Application of sfrp2 gene single specific site methylation detection, tumor diagnosis reagent and system

Abstract

The present application relates to the technical field of gene diagnosis, in particular to the application of SFRP2 gene single specific site methylation detection, tumor diagnosis reagent and system. The present application firstly uses the methylation of SFRP2 gene single specific site chr4: 153781309 as a biomarker for detecting, predicting or monitoring the preparation of tumor development products, compared with other known methylation sites, which can effectively detect tumor patients. Further, on the basis of the methylation detection of the above site chr4: 153781309, the present application combines the methylation of the specific site and the methylation of other sites of SFRP2 gene, which can significantly improve the detection sensitivity and specificity.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic diagnosis, in particular to the application of SFRP2 gene single specific site methylation detection, tumor diagnosis reagent and system. BACKGROUND

[0002] In recent years, DNA methylation is considered to be the most promising tumor marker. DNA methylation refers to the covalent bond of a methyl group to the 5th carbon position of cytosine under the action of DNA methyltransferase, thereby changing the function of DNA. Numerous studies have confirmed that DNA methylation is involved in the regulation of the whole process of tumor occurrence and development. The promoter region of the tumor suppressor gene in normal cells is in a low methylation state, and the downstream DNA normally expresses tumor suppressor proteins. However, in tumor cells, the promoter region shows high methylation, which inhibits the normal expression of tumor suppressor genes. Therefore, the academic community generally believes that DNA methylation changes often precede the occurrence of tumors or are the earliest detectable tumor-related indicators.

[0003] SFRP2 methylation has been confirmed to be related to intestinal cancer and has the potential to be an intestinal cancer marker. However, its clinical diagnostic effect is uneven, for example, (1) there are obvious differences in sensitivity and specificity when different methods are used to detect SFRP2 gene. In the reported hybridization method, the detection sensitivity and specificity are 61.1% and 77.7%, respectively, while in the fluorescence method, the corresponding sensitivity and specificity are 86.3% and 77.3%, respectively; (2) there are obvious differences in sensitivity and specificity of SFRP2 methylation for intestinal cancer diagnosis in different studies, and the sensitivity and specificity fluctuate in a large range; some studies report that the sensitivity of SFRP2 methylation for intestinal cancer detection is 77% to 90%, and the specificity is 77%, while other studies show that the sensitivity of SFRP2 promoter region methylation for intestinal cancer detection is 57%, and the specificity is 90%.

[0004] The main reason for the above-mentioned sensitivity and specificity differences is that the existing detection technology actually detects the overall methylation level of a region of the SFRP2 gene. With the in-depth study of methylation, more and more studies have found that the clinical specificity of DNA methylation in different regions of a gene is quite different, and even within the same region, a single methylation site shows significant biological significance.

[0005] Therefore, the present application is proposed. SUMMARY

[0006] The purpose of the present application is to provide SFRP2 gene site-specific methylation as a first biomarker for the preparation of a product for detecting, predicting or monitoring tumor development, so as to improve the stability of the detection.

[0007] Another object of the present application is to provide a reagent, a kit and a detection system for detecting the site-specific methylation of SFRP2 gene based on the above-mentioned application, so as to realize the early and rapid screening of tumors.

[0008] To solve the above technical problems and achieve the above objects, the present application provides the following technical solutions.

[0009] In a first aspect, the present application provides an application of the single site-specific methylation of SFRP2 gene as a first biomarker in the preparation of a product for detecting, predicting or monitoring tumor development, wherein the single site-specific methylation of SFRP2 gene is chr4: 153781309.

[0010] In a second aspect, the present application provides an application of the methylation of site-specific chr4: 153781309 of SFRP2 gene and a second biomarker in the preparation of a product for detecting, predicting or monitoring tumor development, wherein the second biomarker is selected from (i) and / or (ii):

[0011] (i) at least one of the site-specific methylation of SFRP2 gene in (a)-(d), (a) the site-specific chr4: 153789201 of SFRP2 gene, (b) the site-specific chr4: 153789431 of SFRP2 gene, (c) the site-specific chr4: 153788844 of SFRP2 gene, and (d) the site-specific chr4: 153788604 of SFRP2 gene;

[0012] (ii) at least one of the methylation of SFRP2 gene region in (e)-(f), (e) the region chr4: 153786860-153789009 of SFRP2 gene, and (f) the region chr4: 153789010-153789700 of SFRP2 gene.

