Microrna-responsive multi-gene editing system

The CRISPR-Scissors multiplex gene editing system with a miRNA-responsive mechanism addresses the limitations of current cancer treatments by targeting multiple genes in melanoma cells, enhancing therapeutic efficiency and safety.

WO2026141784A1PCT designated stage Publication Date: 2026-07-02IND ACADEMIC COOPERATION FOUND UNIV OF INCHEON
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/005441
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-12-23
Filing Date
2025-04-22
Publication Date
2026-07-02

AI Technical Summary

Technical Problem

Current cancer treatments, particularly those using protein therapeutics, face limitations such as low therapeutic efficiency, high costs, and temporary effects due to addressing only a single cause, while gene therapies like CRISPR-based systems face challenges in delivery efficiency and lack of cell specificity.

Method used

A CRISPR-Scissors multiplex gene editing system incorporating a miRNA-responsive system into a plasmid-based gene editing system, utilizing a Cas protein and multiple gRNAs to target specific genes in melanoma cells, enhancing therapeutic efficiency by addressing multiple causes simultaneously.

Benefits of technology

The system achieves high specificity and safety in gene editing, offering permanent therapeutic effects and improved treatment efficiency for melanoma by targeting multiple genes involved in growth and immune evasion mechanisms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025005441_02072026_PF_FP_ABST
    Figure KR2025005441_02072026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a microRNA-responsive multi-gene editing system, and specifically, to: a multi-gene editing system; a polynucleotide encoding the multi-gene editing system; a recombinant vector comprising the polynucleotide; a transformant into which the recombinant vector is introduced; a gene editing composition comprising the polynucleotide; and a pharmaceutical composition for treating or preventing cancer, the composition comprising the gene editing composition. The gene editing system according to the present invention has the advantage of being able to be used in gene therapy applications on the basis of high specificity and safety.
Need to check novelty before this filing date? Find Prior Art

Description

MicroRNA-responsive multiplex gene editing system

[0001] The present invention relates to a microRNA-responsive multiple gene editing system, and specifically to a multiple gene editing system, a polynucleotide encoding the multiple gene editing system, a recombinant vector comprising the polynucleotide, a transformant into which the recombinant vector is introduced, a gene editing composition comprising the polynucleotide, and a pharmaceutical composition for the treatment or prevention of cancer comprising the gene editing composition.

[0002] Gene editing technology is a system capable of inducing fundamental changes in cells by altering chromosomes. To apply this system to various fields, it is necessary to develop systems that can edit multiple genes or edit in response to specific stimuli.

[0003] Cancer is a dangerous disease associated with the indiscriminate differentiation and metastasis of cells due to various external and internal causes, characterized by a wide variety of types and a survival rate that is significantly lower than that of other diseases. Among these, melanoma, a type of skin cancer, is a cancer that develops primarily when mutations occur in melanocytes, which produce melanin, due to excessive exposure to ultraviolet rays from sunlight. According to the Melanoma Research Alliance, the survival rate is very high at 98.4 percent in stages 0, I, and II (localized melanoma) before metastasis occurs; however, as metastasis progresses, the survival rate drops sharply, showing a very low survival rate of 22.5% in stage IV (metastatic melanoma).

[0004] Various treatment methods are currently under research to treat these cancers and are broadly divided into two categories: targeted therapy and immunotherapy. Targeted therapy is a treatment method that kills only cancer cells by targeting factors related to tumor cell survival, such as mutations in differentiation or division, and blocking the associated signaling pathways. Immunotherapy is a treatment method that kills cancer cells by activating T-cell immune responses through the use of cytokines to activate immune cells or by using antibodies against immune checkpoint-related receptors such as PD-1 and CTLA-1 to suppress immune evasion mechanisms.

[0005] Currently, most cancer treatments utilize proteins, and research is being conducted on this topic. However, since cancer is fundamentally a disease caused by mutations in various factors, protein therapies that address only a single cause do not offer high therapeutic efficiency. Furthermore, there is a need to resolve various limitations, such as high costs, drug safety, and temporary therapeutic effects.

[0006] Gene therapy is attracting attention as a new treatment method capable of enhancing the efficiency of various cancers by fundamentally resolving genetic abnormalities that cause many difficult-to-treat tumors. These gene therapies are low-cost, offer higher safety compared to proteins, and can provide permanent therapeutic effects through genome editing, thereby overcoming the various limitations of protein therapies.

[0007] Additionally, regarding the low treatment efficiency of protein therapeutics, which is the biggest problem because they can only address a single factor, using CRISPR gene scissors, one of the representative gene editing tools, allows for multiple gene editing using various gRNAs, thereby enabling the simultaneous resolution of various causes and increasing treatment efficiency.

[0008] However, delivering and expressing gRNA in the form of a gene for various multiplex gene editing results in reduced delivery efficiency because multiple plasmids must be delivered at once. Additionally, there is a problem that it may cause side effects due to the lack of cell specificity, so research is needed to solve this problem.

[0009] [Prior Art Literature]

[0010] [Patent Literature]

[0011] Republic of Korea Published Patent Document No. 10-2021-0009186 (January 26, 2021)

[0012] The object of the present invention is to provide a multiple gene editing system comprising: a Cas protein (CRISPR-associated protein); and one or more gRNAs selected from the group consisting of four different gRNAs (guide RNAs).

[0013] In addition, the present invention provides a polynucleotide encoding the multiple gene editing system.

[0014] Another objective of the present invention is to provide a recombinant vector comprising the polynucleotide.

[0015] Another objective of the present invention is to provide a transformant into which the recombinant vector has been introduced.

[0016] Another objective of the present invention is to provide a gene editing composition comprising the polynucleotide.

[0017] Another objective of the present invention is to provide a pharmaceutical composition for the treatment or prevention of cancer, comprising the gene editing composition described above.

[0018] Another objective of the present invention is to provide a method for preventing, treating, or improving cancer, comprising a method of administering the gene editing composition to an individual in need thereof.

[0019] Another objective of the present invention is to provide an anticancer treatment adjuvant method comprising a method of administering the gene editing composition to an individual in need thereof.

[0020] Another objective of the present invention is to provide a use for cancer prevention, treatment, or improvement comprising the gene editing composition as an active ingredient.

[0021] Another objective of the present invention is to provide an anticancer adjuvant use comprising the gene editing composition as an active ingredient.

[0022] Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims, and drawings.

[0023] In order to overcome the various limitations of current cancer treatments, such as low therapeutic efficiency, lack of specific action, high cost, and temporary therapeutic effects, the present invention aims to develop a CRISPR-Scissors multiplex gene editing system incorporating a miRNA-responsive system into a plasmid-based gene editing system and to apply and utilize it for cancer gene editing.

[0024] In one embodiment of the present invention, in order to verify the efficiency of the system applied to melanoma, target genes involved in mechanisms such as melanoma growth and immune evasion for multiple gene editing and gRNAs thereof were selected, a melanoma-specific action system utilizing miRNA was developed, a melanoma-specific gene editing system based on multiple gene editing was completed, and the system was applied to melanoma cells (B16F10) to verify the gene editing efficiency and therapeutic efficiency.

[0025]

[0026] The present invention will be described in detail below.

[0027]

[0028] The present invention provides a multiplex gene editing system comprising: a Cas protein (CRISPR-associated protein); and one or more gRNAs selected from the group consisting of four different gRNAs (guide RNAs).

[0029] In the present invention, gene editing may be gene knockout or inhibition of target gene expression, but is not limited thereto.

[0030] In the present invention, the Cas protein refers to a protein utilized for gene editing, which is an enzyme that binds to guide RNA and cuts or modifies the sequence or location of a target gene or nucleic acid. The above Cas protein is included without limitation as long as it is a protein utilized in gene editing technology in the art. The protein utilized in gene editing technology is capable of recognizing guide RNA and cutting target DNA / RNA; specifically, the above Cas may be Cas9, its functional analogs, or variants, but is included in the above Cas if it can be utilized in gene editing technology without limitation regarding its natural form, variant form, or origin.

[0031] In the present invention, Cas9 refers to a system called the Clustered regulatory interspaced short palindromic repeats (CRISPR) / CRISPR-associated protein 9 (Cas9) system, which acts as a secondary defense immune system in bacteria and archaea.

[0032] In the present invention, the multiple gene editing system refers to a gene editing system utilizing Cas9 rather than the existing Cas9 system, and means a genetically engineered system capable of exhibiting superior effects in cell death compared to the conventional system when four different types of gRNAs are used simultaneously.

[0033] In the present invention, gRNA (guide RNA) refers to RNA that plays a role in cleaving a target gene specifically based on a base sequence by inducing DNA base sequence specificity in a target region. Depending on the number of RNAs constituting the gRNA, it may be classified as sgRNA (single guide RNA) and dual gRNA (dual guide RNA), but is not limited thereto.

[0034] In the present invention, the gRNA may target one or more genes selected from the group consisting of BRAF, PDL1, CD133, and MC1R. Preferably, it may target two or more genes from the group consisting of BRAF, PDL1, CD133, and MC1R, more preferably three or more genes from the group consisting of BRAF, PDL1, CD133, and MC1R, and even more preferably all genes of BRAF, PDL1, CD133, and MC1R.

[0035] In the present invention, the gRNA can be multi-gene edited according to miRNA responsiveness. Specifically, the gRNA may be active by miRNA. The gRNA is four different gRNAs that are separated into individual gRNAs in the presence of miRNA and have activity. Therefore, the activity may be induced by the individual separation of four different gRNAs linked together, and preferably, the activity may be induced by the individual separation of four different gRNAs linked together by miRNA. Meanwhile, the four different gRNAs linked together may be expressed with the same promoter.

