Establishment method and application of trichoderma reesei crisper / cas9 using multiple tandem sgRNA expression of tRNA

By constructing a tRNA-spacer system and a CRISPR/Cas9 vector in Trichoderma reesei, we achieved multi-gene editing and efficient expression of heterologous proteins, solving the problems of cumbersome operation and low efficiency in existing technologies, and realizing efficient multi-gene editing and precise localization expression of heterologous proteins.

CN116179544BActive Publication Date: 2026-03-31SHANDONG UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202211090046.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-09-07
Publication Date
2026-03-31
Estimated Expiration
2042-09-07

AI Technical Summary

Technical Problem

Existing techniques for constructing multiple sgRNA expression cassettes in Trichoderma reesei are cumbersome, have low multi-gene editing efficiency, and are greatly affected by background proteins during heterologous protein expression, making it difficult to achieve efficient multi-gene editing and precise localization expression of heterologous proteins.

Method used

Using the tRNA-spacer system, multiple sgRNA expression cassettes were constructed using the tRNA encoding glycine from Trichoderma reesei as a spacer sequence. Multiple gene editing was achieved through a CRISPR/Cas9 vector. By combining the AMA1 autonomous replication element and resistance marker, a non-integrative CRISPR/Cas9 vector was constructed to knock out the cellulase gene and introduce the glucose oxidase gene at the cbh1 site.

Benefits of technology

This study achieved efficient multi-gene editing and precise localization expression of heterologous proteins in Trichoderma reesei, improved homologous recombination efficiency, reduced the influence of background proteins, and successfully secreted glucose oxidase into the extracellular space with an enzyme activity of 180.12 U/mL.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116179544B_ABST
    Figure CN116179544B_ABST
Patent Text Reader

Abstract

The application provides a method for establishing Trichoderma reesei CRISPR / Cas9 by using multiple serial sgRNAs of tRNA and application, and belongs to the field of genetic engineering and biotechnology. The application provides a multi-gene editing system for simultaneously performing multiple serial sgRNA expression of Trichoderma reesei by using a tRNA-spacer system of CRISPR / Cas9, wherein the tRNA-spacer system is a spacer sgRNA mode using the processing mode of an endogenous tRNA to release multiple sgRNAs targeting different sites from a single transcript, and then a self-replicating CRISPR / Cas9 vector containing Cas9, sgRNA and a screening marker is constructed, so that the CRISPR / Cas9 technology of the precise positioning targeted multi-gene editing system is established in Trichoderma reesei, and has good practical application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and biotechnology, specifically involving the modification of the Trichoderma reesei genome, and further involving the establishment and application of a method for expressing Trichoderma reesei CRISPR / Cas9 using multiple tandem tRNAs. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] *Trichoderma reesei* possesses a strong ability to secrete proteins, enabling efficient protein folding and quality control, systematic eukaryotic protein modification, and effective vesicle transport and secretion. This makes it a promising candidate for becoming a highly efficient microbial cell factory for the industrial production of recombinant proteins. Currently, *Trichoderma reesei* has been used to express various exogenous proteins, such as β-glucosidase from *Aspergillus terreus*, human interferon α-2b, and lipase B from *Candida antarcticus*. Under induction conditions, *Trichoderma reesei* can produce large amounts of cellulase and hemicellulase; however, this consumes energy and generates significant background proteins, hindering the expression and purification of heterologous proteins. Using constitutive promoters to drive heterologous protein expression allows fermentation under glucose conditions, greatly reducing the production of endogenous enzymes / proteins, but the expression yield is far lower than that of inducible expression. Therefore, to improve target protein yield and reduce the impact of background proteins, using an inducible promoter of the cellulase gene to drive target protein expression while simultaneously knocking out the major cellulase gene has become an effective heterologous protein expression strategy for *Trichoderma reesei*. However, multi-gene knockout technology is not yet mature and convenient in *Trichoderma reesei* and requires further exploration.

[0004] The CRISPR / Cas system is a simple, efficient, and multi-gene editing system, with CRISPR / Cas9 derived from Streptococcus pyogenes type II becoming a research hotspot due to its simplicity and convenience. The Cas9 protein is an RNA-mediated endonuclease that cleaves double-stranded DNA and consists of two active parts: the HNH domain and the RuvC domain. The HNH domain cleaves the DNA strand complementary to the crRNA, while the RuvC domain cleaves the DNA strand not complementary to the crRNA. Cas9 requires a nuclear localization sequence (NLS) to target the eukaryotic genome. A single-guided RNA (sgRNA) containing both crRNA and tracrRNA guides Cas9 to the target site. The sgRNA recognizes the 20-nucleotide protospacer sequence upstream of the protospacer adjacent motif (PAM) NGG site. The Cas9 protein cleaves 3-4 bases upstream of the PAM, causing a double-strand break (DSB). DSBs are typically repaired by non-homologous end joining (NHEJ) and homologous recombination (HR). NHEJ repair creates gene interruptions through insertion or deletion (indel). HR repair, on the other hand, integrates donor DNA into the genome through substitution or insertion.

