SNP molecular markers associated with litter size in goat FSHB gene and their application

Abstract

The present invention belongs to the technical field of molecular marker-assisted selection of goats, and particularly relates to a SNP molecular marker associated with the number of lambs in the FSHB gene of goats and its application. The goat SNP site is g.21919354C>T, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1. The allele type of the SNP molecular marker is T, which can significantly improve the number of lambs of goat offspring, and provide a new molecular marker for the detection of the number of lambs of goats or molecular marker-assisted breeding.

Description

Technical Field

[0001] The invention relates to the technical field of goat molecular marker assisted selection, in particular to a SNP molecular marker associated with the litter size in a goat FSHB gene and an application thereof. Background Art

[0002] With the growth of my country's economy and the improvement of residents' living standards, coupled with the upgrading of dietary consumption structure and the change of dietary concepts, the enthusiasm for mutton consumption has been stimulated, and the domestic demand for mutton consumption is strong. Although my country's mutton production has increased in recent years, it is far from keeping up with consumer demand. Compared with other mutton varieties, goat meat is of high quality and good flavor, and is very popular among consumers. Among the many factors affecting goat meat production, the number of lambs born plays an important role, and the number of first-time lambs is lower than that of other parities, and there is a lot of room for improvement. Increasing the number of first-time lambs is one of the important measures to increase goat meat production.

[0003] The number of goats born is a trait with low heritability, and it is difficult to achieve significant genetic progress in a short period of time using conventional breeding methods. With the continuous development of applied genomics, molecular biology, and molecular genetics theory and technology, molecular markers can better solve this problem. Molecular markers are DNA fragments that can directly reflect the differences between genomes of biological individuals or populations. They have the advantages of co-dominance, high polymorphism, abundant sources, and stable performance. They can explain the breeding potential brought by heritable variation at the genetic level.

[0004] Single nucleotide polymorphism (SNP) is a type of molecular marker, which refers to the change in DNA sequence caused by the variation of a single nucleotide at the same position in the genome between individuals, which can subsequently affect gene expression, transcriptional activity, splicing modification, etc. Using SNP to assist in the selection of goat litter size will help improve the reproductive efficiency of goats in my country and increase mutton production.

[0005] Whole Genome Sequencing (WGS) is a new gene detection technology that uses high-throughput sequencing technology to sequence the complete genome sequence of an individual or a population to discover information such as sequence or structural variation. Then, the association between single nucleotide polymorphism sites and specific complex traits is analyzed through genome-wide association study (GWAS) to determine the gene variation related to the trait.

[0006] Follicle-stimulating hormone (FSH), also known as follicle-stimulating hormone, is a heterodimeric glycoprotein hormone secreted by basophils of the anterior pituitary gland. It is composed of α subunit and β subunit (FSHB). The β subunit determines the functional specificity of FSH and determines the number of growing follicles in the reproductive system of female animals. It interacts with LH to affect the ovulation process of animals. The FSHB gene loci related to goat reproductive traits that have been reported so far include G>A and T>A mutations at exon 240bp and 148bp of FSHB gene in Xinong Saanen dairy goats and Boer goats; A>G mutation at position 712 in the 5′ regulatory region of FSHB gene in Tianfu mutton sheep, Boer goats and Chengdu Ma sheep. Screening new FSHB gene loci related to goat reproductive traits provides new molecular marker resources for molecular marker-assisted selection of goats and accelerates the process of breeding and improvement of breeding goats. Summary of the invention

[0007] The purpose of the present invention is to discover the SNP molecular marker associated with the goat litter size in the goat FSHB gene, and to provide a new molecular marker for the detection of the goat litter size trait or SNP molecular marker-assisted breeding.

[0008] The technical solution of the present invention is as follows:

[0009] The present invention provides a SNP molecular marker associated with goat litter size in the FSHB gene, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the SNP site has a C>T base mutation at the 5th bp.

[0010] The present invention also provides a substance for detecting the above-mentioned goat SNP molecular marker, including a PCR primer for amplifying a genomic DNA fragment including the SNP site at the 5 bp position in SEQ ID NO.1 or a kit containing the primer.

[0011] The present invention also provides a goat SNP molecular marker or a material for detecting a goat SNP molecular marker for use in detecting or assisting in detecting the goat lambing trait. The SNP site is a molecular marker of the g.21919354C>T site in the goat genome ARS1.2, and the site T is beneficial to goat lambing.