[0036] In the present invention, the miRNA may be overexpressed in melanoma cells. The miRNA overexpressed in melanoma cells induces the individual separation of four distinct gRNAs. According to one embodiment of the present invention, several candidate groups were selected to confirm the multiple gene editing effect based on the miRNA responsiveness of gRNA in melanoma cells. Among these, gRNA was designed by linking it to the miR-30b complementary sequence, and it was confirmed that the miR-30b complementary sequence is cleaved in melanoma cells, causing the separation of four distinct gRNAs through miRNA action, thereby inducing multiple gene editing. Accordingly, the miRNA may be constructed using a forward primer containing the nucleotide sequence of SEQ ID NO. 45 and a reverse primer containing the nucleotide sequence of SEQ ID NO. 46.

[0037] In the present invention, the gRNA may include the nucleotide sequence of SEQ ID NO. 27 as a target sequence, the gRNA may include one or more nucleotide sequences selected from the group consisting of SEQ ID NOs 53 to 55 as a target sequence, the gRNA may include one or more nucleotide sequences selected from the group consisting of SEQ ID NOs 56 to 58 as a target sequence, the gRNA may include one or more nucleotide sequences selected from the group consisting of SEQ ID NOs 59 to 61 as a target sequence, and the gRNA may include one or more nucleotide sequences selected from the group consisting of SEQ ID NOs 62 to 64 as a target sequence.

[0038] The nucleotide sequences of SEQ ID NOs 27, 45, 46, 53 to 55, 56 to 58, 59 to 61, and 62 to 64 may each have sequence homology of at least 90%, specifically 95%, more specifically 96%, 97%, 98%, or 99% or more, but are not limited thereto. Furthermore, it is obvious that any amino acid sequence or nucleotide sequence having such homology, in which some sequences are deleted, modified, substituted, or added, is also included within the scope of the present invention.

[0039] In addition, the present invention provides a polynucleotide encoding the multiple gene editing system.

[0040] In the present invention, a polynucleotide is a polymer of deoxyribonucleotides or ribonucleotides existing in a single-stranded or double-stranded form. It includes RNA genome sequences, DNA (gDNA and cDNA) and RNA sequences transcribed therefrom, and includes analogs of natural polynucleotides unless specifically noted otherwise.

[0041] In addition, the present invention provides a recombinant vector comprising the above polynucleotide.

[0042] In the present invention, a recombinant vector refers to an expression vector capable of expressing a target protein in a suitable host cell, comprising a gene construct that includes an essential regulatory element operably linked to allow the expression of a gene insert.

[0043] In the present invention, "operably linked" refers to a functional linkage between a nucleic acid expression regulatory sequence (e.g., a promoter, a signal sequence, or an array of transcription factor binding sites) and a nucleic acid sequence encoding a target protein to perform a general function. By doing so, the regulatory sequence regulates the transcription and / or translation of the other nucleic acid sequence. For example, by operably linking the Cas9 sequence and gRNA sequence of the present invention to a promoter, the expression of said sequences is placed under the influence or regulation of said promoter. Operable linkage with a recombinant vector can be prepared using gene recombination techniques well known in the art, and site-specific DNA cleavage and linkage can be performed using enzymes or the like generally known in the art.

[0044] In the present invention, the recombinant vector may include signal sequences or leader sequences for membrane targeting or secretion in addition to expression regulatory elements such as a promoter, operator, start codon, stop codon, polyadenylation signal, and enhancer, and may be manufactured in various ways depending on the purpose. The promoter of the recombinant vector may be constitutive or inducible.

[0045] In the present invention, the recombinant vector may include a plasmid vector, a cosmid vector, or a virus vector, etc.

[0046] In addition, the present invention provides a transformant into which the recombinant vector is introduced.

[0047] In the present invention, the transformant is used in combination with a host cell, and the transformant refers to a eukaryotic or prokaryotic cell into which one or more DNA or vectors are introduced.

[0048] In the present invention, the transformant may have reduced off-target binding affinity to target DNA and enhanced on-target cleavage efficiency.

[0049] In the present invention, "on target" refers to a sequence or location of a target gene or nucleic acid on which a gene editing system acts, and in the present invention, "off target" refers to a sequence or location of a target gene or nucleic acid where base editing activity occurs but is not intended, and where a target-specific base editor forms a partially complementary binding. An off target is a sequence or location of a gene or nucleic acid that is not targeted by a target-specific base editor, or a nucleic acid sequence having less than 100% sequence homology with the nucleic acid sequence of the on target. A nucleic acid sequence having less than 100% sequence homology with the nucleic acid sequence of the on target is a nucleic acid sequence similar to the on target nucleic acid sequence, and may be a nucleic acid sequence containing one or more different base sequences or having one or more base sequences deleted.

[0050] In addition, the present invention provides a gene editing composition comprising the above-mentioned polynucleotide.

[0051] In addition, the present invention provides a pharmaceutical composition for the treatment or prevention of cancer, comprising the gene editing composition.

[0052] In the present invention, the cancer may be one or more selected from liver cancer, lung cancer, pancreatic cancer, non-small cell lung cancer, colon cancer, bone cancer, skin cancer, head or neck cancer, skin or intraocular melanoma, uterine cancer, ovarian cancer, rectal cancer, stomach cancer, pro-anal cancer, colon cancer, breast cancer, esophageal cancer, small intestine cancer, endocrine gland cancer, thyroid cancer, parathyroid cancer, adrenal cancer, and soft tissue sarcoma.

[0053] In the present invention, treatment refers to any act of improving or beneficially altering the symptoms of cancer by administering the composition of the present invention.

[0054] In the present invention, prevention refers to any act in which the possibility of developing cancer or disease is suppressed or delayed by the administration of the composition of the present invention.

[0055] The above pharmaceutical composition may include a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable carrier" may refer to a carrier or diluent that does not irritate living organisms and does not impair the biological activity and properties of the injected compound. Here, "pharmaceutically acceptable" means that the subject of application (prescription) does not possess toxicity beyond an tolerable level without inhibiting the activity of the active ingredient.

[0056] Any carrier that is commonly used and pharmaceutically acceptable in the art may be used as the carrier that can be used in the present invention. Non-limiting examples of said carriers include saline solution, sterile water, Ringer's solution, buffered saline solution, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, etc. These may be used alone or in a mixture of two or more. The said pharmaceutical composition may be prepared as an oral formulation or a parenteral formulation according to the route of administration by conventional methods known in the art, including a pharmaceutically acceptable carrier in addition to the active ingredient.

[0057] The above pharmaceutical composition may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols, external preparations, suppositories, or sterile injectable solutions, each according to conventional methods. When formulating the above pharmaceutical composition, it may be prepared by adding diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, or surfactants.

[0058] When the above pharmaceutical composition is prepared as an oral formulation, it may be prepared in the form of powder, granules, tablets, pills, coated tablets, capsules, liquids, gels, syrups, suspensions, wafers, etc., in accordance with methods known in the art together with a suitable carrier. Examples of pharmaceutically acceptable suitable carriers include sugars such as lactose, glucose, sucrose, dextrose, sorbitol, mannitol, and xylitol; starches such as corn starch, potato starch, and wheat starch; celluloses such as cellulose, methylcellulose, ethylcellulose, sodium carboxymethylcellulose, and hydroxypropylmethylcellulose; polyvinylpyrrolidone; water; methylhydroxybenzoate; propylhydroxybenzoate; magnesium stearate; mineral oil; malt; gelatin; talc; polyols; vegetable oils, etc. In the case of formulation, the formulation may include diluents and / or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants as needed.

[0059] When the above pharmaceutical composition is prepared as a parenteral formulation, it may be formulated in the form of an injectable, transdermal, nasal inhalant, and suppository according to methods known in the art with a suitable carrier. When formulated as an injectable, suitable carriers may include sterile water, ethanol, polyols such as glycerol or propylene glycol, or mixtures thereof; preferably, Ringer's solution, PBS (phosphate buffered saline) containing triethanolamine, sterile water for injection, isotonic solutions such as 5% dextrose, etc. When formulated as a transdermal formulation, it may be formulated in the form of an ointment, cream, lotion, gel, topical solution, paste, liniment, aerosol, etc. In the case of nasal inhalers, they can be formulated in the form of an aerosol spray using suitable propellants such as dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, and carbon dioxide, and when formulated as suppositories, the base may be Witepsol, Tween 61, polyethylene glycols, cocoa starch, laurin starch, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene stearate, and sorbitan fatty acid esters.

[0060] The above pharmaceutical composition may be administered in a pharmaceutically effective amount, wherein the term "pharmaceutically effective amount" means an amount sufficient to treat or prevent a disease with a reasonable benefit / risk ratio applicable to medical treatment or prevention, and the effective dose level may be determined based on factors including the severity of the disease, drug activity, patient's age, weight, health, gender, patient's sensitivity to the drug, the time of administration of the composition of the present invention used, the route of administration and elimination rate, the duration of treatment, drugs combined or used concurrently with the composition of the present invention used, and other factors well known in the medical field. The above pharmaceutical composition may be administered alone or in combination with a component known to exhibit therapeutic effects for known cancer diseases. It is important to administer an amount that obtains maximum effect with a minimum amount without side effects, taking all of the above factors into consideration.

