In vitro methods for editing a B-cell lymphoma 11a gene in a human cell by genome editing, guide ribonucleic acids, and genetically engineered cells.
Genome engineering techniques targeting the BCL11A gene in human cells provide a permanent solution to hemoglobinopathies by enhancing globin protein production, addressing the limitations of current treatments and improving oxygen-carrying capacity.
Patent Information
- Application Number
- BR112018071321
- Authority / Receiving Office
- BR · BR
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2016-12-02
- Filing Date
- 2017-04-18
- Publication Date
- 2026-07-07
- Estimated Expiration
- 2037-04-18
AI Technical Summary
Current treatments for hemoglobinopathies, such as sickle cell anemia and thalassemia, are limited and lack effective, safe methods to address the genetic basis of these disorders, particularly in modulating or inactivating the BCL11A gene to improve oxygen-carrying capacity in red blood cells.
Utilizing genome engineering tools to introduce DNA endonucleases into human cells to create permanent alterations in the BCL11A gene, including single-strand or double-strand breaks, resulting in the deletion, modulation, or inactivation of its transcriptional control sequences, and employing methods like ex vivo and in vivo approaches to implant genome-edited hematopoietic progenitor cells to treat hemoglobinopathies.
This approach enhances the production of normal globin proteins, improving oxygen-carrying capacity and reducing symptoms associated with hemoglobinopathies, offering a potentially curative treatment by upregulating γ-globin expression.
Smart Images

Figure 00000201_0000 
Figure 00000202_0000 
Figure 00000203_0000
Abstract
Description
Descriptive Report of the Invention Patent for IN VITRO METHODS FOR EDITING A B-CELL LYMPHOMA GENE 11A IN A HUMAN CELL BY GENOME EDITING, GUIDE RIBONUCLEIC ACIDS AND GENETICALLY ENGINEERED CELLS. Field
[001] This application provides materials and methods for treating patients with hemoglobinopathies, both ex vivo and in vivo. In addition, this application provides materials and methods for the elimination, modulation or inactivation of a transcriptional control sequence of a B-cell lymphoma 11A (BCL11A) gene in a cell by genome editing. RELATED ORDERS
[002] This application claims the benefit of the US Provisional Application. US Provisional Application 62 / 324,024 filed on April 18, 2016; US Provisional Application 62 / 382,522 filed on September 1, 2016; and US Provisional Application 62 / 429,428 filed on December 2, 2016, all of which are incorporated herein by reference in their entirety. Incorporation by Reference of Sequence Listing
[003] This application contains a Sequence Listing in machine-readable format (filename: 160077PCT Sequence Listing; 14,446,299 bytes - ASCII text file; created on April 7, 2017), which is incorporated herein by reference in its entirety and forms part of the description. Foundation
[004] Hemoglobinopathies include anemias of genetic origin, which result in decreased production and / or increased destruction of red blood cells. These disorders also include genetic defects, which result in the production of abnormal hemoglobins with an associated inability to maintain oxygen concentration. Petition 870200048765, dated 04 / 17 / 2020, p. 6 / 216 2 / 197 Many of these disorders are referred to as β-hemoglobinopathies due to their inability to produce normal β-globin protein in sufficient quantities or inability to produce normal β-globin protein altogether. For example, β-thalassemias result from a partial or complete defect in the expression of the β-globin gene, leading to deficient or absent adult hemoglobin (HbA). Sickle cell anemia results from a point mutation in the structural gene for β-globin, leading to the production of an abnormal hemoglobin (HbS) (Atweh, Semin. Hematol. 38(4):367-73 (2001)). Hemoglobinopathies result in a reduction in the blood's oxygen-carrying capacity, which can lead to symptoms such as fatigue, dizziness, and shortness of breath, particularly during exercise.
[005] For patients diagnosed with hemoglobinopathy, currently only a few symptomatic treatments are available, such as a blood transfusion, to increase oxygen levels in the blood.
[006] Genome engineering refers to the strategies and techniques for the targeted, specific modification of the genetic information (genome) of living organisms. Genome engineering is a very active research field due to the wide range of possible applications, particularly in the areas of human health; correcting a gene that carries a harmful mutation, for example, or exploring the function of a gene. Early technologies developed to insert a transgene into a living cell were often limited by the random nature of the insertion of the new sequence into the genome. Random insertions into the genome can result in the disruption of the normal regulation of neighboring genes, leading to serious undesirable effects. Furthermore, random integration technologies offer little reproducibility, as there is no guarantee that the sequence would be inserted in the same location in two different cells. Strategies re Petition 870200048765, dated 04 / 17 / 2020, page 7 / 216 3 / 197 genome engineering technologies, such as ZFNs, TALENs, HEs, and MegaTALs, allow a specific area of DNA to be modified, thus increasing the precision of the correction or insertion compared to earlier technologies. These newer platforms offer a much higher degree of reproducibility, but still have their limitations.
[007] Despite the efforts of researchers and medical professionals around the world who have been trying to address hemoglobinopathies, there remains a critical need to develop safe and effective treatments for hemoglobinopathies. Summary
[008] The present invention presents an approach to address the genetic basis of hemoglobinopathies. Using genome engineering tools to create permanent changes in the genome that can delete, modulate, or inactivate a transcriptional control sequence of the BCL11A gene with a single treatment, the resulting therapy can improve the effects of hemoglobinopathies.
[009] Cellular, ex vivo and in vivo methods are provided for creating permanent alterations in the genome by eliminating, modulating or inactivating a transcriptional control sequence of the BCL11A gene, which can be used to treat hemoglobinopathies. Components, kits and compositions for performing such methods are also provided herein. Cells produced by such methods are also provided. Examples of hemoglobinopathies include sickle cell anemia and thalassemia (α, β, δ, γ, and combinations thereof).
[0010] A method is provided here for editing a B-cell lymphoma 11A (BCL11A) gene in a human cell by genome editing, the method comprising the step of introducing into the human cell one or more deoxyribonucleic acid (DNA) endonucleases. Petition 870200048765, dated 04 / 17 / 2020, page 8 / 216 4 / 197 to perform one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene, resulting in the permanent deletion, modulation, or inactivation of a transcriptional control sequence of the BCL11A gene. The transcriptional control sequence may be located within a second intron of the BCL11A gene. The transcriptional control sequence may be located within a DNA hypersensitivity site +58 (DHS) of the BCL11A gene.
[0011] Also provided here is an ex vivo method for treating a patient (e.g., a human) with a hemoglobinopathy, the method comprising the steps of: creating a patient-specific induced pluripotent stem cell (iPSC); editing within or near a BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene of the iPSC; differentiating the genome-edited iPSC into a hematopoietic progenitor cell; and implanting the hematopoietic progenitor cell into the patient.
[0012] The step of creating a patient-induced pluripotent stem cell (iPSC) may involve: isolating a somatic cell from the patient; and introducing a set of genes associated with pluripotency into the somatic cell to induce the somatic cell to become a pluripotent stem cell. The somatic cell may be a fibroblast. The set of genes associated with pluripotency may be one or more of the genes selected from the group consisting of OCT4, SOX2, KLF4, Lin28, NANOG, and cMYC.
[0013] The step of editing within or near a BCL11A gene or other DNA sequence encoding a regulatory element of the iPSC's BCL11A gene may include introducing one or more deoxyribonucleic acid (DNA) endonucleases into the iPSC to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within Petition 870200048765, dated 04 / 17 / 2020, p. 9 / 216 5 / 197 or near the BCL11A gene or another DNA sequence encoding a regulatory element of the BCL11A gene, resulting in the permanent deletion, modulation, or inactivation of a transcriptional control sequence of the BCL11A gene.
[0014] The step of differentiating genome-edited iPSCs into hematopoietic progenitor cells may comprise one or more of the following: treatment with a combination of small molecules, delivery of transcription factors (e.g., master transcription factors), or delivery of mRNA encoding transcription factors (e.g., master transcription factors).
[0015] The step of implanting the hematopoietic progenitor cell into the patient may involve implanting the hematopoietic progenitor cell into the patient by transplantation, local injection, systemic infusion, or combinations thereof.
[0016] Also provided here is an ex vivo method for treating a patient (e.g., a human) with a hemoglobinopathy, the method comprising the steps of: isolating a mesenchymal stem cell from the patient; editing within or near a BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene of the mesenchymal stem cell; differentiating the genome-edited mesenchymal stem cell into a hematopoietic progenitor cell; and implanting the hematopoietic progenitor cell into the patient.
[0017] Mesenchymal stem cells can be isolated from the patient's bone marrow or peripheral blood. The step of isolating a mesenchymal stem cell from the patient may involve aspirating bone marrow and isolating mesenchymal cells using density gradient centrifugation medium.
[0018] The step of editing within or near the BCL11A gene or other DNA sequence that encodes a gene regulatory element. Petition 870200048765, dated 04 / 17 / 2020, page 10 / 216 6 / 197 Mesenchymal stem cell BCL11A may involve introducing into the mesenchymal stem cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene, resulting in the permanent deletion, modulation, or inactivation of a transcriptional control sequence of the BCL11A gene.
[0019] The step of differentiating the genome-edited mesenchymal stem cell into a hematopoietic progenitor cell may comprise one or more of the following: treatment with a combination of small molecules, delivery of transcription factors (e.g., master transcription factors), or delivery of mRNA encoding transcription factors (e.g., master transcription factors).
[0020] The step of implanting the hematopoietic progenitor cell into the patient may involve implanting the hematopoietic progenitor cell into the patient by transplantation, local injection, systemic infusion, or combinations thereof.
[0021] Also provided here is an ex vivo method for treating a patient (e.g., a human) with a hemoglobinopathy, the method comprising the steps of: isolating a hematopoietic progenitor cell from the patient; editing within or near a BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene of the hematopoietic progenitor cell; and implanting the genome-edited hematopoietic progenitor cell into the patient.
[0022] The method may also involve treating the patient with granulocyte colony-stimulating factor (GCSF) before the step of isolating a hematopoietic progenitor cell from the patient. The step of treating the patient with granulocyte colony-stimulating factor Petition 870200048765, dated 17 / 04 / 2020, page 11 / 216 7 / 197 tos (GCSF) can be performed in combination with Plerixaflor.
[0023] The step of isolating a hematopoietic progenitor cell from the patient may involve isolating CD34+ cells.
[0024] The step of editing within or near a BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene in the hematopoietic progenitor cell may involve introducing into the hematopoietic progenitor cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene, resulting in a permanent deletion, modulation, or inactivation of a transcriptional control sequence of the BCL11A gene.
[0025] The step of implanting the genome-edited hematopoietic progenitor cell into the patient may involve implanting the genome-edited hematopoietic progenitor cell into the patient by transplantation, local injection, systemic infusion, or combinations thereof.
[0026] An in vivo method is also provided here for treating a patient (e.g., a human) with a hemoglobinopathy, the method comprising the step of editing a BCL11A gene in a patient cell.
[0027] The step of editing a BCL11A gene in a patient cell may involve introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene, resulting in the permanent elimination, modulation, or inactivation of a transcriptional control of the BCL11A gene. The cell may be a bone marrow cell, a hematopoietic progenitor cell, a CD34+ cell, or a combination thereof. Petition 870200048765, dated 17 / 04 / 2020, page 12 / 216 8 / 197 of the same.
[0028] One or more DNA endonucleases may be a Cas1, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, or Cpf1 endonuclease; a homologue thereof, a recombination of the naturally occurring molecule thereof, a codon-optimized version thereof, or modified versions thereof, and combinations thereof.
[0029] The method may comprise introducing into the cell one or more polynucleotides encoding one or more DNA endonucleases. The method may comprise introducing into the cell one or more ribonucleic acids (RNAs) encoding one or more DNA endonucleases. The one or more polynucleotides or one or more RNAs may be one or more modified polynucleotides or one or more modified RNAs. The one or more DNA endonucleases may be one or more proteins or polypeptides. The one or more proteins or polypeptides may be flanked at the N-terminal, the C-terminal, or both the N-terminal and C-terminal by one or more nuclear localization signals (NLSs). The one or more proteins or polypeptides may be flanked by two NLSs, one NLS located at the N-terminal and the second NLS located at the C-terminal. The one or more NLSs may be an SV40 NLS.
[0030] The method may also involve introducing one or more guide ribonucleic acids (gRNAs) into the cell. The one or more gRNAs may be single-molecule guide RNAs (sgRNAs). The one or more gRNAs or one or more sgRNAs may be one or more modified gRNAs, one or more modified sgRNAs, or combinations thereof. The one or more modified sgRNAs may comprise three 2'-O residues. Petition 870200048765, dated 04 / 17 / 2020, p. 13 / 216 9 / 197 methylphosphorothioate at or near each of its 5' and 3' ends. The modified sgRNA may be the nucleic acid sequence of SEQ ID NO: 71,959. One or more DNA endonucleases may be pre-complexed with one or more gRNAs, one or more sgRNAs, or combinations thereof to form one or more ribonucleoproteins (RNPs). The weight ratio of sgRNA to DNA endonuclease in the RNP may be 1:1. The sgRNA may comprise the nucleic acid sequence of SEQ ID NO: 71,959, the sgRNA may be an S. pyogenes Cas9 comprising an N-terminal SV40 NLS and a C-terminal SV40 NLS, and the weight ratio of sgRNA to DNA endonuclease may be 1:1.
[0031] The method may further comprise introducing into the cell a polynucleotide donor template comprising a wild-type BCL11A gene or cDNA comprising a modified transcriptional control sequence.
[0032] The method may further comprise introducing into the cell a guide ribonucleic acid (gRNA) and a polynucleotide donor template comprising a wild-type BCL11A gene or cDNA comprising a modified transcriptional control sequence. One or more DNA endonucleases may be one or more Cas9 or Cpf1 endonucleases that effect a single-strand break (SSB) or double-strand break (DSB) at a locus within or near the BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene, which facilitates the insertion of a new polynucleotide donor template sequence into the chromosomal DNA at the locus resulting in permanent insertion, modulation, or inactivation of the transcriptional control sequence of the chromosomal DNA proximal to the locus. The gRNA may comprise a spacer sequence that is complementary to a segment of the locus. Proximal can refer to nucleotides both upstream and downstream of the locus. Petition 870200048765, dated 04 / 17 / 2020, p. 14 / 216 10 / 197
[0033] The method may further comprise introducing into the cell one or more guide ribonucleic acids (gRNAs) and a polynucleotide donor template comprising a wild-type BCL11A gene or cDNA comprising a modified transcriptional control sequence. One or more DNA endonucleases may be one or more Cas9 or Cpf1 endonucleases that effect or create a pair of single-strand breaks (SSBs) and / or double-strand breaks (DSBs), the first break at a 5' locus and the second break at a 3' locus, within or near the BCL11A gene or another DNA sequence encoding a regulatory element of the BCL11A gene, which facilitates the insertion of a new donor polynucleotide template sequence into the chromosomal DNA between the 5' and 3' loci, resulting in a permanent insertion, modulation, or inactivation of the transcriptional control sequence of the chromosomal DNA between the 5' and 3' loci. A guide RNA may create a pair of SSBs or DSBs.The single guide RNA may comprise a spacer sequence that is complementary to the 5' or 3' locus. Alternatively, the method may comprise a first guide RNA and a second guide RNA. The first guide RNA may comprise a spacer sequence that is complementary to a segment of the 5' locus, and the second guide RNA may comprise a spacer sequence that is complementary to a segment of the 3' locus. The donor template may be single or double. The modified transcriptional control sequence may be located within a second intron of the BCL11A gene. The transcriptional control sequence may be located within a +58 DNA hypersensitivity (DHS) site of the BCL11A gene.
[0034] The one or two gRNAs may be one or two single-molecule guide RNAs (sgRNAs). The one or two gRNAs or one or two sgRNAs may be one or two modified gRNAs or one or two modified sgRNAs. The modified sgRNA may comprise three residues Petition 870200048765, dated 04 / 17 / 2020, p. 15 / 216 11 / 197 2'-O-methylphosphorothioate duos at or near each of their 5' and 3' ends. The modified sgRNA may be the nucleic acid sequence SEQ ID NO: 71,959. One or more Cas9 endonucleases may be pre-complexed with one or two gRNAs or one or two sgRNAs to form one or more ribonucleoproteins (RNPs). One or more Cas9 endonucleases may be flanked at the N-terminal, C-terminal, or both the N-terminal and C-terminal by one or more nuclear localization signals (NLSs). One or more Cas9 endonucleases may be flanked by two NLSs, one NLS located at the N-terminal and the second NLS located at the C-terminal. The one or more NLSs may be an SV40 NLS. The weight ratio of sgRNA to Cas9 endonuclease in RNP can be 1:1. The sgRNA can comprise the nucleic acid sequence SEQ ID NO: 71,959, the Cas9 endonuclease can be an S. pyogenes Cas9 comprising an N-terminal SV40 NLS and a C-terminal SV40 NLS, and the weight ratio of sgRNA to Cas9 endonuclease is 1:1.
[0035] Insertion can be done via homology-directed repair (HDR).
[0036] The SSB, DSB, 5' locus and / or 3' locus may be located within a second intron of the BCL11A gene. The SSB, DSB, 5' locus and / or 3' locus may be located within a DNA hypersensitivity +58 (DHS) site of the BCL11A gene.
[0037] The method may also involve introducing one or more guide ribonucleic acids (gRNAs) into the cell. One or more DNA endonucleases may be one or more Cas9 or Cpf1 endonucleases that effect or create a pair of single-strand breaks (SSBs) or double-strand breaks (DSBs), the first SSB or DSB at a 5' locus and a second SSB or DSB at a 3' locus, within or near the BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene that causes a deletion of the DNA chromosomes. Petition 870200048765, dated 04 / 17 / 2020, p. 16 / 216 12 / 197 chromosomal RNA between the 5' and 3' loci that results in a permanent deletion, modulation, or inactivation of the transcriptional control sequence of chromosomal DNA between the 5' and 3' loci. The first guide RNA may comprise a spacer sequence that is complementary to a segment of the 5' locus, and the second guide RNA may comprise a spacer sequence that is complementary to a segment of the 3' locus. A guide RNA may create a pair of SSBs or DSBs. The single guide RNA may comprise a spacer sequence that is complementary to the 5' or 3' locus. Alternatively, the method may comprise a first guide RNA and a second guide RNA. The first guide RNA may comprise a spacer sequence that is complementary to a segment of the 5' locus, and the second guide RNA may comprise a spacer sequence that is complementary to a segment of the 3' locus.
[0038] One or more gRNAs may be one or more single-molecule guide RNAs (sgRNAs). One or more gRNAs or one or more sgRNAs may be one or more modified gRNAs or one or more modified sgRNAs. The modified sgRNA may comprise three 2'-O-methylphosphorothioate residues at or near each of its 5' and 3' ends. The modified sgRNA may be the nucleic acid sequence of SEQ ID NO: 71,959. One or more Cas9 endonucleases may be pre-complexed with one or more gRNAs or one or more sgRNAs to form one or more ribonucleoproteins (RNPs). One or more Cas9 endonucleases may be flanked at the N-terminal, C-terminal, or both N-terminal and C-terminal by one or more nuclear localization signals (NLSs). One or more Cas9 endonucleases may be flanked by two NLSs, one NLS located at the N-terminus and the second NLS located at the C-terminus. The one or more NLSs may be SV40 NLSs. The weight ratio of sgRNA to Cas9 endonuclease in RNPs may be 1:1.An sgRNA can understand the se. Petition 870200048765, dated 04 / 17 / 2020, p. 17 / 216 13 / 197 nucleic acid sequence of SEQ ID NO: 71,959, Cas9 endonuclease may be an S. pyogenes Cas9 comprising an N-terminal SV40 NLS and a C-terminal SV40 NLS, and the weight ratio of sgRNA to Cas9 endonuclease is 1:1.
[0039] The 5' locus and / or 3' locus may be located within a second intron of the BCL11A gene. The 5' locus and / or 3' locus may be located within a DNA hypersensitivity +58 (DHS) site of the BCL11A gene.
[0040] The mRNA, gRNA, and Cas9 or Cpf1 donor template can be formulated into separate lipid nanoparticles or co-formulated into a single lipid nanoparticle.
[0041] Cas9 or Cpf1 mRNA can be formulated into a lipid nanoparticle, and gRNA and donor template can be delivered to the cell by an adeno-associated virus (AAV) vector.
[0042] Cas9 or Cpf1 mRNA can be formulated into a lipid nanoparticle, and gRNA can be delivered to the cell by electroporation and the donor template can be delivered to the cell by an adeno-associated virus (AAV) vector.
[0043] One or more RNPs can be distributed to the cell by electroporation.
[0044] Editing within or near a BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene can reduce the expression of the BCL11A gene.
[0045] The BCL11A gene can be located on chromosome 2: 60,451,167 - 60,553,567 (Genome Reference Consortium - GRCh38).
[0046] Also provided here are one or more guide ribonucleic acids (gRNAs) for editing a BCL11A gene in a cell from a patient with a hemoglobinopathy. The one or more gRNAs may comprise a spacer sequence selected from the group consisting of nucleic acid sequences in SEQ ID NOs: 1 Petition 870200048765, dated 17 / 04 / 2020, page 18 / 216 14 / 197 71,947 from the Sequence Listing. One or more gRNAs may be one or more single-molecule guide RNAs (sgRNAs). One or more gRNAs or one or more sgRNAs may be one or more modified gRNAs or one or more modified sgRNAs. One or more modified sgRNAs may comprise three 2'-O-methylphosphorothioate residues at or near each of their 5' and 3' ends. One or more modified sgRNAs may comprise the nucleic acid sequence of SEQ ID NO: 71,959. Also provided here is a single-molecule guide RNA (sgRNA) comprising the nucleic acid sequence of SEQ ID NO: 71,959.
[0047] It is understood that the inventions described in this descriptive report are not limited to the examples summarized in this Summary. Several other aspects are described and exemplified herein. Brief Description of the Drawings
[0048] Several aspects of materials and methods for the treatment of hemoglobinopathies disclosed and described in this descriptive report can be better understood by reference to the attached figures, in which:
[0049] Figures 1A-C show plasmids comprising a codon-optimized gene for the S. pyogenes Cas9 endonuclease.
[0050] Figure 1A is a plasmid (CTx-1) comprising a codon-optimized gene for the S. pyogenes Cas9 endonuclease. The CTx-1 plasmid also comprises a gRNA scaffold sequence, which includes a 20 bp spacer sequence from the sequences listed in SEQ ID NOs: 1 - 29,482 of the Sequence Listing.
[0051] Figure 1B is a plasmid (CTx-2) comprising a different codon-optimized gene for the S. pyogenes Cas9 endonuclease. The CTx-1 plasmid also comprises a gRNA scaffold sequence, which includes a 20 bp spacer sequence from the sequences listed in SEQ ID Nos: 1 - 29,482 of the Listing of Petition 870200048765, dated 04 / 17 / 2020, p. 19 / 216 15 / 197 Sequences.
[0052] Figure 1C is a plasmid (CTx-3) comprising yet another different codon-optimized gene for S. pyogenes Cas9 endonuclease. The CTx-3 plasmid also comprises a gRNA scaffold sequence, which includes a 20 bp spacer sequence from the SEQ ID sequences NOs: 1 - 29,482 of the Sequence Listing.
[0053] Figures 2A-B depict the Type II CRISPR / Cas system.
[0054] Figure 2A represents the Type II CRISPR / Cas system including gRNA.
[0055] Figure 2B represents the Type II CRISPR / Cas system including sgRNA.
[0056] Figure 3 shows the rate of DNA editing in CD34+ hematopoietic stem and progenitor cells (HSPCs) and each of the different resulting HPFH genotypes.
[0057] Figures 4A-C show the upregulation of γ-globin expression in differentiated erythrocytes from human CD34+HSPCs edited in bulk from mobilized peripheral blood (mPB).
[0058] Figure 4A represents the hematopoiesis of human CD34+HSPC to erythrocytes.
[0059] Figure 4B shows the γ / WsRNA ratio for each deletion / modification.
[0060] Figure 4C shows the γ / α ratio for each elimination / modification.
[0061] Figures 5A-B show the upregulation of γ-globin expression in differentiated erythrocytes from all gene-edited human CD34+HSPC colonies.
[0062] Figure 5A shows the mRNA γ / α globin ratio (%) for each of the gene-edited colonies.
[0063] Figure 5B shows the average γ / α mRNA ratio (%) for each of the gene modifications. Petition 870200048765, dated 04 / 17 / 2020, page 20 / 216 16 / 197
[0064] Figure 6 shows the rate of DNA editing by BCL11A Intron (SPY101) in erythroid colonies derived from human CD34+HSPCs.
[0065] Figures 7A-B show the correlation between the genotype SPY101 and γ-globin expression in differentiated single-cell colonies of gene-edited human mPB CD34+HSPCs.
[0066] Figure 7A shows the percentage of γ-globin to aglobin (HBG / HBA) for each of the gene-edited colonies.
[0067] Figure 7B shows the percentage of β-like globins (HBG / (HBB+HBG)) for each of the gene-edited colonies.
[0068] Figure 8 shows the effectiveness of targeting multiple gRNAs in human mPB CD34+ cells.
[0069] Figures 9A-B show the hybrid capture assay used to detect off-target editing and the results generated using the hybrid capture assay of edited human mPB CD34+ HSPCs.
[0070] Figure 9A shows a schematic of a hybrid capture assay used to detect editing activity at potential off-target sites.
[0071] Figure 9B shows the activity observed outside the target via hybrid capture sequencing.
[0072] Figures 10A-B show ratios of globin mRNA levels measured in cells from patients with SCD, a patient with β-thalassemia, and healthy donors.
[0073] Figure 10A shows ratios of globin mRNA levels measured in cells from patients with SCD compared with healthy donors.
[0074] Figure 10B shows ratios of globin mRNA levels measured in cells from a patient with β-thalassemia compared Petition 870200048765, dated 04 / 17 / 2020, page 21 / 216 17 / 197 with healthy donors.
[0075] Figures 11A-C show the flow cytometry strategy used to detect various gene-edited cell populations and the results generated using the flow cytometry strategy.
[0076] Figure 11A shows subpopulations of mPB HSPCs Human CD34+ cells, associated surface markers, and flow cytometry activation strategy.
[0077] Figure 11B shows a similar distribution of cell types in the simulated and edited conditions.
[0078] Figure 11C shows similarly high editing efficiencies in subpopulations compared to mass.
[0079] Figure 12 shows the analysis of cell populations. Human CD45RA+ cells in NSG mice 8 weeks after grafting of human CD34+ mPB HSPCs. Data points represent individual animals and represent the percentage of live cells that were human CD45RA+ live cells.
[0080] Figure 13 shows the average editing efficacy of a SPY101 gRNA and Cas9 protein in human CD34+ HSPCs at laboratory and clinically relevant scales.
[0081] Figure 14 shows an overview of the study project of LPG / Toxicology.
[0082] Figure 15 shows an overview of an experimental approach for bulk and single-cell analysis of hemoglobin mRNA and protein levels in erythroid cell populations derived from human CD34+ mPB HSPCs edited with the CRISPR / Cas9 gene.
[0083] Figures 16A-B show the upregulation of γ-globin mRNA and protein in bulk-differentiated human mPB CD34+ HSPCs modified with different targeted edits. Petition 870200048765, dated 04 / 17 / 2020, page 22 / 216 18 / 197
[0084] Figure 16A shows the upregulation of γglobin mRNA in mass-differentiated human mPB CD34+ HSPCs modified with different targeted edits.
[0085] Figure 16B shows the upregulation of γglobin protein in bulk-differentiated human mPB CD34+ HSPCs modified with different targeted edits.
[0086] Figure 17 shows the mean upregulation of γglobin in individual colonies of differentiated human CD34+ mPB HSPCs modified with different targeted edits.
[0087] Figures 18A-B show a genotype for phenotypic correlation in edited colonies on target 5 and target 6 of differentiated human erythroid mPB CD34+HSPCs.
[0088] Figure 18A includes graphs on the left showing the % of colonies with each genotype and graphs on the right showing the percentage of colonies with each level of γglobin upregulation (expressed as the ratio of γ mRNA / (γ+β)globin).
[0089] Figure 18B shows mRNA transcript levels for groups of colonies with similar genotypes.
[0090] Figure 19 presents an overview of an experimental approach for mass analysis of genomic DNA editing efficiency, hemoglobin mRNA expression, and protein in differentiated erythroid cell populations derived from human CD34+ mPB HSPCs edited by the CRISPR / Cas9 gene.
[0091] Figures 20A-B show the percentage of gene editing maintained throughout ex vivo erythroid differentiation of CD34+ mPB HSPCs edited with SPY101 gRNA or SD2 gRNA.
[0092] Figure 20A shows the percentage of gene editing maintained throughout ex vivo erythroid differentiation of mPB CD34+ HSPCs edited with SPY101 gRNA.
[0093] Figure 20B shows the percentage of gene editing. Petition 870200048765, dated 04 / 17 / 2020, page 23 / 216 19 / 197 maintained throughout ex vivo erythroid differentiation of SD2 gRNA-edited mPB CD34+ HSPCs
[0094] Figures 21A-D show the increase in γglobin transcript represented as γ / α or γ / (γ+β) in gene-edited mPB CD34+ HSPCs on days 11 or 15 after erythroid differentiation.
[0095] Figure 21A shows the increase in γ-globin (γ / α) transcript in gene-edited mPB CD34+ HSPCs on day 11 after differentiation.
[0096] Figure 21B shows the increase in γ-globin (γ / α) transcript in gene-edited mPB CD34+ HSPCs on day 15 after differentiation.
[0097] Figure 21C shows the increase in γ-globin transcript (γ / (γ+β)) in gene-edited mPB CD34+ HSPCs on day 11 after differentiation.
[0098] Figure 21D shows the increase in γ-globin transcript (γ / (γ+β)) in gene-edited mPB CD34+ HSPCs on day 15 after differentiation.
[0099] Figures 22A-B are FACS analysis and Median Fluorescence Intensity (MFI) analysis showing γglobin upregulation in gene-edited mPB CD34+ HSPCs on day 15 after differentiation.
[00100] Figure 22A is a FACS analysis showing the upregulation of γ-globin in gene-edited mPB CD34+ HSPCs on day 15 after erythroid differentiation.
[00101] Figure 22B is an MFI analysis showing the mean upregulation of γ-globin in 4 donor-edited CD34+ mPB cells after erythroid differentiation.
[00102] Figure 23A-D represents liquid chromatography-mass spectrometry (LC-MS) data showing the so Petition 870200048765, dated 04 / 17 / 2020, page 24 / 216 20 / 197 γ-globin upregulation, represented as γ / α or γ / (γ+β) in gene-edited mPB CD34+ HSPCs on day 15 after erythroid differentiation.
[00103] Figure 23A represents liquid chromatography-mass spectrometry (LC-MS) data showing the upregulation of γ-globin (γ / α) in gene-edited mPB CD34+ HSPCs on day 15 after differentiation.
[00104] Figure 23B represents liquid chromatography-mass spectrometry (LC-MS) data showing the upregulation of γ-globin (γ / α) in gene-edited CD34+ mPB HSPCs on day 15 after differentiation. normalized for γ-globin (γ / α) in CD34+ mPB HSPCs transfected with GFP gRNA.
[00105] Figure 23C represents liquid chromatography-mass spectrometry (LC-MS) data showing the upregulation of γ-globin (γ / (γ+β)) in gene-edited mPB CD34+ HSPCs on day 15 after differentiation.
[00106] Figure 23D represents liquid chromatography-mass spectrometry (LC-MS) data showing the upregulation of γ-globin (γ / (γ+β)) in gene-edited CD34+ mPB HSPCs on day 15 post-differentiation normalized to γ-globin (γ / α) in CD34+ mPB HSPCs transfected with GFP gRNA.
[00107] Figure 24 shows the hybrid capture bait design.
[00108] Figure 25 shows a graph representing the power of the hybrid capture method to detect indels.
[00109] Figure 26 shows a summary of the data generated from hybrid capture experiments using the gRNA from SPY101.
[00110] Figure 27 shows a summary of the data generated from hybrid capture experiments using SD2 gRNA.
[00111] Figure 28 shows a study plan for grafting experiments. Petition 870200048765, dated 04 / 17 / 2020, page 25 / 216 21 / 197
[00112] Figures 29A-E show 8-week interim probe analysis data for untreated mice and mice injected with sham-edited cells, GFP gRNA-edited cells, SPY101 gRNA-edited cells, or SD2 gRNA-edited cells.
[00113] Figure 29A shows 8-week interim probe analysis data for untreated (UnTx) mice.
[00114] Figure 29B shows 8-week interim probe analysis data for mice injected with sham-edited cells.
[00115] Figure 29C shows 8-week interim probe analysis data for mice injected with GFP gRNA-edited cells.
[00116] Figure 29D shows 8-week interim probe analysis data for mice injected with SPY101 gRNA-edited cells.
[00117] Figure 29E shows 8-week interim probe analysis data for mice injected with SD2 gRNA-edited cells.
[00118] Figure 30 shows the mean data from the 8-week interim bleed analysis.