[0005] Currently, CRISPR / Cas9 has been successfully applied in *Trichoderma reesei*, and multi-gene editing methods have been explored, such as constructing multiple sgRNA transcripts separately or assembling multiple Cas9-gRNA complexes in vitro to form ribonucleoproteins (RNPs), followed by transformation into protoplasts for genome editing. Both methods are time-consuming and laborious, requiring repeated construction of the entire sgRNA expression cassette each time. The former requires exploring the concentration ratio of each sgRNA expression cassette to improve efficiency, while the latter suffers from in vitro sgRNA stability affecting efficiency and is difficult to operate. Therefore, developing a simple multi-sgRNA expression strategy is essential. A search revealed the construction of a tRNA-spacer system in *Trichoderma reesei* for multi-tandem sgRNA expression. This system was then ligated into an extrachromosomal, autonomously replicating plasmid carrying the replication factor AMA1 to construct a Cas9 expression vector (containing an antibiotic resistance selection marker). This resulted in a multi-gene editing system using CRISPR / Cas9 and the tRNA-spacer system for simultaneous multi-tandem sgRNA expression in *Trichoderma reesei*. However, this system has not yet been reported. Summary of the Invention

[0006] To overcome the aforementioned technical problems, this invention provides a method and application for establishing CRISPR / Cas9 expression of multiple tandem sgRNAs in *Trichoderma reesei* using tRNA. Specifically, this invention provides a multi-gene editing system that simultaneously expresses multiple tandem sgRNAs in *Trichoderma reesei* using a CRISPR / Cas9 tRNA-spacer system. The tRNA-spacer system utilizes endogenous tRNA processing to release multiple sgRNAs targeting different sites from a single transcript, using *Trichoderma reesei* tRNA encoding glycine as spacer sgRNAs. Then, by constructing an autonomously replicating CRISPR / Cas9 vector containing Cas9, sgRNA, and a selection marker, a precisely targeted multi-gene editing system of CRISPR / Cas9 is established in *Trichoderma reesei*. This system has been validated by exogenously introducing glucose oxidase into *Trichoderma reesei*, demonstrating significant practical application value.

[0007] To achieve the above-mentioned technical objectives, the technical solution adopted by the present invention is as follows:

[0008] In a first aspect, the present invention provides an sgRNA expression cassette having the following structure from 5'-3': PRASRBSRCSRDSRT, wherein P is a promoter, R is a tRNA sequence encoding glycine from Trichoderma reesei, A, B, C, and D are 20bp protospacer sequences in sgRNAs targeting different genes, S is an sgRNA sequence backbone, and T is a T6 terminator.

[0009] It should be noted that the above sgRNA expression cassette is for illustrative purposes only, taking the targeting of two gene sites, A and B, as an example. If more sites need to be targeted, simply add the -NSR- sequence before T. N is the original spacer sequence of any target site.

[0010] A second aspect of the present invention provides a tRNA-spacer system comprising an expression vector of a Cas9 gene carrying two or more corresponding sgRNA expression cassettes.

[0011] The expression vector may contain an AMA1 autonomous replication element and an resistance marker; specifically, the AMA1 autonomous replication element is utilized because it does not insert into the genome during genetic transformation and is easily lost after transformation without selection, thus allowing the selection marker to be reused.

[0012] The tRNA-spacer system also includes one or more homologous donor DNA sequences, each targeting the gene to be edited.

[0013] A third aspect of the present invention provides the application of the above-described sgRNA expression cassette and / or tRNA-spacer system in gene editing of Trichoderma based on CRISPR / Cas9 gene editing technology.

[0014] The gene editing includes, but is not limited to, gene knockout and homologous integration of donor DNA.

[0015] The *Trichoderma* mentioned can be *Trichoderma reesei*. To verify the effectiveness of the aforementioned sgRNA expression cassette or tRNA-spacer system, this invention takes heterologous expression of glucose oxidase in *Trichoderma reesei* as an example, and simultaneously performs a multi-gene editing system for multiple tandem sgRNA expression. Specifically, in this invention, the genome of *Trichoderma reesei* is edited with multiple genes, knocking out cellobiase 1 CBH1 (P62694.1) and cellobiase 2 gene CBH2 (P07987.1), and introducing the glucose oxidase gox gene (EU532181.1) overexpressing *A. niger* FGX55 at the CBH1 locus. The aforementioned sgRNA expression cassette or tRNA-spacer system is used to achieve the above-mentioned technical effects.

[0016] Therefore, in a fourth aspect, the present invention provides a method for establishing Trichoderma reesei CRISPR / Cas9 expression using multiple tandem sgRNAs of tRNA, the method comprising:

[0017] S1. Construct a plasmid containing a ptrA resistance selection marker and a Cas9 expression cassette;

[0018] S2. Design and synthesize sgRNA expression cassettes containing two targeting cbh1 and cbh2;

[0019] S3. Construct CRISPR / Cas9 vectors targeting cbh1 and cbh2 for localization and knockout;

[0020] S4. Construct a donor DNA fusion fragment expressing glucose oxidase;

[0021] S5. A glucose oxidase expression strain was constructed using a multi-gene editing system that simultaneously expresses multiple tandem sgRNAs in Trichoderma reesei via CRISPR / Cas9 using the tRNA-spacer system.

[0022] A fifth aspect of the present invention provides a glucose oxidase strain obtained by the above-described method. As described above, this strain is named QGOX. Experiments have shown that the glucose oxidase expression strain QGOX obtained by the above-described method reached a maximum enzyme activity of 180.12 U / mL after 12 days of fermentation, while no enzyme activity was detected in the starting strain Q53G; indicating that QGOX successfully secreted glucose oxidase extracellularly.

