Application of miR-3032-z in preparation of product for inhibiting expression of CYP15A1 gene of brown planthopper

Abstract

The invention belongs to the technical field of application of miR-3032-z in preparation of a product for inhibiting expression of a brown planthopper CYP15A1 gene, and particularly relates to the technical field of pest control. The invention provides an application of miR-3032-z or a reagent for overexpressing miR-3032-z in preparation of a product for inhibiting the expression of a CYP15A1 gene of brown planthopper. The products include medicaments or kits. The miR-3032-z is combined with a target gene CYP15A13 'UTR region in a targeted manner to regulate the expression of the gene, the overexpression of the miR-3032-z can inhibit the expression of a cytochrome P450 family gene CYP15A1, the honeydew secretion amount and insect weight gain of biological type Y brown planthoppers on insect-resistant rice YHY15 can be remarkably reduced, the feeding behavior of the biological type Y brown planthoppers can be remarkably inhibited, and the sensitivity of harmful type brown planthoppers to the resistant rice YHY15 is recovered.

Description

Technical Field

[0001] The invention belongs to the technical field of pest control, and particularly relates to application of miR-3032-z in preparing a product for inhibiting the expression of brown planthopper CYP15A1 gene. Background Art

[0002] Brown planthoppers are a type of monophagous pest that feeds on rice. They can cause the loss of nutrients in rice plants by absorbing a large amount of rice phloem sap, which in turn causes the rice leaves to turn yellow and wither, resulting in a decrease in yield and causing serious economic losses. Planting resistant rice varieties containing genes that resist brown planthoppers is currently the most economical and environmentally friendly measure for the prevention and control of brown planthoppers. The interaction between herbivorous insects and host plants is dynamic. For a long time, rice and brown planthoppers have co-evolved, and rice has evolved a complex defense system to resist the invasion of brown planthoppers. In recent years, rice genes that resist brown planthoppers have been continuously mined (ChengX, WuY, Guo J, et al. 2013a. A rice lectin receptor-like kinase that is involved in innate immune responses also contributes to seed germination. The Plant Journal, 76: 687-698). Brown planthoppers have strong adaptability. With the widespread planting of resistant rice, under the pressure of natural selection, brown planthoppers gradually overcome and adapt to the defense mechanism of resistant rice varieties, establish new host relationships, evolve new biotypes, and form new populations (Kobayashi T, Yamamoto K, Suetsugu Y, et al. 2014. Genetic mapping of the rice resistance-breaking gene of the brown planthopper Nilaparvata lugens. Proceedings-Royal Society. Biological Sciences, 281: 20140726). With the emergence of new biotype populations, the resistance of the original insect-resistant gene rice is overcome, and the harmfulness of brown planthoppers to resistant rice is gradually enhanced, which brings severe challenges to the cultivation of resistant rice.

[0003] The increase in the virulence of brown planthoppers to resistant rice is a heritable change. This evolutionary genetic variation mechanism is mainly divided into two categories, one is gene mutation and the other is the change in gene expression level. Gene mutation will cause the brown planthopper to change its ability to bind to the defense-related metabolites produced by resistant rice in response to brown planthopper feeding, thus making the brown planthopper insensitive to resistant rice (Simon JC, D'Alencon E, Guy E, et al. 2015. Genomics of adaptation to host-plants in herbivorous insects. Briefings in Functional Genomics & Proteomics, 14: 413-423). Changes in gene expression levels refer to the fact that the content of gene products with specific functions in organisms will change with time, living environment, physiological behavior, etc. This change is often related to genes related to metabolic resistance (Wang R, Zhu Y, Deng L, et al. 2017. Imidacloprid is hydroxylated by Laodelphaxstriatellus CYP6AY3v2. Insect Biochemistry and Molecular Biology, 26: 543-551. Wu YQ, Xu HF, Pan YO, et al. 2018. Expression profile changes of cytochrome P450 genes between thiamethoxam susceptible and resistant strains of Aphis gossypiiGlover. Pesticide Biochemistry and Physiology, 149: 1-7).Some researchers used high-throughput sequencing technology to conduct transcriptome sequencing analysis on the salivary glands and fat bodies of two different brown planthopper populations that can infect TN1 and Mudgo rice, respectively. The results showed that the differentially expressed genes between the two populations are mostly involved in metabolism, digestion, protein secretion and immune expression pathways, and it is speculated that these genes may be closely related to the evolution of brown planthopper virulence (Ji R, Yu H, Fu Q, et al. 2013. Comparative transcriptome analysis of salivary glands of two populations of rice brown planthopper, Nilaparvata lugens, that differ in virulence. PLoS One, 8: e79612. Yu H, Ji R, Ye W, et al. 2014. Transcriptome analysis of fat bodies from two brown planthopper (Nilaparvata lugens) populations with different virulence levels in rice. PLoS One, 9: e88528). Later, other scholars analyzed the salivary glands of two groups of brown planthoppers, one feeding on resistant rice B5 and the other feeding on susceptible rice TN1, and found that the expression of genes related to sugar metabolism was upregulated in the brown planthopper population feeding on resistant rice B5 (Wang X, Zhang M, Feng F, et al. 2015. Differentially regulated genes in the salivary glands of brown planthopper after feeding in resistant versus susceptible rice varieties. Archives of Insect Biochemistry and Physiology, 89: 69-86).Similarly, transcriptome sequencing of brown plant hoppers feeding on Bph6 transgenic resistant rice lines was performed, and a comparative analysis was performed with the transcriptome data of brown plant hoppers feeding on wild-type Nipponbare. It was found that the expression of genes involved in metabolism, detoxification, autophagy and other processes in brown plant hoppers feeding on resistant rice was upregulated (Zhang J, Guan W, Huang C, et al. 2019. Combining next-generation sequencing and single-molecule sequencing to explore brown plant hopper responses to contrasting genotypes of japonicarice. BMC Genomics, 20: 682).