[00119] Figure 31 shows the % Indel for electroporated human mPB CD34+ HSPCs with various Cas9 mRNAs and SPY101 mRNA (mRNA1-8) compared to electroporated human mPB CD34+ HSPCs with Cas9 protein complexed with SPY101 gRNA (a ribonucleoprotein complex, RNP).
[00120] Figures 32A-B show the normalized cell count and cell viability of electroporated human mPB CD34+ HSPCs with various Cas9 mRNAs and SPY101 mRNA (mRNA1-8) compared to electroporated human mPB CD34+ HSPCs with the Petition 870200048765, dated 04 / 17 / 2020, page 26 / 216 22 / 197 Cas9 protein complexed with SPY101 gRNA (RNP).
[00121] Figure 32A shows the doubling of cell count at 48 hours post-electroporation for human mPB CD34+ HSPCs electroporated with various Cas9 mRNAs and SPY101 mRNA (mRNA1-8) compared to human mPB CD34+ HSPCs electroporated with Cas9 protein complexed with SPY101 gRNA (RNP).
[00122] Figures 32B show cell viability at 48 hours post-electroporation for human mPB CD34+ HSPCs electroporated with various Cas9 mRNAs and SPY101 mRNA (mRNA1-8) compared to human mPB CD34+ HSPCs electroporated with Cas9 protein complexed with SPY101 gRNA (RNP).
[00123] Figures 33A-C show various Cas9 RNP constructs used for Cas9 RNP optimization and the % Indel associated with each of the Cas9 RNP constructs.
[00124] Figure 33A shows several Cas9 RNP constructs.
[00125] Figure 33B shows the % Indel for each of the Cas9 RNP constructs using 1 pg of Cas9:1 pg of gRNA from SPY101.
[00126] Figure 33C shows the % Indel for each of the Cas9 RNP constructs using 3pg of Cas9: 3pg of SPY101 gRNA.
[00127] Figures 34A-B show the gene editing efficiency (%) for human mPB CD34+ HSPCs treated with Cas9 mRNA or Cas9 protein (Feldan or Aldevron) at non-clinical and clinical scales.
[00128] Figure 34A shows the gene editing efficiency (%) for CD34+ human MpB or bone marrow (BM)-derived HSPCs treated with Cas9 mRNA or Cas9 protein (Feldan or Aldevron) on a non-clinical scale.
[00129] Figure 34B shows the gene editing efficiency (%) for human mPB CD34+ HSPCs treated with Cas9 protein (Aldevron) on a clinical scale. Petition 870200048765, dated 04 / 17 / 2020, p. 27 / 216 23 / 197
[00130] Figures 35A-B show the efficacy of SPY101 in human CD34+ mPB HSPCs, presenting the mRNA γα globin ratio in % and the γ / (γ+β) mRNA globin ratio in % for cells treated with Cas9 mRNA and SPY101 gRNA or Cas9 protein (Feldan or Aldevron) complexed with SPY101 gRNA.
[00131] Figure 35A shows the mRNA γ / α globin ratio in % for CD4+ mPB HSPCs treated with Cas9 mRNA and SPY101 gRNA or Cas9 protein (Feldan or Aldevron) complexed with SPY101 gRNA.
[00132] Figure 35B shows the γ / (γ+β) globin ratio in % for CD4+ mPB HSPCs treated with Cas9 mRNA and SPY101 gRNA or Cas9 protein (Feldan or Aldevron) complexed with SPY101 gRNA.
[00133] Figures 36A-B show the efficacy of SPY101 in bone marrow-derived CD34+ HSPCs, presenting the mRNA γ / α globin ratio in % and the mRNA γ / (γ+β) globin ratio in % for cells treated with Cas9 protein (Aldevron, technically optimized vs. non-optimized) complexed with SPY101 gRNA.
[00134] Figure 36A shows the γ / α globin ratio in % for bone marrow-derived CD34+ HSPCs treated with Cas9 protein complexed with SPY101 gRNA.
[00135] Figure 36B shows the γ / (γ+β) mRNA globin ratio in % of bone marrow-derived CD34+ HSPCs treated with Cas9 protein complexed with SPY101 gRNA.
[00136] Figures 37A-B show the efficacy of SPY101 in samples from patients with SCD and β-Thalassemia.
[00137] Figure 37A shows the mean γ / (γ+β) mRNA globin ratio in % for differentiated erythroid cells from six patients with SCD and two healthy donors who were treated with SPY101 gRNA and Cas9 protein. All values were subtracted from Petition 870200048765, dated 04 / 17 / 2020, page 28 / 216 24 / 197 their respective control samples treated with GFP gRNA and Cas9 protein.
[00138] Figure 37B shows the mRNA γ / α globin ratio in % for differentiated erythroid cells from a β-thalassemic patient and two healthy donors that were treated with SPY101 gRNA and Cas9 protein. All values were subtracted from their respective control samples treated with GFP gRNA and Cas9 protein.
[00139] Figures 38A-B show the rate of DNA editing of Bcl11a Intron (SPY101) when using Cas9 mRNA or Cas9 RNP.
[00140] Figure 38A shows the DNA editing rate of BCL11A Intron (SPY101) when using Cas9 mRNA.
[00141] Figure 38B shows the DNA editing rate of the BCL11A Intron (SPY101) when using Cas9 RNP.
[00142] Figures 39A-B show that disruptions of the GATA1 binding site (GBS) caused by SPY101 / Cas9 RNP in erythroid-differentiated human CD34+ mPB HSPCs-derived single-cell colonies are linked to increased γ-globin expression.
[00143] Figure 39A shows the mRNA γα globin ratio of colonies edited by SPY101 without GBS perturbation, monoelec GBS perturbations, or biallelic GBS perturbations.
[00144] Figure 39B shows the γ / (γ+β) globin ratio of mRNA from SPY101-edited colonies without GBS perturbation, monoelelic GBS perturbations, or biallelic GBS perturbations.
[00145] Figures 40A-E show increased γ-globin expression in human CD34+ MpB HSPCs edited with SPY101 / Cas9 RNP differentiated erythroids by flow cytometry analysis. Petition 870200048765, dated 04 / 17 / 2020, page 29 / 216 25 / 197
[00146] Figure 40A is a flow cytometry analysis showing α-globin expression in erythroid-differentiated human MpB CD34+ HSPCs edited with SPY101 / Cas9 gRNA RNP compared with α-globin expression in erythroid-differentiated human MpB CD34+ HSPCs treated with GFP / Cas9 gRNA RNP.
[00147] Figure 40B is a flow cytometry analysis showing β-globin expression in erythroid-differentiated human CD34+ MpB HSPCs edited with SPY101 / Cas9 gRNA RNP compared with β-globin expression in erythroid-differentiated human CD34+ MpB HSPCs treated with GFP / Cas9 gRNA RNP.
[00148] Figure 40C is a flow cytometry analysis showing γ-globin expression in erythroid-differentiated human MpB CD34+ HSPCs edited with SPY101 / Cas9 gRNA RNP compared with γ-globin expression in erythroid-differentiated human MpB CD34+ HSPCs treated with GFP / Cas9 gRNA RNP.
[00149] Figure 40D shows the percentage of γ-globin positive cells in erythroid-differentiated human MpB CD34+ HSPCs edited with SPY101 / Cas9-based RNP compared with erythroid-differentiated human MpB CD34+ HSPCs treated with GFP / Cas9 gRNA RNP.
[00150] Figure 40E shows the median fluorescence intensity (MFI) in erythroid-differentiated human MpB CD34+ HSPCs edited with SPY101 / Cas9 RNP compared with erythroid-differentiated human MpB CD34+ HSPCs treated with GFP / Cas9 gRNA RNP. Brief Description of the Sequence Listing
[00151] SEQ ID Nos: 1-29,482 are 20 bp spacer sequences for targeting within or near a BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene with a Cas9 endonuclease from S. pyogenes. Petition 870200048765, dated 04 / 17 / 2020, p. 30 / 216 26 / 197
[00152] SEQ ID Nos: 29,483-32,387 are 20 bp spacer sequences for targeting within or near a BCL11A gene or other DNA sequence encoding a BCL11A gene regulatory element with an S. aureus Cas9 endonuclease.
[00153] SEQ ID Nos: 32,388-33,420 are 20 bp spacer sequences for targeting within or near a BCL11A gene or other DNA sequence encoding a BCL11A gene regulatory element with a Cas9 endonuclease from S. thermophilus.
[00154] SEQ ID Nos: 33,421-33,851 are 20 bp spacer sequences for targeting within or near a BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene with a T. denticola Cas9 endonuclease.
[00155] SEQ ID Nos: 33,852-36,731 are 20 bp spacer sequences for targeting within or near a BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene with a Cas9 endonuclease from N. meningitides.
[00156] SEQ ID Nos: 36,732-71,947 are 22 bp spacer sequences for targeting within or near a BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene with a Cpf1 endonuclease from Acidominococcus, Lachnospiraceae, and Franciscella Novicida.
[00157] SEQ ID NO: 71.948 is a guide RNA (gRNA) sample for a Cas9 endonuclease from S. pyogenes.
[00158] SEQ ID NO: 71.949 shows a known family of return endonucleases, as classified by their structure.
[00159] SEQ ID NO: 71.950 is gRNA A (CLO1).
[00160] SEQ ID NO: 71.951 is gRNA B (CLO8).
[00161] SEQ ID NO: 71.952 is gRNA C (CSO2).
[00162] SEQ ID NO: 71.953 is gRNA D (CSO6).
[00163] SEQ ID NO: 71.954 is gRNA E (HPFH-15). Petition 870200048765, dated 04 / 17 / 2020, page 31 / 216 27 / 197
[00164] SEQ ID NO: 71.955 is gRNA F (HPFH-4).
[00165] SEQ ID NO: 71.956 is gRNA G (Kenya02).
[00166] SEQ ID NO: 71.957 is gRNA H (Kenya17).
[00167] SEQ ID NO: 71.958 is gRNA I (SD2).
[00168] SEQ ID NO: 71.959 is gRNA J (SPY101).
[00169] SEQ ID Nos: 71.960-71.962 show sample sgRNA sequences. DETAILED DESCRIPTION Fetal hemoglobin
[00170] Fetal hemoglobin (HbF, α2γ2) is the primary oxygen-transporting protein in a human fetus and includes the alpha (α) and gamma (γ) subunits. HbF expression ceases approximately 6 months after birth. Adult hemoglobin (HbA, α2β2) is the primary oxygen-transporting protein in humans after ~34 weeks of birth and includes the alpha (α) and beta (β) subunits. After 34 weeks, a developmental switch results in decreased transcription of γglobin genes and increased transcription of βglobin genes. Since many forms of hemoglobinopathies result from the inability to produce normal βglobin protein in sufficient quantity or the inability to produce normal βglobin protein altogether, increased γglobin (HbF) expression will improve the severity of βglobin disease. B-cell lymphoma 11A (BCL11A)
[00171] B-cell lymphoma 11A (BCL11A) is a gene located on chromosome 2 and ranges from 60,451,167 - 60,553,567 bp (GRCh38). BCL11A is a zinc finger transcription factor that represses fetal hemoglobin (HbF) and upregulates HbF expression beginning at approximately 6 weeks after birth. The BCL11A gene contains 4 exons, spanning 102.4 kb of genomic DNA. BCL11A is also under transcriptional regulation, including a domain of Petition 870200048765, dated 04 / 17 / 2020, page 32 / 216 28 / 197 binding in intron 2 to the master transcription factor GATA-1. GATA-1 binding increases BCL11A expression, which in turn represses HbF expression. Intron 2 contains multiple DNase hypersensitivity (DHS) sites, including sites referred to as +55, +58, and +62 based on their kilobase distance from the transcription start site. Several editing strategies are discussed below to delete, modulate, or inactivate transcriptional control sequences of BCL11A. Naturally occurring SNPs within this region have been associated with decreased BCL11A expression and increased fetal Hb levels (Orkin et al. 2013 GWAS study). These SNPs are organized around 3 DNA hypersensitivity sites, +55DHS, +58DHS, and +62DHS. Of the three regions, the +58 DHS region appears to be the key region associated with increased fetal Hb levels and also harbors a transcriptional control region, GATA1. Therapeutic Approach
[00172] Non-homologous end joining (NHEJ) can be used to delete segments of the BCL11A transcriptional control sequence, either directly or by altering donor or acceptor splice sites through cleavage by a multi-site targeting gRNA, or multiple gRNAs.
[00173] The transcriptional control sequence of the BCL11A gene can also be modulated or inactivated by inserting a wild-type BCL11A gene or cDNA comprising a modified transcriptional control sequence. For example, the donor for modulation or inactivation by homology-directed repair (HDR) contains the modified transcriptional control sequence of the BCL11A gene with large or small flanking homology arms to allow annealing. HDR is essentially an error-free mechanism that uses a provided homologous DNA sequence as a template during DSB repair. The rate of homology-directed repair Petition 870200048765, dated 04 / 17 / 2020, page 33 / 216 29 / 197 (HDR) is a function of the distance between the transcriptional control sequence and the cleavage site, so the choice of overlapping or nearby sites is important. Templates may include extra sequences flanked by homologous regions or may contain a sequence that differs from the genomic sequence, thus allowing sequence editing.
[00174] In addition to eliminating, modulating, or inactivating the transcriptional control sequence of the BCL11A gene by NHEJ or HDR, a variety of other options are possible. If there are small or large deletions, a cDNA can undergo knock-in containing a modified transcriptional control sequence of the BCL11A gene. A full-length cDNA can be placed in any safe port—that is, a non-harmful insertion point other than the BCL11A gene itself—with or without appropriate regulatory sequences. If this construct undergoes knock-in near the regulatory elements of BCL11A, it should have physiological control, similar to the normal gene. Two or more (e.g., a pair) nucleases can be used to delete regions of the transcriptional control sequence, although a donor usually has to be provided to modulate or inactivate the function. In this case, two gRNAs and a donor sequence would be provided.
[00175] Cellular, ex vivo, and in vivo methods are provided here for using genome engineering tools to create permanent changes in the genome: 1) modulating or inactivating the transcriptional control sequence of the BCL11A gene, by deletions arising from the NHEJ pathway; 2) modulating or inactivating the transcriptional control sequence of the BCL11A gene, by HDR; 3) modulating or inactivating the transcriptional control sequence of the BCL11A gene, by deleting at least a portion of the transcriptional control sequence and / or applying knock-in to a BCL11A gene. Petition 870200048765, dated 04 / 17 / 2020, page 34 / 216 30 / 197 of wild type or cDNA comprising a modified transcriptional control sequence at the gene locus or at a safe harbor locus. Such methods use endonucleases, such as CRISPR-associated nucleases (Cas9, Cpf1 and the like), to permanently delete, insert or edit the transcriptional control sequence within or near the genomic locus of the BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene. Thus, examples presented in the present invention can help to eliminate, modulate or inactivate the transcriptional control sequence of the BCL11A gene with a single treatment or a limited number of treatments (instead of administering potential therapies over the patient's lifetime).
[00176] Methods for treating a patient with hemoglobinopathy are provided here. One aspect of such a method is ex vivo cell-based therapy. For example, a patient-induced pluripotent stem cell (iPSC) can be created. Then, the chromosomal DNA of these iPSCs can be edited using the materials and methods described herein. Next, the genome-edited iPSCs can be differentiated into hematopoietic progenitor cells. Finally, the hematopoietic progenitor cells can be implanted into the patient.
[00177] Yet another aspect of such a method is ex vivo cell-based therapy. For example, a mesenchymal stem cell can be isolated from the patient, which can be isolated from the patient's bone marrow or peripheral blood. Then, the chromosomal DNA of these mesenchymal stem cells can be edited using the materials and methods described herein. Next, the genome-edited mesenchymal stem cells can be differentiated into hematopoietic progenitor cells. Finally, these hematopoietic progenitor cells can be implanted into the patient. Petition 870200048765, dated 04 / 17 / 2020, page 35 / 216 31 / 197
[00178] An additional aspect of such a method is ex vivo cell-based therapy. For example, a hematopoietic progenitor cell can be isolated from the patient. Then, the chromosomal DNA of these cells can be edited using the materials and methods described herein. Finally, the genome-edited hematopoietic progenitor cells can be implanted into the patient.
[00179] One advantage of an ex vivo cell therapy approach is the ability to conduct a comprehensive analysis of the therapeutic prior to administration. Nuclease-based therapy may have some level of off-target effects. Performing ex vivo genetic correction allows characterization of the corrected cell population prior to implantation. The present invention includes whole-genome sequencing of the corrected cells to ensure that off-target effects, if any, may be at genomic loci associated with minimal risk to the patient. Furthermore, specific cell populations, including clonal populations, can be isolated prior to implantation.
[00180] Another advantage of ex vivo cell therapy relates to genetic correction in iPSCs compared to other primary cell sources. iPSCs are prolific, facilitating the acquisition of the large number of cells needed for cell-based therapy. Furthermore, iPSCs are an ideal cell type for clonal isolation. This allows for tracking the correct genomic correction without the risk of decreased viability. In contrast, other primary cells are viable only for a few passages and difficult to expand clonally. Thus, manipulating iPSCs for the treatment of a hemoglobinopathy can be much easier and can shorten the amount of time needed to make the desired genetic correction.
[00181] For ex vivo therapy, transplantation requires the removal of Petition 870200048765, dated 04 / 17 / 2020, page 36 / 216 32 / 197 bone marrow niches or donor HSCs for grafting. Current methods rely on radiation and / or chemotherapy. Due to the limitations they impose, safer conditioning regimens have been and are being developed, such as immunodepletion of bone marrow cells by antibodies or antibody-toxin conjugates directed against hematopoietic cell surface markers, for example CD117, c-kit, and others. The success of HSC transplantation depends on efficient return to the bone marrow, subsequent grafting, and bone marrow repopulation. The level of gene-edited cells grafted is important, as is the graft's ability to incorporate multiple cell lines.
[00182] Hematopoietic stem cells (HSCs) are an important target for ex vivo gene therapy because they provide a sustained source of corrected cells. The treated CD34+ cells would be returned to the patient.
[00183] The methods may also include in vivo-based therapy. The chromosomal DNA of the patient's cells is edited using the materials and methods described herein. The cells may be bone marrow cells, hematopoietic progenitor cells, or CD34+ cells.
[00184] Although blood cells present an attractive target for ex vivo treatment and therapy, increased delivery efficacy may allow direct in vivo delivery to hematopoietic stem cells (HSCs) and / or other B and T cell progenitors, such as CD34+ cells. Ideally, targeting and editing would be directed to the relevant cells. Cleavage in other cells can also be avoided by using promoters that are only active in certain cells and / or developmental stages. Additional promoters are inducible and therefore can be temporarily controlled if the nuclease is administered as a plasmid. The amount Petition 870200048765, dated 04 / 17 / 2020, page 37 / 216 The 33 / 197 time that distributed RNA and protein remain in the cell can also be adjusted using treatments or added domains to alter the half-life. In vivo treatment would eliminate several treatment steps, but a lower distribution rate may require higher editing rates. In vivo treatment can eliminate problems and losses of ex vivo treatment and grafting.
[00185] One advantage of in vivo gene therapy may be the ease of production and therapeutic administration. The same therapeutic approach and therapy will have the potential to be used to treat more than one patient, for example, a number of patients who share the same genotype or allele or similar traits. In contrast, ex vivo cell therapy typically requires the use of the patient's own cells, which are isolated, manipulated, and returned to the same patient.
[00186] A cellular method for editing the BCL11A gene in a cell by genome editing is also provided here. For example, a cell can be isolated from a patient or animal. Then, the cell's chromosomal DNA can be edited using the materials and methods described herein.
[00187] The methods provided herein, whether cellular or ex vivo or in vivo, may involve one or a combination of the following: 1) modulation or inactivation of the BCL11A gene transcriptional control sequence by deletions arising from NHEJ; 2) modulation or inactivation of the BCL11A gene transcriptional control sequence by HDR; or 3) modulation or inactivation of the BCL11A gene transcriptional control sequence by deletion of at least a portion of the transcriptional control sequence and / or by applying knock-in to a wild-type BCL11A gene or cDNA comprising a modified transcriptional control sequence at the gene locus or at a heterologous location in Petition 870200048765, dated 04 / 17 / 2020, page 38 / 216 34 / 197 genome (such as a safe harbor location, such as AAVS1). Both HDR and knock-in strategies utilize a donor DNA template in Homology-Directed Repair (HDR). HDR in either strategy can be performed by making one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) at specific sites in the genome, using one or more endonucleases.
[00188] For example, the NHEJ strategy may involve the elimination of at least a portion of the transcriptional control sequence of the BCL11A gene by inducing a single-strand break or double-strand break within or near the BCL11A gene or another DNA sequence encoding a regulatory element of the BCL11A gene with one or more CRISPR endonucleases and a gRNA (e.g., crRNA + tracrRNA or sgRNA) or two or more single-strand breaks or double-strand breaks within or near the BCL11A gene or another DNA sequence encoding a regulatory element of the BCL11A gene with two or more CRISPR endonucleases and two or more sgRNAs. This approach may require the development and optimization of sgRNAs for the transcriptional control sequence of the BCL11A gene.
[00189] For example, the HDR strategy may involve modulating or inactivating the transcriptional control sequence of the BCL11A gene by inducing a single-strand break or double-strand break within or near the BCL11A gene or another DNA sequence encoding a regulatory element of the BCL11A gene with one or more CRISPR endonucleases and a gRNA (e.g., crRNA + tracrRNA, or sgRNA), or two or more single-strand breaks or double-strand breaks within or near the BCL11A gene or another DNA sequence encoding a regulatory element of the BCL11A gene with one or more CRISPR endonucleases and two or more gRNAs, in the presence of an exogenously introduced donor DNA template to direct the response. Petition 870200048765, dated 04 / 17 / 2020, p. 39 / 216 35 / 197 Cellular DSB and Homology-Directed Repair (the donor DNA template can be a short single-stranded oligonucleotide, a short double-stranded oligonucleotide, or a long single- or double-stranded DNA molecule). This approach may require the development and optimization of gRNAs and donor DNA molecules comprising a wild-type BCL11A gene containing a modified transcriptional control sequence.
[00190] For example, the knock-in strategy involves activating a wild-type BCL11A gene or cDNA comprising a modified transcriptional control sequence at the BCL11A gene locus using a gRNA (e.g., crRNA + tracrRNA or sgRNA) or a pair of gRNAs targeted upstream of or at the transcriptional control sequence of the BCL11A gene, or at a safe harbor site (such as AAVS1). The donor DNA can be single-stranded or double-stranded DNA and comprises a wild-type BCL11A gene comprising a modified transcriptional control sequence.
[00191] The advantages of the above strategies (elimination / modulation / inactivation and knock-in) are similar, including, in principle, beneficial short- and long-term clinical and laboratory effects.
[00192] In addition to the editing options listed above, Cas9 or similar proteins can be used to target effector domains to the same target sites that can be identified for editing, or additional target sites within the reach of the effector domain. A range of chromatin-modifying enzymes, methylases, or demethylases can be used to alter the expression of the target gene. These types of epigenetic regulation have some advantages, particularly because they are limited in potential off-target effects.
[00193] The regulation of transcription and translation involves a number of different classes of sites that interact with cellular proteins or nucleotides. Frequently, the DNA binding sites of Petition 870200048765, dated 04 / 17 / 2020, p. 40 / 216 36 / 197 Transcription factors or other proteins can be targeted for mutation or deletion to study the site's role, although they can also be targeted to alter gene expression. Sites can be added via non-homologous termination of NHEJ or direct genome editing by homology-directed repair (HDR). The increased use of genome sequencing, RNA expression, and transcription factor binding genome studies has increased the ability to identify how sites lead to developmental or temporal gene regulation. These control systems can be direct or may involve broad cooperative regulation that may require the integration of activities from multiple enhancers. Transcription factors typically bind to degenerate DNA sequences 6-12 bp in length.The low level of specificity provided by individual sites suggests that complex interactions and rules are involved in binding and functional outcome. Binding sites with less degeneracy may provide simpler means of regulation. Artificial transcription factors can be designed to specify longer sequences that have less similar sequences in the genome and have less potential for off-target cleavage. Any of these types of binding sites can be mutated, eliminated, or even created to allow changes in gene regulation or expression (Canver, MC et al., Nature (2015)). GATA transcription factors are a family of transcription factors characterized by their ability to bind to the GATA DNA-binding sequence. A GATA binding sequence is located at the +58 site of the DNA hypersensitivity (DHS) of the BCL11A gene.
[00194] Another class of gene regulatory regions with these characteristics are microRNA (miRNA) binding sites. miRNAs are non-coding RNAs that play roles Petition 870200048765, dated 04 / 17 / 2020, page 41 / 216 37 / 197 key in post-transcriptional gene regulation. miRNA can regulate the expression of 30% of all mammalian protein-coding genes. Specific and potent gene silencing by double-stranded RNA (RNAi) has been discovered, plus additional small non-coding RNA (Canver, MC et al., Nature (2015)). The largest class of non-coding RNAs important for gene silencing are miRNAs. In mammals, miRNAs are first transcribed as long RNA transcripts, which can be separate transcriptional units, part of protein introns, or other transcripts. The long transcripts are called primary miRNAs (pri-miRNAs) which include imperfect base-paired hairpin structures. These primiRNAs can be cleaved into one or more precursor miRNAs (premiRNAs) by the Microprocessor, a protein complex in the nucleus, involving Drosha.
[00195] Pre-miRNAs are short stem loops ~70 nucleotides long with a 3'-to-2-nucleotide overhang that are exported to mature 19-25 nucleotide miRNA:miRNA* duplexes. The miRNA strand with the least base-pairing stability (the guide strand) can be loaded into the RNA-induced silencing complex (RISC). The passenger guide strand (marked with *) may be functional, but is usually degraded. Mature miRNA binds the RISC to partially complementary sequences on target mRNAs predominantly found in the 3' untranslated regions (UTRs) and induces posttranscriptional gene silencing (Bartel, DP Cell 136, 215-233 (2009); Saj, A. & Lai, EC Curr Opin Genet Dev 21,504-510 (2011)).
[00196] miRNAs may be important in development, differentiation, cell cycle and growth control, and in virtually all biological pathways in mammals and other multicellular organisms. miRNAs may also be involved in the control of Petition 870200048765, dated 04 / 17 / 2020, page 42 / 216 38 / 197 cell cycle, apoptosis and stem cell differentiation, hematopoiesis, hypoxia, muscle development, neurogenesis, insulin secretion, cholesterol metabolism, aging, viral replication and immune responses.
[00197] A single miRNA can target hundreds of different mRNA transcripts, while an individual transcript can be targeted by many different miRNAs. More than 28,645 microRNAs have been annotated in the latest version of miRBase (v.21). Some miRNAs can be encoded by multiple loci, some of which can be expressed from tandem cotranscript clusters. These features allow for complex regulatory networks with multiple pathways and feedback controls. miRNAs can be integral parts of these regulatory and feedback loops and can help regulate gene expression, keeping protein production within limits (Herranz, H. & Cohen, SM Genes Dev 24, 1339-1344 (2010); Posadas, DM & Carthew, RW Curr Opin Genet Dev 27, 1-6 (2014)).
[00198] miRNA may also be important in a large number of human diseases associated with abnormal miRNA expression. This association highlights the importance of the miRNA regulatory pathway. Recent miRNA elimination studies have linked miRNA with the regulation of immune responses (Stern-Ginossar, N. et al., Science 317, 376-381 (2007)).
[00199] miRNA also has a strong link to cancer and may play a role in different types of cancer. miRNAs have been found to be upregulated in various tumors. miRNA may be important in regulating key cancer-related pathways, such as cell cycle control and response to DNA damage, and may therefore be used in diagnosis and clinically targeted. MicroRNAs can delicately regulate the balance of angiogenesis, so experiments that eliminate Petition 870200048765, dated 04 / 17 / 2020, page 43 / 216 39 / 197 nam all microRNAs suppress tumor angiogenesis (Chen, S. et al., Genes Dev 28, 1054-1067 (2014)).
[00200] As has been demonstrated for protein-coding genes, miRNA genes can also be subject to epigenetic alterations that occur with cancer. Many miRNA loci may be associated with CpG islands, increasing their opportunity for regulation by DNA methylation (Weber, B., Stresemann, C., Brueckner, B. & Lyko, F. Cell Cycle 6, 1001-1005 (2007)). Most studies have used treatment with chromatin remodeling drugs to reveal epigenetically silenced miRNAs.
[00201] In addition to its role in RNA silencing, miRNA can also activate translation (Posadas, DM & Carthew, RW Curr Opin Genet Dev 27, 1-6 (2014)). Applying knockout to these sites can lead to decreased expression of the target gene, while introducing these sites can increase expression.
[00202] Individual miRNAs can be knocked out more effectively through mutation of the seed sequence (bases 2-8 of the microRNA), which may be important for binding specificity. Cleavage in this region, followed by NHEJ repair failure, can effectively abolish miRNA function, blocking binding to target sites. miRNAs can also be inhibited by specific targeting of the special loop region adjacent to the palindromic sequence. Catalytically inactive Cas9 can also be used to inhibit shRNA expression (Zhao, Y. et al., Sci Rep 4, 3943 (2014)). In addition to targeting miRNAs, binding sites can also be targeted and mutated to prevent miRNA silencing. Human Cells
[00203] To improve hemoglobinopathies, as described and illustrated here, the main targets for gene editing are cells Petition 870200048765, dated 04 / 17 / 2020, p. 44 / 216 40 / 197 human cells. For example, in ex vivo methods, human cells can be somatic cells, which after being modified using the techniques described, can give rise to progenitor cells. For example, in in vivo methods, human cells can be a bone marrow cell, a hematopoietic progenitor cell, or a CD34+ cell.
[00204] By performing gene editing on autologous cells that are derived from, and therefore already fully compatible with, the patient in need, it is possible to generate cells that can be safely reintroduced into the patient and effectively originate a population of cells that can be effective in improving one or more clinical conditions associated with the patient's disease.
[00205] Progenitor cells (also referred to here as stem cells) are capable of proliferating and giving rise to more progenitor cells, which in turn have the capacity to generate a large number of mother cells that can, in turn, give rise to differentiated or differentiable daughter cells. The daughter cells themselves can be induced to proliferate and produce progeny that subsequently differentiate into one or more types of mature cells, while also retaining one or more cells with parental development potential. The term stem cell then refers to a cell with the capacity or potential, under particular circumstances, to differentiate into a more specialized or differentiated phenotype, and which retains the capacity, under certain circumstances, to proliferate without substantially differentiating.In one aspect, the term progenitor or stem cell refers to a generalized mother cell whose descendants (progeny) specialize, often in different directions, through differentiation, for example, acquiring completely individual characteristics, as occurs in the progressive diversification of embryonic cells and tissues. Cell differentiation is a complex process that... Petition 870200048765, dated 04 / 17 / 2020, page 45 / 216 41 / 197 typically occurs through many cell divisions. A differentiated cell can derive from a multipotent cell which is derived from a multipotent cell, and so on. Although each of these multipotent cells can be considered a stem cell, the range of cell types that each can originate can vary considerably. Some differentiated cells also have the capacity to originate cells with greater developmental potential. Such capacity can be natural or can be artificially induced after treatment with various factors. In many biological cases, stem cells can also be multipotent because they can produce progeny of more than one distinct cell type, but this is not necessary for the nematode.
[00206] Self-renewal may be another important aspect of the stem cell. In theory, self-renewal can occur through one of two main mechanisms. Stem cells can divide asymmetrically, with one daughter cell retaining the stem cell state and the other daughter cell expressing some other distinct specific function and phenotype. Alternatively, some of the stem cells in a population may divide symmetrically into two stems, thus maintaining some stem cells in the population as a whole, while other cells in the population give rise only to differentiated progeny. Generally, progenitor cells have a cellular phenotype that is more primitive (i.e., it is at an earlier stage along a developmental or progression pathway than a fully differentiated cell). Often, progenitor cells also have a significant or very high proliferative potential.Progenitor cells can give rise to multiple distinct differentiated cell types or to a single differentiated cell type, depending on the developmental pathway and the environment in which the cells develop and differentiate.
[00207] In the context of cell ontogeny, the differentiated adjective Petition 870200048765, dated 04 / 17 / 2020, page 46 / 216 42 / 197 or differentiator is a relative term. A differentiated cell is a cell that has progressed further down the developmental pathway than the cell to which it is being compared. Thus, stem cells can differentiate into lineage-restricted precursor cells (such as a hematopoietic progenitor cell), which in turn can differentiate into other types of precursor cells further down the pathway (such as a hematopoietic precursor), and then into a final-stage differentiated cell, such as an erythrocyte, which plays a characteristic role in a particular tissue type, and may or may not retain the ability to proliferate further.
[00208] The term hematopoietic progenitor cell refers to stem cell lineage cells that give rise to all types of blood cells, including erythroid (erythrocytes or red blood cells (RBCs)), myeloid (monocytes and macrophages, neutrophils, basophils, eosinophils, megakaryocytes / platelets, and dendritic cells) and lymphoid (T cells, B cells, NK cells).