[0023] A sixth aspect of the present invention provides a method for producing glucose oxidase by fermentation, the method comprising: inoculating the glucose oxidase strain described in the fifth aspect into a fermentation medium for fermentation culture, and isolating and obtaining glucose oxidase. The glucose oxidase is capable of being secreted extracellularly, thereby greatly facilitating subsequent isolation and acquisition.

[0024] The beneficial technical effects of one or more of the above technical solutions are as follows:

[0025] Existing techniques for expressing multiple sgRNAs in *Trichoderma reesei* are cumbersome. This application, for the first time, utilizes endogenous tRNA processing mechanisms to successfully express four sgRNAs from a single transcript, thereby achieving simultaneous knockout of cbh1 and cbh2. A system for simultaneous multi-gene editing of *Trichoderma reesei* using CRISPR / Cas9 was constructed. Heterologous glucose oxidase was precisely located at the cbh1 gene site, and glucose oxidase was expressed using the strongly inducible promoter Pcbh1 at the cbh1 site. The CRISPR / Cas9 system constructed in this application significantly improved homologous recombination efficiency by 50%, compared to approximately 5% for conventional homologous recombination. The glucose oxidase strain obtained using the above method is an engineered *Trichoderma reesei* strain that successfully introduces exogenous glucose oxidase and possesses the extracellular secretion ability of glucose oxidase, demonstrating significant practical application value. Attached Figure Description

[0026] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0027] Figure 1 The present invention relates to Trichoderma reesei tRNA. Gly Schematic diagram of the structure and method for constructing an tRNA-spacer system to express multiple sgRNAs

[0028] Where: A is the tRNA of Trichoderma reesei encoding glycine. Gly Structure and sequence; B is a schematic diagram of the method for constructing an tRNA-spacer system to express multiple sgRNAs.

[0029] Figure 2 This invention relates to the construction and validation of the plasmid pFC33ptrA-5stsgRNA (cbh1*2-cbh2*2).

[0030] Wherein: A is a schematic diagram of the construction of pFC33ptrA plasmid and a schematic diagram of the sgRNA expression cassette of the tRNA-spacer system; B is the verification result of pFC33ptrA plasmid; C is a schematic diagram of the structure of plasmid pFC33ptrA-5stsgRNA(cbh1*2-cbh2*2); D is the verification result of plasmid pFC33ptrA-5stsgRNA(cbh1*2-cbh2*2).

[0031] Figure 3 This is the construction result of the glucose oxidase expression strain QGOX of the present invention.

[0032] Wherein: A is a schematic diagram of the action of glucose oxidase sgRNA and donor DNA; B is a schematic diagram of upstream and downstream anchoring verification of QGOX; C is the PCR verification result of QGOX transformants.

[0033] Figure 4 This invention relates to a plate colorimetric analysis of the glucose oxidase expression strain QGOX.

[0034] Figure 5 This study analyzes the enzyme activity of the glucose oxidase expression strain QGOX, as described in this invention. Detailed Implementation

[0035] It should be noted that the following detailed description is illustrative and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0036] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the present invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof. It should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for the purpose of describing specific embodiments and not for limiting the scope of protection of the present invention.

[0037] In a typical embodiment of the present invention, an sgRNA expression cassette is provided, the sgRNA expression cassette having the following structure from 5'-3': PRASRBSRCSRDSRT, where P is a promoter, R is a tRNA sequence encoding Trichoderma reesei glycine, A, B, C, and D are 20bp protospacer sequences in sgRNAs targeting different genes, S is an sgRNA sequence backbone, and T is a T6 terminator.

[0038] It should be noted that the above sgRNA expression cassette is for illustrative purposes only, taking the targeting of two gene sites, A and B, as an example. If more sites need to be targeted, simply add the -NSR- sequence before T. N is the original spacer sequence of any target site.

[0039] The tRNA sequence encoding glycine from Trichoderma reesei is shown in SEQ ID NO.1.

[0040] The promoter is 5S rRNA, and its sequence is shown in SEQ ID NO.2;

[0041] The sgRNA sequence backbone is an sgRNA sequence from Streptococcus pyogenes. In one specific embodiment of the present invention, the nucleotide sequence of the sgRNA sequence backbone is shown in SEQ ID NO.3.

[0042] In one or more specific embodiments of the present invention, a tRNA-spacer system is provided, the tRNA-spacer system comprising an expression vector of a Cas9 gene with two or more corresponding sgRNA expression cassettes.

[0043] The expression vector may contain an AMA1 autonomous replication element and an resistance marker; specifically, the AMA1 autonomous replication element is utilized because it does not insert into the genome during genetic transformation and is easily lost after transformation without selection, thus allowing the selection marker to be reused.

[0044] The tRNA-spacer system also includes one or more homologous donor DNA sequences, each targeting the gene to be edited.

[0045] In one or more specific embodiments of the present invention, the above-described sgRNA expression cassette and / or tRNA-spacer system is provided for gene editing of Trichoderma based on CRISPR / Cas9 gene editing technology.

[0046] The gene editing includes, but is not limited to, gene knockout and homologous integration of donor DNA.