[0061] The dosage of the above pharmaceutical composition may be determined by a person skilled in the art by taking into consideration the purpose of use, the degree of toxicity of the disease, the patient's age, weight, gender, medical history, or the type of substance used as an active ingredient. For example, the pharmaceutical composition of the present invention may be administered to an adult at a dose of about 0.1 ng to about 1,000 mg / kg, preferably 1 ng to about 100 mg / kg. The frequency of administration of the composition of the present invention is not particularly limited thereto, but may be administered once a day or divided into several doses. The above dosage or frequency of administration does not limit the scope of the present invention in any way.

[0062] In addition, the present invention provides a method for preventing, treating, or improving cancer, comprising a method of administering the gene editing composition to an individual in need thereof.

[0063] In addition, the present invention provides an anticancer treatment adjuvant method comprising a method of administering the gene editing composition to an individual in need thereof.

[0064] In addition, the present invention provides a use for cancer prevention, treatment, or improvement comprising the gene editing composition as an active ingredient.

[0065] In addition, the present invention provides an anticancer adjuvant use comprising the gene editing composition as an active ingredient.

[0066] In the present invention, target genes that are overexpressed in melanoma and are involved in growth and immune responses were selected, and CRISPR gene scissors-based gRNAs with excellent editing efficiency for said genes were selected and confirmed to act specifically in response to microRNAs in melanoma. Therefore, as a gene editor with high specificity and safety, it has the advantage of being usable in the field of gene therapy applications.

[0067] Figure 1a shows a schematic diagram of the process in which a miRNA-responsive multiplex gene editing system acts within melanoma cells to induce a targeted gene therapy effect.

[0068] FIG. 1b illustrates the target gene of the present invention and the mechanism of action of the gene within melanoma cells.

[0069] Figure 2 shows the gRNA candidates for each target gene.

[0070] Figure 3 shows the results of sequence base analysis for pCas9-single gRNA cloning.

[0071] Figure 4 shows the gene editing efficiency after delivery of a plasmid (pCas9-single gRNA) to gRNA candidates for each of the MC1R, PDL1, and CD133 genes.

[0072] Figure 5 shows the results of electrophoresis (Figure 5a) after delivery of a plasmid (pCas9-single gRNA) to gRNA candidates for the BRAF gene and subsequent treatment with T7E1 enzyme, and the degree of gene modification (Figure 5b) calculated by calculating the area values.

[0073] Figure 6 is a schematic diagram showing the specific action process in melanoma using miRNA action in the present invention.

[0074] Figure 7 shows the miRNA expression levels in melanoma cells B16F10 by performing qRT-PCR.

[0075] Figure 8 is a diagram of the pCas9-miRNA-single gRNA gene sequence.

[0076] Figure 9 shows the results of the sequencing analysis for the cloning of pCas9-miRNA-single gRNA (MC1R-gRNA43).

[0077] Figure 10 shows the gene editing efficiency after pCas9-miRNA-single gRNA and pCas9-single gRNA delivery.

[0078] Figure 11 shows pCas9-multiple gRNA.

[0079] Figure 12 shows the results of sequencing analysis for pCas9-multiple gRNA cloning.

[0080] Figure 13 shows the results of the transfer efficiency (Figure 13a) and average fluorescence intensity (Figure 13b) of pCas9 to B16F10 for the use of various carriers.

[0081] Figure 14a shows the TIDE analysis results for multiple gene editing after delivering only pCas9-multiple gRNA, and Figure 14b shows the TIDE analysis results for multiple gene editing after delivering sequentially up to miR-30b.

[0082] Figure 15a shows the results of the analysis of the relative growth rate of B16F10 cells for single gene editing and multiple gene editing, and Figure 15b shows the results of the analysis of the relative growth rate of B16F10 cells for multiple gene editing when miR-30b was delivered.

[0083] Figure 16 shows the relative growth rate of B16F10 cells when only miRNA was delivered.

[0084] Figure 17a shows micrographs of the metastasis analysis of B16F10 cells for single gene editing and multiple gene editing, Figure 17b shows the relative wound closure rate, and Figure 17c shows the relative wound closure rate at 24 hours.

[0085] Figures 18a to 18c show the relative growth rates of mouse breast cancer cell lines, mouse colon cancer cell lines, and mouse skin cancer cell lines for multiple gene editing.

[0086] Figure 19 shows the degree of cell damage and death following lactate dehydrogenase secretion in neonatal-derived human dermal fibroblasts upon pCas9-multiple gRNA delivery.

[0087] Figure 20a shows an overview of the experiment on confirming treatment efficiency using a mouse model, Figure 20b shows a graph of confirming tumor size at time intervals by injecting a B16F10 cell line cultured with pCas9 or pCas9-multiple gRNA into a C57BL / 6J mouse to produce a melanoma model, and Figure 20c shows a photograph after tumor recovery.

[0088] The present invention is an invention carried out through the following tasks.

[0089] [National R&D projects that supported this invention]

[0090] [Project ID] 2710003787

[0091] [Project No.] 00336523 (RS-2024-00336523)

[0092] [Ministry Name] Ministry of Science and ICT

[0093] [Name of Project Management (Specialized) Agency] National Research Foundation of Korea

[0094] [Research Project Name] Individual Basic Research (Ministry of Science and ICT)

[0095] [Research Project Title] In vivo gene insertion platform using dual prime editing

[0096] Application of treatment for feet and hypercholesterolemia

[0097] [Name of Project Performing Organization] Incheon National University Industry-Academic Cooperation Foundation

[0098] [Research Period] 2024.05.01 ~ 2025.04.30

[0099]

[0100] Hereinafter, the present invention will be described in detail with reference to examples to aid in understanding. However, the following examples are merely illustrative of the content of the present invention and the scope of the present invention is not limited to the following examples. The examples of the present invention are provided to more completely explain the present invention to those with average knowledge in the art.

[0101]

[0102] Example. Melanoma-specific microRNA-responsive multiplex gene editing system

[0103]

[0104] 1. Experimental Method

[0105]

[0106] 1.1. gRNA Design

[0107]

[0108] Synthego's CRISPR Design Tool was used for gRNA design, Mus musculus (Gencode Release M13) was used for the genome, and each target gene was entered into the Gene field. After entering various information into https: / / design.synthego.com / # / , the target activity scores and non-target number information were compared. Three gRNAs were selected for each target gene that had a target score in the top 15% (top 50% for BRAF) and no non-target activity-related mismatches up to two. Subsequently, each gRNA for the target gene was subjected to a BLAST search on NCBI to confirm the presence of target-similar sequences within the genome.

[0109]

[0110] 1.2. Plasmid Cloning

[0111]

[0112] For the cloning of pCas9-single gRNA and pCas9-miRNA-single gRNA, synthesized gRNA oligos (COSMOGENETECH) were reacted using T4 PNK (NEB) in a thermal cycler (BIO RAD Laboratories Inc.) at 37°C for 30 minutes, followed by a reaction at 95°C for 5 minutes, and then hybridization was carried out by lowering the temperature at a rate of 0.1°C per second to 25°C. The reaction product was diluted to a concentration of 50 nM using nuclease-free purified water (NFW) for subsequent use. Table 1 shows the gRNA oligos used in the experiment.

[0113] For vector restriction enzyme treatment, Fast digest BbsI (Fermentas) was applied to pU6-(BbsI)_CBh-Cas9-T2A-mCherry (addgene), and then the degradation reaction was carried out using a Thermal cycler (BIO RAD Laboratories Inc.) under conditions of 60 minutes at 37°C followed by 5 minutes at 70°C.

[0114] For pCas9-multiple gRNA cloning, the plasmid pBHA-multiple gRNA(BIONEER), containing the synthesized multiple gRNA insert sequences, was treated with restriction enzymes using Fast Digest BbsI (Fermentas), and the reaction was carried out under the same conditions as above. Table 2 shows the multiple gRNA insert sequences.

[0115] For agarose gel DNA extraction, a 1% (w / v) agarose gel was prepared in 1x buffer containing 10,000x Nucleic Acid Gel Stain (GenomicBase), and restriction enzyme-treated samples were loaded onto the gel after adding 6x loading buffer (Enzynomics, Inc.). Electrophoresis was performed for 30 minutes using a Mupid-2plus electrophoresis system (Optima Inc.), and the results were verified using a gel recording system LSG 1000 (iNtRON biotechnology). Subsequently, vector DNA was extracted from the agarose gel using a LaboPass™ Gel extraction Kit (COSMOGENETECH).

[0116] Subsequently, the extracted vector, gRNA oligo complex, and multiple gRNA inserts were placed in PCR tubes and subjected to a ligation reaction using T4 Ligase (NEB, M) in a Thermal cycler (BIO RAD Laboratories Inc.) at 22°C for 2 hours.

[0117] After the ligation reaction was completed, the plasmid was transformed using E. coli Top 10, extracted using the FavorPrep™ Plasmid Extraction Mini Kit (Favorgen), and its concentration and purity were measured using a plate reader (Epoch 2, BioTek), followed by sequence analysis (COSMOGENETECH).