[00209] A cell of the erythroid lineage indicates that the cell being contacted is a cell undergoing erythropoiesis, such that, after final differentiation, it forms an erythrocyte or red blood cell. These cells originate from hematopoietic progenitor cells in the bone marrow. Through exposure to specific growth factors and other components of the hematopoietic microenvironment, hematopoietic progenitor cells can mature through a series of intermediate differentiation cell types, all intermediates of the erythroid lineage, into erythrocytes. Thus, cells of the erythroid lineage comprise hematopoietic progenitor cells, rubriblasts, prorubricytes, erythroblasts, metarubricytes, reticulocytes, and erythrocytes.
[00210] The hematopoietic progenitor cell may express at least one of the following characteristic cell surface markers. Petition 870200048765, dated 04 / 17 / 2020, page 47 / 216 43 / 197 cos of hematopoietic progenitor cells: CD34+, CD59+, Thyl / CD90+, CD381o / -, and C-kit / CD1 17+. In some examples provided here, the hematopoietic progenitors may be CD34+.
[00211] The hematopoietic progenitor cell can be a peripheral blood stem cell obtained from the patient after the patient has been treated with one or more factors, such as granulocyte colony-stimulating factor (optionally in combination with Plerixaflor). CD34+ cells can be enriched using the CliniMACS® Cell Selection System (Miltenyi Biotec). CD34+ cells can be stimulated in serum-free medium (e.g., CellGrow SCGM, CellGenix medium) with cytokines (e.g., SCF, rhTPO, rhFLT3) prior to genome editing. The addition of SR1 and dmPGE2 and / or other factors is contemplated to improve long-term engraftment.
[00212] Hematopoietic progenitor cells of the erythroid lineage may have a cell surface marker characteristic of the erythroid lineage: such as CD71 and Terl 19.
[00213] Hematopoietic stem cells (HSCs) may be an important target for gene therapy as they provide a sustained source of corrected cells. HSCs give rise to the myeloid and lymphoid lineages of blood cells. Mature blood cells have a finite lifespan and must be continuously replaced throughout life. Blood cells are continuously produced by the proliferation and differentiation of a population of pluripotent HSCs that can be replenished by self-renewal. Bone marrow (BM) is the main site of hematopoiesis in humans and a good source of hematopoietic stem and progenitor cells (HSPCs). HSPCs can be found in small numbers in peripheral blood (PB). In some indications or treatments, their numbers increase. HSC progeny mature through stages, generating progenitor cells with multiple potentials and committed to the lineage. Petition 870200048765, dated 04 / 17 / 2020, page 48 / 216 44 / 197 gem including lymphoid progenitor cells that give rise to cells expressing BCL11A. B and T cell progenitors are the two cell populations that require BCL11A activity, so they could be edited in the stages before rearrangement, although progenitor correction has the advantage of remaining a source of corrected cells. Treated cells, such as CD34+, would be returned to the patient. The graft level may be important, as is the ability of the graft to produce multiple gene-edited cell lines after in vivo CD34+ infusion.
[00214] Induced Pluripotent Stem Cells
[00215] The genetically modified human cells described herein can be induced by pluripotent stem cells (iPSCs). One advantage of using iPSCs is that the cells can be derived from the same subject to whom the progenitor cells are to be administered. That is, a somatic cell can be obtained from a subject, reprogrammed into an induced pluripotent stem cell, and then rediffered into a progenitor cell to be administered to the subject (e.g., autologous cells). Because the progenitors are essentially derived from an autologous source, the risk of graft rejection or allergic response can be reduced compared to using cells from another subject or group of subjects. Furthermore, the use of iPSCs negates the need for cells obtained from an embryonic source. Thus, in one respect, the stem cells used in the disclosed methods are not embryonic stem cells.
[00216] Although differentiation is generally irreversible in physiological contexts, several methods have recently been developed to reprogram somatic cells into iPSCs. Exemplary methods are known to those skilled in the art and are briefly described below.
[00217] The term reprogramming refers to a process that alters Petition 870200048765, dated 04 / 17 / 2020, page 49 / 216 45 / 197 ra or reverses the differentiation state of a differentiated cell (e.g., a somatic cell). In other words, reprogramming refers to a process of directing the differentiation of a cell toward a more undifferentiated or more primitive cell type. It should be noted that placing too many primary cells into culture can lead to a loss of fully differentiated characteristics. Thus, simply culturing these cells included in the term differentiated cells does not make these cells undifferentiated cells (e.g., undifferentiated cells) or pluripotent cells. The transition from a differentiated cell to pluripotency requires a reprogramming stimulus in addition to the stimuli that lead to the partial loss of differentiated character in culture.Reprogrammed cells also have the characteristic of extended passage capacity without loss of growth potential, compared to parental primary cells, which generally only have the capacity for a limited number of divisions in culture.
[00218] The cell to be reprogrammed may be partially or fully differentiated prior to reprogramming. Reprogramming may involve the complete reversal of the differentiation state of a differentiated cell (e.g., a somatic cell) to a pluripotent or multipotent state. Reprogramming may involve the complete or partial reversal of the differentiation state of a differentiated cell (e.g., a somatic cell) to an undifferentiated cell (e.g., an embryo-like cell). Reprogramming may result in the expression of particular genes by the cells, the expression of which further contributes to the reprogramming. In certain examples described herein, the reprogramming of a differentiated cell (e.g., a somatic cell) may cause the differentiated cell to assume an undifferentiated state (e.g., it is an undifferentiated cell). The resulting cells are Petition 870200048765, dated 04 / 17 / 2020, page 50 / 216 46 / 197 referred to as reprogrammed cells or induced pluripotent stem cells (iPSCs or iPS cells).
[00219] Reprogramming can involve altering, for example, reversing, at least some of the heritable patterns of nucleic acid modification (e.g., methylation), chromatin condensation, epigenetic changes, genomic imprinting, etc., that occur during cell differentiation. Reprogramming is distinct from simply maintaining the existing undifferentiated state of a cell that is already pluripotent or maintaining the less differentiated state of a cell that is already a multipotent cell (e.g., a hematopoietic stem cell). Reprogramming is also distinct from promoting the self-renewal or proliferation of cells that are already pluripotent or multipotent, although the compositions and methods described herein may also be useful for such purposes in some instances.
[00220] Many methods are known in the art that can be used to generate pluripotent stem cells from somatic cells. Any such method that reprograms a somatic cell to the pluripotent phenotype would be appropriate for use in the methods described herein.
[00221] Reprogramming methodologies for generating pluripotent cells using defined combinations of transcription factors have been described. Mouse somatic cells can be converted into ES-like cells with expanded developmental potential through direct transduction of Oct4, Sox2, Klf4, and c-Myc; see, for example, Takahashi and Yamanaka, Cell 126(4): 663-76 (2006). iPSCs resemble ES cells in that they restore the transcriptional circuits associated with pluripotency and much of the epigenetic landscape. Furthermore, mouse iPSCs satisfy all standard assays for pluripotency: es Petition 870200048765, dated 04 / 17 / 2020, page 51 / 216 47 / 197 specifically, in vitro differentiation into cell types of the three germ layers, teratoma formation, contribution to chimeras, germline transmission [see, for example, Maherali and Hochedlinger, Cell Stem Cell. 3(6):595-605 (2008)] and tetraploid complementation.
[00222] Human iPSCs can be obtained using similar transduction methods, and the transcription factor trio, OCT4, SOX2, and NANOG, has been established as the main set of transcription factors governing pluripotency; see, for example, Budniatzky and Gepstein, Stem Cells Transl Med. 3(4):448-57 (2014); Barrett et al., Stem Cells Trans Med 3:1-6 sctm.2014-0121 (2014); Focosi et al., Blood Cancer Journal 4: e211 (2014); and references cited therein. The production of iPSCs can be achieved by introducing nucleic acid sequences encoding stem cell-associated genes into an adult somatic cell, historically using viral vectors.
[00223] iPSCs can be generated or derived from terminally differentiated somatic cells, as well as from adult stem cells or somatic stem cells. That is, a non-pluripotent progenitor cell can become pluripotent or multipotent through reprogramming. In these cases, it may not be necessary to include as many reprogramming factors as is needed to reprogram a terminally differentiated cell. Furthermore, reprogramming can be induced by non-viral introduction of reprogramming factors, for example, by introducing the proteins themselves, or by introducing nucleic acids that encode the reprogramming factors, or by introducing messenger RNAs that, upon translation, produce the reprogramming factors (see, for example, Warren et al., Cell Stem Cell, 7(5):618-30 (2010)). Reprogramming can be achieved by introducing a combination of nucleic acids that encode stem cell-associated genes, including, for example, Oct-4 (also known as Oct). Petition 870200048765, dated 04 / 17 / 2020, p. 52 / 216 48 / 197 3 / 4 or Pouf51), Soxl, Sox2, Sox3, Sox 15, Sox 18, NANOG, Klfl, Klf2, Klf4, Klf5, NR5A2, c-Myc, 1-Myc, n-Myc, Rem2, Tert, and LIN28. Reprogramming using the methods and compositions described herein may also involve the introduction of one or more Oct-3 / 4, a member of the Sox family, a member of the Klf family, and a member of the Myc family into a somatic cell. The methods and compositions described herein may also involve the introduction of one or more of each of Oct-4, Sox2, Nanog, c-MYC, and Klf4 for reprogramming. As noted above, the exact method used for reprogramming is not necessarily critical for the methods and compositions described herein. However, when differentiated cells from reprogrammed cells are used in, for example, human therapy, in one aspect the reprogramming is not carried out by a method that alters the genome. Thus, in these examples, reprogramming can be achieved, for example, without the use of viral or plasmid vectors.
[00224] The reprogramming efficiency (i.e., the number of reprogrammed cells) derived from an initial cell population can be increased by the addition of various agents, for example, small molecules, as shown by Shi et al., Cell-Stem Cell 2:525-528 (2008); Huangfu et al., Nature Biotechnology 26(7):795-797 (2008) and Marson et al., Cell-Stem Cell 3: 132-135 (2008). Thus, an agent or combination of agents that increase the efficiency or rate of production of induced pluripotent stem cells can be used in the production of patient-specific or disease-specific iPSCs.Some non-limiting examples of agents that enhance the efficiency of reprogramming include soluble Wnt, Wnt conditioned medium, BIX-01294 (histone methyltransferase G9a), PD0325901 (MEK inhibitor), DNA methyltransferase inhibitors, histone deacetylase (HDAC) inhibitors, valproic acid, 5'-azacitidine, dexamethasone, suberoylanilide, hydroxamic acid (SAHA), vitamin C, and trichostatin (TSA), among others. Petition 870200048765, dated 04 / 17 / 2020, page 53 / 216 49 / 197 others.
[00225] Other non-limiting examples of reprogramming-promoting agents include: Suberoylanilide Hydroxamic Acid (SAHA (e.g., MK0683, vorinostat) and other hydroxamic acids), BML210, Depudecin (e.g., (-)-Depudecin), HC Toxin, Nullscript (4-(1,3-Dioxo-1H,3H-benzo[de]isoquinolin-2-yl)-N-hydroxybutanamide), Phenylbutyrate (e.g., sodium phenylbutyrate) and valproic acid ((VP A) and other short-chain fatty acids), Scriptaid, Sodium Suramin, Trichostatin A (TSA), APHA Compound 8, Apicidin, Sodium Butyrate, Pivaloyloxymethylbutyrate (Pivanex, AN-9), Trapoxin B, Chlamydocin, Depsipeptide (also known as FR901228 or FK228), benzamides (e.g., CI-994 (e.g., N-acetyl dinalin) and MS-27-275), MGCD0103, NVP-LAQ-824, CBHA (m-carboxycinnamic acid, bis-hydroxamic acid), JNJ16241199, Tubacin, A-161906, proxamide, oxamflatin, 3-Cl-UCHA (e.g., 6-(3-chlorophenylureido)caproic hydroxamic acid), AOE (2-amino-8-oxo-9-acid,10-epoxidecancoc), CHAP31 and CHAP50. Other reprogramming enhancers include, for example, dominant negative forms of HDACs (e.g., catalytically inactive forms), HDAC siRNA inhibitors, and antibodies that bind specifically to HDACs. Such inhibitors are available, for example, from BIOMOL International, Fukasawa, Merck Biosciences, Novartis, Gloucester Pharmaceuticals, Titan Pharmaceuticals, MethylGene, and Sigma Aldrich.
[00226] To confirm the induction of pluripotent stem cells for use with the methods described herein, isolated clones can be tested for the expression of a stem cell marker. Such expression in a cell derived from a somatic cell identifies the cells as induced pluripotent stem cells. Stem cell markers can be selected from the non-limited group. Petition 870200048765, dated 04 / 17 / 2020, page 54 / 216 50 / 197 active including SSEA3, SSEA4, CD9, Nanog, Fbxl5, Ecatl, Esgl, Eras, Gdf3, Fgf4, Crypto, Daxl, Zpf296, Slc2a3, Rexl, Utfl and Natl. In one case, for example, a cell expressing Oct4 or Nanog is identified as pluripotent. Methods for detecting the expression of such markers may include, for example, RT-PCR and immunological methods that detect the presence of the encoded polypeptides, such as Western blots or flow cytometry analyses. Detection may involve not only RT-PCR, but may also include the detection of protein markers. Intracellular markers may be best identified by RT-PCR, or protein detection methods such as immunocytochemistry, while cell surface markers are easily identified, for example, by immunocytochemistry.
[00227] The pluripotent stem cell character of isolated cells can be confirmed by tests that assess the ability of iPSCs to differentiate into cells of each of the three germ layers. As an example, teratoma formation in nude mice can be used to assess the pluripotent character of isolated clones. Cells can be introduced into nude mice and histology and / or immunohistochemistry can be performed on a tumor derived from the cells. The growth of a tumor comprising cells from all three germ layers, for example, further indicates that the cells are pluripotent stem cells. Creating patient-specific iPSCs
[00228] One step of the ex vivo methods of the present invention may involve creating a patient-specific iPS cell, patient-specific iPS cells, or a patient-specific iPS cell line. There are many established methods in the art for creating patient-specific iPS cells, as described in Takahashi and Yamanaka 2006; Takahashi, Tanabe et al. 2007. For example, the creation step may comprise: a) isolating a somatic cell, such as Petition 870200048765, dated 04 / 17 / 2020, page 55 / 216 51 / 197 a skin cell or fibroblast from the patient; and b) introduce a set of genes associated with pluripotency into the somatic cell in order to induce the cell to become a pluripotent stem cell. The set of genes associated with pluripotency may be one or more of the genes selected from the group consisting of OCT4, SOX2, KLF4, Lin28, NANOG and cMYC. Performing a biopsy or aspiration of the patient's bone marrow
[00229] A biopsy or aspiration is a sample of tissue or fluid taken from the body. There are many different types of biopsies or aspirations. Almost all of them involve the use of a sharp tool to remove a small amount of tissue. If the biopsy is on the skin or another sensitive area, anesthetic medication may be applied first. A biopsy or aspiration can be performed according to any of the methods known in the technique. For example, in a bone marrow aspiration, a large needle is used to enter the pelvic bone to collect bone marrow. Isolating a mesenchymal stem cell
[00230] Mesenchymal stem cells can be isolated according to any method known in the art, such as from a patient's bone marrow or peripheral blood. For example, bone marrow aspirate can be collected in a syringe with heparin. The cells can be washed and centrifuged in a Percoll™ density gradient. Cells such as blood cells, liver cells, interstitial cells, macrophages, mast cells, and thymocytes can be separated using Percoll™. The cells can be cultured in Dulbecco's Modified Eagle Medium (DMEM) (low glucose) containing 10% fetal bovine serum (FBS) (Pittinger MF, Mackay AM, Beck SC et al., Science 1999; 284:143-147). Treating a patient with GCSF Petition 870200048765, dated 04 / 17 / 2020, page 56 / 216 52 / 197
[00231] A patient may optionally be treated with granulocyte colony-stimulating factor (GCSF) according to any method known in the art. GCSF may be administered in combination with Plerixaflor. Isolating a hematopoietic progenitor cell from a patient
[00232] A hematopoietic progenitor cell can be isolated from a patient by any method known in the art. CD34+ cells can be enriched using the CliniMACS® Cell Selection System (Miltenyi Biotec). CD34+ cells can be weakly stimulated in serum-free medium (e.g., CellGrow SCGM, CellGenix medium) with cytokines (e.g., SCF, rhTPO, rhFLT3) prior to genome editing. Genome Editing
[00233] Genome editing generally refers to the process of modifying the nucleotide sequence of a genome, preferably in a precise or predetermined manner. Examples of genome editing methods described herein include methods using site-directed nucleases to cut deoxyribonucleic acid (DNA) at precise target locations in the genome, thus creating single-strand or double-strand DNA breaks at specific locations within the genome. Such breaks can be and regularly are repaired by endogenous natural cellular processes such as homology-directed repair (HDR) and NHEJ, as recently reviewed in Cox et al., Nature Medicine 21(2), 121-31 (2015). These two main DNA repair processes consist of a family of alternative pathways. NHEJ joins directly to the DNA ends resulting from a double-strand break, sometimes with the loss or addition of nucleotide sequence, which can disrupt or enhance gene expression.HDR uses a homologous sequence, or donor sequence, as a template to insert a defined DNA sequence at the breakpoint. The sequence... Petition 870200048765, dated 04 / 17 / 2020, p. 57 / 216 53 / 197 The homologous chromatid may be in the endogenous genome, such as a sister chromatid. Alternatively, the donor may be an exogenous nucleic acid, such as a plasmid, a single-stranded oligonucleotide, a double-stranded oligonucleotide, a duplex oligonucleotide, or a virus, which possesses regions of high homology with the cleaved nuclease locus, but which may also contain additional sequence or sequence alterations, including deletions that may be incorporated into the cleaved target locus. A third repair mechanism may be micro-homology-mediated end joining (MMEJ), also known as alternative NHEJ, in which the genetic outcome is similar to NHEJ, where small deletions and insertions may occur at the cleavage site.MMEJ can make use of homologous sequences of a few base pairs flanking the DNA break site to drive a more favorable DNA end-join repair outcome, and recent reports have further elucidated the molecular mechanism of this process; see, for example, Cho and Greenberg, Nature 518, 174-76 (2015); Kent et al., Nature Structural and Molecular Biology, Adv. Online doi:10.1038 / nsmb.2961 (2015); Mateos-Gomez et al., Nature 518, 254-57 (2015); Ceccaldi et al., Nature 528, 258-62 (2015). In some cases, it may be possible to predict likely repair outcomes based on the analysis of potential micro-algorithms at the DNA break site.
[00234] Each of these genome editing mechanisms can be used to create desired genomic alterations. One step in the genome editing process may be to create one or two DNA breaks, the second as double-strand breaks or as two single-strand breaks, at the target locus, near the site of the intended mutation. This can be achieved through the use of site-directed polypeptides, as described and illustrated herein.
[00235] Site-directed polypeptides, such as a DNA endonu Petition 870200048765, dated 04 / 17 / 2020, page 58 / 216 54 / 197 clease can introduce double-strand breaks or single-strand breaks in nucleic acids, for example, genomic DNA. Double-strand breaks can stimulate a cell's endogenous DNA repair pathways (e.g., homology-dependent repair or non-homologous end joining or alternative non-homologous end joining (A-NHEJ) or microhomology-mediated end joining). NHEJ can repair the cleaved target nucleic acid without the need for a homologous template. This can sometimes result in small deletions or insertions (indels) in the target nucleic acid at the cleavage site and can lead to disruption or alteration of gene expression. HDR can occur when a homologous repair template, or donor, is available. The homologous donor template may comprise sequences that can be homologous to sequences flanking the cleavage site of the target nucleic acid. The sister chromatid can be used by the cell as the repair template.However, for genome editing purposes, the repair template can be provided as an exogenous nucleic acid, such as a plasmid, duplex oligonucleotide, single-stranded oligonucleotide, double-stranded oligonucleotide, or viral nucleic acid. With exogenous donor templates, an additional nucleic acid sequence (such as a transgene) or modification (such as a single or multiple base change or a deletion) can be introduced between the homology flanking regions so that the additional or altered nucleic acid sequence is also incorporated into the target locus. MMEJ can result in a genetic outcome similar to NHEJ, in which small deletions and insertions can occur at the cleavage site. MMEJ can make use of homologous sequences of a few base pairs flanking the cleavage site to lead to a favorable end-join DNA repair outcome.In some cases, it may be possible to predict likely repair outcomes with... Petition 870200048765, dated 04 / 17 / 2020, page 59 / 216 55 / 197 based on the analysis of potential micro-algorithms in nuclease target regions.
[00236] Thus, in some cases, homologous recombination can be used to insert an exogenous polynucleotide sequence into the cleavage site of the target nucleic acid. An exogenous polynucleotide sequence is referred to as a donor polynucleotide (or donor sequence or donor polynucleotide template) herein. The donor polynucleotide, a portion of the donor polynucleotide, a copy of the donor polynucleotide, or a portion of a copy of the donor polynucleotide can be inserted into the cleavage site of the target nucleic acid. The donor polynucleotide can be an exogenous polynucleotide sequence, that is, a sequence that does not occur naturally in the cleavage site of the target nucleic acid.
[00237] Modifications to target DNA due to NHEJ and / or HDR can lead to, for example, mutations, deletions, alterations, integrations, gene correction, gene substitution, gene tagging, transgene insertion, nucleotide deletion, gene disruption, translocations, and / or gene mutation. The processes of deletion of genomic DNA and integration of non-native nucleic acid into genomic DNA are examples of genome editing. CRISPR Endonuclease System
[00238] A CRISPR (Clustered Regularly Interconnected Short Palindritic Repeats) genomic locus can be found in the genomes of many prokaryotes (e.g., bacteria and archaea). In prokaryotes, the CRISPR locus encodes products that function as a type of immune system to help defend prokaryotes against foreign invaders such as viruses and phages. There are three stages of CRISPR locus function: integration of new sequences into the CRISPR locus, expression of CRISPR RNA (crRNA), and silencing of foreign invading nucleic acid. Five types of Petition 870200048765, dated 04 / 17 / 2020, page 60 / 216 56 / 197 CRISPR systems (e.g., Type I, Type II, Type III, Type U, and Type V) have been identified.
[00239] A CRISPR locus includes a number of short repeat sequences referred to as repeats. When expressed, repeats can form secondary structures (e.g., haripins) and / or comprise unstructured single-stranded sequences. Repeats generally occur in clusters and frequently diverge between species. Repeats are regularly interspersed with unique intervening sequences, called spacers, resulting in a repeat-spacer-repeat locus architecture. Spacers are identical to, or have high homology with, sequences of known foreign invaders. A spacer-repeat unit encodes a crisprRNA (crRNA), which is processed into a mature form of the spacer-repeat unit. A crRNA comprises a seed or spacer sequence that is involved in targeting a target nucleic acid (in the naturally occurring form in prokaryotes, the spacer sequence targets the nucleic acid of the foreign invader).A spacer sequence is located at the 5' or 3' end of the crRNA.
[00240] A CRISPR locus also comprises polynucleotide sequences that encode CRISPR-associated (Cas) genes. Cas genes encode endonucleases involved in the biogenesis and functional interference stages of crRNA in prokaryotes. Some Cas genes comprise homologous secondary and / or tertiary structures. Type II CRISPR Systems
[00241] The biogenesis of crRNA in a Type II CRISPR system in nature requires a transactivated CRISPR RNA (tracrRNA). The tracrRNA can be modified by endogenous RNaseIII and then hybridizes with a crRNA repeat in the pre-crRNA array. RNaseIII enPetition 870200048765, dated 17 / 04 / 2020, page 61 / 216 57 / 197 dogena can be recruited to cleave pre-crRNA. Cleaved crRNAs can undergo exoribonuclease trimming to produce the mature crRNA form (e.g., 5' trimming). The tracrRNA can remain hybridized with the crRNA, and the tracrRNA and crRNA associate with a site-directed polypeptide (e.g., Cas9). The crRNA of the crRNA-tracrRNA-Cas9 complex can guide the complex to a target nucleic acid to which the crRNA can hybridize. Hybridization of crRNA to target nucleic acid can activate Cas9 for target nucleic acid cleavage. The target nucleic acid in a Type II CRISPR system is referred to as a protospacer adjacent motif (PAM). In nature, the PAM is essential to facilitate the binding of a site-directed polypeptide (e.g., Cas9) to the target nucleic acid. Type II systems (also called Nmeni or CASS4) are subdivided into Type II-A (CASS4) and Type II-B (CASS4a). Jinek et al., Science, 337(6096):816-821 (2012) showed that the system CRISPR / Cas9 is useful for programmable RNA genome editing, and international patent application publication number WO2013 / 176772 provides numerous examples and applications of the CRISPR / Cas endonuclease system for site-specific gene editing. Type V CRISPR systems
[00242] Type V CRISPR systems have several important differences from Type II systems. For example, Cpf1 is a single RNA-guided endonuclease that, unlike Type II systems, does not have tracrRNA. In fact, CRISPR arrays associated with Cpf1 can be processed into mature crRNAs without the requirement of an additional transactivating tracrRNA. The Type V CRISPR array can be processed into short, mature crRNAs of 42-44 nucleotides in length, with each mature crRNA beginning with 19 nucleotides of direct repeat followed by 23-25 nucleotides of spacer sequence. In contrast, mature crRNAs in Type II systems Petition 870200048765, dated 04 / 17 / 2020, p. 62 / 216 58 / 197 can begin with 20-24 nucleotide spacer sequences followed by approximately 22 nucleotides of direct repeat. Furthermore, Cpf1 can utilize an adjacent T-rich protospacer motif so that Cpfl-crRNA complexes efficiently cleave the target DNA preceded by a short T-rich PAM, which contrasts with the G-rich PAM following the target DNA for Type II systems. Thus, Type V systems cleave at a point distant from the PAM, while Type II systems cleave at a point adjacent to the PAM. Additionally, in contrast to Type II systems, Cpf1 cleaves DNA through a staggered double-strand break with a 5' overhang of 4 or 5 nucleotides. Type II systems cleave through a blind double-strand break. Similar to Type II systems, Cpf1 contains a predicted RuvC-type endonuclease domain, but lacks a second HNH endonuclease domain, which is in contrast to Type II systems. Cas Genes / Polypeptides and Adjacent Protospacer Motifs
[00243] Exemplary CRISPR / Cas polypeptides include Cas9 polypeptides in Fig. 1 of Fonfara et al., Nucleic Acids Research, 42: 2577-2590 (2014). The gene naming system CRISPR / Cas has undergone extensive rewriting since the Cas genes were discovered. Fig. 5 from Fonfara, above, provides PAM sequences for Cas9 polypeptides from various species. Site-Directed Polypeptides
[00244] A site-targeted polypeptide is a nuclease used in genome editing to cleave DNA. The nuclease or site-targeted polypeptide can be delivered to a cell or patient as: one or more polypeptides, or one or more mRNAs encoding the polypeptide.
[00245] In the context of a CRISPR / Cas or CRISPR / Cpf1 system, the targeted polypeptide can bind to a guide RNA which, by Petition 870200048765, dated 04 / 17 / 2020, p. 63 / 216 59 / 197, in turn, specifies the target site on the DNA to which the polypeptide is directed. In the CRISPR / Cas or CRISPR / Cpf1 systems disclosed here, the polypeptide directed to the site can be an endonuclease, such as a DNA endonuclease.
[00246] A site-directed polypeptide may comprise a plurality of nucleic acid cleavage (i.e., nuclease) domains. Two or more nucleic acid cleavage domains may be linked together via a linker. For example, the linker may comprise a flexible linker. Linkers may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40 or more amino acids in length.
[00247] Wild-type natural Cas9 enzymes comprise two nuclease domains, an HNH nuclease domain and a RuvC domain. Here, Cas9 refers to both natural and recombinant Cas9s. The Cas9 enzymes contemplated here may comprise an HNH-like or HNH-like nuclease domain and / or a RuvC-like or RuvC-like nuclease domain.
[00248] HNH or HNH-like domains comprise a McrA-like fold. HNH or HNH-like domains comprise two antiparallel β-strands and an α-helix. HNH or HNH-like domains comprise a metal-binding site (e.g., a divalent cationic binding site). HNH or HNH-like domains can cleave a strand of a target nucleic acid (e.g., the complementary strand of the cRNA-targeted strand).
[00249] RuvC or RuvC-like domains comprise an RNaseH or RNaseH-like fold. RuvC / RNaseH domains are involved in a diverse set of nucleic acid-based functions, including acting on both RNA and DNA. The RNaseH domain comprises 5 β-strands surrounded by a plurality of α-helices. RuvC / RNaseH or similar domains Petition 870200048765, dated 04 / 17 / 2020, page 64 / 216 60 / 197 Similar to RuvC / RnaseH, it comprises a metal binding site (e.g., a divalent cation binding site). RuvC / RnaseH or RuvC / RnaseH-like domains can cleave one strand of a target nucleic acid (e.g., the non-complementary strand of a double-stranded target DNA).
[00250] Site-targeted polypeptides can introduce double-strand breaks or single-strand breaks in nucleic acids, for example, genomic DNA. Double-strand breaks can stimulate a cell's endogenous DNA repair pathways (e.g., homology-dependent repair or NHEJ or non-homologous alternative end joining (A-NHEJ) or microhomology-mediated end joining (MMEJ)). NHEJ can repair the cleaved target nucleic acid without the need for a homologous template. This can sometimes result in small deletions or insertions (indels) in the target nucleic acid at the cleavage site and can lead to disruption or alteration of gene expression. HDR can occur when a homologous repair template, or donor, is available. The homologous donor template may comprise sequences that are homologous to sequences flanking the cleavage site of the target nucleic acid. The sister chromatid can be used by the cell as the repair template.However, for genome editing purposes, the repair template can be provided as an exogenous nucleic acid, such as a plasmid, duplex oligonucleotide, single-stranded oligonucleotide, or viral nucleic acid. With exogenous donor templates, an additional nucleic acid sequence (such as a transgene) or modification (such as a single or multiple base change or a deletion) can be introduced between the homology flanking regions so that the additional or altered nucleic acid sequence is also incorporated into the target locus. MMEJ can result in a genetic outcome similar to NHEJ, in which small deletions and insertions occur. Petition 870200048765, dated 04 / 17 / 2020, page 65 / 216 61 / 197 can occur at the cleavage site. MMEJ can make use of homologous sequences of a few base pairs flanking the cleavage site to drive a favorable end-join DNA repair outcome. In some cases, it may be possible to predict likely repair outcomes based on the analysis of potential microalgorithms in nuclease target regions.
[00251] Thus, in some cases, homologous recombination can be used to insert an exogenous polynucleotide sequence into the cleavage site of the target nucleic acid. An exogenous polynucleotide sequence is called a donor polynucleotide (or donor or donor sequence) here. The donor polynucleotide, a portion of the donor polynucleotide, a copy of the donor polynucleotide, or a portion of a copy of the donor polynucleotide can be inserted into the cleavage site of the target nucleic acid. The donor polynucleotide can be an exogenous polynucleotide sequence, that is, a sequence that does not occur naturally in the cleavage site of the target nucleic acid.
[00252] Modifications to target DNA due to NHEJ and / or HDR can lead to, for example, mutations, deletions, alterations, integrations, gene correction, gene substitution, gene tagging, transgene insertion, nucleotide deletion, gene disruption, translocations, and / or gene mutation. The processes of deletion of genomic DNA and integration of non-native nucleic acid into genomic DNA are examples of genome editing.
[00253] The site-targeted polypeptide may comprise an amino acid sequence with at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% amino acid sequence identity with a Petition 870200048765, dated 04 / 17 / 2020, page 66 / 216 62 / 197 exemplifying wild-type site-targeted polypeptide [e.g., Cas9 from S. pyogenes, US2014 / 0068797 Sequence ID No. 8 or Sapranauskas et al., Nucleic Acids Res, 39(21): 9275-9282 (2011)], and several other site-targeted polypeptides. The site-targeted polypeptide may comprise at least 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity with a wild-type site-targeted polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 contiguous amino acids. The site-targeted polypeptide may comprise at least 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity with a wild-type site-targeted polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 contiguous amino acids.The site-targeted polypeptide may comprise at least 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity with a wild-type site-targeted polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 contiguous amino acids in a site-targeted polypeptide HNH nuclease domain. The site-targeted polypeptide may comprise at least 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity with a wild-type site-targeted polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 contiguous amino acids in a site-targeted polypeptide RuvC nuclease domain. The site-targeted polypeptide may comprise at least 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity with a wild-type site-targeted polypeptide (e.g., Cas9 from S.pyogenes, supra) on 10 contiguous amino acids in a RuvC nuclease domain of the polypeptide directed to the site.
[00254] The site-targeted polypeptide may comprise a form Petition 870200048765, dated 04 / 17 / 2020, p. 67 / 216 63 / 197 modified form of a wild-type exemplary site-targeted polypeptide. The modified form of the wild-type exemplary site-targeted polypeptide may comprise a mutation that reduces the nucleic acid cleavage activity of the site-targeted polypeptide. The modified form of the wild-type exemplary site-targeted polypeptide may have less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, or less than 1% of the nucleic acid cleavage activity of the wild-type site-targeted polypeptide (e.g., Cas9 from S. pyogenes, above). The modified form of the site-targeted polypeptide may have no substantial nucleic acid cleavage activity. When a site-targeted polypeptide is a modified form that has no substantial nucleic acid cleavage activity, it is referred to herein as enzymatically inactive.