[0012] Among them, the molecular marker of the g.21919354C>T site is that there is a C>T base mutation at the 5th bp in the sequence shown in SEQ ID NO.1.

[0013] The SNP molecular marker of the present invention is significantly correlated with the trait of the number of first-born lambs in goats.

[0014] The goat breed of the present invention is preferably black-headed sheep.

[0015] The present invention also provides a method for detecting the trait of the number of lambs born in goats, by detecting the base type at the 5th bp in the sequence shown in SEQ ID NO: 1 of the goats, and the first lamb birth of goats with TT genotype is significantly higher than those with CC genotype and CT genotype.

[0016] The goat SNP molecular marker of the present invention or the substance for detecting the goat SNP molecular marker can be used in goat genetic breeding to increase the number of lambs born in future generations of goats.

[0017] The present invention provides a genetic breeding method for increasing the number of lambs born in goats, which comprises determining the base type at the 5th bp in the sequence shown in SEQ ID NO.1 in a core group of goats, and making corresponding selections according to the base type of the goats:

[0018] The breeding of goats is to select individuals with TT base at the 5 bp of the sequence shown in SEQ ID NO.1, and eliminate CT and / or CC type individuals, so as to improve the performance of the number of lambs born in the next generation of goats. The number of lambs born in goats refers to the number of lambs born in the first birth.

[0019] Beneficial effects of the present invention:

[0020] The present invention discovers a molecular marker associated with the number of lambs born in a goat FSHB gene. The molecular marker contains a g.21919354C>T site and can be used as a molecular marker for the trait of the number of lambs born in a goat.

[0021] The present invention verifies the effect of the above-mentioned SNP molecular marker on the number of first-born lambs in goats, and can be applied to the genetic improvement of breeding sheep to increase the number of lambs, thereby increasing the number of lambs born in the offspring and further increasing the market competitiveness of breeding enterprises.

[0022] The present invention provides a new molecular marker for molecular marker-assisted breeding of goat litter size traits, realizes early selection of goat litter size traits, and shortens the breeding process; the detection method is fast and accurate, and is not affected by breeding environment conditions. DETAILED DESCRIPTION

[0023] The present invention obtains all SNP sites on the FSHB gene by whole-genome resequencing of goat genomic DNA, and obtains a molecular marker g.21919354C>T related to the number of lambs by analyzing the correlation between each site and the lambing trait.

[0024] The embodiment of the present invention is to carry out whole genome resequencing of 500 black-headed sheep (Macheng black goat and Boer goat hybrid offspring), wherein 466 sequencing depths are low depth 1X, and 34 sequencing depths are high depth 15X, the purpose is to use high depth sequencing results (less) to perform genotype filling of low depth sequencing results (more), and reduce sequencing costs. Then, the resequencing data is compared with the goat reference genome (genome version ARS1.2), and the Sentieon+Beagle strategy is used to perform genetic variation detection and genotype filling of all autosomes of 500 samples to obtain all SNP sites on the FSHB gene. Finally, the SNP sites are associated with the number of lambs born in the first birth, the number of lambs born in the second birth, the number of lambs born in the third birth, the number of lambs born in the fourth birth, the number of lambs born in the fifth birth, the average number of lambs born in each birth, and the average number of lambs born, and the molecular marker g.21919354C>T related to the number of lambs born in the goat is screened.

[0025] g.21919354 Molecular marker of C>T site: The nucleotide sequence of this fragment is shown in SEQ ID NO:1, and there is a C>T base mutation at the 5th bp in the sequence;

[0026] GCCT Y(C / T) GCACGGTGCAATCAGTGCTGTCGCGGTCACACTTGCCGCAGTGAC (SEQ ID NO. 1).

[0027] The results of GWAS analysis showed that the molecular marker at the g.21919354C>T locus was significantly correlated with the number of first-born lambs in goats. The number of first-born lambs in individuals with genotype TT was significantly higher than that in CC and CT individuals. The number of lambs in the second, fourth and fifth litters, the average number of lambs per parity and the average number of lambs were all higher than those in CC and CT individuals, indicating that T is an allele that is beneficial to the improvement of the lamb number trait. This molecular marker can be used as a molecular marker to detect the trait related to the lamb number in goats, which is of great significance to goat breeding.

[0028] The molecular markers screened by the present invention can be applied to the genotype of genes related to goat litter size traits or association analysis related to goat litter size traits, providing a new molecular marker resource for molecular marker-assisted selection of goat litter size traits.

