Candida tropicalis with effect of reducing nitrite and ammonia nitrogen and application of candida tropicalis

Abstract

The invention discloses candida tropicalis with the effect of reducing nitrite and ammonia nitrogen and application of the candida tropicalis. The saccharomycetes are respectively named as candida tropicalis JM-2, and the preservation number of the candida tropicalis JM-2 is GDMCC No: 64449. The saccharomyces cerevisiae is high in adaptability, grows well in high-concentration ammonia nitrogen and nitrite environments, is relatively high in nitrogen degradation efficiency, can be used as a functional strain for improving water quality, deodorizing farms, deodorizing garbage yards and the like, can be applied to a plurality of places, effectively degrades harmful substances such as nitrite, ammonia nitrogen and the like in water bodies and environments, reduces nitrogen accumulation, protects the environments, and has a wide application prospect. The method has great application potential in livestock and poultry aquaculture and environmental protection.

Description

Technical field:

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to a strain of tropical Candida albicans capable of reducing nitrite and ammonia nitrogen and application thereof. Background technology:

[0002] With the rapid development of social economy, the nitrogen content in industrial, agricultural and domestic sewage has increased sharply. Excessive nitrogen discharge has led to eutrophication of water bodies, seriously damaged the water environment ecosystem and threatened human health. According to the "Second National Pollution Source Census Bulletin", the chemical demand emissions of aquaculture reached 0.73 times that of industrial sources, totaling 666,000 tons. In addition, the total phosphorus emissions exceeded 16,000 tons and the total nitrogen emissions were close to 100,000 tons.

[0003] Among many environmental remediation technologies, biological denitrification has the characteristics of high efficiency, low cost, simple operation and no pollution to the environment. Compared with traditional autotrophic nitrifying bacteria and anaerobic denitrifying bacteria, heterotrophic nitrification-aerobic denitrifying bacteria have the following advantages: (1) faster growth and denitrification rate; (2) lower cost-effectiveness; (3) lower residual intermediate products produced in the nitrogen conversion process. Yeast has the advantages of being easy to culture and being able to synthesize bacterial proteins using inorganic nitrogen sources such as ammonia nitrogen and nitrite nitrogen. Yeast can use various nutritional factors in water bodies, reduce the consumption of dissolved oxygen, help purify water bodies, and promote the growth and development of aquaculture. Yeast, due to its advantages such as being green, safe, non-toxic and pollution-free, has gradually gained market favor. Summary of the invention:

[0004] The first object of the present invention is to provide a strain of Candida tropicalis JM-2 which has the ability to efficiently degrade nitrite and ammonia nitrogen, thereby providing a good biological material for improving water quality in aquaculture.

[0005] The tropical Candida tropicalis JM-2 was deposited in the Guangdong Microbiological Culture Collection Center (GDMCC) on March 25, 2024, with the address being 5th Floor, Building 59, No. 100, Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province, Postal Code: 510070, and the deposit number is GDMCC No: 64449.

[0006] The second object of the present invention is to provide the use of the Candida tropicalis JM-2 in removing odor in livestock and poultry farms.

[0007] The third object of the present invention is to provide the use of Candida tropicalis JM-2 in reducing nitrite and removing ammonia nitrogen.

[0008] The fourth aspect of the present invention provides a microbial agent for degrading nitrite and ammonia nitrogen, which contains Candida tropicalis JM-2 or its fermentation liquid as an active ingredient.

[0009] The fourth object of the present invention is to provide the use of the above-mentioned Candida tropicalis JM-2 in the preparation of microbial agents or animal feed additives.

[0010] Compared with the prior art, the present invention has the following beneficial effects:

[0011] (1) The tropical Candida JM-2 of the present invention has a strong ability to degrade nitrite.

[0012] (2) The tropical Candida JM-2 of the present invention has a strong ability to degrade ammonia nitrogen.

[0013] (3) The tropical Candida JM-2 of the present invention has good acid resistance, bile salt resistance and salt resistance.

[0014] In summary, the tropical Candida JM-2 of the present invention has a good degradation effect on nitrite and ammonia nitrogen in common aquaculture water bodies, and is acid-resistant, salt-resistant, and bile-resistant, and has great application potential in livestock and poultry aquaculture.

