Application of the taste receptor protein OfGr64 and its products in regulating feeding and growth of the Asian corn borer
By regulating the expression of the taste receptor protein OfGr64a in Asian corn borer and using gene knockout or silencing technology, the environmental pollution and drug resistance problems caused by chemical control have been solved, achieving non-chemical control of Asian corn borer and reducing its food consumption and growth.
Patent Information
- Application Number
- CN202110895269.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-08-05
- Publication Date
- 2026-06-30
- Estimated Expiration
- 2041-08-05
AI Technical Summary
Current technologies for controlling the Asian corn borer mainly rely on chemical methods, which leads to environmental pollution and increased pesticide resistance in pests, and there is a lack of effective non-chemical control strategies.
By utilizing the taste receptor protein OfGr64a and its regulatory substances from the Asian corn borer, gene knockout or silencing techniques were used to reduce the expression level of the OfGr64a encoding gene, thereby regulating the Asian corn borer's food intake, sucrose sensitivity, and growth.
It effectively reduces the Asian corn borer's consumption and sensitivity to sucrose, inhibiting its growth and providing an environmentally friendly control method.
Smart Images

Figure BDA0003197603990000081 
Figure BDA0003197603990000091 
Figure BDA0003197603990000121
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology, and more specifically, to the application of the Asian corn borer taste receptor protein OfGr64 and its products in regulating the feeding and growth of the Asian corn borer. Background Technology
[0002] Lepidoptera is the second largest order of insects after Coleoptera. Many of its members are economically important insects, but a significant number are also pests that severely damage field crops. The Asian corn borer (Ostrinia furnacalis) is one such pest belonging to the Pyralidae family of Lepidoptera. Besides corn, the Asian corn borer also damages other gramineous crops, such as millet and sorghum. Currently, chemical control is still the primary method for controlling corn borers in field production. Although new pesticides and formulations are developing towards higher efficiency, lower toxicity, and lower residues, problems such as environmental pollution, increased pesticide resistance in pests, and the mortality of natural enemies remain serious and urgently need to be addressed. Therefore, exploring and developing new control strategies to change existing traditional methods is a worthwhile endeavor for researchers. Summary of the Invention
[0003] The technical problem to be solved by this invention is how to regulate the feeding and growth of the Asian corn borer.
[0004] To solve the above-mentioned technical problems, the present invention provides an application, specifically, the application may be P1 or P2:
[0005] The application of P1, OfGr64a, or substances that regulate the expression of the OfGr64a-encoding gene, or substances that regulate the activity or content of OfGr64a, in regulating the feeding amount and / or sucrose sensitivity and / or growth of the Asian corn borer.
[0006] The application of P2, OfGr64a, or substances that regulate the expression of the OfGr64a-encoding gene, or substances that regulate the activity or content of OfGr64a, in the preparation of products that regulate the feeding amount and / or sucrose sensitivity and / or growth of the Asian corn borer.
[0007] The OfGr64a can be any of the following proteins (a1)-a3):
[0008] a1) Proteins with amino acid sequences as shown in Sequence 2 of the sequence listing;
[0009] a2) Proteins with the same biological function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 2 of the sequence listing.
[0010] a3) is a protein that has 80% or more amino acid sequence identity with the sequence shown in sequence 2 in the sequence listing, is derived from the Asian corn borer and has the same biological function.
[0011] OfGr64a can be synthesized artificially or biosynthesized.
[0012] In the above-mentioned proteins, identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can be obtained.
[0013] In the aforementioned proteins, the 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity.
[0014] Furthermore, in the aforementioned applications, regulating the feeding amount of the Asian corn borer can be done by reducing the feeding amount; regulating the sensitivity of the Asian corn borer to sucrose can be done by reducing the sensitivity to sucrose; regulating the growth of the Asian corn borer can be done by inhibiting the growth of the Asian corn borer; and the substance regulating the expression of the OfGr64a-encoded gene can be a substance that inhibits or reduces the expression of the OfGr64a-encoded gene.
[0015] Furthermore, in the aforementioned application, the substance that inhibits or reduces the expression of the OfGr64a-encoding gene may be any of the following:
[0016] A1) Nucleic acid molecules that inhibit or reduce the expression of the OfGr64a-encoding gene;
[0017] A2) expresses the gene encoding the nucleic acid molecule described in A1);
[0018] A3) contains an expression cassette encoding the gene described in A2);
[0019] A4) A recombinant vector containing the encoding gene described in A2);
[0020] A5) A recombinant vector containing the expression cassette described in A3);
[0021] A6) Recombinant microorganisms containing the encoding gene described in A2);
[0022] A7) Recombinant microorganisms containing the expression cassette described in A3);
[0023] A8) Recombinant microorganisms containing the recombinant vector described in A4);
[0024] A9) Recombinant microorganisms containing the recombinant vector described in A5);
[0025] A10) Transgenic animal cell lines containing the gene encoding described in A2);
[0026] A11) Transgenic animal cell lines containing the expression cassette described in A3);
[0027] A12) Transgenic animal cell lines containing the recombinant vector described in A4);
[0028] A13) Transgenic animal cell lines containing the recombinant vector described in A5);
[0029] A14) Transgenic plant cell lines containing the encoding gene described in A2);
[0030] A15) Transgenic plant cell lines containing the expression cassette described in A3);
[0031] A16) Transgenic plant cell lines containing the recombinant vector described in A4);
[0032] A17) Transgenic plant cell lines containing the recombinant vector described in A5).
[0033] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.
[0034] The inhibition or reduction of the expression of the OfGr64a-encoding gene by the nucleic acid molecules can be achieved through gene knockout or gene silencing.
[0035] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout inactivates a specific target gene by altering its DNA sequence.
[0036] Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing presupposes no change in the DNA sequence, resulting in the absence or reduction of gene expression. Gene silencing can occur at two levels: transcriptional silencing due to DNA methylation, heterochromatinization, and position effects; and post-transcriptional gene silencing, which inactivates the gene at the post-transcriptional level through specific inhibition of target RNA. This includes antisense RNA, co-suppression, gene quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.
[0037] Furthermore, in the aforementioned applications:
[0038] A1) The nucleic acid molecule is a double-stranded RNA molecule, and one strand of the double-stranded RNA molecule is a nucleotide sequence that is transcribed from the DNA fragment at positions 609-1079 of sequence 1 in the sequence listing;
[0039] A2) The coding gene is shown in formula (I): SEQ reverse-X-SEQ forward (I); the sequence of the SEQ forward is the 609th to 1079th position of sequence 1 in the sequence listing; the sequence of the SEQ reverse is inversely complementary to the sequence of the SEQ forward; X is the spacer sequence between the SEQ forward and the SEQ reverse, and X is not complementary to either the SEQ forward or the SEQ reverse.