[0013] In a third aspect, the present application provides a tumor diagnostic reagent, wherein the reagent comprises a specific primer pair for detecting the methylation level of the single site-specific chr4: 153781309, chr4: 153789201, chr4: 153789431, chr4: 153788844 or chr4: 153788604 of SFRP2 gene, and the specific primer pair comprises a forward primer and a capture primer:

[0014] wherein the forward primer for detecting the site-specific chr4: 153781309 of SFRP2 gene has the nucleotide sequence shown in SEQ ID No. 1, and the capture primer has the nucleotide sequence shown in SEQ ID No. 2;

[0015] The forward primer for detecting the specific site chr4: 153789201 of SFRP2 gene has the nucleotide sequence shown in SEQ ID No. 7, and the capture primer has the nucleotide sequence shown in SEQ ID No. 19;

[0016] The forward primer for detecting the specific site chr4: 153789431 of SFRP2 gene has the nucleotide sequence shown in SEQ ID No. 10, and the capture primer has the nucleotide sequence shown in SEQ ID No. 20;

[0017] The forward primer for detecting the specific site chr4: 153788844 of SFRP2 gene has the nucleotide sequence shown in SEQ ID No. 13, and the capture primer has the nucleotide sequence shown in SEQ ID No. 21;

[0018] The forward primer for detecting the specific site chr4: 153788604 of SFRP2 gene has the nucleotide sequence shown in SEQ ID No. 16, and the capture primer has the nucleotide sequence shown in SEQ ID No. 22;

[0019] Preferably, the diagnostic reagent further comprises a reverse primer.

[0020] Further preferably, the nucleotide sequence of the reverse primer comprises GCCTGTCAGCCAACGGTATTCATC (SEQ ID No. 3).

[0021] In an optional embodiment, the nucleotide sequence of the forward primer for detecting the specific site chr4: 153781309 of SFRP2 gene is shown in SEQ ID No. 4, the nucleotide sequence of the capture primer is shown in SEQ ID No. 5, and the nucleotide sequence of the probe is shown in SEQ ID No. 6.

[0022] In an optional embodiment, the reagent further comprises a specific primer pair and a probe for detecting a second biomarker, wherein the specific primer pair and the probe for detecting the second biomarker comprise at least one of (I) to (VI):

[0023] (I) the nucleotide sequence of the capture primer for detecting the methylation of (a) the specific site chr4: 153789201 of SFRP2 gene is shown in SEQ ID No. 8, and the nucleotide sequence of the probe is shown in SEQ ID No. 9;

[0024] (II) the nucleotide sequence of the capture primer for detecting the methylation of (b) the specific site chr4: 153789431 of SFRP2 gene is shown in SEQ ID No. 11, and the nucleotide sequence of the probe is shown in SEQ ID No. 12;

[0025] (III) the nucleotide sequence of the capture primer for detecting the methylation of the specific locus chr4: 153788844 of the SFRP2 gene (c) is shown as SEQ ID No. 14, and the nucleotide sequence of the probe is shown as SEQ ID No. 15;

[0026] (IV) the nucleotide sequence of the capture primer for detecting the methylation of the specific locus chr4: 153788604 of the SFRP2 gene (d) is shown as SEQ ID No. 17, and the nucleotide sequence of the probe is shown as SEQ ID No. 18.

[0027] In an optional embodiment, the probe sequence is labeled with at least one fluorescent group; the fluorescent group is selected from FAM, VIC, CY5, HEX, JOE, ROX, TAMRA, TET, Texas Red, or CY3.

[0028] Based on the third aspect, the fourth aspect, the present application provides a tumor diagnosis kit, which comprises the reagent of any one of the foregoing embodiments and optional consumables.

[0029] The fifth aspect, the present application provides a system for detecting, predicting or monitoring tumor development, which comprises:

[0030] a detection module for detecting the methylation level of the SFRP2 gene of a known sample and a to-be-detected sample using the reagent of any one of the foregoing embodiments or the kit of the foregoing embodiment;

[0031] a comparison module for determining a judgment reference data according to the methylation state data of the known sample, comparing the methylation state of the SFRP2 gene of the to-be-detected sample obtained by the detection module with the judgment reference data, and outputting an evaluation result of the tumor development of the animal according to the closeness of the two.

[0032] The reference data is derived from at least one of the following populations: (a) non-tumor patients, (b) tumor patients.

[0033] In an optional embodiment, the to-be-detected sample is derived from the feces, tissue or body fluid of the detection population.