[0047] The *Trichoderma* mentioned can be *Trichoderma reesei*. To verify the effectiveness of the aforementioned sgRNA expression cassette or tRNA-spacer system, this invention takes heterologous expression of glucose oxidase in *Trichoderma reesei* as an example, and simultaneously performs a multi-gene editing system for multiple tandem sgRNA expression. Specifically, in this invention, the genome of *Trichoderma reesei* is edited with multiple genes, knocking out cellobiase 1 CBH1 (P62694.1) and cellobiase 2 gene CBH2 (P07987.1), and introducing the glucose oxidase gox gene (EU532181.1) overexpressing *A. niger* FGX55 at the CBH1 locus. The aforementioned sgRNA expression cassette or tRNA-spacer system is used to achieve the above-mentioned technical effects.

[0048] Therefore, in one or more specific embodiments of the present invention, a method for establishing Trichoderma reesei CRISPR / Cas9 expression using multiple tandem tRNAs is provided, the method comprising:

[0049] S1. Construct a plasmid containing a ptrA resistance selection marker and a Cas9 expression cassette;

[0050] S2. Design and synthesize sgRNA expression cassettes containing two targeting cbh1 and cbh2;

[0051] S3. Construct CRISPR / Cas9 vectors targeting cbh1 and cbh2 for localization and knockout;

[0052] S4. Construct a donor DNA fusion fragment expressing glucose oxidase;

[0053] S5. A glucose oxidase expression strain was constructed using a multi-gene editing system that simultaneously expresses multiple tandem sgRNAs in Trichoderma reesei via CRISPR / Cas9 using the tRNA-spacer system.

[0054] In one or more specific embodiments of the present invention, in step S1, the plasmid is specifically pFC33ptrA, which can be obtained by the following method:

[0055] The Ttef1 partial sequence was amplified from pFC330 using primer pair Ttef1-DF(Pml I) / Ttef1-DR(ptrA); then the ptrA expression cassette was amplified from the T-ptrA plasmid using primer pair PtrA-F / PtrA-R(Nhe I); finally, the two fragments were fused to obtain Ttef1-ptrA; Ttef1-ptrA and pFC330 were digested with Pml I and Nhe I, ligated together with T4 DNA ligase, and transformed into E. coli DH5α to obtain the final product.

[0056] pFC330 is a known plasmid, and its source can be found in the literature. CS, Nielsen, JB, Kogle, ME, & Mortensen, UH (2015). A CRISPR-Cas9 system for genetic engineering of filamentous fungi. Plos One, 10(7), e133085. The specific nucleotide sequences of the primers used in step S1 above are shown below:

[0057] Ttef1-DF(Pml I):ACGCACGTGATATTACATGACCTGG

[0058] Ttef1-DR(ptrA):ATAAAGTGTAAAGCCTGGGGGTATTGGGATGAATTTTGTATG

[0059] PtrA-F: CCCCAGGCTTTACACTTTAT

[0060] PtrA-R(Nhe I): CTAGCTAGCCCGCTCTTGCATCTTTGTT

[0061] In one or more specific embodiments of the present invention, in step S2, the sgRNA expression cassette containing two sgRNAs targeting cbh1 and cbh2 is specifically a 5stsgRNA (cbh1*2-cbh2*2); it can be obtained by the following method: gene synthesis of an sgRNA expression cassette with 5S rRNA as promoter (SEQ ID NO.2), containing two sgRNAs respectively targeting cbh1 and cbh2, with a tRNA of Trichoderma reesei encoding glycine (SEQ ID NO.1) separating each sgRNA and T6 as terminator;

[0062] In one or more specific embodiments of the present invention, Bgl II and Pac I restriction sites are added to both ends of the sgRNA expression cassette; each sgRNA contains a protospacer and a scaffold sequence (SEQ ID NO.3, sgRNA sequence from Streptococcus pyogenes);

[0063] More specifically, the sgRNA expression cassette has the following structure from 5'-3': PRASRBSRCSRDSRT, where P is the promoter, R is the tRNA sequence encoding glycine from Trichoderma reesei, ABCD are 20bp protospacer sequences in sgRNAs targeting different genes, S is the sgRNA sequence backbone (from the sgRNA sequence of Streptococcus pyogenes), and T is the T6 terminator.

[0064] Specifically, cbh1-U, cbh1-D, cbh2-U, and cbh2-U represent 20bp protospacer motifs targeting the corresponding genes, designed and selected using CRISPOR. The selected sequences are: 5'-GGCCACAGCTCGTGCTCAGT-3', 5'-AGCTTCCAGTGGTAGTGGCT-3', 5'-ACACTGGGA GTAATAGTCGT-3', and 5'-CGTTGCTGGATTCGTTTGTC-3'.

[0065] In one or more specific embodiments of the present invention, the specific method for constructing a CRISPR / Cas9 vector targeting cbh1 and cbh2 knockout in step S3 includes: ligating the plasmid containing the ptrA resistance selection marker and Cas9 expression cassette obtained in step S1 with the sgRNA expression cassette containing two targets of cbh1 and cbh2 obtained in step S2 after enzyme digestion, thereby constructing a CRISPR / Cas9 vector containing sgRNA (targeting cbh1 and cbh2), named pFC33ptrA-5stsgRNA(cbh1*2-cbh2*2).