[0004] The cytochrome P450 family genes that regulate detoxification metabolism are commonly involved in regulating the metabolic resistance of brown planthoppers. They can participate in the metabolism of endogenous and exogenous compounds in insects, including ingested plant secondary metabolites and exogenous compounds such as pesticides. They have a wide range of effects and are one of the most important detoxification systems of insects. They play a very important role in the co-evolution of insects and plants (Wang R, Zhu Y, Deng L, et al. 2017. Imidacloprid ishydroxylated by Laodelphax striatellus CYP6AY3v2. Insect Biochemistry and Molecular Biology, 26: 543-551). Studies have found that overexpression of P450 family genes mediates the metabolic resistance of various pests, including brown planthoppers, to insect growth regulators, carbamates, organophosphates and other substances.

[0005] MicroRNA (miRNA) is a type of endogenous non-coding single-stranded RNA with a length of about 22 nt. It is a small molecule regulatory factor that can be widely involved in the regulation of various life activities of organisms, such as embryonic development, cell growth, differentiation, proliferation, apoptosis, metabolism, etc., and plays an important role in the post-transcriptional regulation of genes (Bushati N, Cohen SM. 2007. MicroRNA functions. Annual Review of Cell and Developmental Biology, 23: 175-205). miRNAs are involved in the physiological activities of insects, such as phenotypic differentiation, genetic development, immune defense, and stress resistance. Studies have found that miRNAs participate in insect resistance by regulating the expression of genes related to resistance and detoxification, including cytochrome P450 family, GST, Bt toxin protein, esterase, superoxide dismutase, ABC transporter and other resistance and detoxification related genes (Zhu B, Li XX, Liu Y, et al. 2017. Global identification of microRNAs associated with chlorantraniliprole resistance in diamondback moth Plutella xylostella (L.). Scientific Reports, 7: 4071). In summary, miRNAs and resistance-related genes play an important role in the evolution of insect resistance and can be used as important targets for pest control. However, there is currently a lack of effective methods for controlling harmful brown planthoppers. Summary of the invention

[0006] The purpose of the present invention is to provide the use of miR-3032-z in the preparation of products that inhibit the expression of the CYP15A1 gene of brown planthoppers. MiR-3032-z and its corresponding target gene CYP15A1 are involved in the detoxification metabolism-related pathways of brown planthoppers, and play an important role in the evolution of the virulence of brown planthoppers and the formation of new biotypes.

[0007] The invention provides application of miR-3032-z or an agent overexpressing miR-3032-z in preparing a product for inhibiting the expression of CYP15A1 gene of brown planthopper; the product comprises a medicine or a kit.

[0008] The present invention also provides the use of an agent for inhibiting the expression of brown planthopper CYP15A1 gene in preparing a drug for restoring the sensitivity of brown planthopper to insect-resistant rice; the agent for inhibiting the expression of brown planthopper CYP15A1 gene includes an agent for overexpressing miR-3032-z.

[0009] The present invention also provides the use of an agent for inhibiting the expression of brown planthopper CYP15A1 gene in the preparation of a drug for destroying the detoxification metabolic ability of brown planthopper to insect-resistant rice; the agent for inhibiting the expression of brown planthopper CYP15A1 gene includes an agent for overexpressing miR-3032-z.

[0010] Preferably, the insect-resistant rice includes insect-resistant rice YHY15.