[0040] The nucleotide sequence of X above is shown in the DNA molecule at positions 484 to 564 of sequence 4 in the sequence listing.
[0041] The gene encoding the aforementioned double-stranded RNA can be the DNA molecule shown in sequence 3 of the sequence listing.
[0042] Furthermore, in the aforementioned application, the OfGr64a encoding gene may be the gene described in b1) or b2) below:
[0043] b1) The coding sequence of the coding strand can be the DNA molecule shown in Sequence 1 of the sequence listing;
[0044] b2) DNA molecules that have more than 80% identity with the DNA molecules described in b1) and encode the same functional proteins.
[0045] Furthermore, in the aforementioned applications, the products described in P2) that regulate the growth and / or feed intake and / or sucrose sensitivity of the Asian corn borer include feed and / or nanocarriers.
[0046] The present invention provides a method for regulating the feeding amount and / or sucrose sensitivity and / or growth of the Asian corn borer, the method comprising feeding the Asian corn borer with a substance that regulates the expression of the OfGr64a encoding gene or a substance that regulates the activity or content of the OfGr64a.
[0047] Furthermore, in the method, regulating the feeding amount of Asian corn borer can be to reduce the feeding amount; regulating the sensitivity of Asian corn borer to sucrose can be to reduce the sensitivity to sucrose; and regulating the growth of Asian corn borer can be to inhibit the growth of Asian corn borer.
[0048] In the method described above, the inhibition of the Asian corn borer's feeding amount can be achieved by inhibiting or reducing the expression level of the OfGr64a-encoded gene.
[0049] In the method described above, reducing the sensitivity of Asian corn borer to sucrose can be achieved by inhibiting or reducing the expression level of the OfGr64a encoding gene.
[0050] In the method described above, the inhibition of the growth of the Asian corn borer can be achieved by inhibiting or reducing the expression level of the OfGr64a-encoded gene.
[0051] In the method, the substance that inhibits or reduces the expression of the OfGr64a-encoded gene can be the double-stranded RNA molecule described in A1 above.
[0052] In the method, the substance that inhibits or reduces the expression of the OfGr64a-encoded gene may also be a biological material related to the double-stranded RNA molecule described in A1 above.
[0053] Specifically, the biological material used in the method can be any one or more of A2)-A17).
[0054] The present invention provides the above-mentioned OfGr64a protein.
[0055] This invention provides a substance that inhibits or reduces the expression of the OfGr64a protein-coding gene.
[0056] The substance that inhibits or reduces the expression of the OfGr64a protein-coding gene may be the substance described in A1)-A17) above.
[0057] The taste receptor protein OfGr64a described in this invention is involved in the regulation of taste sensitivity and food intake in Asian corn borer. The substances described in A1)-A17) above can effectively knock down the expression level of OfGr64a in Asian corn borer, thereby reducing the food intake of Asian corn borer larvae and / or reducing the sensitivity of Asian corn borer larvae to sucrose and / or inhibiting the growth of Asian corn borer larvae.
[0058] The substances described in A1)-A17) above can induce mutations and knock down the expression level of OfGr64a in Asian corn borer larvae. In field pest control, the above plasmids can be mixed with nanocarriers and sprayed to reduce the feeding damage of Asian corn borers on crops such as corn or cotton; alternatively, the substances described in A1)-A17) can be introduced into crops such as corn or cotton to interfere with the genes of Asian corn borers when they feed, thereby achieving the purpose of control. Attached Figure Description
[0059] Figure 1 This is a map of the pET28a plasmid.
[0060] Figure 2 This is the full-length amplified product of OfGr64a.
[0061] Figure 3 The pET28a-OfGr64a recombinant plasmid was identified by double digestion with ECOR1 / BamH1, M: marker.
[0062] Figure 4 The interference effect of OfGr64a in the mouthpiece was measured; ***P<0.001, t-test was used.
[0063] Figure 5 Electrophysiological assays were performed to determine the sensitivity of the lateral pincers to sucrose after dsOfGr64a treatment. The sensitivity level of the lateral pincers to sucrose in the 5th instar larvae of the Asian corn borer was recorded at the tip. **p<0.001 was determined by t-test.
[0064] Figure 6 This indicates the larval selection preference for sucrose after dsOfGr64a interference.
[0065] Figure 7 The number of larvae exhibiting sucrose selection preference after dsOfGr64a interference was statistically analyzed. A: Number of larvae selecting sucrose and water at different time points after dsGFP interference; B: Number of larvae selecting sucrose and water at different time points after dsGr64a interference. **P<0.01; ***P<0.001, t-test used.
[0066] Figure 8 The effect of dsOfGr64a on food intake was determined using t-testing (*P<0.05).
[0067] Figure 9 The effect of dsOfGr64a on sucrose intake was determined using t-tests (P < 0.05).
[0068] Figure 10 Comparative photos showing the effects of dsOfGr64a on larval size.
[0069] Figure 11Analysis data on the effect of dsGr64a on larval weight.
[0070] Figure 12 Electrophoretic identification of dsOfGr64a; the 471bp size in the gel image is the correct size of dsOfGr64a.
[0071] Figure 13 Electrophoretic identification of OfGr64a-1 and OfGr64a-2 synthesized by PCR; where M is marker, 1 is OfGr64a-1, and 2 is OfGr64a-2. Detailed Implementation
[0072] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0073] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0074] The pET28a vector and Escherichia coli BL21(DE3) were provided by Professor Shen Jie's laboratory at China Agricultural University and are disclosed in the literature "Zhong-Zheng Ma, Hang Zhou, Yan-Long Wei, Shuo Yan, Jie Shen. A novel plasmid–Escherichia coli system produces large batch dsRNAs for insect genesilencing. Pest Management Science, Volume 76, Issue 7 July 2020, Pages 2505-2512".
[0075] Test insects: Asian corn borers used in the experiment were collected from the Shangzhuang Experimental Station of China Agricultural University and reared by the Insect Physiology, Biochemistry and Molecular Biology Laboratory of China Agricultural University. The larvae were fed artificial feed in plastic rearing boxes (20×14×8cm2). After the Asian corn borers pupated, they were removed from the feed and transferred to rearing cages where they were fed 5% honey water. The top of the rearing cages was covered with a layer of wax paper for the adults to lay eggs. The wax paper containing eggs was replaced daily and placed back into the rearing boxes for hatching.
[0076] The rearing conditions are: temperature 28℃, photoperiod 16L:8D, and relative humidity controlled at around 60%.