[0066] In one or more specific embodiments of the present invention, the enzyme digestion may be performed using Bgl II or Pac I enzymes; the ligation may be performed using T4 DNA ligase.

[0067] In step S4, the specific method for constructing the donor DNA fusion fragment expressing glucose oxidase includes: amplifying Pcbh1 as the upstream homologous arm using Trichoderma reesei Q53G chromosome as a template; amplifying the glucose oxidase gox gene using A. niger FGX55 chromosome as a template; amplifying Tcbh1 as the downstream homologous arm using Trichoderma reesei Q53G chromosome; and then fusing the amplified fragments to obtain the donor DNA fusion fragment (dGOD-cbh1) that specifically expresses glucose oxidase.

[0068] In one or more specific embodiments of the present invention, the Trichoderma reesei Q53G is obtained by knocking out the pyr4 gene from the Trichoderma reesei QM53 strain; Trichoderma reesei QM53 was purchased from the U.S. Culture Collection.

[0069] In one or more specific embodiments of the present invention, the specific method for constructing the glucose oxidase expression strain in step S5 includes: using Trichoderma reesei Q53G as the starting strain; preparing Trichoderma reesei Q53G protoplasts; then co-transforming the pFC33ptrA-5stsgRNA (cbh1*2-cbh2*2) obtained in step S3 and the dGOD-cbh1 obtained in step S4 into the protoplasts of Trichoderma reesei Q53G; after screening and verification, the glucose oxidase strain that is verified to be correct is named QGOX.

[0070] This invention provides a multi-gene editing system for simultaneous expression of multiple tandem sgRNAs in *Trichoderma reesei* using a CRISPR / Cas9 tRNA-spacer system, and its application in expressing the heterologous protein glucose oxidase. When using promoters of *Trichoderma reesei*'s natural cellulose degradation genes to produce heterologous proteins, these promoters can be strongly activated in the presence of inducers, facilitating high-level protein expression, but also simultaneously generating a large amount of endogenous secreted proteins (cellulases), becoming byproducts of the heterologous protein and hindering protein purification. To reduce background proteins, knocking out the major cellulase-encoding genes in large quantities secreted by *Trichoderma reesei* is an important protein expression strategy. Therefore, using Cas9 non-integrative CRISPR / Cas9 technology with polycistronic sgRNA expression, two major cellulase genes, cbh1 and cbh2 (which encode proteins accounting for more than 70% of total cellulase), are simultaneously knocked out, and the heterologous glucose oxidase is precisely located at the cbh1 gene site. Glucose oxidase is then expressed using the strongly inducible promoter Pcbh1 at the cbh1 site.

[0071] Therefore, in one or more specific embodiments of the present invention, a glucose oxidase strain obtained by the above-described establishment method is provided. As mentioned above, this strain is named QGOX. Experiments have shown that the glucose oxidase expression strain QGOX obtained by the above-described establishment method reached a maximum enzyme activity of 180.12 U / mL after 12 days of fermentation, while no enzyme activity was detected in the starting strain Q53G; indicating that QGOX successfully secreted glucose oxidase extracellularly.

[0072] In one or more specific embodiments of the present invention, a method for producing glucose oxidase by fermentation is provided. The method includes: inoculating the above-mentioned glucose oxidase strain into a fermentation medium for fermentation culture, and isolating and obtaining glucose oxidase. The glucose oxidase is capable of being secreted extracellularly, thereby greatly facilitating subsequent isolation and acquisition.

[0073] The specific fermentation conditions include fermentation for 3-14 days at a temperature of 29-35℃ and a rotation speed of 180-220 r / min.

[0074] The fermentation medium can be any medium suitable for Trichoderma fermentation. In one specific embodiment of the present invention, the medium formula is: CaCl2 0.7g / L, MgSO4·7H2O 0.7g / L, KH2PO4 5g / L, (NH4)2SO4 6g / L, corn steep liquor 25g / L, CaCO3 0.8g / L, lactose 45g / L, yeast extract 10g / L, FeSO4·7H2O 5g / L, MnSO4·H2O 1.6g / L, ZnSO4·7H2O 1.4g / L, and CoCl·6H2O 2g / L, sterilized at 115℃ for 30min.

[0075] To better illustrate the purpose, technical solution, and advantages of this invention, the invention will be further described below with reference to specific embodiments. In the following embodiments, the Q53G strain was preserved in our laboratory (the QM53 strain was obtained by knocking out pyr4), and the materials, plasmids, reagents, etc. used were obtained commercially unless otherwise specified.

[0076] Example 1. Construction of a Cas9 non-integrating genomic CRISPR / Cas9 vector pFC33ptrA-5stsgRNA (cbh1*2-cbh2*2) targeting cbh1 and cbh2 knockout

[0077] Construction of autonomously replicating plasmid pFC33ptrA carrying Cas9 and the selection marker ptrA: First, from pFC330 ( CS, Nielsen, JB, Kogle, ME, & Mortensen, UH (2015). A CRISPR-Cas9 system for genetic engineering of filamentous fungi. Plos One, 10(7), e133085.) The Ttef1 partial sequence was amplified using primer pair Ttef1-DF(Pml I) / Ttef1-DR(ptrA). Then, the ptrA expression cassette was amplified from the T-ptrA plasmid using primer pair PtrA-F / PtrA-R(Nhe I). Finally, the two fragments were fused to obtain Ttef1-ptrA. Ttef1-ptrA and pFC330 (a vector containing non-integrative Cas9, selected with pyrG) were both digested with Pml I and NheI, ligated together with T4 DNA ligase, transformed into E. coli DH5α, and then single colonies were picked and verified by primer pair Y-ptrA-F / Y-Nhe IR (1.6kb) PCR. The results are as follows. Figure 2 As shown in Figure B, transformant 2 amplified a 1.6kb band, and sequencing confirmed the sequence was correct, demonstrating successful construction of plasmid pFC33ptrA. A schematic diagram of the construction process is shown below. Figure 2 As shown in Figure A.