[00255] The modified form of the site-directed polypeptide may comprise a mutation such that it can induce a single-strand break (SSB) in a target nucleic acid (e.g., cleaving only one of the sugar-phosphate backbones of a double-stranded target nucleic acid). The mutation may result in less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, or less than 1% of nucleic acid cleavage activity in one or more of the plurality of nucleic acid cleavage domains of the wild-type site-directed polypeptide (e.g., Cas9 from S. pyogenes, above). The mutation can result in one or more plurality of nucleic acid cleavage domains retaining the ability to cleave the complementary strand of the target nucleic acid, but reducing its ability to cleave the non-complementary strand of the target nucleic acid. The mutation can result in one or Petition 870200048765, dated 04 / 17 / 2020, page 68 / 216 64 / 197 more of the plurality of nucleic acid cleavage domains retaining the ability to cleave the non-complementary strand of the target nucleic acid, but reducing its ability to cleave the complementary strand of the target nucleic acid. For example, residues in the wild-type exemplary S. pyogenes Cas9 polypeptide, such as Asp10, His840, Asn854, and Asn856, are mutated to inactivate one or more of the plurality of nucleic acid cleavage domains (e.g., nuclease domains). The residues to be mutated may correspond to the Asp10, His840, Asn854, and Asn856 residues in the wild-type exemplary S. pyogenes Cas9 polypeptide (e.g., as determined by sequence and / or structural alignment). Non-limiting examples of mutations include D10A, H840A, N854A, or N856A. Someone skilled in the art will recognize that mutations other than alanine substitutions may be suitable.
[00256] A D10A mutation can be combined with one or more H840A, N854A, or N856A mutations to produce a site-targeted polypeptide with substantially no DNA cleavage activity. An H840A mutation can be combined with one or more D10A, N854A, or N856A mutations to produce a site-targeted polypeptide with substantially no DNA cleavage activity. An N854A mutation can be combined with one or more H840A, D10A, or N856A mutations to produce a site-targeted polypeptide with substantially no DNA cleavage activity. An N856A mutation can be combined with one or more H840A, N854A, or D10A mutations to produce a site-targeted polypeptide with substantially no DNA cleavage activity. Site-targeted polypeptides comprising a substantially inactive nuclease domain are referred to as nickases.
[00257] RNA-guided endonuclease nickase variants, for example Cas9, can be used to increase specificity Petition 870200048765, dated 04 / 17 / 2020, p. 69 / 216 65 / 197 city of CRISPR-mediated genome editing. Wild-type Cas9 is typically guided by a single guide RNA designed to hybridize with a specified 20-nucleotide sequence in the target sequence (such as an endogenous genomic locus). However, various mismatches can be tolerated between the guide RNA and the target locus, effectively reducing the required homology length at the target site to, for example, as little as 13 nt of homology, and thus resulting in a high potential for binding and cleavage of double-stranded nucleic acid by the CRISPR / Cas9 complex in other parts of the target genome – also known as off-target cleavage. Since each of the Cas9 nickase variants cuts only one strand, to create a double-strand break it is necessary for a pair of nickases to bind in close proximity and on opposite strands of the target nucleic acid, thus creating a pair of nicks, which is the equivalent of a double-strand break.This requires two separate guide RNAs – one for each nickase – to bind close together and on opposite strands of the target nucleic acid. This requirement essentially doubles the minimum homology length needed for double-strand breaks to occur, thus reducing the likelihood of a double-strand cleavage event occurring elsewhere in the genome where the two guide RNA sites – if they exist – are unlikely to be close enough to each other to allow double-strand breaks. As described in the technique, nickases can also be used to promote HDR versus NHEJ. HDR can be used to introduce selected changes at target sites in the genome through the use of specific donor sequences that effectively mediate the desired changes.
[00258] Mutations considered may include substitutions, additions, and deletions, or any combination thereof. The mutation converts the mutated amino acid into alanine. The mutation converts the amino acid into alanine. Petition 870200048765, dated 04 / 17 / 2020, pp. 70 / 216 66 / 197 The mutated amino acid is converted into another amino acid (e.g., glycine, serine, threonine, cysteine, valine, leucine, isoleucine, methionine, proline, phenylalanine, tyrosine, tryptophan, aspartic acid, glutamic acid, asparagine, glutamine, histidine, lysine, or arginine). The mutation converts the mutated amino acid into an unnatural amino acid (e.g., selenomethionine). The mutation converts the mutated amino acid into amino acid mimics (e.g., phosphomimics). The mutation may be a conservative mutation. For example, the mutation converts the mutated amino acid into amino acids that resemble the size, shape, charge, polarity, conformation, and / or rotamers of the mutated amino acids (e.g., cysteine / serine mutation, lysine / asparagine mutation, histidine / phenylalanine mutation). The mutation can cause a change in the reading frame and / or the creation of a premature stop codon.Mutations can cause changes in gene regulatory regions or loci that affect the expression of one or more genes.
[00259] Site-targeted polypeptides (e.g., variant, mutated, enzymatically inactive, and / or conditionally enzymatically inactivated site-targeted polypeptides) can target nucleic acid. Site-targeted polypeptides (e.g., variant, mutated, enzymatically inactive, and / or conditionally enzymatically inactivated endoribonucleases) can target DNA. Site-targeted polypeptides (e.g., variant, mutated, enzymatically inactive, and / or conditionally enzymatically inactivated endoribonucleases) can target RNA.
[00260] The site-targeted polypeptide may comprise one or more non-native sequences (for example, the site-targeted polypeptide is a fusion protein).
[00261] The targeted polypeptide may comprise an amino acid sequence comprising at least 15% identification. Petition 870200048765, dated 04 / 17 / 2020, page 71 / 216 67 / 197 amino acid sequence for the Cas9 of a bacterium (e.g., S. pyogenes), a nucleic acid-binding domain, and two nucleic acid-cleavage domains (i.e., an HNH domain and a RuvC domain).
[00262] The site-directed polypeptide may comprise an amino acid sequence comprising at least 15% amino acid identity to the Cas9 of a bacterium (e.g., S. pyogenes), and two nucleic acid cleavage domains (i.e., an HNH domain and a RuvC domain).
[00263] The site-targeted polypeptide may comprise an amino acid sequence comprising at least 15% amino acid identity to Cas9 of a bacterium (e.g., S. pyogenes), and two nucleic acid cleavage domains wherein one or both nucleic acid cleavage domains comprise at least 50% amino acid identity to a Cas9 nuclease domain of a bacterium (e.g., S. pyogenes).
[00264] The site-targeted polypeptide may comprise an amino acid sequence comprising at least 15% amino acid identity to Cas9 of a bacterium (e.g., S. pyogenes), two nucleic acid cleavage domains (i.e., an HNH domain and a RuvC domain) and a non-native sequence (e.g., a nuclear localization signal) or a linker that links the site-targeted polypeptide to a non-native sequence.
[00265] The site-directed polypeptide may comprise an amino acid sequence comprising at least 15% amino acid identity to the Cas9 of a bacterium (e.g., S. pyogenes), and two nucleic acid cleavage domains (i.e., an HNH domain and a RuvC domain), wherein the site-directed polypeptide comprises a mutation in one or both nucleic acid cleavage domains that reduces the cleavage activity of the Petition 870200048765, dated 17 / 04 / 2020, page 72 / 216 68 / 197 nuclease mins in at least 50%.
[00266] The site-directed polypeptide may comprise an amino acid sequence comprising at least 15% amino acid identity to the Cas9 of a bacterium (e.g., S. pyogenes), and two nucleic acid cleavage domains (i.e., an HNH domain and a RuvC domain), wherein one of the nuclease domains comprises the aspartic acid 10 mutation, and / or wherein one of the nuclease domains may comprise a histidine 840 mutation, and wherein the mutation reduces the cleavage activity of the nuclease domain(s) by at least 50%.
[00267] One or more site-directed polypeptides, for example, DNA endonucleases, may comprise two nickases that together effect a double-strand break at a specific locus in the genome, or four nickases that jointly affect or cause double-strand breaks at specific loci in the genome. Alternatively, a single polypeptide, for example, DNA endonuclease, may trigger or cause a double-strand break at a specific locus in the genome.
[00268] The targeted polypeptide can be flanked at the N-terminal, C-terminal, or both the N-terminal and C-terminal by one or more nuclear localization signals (NLSs). For example, a Cas9 endonuclease can be flanked by two NLSs, one NLS located at the N-terminal and the second NLS located at the C-terminal. The NLS can be any NLS known in the art, such as an SV40 NLS. Genome-Directing Nucleic Acid
[00269] The present invention provides a genome-directing nucleic acid that can direct the activities of an associated polypeptide (e.g., site-directed polypeptide) to a specific target sequence within a target nucleic acid. The genome-directing nucleic acid can be RNA. A genome-directing RNA is referred to as guide RNA or gRNA herein. A guide RNA Petition 870200048765, dated 04 / 17 / 2020, p. 73 / 216 69 / 197 may comprise at least one spacer sequence that hybridizes with a target nucleic acid sequence of interest, and a CRISPR repeat sequence. In Type II systems, the gRNA also comprises a second RNA called a tracrRNA sequence. In Type II guide RNA (gRNA), the CRISPR repeat sequence and the tracrRNA sequence hybridize with each other to form a duplex. In Type V guide RNA (gRNA), the crRNA forms a duplex. In both systems, the duplex can bind a site-directed polypeptide, so that the guide RNA and the site-directed polypeptide form a complex. The genome-directed nucleic acid can provide target specificity to the complex by virtue of its association with the site-directed polypeptide. The genome-directed nucleic acid can thus direct the activity of the site-directed polypeptide.
[00270] Examples of guide RNAs include the spacer sequences in SEQ ID NOs: 1-71,947 and the sgRNA sequences in SEQ ID NOs: 71,950-71,959 from the Sequence Listing. As understood by those skilled in the art, each guide RNA can be designed to include a complementary spacer sequence to its genomic target sequence. For example, each of the spacer sequences in SEQ ID NOs: 1-71,947 from the Sequence Listing can be placed in a single RNA chimera or in a crRNA (along with a corresponding tracrRNA). See Jinek et al., Science, 337, 816-821 (2012) and Deltcheva et al., Nature, 471, 602-607 (2011) or Table 1.
[00271] The nucleic acid that directs the genome can be a double-molecule guide RNA. The nucleic acid that directs the genome can be a single-molecule guide RNA.
[00272] A double-stranded guide RNA may comprise two RNA strands. The first strand comprises, in the 5' to 3' direction, an optional spacer extension sequence, a spacer sequence Petition 870200048765, dated 04 / 17 / 2020, page 74 / 216 70 / 197 dora and a minimal CRISPR repeat sequence. The second strand may comprise a minimal tracrRNA sequence (complementary to the minimal CRISPR repeat sequence), a 3' tracrRNA sequence, and an optional tracrRNA extension sequence.
[00273] A single-molecule guide RNA (sgRNA) in a Type II system may comprise, in the 5' to 3' direction, an optional spacer extension sequence, a spacer sequence, a minimal CRISPR repeat sequence, a single-molecule guide linker, a minimal tracrRNA sequence, a 3' tracrRNA sequence, and an optional tracrRNA extension sequence. The optional tracrRNA extension may include elements that contribute additional functionality (e.g., stability) to the guide RNA. The single-molecule guide linker may link the minimal CRISPR repeat and the minimal tracrRNA sequence to form a hairpin structure. The optional tracrRNA extension may comprise one or more hairpins.
[00274] A single-molecule guide RNA (sgRNA) in a Type V system may comprise, in the 5' to 3' direction, a minimal CRISPR repeat sequence and a spacer sequence.
[00275] The sgRNA may comprise a 20-nucleotide spacer sequence at the 5' end of the sgRNA sequence. The sgRNA may comprise a spacer sequence of less than 20 nucleotides at the 5' end of the sgRNA sequence. The sgRNA may comprise a spacer sequence of more than 20 nucleotides at the 5' end of the sgRNA sequence. The sgRNA may comprise a variable-length spacer sequence of 17-30 nucleotides at the 5' end of the sgRNA sequence (see Table 1).
[00276] The sgRNA may not contain uracil at the 3' end of the sgRNA sequence, as in SEQ ID NO: 71,961 of Table 1. The sgR Petition 870200048765, dated 04 / 17 / 2020, page 75 / 216 71 / 197 NA may comprise one or more uracils at the 3' end of the sgRNA sequence, as in SEQ ID NO: 71962 in Table 1. For example, sgRNA may comprise 1 uracil (U) at the 3' end of the sgRNA sequence. sgRNA may comprise 2 uracils (UU) at the 3' end of the sgRNA sequence. sgRNA may comprise 3 uracils (UUU) at the 3' end of the sgRNA sequence. sgRNA may comprise 4 uracils (UUUU) at the 3' end of the sgRNA sequence. sgRNA may comprise 5 uracils (UUUUU) at the 3' end of the sgRNA sequence. sgRNA may comprise 6 uracils (UUUUUU) at the 3' end of the sgRNA sequence. The sgRNA may comprise 7 uracils (UUUUUUU) at the 3' end of the sgRNA sequence. The sgRNA may comprise 8 uracils (UUUUUUUU) at the 3' end of the sgRNA sequence.
[00277] sgRNA can be unmodified or modified. For example, modified sgRNAs may comprise one or more 2'-O-methyl phosphorothioate nucleotides. Table 1 SEQ ID NO sgRNA sequence 71960 gcuaguccguuaucaacuugaaaaaguggcaccgagucggugc 71,962 n<17-30>guuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaa cuugaaaaagu ggcaccgagucggugcu<1-8)
[00278] By way of illustration, the guide RNAs used in the CRISPR / Cas / Cpf1 system, or other smaller RNAs, can be readily synthesized by chemical means, as illustrated below and described in the technique. While chemical synthesis procedures are continually expanding, purifications of such RNAs by procedures such as high-performance liquid chromatography (HPLC, Petition 870200048765, dated 04 / 17 / 2020, pp. 76 / 216 72 / 197 (which avoids the use of gels such as PAGE) tend to become more challenging as polynucleotide lengths increase significantly beyond one hundred nucleotides. One approach used to generate longer RNAs is to produce two or more molecules that are linked together. Much longer RNAs, such as those encoding a Cas9 or Cpf1 endonuclease, are more easily generated enzymatically. Several types of RNA modifications can be introduced during or after the chemical synthesis and / or enzymatic generation of RNAs, for example, modifications that increase stability, reduce the likelihood or degree of innate immune response, and / or improve other attributes, as described in the technique. Spacer Extension Sequence
[00279] In some examples of genome-targeting nucleic acids, a spacer extension sequence can modify activity, provide stability, and / or provide a site for modifications of a genome-targeting nucleic acid. A spacer extension sequence can modify activity or specificity both on and off the target. In some examples, a spacer extension sequence can be provided. The spacer extension sequence may have a length greater than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 1000, 2000, 3000, 4000, 5000, 6000 or 7000 or more nucleotides. The spacer extension sequence may have a length of 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 1000, 2000, 3000, 4000, 5000, 6000, 7000 or more nucleotides.The spacer extension sequence may be less than 10 nucleotides long. The spacer extension sequence may be between 10 and 30 nucleotides long. The spacer extension sequence may be... Petition 870200048765, dated 04 / 17 / 2020, page 77 / 216 73 / 197 between 30 and 70 nucleotides in length.
[00280] The spacer extension sequence may comprise another portion (e.g., a stability control sequence, an endoribonuclease binding sequence, a ribozyme). The portion may decrease or increase the stability of a nucleic acid that targets a nucleic acid. The portion may be a transcriptional terminator segment (i.e., a transcriptional termination sequence). The portion may function in a eukaryotic cell. The portion may function in a prokaryotic cell. The portion may function in both eukaryotic and prokaryotic cells.Non-limiting examples of suitable moieties include: a 5' cap (e.g., a 7-methylguanylate (m7G) cap), a riboswitch sequence (e.g., to allow regulated stability and / or regulated accessibility by proteins and protein complexes), a sequence that forms a duplex dsRNA (i.e., a hairpin), a sequence that directs the RNA to a subcellular location (e.g., nucleus, mitochondria, chloroplasts, and the like), a modification or sequence that provides tracking (e.g., direct conjugation to a fluorescent molecule, conjugation with a moiety that facilitates fluorescent detection, a sequence that allows fluorescence detection, etc.).), and / or a modification or sequence that provides a binding site for proteins (e.g., proteins that act on DNA, including transcriptional activators, transcriptional controls, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, and the like). Spacing Sequence
[00281] The spacer sequence hybridizes with a sequence in a target nucleic acid of interest. The spacer of a genome-targeting nucleic acid can interact with a target nucleic acid in a sequence-specific manner via hybridization (i.e., pairing). Petition 870200048765, dated 04 / 17 / 2020, page 78 / 216 74 / 197 base mentum). The nucleotide sequence of the spacer may vary depending on the target nucleic acid sequence of interest.
[00282] In a CRISPR / Cas system of the present invention, the spacer sequence can be designed to hybridize with a target nucleic acid that is located 5' from a PAM of the Cas9 enzyme used in the system. The spacer can perfectly match the target sequence or it can have mismatches. Each Cas9 enzyme has a specific PAM sequence that it recognizes in a target DNA. For example, S. pyogenes recognizes in a target nucleic acid a PAM comprising the sequence 5'-NRG-3', where R comprises A or G, where N is any nucleotide and N is immediately 3' from the target nucleic acid sequence directed to the spacer sequence.
[00283] The target nucleic acid sequence may comprise 20 nucleotides. The target nucleic acid may comprise fewer than 20 nucleotides. The target nucleic acid may comprise more than 20 nucleotides. The target nucleic acid may comprise at least: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. The target nucleic acid may comprise at most: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. The target nucleic acid sequence may comprise 20 bases immediately 5' from the first nucleotide of the PAM. For example, in a sequence comprising 5'-NNNNNNNNNNNNNNNNNNNNNRG-3' (SEQ ID NO: 71.948), the target nucleic acid may comprise the sequence corresponding to Ns, where N is any nucleotide and the underlined NRG sequence is the PAM of S. pyogenes.
[00284] The spacer sequence that hybridizes with the target nucleic acid can have a length of at least about 6 nucleotides (nt). The spacer sequence can be at least about 6 nt, at least about 10 nt, at least about 15 nt, at least about 18 Petition 870200048765, dated 04 / 17 / 2020, pp. 79 / 216 75 / 197 years nt, hair less than 19 nt, hair less about 20 nt, hair less about 25 nt, hair less about 30 nt, hair less than 35 nt or hair less about 40 nt, from about 6 nt to about 80 nt, from about 6 nt to about 50 nt, from about 6 nt to about 45 nt, from about 6 nt to about 40 nt, from about 6 nt to about 35 nt, from about 6 nt to about 30 nt, from about 6 nt to about nt, from about 6 nt to about 20 nt, from about 6 nt to approximately 19 nt, from about 10 nt to about 50 nt, from about 10 nt to about 45 nt, from about 10 nt to about 40 nt, from about 10 nt to about 35 nt, from about 10 nt to about 30 nt, from about 10 nt to about 25 nt, from about 10 nt to about 20 nt, from about 10 nt to approximately 19 nt, from about 19 nt to about 25 nt, from about 19 nt to about 30 nt, from about 19 nt to about 35 nt, from about 19 nt to about 40 nt,from about 19 nt to about 45 nt, from about 19 nt to about 50 nt, from about 19 nt to about 60 nt, from about 20 nt to about 25 nt, from about 20 nt to about 30 nt, from about 20 nt to about 35 nt, from about 20 nt to about 40 nt, from about 20 nt to about 45 nt, from about 20 nt to about 50 nt, or from about 20 nt to about 60 nt. In some examples, the spacer sequence may comprise 20 nucleotides. In some examples, the spacer may comprise 19 nucleotides.
[00285] In some examples, the complementarity percentage between the spacer sequence and the target nucleic acid is at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 65%, at least 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or 100%. In some examples, the percentage of Petition 870200048765, dated 04 / 17 / 2020, pp. 80 / 216 76 / 197 The complementarity between the spacer sequence and the target nucleic acid is at most about 30%, at most about 40%, at most about 50%, at most 60%, at most 65%, at most 70%, at most 75%, at most 80%, at most about 85%, at most about 90%, at most about 95%, at most about 97%, at most about 98%, at most about 99%, or 100%. In some examples, the percentage of complementarity between the spacer sequence and the target nucleic acid is 100% along the six most contiguous 5' nucleotides of the target sequence of the complementary strand of the target nucleic acid. The complementarity percentage between the spacer sequence and the target nucleic acid can be at least 60% over 20 contiguous nucleotides. The length of the spacer sequence and the target nucleic acid can differ by 1 to 6 nucleotides, which can be considered a bulge or bulges.
[00286] The spacer sequence can be designed or chosen using a computer program. The computer program can use variables such as predicted melting temperature, secondary structure formation, predicted annealing temperature, sequence identity, genomic context, chromatin accessibility, % GC, genomic occurrence frequency (e.g., of identical or similar sequences but varying at one or more points as a result of mismatch, insertion, or deletion), methylation status, presence of SNPs, and the like. Minimum CRISPR Repeat Sequence
[00287] A minimal CRISPR repeat sequence may be a sequence with at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% sequence identity with a repeat sequence of Petition 870200048765, dated 04 / 17 / 2020, page 81 / 216 77 / 197 Reference CRISPR (e.g., crRNA from S. pyogenes).
[00288] A minimal CRISPR repeat sequence may comprise nucleotides that can hybridize with a minimal tracrRNA sequence in a cell. The minimal CRISPR repeat sequence and a minimal tracrRNA sequence may form a duplex, that is, a double-stranded base-pairing structure. Together, the minimal CRISPR repeat sequence and the minimal tracrRNA sequence may bind to the targeted polypeptide site. At least a portion of the minimal CRISPR repeat sequence may hybridize with the minimal tracrRNA sequence. At least one portion of the minimal CRISPR repeat sequence may comprise at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% complementarity to the minimal tracRRNA sequence.At least one portion of the minimal CRISPR repeat sequence may comprise at most about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% complementarity to the minimal tracRRNA sequence.
[00289] The CRISPR repeat sequence can be about 7 nucleotides long to about 100 nucleotides long. For example, the minimum CRISPR repeat sequence length is approximately 7 nucleotides (nt) to approximately 50 nt, approximately 7 nt to approximately 40 nt, approximately 7 nt to approximately 30 nt, approximately 7 nt to approximately 25 nt, approximately 7 nt to approximately 20 nt, approximately 7 nt to approximately 15 nt, approximately 8 nt to approximately 40 nt, approximately 8 nt to approximately 30 nt, approximately 8 nt to approximately 25 nt, approximately 8 nt to approximately 20 nt, approximately 8 nt to approximately 15 nt, approximately 100 nt, approximately 15 nt to approximately 80 nt, approximately 15 nt to approximately 50 nt, Petition 870200048765, dated 04 / 17 / 2020, p. 82 / 216 78 / 197 approximately 15 nt to approximately 40 nt, approximately 15 nt to approximately 30 nt, or approximately 15 nt to approximately 25 nt. In some examples, the minimal CRISPR repeat sequence may be approximately 9 nucleotides long. The minimal CRISPR repeat sequence may be approximately 12 nucleotides long.
[00290] The minimal CRISPR repeat sequence may be at least about 60% identical to a reference minimal CRISPR repeat sequence (e.g., wild-type tracrRNA from S. pyogenes) over a stretch of at least 6, 7, or 8 contiguous nucleotides. For example, the minimal CRISPR repeat sequence may be at least about 65% identical, at least about 70% identical, at least about 75% identical, at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical, or 100% identical to a reference minimal CRISPR repeat sequence over a stretch of at least 6, 7, or 8 contiguous nucleotides. minimal tracrRNA sequence
[00291] A minimal tracrRNA sequence may be a sequence with at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% sequence identity with a reference tracrRNA sequence (e.g., wild-type S. pyogenes tracrRNA).
[00292] A minimal tracrRNA sequence may comprise nucleotides that hybridize with a minimal CRISPR repeat sequence in a cell. A minimal tracrRNA sequence and a minimal CRISPR repeat sequence form a duplex, that is, a double-stranded base-pairing structure. Together, the Petition 870200048765, dated 04 / 17 / 2020, p. 83 / 216 79 / 197 The minimal tracRNA and minimal CRISPR repeat sequences can bind to a site-targeted polypeptide. At least a portion of the minimal tracrRNA sequence can hybridize with the minimal CRISPR repeat sequence. The minimal tracrRNA repeat sequence can be at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% complementary to the minimal CRISPR repeat sequence.
[00293] The tracrRNA sequence can have a length of about 7 nucleotides to about 100 nucleotides. For example, the minimum tracrRNA sequence can be from about 7 nucleotides (nt) to about 50 nt, from about 7 nt to about 40 nt, from about 7 nt to about 30 nt, from about 7 nt to about 25 nt, from about 7 nt to about 20 nt, from about 7 nt to about 15 nt, from about 8 nt to about 40 nt, from about 8 nt to about 30 nt, from about 8 nt to about 25 nt, from about 8 nt to about 20 nt, from about 8 nt to about 15 nt, from about 15 to about 100 nt, from about 15 nt to about 80 nt, from about 15 nt to about 50 nt, from about 15 The minimum tracrRNA sequence can be approximately 40 nucleotides, approximately 15 to 30 nucleotides, or approximately 15 to 25 nucleotides in length. The minimum tracrRNA sequence can be approximately 9 nucleotides long. The minimum tracrRNA sequence can be approximately 12 nucleotides long.The minimal tracrRNA may consist of tracrRNA nt 23-48 described in Jinek et al., supra.
[00294] The minimal tracrRNA sequence must be at least approximately 60% identical to a reference tracrRNA sequence (e.g., wild-type tracrRNA from S. pyogenes) over a stretch of at least 6, 7, or 8 contiguous nucleotides. For example, the minimal tracrRNA sequence may be at least 65% identical Petition 870200048765, dated 04 / 17 / 2020, p. 84 / 216 80 / 197 ca, approximately 70% identical, approximately 75% identical, approximately 80% identical, approximately 85% identical, approximately 90% identical, approximately 95% identical, approximately 98% identical, approximately 99% identical, or 100% identical to a reference minimal tracrRNA sequence over a stretch of at least 6, 7, or 8 contiguous nucleotides,
[00295] The duplex between the minimal CRISPR RNA and the minimal tracrRNA may comprise a double helix. The duplex between the minimal CRISPR RNA and the minimal tracrRNA may comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides. The duplex between the minimal CRISPR RNA and the minimal tracrRNA may comprise, at most, about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides.
[00296] The duplex may comprise a mismatch (i.e., the two duplex tapes are not 100% complementary). The duplex may comprise at least approximately 1, 2, 3, 4, or 5 mismatches. The duplex may comprise at most approximately 1, 2, 3, 4, or 5 mismatches. The duplex may contain at most 2 mismatches. Protrusions
[00297] In some cases, there may be a bulge in the duplex between the minimal CRISPR RNA and the minimal tracrRNA. A bulge is an unpaired region of nucleotides within the duplex. A bulge may contribute to the binding of the duplex to the site-directed polypeptide. The bulge may include, on one side of the duplex, an unpaired 5'-XXXY-3' where X is any purine and Y comprises a nucleotide that may form a wobble pair with a nucleotide on the opposite strand, and an unpaired nucleotide region on the other side of the duplex. The number of unpaired nucleotides on the two sides of the duplex may be different.
[00298] In one example, the protrusion may comprise a Petition 870200048765, dated 04 / 17 / 2020, page 85 / 216 81 / 197 unpaired purine (e.g., adenine) in the minimal CRISPR repeat strand of the bulge. In some examples, the bulge may comprise an unpaired 5'-AAGY-3' minimal tracrRNA sequence strand, wherein Y comprises a nucleotide that may form a wobble pairing with a nucleotide in the minimal CRISPR repeat strand.
[00299] A bulge on the minimal CRISPR repeat side of the duplex may comprise at least 1, 2, 3, 4, or 5 or more unpaired nucleotides. A bulge on the minimal CRISPR repeat side of the duplex may comprise at most 1, 2, 3, 4, or 5 or more unpaired nucleotides. A bulge on the minimal CRISPR repeat side of the duplex may comprise 1 unpaired nucleotide.
[00300] A bulge on the minimal tracrRNA sequence side of the duplex may comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more unpaired nucleotides. A bulge on the minimal tracrRNA sequence side of the duplex may comprise at most 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more unpaired nucleotides. A bulge on a second side of the duplex (e.g., the minimal tracrRNA sequence side of the duplex) may comprise 4 unpaired nucleotides.
[00301] A bulge may include at least one wobble pair. In some examples, a bulge may comprise at most one wobble pair. A bulge may comprise at least one purine nucleotide. A bulge may comprise at least 3 purine nucleotides. A bulge sequence may comprise at least 5 purine nucleotides. A bulge sequence may comprise at least one guanine nucleotide. In some examples, a bulge sequence may comprise at least one guanine nucleotide. Petition 870200048765, dated 17 / 04 / 2020, page 86 / 216 82 / 197 adenine iodide. Staples
[00302] In several examples, one or more hairpins may be located 3' from the minimal tracrRNA in the tracrRNA 3' sequence.
[00303] The hairpin can start at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 or more nucleotides 3' from the last paired nucleotide in the minimal CRISPR repeat and the duplex minimal tracrRNA sequence. The hairpin can start at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides 3' from the last paired nucleotide in the minimal CRISPR repeat and the duplex minimal tracrRNA sequence.
[00304] The hook may comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20 or more consecutive nucleotides. The hook may comprise at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or more consecutive nucleotides.
[00305] The hook may comprise a CC dinucleotide (i.e., two consecutive cytosine nucleotides).
[00306] The hairpin may comprise duplexed nucleotides (i.e., nucleotides in a hairpin, hybridized together). For example, a hairpin may comprise a CC dinucleotide that is hybridized with a GG dinucleotide in a hairpin duplex of the 3' tracrRNA sequence.
[00307] One or more of the hairpins may interact with regions that interact with the guide RNA of a site-targeted polypeptide.
[00308] In some examples, there are two or more hooks, and in other examples, there are three or more hooks. tracRNA 3' sequence
[00309] A 3' tracrRNA sequence may comprise a sequence with at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about Petition 870200048765, dated 04 / 17 / 2020, p. 87 / 216 83 / 197 80%, approximately 85%, approximately 90%, approximately 95%, or 100% sequence identity with a reference tracrRNA sequence (e.g., tracrRNA from S. pyogenes).
[00310] The 3' tracrRNA sequence can have a length of about 6 nucleotides to about 100 nucleotides. For example, the 3' tracrRNA sequence may have a length of about 6 nucleotides (nt) to about 50 nt, from about 6 nt to about 40 nt, from about 6 nt to about 30 nt, from about 6 nt to about 25 nt, from about 6 nt to about 20 nt, from about 6 nt to about 15 nt. nt from about 8 nt to about 40 nt, from about 8 nt to about 30 nt, from about 8 nt to about 25 nt, from about 8 nt to about 20 nt, from about 8 nt to about 15 nt, from about 15 to about 100 nt, from about 15 nt to about 80 nt, from about 15 nt to about 50 nt, from about 15 nt to about 40 nt, from about 15 nt to about 30 nt, or from about 15 nt to about 25 nt. The tracrRNA 3' sequence can be approximately 14 nucleotides long.
[00311] The 3' tracrRNA sequence may be at least about 60% identical to a reference 3' tracrRNA sequence (e.g., wild-type 3' tracrRNA sequence of S. pyogenes) over a stretch of at least 6, 7, or 8 contiguous nucleotides. For example, the 3' tracrRNA sequence may be at least about 60% identical, about 65% identical, about 70% identical, about 75% identical, about 80% identical, about 85% identical, about 90% identical, about 95% identical, about 98% identical, about 99% identical, or 100% identical to a reference 3' tracrRNA sequence (e.g., wild-type 3' tracrRNA sequence of S. pyogenes) over a stretch of at least 6, 7, or 8 contiguous nucleotides.
[00312] The 3' tracrRNA sequence may comprise more than one duplexed region (e.g., hairpin, hybridized region). A Petition 870200048765, dated 04 / 17 / 2020, pp. 88 / 216 The 84 / 197 tracrRNA 3' sequence may comprise two duplexed regions.
[00313] The 3' tracRRNA sequence may comprise a stem-loop structure. The stem-loop structure in the 3' tracRRNA may comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 or more nucleotides. The stem-loop structure in the 3' tracRRNA may comprise at most 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides. The stem-loop structure may comprise a functional portion. For example, the stem-loop structure may comprise an aptamer, a ribozyme, a protein-interacting hook, a CRISPR array, an intron, or an exon. The stem-loop structure may comprise at least about 1, 2, 3, 4, or 5 or more functional portions. The rod-handle structure may comprise a maximum of approximately 1, 2, 3, 4, or 5 or more functional units.
