Meat-type duck breast muscle rate related snp molecular marker and application thereof

By identifying SNP loci associated with breast muscle percentage on chromosome NC_051772.1 of meat-type ducks, and combining this with molecular marker-assisted selection, the problem of low breast muscle percentage in domestic meat-type ducks was solved, resulting in a significant improvement in breeding efficiency and breast muscle percentage.

CN116219029BActive Publication Date: 2026-06-02JIANGSU INST OF POULTRY SCI +2
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310025898.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-01-09
Publication Date
2026-06-02
Estimated Expiration
2043-01-09

AI Technical Summary

Technical Problem

Domestic meat-type ducks generally have a smaller breast muscle ratio, making them less competitive in the market than foreign breeds. Conventional breeding methods gradually reduce genetic progress after a certain stage of selection, resulting in poorer breeding outcomes.

Method used

Genome-wide association analysis identified SNP loci on chromosome NC_051772.1 of meat-type ducks that were significantly associated with pectoral muscle rate. Primer pairs were designed for PCR amplification and sequencing to identify genotypes, and molecular marker-assisted selection was performed in combination with phenotypes.

Benefits of technology

It significantly improved the breast muscle rate of meat-type ducks, providing a reliable means to accelerate the breeding process and select meat-type ducks with faster growth rate and higher meat yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116219029B_ABST
    Figure CN116219029B_ABST
Patent Text Reader

Abstract

The application relates to the field of biotechnology and poultry breeding, and particularly discloses a molecular marker related to the breast muscle rate of meat-type ducks and application thereof. The molecular marker comprises a G->A single nucleotide polymorphism (SNP) mutation site, and the SNP mutation is located at the 140666858th site of duck chromosome 1 NC_051772.1. The mutation site significantly affects the breast muscle rate of meat-type ducks, and the breast muscle rate of the AA genotype is significantly higher than that of the GG genotype and the GA genotype. By using the site to implement molecular marker-assisted selection, the selection efficiency of the breast muscle rate of meat-type ducks can be improved, and the breeding process of meat-type ducks can be accelerated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of biotechnology and poultry breeding, specifically to a SNP molecular marker that is significantly associated with breast muscle rate in meat-type ducks and its application. Background Technology

[0002] The meat-type ducks described in this invention are duck breeds suitable for meat production, including dual-purpose local Muscovy ducks, Beijing ducks, and Cherry Valley ducks. In conventional breeding of meat-type ducks, the primary consideration is the breast muscle yield (i.e., breast muscle percentage), as the size of the breast muscle percentage directly determines the economic benefits of commercial raising of this breed. Compared to foreign breeds, domestic meat-type ducks generally have a smaller breast muscle percentage, resulting in significantly lower market competitiveness. With the development of molecular biotechnology, marker-assisted selection using molecular markers associated with traits can accelerate the genetic progress of target traits and improve breeding efficiency. To expedite the selection of breast muscle percentage in domestic meat-type ducks, it is necessary to screen for reliable molecular markers for breast muscle percentage in domestic meat-type ducks.

[0003] The current conventional breeding method involves calculating breeding values ​​through pedigree and phenotypic analysis, and then selecting and mating based on these values. This method has some effectiveness in breeding practice, but as breeding progresses to a certain stage, genetic progress gradually decreases, and the breeding effect gradually deteriorates.

[0004] Therefore, this invention is proposed. Summary of the Invention

[0005] With the development of molecular biology techniques, individuals can now be genotyped at the genomic level, and molecular markers that significantly influence specific phenotypes can be identified by combining phenotypic data with molecular marker-assisted selection in breeding. These important molecular markers can be used in conjunction with pedigree and phenotypic values ​​for marker-assisted selection, improving selection effectiveness. For specific breeds and traits, the key is to find molecular markers that have a significant impact on phenotype and can be quickly identified. This study measured the pectoral muscle rate of a meat-type duck population at market age, collected blood samples from each individual, and performed genome resequencing. Using GWAS, a molecular marker significantly associated with pectoral muscle rate was identified. Statistical analysis of this molecular marker and phenotype revealed significant differences in pectoral muscle rate among different genotypes at this locus.

[0006] This invention measures the breast muscle rate of meat-type ducks, collects blood samples from each individual, resequencing their genomes. Using the GWAS method, a molecular marker significantly associated with breast muscle rate is identified. Statistical analysis of this molecular marker and phenotype reveals significant differences in breast muscle rate among different genotypes at this locus.