[0118]

[0119] No.gRNA 명서열 ( 5'- 3')서열번호1PDL1 gRNA 4 oligo senseCAC CGT CCA AAG GAC TTG TAC GTG G12PDL1 gRNA 4 oligo antisenseAAA CCC ACG TAC AAG TCC GGA GGA C12CPDL oligo senseCAC CGG TAT GGC AGC AAC GTC ACG A34PDL1 gRNA 6 oligo antisenseAAA CTC GTG ACG TTG CTG CCA TAC C45PDL1 gRNA 32 oligo senseCAC CGT GCT GCA TAA TCA GCT ACG G56PDL1 gRNA 32 oligo CAACC GCA GCA GCA TCA C67MC1R gRNA 1 oligo senseCAC CGT GAC AAG ACT ATG TCC ACT C78MC1R gRNA 1 oligo antisenseAAA CGA GTG GAC ATA GTC TTG TCA C89MC1R gRNA 43 oligo senseCAC CGC ACA GAT GAG CAC GTC AATAAR gRNA oligo 314 CCA TTG ACG TGC TCA TCT GTG C1011MC1R gRNA 54 oligo senseCAC CGC TTG TAG TAG GTG ATA AAG A1112MC1R gRNA 54 oligo antisenseAAA CTC TTT ATC ACC TAC TAC AAG C1213CD133 g CGAC CGAC or AGC AGC sense AGC AAC AGC A1314CD133 gRNA 1 oligo antisenseACG ACA ATG ACC CCG ACA CAG CCA C1415CD133 gRNA 9 oligo senseCAC CGT GCA TTC CAT AAC ACT CCT G1516CD133 gRNA 9 oligo antisenseAAA CCA TGAGGGTA TGGAAT GCA C1617CD133 gRNA 20 oligo senseCAC CGG GTG CAC ATC TTC CTC AAC G1718CD133 gRNA 20 oligo antisenseAAA CCG TTG AGG AAG ATG TGC ACC C1819BRAF gRNA 1 oligo senseCAC CGG CAA ATG ATT AAG TTG ACA C1920BRAF gRNA 1 oligo antisenseAAA CGT GTC AAC TTA ATC ATT TGC C2021BRAF gRNA 2 oligo senseCAC CGG TTG ACA CAG GAA CAT ATA G2122BRAF gRNA 2 oligo antisenseAAA CCT ATA TGT TCC TGT GTC AAC C2223BRAF gRNA 6 oligo senseCAC CGG CCC TAT TGG ACA AAT TTG G2324BRAF gRNA 6 oligo antisenseAAA CCC AAA TTT GTC CAA TAG GGC C2425miRNA cs-MC1R gRNA 43 senseCAC CGG TTT TAG AGC TAG AAA TAG CAA GTT AAA ATA AGG CTA GTC CGA GCT GAG TGT AGG ATG TTT ACA CAC AGA TGA GCA CGT CAA TG2526miRNA cs-MC1R gRNA 43 antisenseAAA CCA TTG ACG TGC TCA TCT GTG TGT AAA CAT CCT ACA CTC AGC TCG GAC TAG CCT TAT TTT AAC TTG CTA TTT CTA GCT CTA AAA CC26

[0120]

[0121]

[0122] Insert Name Sequence (5'- 3')Sequence Number Multiple gRNAGAAGACCCCACCGAGCTGAGTGTAGGATGTTTACACACAGATGAGCACGTCAATGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAGCTGAGTGTAGGATGTTTACAGTATGGCAGCAACGTCACGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT AGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAGCTGAGTGTAGGATGTTTACAACACAGCCCCAGTAACAGCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAGTGGCACCGAGTCGGTGCAGCTGAGTGTAGGATGTTTACAGTTGACACAGGAACATATAGGTTTTTCGTCTTC27

[0123]

[0124] 1.3. Cell Culture

[0125]

[0126] Mouse melanoma cells (B16F10) and mouse embryonic fibroblasts (NIH / 3T3) were cultured in DMEM (Dulbecco's modified eagle's medium, Corning) containing 10% fetal bovine serum (Corning) and 1% penicillin-streptomycin (Life Technologies) in a CellCulture CO2 Incubator (ESCO) at 37°C under CO2 standard conditions. Subculture was performed at intervals of 3-4 days.

[0127]

[0128] 1.4. Analysis of Gene Editing Efficiency

[0129]

[0130] To verify the gene editing efficiency for various experiments in the present invention, experiments were conducted as follows. B16F10 and NIH / 3T3 cells cultured at a density of over 80% were placed in 24-well plates at a density of 5.0 x 10⁶ 4 Cells were cultured at 0.5 mL per well under standard conditions for 24 hours.

[0131] A solution of Opti-MEM and Lipofectamine 3000 was mixed with a solution of Opti-MEM, 500 ng of plasmid, and p3000 reagent to make a total volume of 50 μL, reacted at room temperature for 20 minutes, delivered to cells, and cultured under standard conditions for 24 hours. Afterward, the medium was removed and replaced with fresh medium, and cultured under standard conditions for 24 hours. When delivering additional miRNA (BIONICS), the medium was replaced, and a solution of Opti-MEM and Lipofectamine RNAiMAX was mixed with a solution of Opti-MEM and 50 nM of miRNA to make a total volume of 50 μL, reacted at room temperature for 5 minutes, delivered to cells, and cultured under standard conditions for 24 hours.

[0132] After removing the cell medium, 500 μL of DPBS (Dulbecco's Phosphate Buffered Saline, Sigma-Aldrich) was added to wash the cells. Then, the DPBS was removed, and 50 μL of 0.25% Trypsin-EDTA (Thermo Fisher Scientific) was added and reacted under standard conditions for 3 minutes to detach the cells from the well plate. Subsequently, 450 μL of DMEM medium was added to neutralize the 0.25% Trypsin-EDTA, and the mixture was transferred to an E-tube. Genomic DNA was then extracted from the extracted cells using the LaboPass™ Genomic DNA Isolation Kit (COSMOGENETECH).

[0133] Using the previously extracted genomic DNA as a template, PCR reactions were performed with a 300 bp margin before and after each gRNA target site. The PCR reaction was conducted in a thermal cycler by mixing 200 ng of template DNA, 10 μM of primers, and 2X DLRTaq PCR Master Mix. The cycle consisted of 40 cycles of digestion at 95°C for 20 seconds, primer binding at different temperatures for each target for 40 seconds, and extension at 72°C for 1 minute. Table 3 shows the primers for each target site and the primer binding temperatures during PCR. The PCR products were purified using the LaboPass™ PCR Purification Kit (COSMOGENETECH) and stored at -20°C.

[0134] To verify insertion / deletion efficiency through TIDE analysis using PCR amplified products, sequencing was performed (COSMOGENETECH). Subsequently, the resulting sequencing chromatogram file (.ab1) was entered into the TIDE analysis site (http: / tide.nki.nl) and the ICE analysis site (https: / ice.synthego.com / # / ) to analyze base insertion / deletion efficiency and confirm gene editing efficiency. For gene editing using pCas9-single gRNA and pCas9-miRNA-single gRNA, as well as intercellular gene editing, a total of three measurements were presented as individual points and mean ± standard deviations, while for gene editing using pCas9-multiple gRNA, a total of four measurements were presented as individual points and mean ± standard deviations.

[0135] To verify the gene modification efficiency via T7E1 enzyme treatment using PCR amplified product, 200 ng of PCR amplified product and 2 μL of 10X NEBuffer2 (NEB) were placed in a PCR tube, and the total volume was adjusted to 19 μL using NFW. The reaction was then carried out in a thermal cycler at 95°C for 5 minutes, followed by a reduction to 85°C at -2°C / sec, and then to 25°C at -0.1°C / sec. Subsequently, 1 μL of T7EI (NEB) was added, and the enzyme reaction was carried out in a thermal cycler at 37°C for 15 minutes.

[0136] Subsequently, a 3% agarose gel was prepared in 1x buffer containing 10,000x Nucleic Acid Gel Stain (GenomicBase), and enzyme-treated samples were loaded onto the gel after adding 6x loading buffer (Enzynomics, Inc.). Electrophoresis was performed for 40 minutes using a Mupid-2plus electrophoresis system (Optima Inc.), and the results were verified using a gel recording system LSG 1000 (iNtRON biotechnology).

[0137] Subsequently, the gene modification efficiency was verified by calculating the area between bands of each gel using ImageJ. The results were presented as the points and mean ± standard deviation of a total of three measurements.

[0138]

[0139] No.Primer Name Sequence (5'-3')Sequence NumberPrimer Binding Temperature (℃)1MC1R-TIDE-F.PTCA GCA GGA AGT GTC TAT GC28542MC1R-TIDE-R.PCCC AGA AGG ATA GTA AGG GT293PDL1-TIDE-F.PCTA CTG AAC ATT CCC AGG GA30554PDL1-TIDE-R.PGGC TGA GTA TTA TCT GGT ACT G315CD133-TIDE-F.PGCC CGT GTA TAA TCA GTG CTT CT32586CD133-TIDE-R.PTCT AAG CCA TGT CAC TTC CTC TG337BRAF-T7E1-F.PTTG ATG GTG GGT TAT GCT CTC C34578BRAF-T7E1-R.PCAA GCA AAT GAT TAA GTT GAC ACA GG35

[0140]

[0141] 1.5. Real-time Quantitative Polymerase Chain Reaction (qRT-PCR) Using Reverse Transcription Agents for miRNA Quantification

[0142]

[0143] To quantitatively identify miRNAs specifically overexpressed in melanoma cells, real-time quantitative polymerase chain reaction using reverse transcriptase was performed. B16F10 and HEK293T cells cultured at a density of over 80% were placed in 24-well plates at a density of 5.0 x 10⁶ 4 Cells were cultured at 0.5 mL per well under standard conditions for 48 hours.

[0144] Subsequently, to extract RNA, DMEM was removed from each well, and 500 μL of NFW was added for a total of three washes. Cells were lysed by adding 500 μL of Tri-RNA reagent (FAVORGEN), transferred to an E-tube, and incubated at room temperature for 5 minutes. 100 μL of chloroform (Sigma-Aldrich) was added and reacted at room temperature for 2 minutes, followed by centrifugation at 12,000 rpm at 4°C for 3 minutes to transfer only the colorless RNA column to a new 150 μL E-tube. 150 μL of isopropanol (Supelco) was added and reacted at room temperature for 10 minutes, followed by centrifugation at 12,000 rpm at 4°C for 15 minutes to remove the supernatant, after which the RNA pellet was washed with 70% ethanol. Afterwards, NFW was added to melt the pellets, and they were stored at -80 ℃.