[0034] In an optional embodiment, the tumor comprises an advanced adenoma.

[0035] Optionally, the tumor comprises colorectal cancer.

[0036] Optionally, the tumor comprises colorectal cancer advanced adenoma.

[0037] The application first uses the methylation of a single specific site chr4: 153781309 of the SFRP2 gene as a biomarker for detecting, predicting or monitoring tumor development, and compared with other known methylation sites, can effectively detect tumor patients. Further, based on the methylation detection of the site chr4: 153781309, the application combines the methylation of the site with the methylation of other sites of the SFRP2 gene, which can significantly improve the detection sensitivity and specificity.

[0038] The application also provides reagents, kits and systems for tumor diagnosis for detecting methylation including the site chr4: 153781309. The reagents, kits and systems are for detecting the site-specific methylation of the SFRP2 gene, and compared with the prior art method for detecting the SFRP2 gene fragment, do not need to perform methylation conversion, significantly improve the detection efficiency, and reduce the detection cost. BRIEF DESCRIPTION OF DRAWINGS

[0039] In order to more clearly illustrate the specific embodiments of the application or the technical solutions in the prior art, the drawings needed in the specific embodiments or the prior art description will be briefly introduced below. Obviously, the drawings in the following description are some embodiments of the application, and those skilled in the art can also obtain other drawings according to these drawings without creative labor.

[0040] Figure 1 ROC curve results of the site chr4: 153781309 in the experimental examples of the application;

[0041] Figure 2 ROC curve results of the site chr4: 153788844 in the experimental examples of the application;

[0042] Figure 3 ROC curve results of the site chr4: 153789431 in the experimental examples of the application;

[0043] Figure 4 ROC curve results of the site chr4: 153789201 in the experimental examples of the application;

[0044] Figure 5 ROC curve results of the site chr4: 153788604 in the experimental examples of the application;

[0045] Figure 6 ROC curve results of model 1 in the experimental examples of the application. DETAILED DESCRIPTION

[0046] In order to make the objects, technical solutions and advantages of the embodiments of the present application clearer, the following will be combined with the accompanying drawings to make a clear and complete description of the technical solutions in the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. The components of the embodiments of the present application described and shown in the accompanying drawings can be arranged and designed in various different configurations.

[0047] Therefore, the following detailed description of the embodiments of the present application provided in the accompanying drawings is not intended to limit the scope of the claimed present application, but only represents selected embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor are within the scope of protection of the present application.

[0048] It should be noted that: similar reference numerals and letters represent similar items in the following drawings, therefore, once an item is defined in one drawing, it does not need to be further defined and explained in the subsequent drawings.

[0049] The full-length region of the SFRP2 gene is chr4: 153780360-153789700, and the gene data is from: UCSC Genome Browser on Human Dec. 2013 (GRCh38 / hg38) Assembly.

[0050] In a specific embodiment, in the first aspect, the present application provides the use of the methylation of a single specific site of the SFRP2 gene as a first biomarker in the preparation of a product for detecting, predicting or monitoring tumor development, and the single specific site of the SFRP2 gene is chr4: 153781309.

[0051] In the second aspect, the present application provides the use of the methylation of the specific site chr4: 153781309 of the SFRP2 gene and a second biomarker in the preparation of a product for detecting, predicting or monitoring tumor development, and the second biomarker is selected from (i) and / or (ii):

[0052] (i) the methylation of at least one specific site of the SFRP2 gene in (a)-(d), (a) the specific site chr4: 153789201 of the SFRP2 gene, (b) the specific site chr4: 153789431 of the SFRP2 gene, (c) the specific site chr4: 153788844 of the SFRP2 gene, and (d) the specific site chr4: 153788604 of the SFRP2 gene;

[0053] (ii) methylation of at least one of the SFRP2 gene regions in (e)-(f), (e) SFRP2 gene region chr4: 153786860-153789009, (f) SFRP2 gene region chr4: 153789010-153789700.

[0054] In a third aspect, the present application provides a tumor diagnostic reagent, which comprises a specific primer pair for detecting the methylation level of the SFRP2 gene single specific site chr4: 153781309, chr4: 153789201, chr4: 153789431, chr4: 153788844 or chr4: 153788604, the specific primer pair comprising a forward primer and a capture primer.