[0029] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is described in detail below in conjunction with embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0030] Example 1

[0031] Goat whole genome resequencing

[0032] 1. Blood Collection and Leukocyte Separation

[0033] Collect 5 mL of goat venous blood in an EDTA anticoagulant tube, place the anticoagulant tube in an ice box with ice packs, bring it back to the laboratory and store it in a 4°C refrigerator, and extract white blood cells. The specific steps are as follows:

[0034] (1) Take 2 mL of blood into a 10 mL centrifuge tube;

[0035] (2) Add ultrapure water to the 9-10 mL mark, invert 20 times, and let stand for 10 minutes;

[0036] (3) Place the centrifuge tube in a centrifuge and centrifuge at 5000 rpm for 10 min. Discard the supernatant (try to pour out the supernatant as much as possible and do not pour out the white blood cells at the bottom);

[0037] (4) Repeat steps (2) and (3);

[0038] (5) Store the separated white blood cells in a -80°C refrigerator for future use.

[0039] 2. Genomic DNA Extraction and Whole Genome Resequencing

[0040] The blood / cell genomic DNA kit (Beijing Tianmo Technology Development Co., Ltd.) was used to extract DNA from leukocytes. The specific method is described in the instructions. The genomic DNA that passed the quality inspection was sent to Beijing Novogene Technology Co., Ltd. for secondary quality inspection and library construction, and the whole genome resequencing of PE 150 was performed on the BGI platform. The original data was obtained in FASTQ format. 34 samples were subjected to high-depth whole genome resequencing, with an average sequencing depth of approximately 19.72X and a total data size of 1.4T; 466 samples were subjected to low-depth whole genome resequencing, with an average sequencing depth of approximately 1.65X and a total data size of 1.6T.

[0041] Example 2

[0042] Genome alignment, genetic variation detection, and genotype filling

[0043] 1. Raw sequencing data analysis and genome alignment

[0044] The high-depth sequencing data and low-depth sequencing data were quality controlled using the same process.

[0045] (1) The raw data were filtered using Fastp software. The filtering criteria were as follows: reads with a base quality value lower than 20 and a ratio of more than 30% were removed; reads with an n base greater than 5% were removed. Clean reads were obtained after quality control in the above steps.

[0046] (2) Use BWA software to align cleanreads to the goat reference genome Capra_hircus.ARS1.2.

[0047] (3) Use Samtools software to sort the aligned BAM files.

[0048] (4) Use Picard to mark duplicate reads.

[0049] (5)Samtools software builds the index.

[0050] 2. Detection of variant sites and genotype filling

[0051] (1) GATKHaploytypeCaller generates a gvcf file for each sample according to the autosome number.

[0052] (2) GATKCombineGVCFs merges the gvcf files of each sample of a single chromosome.

[0053] (3) GATKGenotypeGVCFs performs population SNP calling by chromosome.

[0054] (4) GATKMergeVcfs merges autosomal population vcf files.

[0055] (5) GATKSelectVariants screens SNPs in population vcf files.

[0056] (6) GATKVariantFiltration marks false positive SNP sites.

[0057] (7) The grep command filters the marked SNP sites.

[0058] (8) Plink software was used to filter SNP sites (geno0.1--maf0.05--hwe1e-06).

[0059] (9) Beagle software was used to fill in the missing sites.

[0060] (10) Use Sentieon Haplotyper and GVCFtyper modules to detect and type genetic variations in population genomes.

[0061] (11) Beagle was used for genotype filling, and ultimately 26,131,221 high-quality SNPs were obtained.

[0062] Example 3

[0063] Detection of polymorphic distribution of molecular markers of the present invention in goat populations

[0064] The genotype frequency and allele frequency of the g.21919354C>T locus of the FSHB gene after typing in black-headed sheep were calculated. The specific formula and method are as follows:

[0065] Genotype frequency = number of individuals with the genotype / total number of samples in the test population;

[0066] Allele frequency = homozygous genotype frequency of the allele + heterozygous genotype frequency of the gene / 2.

[0067] SPSS software was used to perform differential analysis on the distribution of different genotypes at the loci. Hardy-Weinberg equilibrium is an ideal situation in which a population (not affected by specific interference factors, such as non-random mating, selection, migration, mutation, or limited population size) has a constant gene frequency and a stable equilibrium state after many generations.