[0077] Asian corn borer artificial feed formula: 150.0g corn flour, 150.0g soybean flour, 75.0g glucose, 4.0g ascorbic acid, 22.0g agar, 90.0g yeast powder, 5.0g sorbic acid, 1100mL water.
[0078] Preparation method: Mix 150g corn flour, 150g soybean flour, and 90g yeast powder thoroughly and bake in an oven at 120℃ for 1 hour; dissolve 75g edible glucose and 4g ascorbic acid in 400mL of water and pour into the baked mixture, stir thoroughly, and let it ferment for 2 hours; weigh 40g corn flour, add an appropriate amount of water and boil; weigh 22g agar, add an appropriate amount of water (total 700ml), stir well, pour into boiling water and continue to simmer over low heat. After boiling for 5 minutes, turn off the heat and let it cool to about 60℃; weigh 5.0g sorbic acid, add it to the mixture and stir thoroughly, quickly pour into a sterilized medical white porcelain dish, cool and refrigerate at 4℃ for later use.
[0079] Example 1: Method for obtaining genes
[0080] 1.1 Extraction of RNA from corn borer larvae
[0081] RNA extraction from Asian corn borers was performed using the Trizol method in a fume hood. Gloves and masks were worn during the procedure to minimize RNA degradation and loss. The specific procedures are as follows:
[0082] (1) Take a 5th instar Asian corn borer larva and put it into a 1.5 mL enzyme-free EP centrifuge tube containing 100 μL Trizol Reagent. Grind the corn borer thoroughly on ice with an RNase-free electric grinder until it becomes a homogenate. Add 500 μL Trizol Reagent to the centrifuge tube and let it stand for 5 min by vortexing.
[0083] (2) Add 120 μL of chloroform, vortex, and let stand at room temperature for 5 min;
[0084] (3) Centrifuge at 4℃, 12000rpm for 15min;
[0085] (4) Take about 300 μL of the upper aqueous phase into a new 1.5 mL enzyme-free centrifuge tube, add an equal volume of isopropanol, mix thoroughly by inverting, and let stand for 10-30 min.
[0086] (5) Centrifuge at 4℃, 13000 rpm for 20 min, and discard the supernatant;
[0087] (6) Add 1 mL of 75% ethanol (prepared with RNase-Free ddH2O), rinse the precipitate, centrifuge at 13000 rpm for 10 min at 4℃, and discard the supernatant;
[0088] (7) Repeat step (6);
[0089] (8) Remove excess liquid and place the centrifuge tube in a clean bench to air dry at room temperature until the precipitate becomes transparent.
[0090] (9) Add 50 μL of RNase-Free ddH2O to dissolve the precipitate, and use a pipette tip to repeatedly blow and mix until fully dissolved;
[0091] (10) Take 2 μL of RNA and use Nandrop to measure the absorbance at 260 / 280, 260 / 230 and RNA concentration;
[0092] (11) Store at -80℃.
[0093] 1.2 cDNA Synthesis
[0094] Using the extracted total RNA as a template, according to PrimeScript TM RT reagent Kit with gDNA Eraser (Perfect Real Time) Reverse Transcription Kit Instructions (TaKaRa, Dalian) - Synthesize single-stranded cDNA.
[0095] 1.3 PCR amplification of the coding region of the OfGr64a gene
[0096] (1) Design sequence primers of the coding region, OfGr64a-CDS-F and OfGr64a-CDS-R.
[0097] OfGr64a-CDS-F:ATGTTCTCCCCACTTTGACG
[0098] OfGr64a-CDS-R:TCATTTGTCATACTGAATGAGCACC
[0099] (2) PCR reaction system: 10 μL 2×Phanta Master Mix (Vazyme, Nanjing), 7 μL L Nase-Freed H2O, 1 μL of Gr64a-CDS-F / R primers, and 1 μL first-strand cDNA. After mixing by pipetting, the mixture was briefly centrifuged and then placed in a PCR instrument for amplification.
[0100] (3) PCR amplification program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 60℃ annealing for 1 min, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ final extension for 10 min, and storage at 4℃.
[0101] 1.4 Purification of PCR products
[0102] The PCR products were detected using a 1% agarose gel and then excised and recovered from the gel, following the instructions of the OMEGA Gel Extraction Kit.
[0103] 1.5 PCR products and Zero Cloning Kit Carrier Connection
[0104] The reaction system consisted of 4 μL of gel recovery product and 1 μL of... Zero Cloning Vector (Full-Gold, CB501-01), mix thoroughly by suction and beat, react at 37℃ for 30 min.
[0105] 1.6 Transformation
[0106] Add 5 μL of the ligation product to 50 μL of Trans1-T1 competent cells, gently tumble to mix, incubate on ice for 20 min, heat shock in a 42°C metal bath for 30 s, immediately place on ice for 2 min, add 250 μL of LB liquid medium, and incubate at 37°C for 1 h at 200 rpm. Spread 200 μL of the bacterial culture onto ampicillin medium and incubate overnight at 37°C upside down.
[0107] When a single colony grows to 0.5 mm, pick a white colony (choose a larger colony near the edge of the culture medium) and place it in a 1.5 mL centrifuge tube containing 1000 μL LB (containing the antibiotic ampicillin). Incubate at 37°C and 220 rpm for 7-8 h.
[0108] 1.7 Colony PCR Detection and Sequencing
[0109] Take 1 μL of the cultured bacterial solution and mix it thoroughly with 5 μL of 2×Taq Master Mix, 3 μL of ddH2O, 0.5 μL of M13F, and 0.5 μL of L13R. Pre-denature at 94℃ for 5 min; then denature at 94℃ for 30 s, anneal at 55℃ for 30 s, and extend at 72℃ for 30 s, for 30 cycles. Perform PCR reaction with a final extension at 72℃ for 10 min. Detect the amplification products using 1% agarose gel electrophoresis. If the target band (i.e., a band approximately 1164 bp in length) is present, [the product is considered positive]. Figure 2 As shown in the figure, three PCR clones were selected and sent to the company for sequencing.
[0110] The results showed that a cDNA coding region of 1164 bp was successfully obtained, as shown in Sequence 1 of the sequence listing. The nucleotide sequence was translated into an amino acid sequence, as shown in Sequence 2 of the sequence listing, using the Translate tool of the ExPASy database (http: / / www.expasy.org / translate), which encodes 387 amino acid residues.