[0145] cDNA synthesis was carried out using the miRCURY LNA RT Kit (QIAGEN) with 200 ng of template RNA according to the method provided by the company.

[0146] To perform real-time quantitative polymerase chain reaction, 1 μL of previously synthesized cDNA, 10 μL of 2X GoTaq QPCR Master Mix, 0.6 μL each of 10 μM forward and reverse primers, and 7.8 μL of NFW were added to a qRT-PCR tube and mixed. The qRT-PCR tube was placed in QuantStudio3 (appliedbiosytes) and reacted by first digesting at 95 °C for 60 seconds, followed by digesting at 95 °C for 15 seconds, primer binding at different temperatures for each miRNA primer for 30 seconds, and extension at 72 °C, repeating this process a total of 40 times, after which the results were checked. Table 4 below shows the miRNA primers used and their corresponding primer binding temperatures.

[0147]

[0148] No. Primer Name Sequence ( 5'- 3') Sequence Number Primer Binding Temperature (°C) 1 miR-15b-5p F.PTAG CAG CAC ATC ATG 364 2 2 miR-15b-5p R.PT TTT TTT TTT TTT TTT TTT GTA AAC 37 3 miR-532-5p F.PCAT GCC TTG AGT GTA 384 2 4 miR-532-5p R.PT TTT TTT TTT TTA CGG TCC 39 5 miR-221-3p F.PAGC TAC ATT GTC TGC 404 2 6 miR-221-3p R.PTTT TTT TTT TTT TGA AAC CCA 41 7 miR-222-3p F.PAGC TAC ATC TGG CTA 424 2 8 mmu-miR-222-3p R.PT TTT TTT TTT TAG ACC CAG439Hsa-miR-222-3p R.PTTT TTT TTT TTT TTT ACC CAG4410miR-30b-5p F.PTGT AAA CAT CCT ACA C454211miR-30b-5p R.PTTT TTT TTT TTT TTT TTA GCT GA4612miR-30d-5p F.PTGT AAA CAT CCC CGA474213miR-30d-5p R.PTTT TTT TTT TTT TTC TTC CAG4814Human-GAPDH F.PGTC TCC TCT GAC TTC AAC AG495215Human-GAPDH R.PACC ACC CTG TTG CTG TAG5016Mouse-GAPDH F.PCAT CAC TGC CAC CCA GAA515217Mouse-GAPDH R.PATG CCA GTG AGC TTC CC52

[0149]

[0150] 1.6. Analysis of Fluorescence Intensity After Transformation Using Various Carriers

[0151]

[0152] To select the plasmid with the best delivery efficiency among various non-viral vectors, delivery efficiency was analyzed by comparing the expression levels of the fluorescent protein (mCherry) encoded within the plasmid. B16F10 cells cultured at a density of over 80% were placed in 24-well plates at a density of 5.0 x 10⁶ 4 Cells were cultured at 0.5 mL per well under standard conditions for 48 hours.

[0153] The complex preparation method for each delivery vehicle was carried out by adopting the company's method, which is explained in detail below. For jetPEI, a solution prepared by mixing jetPEI with 150 mM NaCl was mixed with a solution prepared by mixing 150 mM NaCl and 500 ng of pCas9-multiple gRNA to make a total volume of 100 μL, and the complex was prepared and reacted at room temperature for 20 minutes. For Lipofectamine2000 (Invitrogen), a solution prepared by mixing Opti-MEM (Corning) and Lipofectamine2000 was mixed with a solution prepared by mixing Opti-MEM and 500 ng of pCas9-multiple gRNA, and the mixture was reacted at room temperature for 5 minutes; subsequently, the two solutions were combined to make a total volume of 100 μL and reacted at room temperature for 20 minutes. Lipofectamine3000 (Invitrogen) was prepared by mixing a solution of Opti-MEM and Lipofectamine3000 with a solution of Opti-MEM, 500 ng of pCas9-multiple gRNA, and p3000 reagent to a total volume of 50 μL, and reacting at room temperature for 20 minutes. The prepared complex solutions were then placed in separate wells and cultured under standard conditions for one day. After replacing the cell medium with fresh medium, the cells were cultured again under standard conditions for one day.

[0154] After removing the cell medium, the cells were washed with 500 μL of DPBS. Subsequently, the DPBS was removed, and 50 μL of 0.25% Trypsin-EDTA (Thermo Fisher Scientific) was added and incubated under standard conditions for 3 minutes to detach the cells from the well plate. Then, 450 μL of DMEM medium was added to neutralize the 0.25% Trypsin-EDTA; the mixture was then transferred to an E-tube and centrifuged at 300 xg for 5 minutes. The supernatant was removed, and another 500 μL of DPBS was added to loosen the pellet, followed by another centrifugation at 300 xg for 5 minutes. The supernatant was discarded again, and the pellet was loosened with 100 μL of DPBS, followed by Arthur TM Inject 20 μL into the cell analysis slide (NanoEntek) Arthur TM The results were analyzed by measuring the fluorescence intensity of the cells using a Novel Fluorescence Cell Counter (NanoEntek).

[0155]

[0156] 1.7. Analysis of Cell Growth Rate via WST-1 Test

[0157]

[0158] The WST-1 study was conducted to determine the effect of multiplex gene editing on the growth rate of melanoma under various conditions. B16F10 cells cultured at a density of over 80% were placed in 96-well plates at a density of 1.0 x 10⁶ 4 Cells were cultured at 0.1 mL per well under standard conditions for 24 hours.

[0159] Complexes were prepared by mixing a solution of Opti-MEM and Lipofectamine 3000 with a solution of Opti-MEM mixed with 100 ng of either pCas9-single gRNA or pCas9-multiple gRNA for each target gene, respectively, and 10 μL of each complex was added to each well and cultured under standard conditions for 24 hours. After replacing the cell medium, the cells were cultured under standard conditions for 24 hours. When delivering additional miRNA, after replacing the medium, a solution of Opti-MEM mixed with Lipofectamine RNAiMAX was mixed with a solution of Opti-MEM mixed with 10 nM miRNA to make a total volume of 10 μL, reacted at room temperature for 5 minutes, delivered to the cells, and cultured under standard conditions for 24 hours.

[0160] In the experiment where only miRNA was delivered, a solution containing Opti-MEM and Lipofectamine RNAiMAX and a solution containing Opti-MEM and 10 nM miRNA were mixed to make a total of 10 μL, reacted at room temperature for 5 minutes, delivered to cells, and cultured under standard conditions for 24 hours. After replacing the cell medium, the cells were cultured under standard conditions for 24 hours.

[0161] CCK reagent (DonginLS) was rapidly added at 10% of the total volume, and the samples were incubated for 1 hour under standard conditions in the dark. Absorbance was measured at a wavelength of 450 nanometers using a plate reader (Epoch 2, BioTek). For the experiment delivering only miRNA, 8 measurements were taken, and for the experiment on multiplex gene editing, 12 measurements were taken. The values ​​were presented as individual points and the mean ± standard deviation, and statistical analysis was performed using a T-test and displayed (ns: not significant, * : p < 0.05, ** : p < 0.01, *** : p < 0.001, **** : p < 0.0001).

[0162]

[0163] 1.8. Analysis of Cell Metastasis Extent After Multigene Editing via Cell Migration Analysis

[0164]

[0165] Regarding single gene editing, cell migration analysis was performed to determine the effect of multiple gene editing on the extent of melanoma metastasis. B16F10 cells cultured at a density of over 80% were placed in 24-well plates at a density of 5.0 x 10⁶ 4 Cells were cultured at 0.5 mL per well under standard conditions for 24 hours.

[0166] Complexes were prepared by mixing a solution of Lipofectamine3000 in Opti-MEM with a solution of p3000 and 500 ng of either pCas9-single gRNA or pCas9-multiple gRNA for each target gene in Opti-MEM, respectively, and 50 μL of each was added to each well and cultured under standard conditions for 24 hours.

[0167] After replacing the cell medium, a straight scratch was made in the center of the well where the cells were being cultured using a 20-200 μl pipette tip, and the medium was replaced once again. Subsequently, at 4, 8, and 24 hours, the well was examined under a microscope to check how much the cells had moved back to the center, and microscopic images were taken to record this.

[0168] Subsequently, the scratch area at each measurement time was calculated by using ImageJ on the well images to determine the area of ​​the cell-free region in the center. Then, the results were organized using the formula for calculating the relative wound closure rate: Relative Wound Closure Rate : % (Wound area at initial time - Wound area at current time) / Wound area at initial time × 100. The four measurements were presented as individual points and mean ± standard deviation.

[0169]

[0170] 1.9. Analysis of Melanoma Cell-Specific Growth Inhibition via WST-1 Test

[0171]

[0172] WST-1 analysis was performed to determine whether multiplex gene editing using the previously designed pCas9-multiple gRNA acts specifically on melanoma to inhibit cell growth. B16F10, 4T1, and NIH / 3T3 cells cultured at a density of over 80% were placed in 96-well plates at a density of 1.0 x 10⁶ 4 Cells were cultured at 0.1 mL per well under standard conditions for 24 hours.

[0173] Complexes were prepared by mixing a solution of Opti-MEM and Lipofectamine3000 with solutions of Opti-MEM, pCas9-multiple gRNA 100 ng, and p3000, respectively, and 10 μL of each was added to each well and cultured under standard conditions for 24 hours. After replacing the cell medium, the cells were cultured under standard conditions for 24 hours.