[0007] In a first aspect, the present invention provides a single nucleotide polymorphism (SNP) molecular marker associated with breast muscle rate in meat-type ducks, characterized in that the SNP molecular marker comprises an SNP site located at position 140666858 on chromosome NC_051772.1 of meat-type ducks, the nucleotide base of which is G or A, and the genotype of which is GG, GA or AA.

[0008] Furthermore, the pectoral muscle percentage of individuals with the AA genotype at the SNP locus was significantly higher than that of individuals with the GG and GA genotypes, and the pectoral muscle percentage of individuals with the GA genotype was significantly higher than that of individuals with the GG genotype.

[0009] In some specific embodiments, the base sequence of the SNP molecular marker is shown in SEQ ID NO:3.

[0010] The present invention also provides a primer pair for identifying or amplifying the SNP molecular markers of any one of claims 1-3.

[0011] In one specific embodiment, the nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO:1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:2.

[0012] This invention provides a method for evaluating the breast muscle rate of meat-type ducks, characterized in that the method includes detecting the genotype of the SNP site in the SNP molecular marker, wherein the breast muscle rate of individuals with the AA genotype at the SNP site is significantly higher than that of individuals with the GG and GA genotypes, and the breast muscle rate of individuals with the GA genotype is significantly higher than that of individuals with the GG genotype.

[0013] Preferably, the method includes the following steps:

[0014] (4) Extract total DNA from the duck genome to be tested;

[0015] (5) Using the total DNA from (1) as a template, perform PCR amplification using the primer pair;

[0016] (6) Sequencing the PCR amplification products to determine the genotype of the SNP site in the duck to be tested.

[0017] The present invention also provides the application of the SNP molecular markers related to breast muscle rate in meat-type ducks in the breeding of meat-type duck breeds, characterized in that the application includes the evaluation of breast muscle rate in meat-type ducks.

[0018] The present invention has the following beneficial effects:

[0019] This invention utilizes genome-wide association analysis to discover for the first time a SNP (G / A) on chromosome NC_051772.1 of meat-type ducks that is significantly associated with breast muscle rate. This locus significantly affects breast muscle rate in meat-type ducks, and the AA genotype is the superior genotype.

[0020] Therefore, the present invention provides a molecular marker (SEQ ID) containing the SNP and its flanking sequences.

[0021] The molecular marker NO:3 and a pair of upstream and downstream primers (SEQ ID NO:1 and SEQ ID NO:2) were used to genotype the molecular marker. Based on the genotyping results, molecular marker-assisted selection was carried out, providing a reliable means for breeding or cultivating meat-type ducks with faster growth rate and higher meat yield. Attached Figure Description

[0022] Figure 1 The Manhattan plot for genome association analysis shows that a locus on chromosome NC_051772.1 is significantly associated with breast muscle rate in meat-type ducks;

[0023] Figure 2 Agarose gel electrophoresis image of the amplification products;

[0024] Figure 3 Peak diagrams for three genotypes: GG, GA, and AA. Detailed Implementation

[0025] Example 1: Identification of SNP molecular markers

[0026] Blood was collected from the wing veins of 500 market-age meat-type ducks. After slaughter and dissection, the breast muscle weight and eviscerated weight were measured, and the breast muscle percentage was calculated. Genomic DNA was then extracted, and whole-genome breast muscle percentage sequencing was performed using the Illumina HiSeq X-Ten sequencing platform, with a sequencing depth of 10× per individual. After quality control, the data were sequenced and genotypes extracted using BWA and GATK software. Combined with breast muscle percentage and genotyping data, a mixed linear model GWAS analysis was performed using rMVP software. The results showed that locus 140666858 on chromosome 1 (NC_051772.1) (G to A mutation) was significantly associated with breast muscle percentage in meat-type ducks. Figure 1 As shown in the figure, the arrow indicates the NC_051772.1:140666858 locus. The pectoral muscle prevalence was 9.94% for the GG genotype, 10.60% for the GA genotype, and 11.12% for the AA genotype (P = 1.5e-05). The number of individuals with the GG, GA, and AA genotypes were 387, 159, and 30, respectively, conforming to the Hardy-Weinberg equilibrium (P = 0.1606).