[0111] Example 2: Construction of RNAi interference vector containing target gene
[0112] 2.1 Cloning the target gene
[0113] Primer design was performed using Primer 5.0. The primer sequences for OfGr64a-dsRNA synthesis are as follows (5'-3'):
[0114] OfGr64a-1F CCGGAATTCCGGTACTTCACGCTATCAC
[0115] OfGr64a-1R CGCGGATCCGCGTCATTTGTCATACTGA
[0116] OfGr64a-2F CCGCTCGAGCGGTACTTCACGCTATCAC
[0117] OfGr64a-2R CGCGGATCCGCGAATCCCATCCCACTTA
[0118] Using phanta mix (Vazyme) reagent and cDNA from the Asian corn borer as a template, PCR amplification was performed to obtain the OfGr64a-1 and OfGr64a-2 fragments. The reaction system is as follows:
[0119] 2×Taq Master Mix 10.0μL
[0120] Primer F 1.0μL
[0121] Primer R 1.0μL
[0122] Template (cDNA) 1μg
[0123] ddH2O Up to 20μL
[0124] The reaction conditions are shown in Table 1:
[0125] Table 1: Reaction System
[0126]
[0127] 2.2 Purification of the target gene
[0128] After identification by agarose gel electrophoresis, the PCR products were recovered by gel cutting using the Tiangen gel recovery kit. The specific steps are as follows:
[0129] (1) The enzyme digestion products were electrophoresed with 1% agarose gel. The position of the gene band was detected in the electrophoresis gel imaging instrument. After taking a picture, the gel band of the target gene was cut off with a sterilized scalpel blade. The cut gel was placed in a 1.5 mL centrifuge tube and weighed.
[0130] (2) Place the adsorption column in the collection tube, add 500 μL of Buffer BL, centrifuge at 12000 rpm for 1 min, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.
[0131] (3) Add a certain proportion of Buffer GL to the centrifuge tube containing the gel strip, place it in a metal bath at 65°C, and invert it once every 1-2 minutes until the gel is completely dissolved.
[0132] (4) After the sol solution in the centrifuge tube has cooled to room temperature, transfer the liquid into the adsorption column of step (1), let it stand at room temperature for 3-5 minutes, centrifuge at 12000 rpm for 1 minute, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube.
[0133] (5) Add 700 μL of W2 (anhydrous ethanol has been confirmed to be added) to the adsorption column, centrifuge at 12000 rpm for 1 min, and discard the waste liquid;
[0134] (6) Rinse once more, and repeat step (5);
[0135] (7) Place the adsorption column into an empty collection tube and centrifuge at 12,000 rpm for 2 min;
[0136] (8) Remove the adsorption column and place it in a clean 1.5 mL centrifuge tube. Open the cap and let it stand at room temperature for 10 min.
[0137] (9) Add 30-50 μL of ddH2O preheated at 65℃ to the middle of the adsorption membrane, let it stand at room temperature for 2 min, centrifuge at 12000 rpm for 2 min, and collect the solution at the bottom of the centrifuge tube as the target gene DNA.
[0138] A portion of the collected DNA solution was subjected to gel electrophoresis, and the results are as follows: Figure 13 As shown, M is the marker, 1 is OfGr64a-1, and 2 is OfGr64a-2; the band size is normal, the electrophoretic bands are single, and the electrophoresis verification result is correct. The remaining solution is stored in a -20℃ refrigerator for later use.
[0139] 2.3 Construction of the pET28a-OfGr64a expression vector
[0140] The nucleotide sequence of OfGr64a-1 is shown in Sequence 4 of the sequence listing, containing a DNA fragment with nucleotide sequences as shown in Sequence 1 of the sequence listing (positions 609-1079) and a circular coding region (X) with nucleotide sequences as shown in Sequence 4 of the sequence listing (positions 484-564). The nucleotide sequence of OfGr64a-2 is shown in Sequence 5 of the sequence listing, containing a DNA fragment with nucleotide sequences as shown in Sequence 1 of the sequence listing (positions 609-1079). The OfGr64a-1 fragment was double-digested with EcoRI and BamHI, and the OfGr64a-2 fragment was double-digested with XhoI and BamHI. pET28a (as shown in Sequence 4 of the sequence listing) was then digested. Figure 1 The target gene was ligated to the vector using EcoRI and XhoI double digestion. After purification of the digestion product, the target gene was ligated to the vector using NEB's T4 ligase to obtain the recombinant expression vector pET28a-OfGr64a, which encodes a double-stranded RNA gene named dsOfGr64a.
[0141] The connection system is as follows:
[0142]
[0143] pET28a-OfGr64a is an expression vector obtained by replacing the fragment between the EcoRI and XhoRI recognition sites of pET28a with the nucleotide sequence from position 1 to position 1035 of sequence 3 in the sequence listing, while keeping the other sequences of pET28a unchanged.
[0144] pET28a-OfGr64a contains the coding gene for dsOfGr64a, which is a DNA molecule as shown in Sequence 3 of the sequence listing. The structure of the coding gene for dsOfGr64a is SEQ forward-X-SEQ reverse (I); the SEQ forward sequence is shown from position 1 to 471 of Sequence 3 in the sequence listing; the SEQ reverse sequence is inversely complementary to the SEQ forward sequence, and its nucleotide sequence is shown from position 565 to 1035 of Sequence 3 in the sequence listing; X is a spacer sequence between the SEQ forward and the SEQ reverse, and X is not complementary to either the SEQ forward or the SEQ reverse, and its nucleotide sequence is shown from position 472 to 552 of Sequence 3 in the sequence listing.
[0145] The above mixture was incubated overnight at 16°C in a metal bath, and then heated at 65°C for 10 minutes to inactivate the enzyme.
[0146] The ligation product was transferred to Trans1-T1 competent cells from TransGen Biotech and plated overnight. Positive clones were selected the next day for enzyme digestion identification.
[0147] Identification of the recombinant plasmid using a double enzyme digestion method: The digestion products were verified using a 1% gel electrophoresis. Double digestion with EcoRI and BamHI yielded a fragment of 558 bp in length, as shown below. Figure 3 As shown, Figure 3 In the diagram, M represents the Marker. The band near the 500bp Marker is ofGr64a-1, and the band near the 5000bp Marker is the vector fragment after double digestion. The digestion verification result is correct.
[0148] The double-stranded RNA molecule pET28a-OfGr64a, named dsOfGr64a, has a nucleotide sequence on one strand that is the sequence transcribed from the DNA fragment at positions 609 to 1079 of sequence 1 in the sequence listing (referred to as the forward sequence); the nucleotide sequence on the other strand is inversely complementary to the forward sequence.