[0055] wherein the forward primer for detecting the SFRP2 gene specific site chr4: 153781309 has the nucleotide sequence shown in SEQ ID No. 1 (TCCTTTAGGTGAAAACAGCTAT), and the capture primer has the nucleotide sequence shown in SEQ ID No. 2 (GTTTGCATCCCCAGCA); the forward primer for detecting the SFRP2 gene specific site chr4: 153789201 has the nucleotide sequence shown in SEQ ID No. 7 (GGGAGGAGCCAATGAAGGGTAAT), and the capture primer has the nucleotide sequence shown in SEQ ID No. 19 (GCAAAACCAGACCCAGA); the forward primer for detecting the SFRP2 gene specific site chr4: 153789431 has the nucleotide sequence shown in SEQ ID No. 10 (CCAGCAGAAACTTCGGACTGG), and the capture primer has the nucleotide sequence shown in SEQ ID No. 20 (GTGCCGCCGGGG); the forward primer for detecting the SFRP2 gene specific site chr4: 153788844 has the nucleotide sequence shown in SEQ ID No. 13 (CGGCCGCCTCGCCCTTC), and the capture primer has the nucleotide sequence shown in SEQ ID No. 21 (GCGACCCCGAGGG); and the forward primer for detecting the SFRP2 gene specific site chr4: 153788604 has the nucleotide sequence shown in SEQ ID No. 16 (CGAGCACAGGAACTTCTTGGTGTC), and the capture primer has the nucleotide sequence shown in SEQ ID No. 22 (GCTTGGATCCCGCT).

[0056] As can be known from the background art, when the detection results of a set of detection primers and probes contain multiple methylation sites, the detection stability will be poor, so when detecting the methylation of the site chr4: 153781309, the interference of other methylation sites should be avoided as much as possible, and therefore, the amplification region of the detection primers and probes should be reduced as much as possible.

[0057] Preferably, the diagnostic reagent further comprises a reverse primer.

[0058] Further preferably, the nucleotide sequence of the reverse primer comprises GCCTGTCAGCCAACGGTATTCATC (SEQ ID No. 3).

[0059] In a specific embodiment provided by the present application, the amplification region of the primer pair and the probe for detecting the methylation of the site chr4: 153781309 is chr4: 153780360-153786859, and the further preferred amplification region is chr4: 153781219-153781309. The corresponding amplification region of the nucleotide sequence of the above-mentioned forward primer comprises TCCTTTAGGTGAAAACAGCTAT (SEQ ID No. 1), and the nucleotide sequence of the capture primer comprises GTTTGCATCCCCAGCA (SEQ ID No. 2), i.e. chr4: 153781219-153781309, and the amplification of the region can realize the detection of the methylation of the single site chr4: 153781309. For the reverse primer and the probe, the person skilled in the art can perform routine design and selection with the purpose of amplifying the above-mentioned region, and in a specific embodiment, the nucleotide sequence of the reverse primer used in the present application is GCCTGTCAGCCAACGGTATTCATC (SEQ ID No. 3).

[0060] In an optional embodiment, the nucleotide sequence of the forward primer for detecting the specific site chr4: 153781309 of the SFRP2 gene is shown in SEQ ID No. 4 (TTTCCTTTAGGTGAAAACAGCTAT), the nucleotide sequence of the capture primer is shown in SEQ ID No. 5 (GCCTGTCAGCCAACGGTATTCATCTTTGTTTGCATCCCCAGCATTCTACAAGATTCGGGTGGGCT), the nucleotide sequence of the reverse primer is shown in SEQ ID No. 3, and the nucleotide sequence of the probe is shown in SEQ ID No. 6 (CCACTCCTGTGGCCTT).

[0061] In an alternative embodiment, the reagent further comprises a specific primer pair and a probe for detecting the second biomarker, wherein the specific primer pair and the probe for detecting the second biomarker comprises at least one of (I) to (VI):

[0062] (I) the nucleotide sequence of the capture primer for detecting the methylation of (a) a specific locus chr4: 153789201 of SFRP2 gene is shown in SEQ ID No. 8 (GCCTGTCAGCCAACGGTATTCATCTTTGCAAAACCAGACCCAGATTATGCAAATCTGGAGGGTGGGG), and the nucleotide sequence of the probe is shown in SEQ ID No. 9 (CGAGGAGGGCTGGTC);

[0063] (II) the nucleotide sequence of the capture primer for detecting the methylation of (b) a specific locus chr4: 153789431 of SFRP2 gene is shown in SEQ ID No. 11 (GCCTGTCAGCCAACGGTATTCATCTTTGTGCCGCCGGGGCCTCTCCCACTCATGCCTGGCA), and the nucleotide sequence of the probe is shown in SEQ ID No. 12 (CCCGGGCTTGTTTTGC);