[0068] p 2 represents the frequency of homozygous alleles (such as Y), q 2 represents the frequency of homozygous alleles (such as y), and 2pq represents the frequency of heterozygotes (such as Yy). If a population reaches genetic equilibrium, its genotype frequency should conform to (p+q) 2 =p 2 +2pq+q 2 =1, based on the theoretical value, the actual value can be calculated to perform a chi-square test to determine whether each gene is in a Hardy-Weinberg equilibrium state in the population:

[0069] χ 2 =∑(O i -E i )2 / E i

[0070] Where O represents the observed value of gene frequency, E represents the expected value of gene frequency, and χ 2 is the obtained chi-square test value. Compare the calculated chi-square value with the corresponding chi-square table. If the p-value range is greater than 0.05, it means that this site conforms to the Hardy-Weinberg equilibrium. If it is less than 0.05, this site deviates from the Hardy-Weinberg equilibrium.

[0071] The test results are shown in Table 1: g.21919354C>T is dominated by homozygous CC, and allele C is the dominant allele. And the chi-square test found that this g.21919354C>T polymorphic site conforms to the Hardy-Weinberg law (P>0.05).

[0072] Table 1 Genotype frequency and allele frequency of FSHB gene polymorphism sites in goat population

[0073]

[0074] Example 4

[0075] Association analysis and application of the molecular marker of the present invention with the trait of litter size

[0076] In order to determine whether the FSHB gene g.21919354C>T site is related to the difference in goat litter size, the GLM program in SAS statistical analysis software was used to perform association analysis between the traits of individuals with different genotypes of molecular markers. The model used was:

[0077] Model 1: Y = overall mean + genotype + farm environment effect + residual

[0078] Model 2: Y = overall mean + additive effect + dominant effect + farm environment effect + residual.

[0079] Where Y is the phenotypic value of the trait. Additive effect = (homozygous 1 - homozygous 2) / 2, with 1, 0, and -1 representing homozygous 1, heterozygous, and homozygous 2 respectively; dominant effect = heterozygous - (homozygous 1 + homozygous 2) / 2, with 1, -1, and 1 representing homozygous 1, heterozygous, and homozygous 2 respectively.

[0080] The results of statistical analysis are shown in Table 2: the number of first-born lambs of the TT genotype in the g.21919354C>T locus was significantly higher than that of the CC genotype and the CT genotype (P<0.05). Although the number of lambs born in the second, fourth, fifth, average number of lambs per parity and average number of lambs did not reach a significant level, they were all higher than those of the CC genotype and the CT genotype.

[0081] Table 2 Association analysis between FSHB gene polymorphisms and goat litter size

[0082]

[0083]

[0084] Note: The values ​​in the table are expressed as mean ± standard error. Different lowercase letters in the same row indicate significant differences (P<0.05), and the same letters indicate insignificant differences (P>0.05).

[0085] The above-mentioned FSHB gene g.21919354C>T locus can be used as a new molecular marker for genetic improvement of goat litter size trait.

[0086] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for detecting a goat SNP molecular marker in detecting or assisting in detecting the first-born lamb number trait of a black-headed sheep, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the SNP site has a C>T base mutation at the 5th bp; the number of first-born lambs of black-headed sheep with TT genotype is significantly higher than that of CC genotype and CT genotype.

2. The use according to claim 1, characterized in that: The substance for detecting the goat SNP molecular marker includes PCR primers for amplifying the genomic DNA fragment including the SNP site at the 5th bp in SEQ ID NO.1 or a kit containing the primers.

3. A method for detecting the number of first-born lambs of black-headed sheep, characterized in that: The base type at the 5th bp in the sequence shown in SEQ ID NO:1 of black-headed sheep was detected. The number of first-born lambs in black-headed sheep with TT genotype was significantly higher than that with CC genotype and CT genotype.

4. Application of a substance for detecting SNP molecular markers in goats in genetic breeding of first-born black-headed sheep, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the SNP site has a C>T base mutation at the 5th bp; the number of first-born lambs of black-headed sheep with TT genotype is significantly higher than those with CC genotype and CT genotype.

5. A genetic breeding method for increasing the number of first-born lambs of black-headed sheep, characterized in that: Determine the base type at the 5th bp in the sequence shown in SEQ ID NO.1 in the black-headed sheep core group, and make corresponding selections based on the base type of the black-headed sheep: In the successive breeding of breeding sheep, individuals with TT base at the 5th bp in the sequence shown in SEQ ID NO.1 are selected, and CT and / or CC type individuals are eliminated, thereby improving the first-birth lambing performance of the next generation of black-headed sheep.

Images