[0149] Example 3: In vitro synthesis of dsRNA
[0150] 3.1 Inducible expression of dsOfGr64a
[0151] pET28a-OfGr64a was transformed into E. coli BL21(DE3) competent cells, and positive clones (i.e., recombinant E. coli obtained by transforming pET28a-OfGr64a into E. coli BL21(DE3), named BL21(DE3) / pET28a-OfGr64a) were selected, and the cells were multiplied and cultured overnight. The specific induction process is as follows:
[0152] (1) The overnight cultured bacterial suspension was inoculated into 300 mL of LB liquid medium with Kan resistance at a ratio of 1:150, and cultured at 37°C in a shaker at 220 rpm for 3-5 h to ensure its OD. 600nm The value reaches 0.4 or higher;
[0153] (2) Add IPTG to a final concentration of 1 mM;
[0154] (3) Induce at 37℃ and 220rpm for 4h in a shaker to obtain the induced bacterial solution.
[0155] 3.2 Extraction of dsOfGr64a
[0156] Total RNA was extracted from the induced bacterial culture. The ethanol fixation method was used for RNA extraction, and the specific procedures are as follows:
[0157] (1) After induction, the bacterial solution was placed in a water bath at 80℃ for 20 minutes;
[0158] (2) Collect 5 mL of bacterial solution after water bath, centrifuge at 4℃ and 6000g for 5 min, and discard the supernatant;
[0159] (3) Add 250 μL of 75% ethanol (prepared with PBS), vortex quickly to mix, let stand at room temperature for 5 min, centrifuge at 4℃ for 6000g for 5 min, and discard the supernatant;
[0160] (4) Add 50 μL of 150 mM NaCl solution to suspend the precipitate and let it stand at room temperature for 1 h;
[0161] (5) Centrifuge at 8000g for 10 minutes at 4℃ and take the supernatant.
[0162] The supernatant obtained above contained a double-stranded RNA liquid named dsOfGr64a expressed by the recombinant bacterium BL21(DE3) / pET28a-OfGr64a (hereinafter referred to as dsOfGr64a liquid). A portion of the supernatant was taken for verification by agarose gel electrophoresis to determine whether the size of the target gene product band contained in the engineered bacterium was correct. The results are as follows. Figure 12 As shown, the 471bp size in the electrophoresis gel image is the correct size of dsOfGr64a. The concentration of dsOfGr64a in the liquid was determined to be 2000 ng / μL using an ND2000 (Thermo NanoDrope 2000) micro-ultraviolet spectrophotometer.
[0163] 3.3 Preparation of control double-stranded RNA-dsGFP
[0164] Replace pET28a-OfGr64a in 3.1 with pET28a-dsGFP, and prepare a liquid containing double-stranded RNA named dsGFP (hereinafter referred to as dsGFP liquid) according to the methods in 3.1 and 3.2 above. The dsGFP content in the dsGFP liquid was determined to be 2000 ng / μL using an ND2000 (ThermoNanoDrope 2000) micro UV spectrophotometer.
[0165] In this expression vector, pET28a-dsGFP is obtained by replacing the fragment between the EcoRI and XhoRI recognition sites of pET28a with the DNA fragment whose nucleotide sequence is from position 1 to position 824 of sequence 6 in the sequence listing, while keeping the other sequences of pET28a unchanged.
[0166] The nucleotide sequence of one strand of the double-stranded RNA molecule pET28a-dsGFP, named dsGFP, is the sequence transcribed from the DNA fragment at positions 1-377 of sequence 6 in the sequence listing (referred to as the forward sequence); the nucleotide sequence of the other strand is inversely complementary to the forward sequence.
[0167] Example 4: Disruption of dsOfGr64a on Asian corn borer larvae
[0168] 4.1 Determination of OfGr64a expression level in larvae
[0169] 4.1.1 Feeding of dsOfGr64a
[0170] 4.1.1.1 Preparation of feed for the dsOfGr64a treatment group
[0171] (1) Weigh out 150g each of soybean flour and corn flour, and 90g of yeast powder, mix them well, and place them in an oven at 120℃ for 1-2 hours.
[0172] (2) Weigh out 75g of glucose and 4g of ascorbic acid, add 400mL of water, stir and dissolve thoroughly, then pour into the mixed powder in step 1, stir thoroughly, and ferment for 2 hours.
[0173] (3) Weigh 700mL of water, pour in some of the water to dissolve 40g of cornstarch, place it on an induction cooker and heat it, stirring constantly to prevent scorching. Dissolve 22g of agarose in the remaining water, and add it in several batches after the mixture boils, stirring continuously until the liquid boils and becomes viscous. When it cools to about 60℃, pour it into the mixture from step 2 and stir thoroughly.
[0174] (4) Weigh 5g of sorbic acid and mix it into the mixture in step (3), stir thoroughly to obtain artificial feed.
[0175] (5) Measure 100g of the artificial feed prepared in step 4, add 20mg of dsOfGr64a liquid from Example 3, mix well, pour it into a box lined with plastic wrap to obtain the dsOfGr64a-treated group feed, and store it in a 4℃ refrigerator for later use. When needed, take an appropriate amount, cut it into pieces, place it in a petri dish, and place it in an Asian corn borer incubator overnight to remove excess moisture. Feed the newly hatched 5th instar larvae the next day.
[0176] 4.1.1.2. Preparation of dsGFP control group diet
[0177] Except for replacing the dsOfGr64a liquid in 4.1.1.1 with the dsGFP liquid of Example 3, everything else is the same as in 4.1.1.1, and the dsGFP control group feed is obtained.
[0178] 4.1.1.3 Feeding treatment
[0179] Newly hatched fifth-instar larvae were placed in 90mm plastic culture dishes (with holes punched in the lid) and randomly divided into two groups: a dsOfGr64a treatment group (dsGr64a) and a control group (dsGFP). The dsOfGr64a treatment group was fed the dsOfGr64a treatment group diet as described in section 4.1.1.1, while the dsGFP control group was fed the dsGFP control group diet as described in section 4.1.1.2. Subsequent experiments were conducted 24 hours after feeding.
[0180] 4.1.2 Obtaining cDNA from larval mouthparts
[0181] Fifteen larvae from the dsOfGr64a treatment group (dsGr64a) and the control group (dsGFP) were fed for 24 hours as described in 4.1.1.3. Their mouthparts were dissected and stored in 100 μL Trizol. Total RNA was extracted from the mouthparts using the method described in Example 1. cDNA was prepared using the TaKaRa PrimeScrip™ RT reagent Kit (Perfect Real Time), and the reverse transcription system was a standard 1 μg RNA reverse transcription system.
[0182] 4.1.3 Determination of OfGr64a expression level in larval mouthparts
[0183] The cDNA obtained in the previous step was used to detect the differential expression of the OfGr64a gene in Asian corn borer using real-time quantitative PCR technology, with the Actin gene as an internal control.