[0064] (III) the nucleotide sequence of the capture primer for detecting the methylation of (c) a specific locus chr4: 153788844 of SFRP2 gene is shown in SEQ ID No. 14 (GCCTGTCAGCCAACGGTATTCATCTTTGCGACCCCGAGGGGGCCCGGGACAAGCTCGAACTC), and the nucleotide sequence of the probe is shown in SEQ ID No. 15 (CTCCGCTCCCTCTGC);

[0065] (IV) the nucleotide sequence of the capture primer for detecting the methylation of (d) a specific locus chr4: 153788604 of SFRP2 gene is shown in SEQ ID No. 17 (GCCTGTCAGCCAACGGTATTCATCTTTGCTTGGATCCCGCTGTCATCGAGGCAGACGG), and the nucleotide sequence of the probe is shown in SEQ ID No. 18 (CATGAAGCAGTGCCACC);

[0066] In an alternative embodiment, the probe sequence is labeled with at least one fluorescent group, and the fluorescent group is selected from FAM, VIC, CY5, HEX, JOE, ROX, TAMRA, TET, Texas Red or CY3.

[0067] In a fourth aspect, the present application provides a tumor diagnosis kit, which comprises the reagent of any one of the preceding embodiments and optional consumables.

[0068] It should be understood that the optional consumables of the above-mentioned kit are consumable materials packaged with the kit to ensure the smooth implementation of the kit detection, including but not limited to liquid taking devices, reaction vessels, cleaning devices, and liquid mixing devices, etc. Those skilled in the art can make adaptive updates according to the improvement of the consumables of the kit, and the above-mentioned adaptive selection should be understood as the protection scope of the present application without having a decisive influence on the detection results.

[0069] In a fifth aspect, the present application provides a system for detecting, predicting or monitoring tumor development, which comprises:

[0070] a detection module for detecting the methylation level of SFRP2 gene of known samples and to-be-detected samples using the reagent of any one of the preceding embodiments or the kit of the preceding embodiments;

[0071] a comparison module for determining a judgment reference data according to the methylation state data of the known samples, comparing the methylation state of SFRP2 gene of the to-be-detected samples obtained by the detection module with the judgment reference data, and outputting an evaluation result of the development of the tumor of the animal according to the closeness of the two.

[0072] The reference data is derived from at least one of the following groups of people: (a) non-tumor patients, (b) tumor patients.

[0073] In an optional embodiment, the to-be-detected sample is derived from the feces, tissue or body fluid of the detection population.

[0074] In an optional embodiment, the tumor comprises advanced adenoma.

[0075] Optionally, the tumor comprises colorectal cancer.

[0076] Optionally, the tumor comprises colorectal cancer advanced adenoma.

[0077] Some embodiments of the present application will be described in detail below with reference to the accompanying drawings. The following examples and features in the examples can be combined with each other without conflict.

[0078] Example 1

[0079] The embodiment provides a primer pair and a probe for detecting methylation of a site chr4:153781309, the primer pair comprising a forward primer, a capture primer and a reverse primer, the nucleotide sequence of the forward primer being TTTCCTTTAGGTGAAAACAGCTAT, the nucleotide sequence of the capture primer being GCCTGTCAGCCAACGGTATTCATCTTTGTTTGCATCCCCAGCATTCTACAAGATTCGGGTGGGCT, the nucleotide sequence of the reverse primer being GCCTGTCAGCCAACGGTATTCATC, and the nucleotide sequence of the probe being CCACTCCTGTGGCCTT, and the 5' end of the probe being modified by a FAM fluorescent group.

[0080] It should be noted that the probe in the embodiment has other options, and the target site thereof is located in the amplification region chr4:153781219-153781309.

[0081] Embodiment 2

[0082] The embodiment provides a primer pair and a probe for detecting methylation of a site chr4:153789201, the primer pair comprising a forward primer, a capture primer and a reverse primer, the nucleotide sequence of the forward primer being as shown in SEQ ID No. 7, the nucleotide sequence of the capture primer being as shown in SEQ ID No. 8, and the nucleotide sequence of the reverse primer being as shown in SEQ ID No. 3. The nucleotide sequence of the probe is as shown in SEQ ID No. 9, and the 5' end of the probe is modified by a VIC fluorescent group.