[00314] The hairpin in the tracRRNA 3' sequence may comprise a P-domain. In some instances, the P-domain may comprise a double-stranded region in the hairpin. tracrRNA Extension Sequence
[00315] A tracrRNA extension sequence may be provided if the tracrRNA is in the context of single-molecule or double-molecule guides. The tracrRNA extension sequence may have a length of about 1 nucleotide to about 400 nucleotides. The tracrRNA extension sequence may have a length greater than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, or 400 or more nucleotides. The tracrRNA extension sequence can be about 20 to about 5,000 or more nucleotides long. The tracrRNA extension sequence can be more than 1,000 nucleotides long. The tracrRNA extension sequence can be shorter than 1, 5, 10, 15, 20, 25, 30, Petition 870200048765, dated 04 / 17 / 2020, pp. 89 / 216 85 / 197 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400 or more nucleotides. The tracrRNA extension sequence may be less than 1000 nucleotides long. The tracrRNA extension sequence may comprise less than 10 nucleotides in length. The tracrRNA extension sequence may be 10-30 nucleotides long. The tracrRNA extension sequence may be 30-70 nucleotides long.
[00316] The tracrRNA extension sequence may comprise a functional portion (e.g., a stability control sequence, ribozyme, endoribonuclease binding sequence). The functional portion may be a transcriptional terminator segment (i.e., a transcriptional termination sequence). The functional portion may have a total length of about 10 nucleotides (nt) to about 100 nucleotides, from about 10 nt to about 20 nt, from about 20 nt to about 30 nt, from about 30 nt to about 40 nt, from about 40 to about 50 nt, from about 50 nt to about 60 nt, from about 60 nt to about 70 nt, from about 70 nt to about 80 nt, from about 80 nt to about 90 nt, or from about 90 nt to about 100 nt, from about 15 nt to about 80 nt, from about 15 nt to about 50 nt, from about 15 nt to about 40 nt, from about 15 nt to about 30 nt, or from about 15 nt to about 25 nt. The functional portion can function in a eukaryotic cell.The functional portion can function in a prokaryotic cell. The functional portion can function in both eukaryotic and prokaryotic cells.
[00317] Non-limiting examples of suitable functional extension portions of tracrRNA include a 3' polyadenylated tail, a riboswitch sequence (e.g., to allow regulated stability and / or regulated accessibility by protein and protein complexes), a sequence that forms a duplex dsRNA (i.e., a gram). Petition 870200048765, dated 04 / 17 / 2020, pp. 90-216 86 / 197 po), a sequence that directs RNA to a subcellular location (e.g., nucleus, mitochondria, chloroplasts, and the like), a modification or sequence that provides tracking (e.g., direct conjugation to a fluorescent molecule, conjugation with a moiety that facilitates fluorescent detection, a sequence that allows fluorescence detection, etc.), and / or a modification or sequence that provides a binding site for proteins (e.g., proteins that act on DNA, including transcriptional activators, transcriptional controls, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, and the like). The tracRNA extension sequence may comprise a primer binding site or a molecular index (e.g., barcode sequence). The tracRNA extension sequence may comprise one or more affinity tags. Single Molecule Guide Ligand Sequence
[00318] The ligand sequence of a single-molecule guide nucleic acid can have a length of about 3 nucleotides to about 100 nucleotides. In Jinek et al., Supra, for example, a simple 4-nucleotide tetraloop (-GAAA-) was used, Science, 337 (6096):816-821 (2012). An illustrative linker has a length of about 3 nucleotides (nt) to about 90 nt, about 3 nt to about 80 nt, about 3 nt to about 70 nt, about 3 nt to about 60 nt, about 3 to about 50 nt, about 3 nt to about 40 nt, about 3 nt to about 30 nt, about 3 nt to about 20 nt, about 3 nt to about 10 nt.For example, the binder may have a length of about 3 nt to about 5 nt, from about 5 nt to about 10 nt, from about 10 nt to about 15 nt, from about 15 nt to about 20 nt, from about 20 to about 25 nt, from about 25 nt to about 30 nt, from about 30 nt to about 35 nt, from about 35 nt to about 40 nt, from about 40 nt to about 50 nt, from about 50 nt to. Petition 870200048765, dated 04 / 17 / 2020, pp. 91 / 216 87 / 197 approximately 60 nt, approximately 60 nt to approximately 70 nt, approximately 70 nt to approximately 80 nt, approximately 80 nt to approximately 90 nt, or approximately 90 nt to approximately 100 nt. The linker of a single-molecule guide nucleic acid may have between 4 and 40 nucleotides. The linker may be at least approximately 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, or 7000 or more nucleotides. The linker can be, at most, about 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500 or 7000 or more nucleotides.
[00319] The ligands can comprise any of a variety of sequences, although in some examples the ligand does not comprise sequences that have extensive regions of homology with other portions of the guide RNA, which could cause intramolecular binding that could interfere with other functional regions of the guide. In Jinek et al., supra, a sequence of 4 single nucleotides was used - GAAA, Science, 337 (6096): 816-821 (2012), but numerous other sequences, including longer sequences, can also be used.
[00320] The linker sequence may comprise a functional portion. For example, the linker sequence may include one or more features, including an aptamer, a ribozyme, a protein-interacting hook, a protein-binding site, a CRISPR array, an intron, or an exon. The linker sequence may comprise at least about 1, 2, 3, 4, or 5 or more functional portions. In some examples, the linker sequence may comprise at most about 1, 2, 3, 4, or 5 or more functional portions.
[00321] One step of the ex vivo methods of the present invention may comprise editing patient-specific iPSC cells using genome engineering. Alternatively, one step of the ex vivo methods of the present invention may comprise editing Petition 870200048765, dated 04 / 17 / 2020, pp. 92 / 216 88 / 197 mesenchymal stem cells or hematopoietic progenitor cells. Similarly, a step in the in vivo methods of the present invention may comprise editing cells in a patient with hemoglobinopathy using genomic engineering. Likewise, a step in the cellular methods of the present invention may comprise editing within or near a BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene in a human cell by genetic engineering.
[00322] Different patients with hemoglobinopathy generally require different elimination, modulation, or inactivation strategies. Any CRISPR endonuclease can be used in the methods of the present invention, each CRISPR endonuclease having its own associated PAM, which may or may not be disease-specific. For example, gRNA spacer sequences for targeting within or near a BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene with a CRISPR / Cas9 endonuclease from S. pyogenes have been identified in SEQ ID NOs: 1-29,482 of the Sequence Listing. gRNA spacer sequences for targeting within or near a BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene with an S. aureus CRISPR / Cas9 endonuclease were identified in SEQ ID NOs: 29,483-32,387 from the Sequence Listing.gRNA spacer sequences for targeting within or near a BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene with a CRISPR / Cas9 endonuclease from S. thermophilus were identified in SEQ ID Nos. 32,388-33,420 of the Sequence Listing. gRNA spacer sequences for targeting within or near a BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene with a CRISPR / Cas9 endonuclease from S. thermophilus. Petition 870200048765, dated 04 / 17 / 2020, pp. 93 / 216 89 / 197 T. denticola were identified in SEQ ID Nos. 33,421-33,851 of the Sequence Listing. gRNA spacer sequences for targeting within or near a BCL11A gene or other DNA sequence encoding a BCL11A gene regulatory element with a CRISPR / Cas9 endonuclease from N. meningitides were identified in SEQ ID Nos. 33,852-36,731. gRNA spacer sequences for targeting within or near a BCL11A gene or other DNA sequence encoding a BCL11A gene regulatory element with a CRISPR / Cpf1 endonuclease from Acidominococcus, Lachnospiraceae, and Franciscella Novicida were identified in SEQ ID Nos. 36,732-71,947.
[00323] For example, the transcriptional control sequence of the BCL11A gene can be modulated or inactivated by deletions that arise due to the NHEJ pathway. NHEJ can be used to delete segments of the BCL11A gene's transcriptional control sequence, either directly or by altering donor or splice receptor sites through cleavage by a multi-site targeting gRNA, or multiple gRNAs.
[00324] The transcriptional control sequence of the BCL11A gene can also be modulated or inactivated by inserting a wild-type BCL11A gene or cDNA comprising a modified transcriptional control sequence. For example, the donor for HDR modulation or inactivation contains the modified transcriptional control sequence of the BCL11A gene with large or small flanking homology arms to allow annealing. HDR is essentially an error-free mechanism that uses a homologous DNA sequence provided as a template during DSB repair. The rate of homology-directed repair (HDR) is a function of the distance between the transcriptional control sequence and the cleavage site, so the choice of overlapping or closer sites is important. Templates may include extra sequences flanked by the re Petition 870200048765, dated 04 / 17 / 2020, pp. 94 / 216 90 / 197 homologous regions may contain a sequence that differs from the genomic sequence, thus allowing sequence editing.
[00325] In addition to modulating or inactivating the transcriptional control sequence of the BCL11A gene by NHEJ or HDR, a variety of other options are possible. If there are small or large deletions, a cDNA can undergo knock-in where it contains a modified transcriptional control sequence. A full-length cDNA can be placed in any safe port, but must use a provided promoter or other. If this construct undergoes knock-in at the correct location, it will have physiological control, similar to the normal gene. Nuclease pairs can be used to delete gene regions, although a donor would normally have to be provided to modulate or inactivate function. In this case, two gRNAs would be provided and a donor sequence.
[00326] Some genomic engineering strategies involve modulating or inactivating a transcriptional control sequence of the BCL11A gene, deleting at least part of the BCL11A gene's transcriptional control sequence, and / or applying knock-in to a wild-type BCL11A gene or cDNA comprising a modified transcriptional control sequence at the corresponding gene locus or safe harbor locus by homology-directed repair (HDR), which is also known as homologous recombination (HR). This strategy can modulate or inactivate the BCL11A gene's transcriptional control sequence and reverse, treat, and / or mitigate the disease state. Donor nucleotides for modulation / inactivation of transcriptional control sequences are often small (<300 bp). This is advantageous since HDR efficiencies can be inversely related to the size of the donor molecule.Furthermore, it is expected that donor models will be able to adapt to adeno-associated virus (AAV) molecules. Petition 870200048765, dated 04 / 17 / 2020, pp. 95 / 216 91 / 197 limited size, which proved to be an effective means of supplying donor models.
[00327] Direct homology repair is a cellular mechanism for repairing double-strand breaks (DSBs). The most common form is homologous recombination. There are additional pathways to HDR, including single-strand annealing and alternative HDR. Genomic engineering tools allow researchers to manipulate cellular pathways of homologous recombination to create site-specific modifications in the genome. Cells have been found to repair a double-strand break using a synthetic donor molecule provided trans. Therefore, by introducing a double-strand break near a specific mutation and providing a suitable donor, targeted changes can be made to the genome. Specific cleavage increases the HDR rate more than 1,000 times above the rate of 1 in 106 that receive only a homologous donor.The rate of homology-directed repair (HDR) at a given nucleotide is a function of the distance to the cleavage site; therefore, choosing overlapping or closer target sites is important. Gene editing offers an advantage over gene addition, as in situ correction leaves the rest of the genome undisturbed.
[00328] The donors provided for HDR editing vary widely, but may contain the intended sequence with small or large flanking homology arms to allow annealing with genomic DNA. The homology regions flanking the introduced genetic alterations may be 30 bp or smaller, or as large as a multi-kilobase cassette that may contain promoters, cDNAs, etc. Both single-stranded and double-stranded oligonucleotide donors were used. These oligonucleotides range in size from less than 100 nt to more than kb, although longer ssDNA can also be generated and used. Petition 870200048765, dated 04 / 17 / 2020, pp. 96 / 216 92 / 197 Double-stranded donors can be used, including PCR amplicons, plasmids, and minicircles. In general, an AAV vector has been found to be a very effective means of delivering a donor model, although packaging limits for individual donors are <5kb. Active transcription of the donor increased HDR threefold, indicating that promoter inclusion may increase conversion. Conversely, donor CpG methylation decreased gene expression and HDR.
[00329] In addition to wild-type endonucleases, such as Cas9, there are nickase variants that have one or more inactivated nuclease domains resulting in the cleavage of only one strand of DNA. HDR can be targeted from individual Cas nickases or using pairs of nickases flanking the target area. Donors can be single-stranded, cleavage, or dsDNA.
[00330] Donor DNA can be supplied with the nuclease or independently by a variety of different methods, for example, by transfection, nanoparticle, microinjection, or viral transduction. A variety of binding options have been proposed to increase the availability of donors for HDR. Examples include binding the donor to the nuclease, binding to nearby DNA-binding proteins, or binding to proteins involved in final DNA ligation or repair.
[00331] The choice of repair pathway can be guided by a number of culture conditions, such as those that influence the cell cycle, or by targeting DNA repair and associated proteins. For example, to increase HDR, key NHEJ molecules can be suppressed, such as KU70, KU80, or DNA ligase IV.
[00332] Without a donor present, the ends of a DNA break or ends of different breaks can be joined using the various non-homologous repair pathways in which the ends of Petition 870200048765, dated 04 / 17 / 2020, pp. 97 / 216 93 / 197 DNA is joined with little or no base pairing at the junction. In addition to canonical NHEJ, similar repair mechanisms exist, such as alt-NHEJ. If there are two breaks, the intervening segment can be deleted or reversed. NHEJ repair pathways can lead to insertions, deletions, or mutations at the joints.
[00333] NHEJ was used to insert a 15 kb inducible gene expression cassette into a defined locus in human cell lines after nuclease cleavage. Maresca, M., Lin, VG, Guo, N. & Yang, Y., Genome Res 23, 539-546 (2013).
[00334] In addition to genome editing by NHEJ or HDR, site-specific genetic insertions have been performed using both the NHEJ and HR pathways. A combination approach may be applicable in certain settings, possibly including intron / exon borders. NHEJ may prove effective for ligation at the intron, while error-free HDR may be more suitable in the coding region.
[00335] As a further alternative, the wild-type BCL11A gene or cDNA comprising a modified transcriptional control sequence may undergo knock-in at the corresponding gene locus or at a safe harbor site, such as AAVS1. In some instances, the methods may provide a gRNA or a pair of gRNAs that can be used to facilitate the incorporation of a new sequence from a polynucleotide donor template to knock out part or all of the wild-type BCL11A gene or cDNA comprising a modified transcriptional control sequence.
[00336] The methods can provide gRNA pairs that perform a deletion by cutting the gene twice, one gRNA cutting at the 5' end of one or more mutations and the other gRNA cutting at the 3' end of one or more mutations that facilitate the insertion of a new sequence from a polynucleotide donor template to Petition 870200048765, dated 04 / 17 / 2020, pp. 98 / 216 94 / 197 replaces the transcriptional control sequence of the BCL11A gene. The cut can be made by a pair of DNA endonucleases, each producing a DSB in the genome, or by multiple nickases that together form a DSB in the genome.
[00337] Alternatively, methods can provide a gRNA to make a double-strand cut around a transcriptional control sequence of the BCL11A gene that facilitates the insertion of a new sequence from a polynucleotide donor template to replace the BCL11A gene transcriptional control sequence with a wild-type BCL11A gene or cDNA comprising a modified transcriptional control sequence. The double-strand cut can be made by a single DNA endonuclease or multiple nickases that together form a DSB in the genome.
[00338] Illustrative modifications within or near the BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene include substitutions within or near (proximal) the transcriptional control sequence of the BCL11A gene referred to above, such as in the region less than 3 kb, less than 2 kb, less than 1 kb, less than 0.5 kb upstream or downstream of the transcriptional control sequence.
[00339] Such variants may include larger substitutions in the 5' and / or 3' direction than the specific substitution in question, or smaller in either direction. Therefore, by near or proximal to specific substitutions, it is intended that the SSB or DSB locus associated with a desired substitution boundary (also referred to here as an endpoint) may be within a region that is less than about 3 kb from the annotated reference locus. The SSB or DSB locus may be more proximal and within 2 kb, within 1 kb, within 0.5 kb, or within 0.1 kb. In the case of a small substitution, the desired endpoint may be either adjacent to the reference locus, Petition 870200048765, dated 04 / 17 / 2020, pp. 99 / 216 95 / 197 whereby it is desired that the endpoint be within 100 sc, within 50 sc, within 25 sc, or less than 10 sc to 5 sc from the reference locus.
[00340] It can be expected that examples comprising major or minor substitutions will provide the same benefit, provided that transcriptional control activity is modulated or inactivated. It is thus expected that many variations of the substitutions described and illustrated here may be effective in improving hemoglobinopathies.
[00341] Another genomic engineering strategy involves exon or intron deletion. Targeted deletion of specific exons or introns can be an attractive strategy for treating a large subset of patients with a single therapeutic cocktail. Deletions can be single exon or intron deletions or multiple exon or intron deletions. While multiple exon deletions can reach a larger number of patients, for larger deletions, the efficiency of the deletion decreases considerably with increasing size. Therefore, deletion ranges can be from 40 to 10,000 base pairs (bp) in size. For example, deletions can range from 40 to 100; 100-300; 300-500; 500-1,000; 1,000-2,000; 2,000-3,000; 3,000-5,000; or 5,000-10,000 pairs of base sizes.It may be desirable to exclude an intron if the intron contains a regulatory element, such as a transcriptional control element (for example, a transcription factor binding site).
[00342] In order to ensure that the pre-mRNA is processed correctly after suppression, surrounding splicing signals can be suppressed. The splicing donor and acceptors are usually within 100 base pairs of the neighboring intron. Therefore, in some examples, the methods can provide all gRNAs Petition 870200048765, dated 04 / 17 / 2020, pages 100 / 216 96 / 197 that cut approximately + / - 100-3100 bp relative to each exon / intron junction of interest.
[00343] For any of the genome editing strategies, gene editing can be confirmed by sequencing or PCR analysis. Target Sequence Selection
[00344] Changes in the location of the 5' and / or 3' boundary relative to the particular reference loci can be used to facilitate or enhance particular gene editing applications, which depend in part on the endonuclease system selected for editing, as described and illustrated herein.
[00345] In a first, non-limiting example of this selection of target sequences, many endonuclease systems have rules or criteria that can guide the initial selection of potential target sites for cleavage, such as the requirement of a PAM sequence motif in a particular position adjacent to the DNA cleavage sites in the case of Type II or Type V CRISPR endonucleases.
[00346] In another non-limiting example of target sequence selection or optimization, the frequency of off-target activity for a particular combination of target sequence and gene-editing endonuclease (i.e., the frequency of DSBs occurring at sites other than the selected target sequence) can be evaluated relative to the frequency of on-target activity. In some cases, cells that have been correctly edited at the desired locus may have a selective advantage over other cells. Illustrative, but not limiting, examples of a selective advantage include the acquisition of attributes such as increased replication rates, persistence, resistance to certain conditions, increased rates of successful grafting or in vivo persistence after introduction into a patient, and other attributes associated with maintaining or increasing cell number or viability. Petition 870200048765, dated 04 / 17 / 2020, pp. 101 / 216 97 / 197 of such cells. In other cases, cells that have been correctly edited at the desired locus can be positively selected by one or more screening methods used to identify, classify, or select the correctly edited cells. Both selective advantage and targeted selection methods can take advantage of the phenotype associated with the correction. In some cases, cells can be edited two or more times to create a second modification that creates a new phenotype that is used to select or purify the desired cell population. Such a second modification could be created by adding a second gRNA for a selectable or traceable marker. In some cases, cells can be correctly edited at the desired locus using a DNA fragment that contains both the cDNA and a selectable marker.
[00347] If any selective advantage is applicable or any targeted selection must be applied in a particular case, the selection of the target sequence may also be guided by consideration of off-target frequencies in order to increase the effectiveness of the application and / or reduce the potential for undesirable changes at sites other than the desired target. As further described and illustrated herein and in the art, the occurrence of off-target activity may be influenced by several factors including similarities and differences between the target site and various off-target sites, as well as the specific endonuclease used.Bioinformatics tools are available that assist in predicting off-target activity, and often such tools can also be used to identify the most likely sites of off-target activity, which can then be evaluated in experimental settings to assess relative frequencies of off-target to on-target activity, thus allowing the selection of sequences that have higher relative on-target activity. Illustrative examples of such techniques are provided here, and others are known in the art. Petition 870200048765, dated 04 / 17 / 2020, pp. 102 / 216 98 / 197
[00348] Another aspect of target sequence selection relates to homologous recombination events. Sequences that share regions of homology can serve as focal points for homologous recombination events that result in the elimination of intervening sequences. Such recombination events occur during the normal course of chromosome replication and other DNA sequences, and also at other times when DNA sequences are being synthesized, as in the case of double-strand break repairs (DSBs), which occur regularly during the normal cell replication cycle, but can also be increased by the occurrence of various events (such as UV light and other DNA break inducers) or the presence of certain agents (such as various chemical inducers). Many of these inducers cause DSBs to occur indiscriminately in the genome, and DSBs can be regularly induced and repaired in normal cells.During repair, the original sequence can be reconstructed with complete fidelity; however, in some cases, small insertions or deletions (called indels) are introduced into the DSB site.
[00349] DSBs can also be specifically induced at particular locations, as in the case of the endonuclease systems described herein, which can be used to trigger targeted or preferential gene modification events at selected chromosomal locations. The tendency of homologous sequences to undergo recombination in the context of DNA repair (as well as replication) can be exploited in various circumstances, and is the basis for an application of gene editing systems, such as CRISPR, in which homology-directed repair is used to insert a sequence of interest, provided through the use of a donor polynucleotide, at a desired chromosomal location.
[00350] The regions of homology between particular sequences, which Petition 870200048765, dated 04 / 17 / 2020, pp. 103 / 216 99 / 197 can be small regions of micro-homology that may comprise only ten base pairs or less, and can also be used to elicit desired deletions. For example, a single DSB can be introduced into a site that exhibits micro-homology with a nearby sequence. During the normal course of repair of such a DSB, a result that occurs with high frequency is the deletion of the intervening sequence as a result of recombination being facilitated by the DSB and the concomitant cellular repair process.
[00351] In some circumstances, however, the selection of target sequences within regions of homology can also lead to much larger deletions, including genetic fusions (when the deletions are in coding regions), which may or may not be desirable given the particular circumstances.
[00352] The examples provided here best illustrate the selection of multiple target regions for the creation of DSBs designed to induce substitutions that result in the modulation or inactivation of transcriptional control protein activity, as well as the selection of specific target sequences within such regions that are designed to minimize off-target events relative to on-target events.
[00353] Nucleic Acid Modifications
[00354] In some cases, the polynucleotides introduced into the cells may comprise one or more modifications that can be used individually or in combination, for example, to increase activity, stability or specificity, alter distribution, reduce innate immune responses in host cells or other enhancements, as further described and known in the art.
[00355] In certain examples, modified polynucleotides can be used in the CRISPR / Cas9 / Cpf1 system, in which case guide RNAs (single-molecule guides or double-molecule guides) and / or Petition 870200048765, dated 04 / 17 / 2020, pp. 104 / 216 100 / 197 A DNA or RNA that encodes a Cas or Cpf1 endonuclease introduced into a cell can be modified, as described and illustrated below. Such modified polynucleotides can be used in the CRISPR / Cas9 / Cpf1 system to edit any one or more genomic loci.
[00356] Using the CRISPR / Cas9 / Cpf1 system for illustrative purposes only, but not limiting, of such uses, guide RNA modifications can be used to improve the formation or stability of the CRISPR / Cas9 / Cpf1 genome editing complex comprising guide RNAs, which can be single-molecule or double-molecule guide RNAs, and a Cas or Cpf1 endonuclease. Guide RNA modifications can also, or alternatively, be used to improve the initiation, stability, or kinetics of interactions between the genome editing complex and the target sequence in the genome, which can be used, for example, to improve activity at the target. Guide RNA modifications can also, or alternatively, be used to increase specificity, for example, the relative rates of genome editing at the target site compared to effects at other (off-target) sites.
[00357] Modifications can also or alternatively be used to increase the stability of a guide RNA, for example, by increasing its resistance to degradation by ribonucleases (RNases) present in a cell, thus increasing its half-life in the cell. The half-life of modified guide RNA can be particularly useful in aspects where a Cas or Cpf1 endonuclease is introduced into the cell to be edited via an RNA that needs to be translated to generate the endonuclease, as it increases the half-life of introduced guide RNAs while the RNA encoding the endonuclease can be used to increase the time that the guide RNAs and the Cas or Cpf1-encoded endonuclease coexist. Petition 870200048765, dated 17 / 04 / 2020, p. 105 / 216 101 / 197 is in the cell.
[00358] Modifications can also, or alternatively, be used to decrease the likelihood or degree to which RNAs introduced into cells elicit innate immune responses. Such responses, which have been well characterized in the context of RNA interference (RNAi), including small interfering RNAs (siRNAs), as described below and in the technique, tend to be associated with reduced RNA half-life and / or the elicitation of cytokines or other factors associated with immune responses.
[00359] One or more types of modifications may also be made to RNAs encoding an endonuclease that are introduced into a cell, including, without limitation, modifications that increase the stability of the RNA (such as increasing its degradation by RNAs present in the cell), modifications that increase the translation of the resulting product (i.e., the endonuclease), and / or modifications that decrease the likelihood or degree to which the RNAs introduced into cells elicit innate immune responses.
[00360] Combinations of modifications, such as the previous ones and others, can also be used. In the case of CRISPR / Cas9 / Cpf1, for example, one or more types of modifications can be made to guide RNAs (including those exemplified above), and / or one or more types of modifications can be made for RNAs encoding Cas endonuclease (including those exemplified above).
[00361] By way of illustration, the guide RNAs used in the CRISPR / Cas9 / Cpf1 system, or other smaller RNAs, can be readily synthesized by chemical means, allowing various modifications to be readily incorporated, as illustrated below and described in the technique. While chemical synthesis procedures are continuously expanding, purifications of such RNAs by procedures such as high-performance liquid chromatography are also being developed. Petition 870200048765, dated 04 / 17 / 2020, pp. 106 / 216 102 / 197 (HPLC, which avoids the use of gels like PAGE) tend to become more challenging as polynucleotide lengths increase significantly beyond one hundred nucleotides. One approach that can be used to generate longer chemically modified RNAs is to produce two or more molecules that are linked together. Much longer RNAs, such as those encoding a Cas9 endonuclease, are more easily generated enzymatically. While few types of modifications are available for use in enzymatically produced RNAs, there are still modifications that can be used to, for example, increase stability, reduce the likelihood or degree of the innate immune response, and / or enhance other attributes, as described further below and in the technique; and new types of modifications are regularly being developed.
[00362] By illustrating various types of modifications, especially those frequently used with chemically synthesized smaller RNAs, modifications may comprise one or more nucleotides modified at the 2' position of the sugar, in some respects, a nucleotide modified with 2'-O-alkyl, 2'-O-alkyl-O-alkyl or 2'-fluoro. In some examples, RNA modifications may comprise 2'-fluoro, 2'-amino or 2'-O-methyl modifications in the ribose of pyrimidines, abasic residues, or an inverted base at the 3' end of the RNA. Such modifications may be routinely incorporated into oligonucleotides and these oligonucleotides have been shown to have a higher Tm (i.e., higher binding affinity to the target) than 2'-deoxy-oligonucleotides against a given target.
[00363] It has been shown that a number of nucleotide and nucleoside modifications cause the oligonucleotide into which they are incorporated to be more resistant to digestion with nuclease than the native oligonucleotide; these modified oligos survive intact for longer than unmodified oligonucleotides. Examples Petition 870200048765, dated 17 / 04 / 2020, page 107 / 216 103 / 197 Modified oligonucleotide structures include those comprising modified backbones, for example, phosphorothioates, phosphotriesters, methylphosphonates, short-chain alkyl or cycloalkyl sugar linkages, or short-chain heteroatomic or heterocyclic sugar linkages. Some oligonucleotides are phosphorothioate backbone oligonucleotides and those with heteroatom backbones, particularly CH2-NH-O-CH2, CH,~N(CH3)~O~CH2 (known as a methylene (methylimino) backbone or MMI), CH2--O--N(CH3)-CH2 backbones, CH2-N(CH3)-N(CH3)-CH2 and ON(CH3)-CH2-CH2 backbones, wherein the native phosphodiester backbone is represented as OP--O-CH,); Main structures of amide [see De Mesmaeker et al., Ace. Chem. Res. 28:366-374 (1995)]; main structure of morpholino (see Summerton and Weller, US Patent 5,034).506); the peptide nucleic acid (PNA) backbone (in which the oligonucleotide phosphodiester backbone is replaced by a polyamide backbone, with nucleotides linked directly or indirectly to the aza nitrogen atoms of the polyamide backbone, see Nielsen et al., Science 1991, 254, 1497).Phosphorus-containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3'-aminophosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranephosphates having normal 3'-5' linkages, 2'-5'-linked analogs thereof, and those having inverted polarity in which adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'; see U.S. Patent 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; Petition 870200048765, dated 04 / 17 / 2020, pp. 108 / 216 104 / 197 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050.
[00364] Oligomeric compounds based on morpholino are described in Braasch and David Corey, Biochemistry, 41 (14):4503-4510 (2002); Genesis, Volume 30, Issue 3, (2001); Heasman, Dev. Biol., 243: 209-214 (2002); Nasevicius et al., Nat. Genet., 26:216-220 (2000); Lacerra et al., Proc. Natl. Acad. Sci., 97: 9591-9596 (2000); and US Patent 5,034,506, issued July 23, 1991.
[00365] Cyclohexenyl nucleic acid oligonucleotide mimetics are described in Wang et al., J. Am. Chem. Soc., 122: 8595-8602 (2000).
[00366] Modified oligonucleotide backbones that do not include a phosphorus atom have backbones that are formed by short-chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short-chain heteroatomic or heterocyclic internucleoside linkages. These comprise those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide, and sulfone backbones; formacetyl and thioformacetyl backbones; methyleneformoacetyl and thioformacetyl backbones; alkene-containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed component parts of N, O, S, and CH2; See US Patent 5.034.506; 5.166.315; 5.185.444; 5.214.134; 5.216.141; 5.235.033; 5.264.562; 5.264.564; 5.405.938; 5.434.257;. 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439. Petition 870200048765, dated 04 / 17 / 2020, pp. 109 / 216 105 / 197
[00367] One or more substituted sugar moieties may also be included, for example, one of the following in the 2' position: OH, SH, SCH3, F, OCN, OCH3, OCH3, OCH3, O(CH2)n CH3, O(CH2)n NH2, or O(CH2)n CH3, where n is from 1 to about 10; C1 to C10 lower alkyl, alkoxyalkoxyl, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF3; OCF3; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; SOCH3; SO2 CH3; ONO2; NO2; N3; NH2; heterocycloalkyl; heterocycloalkyl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleavage group; a reporter group; an intercalator; a group to improve the pharmacokinetic properties of an oligonucleotide; or a group to improve the pharmacodynamic properties of an oligonucleotide and other substituents with similar properties. In some respects, a modification includes 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl)) (Martin et al, HeIv. Chim. Acta, 1995, 78, 486).Other modifications include 2'-methoxy (2'-OCH3), 2'-propoxy (2'-OCH2 CH2CH3), and 2'-fluoro (2'-F). Similar modifications can also be made at other positions in the oligonucleotide, particularly the 3' position of the sugar in the 3'-terminal nucleotide and the 5' position of the 5'-terminal nucleotide. Oligonucleotides may also have sugar mimetics, such as cyclobutyls, in place of the pentofuranosyl group.
[00368] In some examples, both a sugar and an internucleosidic linkage, that is, the backbone, of the nucleotide units can be replaced by new groups. The base units can be retained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, a mimetic oligonucleotide that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an oligonucleotide can be replaced by an amide-containing backbone, Petition 870200048765, dated 04 / 17 / 2020, pages 110 / 216 106 / 197, for example, is a major aminoethylglycine structure. Nucleobases can be retained and linked directly or indirectly to aza nitrogen atoms of the amide portion of the major structure. Representative U.S. patents teaching the preparation of PNA compounds comprise, but are not limited to, U.S. Patents 5,539,082; 5,714,331; and 5,719,262. Further teachings of PNA compounds can be found in Nielsen et al., Science, 254: 1497-1500 (1991).
[00369] Guide RNAs may also include, additionally or alternatively, modifications or substitutions of nucleobases (often referred to in the technique simply as base). As used herein, unmodified or natural nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C), and uracil (U).Modified nucleobases include nucleobases found only infrequently or transiently in natural nucleic acids, for example, hypoxanthine, 6-methyladenine, 5-Me pyrimidines, particularly 5-methylcytosine (also referred to as 5-methyl-2'-deoxycytosine and frequently referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic nucleobases, for example, 2-aminoadenine, 2-(methylamino)adenine, 2-(imidazolylalkyl)adenine, 2-(aminoalkylamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-desazaguanine, N6 (6-aminohexyl)adenine and 2, 6-diaminopurine. Kornberg, A., DNA Replication, WH Freeman & Co., San Francisco, pp75-77 (1980); Gebeyehu et al., Nucl. Acids Res. 15:4513 (1997). A universal base known in the art, for example, inosine, may also be included.5-Me-C substitutions have been shown to increase nucleic acid duplex stability at 0.6-1.2°C. (Sanghvi, YS, in Crooke, ST and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Juniors, Petition 870200048765, 04 / 17 / 2020, p. 111 / 216. 107 / 197 ton, 1993, pp. 276-278) and are aspects of basic substitutions.