[0174] After rapidly adding CCK reagent at 10% of the total volume, the mixture was incubated for 1 hour under standard conditions in the dark. Absorbance was measured at a wavelength of 450 nanometers using a plate reader. Eight measurements were presented as individual points and the mean ± standard deviation, and statistical analysis using a T-test was performed and displayed (ns: not significant, * : p < 0.05, **** : p < 0.0001).

[0175]

[0176] 1.10. Analysis of Melanoma Cell-Specific Growth Inhibition via Lactate Dehydrogenase Testing

[0177]

[0178] Lactate dehydrogenase assays were performed to determine whether pCas9-multiple gRNA induces cell damage or apoptosis when delivered to normal cells. HDFn cells cultured at a density of over 80% were placed in 96-well plates at a density of 1.0 x 10⁶ 4 Cells were cultured at 0.1 mL per well under standard conditions for 24 hours.

[0179] Complexes were prepared by mixing a solution of Opti-MEM and Lipofectamine3000 with solutions of Opti-MEM, pCas9-multiple gRNA 100 ng, and p3000, respectively. These complexes were diluted to 25%, 50%, 75%, and the original concentration, and 10 μL of each was added to each well and incubated under standard conditions for 6 hours. Additionally, Free Lipo was treated with a solution of Opti-MEM containing only Lipo, and Free Multi was treated with a solution of Opti-MEM containing only pCas9-multiple gRNA, and incubated under standard conditions for 6 hours.

[0180] Subsequently, to ensure complete elimination of the positive control group, 10x lysis buffer (Promega) was added, and the samples were incubated at room temperature for 45 minutes. 50 μL of each well was transferred to a new 96-well plate, and an additional 50 μL of CytoTox 96® reagent (Promega) was added to each well. The samples were then incubated at room temperature in the dark for 30 minutes. Afterward, absorbance was measured at a wavelength of 490 nanometers using a plate reader. The eight measurements were presented as individual points and the mean ± standard deviation, and statistical analysis using a T-test was performed and displayed ( **** : p < 0.0001).

[0181]

[0182] 1.11. Analysis of Multi-Gene Editing Treatment Efficacy in Mouse Melanoma Model

[0183]

[0184] To verify the therapeutic efficacy of the multiplex gene editing system in vivo, a mouse melanoma model was constructed, and tumor growth rates were compared. B16F10 cells cultured at a density of over 80% were placed in 75T flasks at a density of 1.0 x 10⁶ 6 Cells were cultured at 20 mL per well under standard conditions for 24 hours.

[0185] Complexes were prepared by mixing a solution of Opti-MEM and Lipofectamine3000 with a solution of Opti-MEM, 20 μg of pCas9-multiple gRNA, and p3000, respectively, and 1 ml of each was added to each flask and cultured under standard conditions for 120 hours.

[0186] Subsequently, after removing the medium, 3 mL of DPBS was added for washing. Then, 2 mL of Trypsin / EDTA was added, and the cells were incubated under standard conditions for 2 minutes before being detached from the flask. 6 mL of DMEM was added, and the cells were recovered by centrifugation at 150 xg for 3 minutes. Cell counts were then performed on each flask, yielding 2 x 10⁶ cells. 6 Cells were placed into E-tubes, centrifuged at 500 xg for 3 minutes to remove the medium, and then the cells were recirculated with 100 μL of PBS.

[0187] Subsequently, 100 μL of the previously recovered cells (2 x 10⁶) were placed onto the skin membrane of the left thigh of a pre-shaved 6-week-old female C57BL / 6J mouse model (Raonbio). 6 Ultra-Fine TM A melanoma model was created by injecting 0.3 mL of II Insulin Syringe (Becton, Dickinson and Company).

[0188] After growing the tumor for 6 days, the width, length, and height of the tumor were measured using a caliper, and the tumor volume was measured using the formula width x length x height x 0.52. The tumor volume was measured using the same method on days 9, 13, 15, 17, 19, and 21.

[0189] On day 21, after measuring the tumor, the mouse model was placed in an euthanasia CO2 incubator to perform euthanasia. After euthanasia, the grown tumor was collected, the results were recorded, and then stored at -80℃.

[0190]

[0191] 2. Experimental Results

[0192]

[0193] 2.1. gRNA Selection for Melanoma Overexpressed Target Genes

[0194]

[0195] 2.1.1. Selection of Editing Target Genes and Selection of gRNA Candidates for Those Genes

[0196]

[0197] (1) Selection of target genes for melanoma overexpression

[0198]

[0199] A total of four genes were selected that are overexpressed in melanoma and are involved in growth, differentiation, and immune function, based on a review of results from previously filed papers (Fig. 1). Regarding each target gene, BRAF is the factor with the highest mutation rate in melanoma and is involved in growth and differentiation through the MAPK signaling pathway, while CD133 is a factor involved in melanoma recurrence, metastasis, and drug resistance. PDL1 is an immunosuppressive factor that inhibits T-cell activity through interaction with PD-1 on T cells, and MC1R, upon interaction with a ligand, is involved in melanin production, cell growth, and differentiation, and acts to inhibit T-cell infiltration into cancer cells. The figure was created using BIORENDER.

[0200]

[0201] (2) Design of CRISPR-Cas9 gRNA candidates for each target gene

[0202]

[0203] To maximize gRNA on-target effects while simultaneously minimizing off-target effects, a total of 12 gRNAs were designed—three for each target gene (MC1R, PDL1, CD133, BRAF)—using a gRNA design tool (Fig. 2). CD274 is the gene name for MC1R, and Prom1 is the gene name for CD133. The numbers following each gRNA represent the gRNA rankings assigned by the design tool, and gRNAs for each target gene were selected based on on-target scores and off-target information (Table 5). Regarding off-target effects, the selected gRNAs were analyzed using NCBI's BLAST search to determine the degree of similarity between target-like sequences and the selected gRNAs at different locations; it was found that no off-target similar sequences had a discrepancy of two bases or fewer.

[0204]

[0205] TargetRANKSEQ ID NO:CUTSITEEXONON TARGET SCOREOFF TARGETSMC1R4UCCAAAGGACUUGUACGUGG5329,373,591Exon 30.6750,0,0,1,606GUAUGGCAGCAACGUCACGA5429,373,615Exon 30.6570,0,0,3,3032UGCUGCAUAAUCAGCUACGG5529,373,859Exon 30.6420,0,0,1,56PDL11UGACAAGACUAUGUCCACUC56123,407,517Exon 10.6090,0,0,9,7043CACAGAUGAGCACGUCAAUG57123,407,863Exon 10.6480,0,0,7,11354CUUGUAGUAGGGAUAAAGA58123,408,039Exon 10.6780,0,0,16,266CD1331ACACAGCCCCAGUAACAGCA5944,094,590Exon 20.6890,0,0,28,2249UGCAUUCCAUAACACUCCUG6044,094,530Exon 20.6760,0,0,11,14420GGUGCACAUCUUCCUCAACG6144,094,425Exon 20.70,0,0,4,59BRAF1GCAAAUGAUUAAGUUGACAC6239,688,315Exon 20.6020,0,0,4,1002GUUGACACAGGAACAUAUAG6339,688,303Exon 20.5580,0,0,12,1706GCCCUAUUGGACAAAUUUGG6439,688,281Exon 20.5480,0,0,3,46

[0206]

[0207] (3) pCas9-single gRNA plasmid cloning

[0208]

[0209] Cloning experiments were conducted by constructing the designed gRNA in an oligo form and ligating it using a pCas9 plasmid containing the Cas9 protein encoding sequence as a vector.

[0210] After conducting pCas9-single gRNA cloning experiments using the E. coli Top 10 strain, sequencing analysis was performed. It was confirmed that all 12 gRNAs were successfully cloned without any mutations in the base pairs (Fig. 3).

[0211]

[0212] 2.1.2. Selection of Optimal gRNA for Each Target Gene

[0213]

[0214] (1) Selection of optimal gRNA through TIDE analysis

[0215]

[0216] After delivering a total of nine pCas9-single gRNAs to the MC1R, PDL1, and CD133 target genes to B16F10 melanoma cell lines, the chromosomes were purified and the target sites were amplified via PCR. The sequence analysis results were then analyzed using the TIDE program to confirm the gene editing results of the gRNAs for each target gene (Fig. 4). By comparing the editing efficiencies, gRNA43 showed the highest editing efficiency for MC1R at 17%, gRNA1 for CD133 at 26%, and gRNA6 for PDL1 at 26%, thus completing the selection of gRNAs for the three target genes.

[0217]

[0218] (2) Selection of optimal gRNA for the BRAF gene through T7E1 enzymatic reaction

[0219]

[0220] After delivering a total of three pCas9-single gRNAs targeting the BRAF gene to B16F10 cells, the chromosomes were purified and the target sites were amplified via PCR. Subsequently, the editing efficiency was confirmed by treating the INDEL site with T7E1, an enzyme that induces gene cleavage, through an enzymatic reaction (Fig. 5). PCR results showed that the gene was amplified by 80 bp. Upon treatment with T7E1, BRAF-gRNA1 split into 26 bp and 54 bp, BRAF-gRNA2 into 30 bp and 50 bp, and BRAF-gRNA6 into 20 bp and 60 bp. Electrophoresis confirmed all cleaved bands (Fig. 5a), and the gene editing efficiency was verified by checking the band intensity using ImageJ (Fig. 5b). By substituting each band intensity into the formula to verify gene editing efficiency, gRNA2 showed the highest average editing efficiency of 3.5%, and based on this, the selection of gRNA was completed (Equation 1).