[0083] Embodiment 3

[0084] The embodiment provides a primer pair and a probe for detecting methylation of a site chr4:153789431, the primer pair comprising a forward primer, a capture primer and a reverse primer, the nucleotide sequence of the forward primer being as shown in SEQ ID No. 10, the nucleotide sequence of the capture primer being as shown in SEQ ID No. 11, and the nucleotide sequence of the reverse primer being as shown in SEQ ID No. 3. The nucleotide sequence of the probe is as shown in SEQ ID No. 12, and the 5' end of the probe is modified by a VIC fluorescent group.

[0085] Embodiment 4

[0086] The embodiment provides a primer pair and a probe for detecting methylation of a site chr4: 153788844, the primer pair comprising a forward primer, a capture primer and a reverse primer, a nucleotide sequence of the forward primer is shown as SEQ ID No. 13, a nucleotide sequence of the capture primer is shown as SEQ ID No. 14, and a nucleotide sequence of the reverse primer is shown as SEQ ID No. 3. A nucleotide sequence of the probe is shown as SEQ ID No. 15, and a 5' end of the probe is subjected to VIC fluorescent group modification.

[0087] Embodiment 5

[0088] The embodiment provides a primer pair and a probe for detecting methylation of a site chr4: 153788604, the primer pair comprising a forward primer, a capture primer and a reverse primer, a nucleotide sequence of the forward primer is shown as SEQ ID No. 16, a nucleotide sequence of the capture primer is shown as SEQ ID No. 17, and a nucleotide sequence of the reverse primer is shown as SEQ ID No. 3. A nucleotide sequence of the probe is shown as SEQ ID No. 18, and a 5' end of the probe is subjected to VIC fluorescent group modification.

[0089] Experimental Example

[0090] The experimental example comprises 108 fecal samples of colorectal cancer patients, 31 fecal samples of advanced adenoma, and the primer pair and the probe provided in the embodiments 1-5 are used for early screening of intestinal cancer according to the following methods:

[0091] 1. Extract human DNA in feces:

[0092] Any method can be used to obtain human DNA in feces, and in the example, a soil and fecal genomic DNA extraction kit (model number: TD601) from Beijing Tianmo Science and Technology Development Co., Ltd. is used, and the specific operation is as follows:

[0093] (1) Take 2g of fresh fecal sample into a fecal collection tube, and 10ml of preservative (Beijing Tianmo Science and Technology Development Co., Ltd., model number: TR110) is preloaded in the collection tube, mix thoroughly, take 600ul of the mixture into a lysis tube, mix thoroughly on a vortex instrument at the maximum speed for more than 5 minutes, and place the lysis tube in a centrifuge, and centrifuge at ≥10000xg for 1 minute.

[0094] (2) Add 400 μL of the supernatant to No. 3 column F, and put the No. 3 column F into a collection tube, centrifuge at 8000 x g for 1 minute, discard the filter column, add 1200 μL of genomic DNA lysis solution to the collection tube of the previous step, mix thoroughly, put No. 2 column into a new collection tube, and add 700 μL of the mixture to No. 2 column, centrifuge at 10000 x g for 1 minute, and discard the waste liquid in the collection tube.

[0095] (3) Repeat step (2) until all the mixture is used up.

[0096] (4) Put No. 2 column into a new collection tube, add 200 μL of genomic DNA washing solution 1 to No. 2 column, centrifuge at ≥10000 x g for 1 minute, and add 500 μL of genomic DNA washing solution 2 to No. 2 column, centrifuge at ≥10000 x g for 1 minute.

[0097] (5) Repeat step (4), discard the waste liquid in the collection tube, and put No. 2 column back into the collection tube, centrifuge at ≥10000 x g for 2 minutes, and remove the washing solution as much as possible to avoid inhibition of downstream reactions by residual ethanol in the washing solution, move No. 2 column to a clean 1.5 ml centrifuge tube, add 120 μl of genomic DNA elution solution directly to the column matrix, stand at room temperature for 2-5 minutes, centrifuge at ≥10000 x g for 1 minute to elute the genomic DNA, and put the inhibitor removal column into a collection tube, add 600 μL of inhibitor removal solution, and centrifuge at ≥8000 x g for 3 minutes.

[0098] (6) Put the eluted genomic DNA into the prepared inhibitor removal column, put the inhibitor removal column into a clean 1.5 ml centrifuge tube, and centrifuge at 16000 x g for 3 minutes.