[0078] Among them, the primer sequences involved are:

[0079] Y-ptrA-F: GACCATTTCGGTGGCAAGT;

[0080] Y-Nhe IR: GGTTTTTTTATGGGGGGA.

[0081] A schematic diagram of the sgRNA expression cassette of the tRNA-spacer system is shown below. Figure 1 B, according to its design, synthesized a 5stsgRNA expression cassette (cbh1*2-cbh2*2) containing two sgRNA expression cassettes targeting cbh1 and cbh2, with Bgl II and Pac I restriction sites at both ends. See schematic diagram. Figure 2 As shown in C.

[0082] Constructing a Cas9 non-integrating genomic CRISPR / Cas9 vector pFC33ptrA-5stsgRNA(cbh1*2-cbh2*2) targeting cbh1 and cbh2 knockout: The 5stsgRNA (cbh1*2-cbh2*2) fragment containing Bgl II and Pac I restriction sites was digested with the autonomously replicating plasmid pFC33ptrA carrying Cas9 and the selection marker ptrA using Bgl II and Pac I, ligated together with T4 DNA ligase, transformed into E. coli DH5α, and then single colonies were picked and verified by PCR using primers Y-sg-F / Y-sg-R. The results are as follows. Figure 2 As shown in Figure D, the correct transformant shows a 1.4kb band, and sequencing confirmed that the sequence was correct, proving that pFC33ptrA-5stsgRNA(cbh1*2-cbh2*2) was successfully constructed.

[0083] Among them, the primer sequences involved are:

[0084] Y-sg-F: TGCCTCTGGTCAGTTGGTCT;

[0085] Y-sg-R: ACTTGGGCGGTGATTCTG.

[0086] Example 2. Construction of glucose oxidase expression strain QGOX

[0087] Construction of glucose oxidase expression donor DNA: First, using primer pair CBH1-UF1 / Pcbh1-R (Sp-cbh1) with *Trichoderma reesei* Q53G chromosome as template, the cbh1 promoter Pcbh1 carrying the cbh1 signal peptide was amplified as the upstream homologous arm. Simultaneously, using primer pair Sp-cbh1(gox) / GOD-R(6xHis) with *A. niger* FGX55 chromosome as template, the glucose oxidase *gox* gene was amplified. Then, using primer pair cbh1-F2(6XHis) / CBH1-DR2 with *Trichoderma reesei* Q53G chromosome, the Tcbh1 terminator was amplified as the downstream homologous arm. Finally, the three amplified fragments were fused to obtain the donor DNA fusion fragment (dGOD-cbh1) for targeted expression of glucose oxidase. A schematic diagram of the dGOD-cbh1 construction is shown below. Figure 3 As shown in Figure A.

[0088] Among them, the primer sequences involved are:

[0089] CBH1-UF1:TTGTGAAGTCGGTAATCCC;

[0090] Pcbh1-R(Sp-cbh1): AGATGACGGCCAACTTCCGATACATTGGGTTTCTGTGCCTCAA;

[0091] Sp-cbh1(gox):ATGTATCGGAAGTTGGCCGTCATCTCGGCCTTCTTGGCCACAGCTCGTGCTATGCAGACTCTCCTTGTGAGCT;

[0092] GOD-R(6xHis):CTAATGATGATGATGATGATGCTGCATGGAAGCATAATCTTCC;

[0093] cbh1-F2(6XHis):CATCATCATCATCATCATTAGAGGTCCTGAACCCTTACTAC;

[0094] CBH1-DR2:ATTCCCCATTCAGTCAG.

[0095] Genetic transformation of Trichoderma reesei Q53G was performed using a PEG / CaCl2-mediated protoplast transformation method, with the pyridine thiamine resistance gene ptrA as the selection marker.

[0096] The purified glucose oxidase donor DNA fusion fragment (dGOD-cbh1) and the Cas9 non-integrative genomic CRISPR / Cas9 vector pFC33ptrA-5stsgRNA (cbh1*2-cbh2*2) targeting cbh1 and cbh2 knockout were co-transformed into Trichoderma reesei Q53G protoplasts. The protospacer in the four designed sgRNAs paired with the DNA strands of the target genes on the genome to identify different locations in the cbh1 and cbh2 genes, guiding Cas9 to cleave the DNA three to four bases before the PAM position. Subsequently, homologous recombination occurred between the homologous donor DNA fragment and the sequences flanking the cbh1 target site. A schematic diagram of this process is shown below. Figure 3 As shown in Figure A, transformants were screened by adding 6‰ pyridinethiamine hydrobromide to the plate. Genomic DNA extracted from the transformants was used as a template for gene PCR verification using primers. If the verification was successful, the *Trichoderma reesei* glucose oxidase expression strain QGOX was constructed.