[0015] Candida tropicalis JM-2 was deposited on March 25, 2024 in the Guangdong Microbiological Culture Collection Center (GDMCC), located at 5th Floor, Building 59, No. 100, Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province, Postal Code: 510070, and the deposit number is GDMCC No: 64449. Description of the drawings:

[0016] Figure 1 The photographs are of the morphology of Candida tropicalis JM-2.

[0017] Figure 2 This is the degradation effect of nitrite by Candida tropicalis JM-2 in the culture medium at different time periods.

[0018] Figure 3 This is the degradation effect of ammonia nitrogen by Candida tropicalis JM-2 in the culture medium at different times.

[0019] Figure 4 The tolerance of Candida tropicalis JM-2 to different pH values.

[0020] Figure 5 Tolerance of Candida tropicalis JM-2 to different bile salts.

[0021] Figure 6The tolerance of Candida tropicalis JM-2 to different salt concentrations. Specific implementation method:

[0022] The specific embodiments of the present invention are further described in detail below in conjunction with the accompanying drawings and examples. The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. The parameters, proportions, etc. of the examples can be selected according to local conditions without substantial effect on the results. Unless otherwise specified, the methods described in the examples are all conventional methods, and the reagents used are all conventional reagents or reagents prepared in a conventional manner.

[0023] Example 1 Enrichment, culture, separation, purification and preservation of yeast strains

[0024] (1) Isolation, screening and preservation of yeast strains

[0025] The yeast strain of the present invention is separated from industrial waste water by the inventor.

[0026] Separation medium (PDA medium): 200 g potato (peeled), 20 g glucose, 14 g agar, add water to make up to 1000 mL, divide into 250 mL Erlenmeyer flasks, 100 mL per bottle; sterilize at 121°C for 20 min.

[0027] The sample was spread on a plate containing separation medium by dilution coating method, and yeast strains were obtained after purification. The yeast strain with the ability to degrade nitrite and ammonia nitrogen, tropical Candida JM-2, was screened. The colony morphology of tropical Candida JM-2 was observed by naked eye. The cells were spherical or ovoid. The colonies on PDA medium were white, dull or slightly shiny, and had pseudohyphae. The results are shown in Figure 1 .

[0028] Example 2 Molecular Biological Identification of Yeast JM-2

[0029] The DNA of the strain was extracted using a yeast DNA kit. The forward primer ITS1 (5'-TCC GTAGGT GAACCT GCGG-3) and the reverse primer ITS4 (5'-TCC TCC GCT TAT TGATAT GC-3') were used to amplify the ITS1 and ITS2 regions of the rDNA gene by polymerase chain reaction (PCR). The sequence was sent to Shanghai Meiji Biopharmaceutical Technology Co., Ltd. (Guangzhou Branch) for sequence sequencing. The sequence is shown in SEQ ID NO.1. The sequencing results were submitted to the NCBI database, and BLAST was used for homology sequence retrieval to determine the taxonomic status of the target strain. Combined with morphological observation, the strain JM-2 isolated in Example 1 of the present invention was preliminarily identified as Candida tropicalis. JM-2 was deposited in the Guangdong Microbiological Culture Collection Center (GDMCC) on March 25, 2024, with an address of 5th Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province, Postal Code: 510070, and the deposit number is GDMCC No: 64449.

[0030] Example 3 Determination of the effect of yeast on the degradation of nitrite and ammonia nitrogen

[0031] Medium 1 (1 L): Glucose 0.5 g, sodium pyruvate 0.3 g, potassium dihydrogen phosphate 0.3 g, disodium hydrogen phosphate 0.2 g, sodium chloride 0.5 g, magnesium chloride 0.1 g, ammonium chloride 0.0535 g, NaNO 2 0.025g, water 1L.

[0032] Trace element solution (1L): 0.64g disodium ethylenediaminetetraacetic acid, 0.55g ferrous sulfate, 0.23g zinc sulfate, 0.34g manganese sulfate, 0.075g copper sulfate, 0.55g calcium chloride, 0.025g ammonium molybdate, 1L water.