[0099] (7) Repeat step (6), and the obtained genomic DNA can be directly used in subsequent methylation detection experiments.

[0100] 2. Enzymatic digestion reaction

[0101] Enzymatic digestion reaction system:

[0102] Composition Concentration Amount of single-hole reaction Taq enzyme buffer 1X 1 μL Gla I (50 U / μL) 12.5U 0.25 μL 200 mM trehalose 20 mM 1 μL DNA 4 μL Water 3.75 μL

[0103] Mix thoroughly, and after instantaneous separation, place in a constant-temperature incubator, 30°C for 20 minutes, 65°C for 30 minutes, and store at 4°C; the product after the reaction is the template for methylation detection.

[0104] 3. Methylation detection:

[0105] PCR reaction system:

[0106]

[0107]

[0108] Composition Main component PCR reaction solution 1 Buffer, dNTP PCR reaction solution 2 Taq DNA polymerase Positive control Methylation positive genome

[0109]

[0110] (1) PCR reaction solution 1, PCR reaction solution 2, primers and positive control were taken out, thawed, shaken for 30 s, and centrifuged for 30 s to prevent reagent residue in the tube cap.

[0111] (2) Reaction solution preparation: according to the number of samples to be amplified and detected, the number of reaction solution tubes to be divided was calculated.

[0112] Composition Main component PCR reaction solution 1 1.8 μL Primer probe 9.6 μL PCR reaction solution 2 0.6 μL

[0113] (3) Dispensing: the prepared reaction solution was dispensed into reaction tubes / reaction plates at 12 μL / tube.

[0114] (4) Sample addition: 8 μL of treated negative control NC, enzyme digestion reaction product and positive control PC were added to each reaction tube with dispensed reaction solution in sequence. After sample addition, the tube cap or film was covered, and short centrifugation was performed for 30 s, and PCR amplification reaction was immediately performed.

[0115] PCR amplification was performed according to the following table.

[0116] PCR amplification program:

[0117]

[0118] Result judgment:

[0119] After the positive control, negative control and internal control were qualified, the sample detection results were judged according to the following table.

[0120]

[0121]

[0122] On the basis of examples 1-5, the detection results were judged by combining 5 sites.

[0123] Combined judgment example:

[0124] Site CT value chr4:153781309 X1 chr4:153788844 X2 chr4:153789431 X3 chr4:153789201 X4 chr4:153788604 X5

[0125] Model 1 (5-site joint detection) [Y = -1.56 * X1 + 0.048 * X2 - 0.437 * X3 + 0.131 * X4 + 0.283 * X5 + 52.899] Model 1 P value calculation p = 1 / (1 + Exp^((-1) x Y))

[0126]

[0127] If the sample detection result is positive, it indicates that the subject has a high risk of colorectal cancer, and if the sample detection result is negative, it does not completely exclude the subject from having colorectal cancer.

[0128] The methylation detection results are shown in the following table:

[0129]

[0130]

[0131]

[0132] The ROC analysis results of the methylation detection results of different sites are shown in Figures 1-6 The ROC curve shown in the figure shows that the AUC value of the chr4: 153781309 site is 0.903, which has good distinguishing ability for intestinal cancer and healthy samples (as shown in Figure 1 ). The AUC value of the chr4: 153788844 site is 0.597, which has poor distinguishing ability for intestinal cancer and healthy samples (as shown in Figure 2 ). The AUC value of the chr4: 153789431 site is 0.591, which has poor distinguishing ability for intestinal cancer and healthy samples (as shown in Figure 3 ). The AUC value of the chr4: 153789201 site is 0.516, which has poor distinguishing ability for intestinal cancer and healthy samples (as shown in Figure 4 ). The AUC value of the chr4: 153788604 site is 0.516, which has poor distinguishing ability for intestinal cancer and healthy samples (as shown in Figure 5 ). Model 1 is a joint diagnosis model of the chr4: 153781309 site and the chr4: 153788844, chr4: 153789431, chr4: 153789201, and chr4: 153788604 sites, and its AUC value for distinguishing intestinal cancer and healthy samples is 0.911 (as shown in Figure 6 ).