[0184] Primer sequence (5'-3')
[0185] OfGr64a F ATTGTAGCGTGCTTCATC
[0186] OfGr64a R AATCCATTGGCAGAGTGT
[0187] Actin F ACGGAGGTGGTAACCATCAACA
[0188] Actin R ACGCCTCCTTCTTGGTGTCG
[0189] Using the SuperReal PreMix Plus (SYBR Green) kit from Tiangen Biotech, with cDNA as a template, the reaction system is as follows:
[0190]
[0191] The results are as follows Figure 4 As shown, the expression level of OfGr64a mRNA in the dsOfGr64a treatment group was significantly lower than that in the control group (dsGFP), indicating that dsOfGr64a can significantly reduce the expression of OfGr64a mRNA.
[0192] 4.2 Effects of dsOfGr64a on the selection bias of Asian corn borer larvae
[0193] The electrophysiological method for measuring the sucrose sensitivity of the lateral pincushion after dsOfGr64a treatment was the tip recording method: Fifth-instar Asian corn borer larvae were taken, and the larvae were cut off from the second thorax segment with a blade. The ring end of a silver electrode (reference electrode) was inserted into the larva's head, exposing the pincushion sensor. The other end of the reference electrode was inserted into a preamplifier connected to an electrophysiological signal processing system. The solution to be tested was added to a pointed glass electrode (recording electrode) with a diameter of approximately 30 μm using a microinjector and fixed on a micro-manipulator. When the solution in the glass electrode came into contact with the larva's pincushion sensor, the reaction signal of the taste neurons was recorded and presented as a pulse signal by the electrophysiological signal processing system. A total of 20 larvae were tested, and the results were processed using SAPID 16.0 software. The results are as follows: Figure 5 As shown, the lateral pincers of larvae showed a significant decrease in sucrose sensitivity after dsOfGr64a interference.
[0194] In a 90mm plastic petri dish, agar blocks containing 2% water and 2% sucrose solution were placed in the four corners. Ten fifth-instar larvae from each of the dsOfGr64a treatment group (dsGr64a) and control group (dsGFP) were fed for 24 hours and placed in the center of the petri dish. Their feeding behavior was observed at 0.5h, 1h, 3h, and 6h. The number of larvae was recorded and photographed (e.g., ...). Figure 6 The number of larvae exhibiting sucrose-selective tendencies after dsOfGr64a interference is shown in the following statistics. Figure 7 As shown, A: the number of larvae choosing sucrose and water at different time points after dsGFP interference; B: the number of larvae choosing sucrose and water at different time points after dsOfGr64a interference (marked as dsGr64a in the figure) (**P<0.01; ***P<0.001 was determined by t-test). The results showed that at the four observed time points, the larvae in the control group were more inclined to feed on agar blocks containing sucrose than water, while the larvae treated with dsOfGr64a showed no obvious preference for water or sucrose. This result is consistent with the decreased sensitivity of the lateral pincus to sucrose observed by electrophysiological testing.
[0195] 4.3 Effect of dsOfGr64a on the feeding amount of Asian corn borer larvae
[0196] The amount of edible blue dye (Brilliant blue) added to the corn borer's food was measured over a certain period of time. The concentration of Brilliant blue in the food was 2.5 g / 100 mL (i.e., 2.5 g of Brilliant blue was added to 100 mL of corn borer food). After thorough mixing, the food turned dark blue.
[0197] During the test, five larvae from the dsOfGr64a treatment group (dsOfGr64a) and the control group (dsGFP) fed for 24 hours (as described in section 4.1.1.3) were placed in a petri dish containing dye-treated food. After feeding for 15 minutes, the midgut was collected. 200 μL of ddH2O was added to the sample, and after thorough grinding, 800 μL of ddH2O was added and mixed thoroughly. The mixture was allowed to stand for 5 minutes, then centrifuged at 13000 rpm for 10-15 minutes. The blue liquid was extracted using a syringe, and a filter membrane was added to the syringe tip to filter out impurities such as fat bodies. The filtered liquid was collected. 200 μL of the liquid was transferred to a transparent 96-well plate, and the absorption peak was detected at 625 nm using a spectrophotometer. The value was recorded as SV (Spectrophotometric value), representing the amount of food consumed by the corn borer larvae during a specific time period. The results are as follows: Figure 8 As shown, the results indicate that after treatment with dsOfGr64a, the feeding amount of 5th instar larvae was significantly reduced compared with the control (*P<0.05, t-test used).
[0198] 4.4 Effect of dsOfGr64a on sucrose consumption by Asian corn borer larvae
[0199] The experimental method was as follows: A 100 mM sucrose solution was prepared, along with a solid agar diet containing 2% sucrose and 2.5% blue dye. Five larvae from the dsOfGr64a treatment group (dsOfGr64a) and the control group (dsGFP) from section 4.1.1.3, after being fed this diet for 24 hours, were placed in a petri dish containing the dye-fed food. Subsequent steps were the same as in section 4.3. The results were as follows: Figure 9 As shown, after treatment with dsOfGr64a, the sucrose consumption of 5th instar larvae decreased significantly compared with the control (*P<0.05, t-test used).
[0200] 4.5 Effects of dsOfGr64a on the body weight of Asian corn borer larvae
[0201] The measurement method was as follows: Ten larvae treated with dsGFP and dsOfGr64a for 24 hours were weighed. The total weight was divided by the number of larvae to represent the weight of a single larva in that treatment. This experiment was performed in three biological replicates. Statistical data are shown in Table 2, which is a statistical graph of weight. The effect of dsOfGr64a on larval body size is shown below. Figure 10 As shown, the effect of dsOfGr64a on larval weight is as follows: Figure 11 As shown, the results indicate that, compared to the control group, the larvae treated with dsOfGr64a were smaller and weighed less.
