The effect of siRNA-mediated knockdown of GSK3A and / or GSK3B on total PrPclevels in undifferentiated CAD5 cells was also determined. Western blot analysis showed the reduction in total PrPc, GSK3A, and / or GSK3B in the lysates of undifferentiated CAD5 cells after siRNA knockdown of GSK3A, GSK3B, or GSK3A and GSK3B in combination as compared to a beta-tubulin control ( FIG. 9).

[0069] Negat ive regulators of the cell surface expression of PrPcalso largely differed in identity between cell states but were functionally much more closely related. Negative regulators in both cell states were primarily related to gene expression regulation including RNA processing and transcription factors. Negative regulators validated in the undifferentiated cell state also related to DNA maintenance (Chekl, Top2a), while those in the differentiated state did not, potentially reflecting differences in cell cycle between actively proliferating and quiescent cells.DC0592WO PATENT

[0070] Taken together, these studies identify unique genes which regulate cell surface PrPcin a state-dependent manner, as well as core shared genes and pathways which represent fundamental regulators of cell surface PrPcexpression in a model system with direct relevance to disease.

Claims

DC0592WO PATENT WHAT IS CLAIMED IS:

1. A method of treating or retarding the development of a prion or prion-related disease or condition, comprising administering to a subject in need of treatment an effective amount of at least one oligosaccharyltransf erase (OST) complex inhibitor and / or at least one Glycogen Synthase Kinase-3 (GSK3) inhibitor thereby treating or retarding the development a prion or prion-related disease or condition in the subject.

2. The method of claim 1, wherein the subj ect has, is susceptible to, or at risk of developing a prion or prion- related disease or condition.

3. The method of claim 1, wherein the prion or prion- related disease or condition comprises scrapie, bovine spongiform encephalopathy, transmissible mink encephalopathy, feline spongiform encephalopathy, chronic wasting disease kuru, Creutzfeldt- Jakob disease, Gerstmann-Straussler- Scheinker Syndrome, fatal insomnia, or variant Creutzfeldt-Jakob disease.

4. The method of claim 1, wherein the at least one OST complex inhibitor is a selective inhibitor of STT3A, a selective STT3B, or an inhibitor of STT3A and STT3B.

5. The method of claim 4, wherein the selective inhibitor of STT3A has the structure of:N"' O N-?DC0592WO PATENT or a pharmaceutically acceptable salt, analog, or prodrug thereof.

6. The method of claim 4, wherein the selective inhibitor of STT3B has the structure of:H3<0 II II0 or a pharmaceutically acceptable salt, analog, or prodrug thereof.

7. The method of claim 4, wherein inhibitor of STT3A and STT3B has the structure of:0 NII j / hTHor a pharmaceutically acceptable salt, analog, or prodrug thereof.

8. The method of claim 1, wherein the at least one GSK3 inhibitor is a selective inhibitor of GSK3A, a selective GSK3B, or an inhibitor of GSK3A and GSK3B.

9. The method of claim 8, wherein the inhibitor of GSK3A and GSK3B is laduviglusib.

10. A method of inhibiting cell surface expression of PrPc(cellular prion protein), comprising contacting a cell expressing PrPcwith an effective amount of at least one oligosaccharyltransf erase (OST) complex inhibitor and / or atDC0592WO PATENT least one Glycogen Synthase Kinase-3 (GSK3) inhibitor thereby inhibiting cell surface expression of the PrPc.

11. The method of claim 10, wherein the cell is a neuron, astrocyte or glial cell.

12. The method of claim 10, wherein the at least one OST complex inhibitor is a selective inhibitor of STT3A, a selective STT3B, or an inhibitor of STT3A and STT3B.

13. The method of claim 12, wherein the selective inhibitor of STT3A has the structure of:or a pharmaceutically acceptable salt, analog, or prodrug thereof.

14. The method of claim 12, wherein the selective inhibitor of STT3B has the structure of:+ < " N N 0 II O Na II0 or a pharmaceutically acceptable salt, analog, or prodrug thereof.

15. The method of claim 12, wherein inhibitor of STT3A and STT3B has the structure of:DC0592WO PATENTor a pharmaceutically acceptable salt, analog, or prodrug thereof.

16. The method of claim 10, wherein the at least one GSK3 inhibitor is a selective inhibitor of GSK3A, a selective GSK3B, or an inhibitor of GSK3A and GSK3B.

17. The method of claim 16, wherein the inhibitor of GSK3A and GSK3B is laduviglusib.

18. A method of inhibiting replication of PrPSc(scrapie isoform of the prion protein), comprising contacting a cell expressing PrPc(cellular prion protein) with an effective amount of an oligosaccharyltransf erase (OST) complex inhibitor and / or a Glycogen Synthase Kinase-3 (GSK3) inhibitor thereby inhibiting replication of PrPSc.

19. The method of claim 18, wherein the PrPSccomprises an inherited, sporadic, or infectious form of prion.

20. The method of claim 18, wherein the cell is a neuron, astrocyte or glial cell.

21. The method of claim 18, wherein the at least one OST complex inhibitor is a selective inhibitor of STT3A, a selective STT3B, or an inhibitor of STT3A and STT3B.

22. The method of claim 21, wherein the selective inhibitor of STT3A has the structure of:DC0592WO PATENTor a pharmaceutically acceptable salt analog, or prodrug thereof.

23. The method of claim 21, wherein the selective inhibitor of STT3B has the structure of:or a pharmaceutically acceptable salt, analog, or prodrug thereof.

24. The method of claim 21, wherein inhibitor of STT3A and STT3B has the structure of:or a pharmaceutically acceptable salt, analog, or prodrug thereof.

25. The method of claim 18, wherein the at least one GSK3 inhibitor is a selective inhibitor of GSK3A, a selective GSK3B, or an inhibitor of GSK3A and GSK3B.DC0592WO PATENT 26. The method of claim 25, wherein the inhibitor of GSK3A and GSK3B is laduviglusib.

Images