[0033] The culture medium 1 is sterilized by high pressure, and the trace element solution is added to the culture medium 1 at a volume ratio of 0.2% to obtain the final culture medium 2.

[0034] The activated tropical Candida JM-2 was inoculated into the YPD medium and placed in a 30°C incubator for about 20 hours to obtain the seed solution. The seed solution was centrifuged and washed twice with water, then resuspended and added to the medium 2 at a volume ratio of 1%. After culturing for 2 and 3 days, samples were taken to monitor the changes in nitrite and ammonia nitrogen content. The positive control strains were GDM2.148, GDM2.176, GDM2.8, and GDM2.9. The method for determining the nitrite content was based on the spectrophotometric method for the determination of nitrite nitrogen in water quality of GB7493-1987, and the method for determining the ammonia nitrogen content was based on the spectrophotometric method for the determination of ammonia nitrogen in water quality of HJ535-2009.

[0035] from Figure 2 It can be seen that Candida tropicalis JM-2 can degrade nitrite after 3 days of culture, and the degradation efficiency is 45.88%.

[0036] from Figure 3 It can be seen that after 3 days of cultivation, Candida tropicalis JM-2 had a significant effect in degrading ammonia nitrogen, with a degradation efficiency of 100%.

[0037] Example 4 Analysis of tolerance of isolated yeast

[0038] The seed solution of tropical Candida JM-2 of Example 3 was inoculated into PDB liquid culture medium with different pH values ​​(3.0, 4.0, 5.0, 6.0, 7.0), different bile salt concentrations (0.3%, 0.4%, 0.5%, 0.6%), and different NaCl concentrations (3.0%, 5.0%, 7.0%, 9.0%) at an inoculum volume of 3% (V / V), and cultured at 30°C for 24 h. The OD was measured by a spectrophotometer. 600 nm The values ​​were measured in 3 parallels and the average value was taken. 600 nm The values ​​were used to determine the growth of yeast under different conditions.

[0039] Depend on Figure 4 It can be seen that the OD value of Candida tropicalis JM-2 was the largest at pH 4, and the OD value decreased slightly at pH 3, indicating that it had good tolerance to low pH values.

[0040] Depend on Figure 5 It can be seen that compared with the blank, the OD value of tropical Candida JM-2 in the bile salt environment is slightly lower, and the OD value can still reach 0.57 when the bile salt content is 0.6%, which has relatively good high bile salt tolerance.

[0041] Depend on Figure 6 It can be seen that compared with the blank, the OD value of tropical Candida JM-2 decreased in a high-salt environment, and the OD was still 0.95 in a 5% high-salt environment, indicating that it has good salt tolerance.

[0042] SEQ ID NO.1:

[0043] TTTTATTGAACAAATTTCTTTGGTGGCGGGAGCAATCCTACCGCCAGAGGTTATAACTAA

[0044] ACCAAACTTTTTATTTACAGTCAAACTTGATTTATTATTACAATAGTCAAAACTTTCAACA

[0045] ACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAA

[0046] TTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAA

[0047] GGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCCCCGGGTTTGGTGTTGAGCAATA

[0048] CGCTAGGTTTGTTTGAAAGAATTTAACGTGGAAACTTATTTTAAGCGACTTAGGTTTATC

[0049] CAAAAACGCTTATTTTGCTAGTGGCCACCACAATTTATTTCATAACTTTGACCTCAAA。

Claims

1. Candida tropicalis JM-2, deposited with GDMCC No: 64449.

2. Use of the Candida tropicalis JM-2 according to claim 1 in removing odor in livestock and poultry farms.

3. Use of the tropical Candida tropicalis JM-2 according to claim 1 in reducing nitrite and removing ammonia nitrogen.

4. A microbial agent for degrading nitrite and ammonia nitrogen, characterized in that: Contains the tropical Candida tropicalis JM-2 or its fermentation liquid as claimed in claim 1 as an active ingredient.

5. Use of the Candida tropicalis JM-2 according to claim 1 in the preparation of microbial agents or animal feed additives.

6. Use of the Candida tropicalis JM-2 according to claim 1 in the preparation of microbial agents or animal feed additives.

Images