[0221]

[0222] [Equation 1]

[0223] % Gene modification = 100 x (1 - (1- fraction cleaved) 1 / 2 )

[0224]

[0225] 2.2. Development of a Melanoma-Specific Gene Editing System Based on Multi-Gene Editing

[0226]

[0227] 2.2.1. Introduction of a Melanoma-Specific Operation System

[0228]

[0229] (1) Melanoma-specific operating system design

[0230]

[0231] miRNA is a short RNA molecule for gene expression that forms a complex and completely degrades the nucleotide sequence at a specific location when it fully hybridizes with the nucleotide sequence of the genome. There are various types of miRNAs, and their expression levels vary from cell to cell. Therefore, a design was developed to facilitate expression by using the complementary sequence of the miRNA overexpressed in melanoma cells as a means to link the previously determined gRNA encoding sequences of each target gene (Fig. 6).

[0232] In normal cells, specific miRNAs are not overexpressed, so the miRNA complementary sequence in the middle is not cleaved, and all gRNAs are expressed connectedly, making it very difficult to perform gene editing. However, in melanoma cells, specific miRNAs are overexpressed, so the miRNA complementary sequence is cleaved, and each gRNA is separated from each other, allowing the gene editing function to be performed well.

[0233]

[0234] (2) Discovery and selection of melanoma-specific overexpressed miRNAs through RT-qPCR quantitative analysis

[0235]

[0236] After selecting a total of 6 miRNAs that are overexpressed in melanoma as candidates through a literature search, RT-qPCR was performed to determine the expression levels in the B16F10 cell line (Fig. 7).

[0237] Expression levels were verified by determining how much the miRNA expression level of B16F10 increased relative to GAPDH when the miRNA expression level of HEK293T relative to the housekeeping gene GAPDH was set to 1. As a result, among a total of 6 candidates, miR-30b showed the highest expression level, averaging 3 times, so miR-30b was selected as the melanoma-specific miRNA.

[0238]

[0239] (3) Design and cloning of pCas9-miRNA-single gRNA for miRNA function verification

[0240]

[0241] To verify whether gene editing occurs in B16F10 cells when the miRNA complementary sequence is in the middle of the gRNA, a gRNA scaffold-like sequence was designed to be expressed ahead of the miRNA complementary sequence and the gRNA sequence (Fig. 8).

[0242] In the presence of miRNA, the expressed gRNA will be able to perform normal gene editing functions as the gRNA scaffold-like sequence is cleaved. Subsequently, in the presentation of experimental results, the complementary sequence was indicated by the abbreviation 'cs'.

[0243] Cloning was performed in the same manner as the previous pCas9-single gRNA cloning method, and after conducting the cloning experiment using the E. coli Top 10 strain, sequencing analysis was performed (Fig. 9). Sequencing confirmed that the cloning was successful.

[0244]

[0245] (4) Confirmation of gene editing operation of the melanoma-specific system through TIDE analysis

[0246]

[0247] After delivering the previously prepared plasmids pCas9-miRNA-single gRNA and pCas9-single gRNA to B16F10 cell lines, the gene editing efficiency was confirmed by TIDE analysis (Fig. 10). The target gene is MC1R.

[0248] The gene editing efficiency was found to be an average of 15.2% for pCas9-single gRNA (no miRNA cs) and 4.0% for pCas9-miRNA-single gRNA (miR30b cs). This confirmed that although gene editing was inhibited and reduced due to gRNA scaffold mimics, the miRNA functioned to achieve gene editing efficiency.

[0249]

[0250] 2.2.2. Production of Multiple Gene Editing Melanoma-Specific Plasmids

[0251]

[0252] (1) Design of a multi-gene edited melanoma-specific plasmid

[0253]

[0254] A plasmid was designed that can induce multiple gene editing by expressing all target gene gRNAs and Cas9 proteins upon delivery of a single plasmid (Fig. 11).

[0255] By designing the gRNAs for each previously selected target gene to be linked to the miR-30b complementary sequence, when actually expressed, the miR-30b complementary sequence is cleaved through miRNA action within melanoma cells, causing each gRNA to detach and induce multiple gene editing.

[0256]

[0257] (2) Cloning of multiple gene-editing melanoma-specific plasmids

[0258]

[0259] To clone the previously designed plasmid (pCas9-multiple gRNA), the plasmid containing the gRNA insert and the pCas9 vector were ligated after cutting with the BbsI restriction enzyme.

[0260] Subsequently, cloning experiments were conducted using the E. coli Top 10 strains in the same manner as in the previous experiment, followed by sequencing analysis (Fig. 12). A total of 7 plasmids were extracted, and it was confirmed that all of them matched the designed reference sequence.

[0261]

[0262] 2.3. Optimization of Delivery Efficiency to B16F10 Cells

[0263]

[0264] 2.3.1. Selection of Carriers to B16F10 Cells

[0265]

[0266] Until now, plasmid delivery has been carried out using the Polyethylenimine (PEI)-based jetPEI; however, since this method does not have very high delivery efficiency and has high cytotoxicity, experiments were conducted to select a different delivery vehicle to further improve delivery efficiency.

[0267] Delivery was performed using the liposome-based drugs Lipofectamine 2000 and Lipofectamine 3000, and the PEI-based drug jetPEI, and the delivery efficiency was confirmed through the fluorescence intensity obtained by the expression of mCherry encoded in the pCas9 plasmid (Fig. 13).

[0268] Compared to PEI, the delivery efficiency of Lipo3000 was about twice as high, and when checking the mean fluorescence intensity (MFI), it was confirmed that Lipo3000 had a higher delivery efficiency of 2.7 times compared to PEI for free pDNA, confirming that Lipofectamine 3000 is the best carrier for plasmid delivery.

[0269]

[0270] 2.4 Verification of Therapeutic Efficacy of a Multi-Gene Editing Melanoma-Specific Gene Editing System

[0271]

[0272] 2.4.1. Verification of Multi-Gene Editing Efficiency via TIDE Analysis

[0273]

[0274] The previously cloned pCas9-multiple gRNA was delivered to B16F10 cell lines using Lipofectamine 3000, and then TIDE analysis was performed to confirm the gene editing efficiency at each target gene site (Fig. 14a).

[0275] Excluding BRAF, which is difficult to confirm with TIDE analysis, the gene editing efficiency was checked for a total of three genes. The results showed average gene editing efficiencies of 3.3% for the MC1R gene and 8.4% for CD133, confirming that simultaneous editing is possible. When comparing gene editing efficiency with pCas9-miRNA-single gRNA, there was no significant difference between simultaneous editing (3.3%) and single editing (4.0%), confirming that multiple gene editing is possible without a decrease in efficiency.

[0276] Additionally, based on the principle of multiplex gene editing according to the miRNA responsiveness of pCas9-multiple gRNA, miR-30b mimics, which were previously confirmed to be overexpressed in RT-qPCR B16F10, were delivered to the B16F10 cell line using pCas9-multiple gRNA via Lipofectamine 3000, followed by sequential delivery via Lipofectamine RNAiMAX, and then TIDE analysis was performed to confirm the gene editing efficiency at each target gene site (Fig. 14b).

[0277] Compared to previous experiments in which miR-30b mimics were not delivered, when editing efficiency was checked, the MC1R gene showed an increase in gene editing efficiency of approximately 4 times at 11.7%, and the CD133 gene showed an increase of approximately 2 times at 8.1%. This demonstrated that the additional supply of miR-30b further activated the miRNA-responsive multi-gene editing system, thereby increasing gene editing efficiency, and also confirmed that the enhancement of gRNA function through actual miRNA responsiveness was functioning normally.

[0278]

[0279] 2.4.2. Confirmation of Cell Growth Inhibition by Multiple Gene Editing

[0280]

[0281] The extent to which cell growth is inhibited by multiple gene editing under various conditions was confirmed by measuring absorbance through WST-1 analysis (Fig. 15).

[0282] First, we confirmed how much more cell growth is inhibited when multiple gene editing is performed compared to single gene editing (Fig. 15a). When checking the absorbance results, single gene editing showed a cell growth rate of about 80%, with MC1R at 84%, PDL1 at 80%, CD133 at 94%, and BRAF at 85%, whereas multiple gene editing showed a lower cell growth rate of 74%.

[0283] Compared to the previous gene editing efficiency experiment results, single gene editing showed more than four times the gene editing efficiency for each target gene compared to multiple gene editing, but it was confirmed that the cell growth rate was lowered further through the synergistic effect using multiple gene editing.

[0284] Next, we investigated how much more cell growth was inhibited when miRNAs were sequentially delivered to enhance gene editing efficiency during multiplex gene editing (Fig. 15b). When examining the absorbance results, it was confirmed that the cell growth rate decreased with increasing gene editing efficiency, with 79% for multiplex gene editing when miRNAs were not delivered, 69% when a single-stranded negative control (ss-NC) was delivered, and 60% when miR-30b mimics were delivered.

[0285] Finally, to determine whether cell growth was inhibited due to delivery toxicity caused by miRNA delivery, the cell growth rate when only miR-30b was delivered was checked (Fig. 16). When checking the absorbance results, it was confirmed that the experimental group delivered with miRNA showed a higher cell growth rate of 110% compared to the control group delivered only Lipofectamine, confirming that there was no inhibition of cell growth caused by miR-30b delivery.