[0097] The upstream anchoring fragment (3.0 kb) was amplified using primer pairs Y-CBH1-UF2 / Y-GOD-R2; the downstream anchoring fragment (2.6 kb) was amplified using primer pairs Y-GOD-F3 / Y-CBH1-DR3. The results are as follows: Figure 2As shown in D, the selected target transformant QGOX can amplify the corresponding fragment, while the starting strain Q53G cannot amplify the band. A schematic diagram of QGOX upstream and downstream anchoring verification is shown below. Figure 3 As shown in B.

[0098] Among them, the primer sequences involved are:

[0099] Y-CBH1-UF2:GGGTTTGGAGCAATGTGG;

[0100] Y-GOD-R2: AGAAGGTCCCACACATCG;

[0101] Y-GOD-F3: CTGGAGCCCCTTGGTAT;

[0102] Y-CBH1-DR3:TCTCCTATGTCTGCTCGG.

[0103] The cbh1 and cbh2 genes were amplified using primer pairs Y-cbh1-F4 / Y-cbh1-R4 (1.3kb) and Y-cbh2-F5 / Y-cbh2-R5 (1.3kb), respectively, to verify whether the genes had been knocked out. The results are as follows: Figure 2 As shown in C, if pFC33ptrA-5stsgRNA (cbh1*2-cbh2*2) is successfully transformed into *Trichoderma reesei* but no 1.3kb amplification product is obtained, the starting strain can amplify 1.3kb bands separately. A schematic diagram of the sgRNA cleavage sites of cbh1 and cbh2 is shown below. Figure 3 As shown in ▲▼ in section A.

[0104] Among them, the primer sequences involved are:

[0105] Y-cbh1-F4: ATGGCAGAAATGCTCGTC;

[0106] Y-cbh1-R4:AATGGGTCCGAACTTGAT;

[0107] Y-cbh2-F5: ACTCCAACGACTATTACTC;

[0108] Y-cbh2-R5:CAGTGGGAGTCAAATCGT.

[0109] Example 3. Plate colorimetric analysis of glucose oxidase expression strain QGOX

[0110] Glucose oxidase catalyzes the oxidation of the first hydroxyl group of glucose to form D-glucose-δ-lactone, and simultaneously utilizes molecular oxygen as an electron acceptor to produce hydrogen peroxide. This hydrogen peroxide, catalyzed by horseradish peroxidase (HPR), oxidizes the chromogenic substrate (such as o-anisidine) to produce a colored substance (reddish-brown at 500 nm). Based on this, in this experiment, the QGOX strain was cultured in MM medium with lactose as the sole carbon source for 3 days. The chromogenic solution was prepared, poured onto plates, and incubated at 35°C for 15 min. The results are as follows: Figure 4 The starting strain Q53G showed no color development, while QGOX showed a reddish-brown color, indicating that glucose oxidase was successfully secreted extracellularly.

[0111] Glucose oxidase chromogenic solution: 100 U / mL peroxidase solution, 18% glucose solution, and 1% o-anisidine stock solution. Add 0.8% agarose solution after heating and cooling. For every 10 mL of agarose system, add 2 mL of glucose solution, 150 μL of o-anisidine solution, and 200 μL of peroxidase solution, mix well, and pour into cellulose plates on which transformants are grown. Incubate at 35°C for 15 min.

[0112] Example 4. Enzyme activity analysis of glucose oxidase expression strain QGOX

[0113] Under lactose fermentation conditions, the glucose oxidase activity of QGOX fermentation broth was measured. The results are as follows: Figure 5 As shown, the highest enzyme activity of 180.12 U / mL was reached after 12 days of fermentation, while no enzyme activity was detected in the starting strain Q53G. This indicates that QGOX successfully secreted glucose oxidase into the extracellular space.

[0114] Lactose fermentation medium: CaCl2 0.7g / L, MgSO4·7H2O 0.7g / L, KH2PO4 5g / L, (NH4)2SO4 6g / L, corn steep liquor 25g / L, CaCO3 0.8g / L, lactose 45g / L, yeast extract 10g / L, FeSO4·7H2O 5g / L, MnSO4·H2O 1.6g / L, ZnSO4·7H2O 1.4g / L and CoCl·6H2O 2g / L, sterilized at 115℃ for 30min.

[0115] Glucose oxidase detection solution: o-anisidine stock solution (1% o-anisidine dissolved in methanol as stock solution); o-anisidine solution (0.1 mL of stock solution added to 12 mL of citrate buffer); 18% glucose solution; 100 U / mL horseradish peroxidase solution; 2 M sulfuric acid solution; citrate buffer (pH = 6.0).

[0116] Determination of glucose oxidase activity: 2 mL of o-anisidine solution, 0.3 mL of 18% glucose, and 0.1 mL of horseradish peroxidase solution were mixed in a test tube and incubated at 35°C for 2 min. Then, 0.1 mL of diluted sample was added and the reaction was allowed to proceed for another 3 min. Finally, 2 mL of 2M sulfuric acid solution was added to terminate the reaction and the mixture was stirred. The absorbance was measured at 500 nm, and the enzyme activity was calculated based on the standard curve.