[0027] Example 2: Primer design for identifying the nucleotide polymorphism of NC_051772.1:140666858

[0028] Based on the whole-genome sequencing results of Example 1, primers were designed to identify the nucleotide polymorphism at the NC_051772.1:140666858 site on the duck genome, as follows:

[0029] Upstream primer: GCTTGGTGCACGTGCTTATT (SEQ ID NO:1)

[0030] Downstream primer: CAGCCAGCCAAGCTCTTCTA (SEQ ID NO:2)

[0031] The amplified product bands are as follows:

[0032] gcttggtgcacgtgcttatttcttgataaggtctagcttccttttcccttaagc

[0033] aaatgagggcattttataatgattcttagcagcaaagagggggctttgtccttt

[0034] gttttcctttggctttaccagtggtaatgccctagtatctggtaggttgctggt

[0035] tgtgtgaggcctgtgatgctattttttctagtattgagcggagraggttgatgt

[0036] taacgacatggatgccgtatcataatttttttacactcagcctctacagagagc

[0037] ctatgtttttttcaggaagcattcccatttgtttgaaaaattagaacggcttaa

[0038] ttgtagggtggaggtagaagagcttggctggctg(SEQ ID NO:3), where r is G or A.

[0039] Example 3: Genotyping verification of meat-type duck population

[0040] Experimental materials: A population of 600 ducks other than those whose genomes were resequencing for meat-type ducks.

[0041] Obtain the genotype of each individual:

[0042] 1. Measure the breast muscle rate of 600 ducks.

[0043] 2. Blood sample collection: Blood was collected from the wing veins of each duck using EDTA2K vacuum blood collection tubes and stored at -20℃ for later use.

[0044] 3. Genomic DNA extraction from whole blood.

[0045] 4. Genotype determination: Genomic DNA from each duck was used as a template, and PCR amplification was performed using the primers designed in Example 2. The agarose gel electrophoresis image of the amplification products is shown below. Figure 2 As shown. Wells 1 and 7 contain D2000 markers, and the remaining wells contain amplification products.

[0046] The obtained products were sequenced using Sanger sequencing to determine the genotype of each individual. The peak shapes for the three genotypes (GG, GA, and AA) are shown below. Figure 3 As shown.

[0047] Example 4: Validation of SNP loci-phenotype association analysis

[0048] 1. Grouping by different genotype information: Based on the sequence information, view the genotype of the mutation site. According to the genotype, it is divided into GG genotype group, GA genotype group and AA genotype group, with 345, 178 and 77 in each group respectively.

[0049] 2. The pectoral muscle percentages of the GG, GA, and AA genotype groups were 9.35%, 10.07%, and 11.85%, respectively. Analysis of variance (ANOVA) on the pectoral muscle percentages of different genotype groups revealed a highly significant correlation between genotype differences and pectoral muscle percentage. Specifically, the pectoral muscle percentage of the AA genotype group was significantly higher than that of the GG and GA genotype groups, while the pectoral muscle percentage of the GA genotype group was also significantly higher than that of the GG genotype group. This indicates that the A allele is a superior allele that can significantly increase pectoral muscle percentage.

Claims

1. A method for evaluating the breast muscle percentage of meat-type ducks, characterized in that, The method includes detecting the genotype of a SNP locus located at position 140666858 on chromosome NC_051772.1 of meat-type ducks. The genotype at this locus is GG, GA, or AA. Individuals with the AA genotype at the SNP locus have significantly higher pectoral muscle percentages than those with the GG and GA genotypes, and the pectoral muscle percentage of individuals with the GA genotype is significantly higher than that of individuals with the GG genotype. The base sequence of the SNP molecular marker containing the SNP locus is shown in SEQ ID NO:3, where position 206 is "r", where "r" represents G or A. The detection process for the genotype at the aforementioned SNP locus includes the following steps: (1) Extract total DNA from the genomic genome of the duck to be tested; (2) Using the total DNA from (1) as a template, PCR amplification was performed using a primer pair consisting of an upstream primer with nucleotide sequence SEQ ID NO:1 and a downstream primer with nucleotide sequence SEQ ID NO:2; (3) Sequencing the PCR amplification product from step (2) to determine the genotype of the duck SNP site to be tested.

2. The application of the method for evaluating breast muscle rate in meat-type ducks as described in claim 1 in the breeding of meat-type duck breeds, characterized in that, This application selects meat-type duck breeds based on the evaluation of breast muscle rate in meat-type ducks.