[0286] In summary, multiplex gene editing simultaneously edited multiple genes related to growth, differentiation, and immune evasion in melanoma, inducing a synergistic effect that inhibited cell growth more severely than single-gene editing. Furthermore, it was confirmed that delivering miRNA to enhance gene editing efficiency resulted in even greater inhibition, thereby demonstrating the therapeutic effect of melanoma.

[0287]

[0288] 2.4.3. Confirmation of Inhibition of Cell Metastasis by Multiple Gene Editing

[0289]

[0290] To determine how much more multiple gene editing inhibits the metastasis of melanoma cells compared to single gene editing, cell migration analysis was performed (Fig. 17).

[0291] After inducing single gene editing or multiple gene editing, a scratch was made in the middle of the well, and the degree of area reduction over time was confirmed using a microscope (Fig. 17a). At this time, compared to the control group in which no gene editing was performed, it was confirmed that the scratched area decreased less over time with single gene editing or multiple gene editing.

[0292] When the scratched area was converted into a quantitative value using ImageJ and the relative area closure rate was calculated, after 24 hours, the average closure rate was found to be 73% for the control group without gene editing, 60% for MC1R, 62% for PDL1, 62% for CD133, 55% for BRAF for single gene editing, and 53% for multiple gene editing (Figs. 17b, 17c).

[0293] Accordingly, similar to the previous cell growth inhibition experiment, it was confirmed that although multiple gene editing has lower gene editing efficiency compared to single gene editing, it reduces the degree of metastasis in melanoma cells by inducing a synergistic effect through the simultaneous editing of multiple genes.

[0294]

[0295] 2.4.4 Confirmation of Therapeutic Specificity and Stability of Multiple Gene Editing Systems

[0296]

[0297] (1) Confirmation of the specificity of multiple gene editing for melanoma treatment

[0298]

[0299] To confirm whether the multiplex gene editing system using the previously designed and fabricated pCas9-multiple gRNA acts specifically in melanoma, various mouse tumor cells were cultured, and after delivering the pCas9-multiple gRNA, the degree of cell growth inhibition was confirmed by checking the absorbance after the WST-1 experiment (Fig. 18).

[0300] The cell lines used were a total of three: mouse breast cancer cell line 4T1 (Fig. 18a), mouse colon cancer cell line CT-26 (Fig. 18b), and mouse melanoma cell line B16F10 (Fig. 18c). After culturing each of the above cells and delivering pCas9-multiple gRNA, the degree of cell growth inhibition was compared. Compared to the control group, 4T1 showed 92% and CT-26 showed 111%, indicating that even if the cell growth rate increased or decreased, there was almost no difference from the control group and no statistical difference existed. However, B16F10 showed 81% cell growth inhibition, and it was confirmed that there was a very high statistical difference.

[0301] Through this, it was confirmed that the pCas9-multiple gRNA was designed with target genes selected as important factors for cell growth, differentiation, and immune function in melanoma, and miRNAs selected as overexpressed in melanoma, and that it acts specifically only in melanoma to produce therapeutic efficiency.

[0302] Additionally, it is believed that if target genes in other tumor cell lines are selected to replace gRNAs, and miRNA responsiveness is designed to respond to miRNAs overexpressed in the tumor cell lines, it can be developed into a multi-gene editing system capable of acting specifically on that tumor.

[0303]

[0304] (2) Confirmation of cell stability following delivery of a multiple gene editing system

[0305]

[0306] To determine whether the previously designed and fabricated pCas9-multiple gRNA exhibits toxicity when delivered to normal cells, a lactate dehydrogenase test was performed on HDFn cells, which are neonatal human dermal fibroblasts, to check the degree of cell damage or death (Fig. 19). Lactate dehydrogenase is one of the enzymes released outside the cell when cell damage or death occurs.

[0307] After culturing HDFn cells and delivering pCas9-multiple gRNA, the degree of lactate dehydrogenase release due to toxicity, CytoTox 96 ® This was confirmed through absorbance after reagent treatment. At this time, compared to the positive control group in which all lactate dehydrogenase was released upon treatment with cell lysis buffer, delivery of Lipofectamine 3000 alone resulted in 4% release, delivery of pCas9-multiple gRNA alone resulted in 6% release, and delivery of the mixed complex of the two at various concentrations resulted in 5–10% release of lactate dehydrogenase.

[0308] Through verification of the results, it was confirmed that pCas9-multiple gRNA is delivered into normal cells with minimal toxicity, as almost no lactate dehydrogenase is released, causing almost no cell damage or death.

[0309]

[0310] 2.5 Confirmation of Therapeutic Efficacy Following Multiple Gene Editing in a Mouse Melanoma Model

[0311]

[0312] To determine whether multiple gene editing in melanoma using the designed and produced pCas9-multiple gRNA shows therapeutic efficiency in an actual tumor model, a mouse melanoma model was created using melanoma cell lines delivered with pCas9 or pCas9-multiple gRNA, and the tumor growth rate was compared (Fig. 20a).

[0313] Melanoma cell lines pre-delivered with pCas9 or pCas9-multiple gRNA in vitro were cultured and injected into a C57BL / 6J mouse model, where they were incubated for 6 days. Subsequently, tumor size was measured at regular intervals, and tumor volumes were calculated and compared (Fig. 20b). When comparing tumor sizes, it was observed that the experimental group delivered with pCas9-multiple gRNA showed a slower tumor growth rate over time compared to the control group of melanoma models delivered with pCas9.

[0314] Subsequently, when the size was last compared on day 21, pCas9 was 2884 mm 3 , pCas9-multiple gRNA is 326 mm 3 This showed a difference in tumor size of approximately nine times, and a clear difference was also shown when comparing sizes after recovery (Fig. 20c).

[0315] We confirmed that multiplex gene editing demonstrated therapeutic efficacy in an actual melanoma model, thereby reducing the growth rate of melanoma, and verified that it exhibited therapeutic efficacy not only in vitro but also in vivo.

[0316]

[0317] Foregoing, specific parts of the present invention have been described in detail. It will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. Accordingly, the actual scope of the invention is defined by the appended claims and their equivalents.

Claims

1. A multiplex gene editing system comprising a Cas protein (CRISPR-associated protein); and one or more gRNAs selected from a group consisting of four different gRNAs (guide RNAs).

2. In Paragraph 1, A multiple gene editing system in which the above Cas protein is a Cas9 protein, a functional analog or variant protein thereof.

3. In Paragraph 1, A multiple gene editing system in which the above gRNA targets one or more genes selected from the group consisting of BRAF, PDL1, CD133, and MC1R.

4. In Paragraph 1, A multiple gene editing system in which the above gRNA is active via miRNA.

5. In Paragraph 4, A multiple gene editing system in which the above activity is induced by the individual separation of four different gRNAs linked together.

6. In Paragraph 4, A multiple gene editing system in which the above miRNA is overexpressed in melanoma cells.

7. In Paragraph 4, A multiplex gene editing system in which the miRNA is constructed using a forward primer containing the nucleotide sequence of SEQ ID NO. 45 and a reverse primer containing the nucleotide sequence of SEQ ID NO.

46.

8. In Paragraph 1, A multiple gene editing system in which the above gRNA includes the nucleotide sequence of SEQ ID NO. 27 as a target sequence.

9. In Paragraph 1, A multiple gene editing system in which the above gRNA comprises one or more nucleotide sequences selected from the group consisting of SEQ ID NOs 53 to 55 as target sequences.

10. In Paragraph 1, A multiple gene editing system in which the above gRNA comprises one or more nucleotide sequences selected from the group consisting of SEQ ID NOs 56 to 58 as target sequences.

11. In Paragraph 1, A multiple gene editing system in which the above gRNA comprises one or more nucleotide sequences selected from the group consisting of SEQ ID NOs 59 to 61 as target sequences.

12. In Paragraph 1, A multiple gene editing system in which the above gRNA comprises one or more nucleotide sequences selected from the group consisting of SEQ ID NOs 62 to 64 as target sequences.

13. A polynucleotide encoding a multiple gene editing system according to any one of claims 1 to 12.

14. A recombinant vector comprising the polynucleotide of claim 13.

15. In Paragraph 14, The above vector is a recombinant vector that is a plasmid vector, a cosmid vector, or a viral vector.

16. A transformant into which the recombinant vector of paragraph 14 or 15 has been introduced.

17. In Paragraph 16, The above-described transformant is characterized by reduced off-target binding affinity to target DNA and enhanced on-target cleavage efficiency.

18. A gene editing composition comprising the polynucleotide of claim 13.

19. A pharmaceutical composition for the treatment or prevention of cancer, comprising a gene editing composition according to paragraph 18.

20. In Paragraph 19, A pharmaceutical composition for the treatment or prevention of cancer, wherein the above cancer is one or more selected from liver cancer, lung cancer, pancreatic cancer, non-small cell lung cancer, colon cancer, bone cancer, skin cancer, head or neck cancer, skin or intraocular melanoma, uterine cancer, ovarian cancer, rectal cancer, stomach cancer, pro-anal cancer, colon cancer, breast cancer, esophageal cancer, small intestine cancer, endocrine gland cancer, thyroid cancer, parathyroid cancer, adrenal cancer, and soft tissue sarcoma.

21. A method for preventing, treating, or improving cancer, comprising a method of administering a gene editing composition according to paragraph 18 to an individual in need thereof.

22. An adjuvant anticancer treatment method comprising a method of administering a gene editing composition according to paragraph 18 to an individual in need thereof.

23. Use for the prevention, treatment, or improvement of cancer comprising a gene editing composition according to paragraph 18 as an active ingredient.

24. An anticancer adjuvant use comprising a gene editing composition according to paragraph 18 as an active ingredient.