[0202] Table 2: Larval Weight Statistics
[0203] Group 1 2 3 Experimental group (dsOfGr64a) 0.025993g 0.023418g 0.025083g Control group (dsGFP) 0.025733g 0.027364g 0.029883g
[0204] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims. sequence list <110> China Agricultural University <120> Application of the Asian corn borer taste receptor protein OfGr64a in products regulating the growth of the Asian corn borer <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1164 <212> DNA <213> Asian corn borer (Ostrinia furnacalis) <400> 1 atgttcctcc ccactttgac gcacatcttt acagtggccc agtgggtcgg gattcccaca 60 tatgggaata aaatgtcttt ggtgtgggct ataattgtac tctcaatgct gacagctata 120 gaagccgctg ctatttggac gctcataaaa atattaactg gagttgctaa acatgttgac 180 gatggacgtg gtctaacggc aagactctct ggcagtgtat tctatggcaa tggtttcctc 240 tccctcattc tatcttggaa gttcatatcc tcgtggagaa ggctctccgt ctactggaag 300 agagccgagt tgttggacgc tacactgggt ccacccgacg ctaccatcca aaggagagtc 360 attattgtag cgtgcttcat ctcaatatgc tctattgtgg aacatttgct aagcatgttt 420 atggccatag gctttgacac tctgccaatg gattacttac ataagtacat tttaaattcc 480 catgcatttc tgataagacc tgatacttac agcctatgga ctgcaatccc gatatttttt 540 ataagcaaaa tagcaacaat attatggaat tttcaagatc tataataat tttgataagc 600 atgggactta cttcacgcta tcacagatta aatttatacg tcaattcgct agtaaaaaag 660 gaaaacgtgg acaaagagaa aaggatcagc acagcaaaat atgtgcgcaa ccaaaaatgg 720 cgtcgcgtc gcgaggcgta cgtgcgccaa gctacactag tgcgtatggt ggacgcacaa 780 attggcgcgc tggttcttct gtcaaatatt aaacttct tcttcatctg cctccaatta 840 ttcttgggtc taaacaaaac tggaggatca ctgatgagct acttctacta cttcttatct 900 ctgggctggc tcctcttcag ggcatgcagc gttgtgctgg ctgctgctga cgtccatatt 960 tattctagaa cagctctaga atacattagg ctatgtccgg actcaggata caatgttgag 1020 ataaagagac tcaacaatca actaagtcac gactttgtgg cattaagtgg gatgggattc 1080 ttttggttga gtagagagac gttactggag gtggctggca acataataaa atatgagctg 1140 gtgctcattc agtatgacaa atga 1164 <210> 2 <211> 387 <212> PRT <213> Asian corn borer (Ostrinia furnacalis) <400> 2 Met Phe Leu Pro Thr Leu Thr His Ile Phe Thr Val Ala Gln Trp Val 1 5 10 15 Gly Ile Pro Thr Tyr Gly Asn Lys Met Ser Leu Val Trp Ala Ile Ile 20 25 30 Val Leu Ser Met Leu Thr Ala Ile Glu Ala Ala Ala Ile Trp Thr Leu 35 40 45 Ile Lys Ile Leu Thr Gly Val Ala Lys His Val Asp Asp Gly Arg Gly 50 55 60 Leu Thr Ala Arg Leu Ser Gly Ser Val Phe Tyr Gly Asn Gly Phe Leu 65 70 75 80 Ser Leu Ile Leu Ser Trp Lys Phe Ile Ser Ser Trp Arg Arg Leu Ser 85 90 95 Val Tyr Trp Lys Arg Ala Glu Leu Leu Asp Ala Thr Leu Gly Pro Pro 100 105 110 Asp Ala Thr Ile Gln Arg Arg Val Ile Ile Val Ala Cys Phe Ile Ser 115 120 125 Ile Cys Ser Ile Val Glu His Leu Leu Ser Met Phe Met Ala Ile Gly 130 135 140 Phe Asp Thr Leu Pro Met Asp Tyr Leu His Lys Tyr Ile Leu Asn Ser 145 150 155 160 His Ala Phe Leu Ile Arg Pro Asp Thr Tyr Ser Leu Trp Thr Ala Ile 165 170 175 Pro Ile Phe Phe Ile Ser Lys Ile Ala Thr Ile Leu Trp Asn Phe Gln 180 185 190 Asp Leu Ile Ile Ile Leu Ile Ser Met Gly Leu Thr Ser Arg Tyr His 195 200 205 Arg Leu Asn Leu Tyr Val Asn Ser Leu Val Lys Lys Glu Asn Val Asp 210 215 220 Lys Glu Lys Arg Ile Ser Thr Ala Lys Tyr Val Arg Asn Gln Lys Trp 225 230 235 240 Arg Arg Val Arg Glu Ala Tyr Val Arg Gln Ala Thr Leu Val Arg Met 245 250 255 Val Asp Ala Gln Ile Gly Ala Leu Val Leu Leu Ser Asn Ile Asn Asn 260 265 270 Phe Phe Phe Ile Cys Leu Gln Leu Phe Leu Gly Leu Asn Lys Thr Gly 275 280 285 Gly Ser Leu Met Ser Tyr Phe Tyr Tyr Phe Leu Ser Leu Gly Trp Leu 290 295 300 Leu Phe Arg Ala Cys Ser Val Val Leu Ala Ala Ala Asp Val His Ile 305 310 315 320 Tyr Ser Arg Thr Ala Leu Glu Tyr Ile Arg Leu Cys Pro Asp Ser Gly 325 330 335 Tyr Asn Val Glu Ile Lys Arg Leu Asn Asn Gln Leu Ser His Asp Phe 340 345 350 Val Ala Leu Ser Gly Met Gly Phe Phe Trp Leu Ser Arg Glu Thr Leu 355 360 365 Leu Glu Val Ala Gly Asn Ile Ile Lys Tyr Glu Leu Val Leu Ile Gln 370 375 380 Tyr Asp Lys 385 <210> 3 <211>1035 <212>DNA <213>Artificial Sequence <400> 3 tacttcacgc tatcacagat taaatttata cgtcaattcg ctagtaaaaa aggaaaacgt 60 ggacaaagag aaaaggatca gcacagcaaa atatgtgcgc aaccaaaaat ggcgtcgcgt 120 tcgcgaggcg tacgtgcgcc aagctacact agtgcgtatg gtggacgcac aaattggcgc 180 gctggttctt ctgtcaaata ttaacaactt cttcttcatc tgcctccaat tattcttggg 240 tctaaacaaa actggaggat cactgatgag ctacttctac tacttcttat ctctgggctg 300 gctcctcttc agggcatgca gcgttgtgct ggctgctgct gacgtccata tttattctag 360 aacagctcta gaatacatta ggctatgtcc ggactcagga tacaatgttg agataaagag 420 actcaacaat caactaagtc acgactttgt ggcattaagt gggatgggat tcttttggtt 480 gagtagacag acattactgg aggtggctgg caacataata atgaactggt gctcattcag 540 tatgacaaat gacgcggatc cgcgaatccc atcccactta atgccacaaa gtcgtgactt 600 agttgattgt tgagtctctt tatctcaaca ttgtatcctg agtccggaca tagcctaatg 660 tattctagag ctgttctaga ataaatatgg acgtcagcag cagccagcac aacgctgcat 720 gccctgaaga ggagccagcc cagagataag aagtagtaga agtagctcat cagtgatcct 780 ccagttttgt ttagacccaa gaataattgg aggcagatga agaagaagtt gttaatattt 840 gacagaagaa ccagcgcgcc aatttgtgcg tccaccatac gcactagtgt agcttggcgc 900 acgtacgcct cgcgaacgcg acgccatttt tggttgcgca catattttgc tgtgctgatc 960 cttttctctt tgtccacgtt ttcctttttt actagcgaat tgacgtataa atttaatctg 1020 tgatagcgtg aagta 1035 <210> 4 <211> 576 <212> DNA <213> Artificial Sequence <400> 4 ccggaattcc ggtacttcac gctatcacag attaaattta tacgtcaatt cgctagtaaa 60 aaaggaaaac gtggacaaag agaaaaggat cagcacagca aaatatgtgc gcaaccaaaa 120 atggcgtcgc gttcgcgagg cgtacgtgcg ccaagctaca ctagtgcgta tggtggacgc 180 acaaattggc gcgctggttc ttctgtcaaa tattaacaac ttcttcttca tctgcctcca 240 attattcttg ggtctaaaca aaactggagg