[0133] The sensitivity and specificity of different SFRP2 methylation sites in fecal samples are as follows:

[0134] Site Sensitivity Specificity AUC chr4:153781309 80.28％ 89.19％ 0.903 chr4:153788844 19.72％ 97.30％ 0.597 chr4:153789431 66.20％ 48.65％ 0.591 chr4:153789201 83.10％ 35.14％ 0.516 chr4:153788604 52.00％ 56.76％ 0.516 Model 1 81.08％ 83.10％ 0.911

[0135] As can be seen from the table, the fecal sample detection results show that the methylation detection sensitivity and specificity of the single site chr4: 153781309 and model 1 are the best, which can effectively distinguish colorectal cancer patients from non-patients; compared with other single sites and multi-site joint model 1, it is an effective marker for distinguishing intestinal cancer from normal.

[0136] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, and are not intended to limit the present application; although the present application has been described in detail with reference to the above embodiments, those skilled in the art should understand that the technical solutions recorded in the above embodiments can be modified, or some or all of the technical features can be replaced by equivalents; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present application.

Claims

1. The application of a reagent for detecting methylation at a single specific site of the SFRP2 gene as a first biomarker in the preparation of colorectal cancer diagnostic products, wherein the single specific site of the SFRP2 gene is chr4:153781309; Genetic data sourced from: UCSC Genome Browser on Human Dec. 2013 (GRCh38 / hg38) Assembly; The reagents include primer pairs, probes, and Gla I enzyme for detecting the methylation level of a specific site chr4:153781309 in the SFRP2 gene. The primer pair includes a forward primer, a capture primer, and a reverse primer. The nucleotide sequence of the forward primer is SEQ ID No. 4, the nucleotide sequence of the capture primer is SEQ ID No. 5, the nucleotide sequence of the reverse primer is SEQ ID No. 3, and the nucleotide sequence of the probe is SEQ ID No.

6.

2. The application of reagents for detecting methylation at a specific site chr4:153781309 of the SFRP2 gene and a second biomarker in the preparation of colorectal cancer diagnostic products, wherein the second biomarker is a combination of SFRP2 gene specific sites chr4:153789201, SFRP2 gene specific sites chr4:153789431, SFRP2 gene specific sites chr4:153788844 and SFRP2 gene specific sites chr4:153788604; Genetic data sourced from: UCSC Genome Browser on Human Dec. 2013 (GRCh38 / hg38) Assembly; The reagent includes primer pairs and probes for detecting the methylation level of a specific site chr4:153781309 in the SFRP2 gene. The primer pairs include a forward primer, a capture primer, and a reverse primer. The nucleotide sequence of the forward primer is SEQ ID No. 4, the nucleotide sequence of the capture primer is SEQ ID No. 5, the nucleotide sequence of the reverse primer is SEQ ID No. 3, and the nucleotide sequence of the probe is SEQ ID No.

6. The reagents include: Primer pairs and probes for detecting the methylation level of a specific site chr4: 153789201 in the SFRP2 gene. The primer pairs include a forward primer, a capture primer, and a reverse primer. The nucleotide sequence of the forward primer is SEQ ID No. 7, the nucleotide sequence of the capture primer is SEQ ID No. 8, the nucleotide sequence of the reverse primer is SEQ ID No. 3, and the nucleotide sequence of the probe is SEQ ID No.

9. The reagents include primer pairs and probes for detecting the methylation level of a specific site chr4: 153789431 in the SFRP2 gene. The primer pairs include a forward primer, a capture primer, and a reverse primer. The nucleotide sequence of the forward primer is SEQ ID No. 10, the nucleotide sequence of the capture primer is SEQ ID No. 11, the nucleotide sequence of the reverse primer is SEQ ID No. 3, and the nucleotide sequence of the probe is SEQ ID No.

12. The reagents include primer pairs and probes for detecting the methylation level of a specific site chr4:153788844 in the SFRP2 gene. The primer pairs include a forward primer, a capture primer, and a reverse primer. The nucleotide sequence of the forward primer is SEQ ID No. 13, the nucleotide sequence of the capture primer is SEQ ID No. 14, the nucleotide sequence of the reverse primer is SEQ ID No. 3, and the nucleotide sequence of the probe is SEQ ID No.

15. The reagents include primer pairs and probes for detecting the methylation level of a specific site chr4: 153788604 in the SFRP2 gene. The primer pairs include a forward primer, a capture primer, and a reverse primer. The nucleotide sequence of the forward primer is SEQ ID No. 16, the nucleotide sequence of the capture primer is SEQ ID No. 17, the nucleotide sequence of the reverse primer is SEQ ID No. 3, and the nucleotide sequence of the probe is SEQ ID No.

18. The reagent also includes Gla I enzyme.

Images