[0117] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of them. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention. Although the specific embodiments of the present invention have been described above, they are not intended to limit the protection scope of the present invention. Those skilled in the art should understand that various modifications or variations that can be made by those skilled in the art without creative effort based on the technical solutions of the present invention are still within the protection scope of the present invention.

Claims

1. A method for establishing Trichoderma reesei CRISPR / Cas9 using a plurality of tRNA tandem sgRNA expression, characterized by, The method comprises the following steps: S1, construct containing ptrA plasmids for resistance selection markers and Cas9 expression cassettes; S2, design and synthesize an sgRNA expression cassette comprising two targeting cbh1 and cbh2 sgRNAs; S3, construct targeting cbh1 and cbh2 knockout CRISPR / Cas9 vectors; S4, constructing a donor DNA fusion fragment expressing glucose oxidase; S5, constructing a glucose oxidase expression strain by using a multi-gene editing system for simultaneously expressing multiple sgRNAs by CRISPR / Cas9 using a tRNA-spacer system in Trichoderma reesei; In the step S1, the plasmid is specifically pFC33ptrA, which can be obtained by the following method: pFC330 was amplified with primer pair Ttefl-DF (Pml I) / Ttefl-DR (ptrA) from T tef1 part of the sequence; then primer pair PtrA-F / PtrA-R (Nhe I) was used to amplify the rest of the sequence from T ptrA plasmid ptrA expression cassette; finally, the two fragments were fused to get T tef1 - ptrA ; the T tef1 - ptrA tefl-1 gene was amplified from pFC330 with primer pair Ttefl-DF (Pml I) / Ttefl-DR (ptrA) and the T Pml I, Nhe I digested, ligated together with T4 DNA ligase, and transformed into E. coli DH5α. The sgRNA expression cassette in the step S2 contains two sgRNAs targeting cbh1 and cbh2 Specifically, the sgRNA expression cassette is 5stsgRNA(cbh1*2-cbh2*2), which is obtained by gene synthesis of the sequence as shown in SEQ ID NO. 2 5S rRNA as a promoter, contains two sgRNAs targeting cbh1 and cbh2 spaced by a Trichoderma reesei glycine-encoding tRNA for each sgRNA and terminated by T6. Each sgRNA comprises a protospacer and a scaffold sequence as shown in SEQ ID NO.

3. In the step S3, the targeting cbh1 and cbh2 The specific method for positioning the knockout CRISPR / Cas9 vector comprises: connecting the plasmid containing the sgRNA expression cassette targeting ptrA the resistance screening marker and the Cas9 expression cassette obtained after the enzyme digestion of the plasmid containing the sgRNA expression cassette comprising the two targeting cbh1 and cbh2 sgRNAs to obtain a CRISPR / Cas9 vector containing the sgRNA targeting cbh1 and cbh2 the sgRNAs, which is named as pFC33ptrA-5stsgRNA(cbh1*2-cbh2*2). The donor DNA fusion fragment for expressing glucose oxidase is constructed in step S4, and the specific method comprises: amplifying P cbh1 as the upstream homologous arm; amplifying the glucose oxidase gene from the FGX55 chromosome as the downstream homologous arm; and then fusing the amplified fragments to obtain the donor DNA fusion fragment dGOD-cbh1 for expressing glucose oxidase. A.niger as the upstream homologous arm; amplifying the glucose oxidase gene from the FGX55 chromosome as the downstream homologous arm; and then fusing the amplified fragments to obtain the donor DNA fusion fragment dGOD-cbh1 for expressing glucose oxidase. gox as the upstream homologous arm; amplifying the glucose oxidase gene from the FGX55 chromosome as the downstream homologous arm; and then fusing the amplified fragments to obtain the donor DNA fusion fragment dGOD-cbh1 for expressing glucose oxidase. cbh1 as the upstream homologous arm; amplifying the glucose oxidase gene from the FGX55 chromosome as the downstream homologous arm; and then fusing the amplified fragments to obtain the donor DNA fusion fragment dGOD-cbh1 for expressing glucose oxidase. The Trichoderma reesei Q53G strain is obtained by knocking out the gene pyr4 from the Trichoderma reesei QM53 strain The Trichoderma reesei Q53G strain is obtained by knocking out the gene In the step S5, the specific method for constructing the glucose oxidase expression strain comprises the following steps: taking Trichoderma reesei Q53G as a starting strain; preparing protoplasts of Trichoderma reesei Q53G, and then co-transfecting the protoplasts of Trichoderma reesei Q53G with the pFC33ptrA-5stsgRNA(cbh1*2-cbh2*2) obtained in the step S3 and the dGOD-cbh1 obtained in the step S4, screening and verifying, verifying the correct glucose oxidase strain, and naming it as QGOX.

2. The glucose oxidase strain obtained by the method of claim 1.

3. A method for the fermentative production of glucose oxidase, characterized in that, The method comprises the following steps: inoculating the glucose oxidase strain of claim 2 into a fermentation medium for fermentation culture, and isolating and obtaining glucose oxidase.

Citation Information

Patent Citations

  • Novel Trichoderma host cell and application thereof

    CN108251310A

  • Methods and compositions for multiplex RNA guided genome editing and other RNA technologies

    US20160264981A1

  • Visualized Screening Method for Aspergillus Recombinant Strains with Multigene Editing

    US20220177925A1