atcactgatg agctacttct actacttctt 300 atctctgggc tggctcctct tcagggcatg cagcgttgtg ctggctgctg ctgacgtcca 360 tatttattct agaacagctc tagaatacat taggctatgt ccggactcag gatacaatgt 420 tgagataaag agactcaaca atcaactaag tcacgacttt gtggcattaa gtgggatggg 480 attcttttgg ttgagtagac agacattact ggaggtggct ggcaacataa taatgaactg 540 gtgctcattc agtatgacaa atgacgcgga tccgcg 576 <210> 5 <211> 495 <212> DNA <213> Artificial Sequence <400> 5 ccgctcgagc ggtacttcac gctatcacag attaaattta tacgtcaatt cgctagtaaa 60 aaaggaaaac gtggacaaag agaaaaggat cagcacagca aaatatgtgc gcaaccaaaa 120 atggcgtcgc gttcgcgagg cgtacgtgcg ccaagctaca ctagtgcgta tggtggacgc 180 acaaattggc gcgctggttc ttctgtcaaa tattaacaac ttcttcttca tctgcctcca 240 attattcttg ggtctaaaca aaactggagg atcactgatg agctacttct actacttctt 300 atctctgggc tggctcctct tcagggcatg cagcgttgtg ctggctgctg ctgacgtcca 360 tatttattct agaacagctc tagaatacat taggctatgt ccggactcag gatacaatgt 420 tgagataaag agactcaaca atcaactaag tcacgacttt gtggcattaa gtgggatggg 480 attcgcggat ccgcg 495 <210> 6 <211> 824 <212> DNA <213> Artificial Sequence <400> 6 cacaagttca gcgtgtccgg cgagggcgag ggcgatgcca cctacggcaa gctgaccctg 60 aagttcatct gcaccaccgg caagctgccc gtgccctggc ccaccctcgt gaccaccctg 120 acctacggcg tgcagtgctt cagccgctac cccgaccaca tgaagcagca cgacttcttc 180 aagtccgcca tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa ggacgacggc 240 aactacaaga cccgcgccga ggtgaagttc gagggcgaca ccctggtgaa ccgcatcgag 300 ctgaagggca tcgacttcaa ggaggacggc aacatcctgg ggcacaagct ggagtacaac 360 tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac 420 ttcaagatcc gccaccccaa gcttgggacg ttgtggctgt tgtagttgta ctccagcttg 480 tgccccagga tgttgccgtc ctccttgaag tcgatgccct tcagctcgat gcggttcacc 540 agggtgtcgc cctcgaactt cacctcggcg cgggtcttgt agttgccgtc gtccttgaag 600 aagatggtgc gctcctggac gtagccttcg ggcatggcgg acttgaagaa gtcgtgctgc 660 ttcatgtggt cggggtagcg gctgaagcac tgcacgccgt aggtcagggt ggtcacgagg 720 gtgggccagg gcacgggcag cttgccggtg gtgcagatga acttcagggt cagcttgccg 780 taggtggcat cgccctcgcc ctcgccggac acgctgaact tgtg 824
Claims
1. Application, wherein the application is P1 or P2: P1. Application of substances that reduce the expression of the OfGr64a gene in reducing the feeding rate of the Asian corn borer. P2. The application of a substance that reduces the expression of the OfGr64a-encoding gene in the preparation of a product that reduces the feeding rate of the Asian corn borer, wherein OfGr64a is at least one of the following: a1) Proteins with amino acid sequences as shown in Sequence 2 of the sequence listing. a2) A protein that has more than 99% identity with the amino acid sequence shown in sequence 2 of the sequence listing, is derived from the Asian corn borer and has the same biological function; The substance that reduces the expression of the OfGr64a encoding gene is any one of the following: A1) Nucleic acid molecules that inhibit or reduce the expression of the OfGr64a-encoding gene; A2) Expresses the gene encoding the nucleic acid molecule described in A1); A3) contains an expression cassette containing the gene encoding described in A2); A4) A recombinant vector containing the encoding gene described in A2); A5) A recombinant vector containing the expression cassette described in A3); A6) Recombinant microorganisms containing the encoding gene described in A2); A7) Recombinant microorganisms containing the expression cassette described in A3); A8) Recombinant microorganisms containing the recombinant vector described in A4); A9) Recombinant microorganisms containing the recombinant vector described in A5); A1) The nucleic acid molecule is a double-stranded RNA molecule, which is transcribed from sequence 3 in the sequence listing.
2. Use according to claim 1, characterized in that: A2) The coding gene is shown in formula (I): SEQ forward - X - SEQ reverse (I); the sequence of the SEQ forward is the 609th to 1079th position of sequence 1 in the sequence listing; the sequence of the SEQ reverse is inversely complementary to the sequence of the SEQ forward; X is the spacer sequence between the SEQ forward and the SEQ reverse, and X is not complementary to either the SEQ forward or the SEQ reverse. The encoding gene is a DNA molecule as shown in sequence 3 of the sequence listing.
3. The application according to claim 2, characterized in that: The OfGr64a encoding gene is the gene described in b1) or b2) below: b1) The coding sequence of the coding strand is the DNA molecule shown in Sequence 1 of the sequence listing; b2) DNA molecules that have more than 99% identity with the DNA molecules described in b1) and encode the same functional proteins.
4. The application according to claim 1, characterized in that, The products mentioned in P2 that reduce the consumption of Asian corn borers include feed.
5. A method for reducing the consumption of Asian corn borer, characterized by: This includes feeding the insects with the substance described in any of claims 1-4 that reduces the expression of the OfGr64a-encoding gene.
6. A biomaterial, characterized in that: The biomaterial is a substance that inhibits or reduces the expression of the OfGr64a-encoding gene as described in claim 1, and the biomaterial is at least one of A1) to A9) as described in claim 1 or 2.
Citation Information
Patent Citations
Chemosensory gene family encoding gustatory and olfactory receptors and uses thereof
US20030045472A1
Insect chemosensory receptors and methods of use thereof
US20100043083A1