[00370] Modified nucleobases may comprise other synthetic and natural nucleobases, such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudo-uracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other substituted 8 adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-uracis and substituted cytosines, 7-methylquanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-desazaguanine and 7-deazaadenine, and 3-desazaguanine and 3-deazaadenine.
[00371] In addition, the nucleobases may comprise those described in U.S. Patent 3,687,808, those disclosed in 'The Concise Encyclopedia of Polymer Science and Engineering', pages 858-859, Kroschwitz, JI, ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., 'Angewandle Chemie, International Edition', 1991, 30, page 613, and those disclosed by Sanghvi, YS, Chapter 15, 'Antisense Research and Applications', pages 289-302, Crooke, ST and Lebleu, B. et al., CRC Press, 1993. Some of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, comprising 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-Methylcytosine substitutions have been shown to increase nucleic acid duplex stability at 0.6–1.2°C (Sanghvi, YS, Crooke, ST, and Lebleu, B.)., eds, 'Antisense Research and Applications', CRC Press, Boca Raton, 1993, pp 276-278) and are aspects of base substitutions, even more so when combined. Petition 870200048765, dated 04 / 17 / 2020, pp. 112 / 216 108 / 197 with 2'-O-methoxyethyl sugar modifications. The modified nucleobases are described in US Patent 3,687,808, as well as 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,596,091; 5,614,617; 5,681,941; 5,750,692; 5,763,588; 5,830,653; 6,005,096; and Publication of US Patent Application 2003 / 0158403.
[00372] Thus, the term modified refers to an unnatural sugar, phosphate, or base that is incorporated into a guide RNA, an endonuclease, or a transcriptional control sequence of BCL11A or a guide RNA and an endonuclease. It is not necessary that all positions in a given oligonucleotide be uniformly modified, and in fact, more than one of the aforementioned modifications may be incorporated into a single oligonucleotide, or even into a single nucleoside within an oligonucleotide.
[00373] Guide RNAs and / or mRNAs (or DNA) encoding an endonuclease may be chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Such moieties include, but are not limited to, lipid moieties, such as a cholesterol moiety [Letsinger et al., Proc. Natl. Acad. Sci. USA, 86:6553-6556 (1989)]; cholic acid [Manoharan et al., Bioorg. Med. Chem. Let., 4: 1053-1060 (1994)]; a thioether, e.g., hexyl-S-tritylthiol [Manoharan et al., Ann. NY Acad. Sci., 660: 306-309 (1992) and Manoharan et al., Bioorg. Med. Chem. Let. 3:2765-2770 (1993)]; a thiocholesterol [Oberhauser et al., Nucl. Acids Res., 20: 533-538 (1992)]; an aliphatic chain, for example, dodecandiol or undecyl residues [Kabanov et al., FEBS Lett., 259: 327-330 (1990) and Svinarchuk et al., Biochimie, 75: 49-54 (1993)]; a phospholipid, for example, dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate [Manoharan et al., Tetrahedron Lett., 36: 3651-3654 (1995) and Shea et al., Nucl. Acids. Petition 870200048765, dated 04 / 17 / 2020, pp. 113 / 216 109 / 197 [Res., 18: 3777-3783 (1990)]; a polyamine or a polyethylene glycol chain [Mancharan et al., Nucleosides & Nucleotides, 14: 969-973 (1995)]; adamantane acetic acid [Manoharan et al., Tetrahedron Lett., 36: 3651-3654 (1995)]; a palmityl moiety [(Mishra et al., Bio chim. Biophys. Acta, 1264: 229-237 (1995)]; or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety [Crooke et al., J. Pharmacol. Exp. Ther., 277: 923-937 (1996)]. See also US Patent 4,828,979 5,552,538 5,118,802 5,608,046 4,824,941 5,112,963 5,254,469 5,371,241 5.514.785 4.948.882; 5.578.717, 5.138.045; 4.587.044; 4.835.263; 5.214.136; 5.258.506; 5.391.723; 5.565.552; 5.218.105; 5.580.731; 5.414.077; 4.605.735; 4.876.335; 5.082.830; 5.262.536; 5.416.203, 5.567.810; 5.525.465 5.580.731 5.486.603 4.667.025 4.904.582 5.112.963 5.272.250 5.451.463 5.574.142 5.541.313; 5.591.584; 5.512.439; 4.762.779; 4.958.013; 5.214.136; 5.292.873; 5.510.475; 5.585.481; 5.545.730; 5.109.124; 5.578.718; 4.789.737; 5.082.830; 5.245.022; 5.317.098; 5,512,667; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941.
[00374] Sugars and other moieties can be used to target proteins and complexes comprising nucleotides, such as cationic polysomes and liposomes, to particular sites. For example, liver cell-directed transfer can be mediated through asialoglycoprotein receptors (ASGPRs); see, for example, Hu, et al., Protein Pept Lett. 21(10):1025-30 (2014). Other systems known in the field and regularly developed can be used to target biomolecules of use in the present case and / or their complexes to particular target cells of interest.
[00375] These targeting or conjugated portions may include conjugated groups covalently linked to functional groups, such as primary or secondary hydroxyl groups. The conjugated groups Petition 870200048765, dated 17 / 04 / 2020, page 114 / 216110 / 197 The components of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that improve the pharmacodynamic properties of oligomers, and groups that improve the pharmacokinetic properties of oligomers. Typical conjugated groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that improve pharmacodynamic properties, in the context of this description, include groups that improve uptake, increase resistance to degradation, and / or strengthen specific hybridization of the sequence with the target nucleic acid. Groups that improve pharmacokinetic properties, in the context of this invention, include groups that improve the absorption, distribution, metabolism, or excretion of the compounds of the present invention.Representative conjugated groups are disclosed in International Patent Application PCT / US92 / 09196, filed October 23, 1992, and US Patent 6,287,860. Conjugated moieties include, but are not limited to, lipid moieties, such as a cholesterol moiety, oleic acid, a thioether, for example, hexyl-5-tritylthiol, a thiocholesterol, an aliphatic chain, for example, dodecandiol or undecyl residues, a phospholipid, for example, dihexadecyl-racglycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane-acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxy-cholesterol moiety. See, for example, U.S. Patents 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730. 5,552,538; 5,578,717; 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; Petition 870200048765, dated 04 / 17 / 2020, pp. 115 / 216 111 / 197 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941.
[00376] Longer polynucleotides that are less susceptible to chemical synthesis and are typically produced by enzymatic synthesis can also be modified by various means. Such modifications may include, for example, the introduction of certain nucleotide analogs, the incorporation of particular sequences or other portions at the 5' or 3' ends of molecules, and other modifications. As an illustration, the mRNA encoding Cas9 is approximately 4 kb long and can be synthesized by transcription in vitro. Modifications to mRNA can be applied to, for example, increase its translation or stability (such as increasing its resistance to degradation within a cell), or reduce the RNA's tendency to induce an innate immune response that is frequently observed in cells after the introduction of exogenous RNAs, particularly longer RNAs such as the one encoding Cas9.
[00377] Numerous such modifications have been described in the art, such as polyA tails, 5' capping analogs (e.g., Antireverse Capping Analog (ARCA) or m7G(5') ppp(5')G (mCAP)), modified 5' or 3' untranslated regions (UTRs), use of modified bases (such as Pseudo-UTP, 2-Thio-UTP, 5-methylcytidine-5'triphosphate (5-methyl-CTP) or N6-methyl-ATP), or phosphatase treatment to remove 5'-terminal phosphates. These and other modifications are known in the art, and new RNA modifications are being developed regularly.
[00378] There are numerous commercial suppliers of modified RNAs, including, for example, TriLink Biotech, AxoLabs, BioSynthesis Inc., Dharmacon, and many others. As described by TriLink, Petition 870200048765, dated 04 / 17 / 2020, pages 116 / 216 112 / 197 for example, 5-methyl-CTP can be used to confer desirable characteristics, such as increased stability of nucleases, increased translation, or reduced interaction of innate immune receptors with transcribed RNA in vitro. 5-Methylcytidine-5'-Triphosphate (5-Methyl-CTP), N6-Methyl-ATP, as well as Pseudo-UTP and 2-Thio-UTP, have also been shown to reduce innate immune stimulation in culture and in vivo by enhancing translation, as illustrated in publications by Kormann et al. and Warren et al., cited below.
[00379] It has been demonstrated that chemically modified mRNA in vivo can be used to achieve enhanced therapeutic effects; see, for example, Kormann et al., Nature Biotechnology 29, 154-157 (2011). Such modifications can be used, for example, to increase the stability of the RNA molecule and / or reduce its immunogenicity. Using chemical modifications such as Pseudo-U, N6Methyl-A, 2-Thio-U, and 5-Methyl-C, it was found that replacing only a quarter of the uridine and cytidine residues with 2-Thio-U and 5-Methyl-C, respectively, resulted in a significant decrease in mRNA recognition mediated by Toll-like receptors (TLRs) in mice. By reducing the activation of the innate immune system, these modifications can be used to effectively increase mRNA stability and longevity in vivo; see, for example, Kormann et al., supra.
[00380] It has also been shown that repeated administration of synthetic messenger RNAs incorporating modifications designed to circumvent innate antiviral responses can reprogram differentiated human cells to pluripotency. See, for example, Warren, et al., Cell Stem Cell, 7 (5): 618-30 (2010). Such modified mRNAs acting as primary reprogramming proteins may be an efficient means of reprogramming various types of human cells. Such cells are referred to as induced pluripotent stem cells (iPSCs), and Petition 870200048765, dated 04 / 17 / 2020, pp. 117 / 216 113 / 197 found that enzymatically synthesized RNA incorporating 5-Methyl-CTP, Pseudo-UTP, and an Antireverse Capping Analog (ARCA) could be used to effectively evade the cell's antiviral response; see, for example, Warren et al., supra.
[00381] Other polynucleotide modifications described in the art include, for example, the use of polyA tails, the addition of 5' capping analogs (such as m7G(5')ppp(5')G (mCAP)), modifications of 5' or 3' untranslated regions (UTRs), or phosphatase treatment to remove 5'-terminal phosphates, and new approaches are being developed regularly.
[00382] A number of compositions and techniques applicable to the generation of modified RNAs for use herein have been developed in connection with RNA interference modification (RNAi), including small interfering RNAs (siRNAs). siRNAs present particular challenges in vivo because their gene silencing effects via mRNA interference are generally transient, which may require repeated administration. In addition, siRNAs are double-stranded RNAs (dsRNAs), and mammalian cells have immune responses that have evolved to detect and neutralize dsRNA, which is often a byproduct of viral infection.Thus, there are mammalian enzymes, such as PKR (dsRNA-responsive kinase), and potentially retinoic acid-induced gene I (RIG-I), that can mediate cellular responses to dsRNA, as well as Toll-like receptors (such as TLR3, TLR7, and TLR8) that can trigger the induction of cytokines in response to such molecules; see, for example, the comments of Angart et al., Pharmaceuticals (Basel) 6(4): 440-468 (2013); Kanasty et al., Molecular Therapy 20(3): 513-524 (2012); Burnett et al., Biotechnol J. 6(9):1130-46 (2011); Judge and MacLachlan, Hum Gene Ther 19(2):111-24 (2008); and references cited therein.
[00383] A wide variety of modifications has been developed and Petition 870200048765, dated 04 / 17 / 2020, pp. 118 / 216 114 / 197 applied to increase RNA stability, reduce innate immune responses, and / or achieve other benefits that may be useful in connection with the introduction of polynucleotides into human cells, as described herein; see, for example, the comments by Whitehead KA et al., Annual Review of Chemical and Biomolecular Engineering, 2: 77-96 (2011); Gaglione and Messere, Mini Rev Med Chem, 10(7):578-95 (2010); Chernolovskaya et al, Curr Opin Mol Ther., 12(2):158-67 (2010); Deleavey et al., Curr Protoc Nucleic Acid Chem Chapter 16:Unit 16.3 (2009); Behlke, Oligonucleotides 18(4):305-19 (2008); Fucini et al., Nucleic Acid Ther 22(3): 205-210 (2012); Bremsen et al., Front Genet 3:154 (2012).
[00384] As noted above, there are a number of commercial suppliers of modified RNAs, many of whom specialize in modifications aimed at improving the effectiveness of siRNAs. A variety of approaches are offered based on various findings reported in the literature. For example, Dharmacon notes that replacing a non-bridged oxygen with sulfur (phosphorothioate, PS) has been widely used to improve the nuclease resistance of siRNAs, as reported by Kole, Nature Reviews Drug Discovery 11:125-140 (2012). Modifications at the 2' position of ribose have been reported to improve the nuclease resistance of the internucleotide phosphate bond, while increasing duplex stability (Tm), which has also been shown to provide protection against immune system activation.A combination of moderate modifications to the PS main structure with small, well-tolerated 2' substitutions (2'-O-Methyl, 2'-Fluoro, 2'-Hydro) have been associated with highly stable siRNAs for in vivo applications, as reported by Soutschek et al. Nature 432:173-178 (2004); and 2'-O-Methyl modifications have been reported to be effective in improving stability as reported by Volkov, Oligonucleotides 19:191-202 (2009). Regarding... Petition 870200048765, dated 04 / 17 / 2020, pages 119 / 216 115 / 197 modifying specific sequences with 2'-O-Methyl, 2'-Fluoro, 2'-Hydro has been reported to reduce the TLR7 / TLR8 interaction while generally preserving silencing activity; see, for example, Judge et al., Mol. Ter. 13:494-505 (2006); and Cekaite et al., J. Mol. Biol. 365:90-108 (2007). Additional modifications, such as 2-thiouracil, pseudouracil, 5-methylcytosine, 5-methyluracil, and N6-methyladenosine, have also been shown to minimize the immunological effects mediated by TLR3, TLR7, and TLR8; see, for example, Kariko, K. et al., Immunity 23:165-175 (2005).
[00385] As is also known in the art and commercially available, various conjugates can be applied to polynucleotides, such as RNAs, for use in the present document that can increase their distribution and / or uptake by cells, including for example cholesterol, tocopherol and folic acid, lipids, peptides, polymers, ligands and aptamers; see, for example, the review by Winkler, Ther. Deliv. 4:791-809 (2013), and references cited therein. Codon Optimization
[00386] A polynucleotide encoding a site-directed polynucleotide can be codon-optimized according to standard methods in the art for expression in the cell containing the target DNA of interest. For example, if the intended target nucleic acid is in a human cell, a human codon-optimized polynucleotide encoding Cas9 is contemplated for use in the production of the Cas9 polypeptide. Complexes of a Genome-Directing Nucleic Acid and a Site-Directed Polypeptide
[00387] A genome-directing nucleic acid interacts with a site-directed polypeptide (e.g., a nucleic acid-guided nuclease such as Cas9), thus forming a complex. The genome-directing nucleic acid guides the site-directed polypeptide to Petition 870200048765, dated 04 / 17 / 2020, pp. 120 / 216 116 / 197 ra a target nucleic acid. RNPs
[00388] The site-directed polypeptide and the genome-directed nucleic acid can each be administered separately to a cell or patient. Alternatively, the site-directed polypeptide can be pre-complexed with one or more genome-directed nucleic acids (guide RNA, sgRNA, or crRNA in conjunction with a tracrRNA). The pre-complexed material can then be administered to a cell or patient. This pre-complexed material is known as a ribonucleoprotein (RNP) particle. The site-directed polypeptide in the RNP can be, for example, a Cas9 endonuclease or a Cpf1 endonuclease. The site-directed polypeptide can be flanked at the N-terminal, C-terminal, or both the N-terminal and C-terminal by one or more nuclear localization signals (NLSs). For example, a Cas9 endonuclease may be flanked by two NLSs, one NLS located at the N-terminus and the second NLS located at the C-terminus.The NLS can be any NLS known in the art, such as an SV40 NLS. The weight ratio of nucleic acid targeting genome to polypeptide targeting site on the RNP can be 1:1. For example, the weight ratio of sgRNA to Cas9 endonuclease on the RNP can be 1:1. For example, the sgRNA might comprise the nucleic acid sequence SEQ ID NO: 71959, the Cas9 endonuclease might be an S. pyogenes Cas9 comprising an N-terminal SV40 NLS and a C-terminal SV40 NLS, and the weight ratio of sgRNA to Cas9 endonuclease is 1:1. Components of the Nucleic Acid Coding System
[00389] The present invention provides a nucleic acid comprising a nucleotide sequence encoding a nucleic acid targeting genome description, a polypeptide targeting the description site, and / or any nucleic acid or protein molecule. Petition 870200048765, dated 04 / 17 / 2020, pages 121 / 216 117 / 197 required to perform the aspects of the methods of description.
[00390] The nucleic acid that encodes a nucleic acid according to the description genome, a polypeptide directed to the description site, and / or any nucleic acid or protein molecule needed to perform aspects of the description methods may comprise a vector (e.g., a recombinant expression vector).
[00391] The term vector refers to a nucleic acid molecule capable of carrying another nucleic acid to which it has been attached. One type of vector is a plasmid, which refers to a loop of circular double-stranded DNA to which additional nucleic acid segments can be attached. Another type of vector is a viral vector, in which additional nucleic acid segments can be attached to the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors with a bacterial origin of replication and episomic mammalian vectors). Other vectors (e.g., non-episomic mammalian vectors) are integrated into the genome of a host cell after introduction into the host cell and, in this way, are replicated along with the host genome.
[00392] In some examples, vectors may be able to direct the expression of nucleic acids to which they are operatively linked. Such vectors are referred to here as recombinant expression vectors, or more simply expression vectors, which serve equivalent functions.
[00393] The term operatively linked means that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a way that allows the expression of the nucleotide sequence. The term regulatory sequence is intended to include, for example, promoters, enhancers, and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences Petition 870200048765, dated 04 / 17 / 2020, pp. 122 / 216 118 / 197 are well known in the art and are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Regulatory sequences include those that direct the constitutive expression of a nucleotide sequence in many types of host cells, and those that direct the expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector may depend on factors such as the choice of target cell, the desired level of expression, and the like.
[00394] The contemplated expression vectors include, but are not limited to, viral vectors based on vaccinia virus, poliovirus, adenovirus, adeno-associated viruses, SV40, herpes simplex virus, human immunodeficiency virus, retroviruses (e.g., Murine Leukemia Virus, splenic necrosis virus and retrovirus-derived vectors such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, a lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus and mammary tumor virus) and other recombinant vectors. Other contemplated vectors for eukaryotic target cells include, but are not limited to, pXT1, pSG5, pSVK3, pBPV, pMSG and pSVLSV40 (Pharmacia) vectors. Additional vectors contemplated for eukaryotic target cells include, but are not limited to, the pCTx-1, pCTx-2, and pCTx-3 vectors, which are described in Figures 1A to 1C. Other vectors may be used provided they are compatible with the host cell.
[00395] In some examples, a vector may comprise one or more transcription and / or translation control elements. Depending on the host / vector system used, any of several suitable transcription and translation control elements, including constitutive and inducible promoters, transcription enhancer elements Petition 870200048765, dated 04 / 17 / 2020, pages 123 / 216 119 / 197 transcription, transcription terminators, etc. can be used in the expression vector. The vector can be a self-inactivation vector that inactivates viral sequences or components of the CRISPR machinery or other elements.
[00396] Non-limiting examples of suitable eukaryotic promoters (i.e., functional promoters in a eukaryotic cell) include those of cytomegalovirus (CMV), herpes simplex virus (HSV) thymidine kinase, SV40 early and late, retrovirus long terminal repeats (LTRs), human elongation factor 1 (EF1) promoter, a hybrid construct comprising the cytomegalovirus (CMV) enhancer fused to chicken beta-actin (CAG) promoter, murine stem cell virus (MSCV) promoter, phosphoglycerate kinase-1 (PGK) locus promoter, and mouse metallothionein-I.
[00397] To express small RNAs, including guide RNAs used in connection with Cas endonuclease, several promoters, such as RNA polymerase III promoters, including, for example, U6 and H1, may be advantageous. Descriptions and parameters for improving the use of such promoters are known in the art, and additional information and approaches are being described regularly; see, for example, Ma, H. et al., Molecular Therapy - Nucleic Acids 3, e161 (2014) doi:10.1038 / mtna.2014.12.
[00398] The expression vector may also contain a ribosome-binding site for translation initiation and a transcription terminator. The expression vector may also comprise sequences appropriate for amplifying expression. The expression vector may also include nucleotide sequences encoding non-native tags (e.g., histidine tag, hemagglutinin, green fluorescent protein, etc.) that are fused with the site-targeted polypeptide, thus resulting in a fusion protein. Petition 870200048765, dated 04 / 17 / 2020, pages 124 / 216 120 / 197
[00399] A promoter can be an inducible promoter (e.g., a heat shock promoter, tetracycline-regulated promoter, steroid-regulated promoter, metal-regulated promoter, estrogen receptor-regulated promoter, etc.). The promoter can be a constitutive promoter (e.g., CMV promoter, UBC promoter). In some cases, the promoter can be a spatially restricted and / or temporally limited promoter (e.g., a tissue-specific promoter, a cell-type-specific promoter, etc.).
[00400] Nucleic acid encoding a genome-targeted nucleic acid and / or a site-targeted polypeptide can be packaged within or on the surface of delivery vehicles for distribution into cells. Contemplated delivery vehicles include, but are not limited to, nanospheres, liposomes, quantum dots, nanoparticles, polyethylene glycol particles, hydrogels, and micelles. As described in the art, a variety of targeting moieties can be used to enhance the preferential interaction of such vehicles with desired cell types or sites.
[00401] The introduction of the described complexes, polypeptides, and nucleic acids into cells can occur through viral or bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, nucleofection, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran-mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct microinjection, nanoparticle-mediated nucleic acid delivery, and the like. Distribution
[00402] Guide RNA polynucleotides (RNA or DNA) and / or endonuclease polynucleotide(s) (RNA or DNA) can be delivered by viral or non-viral delivery vehicles known in the art, Petition 870200048765, dated 04 / 17 / 2020, pages 125 / 216 121 / 197 such as electroporation, mechanical force, cell deformation (SQZ Biotech) and cell-penetrating peptides. Alternatively, the endonuclease polypeptide(s) may be delivered by viral or non-viral delivery vehicles known in the art, such as electroporation or lipid nanoparticles. In other alternative aspects, the DNA endonuclease may be administered as one or more polypeptides, alone or pre-complexed with one or more guide RNAs, or one or more crRNAs together with a tracrRNA.
[00403] Electroporation is a delivery technique in which an electric field is applied to one or more cells to increase the permeability of the cell membrane, allowing substances such as drugs, nucleic acids (nucleic acids that target the genome), proteins (site-directed polypeptides), or RNPs to be introduced into the cell. In general, electroporation works by passing thousands of volts through a distance of one to two millimeters of cells suspended in an electroporation cuvette (1.0 - 1.5 kV, 250 - 750 V / cm).
[00404] Polynucleotides can be delivered by nonviral delivery vehicles including, but not limited to, nanoparticles, liposomes, ribonucleoproteins, positively charged peptides, small molecule RNA conjugates, aptamer RNA chimeras, and RNA fusion protein complexes. Some exemplary nonviral delivery vehicles are described in Peer and Lieberman, Gene Therapy, 18:1127-1133 (2011) (which focuses on nonviral delivery vehicles for siRNA that are also useful for the delivery of other polynucleotides).
[00405] Polynucleotides, such as guide RNA, sgRNA, and mRNA encoding an endonuclease, can be delivered to a cell or patient via a lipid nanoparticle (LNP).
[00406] An LNP refers to any particle with a diameter Petition 870200048765, dated 04 / 17 / 2020, pages 126 / 216 122 / 197 less than 1000 nm, 500 nm, 250 nm, 200 nm, 150 nm, 100 nm, 75 nm, 50 nm or 25 nm. Alternatively, a nanoparticle may vary in size from 1-1000 nm, 1-500 nm, 1-250 nm, 25-200 nm, 25-100 nm, 35-75 nm or 25-60 nm.
[00407] LNPs can be made from cationic, anionic, or neutral lipids. Neutral lipids, such as fusogenic DOPE phospholipid or the cholesterol component of the membrane, can be included in LNPs as auxiliary lipids to increase transfection activity and nanoparticle stability. Limitations of cationic lipids include low efficacy due to poor stability and rapid clearance, as well as the generation of inflammatory or anti-inflammatory responses.
[00408] LNPs can also be composed of hydrophobic lipids, hydrophilic lipids, or both hydrophobic and hydrophilic lipids.
[00409] Any lipid or combination of lipids known in the art can be used to produce an LNP. Examples of lipids used to produce LNPs are: DOTMA, DOSPA, DOTAP, DMRIE, cholesterol-DC, DOTAP-cholesterol, GAPDMORIE-DPyPE, and GL67A-DOPE-DMPE-polyethylene glycol (PEG). Examples of cationic lipids are: 98N12-5, C12-200, DLin-KC2DMA (KC2), DLin-MC3-DMA (MC3), XTC, MD1, and 7C1. Examples of neutral lipids are: DPSC, DPPC, POPC, DOPE, and SM. Examples of PEG-modified lipids are: PEG-DMG, PEG-CerC14, and PEGCerC20.
[00410] Lipids can be combined in any number of molar ratios to produce an LNP. Furthermore, the polynucleotide(s) can be combined with lipid(s) in a wide range of molar ratios to produce an LNP.
[00411] As stated earlier, the site-targeted polypeptide and the genome-targeting nucleic acid can each be Petition 870200048765, dated 04 / 17 / 2020, pages 127 / 216 123 / 197 administered separately to a cell or to a patient. On the other hand, the site-targeted polypeptide can be pre-complexed with one or more guide RNAs or one or more crRNAs together with a tracrRNA. The pre-complexed material can then be administered to a cell or to a patient. This pre-complexed material is known as a ribonucleoprotein (RNP) particle.
[00412] RNA is capable of forming specific interactions with RNA or DNA. While this property is exploited in many biological processes, it also comes with the risk of promiscuous interactions in a nucleic acid-rich cellular environment. One solution to this problem is the formation of ribonucleoprotein particles (RNPs), in which RNA is pre-complexed with an endonuclease. Another benefit of RNPs is the protection of RNA from degradation.
[00413] The endonuclease in RNP can be modified or unmodified. Similarly, gRNA, crRNA, tracrRNA, or sgRNA can be modified or unmodified. Numerous modifications are known in the art and can be used.
[00414] Endonuclease and sgRNA can generally be combined in a 1:1 molar ratio. Alternatively, endonuclease, crRNA, and tracrRNA can generally be combined in a 1:1:1 molar ratio. However, a wide range of molar ratios can be used to produce an RNP.
[00415] A recombinant adeno-associated virus (AAV) vector can be used for delivery. Techniques for producing rAAV particles, in which an AAV genome to be packaged, including the polynucleotide to be delivered, the rep and cap genes, and the functions of the helper virus are provided to a cell, are standard in the art. rAAV production typically requires the following components to be present in a single cell (denoted here as a packaging cell): an rAAV genome, rep and cap genes of Petition 870200048765, dated 04 / 17 / 2020, pages 128 / 216 124 / 197 AAVs separated from (i.e., not in) the rAAV genome and helper virus functions. The rep and cap genes of AAV can be from any AAV serotype to which the recombinant virus can be derived and can be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13 and AAV rh.74. The production of pseudotyped rAAV is disclosed, for example, in the publication number of international patent application WO 01 / 83692. See Table 2. Table 2 AAV Serotype GenBank Accession Number AAV-1 NC 002077.1 AAV-2 NC 001401.2 AAV-3 NC 001729.1 AAV-3B AF028705.1 AAV-4 NC 001829.1 AAV-5 NC 006152.1 AAV-6 AF028704.1 AAV-7 NC 006260.1 AAV-8 NC 006261.1 AAV-9 AX753250.1 AAV-10 AY631965.1 AAV-11 AY631966.1 AAV-12 DQ813647.1 AAV-13 EU285562.1
[00416] One method of generating a packaging cell involves creating a cell line that stably expresses all the components necessary for the production of AAV particles. For example, a plasmid (or multiple plasmids) comprising an rAAV genome without AAV rep and cap genes, AAV rep and cap genes separated from the rAAV genome, and a selectable marker, such as a neomycin resistance gene, are integrated into the genome of a cell. AAV genomes have been introduced into bacterial plasmids by procedures such as CG tailing (Samulski et al., 1982, Proc. Natl. Acad. S6. USA, 79:2077-2081), addition Petition 870200048765, dated 04 / 17 / 2020, pp. 129 / 216 125 / 197 synthetic ligands containing restriction endonuclease cleavage sites (Laughlin et al., 1983, Gene, 23: 65-73) or direct ligation of blunt ends (Senapathy & Carter, 1984, J Biol. Chem., 259:4661-4666). The packaging cell line can then be infected with a helper virus, such as adenovirus. The advantages of this method are that the cells are selectable and are suitable for large-scale production of rAAV. Other examples of suitable methods use adenovirus or baculovirus, instead of plasmids, to introduce rAAV genomes and / or rep and cap genes into packaging cells.
[00417] General principles of rAAV production are reviewed in, for example, Carter, 1992, Current Opinions in Biotechnology, 1533-539; e Musician, 1992, Curr. Topics in Microbial. and Immunol., 158:97-129). Various approaches are described in Ratschin et al., Mol. Cell. Biol. 4:2072 (1984); Hermonat et al., Proc. Natl. Acad. Sci. USA, 81:6466 (1984); Tratschin et al., Mo1. Cell. Biol. 5:3251 (1985); McLaughlin et al., J. Virol., 62:1963 (1988); and Lebkowski et al., 1988 Mol. Cell. Biol., 7:349 (1988). Samulski et al. (1989, J. Virol., 63:3822-3828); US Patent 5,173,414; WO 95 / 13365 and corresponding US Patent 5,658,776 ; WO 95 / 13392; WO 96 / 17947; PCT / US98 / 18600; WO 97 / 09441 (PCT / US96 / 14423); WO 97 / 08298 (PCT / US96 / 13872); WO 97 / 21825 (PCT / US96 / 20777); WO 97 / 06243 (PCT / FR96 / 01064); WO 99 / 11764; Perrin et al. (1995) Vaccines 13:1244-1250; Paul et al. (1993) Human Gene Therapy 4:609-615; Clark et al. (1996) Gene Therapy 3:11241132; US Patent No. 5,786,211; US Patent No. 5,871,982; and US 6 Patent.258,595.
[00418] AAV vector serotypes can be combined to target cell types. For example, the following exemplary cell types can be transduced by the indicated AAV serotypes, among others. See Table 3. Petition 870200048765, dated 04 / 17 / 2020, pp. 130 / 216 126 / 197 Table 3 Tissue / Cell Type Serotype Liver AAV8, AA3, AA5, AAV9 Skeletal Muscle AAV1, AAV7, AAV6, AAV8, AAV9 Central Nervous System AAV5, AAV1, AAV4 RPE AAV5, AAV4 Photoreceptor Cells AAV5 Lung AAV9 Heart AAV8 Pancreas AAV8 Kidney AAV2, AA8
[00419] In addition to adeno-associated viral vectors, other viral vectors may be used. Such viral vectors include, but are not limited to, lentiviruses, alphaviruses, enteroviruses, pestiviruses, baculoviruses, herpesviruses, Epstein-Barr virus, papovaviruses, poxviruses, vaccinia virus, and herpes simplex virus.
[00420] In some cases, Cas9 mRNA, sgRNA targeting one or two loci within or near the BCL11A gene, or another DNA sequence encoding a regulatory element of the BCL11A gene, and donor DNA can be formulated separately into lipid nanoparticles, or they are all co-formulated into a single lipid nanoparticle.
[00421] In some cases, Cas9 mRNA can be formulated into a lipid nanoparticle, while sgRNA and donor DNA can be delivered in an AAV vector.
[00422] Options are available for delivering the Cas9 nuclease as a DNA plasmid, as mRNA, or as a protein. The guide RNA can be expressed from the same DNA, or it can also be delivered as RNA. The RNA can be chemically modified to alter or improve its half-life, or to decrease the likelihood or degree of immune response. The endonuclease protein can be complexed with gRNA before delivery. Viral vectors allow for efficient delivery; split versions of Cas9 and smaller Cas9 orthologs can be packaged into AAVs, as can the Petition 870200048765, dated 04 / 17 / 2020, pp. 131 / 216 127 / 197 donors for HDR. There are also a variety of non-viral delivery methods that can deliver each of these components, or non-viral and viral methods can be employed together. For example, nanoparticles can be used to deliver the protein and guide the RNA, while AAV can be used to deliver a donor DNA. Genetically Modified Cells
[00423] The term genetically modified cell refers to a cell comprising at least one genetic modification introduced by genome editing (e.g., using the CRISPR / Cas9 / Cpf1 system). In some ex vivo examples herein, the genetically modified cell may be a genetically modified progenitor cell. In some in vivo examples, the genetically modified cell may be a genetically modified hematopoietic progenitor cell. A genetically modified cell comprising an exogenous genome-targeting nucleic acid and / or an exogenous nucleic acid encoding a genome-targeting nucleic acid is contemplated herein.
[00424] The term treated control population describes a population of cells that have been treated with identical media, viral induction, nucleic acid sequences, temperature, confluence, flask size, pH, etc., except for the addition of genome editing components. Any method known in the art can be used to measure modulation or inactivation of the BCL11A gene transcriptional control sequence or protein expression or activity, for example, Western blot analysis of the BCL11A gene protein transcriptional control sequence or quantification of the BCL11A gene mRNA transcriptional control sequence.
[00425] The term isolated cell refers to a cell that has been removed from an organism in which it was originally found, or a Petition 870200048765, dated 04 / 17 / 2020, pp. 132 / 216 128 / 197 descendant of such a cell. Optionally, the cell can be cultured in vitro, for example, under defined conditions or in the presence of other cells. Optionally, the cell can be subsequently introduced into a second organism or reintroduced into the organism from which it (or the cell from which it is descended) was isolated.
[00426] The term isolated population in relation to an isolated population of cells refers to a population of cells that has been removed and separated from a mixed or heterogeneous population of cells. In some cases, the isolated population may be a substantially pure population of cells compared to the heterogeneous population from which the cells were isolated or enriched. In some cases, the isolated population may be an isolated population of human progenitor cells, for example, a substantially pure population of human progenitor cells compared to a heterogeneous population of cells comprising human progenitor cells and cells from which the human progenitor cells were derived.
[00427] The term substantially enhanced, in relation to a particular cell population, refers to a cell population in which the occurrence of a particular cell type is increased relative to pre-existing or reference levels by at least 2 times, at least 3-, at least 4-, at least 5-, at least 6-, at least 7-, at least 8-, at least 9-, at least 10-, at least 20-, at least 50-, at least 100-, at least 400-, at least 1000-, at least 5000-, at least 20000-, at least 100000- or more times depending, for example, on the desired levels of such cells to improve hemoglobinopathy.
[00428] The term substantially enriched with respect to a particular cell population refers to a cell population that is at least about 10%, about 20%, about 30%, about Petition 870200048765, dated 04 / 17 / 2020, pp. 133 / 216 129 / 197 40%, approximately 50%, approximately 60%, or more in relation to the cells that make up a total cell population.
[00429] The term substantially pure with respect to a particular cell population refers to a population of cells that is at least about 75%, at least 85%, at least 90%, or at least 95% pure with respect to the cells that make up a total cell population. That is, the terms substantially pure or essentially purified with respect to a population of progenitor cells refer to a population of cells that contains less than about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, about 1%, or less than 1%, of cells that are not progenitor cells as defined by the terms herein. Differentiation of genome-edited iPSCs into hematopoietic progenitor cells
[00430] Another step in the ex vivo methods of the present invention may comprise the differentiation of genome-edited iPSCs into hematopoietic progenitor cells. The differentiation step may be performed according to any method known in the art. Differentiation of genome-edited mesenchymal stem cells into hematopoietic progenitor cells.
[00431] Another step in the ex vivo methods of the present invention may comprise the differentiation of genome-edited mesenchymal stem cells into hematopoietic progenitor cells. The differentiation step may be performed according to any method known in the art. Implanting cells in patients
[00432] Another step in the ex vivo methods of the present invention may comprise implanting the cells into patients. This implantation step can be performed using any implantation method. Petition 870200048765, dated 04 / 17 / 2020, pp. 134 / 216 130 / 197 known in the art. For example, genetically modified cells can be injected directly into the patient's bloodstream or administered to the patient in another way. Genetically modified cells can be purified ex vivo using a selected marker. Acceptable Pharmaceutical Carriers
[00433] The ex vivo methods of administering progenitor cells to a subject contemplated herein may involve the use of therapeutic compositions comprising progenitor cells.
[00434] Therapeutic compositions may contain a physiologically tolerable carrier in conjunction with the cellular composition, and optionally at least one additional bioactive agent as described herein, dissolved or dispersed as an active ingredient. In some cases, the therapeutic composition is not substantially immunogenic when administered to a mammal or human patient for therapeutic purposes, unless desired.
[00435] In general, the progenitor cells described herein can be administered as a suspension with a pharmaceutically acceptable carrier. One skilled in the art will recognize that a pharmaceutically acceptable carrier to be used in a cell composition will not include buffers, compounds, cryopreservation agents, preservatives, or other agents in amounts that substantially interfere with the viability of the cells to be administered to the subject. A formulation comprising cells may include, for example, osmotic buffers that allow the integrity of the cell membrane to be maintained, and optionally, nutrients to maintain cell viability or enhance engraftment after administration. Such formulations and suspensions are known to those skilled in the art and / or can be adapted for use with the progenitor cells as described herein using experimental protocols. Petition 870200048765, dated 04 / 17 / 2020, pages 135 / 216 131 / 197 tina.
[00436] A cell composition may also be emulsified or presented as a liposomal composition, provided that the emulsification procedure does not negatively affect cell viability. The cells and any other active ingredient may be mixed with excipients that are pharmaceutically acceptable and compatible with the active ingredient, and in quantities suitable for use in the therapeutic methods described herein.
[00437] Additional agents included in a cellular composition may include pharmaceutically acceptable salts of the components contained therein. Pharmaceutically acceptable salts include acid addition salts (formed with the free amino groups of the polypeptide) which are formed with inorganic acids, such as, for example, hydrochloric or phosphoric acids, or organic acids, such as acetic, tartaric, mandelic and the like. Salts formed with free carboxyl groups may also be derived from inorganic bases, such as, for example, sodium, potassium, ammonium, calcium or ferric hydroxides, and organic bases, such as isopropylamine, trimethylamine, 2-ethylaminoethanol, histidine, procaine and the like.
[00438] Physiologically tolerable carriers are well known in the art. Exemplary liquid carriers are sterile aqueous solutions that contain no materials other than the active ingredients and water, or contain a buffer, such as sodium phosphate at a physiological pH value, physiological saline solution, or both, such as phosphate-buffered saline solution. Furthermore, aqueous carriers may contain more than one buffer salt, as well as salts such as sodium and potassium chlorides, dextrose, polyethylene glycol, and other solutes. Liquid compositions may also contain liquid phases in addition to and to the exclusion of water. Examples of such additional liquid phases are glycerin, vegetable oils, such as Petition 870200048765, dated 04 / 17 / 2020, pages 136 / 216 132 / 197 Cottonseed oil and water-in-oil emulsions. The amount of an active compound used in cellular compositions that is effective in treating a particular disorder or condition may depend on the nature of the disorder or condition and can be determined by standard clinical techniques. Administration and Effectiveness
[00439] The terms administer, introduce, and transplant are used interchangeably in the context of placing cells, for example, progenitor cells, into a subject by a method or route that results in at least partial localization of the introduced cells to a desired site, such as a site of injury or repair, in such a way that a desired effect(s) is produced. Cells, for example, progenitor cells, or their differentiated progeny, may be administered by any appropriate route that results in distribution to a desired location in the subject where at least a portion of the implanted cells or cell components remain viable. The period of viability of the cells after administration to a subject may be as short as a few hours, for example, twenty-four hours, to a few days, up to several years, or up to the patient's lifetime, i.e., long-term grafting.For example, in some aspects described here, an effective quantity of myogenic progenitor cells is administered via a systemic route, such as an intraperitoneal or intravenous route.
[00440] The terms individual, subject, host, and patient are used interchangeably here and refer to any subject for whom diagnosis, treatment, or therapy is desired. In some respects, the subject is a mammal. In some respects, the subject is a human being.
[00441] When provided prophylactically, the progenitor cells described herein may be administered to a subject before Petition 870200048765, dated 04 / 17 / 2020, pp. 137 / 216 133 / 197 any symptom of a hemoglobinopathy, for example, before the development of fatigue, shortness of breath, jaundice, delayed puberty with slow growth, joint, bone and chest pain, enlarged spleen and liver. Consequently, prophylactic administration of a population of hematopoietic progenitor cells serves to prevent a hemoglobinopathy, such as thalassemia-B or Sickle Cell Disease.
[00442] When therapeutically provided, hematopoietic progenitor cells are provided at (or after) the onset of a symptom or indication of hemoglobinopathy, for example, after the onset of the disease.
[00443] The population of hematopoietic progenitor cells to be administered according to the methods described herein may comprise allogeneic hematopoietic progenitor cells obtained from one or more donors. Allogeneic refers to a hematopoietic progenitor cell or biological samples comprising hematopoietic progenitor cells obtained from one or more different donors of the same species, wherein the genes at one or more loci are not identical. For example, a population of hematopoietic progenitor cells to be administered to a subject may be derived from one or more unrelated donor subjects, or from one or more non-identical siblings. In some cases, syngeneic populations of hematopoietic progenitor cells may be used, such as those obtained from genetically identical animals, or from identical twins.Hematopoietic progenitor cells can be autologous cells; that is, hematopoietic progenitor cells are obtained or isolated from a subject and administered to the same subject, i.e., the donor and the recipient are the same.
[00444] The term effective quantity refers to the amount of a population of progenitor cells or their progeny needed to Petition 870200048765, dated 04 / 17 / 2020, pp. 138 / 216 134 / 197 to prevent or alleviate at least one or more signs or symptoms of hemoglobinopathy, and refers to a sufficient quantity of a composition to provide the desired effect, for example, to treat a subject with hemoglobinopathy. The term therapeutically effective amount therefore refers to a quantity of progenitor cells or a composition comprising progenitor cells that is sufficient to promote a particular effect when administered to a typical subject, such as someone who has or is at risk of hemoglobinopathy. An effective amount would also include a quantity sufficient to prevent or delay the development of a disease symptom, alter the course of a disease symptom (for example, but not limited to, delaying the progression of a disease symptom), or reverse a disease symptom. It is understood that for any given case, an appropriate effective amount can be determined by one skilled in the art using routine experimentation.
[00445] For use in the various aspects described in this document, an effective quantity of progenitor cells comprises at least 102 progenitor cells, at least 5 x 102 progenitor cells, at least 103 progenitor cells, at least 5 x 103 progenitor cells, at least 104 progenitor cells, at least 5 x 104 progenitor cells, at least 105 progenitor cells, at least 2 x 105 progenitor cells, at least 3 x 105 progenitor cells, at least 4 x 105 progenitor cells, at least 5 x 105 progenitor cells, at least 6 x 105 progenitor cells, at least 7 x 105 progenitor cells, at least 8 x 105 progenitor cells progenitor cells, at least 9 x 10⁵ progenitor cells, at least 1 x 10⁶ progenitor cells, at least 2 x 10⁶ progenitor cells, at least 3 x 10⁶ progenitor cells, at least 4 x 10⁶ progenitor cells, at least 5 x 10⁶ progenitor cells, at least 6 x 10⁶ progenitor cells, at least 7 x 10⁶ progenitor cells,at least 8 times, Petition 870200048765, dated 04 / 17 / 2020, pp. 139 / 216 135 / 197 106 progenitor cells, at least 9 x 106 progenitor cells, or multiples thereof. The progenitor cells may be derived from one or more donors, or may be obtained from an autologous source. In some examples described herein, the progenitor cells may be expanded in culture prior to administration to a subject in need thereof.
[00446] Administered refers to the distribution of a progenitor cell composition in a subject by a method or route that results in at least partial localization of the cell composition to a desired site. A cell composition may be administered by any appropriate route that results in effective treatment in the subject, i.e., administration results in distribution to a desired site in the subject where at least a portion of the distributed composition, i.e., at least 1 x 10⁴ cells, are distributed to the desired site over a period of time. Modes of administration include injection, infusion, instillation, or ingestion. Injection includes, without limitation, intravenous, intramuscular, intra-arterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intra-articular, subcapsular, subarachnoid, intraspinal, intracerebral spinal, and intrasternal injection and infusion.In some examples, the route is intravenous. For cell distribution, administration by injection or infusion may be performed.
[00447] Cells can be administered systemically. The phrases systemic administration, systemically administered, peripheral administration, and peripherally administered refer to the administration of a population of progenitor cells not directly to a target site, tissue, or organ, so that they enter the subject's circulatory system and are therefore subject to metabolism and other similar processes.
[00448] The effectiveness of a treatment that includes a composition pa Petition 870200048765, dated 04 / 17 / 2020, pp. 140 / 216 136 / 197 The treatment of hemoglobinopathies can be determined by a specialist physician. However, treatment is considered effective if any or all of the signs or symptoms of, for example, functional BCL11A and functional Hb levels are beneficially altered (e.g., decreased by at least 10% for BCL11A and / or increased by at least 10% for HbF), or other clinically accepted symptoms or disease markers are improved or enhanced. Effectiveness can also be measured by an individual's inability to worsen as assessed by hospitalization or need for medical interventions (e.g., disease progression is halted or at least slowed). The methods for measuring these indicators are known to those skilled in the art and / or described herein.Treatment includes any treatment of a disease in an individual or animal (some non-limiting examples include a human or a mammal) and includes: (1) inhibiting the disease, for example, stopping or slowing the progression of symptoms; or (2) alleviating the disease, for example, causing regression of symptoms; and (3) preventing or reducing the likelihood of developing symptoms.
[00449] The treatment according to the present invention can improve one or more symptoms associated with hemoglobinopathies by decreasing the amount of functional BCL11A and / or increasing the amount of functional HbF in the individual. Early signs typically associated with hemoglobinopathies include, for example, fatigue, shortness of breath, jaundice, slow growth, delayed puberty, joint, bone and chest pain, and enlarged spleen and liver. Kits
[00450] The present invention provides kits for carrying out the methods described herein. A kit may include one or more of a genome-targeting nucleic acid, a polynucleotide encoding a nucleic acid Petition 870200048765, dated 04 / 17 / 2020, pp. 141 / 216 137 / 197 cleico that targets the genome, a site-directed polypeptide, a polynucleotide encoding a site-directed polypeptide, and / or any nucleic acid or protein molecule necessary to perform aspects of the methods described herein, or any combination thereof.
[00451] A kit may comprise: (1) a vector comprising a nucleotide sequence encoding a genome-targeting nucleic acid, (2) the site-targeted polypeptide or a vector comprising a nucleotide sequence encoding the site-targeted polypeptide, and (3) a reagent for reconstitution and / or dilution of the vector(s) and / or the polypeptide.
[00452] A kit may comprise: (1) a vector comprising (i) a nucleotide sequence encoding a genome-targeting nucleic acid, and (ii) a nucleotide sequence encoding the site-targeting polypeptide; and (2) a reagent for reconstitution and / or dilution of the vector.
[00453] In any of the above kits, the kit may comprise a single-molecule genome targeting nucleic acid. In any of the above kits, the kit may comprise a double-molecule genome targeting nucleic acid. In any of the above kits, the kit may comprise two or more double-molecule guides or single-molecule guides. The kits may comprise a vector encoding the nucleic acid targeting nucleic acid.
[00454] In any of the kits above, the kit may also include a polynucleotide to be inserted to effect the desired genetic modification.
[00455] The components of a kit may be in separate containers or combined in a single container.
[00456] Any kit described above may also include one or more additional reagents, where such additional reagents are selected Petition 870200048765, dated 04 / 17 / 2020, pp. 142 / 216 138 / 197 components of a buffer, a buffer for introducing a polypeptide or polynucleotide into a cell, a washing buffer, a control reagent, a control vector, a polynucleotide control RNA, a reagent for in vitro production of the polypeptide from DNA, adapters for sequencing and the like. A buffer may be a stabilizing buffer, a reconstitution buffer, a dilution buffer or the like. A kit may also comprise one or more components that can be used to facilitate or enhance binding to the target or cleavage of DNA by the endonuclease, or to improve targeting specificity.
[00457] In addition to the components mentioned above, a kit may also include instructions for using the kit components to practice the methods. The instructions for practicing the methods may be recorded on a suitable recording medium. For example, the instructions may be printed on a substrate such as paper or plastic, etc. The instructions may be present in the kits as an information leaflet, on the labeling of the kit container or its components (i.e., associated with the packaging or sub-packaging), etc. The instructions may be present as an electronic storage data file present on a suitable computer-readable storage medium, for example, CD-ROM, floppy disk, flash drive, etc. In some cases, the actual instructions are not present in the kit, but means may be provided to obtain the instructions from a remote source (e.g., via the Internet).An example of this is a kit that includes a web address where instructions can be viewed and / or downloaded. As with the instructions themselves, this means that obtaining the instructions can be recorded on a suitable substrate. RNA Formulation Guide.
[00458] The guide RNAs of the present invention can be formulated Petition 870200048765, dated 04 / 17 / 2020, pp. 143 / 216 139 / 197 with pharmaceutically acceptable excipients, such as carriers, solvents, stabilizers, adjuvants, diluents, etc., depending on the particular mode of administration and dosage form. Guide RNA compositions may be formulated to achieve a physiologically compatible pH, and range from a pH of about 3 to a pH of about 11, about pH 3 to about pH 7, depending on the formulation and route of administration. In some cases, the pH may be adjusted to a range of about pH 5.0 to about pH 8. In some cases, the compositions may comprise a therapeutically effective amount of at least one compound as described herein, together with one or more pharmaceutically acceptable excipients.Optionally, the compositions may comprise a combination of the compounds described herein, or may include a second active ingredient useful in treating or preventing bacterial growth (for example, and without limitation, antibacterial or antimicrobial agents), or may include a combination of reagents of the present invention.
[00459] Suitable excipients include, for example, carrier molecules which include large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers and inactivated virus particles. Other exemplary excipients may include antioxidants (for example and without limitation, ascorbic acid), chelating agents (for example and without limitation, EDTA), carbohydrates (for example and without limitation, dextrin, hydroxyalkylcellulose and hydroxyalkylmethylcellulose), stearic acid, liquids (for example and without limitation, oils, water, saline solution, glycerol and ethanol), humectants or emulsifiers, pH buffering substances and the like. Other Possible Therapeutic Approaches Petition 870200048765, dated 04 / 17 / 2020, pp. 144 / 216 140 / 197
[00460] Gene editing can be conducted using nucleases designed to target specific sequences. To date, there are four main types of nucleases: meganucleases and their derivatives, zinc finger nucleases (ZFNs), transcription activators as effector nucleases (TALENs), and CRISPR-Cas9 nuclease systems. Nuclease platforms vary in design difficulty, targeting density, and mode of action, particularly because the specificity of ZFNs and TALENs is through protein-DNA interactions, while RNA-DNA interactions primarily target Cas9. Cas9 cleavage also requires an adjacent motif, the PAM, which differs between different CRISPR systems. Streptococcus pyogenes Cas9 cleaves using an NGG PAM, while Neisseria meningitidis CRISPR can cleave at sites with PAMs including NNNNGATT, NNNNNGTTT, and NNNNGCTT. Several other Cas9 orthologs have directed the protospacer adjacent to alternative PAMs.
[00461] CRISPR endonucleases, such as Cas9, can be used in the methods of the present invention. However, the teachings described herein, such as therapeutic target sites, can be applied to other forms of endonucleases, such as ZFNs, TALENs, HEs or MegaTALs, or by using combinations of nucleases. However, in order to apply the teachings of the present invention to such endonucleases, it would be necessary, among other things, to engineer proteins directed to specific target sites.
[00462] Additional binding domains can be fused to the Cas9 protein to increase specificity. The target sites of these constructs would map to the specified gRNA site, but would require additional binding motifs, such as a zinc finger domain. In the case of Mega-TAL, a meganuclease can be fused to a DNA-binding domain of TALE. The meganuclease domain can increase specificity and provide the Petition 870200048765, dated 04 / 17 / 2020, pp. 145 / 216 141 / 197 cleavage. Similarly, inactivated or dead Cas9 (dCas9) can be fused with a cleavage domain and requires the sgRNA / Cas9 target site and the adjacent binding site for the fused DNA-binding domain. This would likely require some dCas9 protein engineering, in addition to catalytic inactivation, to diminish binding without the additional binding site. Zinc Finger Nucleases
[00463] Zinc finger nucleases (ZFNs) are modular proteins consisting of an engineered zinc finger DNA-binding domain linked to the catalytic domain of the FokI Type II endonuclease. Because FokI functions only as a dimer, a pair of ZFNs must be engineered to bind to cognate target half-site sequences on opposite DNA strands and with precise spacing between them to allow the catalytically active FokI dimer to form. Following dimerization of the FokI domain, which by itself has no sequence specificity per se, a double-strand DNA break is generated between the ZFN half-sites as the initial step in genome editing.
[00464] The DNA-binding domain of each ZFN is typically composed of 3-6 zinc fingers of the abundant Cys2-His2 architecture, with each finger primarily recognizing a triplet of nucleotides in one strand of the target DNA sequence, although cross-strand interaction with a fourth nucleotide may also be important. Altering the amino acids of a finger at positions that make important contacts with DNA alters the sequence specificity of a given finger. Thus, a four-finger zinc finger protein will selectively recognize a 12 bp target sequence, where the target sequence is a composite of the triplet preferences contributed by each finger, although the triplet preference is influenced to varying degrees by neighboring fingers. An important aspect of Petition 870200048765, dated 04 / 17 / 2020, pp. 146 / 216 142 / 197 ZFNs are readily redirected to virtually any genomic address simply by modifying the individual fingers, although considerable expertise is required to do this well. In most ZFN applications, 4-6 finger proteins are used, recognizing 12-18 bp respectively. Thus, a pair of ZFNs will typically recognize a combined target sequence of 24-36 bp, not including the typical 5-7 bp spacer between half-sites. Binding sites can be further separated with larger spacers, including 15-17 bp. A target sequence of this length is likely to be unique in the human genome, assuming that repetitive sequences or gene homologs are excluded during the design process. However, ZFN protein-DNA interactions are not absolute in their specificity, therefore off-target cleavage and binding events occur, either as a heterodimer between the two ZFNs, or as a homodimer of one or the other ZFN.The last possibility was effectively eliminated by engineering the FokI domain dimerization interface to create plus and minus variants, also known as heterodimer-binding variants, which can only dimerize with each other, and not with themselves. Forcing the heterodimer-binding prevents homodimer formation. This greatly improved the specificity of ZFNs, as well as any other nuclease that adopts these FokI variants.
[00465] A variety of ZFN-based systems have been described in the art, their modifications are regularly reported, and numerous references describe rules and parameters that are used to guide the design of ZFNs; see, for example, Segal et al., Proc Natl Acad Sci USA 96(6):2758-63 (1999); Dreier B et al., J Mol Biol. 303(4):489-502 (2000); Liu Q et al., J Biol Chem. 277(6):3850-6 (2002); Dreier et al., J Biol Chem 280(42):35588-97 (2005); and Dreier et al., J Biol Chem. 276(31):29466-78 (2001). Petition 870200048765, dated 04 / 17 / 2020, pp. 147 / 216 143 / 197 Transcription-Activating Effector-Like Nucleases (TALENs)
[00466] TALENs represent another form of modular nucleases whereby, as with ZFNs, an engineered DNA-binding domain is linked to the FokI nuclease domain, and a pair of TALENs operate in tandem to achieve targeted DNA cleavage. The main difference from ZFNs is the nature of the DNA-binding domain and the associated target DNA sequence recognition properties. The TALEN DNA-binding domain is derived from TALE proteins, which were originally described in the plant bacterial pathogen Xanthomonas sp. TALEs are composed of serial arrays of 33-35 amino acid repeats, with each repeat recognizing a single base pair in the target DNA sequence that is typically up to 20 bp in length, giving a total target sequence length of up to 40 bp.The nucleotide specificity of each repeat is determined by the variable repeated diresidue (RVD), which includes only two amino acids at positions 12 and 13. The bases guanine, adenine, cytosine, and thymine are predominantly recognized by the four RVDs: Asn-Asn, Asn-Ile, His-Asp, and Asn-Gly, respectively. This constitutes a much simpler recognition code than for zinc fingers and therefore represents an advantage over the latter for nuclease design. However, as with ZFNs, the protein-DNA interactions of TALENs are not absolute in their specificity, and TALENs have also benefited from the use of heterodimeric variants of the FokI domain to reduce off-target activity.
[00467] Additional variants of the FokI domain have been created that are deactivated in their catalytic function. If one half of a TALEN or ZFN pair contains an inactive FokI domain, then only single-stranded DNA cleavage (cuts) will occur at the target site, instead of a DSB. The result is comparable to the use of mutants. Petition 870200048765, dated 04 / 17 / 2020, pages 148 / 216 144 / 197 nickase CRISPR / Cas9 / Cpf1 in which one of the Cas9 cleavage domains has been disabled. DNA cuts can be used to boost genome editing by HDR, but with less efficiency than with a DSB. The main benefit is that off-target cuts are repaired quickly and accurately, unlike DSB, which is prone to NHEJ-mediated repair failures.
[00468] A variety of TALEN-based systems have been described in the art, and modifications thereof are regularly reported; see, for example, Boch, Science 326(5959):1509-12 (2009); Mak et al., Science 335(6069):716-9 (2012); and Moscow et al., Science 326(5959):1501 (2009). The use of TALENs based on the platform Golden Gate, or cloning scheme, has been described by multiple groups; see, for example, Cermak et al., Nucleic Acids Res. 39(12):e82 (2011); Li et al., Nucleic Acids Res. 39(14):6315-25(2011); Weber et al., PLoS One. 6(2):e16765 (2011); Wang et al., J Genet Genomics 41(6):339-47, Epub 2014 May 17 (2014); and Cermak T et al., Methods Mol Biol. 1239:133-59 (2015). Rebound Endonucleases
[00469] Backhand endonucleases (HEs) are sequence-specific endonucleases that possess long recognition sequences (14-44 base pairs) and cleave DNA with high specificity—often at single sites in the genome. There are at least six known families of HEs classified by their structure, including LAGLIDADG (SEQ ID NO. 71949), GIY-YIG, His-Cis box, HNH, PD-(D / E)xK, and Vsr-like, which are derived from a wide range of hosts, including eukaryotes, protists, bacteria, archaea, cyanobacteria, and phages. As with ZFNs and TALENs, HEs can be used to create a DSB at a target locus as the initial step in genome editing. Furthermore, some natural and engineered HEs cut only a single strand of DNA, fun Petition 870200048765, dated 04 / 17 / 2020, pp. 149 / 216 145 / 197 thus acting as site-specific nickases. The large target sequence of HEs and the specificity they offer made them attractive candidates for creating site-specific DSBs.
[00470] A variety of HE-based systems have been described in the technique, and modifications thereof are regularly reported; see, for example, the reviews by Steentoft et al., Glycobiology 24(8):663-80 (2014); Belfort and Bonocora, Methods Mol Biol. 1123:1-26 (2014); Hafez and Hausner, Genome 55(8):553-69 (2012); and references cited therein. MegaTAL / Tev-mTALEN / MegaTev
[00471] As further examples of hybrid nucleases, the MegaTAL platform and the Tev-mTALEN platform use a fusion of catalytically active TALE DNA binding domains and HEs, taking advantage of both the tunable DNA binding and specificity of TALE, as well as the cleavage sequence specificity of HE; see, for example, Boissel et al., NAR 42: 2591-2601 (2014); Kleinstiver et al., G3 4: 1155-65 (2014); and Boissel and Scharenberg, Mol. Biol. Methods 1239: 171-96 (2015).
[00472] In a further variation, the MegaTev architecture is the fusion of a meganuclease (Mega) with the nuclease domain derived from the GIY-YIG I-TevI directed endonuclease (Tev). The two active sites are positioned ± 30 bp into a DNA substrate and generate two DSBs with non-matching cohesive ends; see, for example, Wolfs et al., NAR 42, 8816-29 (2014). It is anticipated that other combinations of existing nuclease-based approaches will evolve and be useful for achieving the target genome modifications described herein. dCas9-FokI or dCpf1-Fok1 and other nucleases
[00473] The combination of the structural and functional properties of the nuclease platforms described above offers an approach Petition 870200048765, dated 04 / 17 / 2020, pages 150 / 216 146 / 197 additional genome editing that can potentially overcome some of the inherent deficiencies. As an example, the CRISPR genome editing system typically uses a single Cas9 endonuclease to create a DSB. Targeting specificity is driven by a 20 or 24 nucleotide sequence in the guide RNA that undergoes Watson-Crick base pairing with the target DNA (plus 2 additional bases in the adjacent NAG or NGG PAM sequence in the case of S. pyogenes Cas9). This sequence is long enough to be unique in the human genome; however, RNA / DNA interaction specificity is not absolute, with significant promiscuity sometimes tolerated, particularly in the 5' half of the target sequence, effectively reducing the number of bases that drive specificity.One solution to this has been to completely disable the catalytic function of Cas9 or Cpf1 – retaining only the RNA-guided DNA binding function – and instead fusing a FokI domain to the disabled Cas9; see, for example, Tsai et al., Nature Biotech 32: 569-76 (2014); and Guilinger et al., Nature Biotech. 32: 577-82 (2014). Because FokI must dimerize to become catalytically active, two guide RNAs are needed to tie two FokI fusions together in close proximity to form the dimer and cleave the DNA. This essentially doubles the number of bases in the combined target sites, thus increasing the accuracy of targeting by CRISPR-based systems.
[00474] As another example, fusing the TALE DNA-binding domain to a catalytically active HE, such as I-TevI, takes advantage of the binding and tunable DNA specificity of TALE, as well as the cleavage sequence specificity of I-TevI, with the expectation that off-target cleavage can be further reduced. Detection of on-target and off-target mutations by sequencing
[00475] To sequence putative on-target and off-target sites, appropriate amplification primers were identified and the Petition 870200048765, dated 04 / 17 / 2020, pp. 151 / 216 147 / 197 reactions were prepared with these primers using genomic DNA harvested using QuickExtract DNA extraction solution (Epicenter) from treated cells three days after transfection. The amplification primers contain the specific gene portion flanked by adapters. The 5' end of the forward primer includes a modified forward primer binding site (read1). The 5' end of the reverse primer contains a modified reverse primer binding site (read2) and a barcode, in the opposite orientation. Individual PCR reactions were validated by separation on agarose gels, then purified and re-amplified. The forward primers of the second round contain the Illumina P5 sequence, followed by a portion of the modified forward primer binding site (read1).The reverse primers from the second round contain the Illumina P7 sequence (at the 5' end), followed by the 6-base barcode and the modified barcode and reverse primer binding site (read2). The second-round amplifications were also verified on agarose gels, then purified and quantified using a NanoDrop spectrophotometer. The amplification products were pooled to match concentration and then submitted to the Emory Integrated Genomic core for library preparation and sequencing on an Illumina Miseq machine.
[00476] The sequencing reads were barcoded and then aligned to bioinformatics-provided reference sequences for each product. Insertion and deletion rates in the aligned sequencing reads were detected in the region of the putative cleavage sites using the software described previously; see, for example, Lin et al., Nucleic Acids Res., 42: 74737485 (2014). The levels of insertions and deletions detected in this window were then compared to the level seen at the same location in the DNA. Petition 870200048765, dated 04 / 17 / 2020, pages 152 / 216 148 / 197 genomic isolated from cells transfected by simulation to minimize the effects of sequencing artifacts. Mutation Detection Assays
[00477] The on- and off-target cleavage activities of Cas9 and guide RNA combinations were measured using the mutation rates resulting from imperfect double-strand break repair by NHEJ.
[00478] Target loci were amplified using AccuPrime Taq DNA Polymerase High Fidelity (Life Technologies, Carlsbad, CA) following the manufacturer's instructions for 40 cycles (94°C, 30 s; 5260°C, 30 s; 68°C, 60 s) in 50 µl reactions containing 1 µl of cell lysate and 1 µl of each 10 μM amplification primer. T7EI mutation detection assays were performed according to the manufacturers' protocol [Reyon et al., Nat. Biotechnol., 30: 460-465 (2012)], with digestions separated on 2% agarose gel and quantified using ImageJ [Guschin et al., Methods Mol. Biol., 649: 247-256 (2010)]. The assays determine the percentage of insertions / deletions (indels) in the bulk cell population. Methods and Compositions of the Invention
[00479] Consequently, the present invention relates in particular to the following non-limiting inventions: In a first method, Method 1, the present invention provides a method for editing a BCL11A gene in a human cell by genome editing, the method comprising the step of introducing into the human cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs), within or near the BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene, which results in a permanent deletion, modulation or inactivation of a transcriptional control sequence of the BCL11A gene.
[00480] In another method, Method 2, the present invention pro Petition 870200048765, dated 04 / 17 / 2020, pages 153 / 216 149 / 197 provides a method for editing a BCL11A gene in a human cell by genome editing, as provided in Method 1, wherein the transcriptional control sequence is located within a second intron of the BCL11A gene.
[00481] In another method, Method 3, the present invention provides a method for editing a BCL11A gene in a human cell by genome editing, as provided in Methods 1 or 2, wherein the transcriptional control sequence is located within a DNA hypersensitivity (DHS) +58 site of the BCL11A gene.
[00482] In another method, Method 4, the present invention provides an ex vivo method for treating a patient with a hemoglobinopathy, the method comprising the steps of: creating a patient-specific induced pluripotent stem cell (iPSC); editing within or near a BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene of the iPSC; differentiating the genome-edited iPSC into a hematopoietic progenitor cell; and implanting the hematopoietic progenitor cell into the patient.
[00483] In another method, Method 5, the present invention provides an ex vivo method for treating a patient with a hemoglobinopathy, as provided in Method 4, wherein the creation step comprises: isolating a somatic cell from the patient; and introducing a set of genes associated with pluripotency into the somatic cell to induce the somatic cell to become a pluripotent stem cell.
[00484] In another method, Method 6, the present invention provides an ex vivo method for treating a patient with a hemoglobinopathy, as provided in Method 5, wherein the somatic cell is a fibroblast.
[00485] In another method, Method 7, the present invention provides an ex vivo method for treating a patient with a hemorrhage. Petition 870200048765, dated 04 / 17 / 2020, pp. 154 / 216 150 / 197 globinopathy, as provided in Methods 5 or 6, where the set of genes associated with pluripotency is one or more of the selected genes from the group consisting of OCT4, SOX2, KLF4, Lin28, NANOG, and cMYC.
[00486] In another method, Method 8, the present invention provides an ex vivo method for treating a patient with hemoglobinopathy, as provided in any of Methods 4-7, wherein the editing step comprises introducing into the iPSC one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs), within or near the BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene, which results in a permanent deletion, modulation, or inactivation of a transcriptional control sequence of the BCL11A gene.
[00487] In another method, Method 9, the present invention provides an ex vivo method for treating a patient with hemoglobinopathy, as provided in any of Methods 4-8, wherein the differentiation step comprises one or more of the following to differentiate the genome-edited iPSC into a hematopoietic progenitor cell: treatment with a combination of small molecules, delivery of major transcription factors, delivery of mRNA encoding major transcription factors, or delivery of mRNA encoding transcription factors.
[00488] In another method, Method 10, the present invention provides an ex vivo method for treating a patient with hemoglobinopathy, as provided in any of Methods 4-9, wherein the implantation step comprises implanting the hematopoietic progenitor cell into the patient by transplantation, local injection, systemic infusion, or combinations thereof.
[00489] In another method, Method 11, the present invention Petition 870200048765, dated 04 / 17 / 2020, pages 155 / 216 Patent 151 / 197 provides an ex vivo method for treating a patient with a hemoglobinopathy, the method comprising the steps of: isolating a mesenchymal stem cell from the patient; editing within or near a BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene of the mesenchymal stem cell; differentiating the genome-edited mesenchymal stem cell into a hematopoietic progenitor cell; and implanting the hematopoietic progenitor cell into the patient.
[00490] In another method, Method 12, the present invention provides an ex vivo method for treating a patient with hemoglobinopathy, as provided in Method 11, wherein the mesenchymal stem cell is isolated from the patient's bone marrow or peripheral blood.
[00491] In another method, Method 13, the present invention provides an ex vivo method for treating a patient with hemoglobinopathy, as provided in Methods 11 or 12, wherein the isolation step comprises: bone marrow aspiration and isolation of mesenchymal cells using density gradient centrifugation media.
[00492] In another method, Method 14, the present invention provides an ex vivo method for treating a patient with hemoglobinopathy, as set forth in any of Methods 11-13, wherein the editing step comprises introducing into the mesenchymal stem cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs), within or near the BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene, which results in a permanent deletion, modulation or inactivation of a transcriptional control sequence of the BCL11A gene. Petition 870200048765, dated 04 / 17 / 2020, pages 156 / 216 152 / 197
[00493] In another method, Method 15, the present invention provides an ex vivo method for treating a patient with hemoglobinopathy, as provided in any of Methods 11-14, wherein the differentiation step comprises one or more of the following to differentiate the genome-edited mesenchymal stem cell into a hematopoietic progenitor cell: treatment with a combination of small molecules, delivery of major transcription factors, delivery of mRNA encoding major transcription factors, or delivery of mRNA encoding transcription factors.
[00494] In another method, Method 16, the present invention provides an ex vivo method for treating a patient with hemoglobinopathy, as provided in any of Methods 11-15, wherein the implantation step comprises implanting the hematopoietic progenitor cell into the patient by transplantation, local injection, systemic infusion, or combinations thereof.
[00495] In another method, Method 17, the present invention provides an ex vivo method for treating a patient with a hemoglobinopathy, the method comprising the steps of: isolating a hematopoietic progenitor stem cell; editing within or near a BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene of the hematopoietic progenitor cell; and implanting the genome-edited hematopoietic progenitor cell into the patient.
[00496] In another method, Method 18, the present invention provides an ex vivo method for treating a patient with a hemoglobinopathy as provided in Method 17, wherein the method further comprises treating the patient with granulocyte colony-stimulating factor (GCSF) prior to the isolation step.
[00497] In another method, Method 19, the present invention provides an ex vivo method for treating a patient with a hemorrhage. Petition 870200048765, dated 04 / 17 / 2020, pages 157 / 216 153 / 197 globinopathy as provided in Method 18, where the treatment step is performed in combination with Plerixaflor.
[00498] In another method, Method 20, the present invention provides an ex vivo method for treating a patient with a hemoglobinopathy as provided in any of Methods 17-19, wherein the isolation step comprises the isolation of CD34+ cells.
[00499] In another method, Method 21, the present invention provides an ex vivo method for treating a patient with hemoglobinopathy, as set forth in any of Methods 17-20, wherein the editing step comprises introducing into the hematopoietic progenitor cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs), within or near the BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene, which results in a permanent deletion, modulation or inactivation of a transcriptional control sequence of the BCL11A gene.
[00500] In another method, Method 22, the present invention provides an ex vivo method for treating a patient with hemoglobinopathy, as provided in any of Methods 17-21, wherein the implantation step comprises implanting the genome-edited hematopoietic progenitor cell into the patient by transplantation, local injection, systemic infusion, or combinations thereof.
[00501] In another method, Method 23, the present invention provides an in vivo method for treating a patient with a hemoglobinopathy, the method comprising the step of editing a BCL11A gene in a patient cell.
[00502] In another method, Method 24, the present invention provides a vivo method for treating a patient with hemoglobin. Petition 870200048765, dated 04 / 17 / 2020, pages 158 / 216 154 / 197 pathy, as provided in Method 23, wherein the editing step comprises introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs), within or near the BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene, resulting in a permanent elimination, modulation, or inactivation of a transcriptional control of the BCL11A gene.
[00503] In another method, Method 25, the present invention provides an in vivo method for treating a patient with a hemoglobinopathy as provided in Methods 23 or 24, wherein the cell is a bone marrow cell, a hematopoietic progenitor cell, or a CD34+ cell.
[00504] In another method, Method 26, the present invention provides a method according to any of Methods 1, 8, 14, 21 and 24, wherein one or more DNA endonucleases is a Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, or Cpf1 endonuclease; a homolog thereof, a recombination of the naturally occurring molecule thereof, a codon-optimized version thereof, or modified versions thereof, and combinations thereof.
[00505] In another method, Method 27, the present invention provides a method such as that provided in Method 26, wherein the method comprises introducing into the cell one or more polynucleotides encoding one or more DNA endonucleases.
[00506] In another method, Method 28, the present invention pro Petition 870200048765, dated 04 / 17 / 2020, pp. 159 / 216 155 / 197 provides a method such as is provided in Methods 26 or 27, wherein the method comprises introducing into the cell one or more ribonucleic acids (RNAs) encoding one or more DNA endonucleases.
[00507] In another method, Method 29, the present invention provides a method as provided in Methods 27 or 28, wherein one or more polynucleotides or one or more RNAs are one or more modified polynucleotides or one or more modified RNAs.
[00508] In another method, Method 30, the present invention provides a method as provided in Method 26, wherein one or more DNA endonucleases is one or more proteins or polypeptides.
[00509] In another method, Method 31, the present invention provides a method as provided in Method 30, wherein one or more proteins or polypeptides are flanked at the N-terminal, C-terminal, or both the N-terminal and C-terminal by one or more nuclear localization signals (NLSs).
[00510] In another method, Method 32, the present invention provides a method as provided in Method 31, wherein one or more proteins or polypeptides are flanked by two NLSs, one NLS located at the N-terminus and the second NLS located at the C-terminus.
[00511] In another method, Method 33, the present invention provides a method as provided in any of Methods 31-32, wherein one or more NLSs is an SV40 NLS.
[00512] In another method, Method 34, the present invention provides a method as provided in any of Methods 1-33, wherein the method further comprises introducing into the cell one or more guide ribonucleic acids (gRNAs).
[00513] In another method, Method 35, the present invention provides a method as provided in Method 34, wherein a Petition 870200048765, dated 04 / 17 / 2020, pages 160 / 216 156 / 197 or more gRNAs are single-molecule guide RNAs (sgRNAs).
[00514] In another method, Method 36, the present invention provides a method as provided in Methods 34 or 35, wherein one or more gRNAs or one or more sgRNAs are one or more modified gRNAs or one or more modified sgRNAs.
[00515] In another method, Method 37, the present invention provides a method as provided in Method 36, wherein one or more modified sgRNAs comprise three 2'-O-methylphosphorothioate residues at or near each of their 5' and 3' ends.
[00516] In another method, Method 38, the present invention provides a method as provided in Method 37, wherein the modified sgRNA is the nucleic acid sequence of SEQ ID No: 71,959.
[00517] In another method, Method 39, the present invention provides a method as provided in Methods 34-38, wherein one or more DNA endonucleases is pre-complexed with one or more gRNAs or one or more gRNAs to form one or more ribonucleoproteins (RNPs).
[00518] In another method, Method 40, the present invention provides a method as provided in Method 39, wherein the weight ratio of sgRNA to DNA endonuclease in RNP is 1:1.
[00519] In another method, Method 41, the present invention provides a method as provided in Method 40, wherein the sgRNA comprises the nucleic acid sequence of SEQ ID NO: 71959, the DNA endonuclease is an S. pyogenes Cas9 comprising an N-terminal SV40 NLS and a C-terminal SV40 NLS, wherein the weight ratio of sgRNA to DNA endonuclease is 1:1.
[00520] In another method, Method 42, the present invention provides a method as provided in any of Methods 1-41, wherein the method further comprises introducing into Petition 870200048765, dated 04 / 17 / 2020, pages 161 / 216 157 / 197 cell a polynucleotide donor template comprising a wild-type BCL11A gene or cDNA comprising a modified transcriptional control sequence.
[00521] In another method, Method 43, the present invention provides a method as provided in any of Methods 1, 8, 14, 21 or 24, wherein the method further comprises introducing into the cell a guide ribonucleic acid (gRNA) and a polynucleotide donor template comprising a wild-type BCL11A gene or cDNA comprising a modified transcriptional control sequence, and wherein one or more DNA endonucleases are one or more Cas9 or Cpf1 endonucleases that effect a single-strand break (SSB) or a double-strand break (DSB) at a locus within or near the BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene that facilitates the insertion of a new polynucleotide donor template sequence into the chromosomal DNA at the locus resulting in permanent insertion, modulation or inactivation of the DNA transcriptional control sequence. chromosomal proximal to the locus,and where the gRNA comprises a spacer sequence that is complementary to a segment of the locus.
[00522] In another method, Method 44, the present invention provides a method as provided in Method 43, wherein proximal means nucleotides both upstream and downstream of the locus.
[00523] In another method, method 45, the present invention provides a method, as provided in any of methods 1, 8, 14, 21 or 24, wherein the method further comprises introducing into the cell one or more guide ribonucleic acids (gRNAs) and a polynucleotide donor template comprising a wild-type BCL11A gene or cDNA comprising a sequence Petition 870200048765, dated 04 / 17 / 2020, pages 162 / 216 158 / 197 of modified transcriptional control, one or more DNA endonucleases is one or more Cas9 or Cpf1 endonucleases that effect or create a pair of single-strand breaks (SSBs) or double-strand breaks (DSBs), the first break at a 5' locus and the second break at a 3' locus, within or near the BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene that facilitates the insertion of a new polynucleotide donor template sequence into chromosomal DNA between the 5' and 3' locus resulting in a permanent insertion, modulation, or inactivation of the transcriptional control sequence of chromosomal DNA between the 5' and 3' locus.
[00524] In another method, Method 46, the present invention provides a method as provided in Method 45, wherein a gRNA creates a pair of SSBs or DSBs.
[00525] In another method, Method 47, the present invention provides a method as provided in Method 45, wherein a gRNA comprises a spacer sequence that is complementary to the 5' locus or the 3' locus.
[00526] In another method, Method 48, the present invention provides a method as provided in Method 45, wherein the method comprises a first guide RNA and a second guide RNA, wherein the first guide RNA comprises a spacer sequence that is complementary to a segment of the 5' locus and the second guide RNA comprises a spacer sequence that is complementary to a segment of the 3' locus.
[00527] In another method, Method 49, the present invention provides a method as provided in either of Methods 43-48, wherein the one or two gRNAs are one or two single-molecule guide RNAs (sgRNAs).
[00528] In another method, Method 50, the present invention pro Petition 870200048765, dated 04 / 17 / 2020, pp. 163 / 216 159 / 197 provides a method as provided in any of Methods 43-49, wherein the one or two gRNAs or one or two sgRNAs are one or two modified gRNAs or one or two modified sgRNAs.
[00529] In another method, Method 51, the present invention provides a method as provided in Method 50, wherein the modified sgRNA comprises three 2'-O-methyl-phosphorothioate residues at or near each of its 5' and 3' ends.
[00530] In another method, Method 52, the present invention provides a method as provided in Method 51, wherein the modified sgRNA is the nucleic acid sequence of SEQ ID No: 71,959.
[00531] In another method, Method 39, the present invention provides a method as provided in any of Methods 43-52, wherein one or more Cas9 endonucleases is precomplexed with one or two gRNAs or one or two gRNAs to form one or more ribonucleoproteins (RNPs).
[00532] In another method, Method 54, the present invention provides a method as provided in Method 53, wherein one or more Cas9 endonucleases are flanked at the N-terminal, C-terminal, or both the N-terminal and C-terminal by one or more nuclear localization signals (NLSs).
[00533] In another method, Method 55, the present invention provides a method as provided in Method 54, wherein one or more Cas9 endonucleases are flanked by two NLSs, one NLS located at the N-terminus and the second NLS located at the C-terminus.
[00534] In another method, Method 56, the present invention provides a method as provided in any of Methods 54-55, wherein one or more NLSs is an SV40 NLS. Petition 870200048765, dated 04 / 17 / 2020, pages 164 / 216 160 / 197
[00535] In another method, Method 57, the present invention provides a method as provided in Method 53, wherein the weight ratio of sgRNA to Cas9 endonuclease in RNP is 1:1.
[00536] In another method, Method 58, the present invention provides a method as provided in Method 53, wherein the sgRNA comprises the nucleic acid sequence SEQ ID NO: 71959, the Cas9 endonuclease is a Cas9 S. pyogenes comprising an N-terminal SV40 NLS and a C-terminal SV40 NLS, wherein the weight ratio of sgRNA to Cas9 endonuclease is 1:1.
[00537] In another method, Method 59, the present invention provides a method as provided in any of Methods 43-58, wherein the donor model is single or double tape.
[00538] In another method, Method 60, the present invention provides a method as provided in any of Methods 42-59, wherein the modified transcriptional control sequence is located within a second intron of the BCL11A gene.
[00539] In another method, Method 61, as provided in any of Methods 42-59, the transcriptional control sequence is located within a DNA hypersensitivity site +58 (DHS) of the BCL11A gene.
[00540] In another method, Method 60, the present invention provides a method as provided in any of Methods 42-59, wherein the insertion is by homology-directed repair (HDR).
[00541] In another method, Method 63, the present invention provides a method as provided in any of Methods 8, 14, 21, 24, 43 and 45, wherein the SSB, DSB or locus 5' and locus 3' are located within a second intron of the BCL11A gene.
[00542] In another method, Method 64, the present invention provides a method as provided in any of the Methods Petition 870200048765, dated 04 / 17 / 2020, pp. 165 / 216 161 / 197 of 8, 14, 21, 24, 43 and 45, where SSB, DSB or 5' DSB and 3' DSB are located within a DNA hypersensitivity +58 (DHS) site of the BCL11A gene.
[00543] In another method, Method 65, the present invention provides a method as provided in any of Methods 1, 8, 14, 21 or 24, wherein the method further comprises introducing into the cell one or more guide ribonucleic acids (gRNAs), and wherein one or more DNA endonucleases is one or more Cas9 or Cpf1 endonucleases that effect or create a pair of single-strand breaks (SSBs) or double-strand breaks (DSBs), a first SSB or DSB at a 5' locus and a second SSB or DSB at a 3' locus, within or near the BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene that causes a deletion of chromosomal DNA between the 5' and 3' locus resulting in a permanent deletion, modulation or inactivation of the transcriptional control sequence of the chromosomal DNA between the locus 5' and locus 3'.
[00544] In another method, Method 66, the present invention provides a method as provided in Method 65, wherein a gRNA creates a pair of SSBs or DSBs.
[00545] In another method, Method 67, the present invention provides a method as provided in Method 65, wherein a gRNA comprises a spacer sequence that is complementary to the 5' locus or the 3' locus.
[00546] In another method, Method 68, the present invention provides a method as provided in Method 65, wherein the method comprises a first guide RNA and a second guide RNA, wherein the first guide RNA comprises a spacer sequence that is complementary to a segment of the 5' locus and the second guide RNA comprises a spacer sequence that is complementary to Petition 870200048765, dated 04 / 17 / 2020, pages 166 / 216 162 / 197 a segment of locus 3'.
[00547] In another method, Method 69, the present invention provides a method as provided in Methods 65-68, wherein the one or two gRNAs are one or more single-molecule guide RNAs (sgRNAs).
[00548] In another method, Method 70, the present invention provides a method as provided in Methods 65-69, wherein one or more gRNAs or one or more sgRNAs are one or more modified gRNAs or one or more modified sgRNAs.
[00549] In another method, Method 71, the present invention provides a method as provided in Method 70, wherein the modified sgRNA comprises three 2'-O-methyl-phosphorothioate residues at or near each of its 5' and 3' ends.
[00550] In another method, Method 72, the present invention provides a method as provided in Method 71, wherein the modified sgRNA is the nucleic acid sequence of SEQ ID No: 71,959.
[00551] In another method, Method 73, the present invention provides a method as provided in any of Methods 65-72, wherein one or more Cas9 endonucleases is pre-complexed with one or more gRNAs or one or more gRNAs to form one or more ribonucleoproteins (RNPs).
[00552] In another method, Method 74, the present invention provides a method as provided in Method 73, wherein one or more Cas9 endonucleases are flanked at the N-terminal, C-terminal, or both the N-terminal and C-terminal by one or more nuclear localization signals (NLSs).
[00553] In another method, Method 75, the present invention provides a method as provided in Method 74, wherein one or more Cas9 endonucleases are flanked by two NLSs, one Petition 870200048765, dated 04 / 17 / 2020, pages 167 / 216 163 / 197 The first NLS is located in the N-terminal and the second NLS is located in the C-terminal.
[00554] In another method, Method 76, the present invention provides a method as provided in any of Methods 74-75, wherein one or more NLSs is an SV40 NLS.
[00555] In another method, Method 77, the present invention provides a method as provided in Method 73, wherein the weight ratio of sgRNA to Cas9 endonuclease in RNP is 1:1.
[00556] In another method, Method 78, the present invention provides a method as provided in Method 73, wherein the sgRNA comprises the nucleic acid sequence SEQ ID NO: 71959, the Cas9 endonuclease is a Cas9 S. pyogenes comprising an N-terminal SV40 NLS and a C-terminal SV40 NLS, wherein the weight ratio of sgRNA to Cas9 endonuclease is 1:1.
[00557] In another method, Method 79, the present invention provides a method as provided in either of Methods 65-78, wherein both the 5' locus and the 3' locus are located within a second intron of the BCL11A gene.
[00558] In another method, Method 80, the present invention provides a method as provided in either of Methods 65-78, wherein both the 5' locus and the 3' locus are located within a DNA hypersensitivity site +58 (DHS) of the BCL11A gene.
[00559] In another method, Method 81, the present invention provides a method as provided in any of Methods 1, 8, 14, 21 or 24-80 wherein mRNA, gRNA and Cas9 or Cpf1 donor template are formulated into separate lipid nanoparticles or all co-formulated into a lipid nanoparticle.
[00560] In another method, Method 82, the present invention provides a method as provided in any of the Methods Petition 870200048765, dated 04 / 17 / 2020, pp. 168 / 216 164 / 197 of 1, 8, 14, 21 or 24-80, in which Cas9 or Cpf1 mRNA is formulated into a lipid nanoparticle, and both the gRNA and the donor template are delivered to the cell by an adeno-associated virus (AAV) vector.
[00561] In another method, Method 83, the present invention provides a method as provided in any of Methods 1, 8, 14, 21 or 24-80, wherein Cas9 or Cpf1 mRNA is formulated into a lipid nanoparticle, and both the gRNA and the donor template are delivered to the cell by an adeno-associated virus (AAV) vector.
[00562] In another method, Method 84, the present invention provides a method as provided in any of Methods 1, 8, 14, 21 or 24-80, wherein one or more RNPs are distributed to the cell by electroporation.
[00563] In another method, Method 85, the present invention provides a method as provided in any of Methods 1-84, wherein the BCL11A gene is located on Chromosome 2: 60, 451, 167 - 60 553 577 (Genome Reference Consortium - GRCh38).
[00564] In another method, Method 86, the present invention provides a method as provided in any of Methods 1-85, wherein the hemoglobinopathy is selected from a group consisting of sickle cell anemia and thalassemia (α, β, δ, γ, and combinations thereof).
[00565] In another method, Method 87, the present invention provides a method as provided in any of Methods 1-86, wherein editing within or near a BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene can reduce the expression of the BCL11A gene.
[00566] In a first composition, Composition 1, the present invention provides one or more guide ribonucleic acids (gRNAs) Petition 870200048765, dated 04 / 17 / 2020, pages 169 / 216 165 / 197 to edit a BCL11A gene in a cell from a patient with a hemoglobinopathy, or one or more gRNAs, characterized in that it comprises a spacer sequence selected from the group consisting of nucleic acid sequences in SEQ ID NOs: 1 71,947 from the Sequence Listing.
[00567] In another composition, Composition 2, the present invention provides one or more gRNAs from Composition 1, wherein the one or more gRNAs are one or more single-molecule guide RNAs (sgRNAs).
[00568] In another composition, Composition 3, the present invention provides one or more gRNAs from Compositions 1 or 2, wherein the one or more gRNAs or one or more sgRNAs is one or more modified gRNAs or one or more modified sgRNAs.
[00569] In another composition, Composition 4, the present invention provides one or more sgRNAs of Composition 3, wherein the one or more modified sgRNAs comprise three 2'O-methyl-phosphorothioate residues at or near each of their 5' and 3' ends.
[00570] In another composition, Composition 5, the present invention provides one or more sgRNAs from Composition 3, wherein the one or more modified sgRNAs comprise the nucleic acid sequence of SEQ ID NO: 71959.
[00571] In another composition, Composition 6, the present invention provides a single-molecule guide RNA (sgRNA) comprising the nucleic acid sequence SEQ ID NO: 71959. Definitions
[00572] The term comprising or includes is used in reference to compositions, methods, and respective component(s), which are essential to the invention, but open to the inclusion of unspecified elements, whether essential or not. Petition 870200048765, dated 04 / 17 / 2020, pp. 170 / 216 166 / 197
[00573] The term consisting essentially of refers to the elements required for a given aspect. The term allows for the presence of additional elements that do not materially affect the basic and novel or functional characteristics of the invention's appearance.
[00574] The term consisting of refers to compositions, methods, and their respective components, as described herein, which are exclusive of any element not recited in that description of the aspect.
[00575] The singular forms um, uma and a / o include plural references, unless the context clearly dictates otherwise.
[00576] Any numerical range described in this descriptive report describes all subranges of the same numerical precision (i.e., having the same specified number of digits) included within the specified range. For example, a recited range of 1.0 to 10.0 describes all subranges between (and including) the minimum recited value of 1.0 and the maximum recited value of 10.0, such as, for example, 2.4 to 7.6, even if the range of 2.4 to 7.6 is not expressly recited in the text of the descriptive report. Consequently, the Applicant reserves the right to amend this descriptive report, including the claims, to cite any subrange of the same numerical precision included within the ranges expressly cited in this descriptive report.All such ranges are inherently described in this descriptive report, such that amendment to expressly recite such subranges shall comply with the written description, sufficiency of description, and additional matter requirements, including the requirements under 35 USC § 112(a) and Article 123(2) EPC. Furthermore, unless expressly specified or required by the context, all numerical parameters described in this descriptive report (such as those expressing values, ranges, quantities, percentages, and the like) may be read as if preceded by the word about, even if the word about. Petition 870200048765, dated 04 / 17 / 2020, pp. 171 / 216 167 / 197 ca does not appear explicitly before a number. Additionally, the numerical parameters described in this descriptive report should be constructed in light of the reported number of significant digits, numerical precision, and applying common rounding techniques. It is also understood that the numerical parameters described in this descriptive report will necessarily have the inherent characteristic of variability of the underlying measurement techniques used to determine the numerical value of the parameter. Examples
[00577] The invention will be more fully understood by reference to the following examples, which provide non-limiting illustrative aspects of the invention.
[00578] The examples describe the use of the CRISPR system as an illustrative genome editing technique to create defined genomic deletions, insertions, or substitutions, herein referred to as genomic modifications, within or near the BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene that leads to a permanent deletion, modulation, or inactivation of a transcriptional control sequence of the BCL11A gene. The introduction of defined therapeutic modifications represents a novel therapeutic strategy for the potential improvement of a hemoglobinopathy, as described and illustrated herein. Example 1 - CRISPR / SpCas9 target sites for the transcriptional control sequence of the BCL11A gene
[00579] Regions of the 12.4 kb transcriptional control sequence of the BCL11A gene were screened for target sites. Each area was screened for an adjacent protospacer motif (PAM) with the NRG sequence. 20 bp gRNA spacer sequences corresponding to the PAM were identified, as shown in SEQ ID NOs: 1 29, 482 of the Sequence Listing. Petition 870200048765, dated 04 / 17 / 2020, pp. 172 / 216 168 / 197 Example 2 - CRISPR / SaCas9 target sites for the transcriptional control sequence of the BCL11A gene.
[00580] Regions of the 12.4 kb transcriptional control sequence of the BCL11A gene were screened for target sites. Each area was screened for an adjacent protospacer motif (PAM) with the sequence NNGRRT. 20 bp gRNA spacer sequences corresponding to the PAM were identified, as shown in SEQ ID NOs: 29,483 - 32,387 of the Sequence Listing. Example 3 - CRISPR / StCas9 target sites for the transcriptional control sequence of the BCL11A gene
[00581] Regions of the 12.4 kb transcriptional control sequence of the BCL11A gene were screened for target sites. Each area was screened for an adjacent protospacer motif (PAM) with the sequence NNAGAAW. 20 bp gRNA spacer sequences corresponding to the PAM were identified, as shown in SEQ ID NOs: 32,388 - 33,420 of the Sequence Listing. Example 4 - CRISPR / TdCas9 target sites for the transcriptional control sequence of the BCL11A gene
[00582] Regions of the 12.4 kb transcriptional control sequence of the BCL11A gene were screened for target sites. Each area was screened for an adjacent protospacer motif (PAM) with the sequence NAAAAC. 20 bp gRNA spacer sequences were identified corresponding to the PAM, as shown in SEQ ID NOs: 33,421 - 33,851 of the Sequence Listing. Example 5 - CRISPR / NmCas9 target sites for the transcriptional control sequence of the BCL11A gene
[00583] Regions of the 12.4 kb transcriptional control sequence of the BCL11A gene were screened for target sites. Each area was screened for an adjacent protospacer motif (PAM) with the sequence NNNNGHTT. Spacer sequences were identified Petition 870200048765, dated 04 / 17 / 2020, pp. 173 / 216 169 / 197 gRNA of 20 bp corresponding to PAM, as shown in SEQ ID NOs: 33,852 - 36,731 of the Sequence Listing. Example 6 - CRISPR / Cpf1 target sites for the transcriptional control sequence of the BCL11A gene
[00584] Regions of the 12.4 kb transcriptional control sequence of the BCL11A gene were screened for target sites. Each area was screened for an adjacent protospacer motif (PAM) with the sequence YTN. 22 bp gRNA spacer sequences corresponding to the PAM were identified, as shown in SEQ ID NOs: 36,732 - 71,947 of the Sequence Listing. Example 7 - Bioinformatics analysis of guide tapes
[00585] Candidate guides will be screened and selected in a multi-step process involving both theoretical binding and experimentally assessed activity. By way of illustration, candidate guides with sequences that correspond to a specific target site, such as a site within the transcriptional control sequence of the BCL11A gene, with adjacent PAM, can be evaluated for their cleavage potential at off-target sites with similar sequences, using one or more of a variety of bioinformatics tools available to assess off-target binding, as described and illustrated in more detail below, in order to assess the likelihood of effects at chromosomal positions other than those intended. Candidates with relatively low potential for off-target activity can be experimentally evaluated to measure their on-target activity and then divert activity at various locations.Preferred guides have high enough activity at the target to achieve desired levels of gene editing at the selected locus, and relatively lower off-target activity to reduce the likelihood of changes at other chromosomal loci. The ratio of on-target to off-target activity is generally called es. Petition 870200048765, date...
Claims
1. Single-molecule guide RNA (sgRNA), characterized in that it comprises the nucleic acid sequence SEQ ID NO: 71959, wherein the sgRNA comprises three 2'-O-methylphosphorothioate residues at each of its 5' and 3' ends.
2. Single-molecule guide RNA (sgRNA) according to claim 1, characterized in that it comprises the nucleic acid sequence SEQ ID NO: 71959, wherein bases 1-3 and 97-99 are modified 2'-O-methylphosphorothioate nucleotides.
3. Single-molecule guide RNA (sgRNA) according to claim 1 or 2, characterized in that it consists of the nucleic acid sequence with SEQ ID NO: 71959.
4. Single-molecule guide RNA (sgRNA) according to claim 1 or 2, characterized in that it is for use in the treatment of a patient with hemoglobinopathy.
5. Single-molecule guide RNA (sgRNA) according to claim 4, characterized in that the hemoglobinopathy is sickle cell anemia or thalassemia.
6. Single-molecule guide RNA (sgRNA) according to claim 5, characterized in that the hemoglobinopathy is a thalassemia and the thalassemia is selected from the group consisting of α, β, δ, γ, and combinations thereof, optionally further wherein the thalassemia is β-thalassemia.
7. Ex vivo method of editing a B-cell lymphoma 11A (BCL11A) gene in a human cell by genome editing, the method characterized in that it comprises the step of: introducing into the human cell one or more deoxyribonucleic acid (DNA) endonucleases or a nucleic acid comprising a nucleotide sequence encoding one or more DNA endonucleases or a vector comprising said nucleic acid to effect Petition 870260045281, dated 05 / 13 / 2026, p. 6 / 18 2 / 3 one or more single-strand breaks (SSBs) or double-strand breaks (DSBs), within or near the BCL11A gene or other DNA sequence encoding a regulatory element of the BCL11A gene, resulting in a permanent deletion, modulation, or inactivation of a transcriptional control sequence of the BCL11A gene, wherein the method further comprises introducing into the cell a single-molecule guide ribonucleic acid (sgRNA) comprising the nucleic acid sequence SEQ ID NO: 71.959, wherein the sgRNA comprises three 2'O-methyl-phosphorothioate residues at each of its 5' and 3' ends, a nucleic acid comprising a nucleotide sequence encoding the nucleic acid sequence of said sgRNA, or a vector comprising said nucleic acid, and wherein one or more DNA endonucleases comprise a Cas9 endonuclease.
8. A method according to claim 7, characterized in that the nucleic acid comprises a nucleotide sequence encoding one or more DNA endonucleases and one or more ribonucleic acids (RNAs).
9. A method according to claim 7 or 8, characterized in that one or more DNA endonucleases each comprise, at the N-terminus, at the C-terminus, or at both the N-terminus and C-terminus, one or more nuclear localization signals (NLSs).
10. Method according to claim 7 or 9, characterized in that one or more DNA endonucleases are pre-complexed with gRNA to form one or more ribonucleoproteins (RNPs).
11. Method, according to claim 10, characterized in that one or more RNPs are delivered to the human cell by means of electroporation, wherein one or more DNA endonucleases is a Cas9 of S. pyogenes, wherein the Cas9 of S. pyogenes Petition 870260045281, dated 05 / 13 / 2026, page 7 / 18 3 / 3 comprises an N-terminal NLS of SV40 and a C-terminal NLS of SV40.
12. Method, according to any one of claims 7 to 11, characterized in that the human cell is a hematopoietic progenitor cell, optionally in that the hematopoietic progenitor cell is a CD34+ cell.
13. Method according to claim 9, characterized in that one or more NLSs comprise an SV40 NLS.
14. Method according to claim 10, characterized in that the weight ratio of gRNA to DNA endonuclease in RNPs is 1:1