[0011] The present invention also provides the use of an agent for inhibiting the expression of the CYP15A1 gene of brown planthoppers in the preparation of a drug for reducing the honeydew secretion and / or insect weight gain of brown planthoppers; the agent for inhibiting the expression of the CYP15A1 gene of brown planthoppers includes an agent for overexpressing miR-3032-z.

[0012] The present invention also provides the use of a reagent for inhibiting the expression of the CYP15A1 gene of brown planthoppers in the preparation of a drug for inhibiting the feeding behavior of brown planthoppers; the reagent for inhibiting the expression of the CYP15A1 gene of brown planthoppers comprises a reagent for overexpressing miR-3032-z.

[0013] Preferably, the brown planthopper includes the harmful type brown planthopper.

[0014] Preferably, the harmful brown planthopper includes biological Y-type brown planthopper.

[0015] Preferably, the agent for overexpressing miR-3032-z comprises a miR-3032-z agonist.

[0016] Preferably, the nucleotide sequence of the sense strand of agomiR-3032 is preferably as shown in SEQ ID NO.2, and the nucleotide sequence of the antisense strand of agomiR-3032 is preferably as shown in SEQ ID NO.3.

[0017] The present invention provides the use of miR-3032-z or an agent overexpressing miR-3032-z in the preparation of a product for inhibiting the expression of the CYP15A1 gene of brown planthopper; the product includes a drug or a kit. The present invention finds that miR-3032-z can reversely regulate the detoxification metabolism gene CYP15A1. CYP15A1 is a cytochrome P450 family gene, and cytochrome P450 can participate in the metabolism of endogenous and exogenous compounds in insects. The present invention finds for the first time that miR-3032-z and its corresponding target gene CYP15A1 are involved in the detoxification metabolism-related pathway of brown planthopper, and play an important role in the evolution of the harmfulness of brown planthopper and the formation of new biotypes. Based on high-throughput sequencing analysis technology, the present invention uses miRNA as an entry point to identify the expression difference of a miRNA (miR-3032-z) that can regulate the detoxification metabolism of brown planthoppers in two different biotypes of brown planthoppers, biotype 1 and biotype Y, revealing the important role of miRNA in the evolution of the harmfulness of brown planthoppers and the formation of new biotypes, and providing a new direction for in-depth research on the gene expression regulatory network of brown planthoppers responding to and adapting to resistant rice. The experimental results show that miR-3032-z regulates gene expression by targeting and binding to the 3'UTR region of the target gene, and can inhibit the expression of the cytochrome P450 family gene CYP15A1 by injecting agomir-3032. After the injection of agomir-3032, the honeydew secretion and insect weight gain of biotype Y brown planthoppers on insect-resistant rice YHY15 are significantly reduced, and the feeding behavior is significantly inhibited, so that the harmful brown planthoppers recover the sensitivity to the resistant rice YHY15. The present invention provides new insights into the molecular genetic mechanism of miRNA involvement in the virulence of brown planthoppers, deepens the understanding of the digestive metabolism and detoxification process of brown planthoppers from the perspective of miRNA, provides a reference for the study of detoxification metabolism of brown planthoppers, provides an important theoretical basis for revealing the adaptation of brown planthoppers to insect-resistant rice, deepens the understanding of the molecular mechanism of plant-insect interactions, and provides a reference for the formulation of future control strategies for brown planthoppers. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0019] Figure 1 The pmirGLO plasmid map and enzyme cleavage site schematic diagram provided by the present invention;

[0020] Figure 2The qRT-PCR validation results of miRNA and target gene expression provided by the present invention are shown in FIG; wherein, A: miR-3032-z expression level of two biotypes of brown planthoppers; B: target gene CYP15A1 expression level of two biotypes of brown planthoppers; data represent mean values ​​(three biological replicates) ± standard errors, and statistical analysis was performed using T-test: **P<0.01, ***P<0.001;

[0021] Figure 3 This is a graph showing the results of verifying the binding of miRNA to target genes using the dual luciferase reporter system provided by the present invention; wherein the data represent the mean value (three biological replicates) ± standard error, and the one-way ANOVA Tukey test was used for the test, and different English letters above the bar graph indicate significant differences (P<0.05);

[0022] Figure 4 The diagram is a result of the regulation of CYP15A1 expression by miR-3032-z provided by the present invention; wherein, A: a diagram showing the expression of miR-3032-z after injection of agomir-3032; B: a diagram showing the expression of CYP15A1 after injection of agomir-3032; C: a diagram showing the expression of miR-3032-z after injection of antagomir-3032; D: a diagram showing the expression of CYP15A1 after injection of antagomir-3032; CK represents a blank control group without microinjection, and NC represents a negative control group; data represent mean values ​​(three biological replicates) ± standard errors, and statistical analysis was performed using a T test: * represents a significant difference between the experimental group and the negative control group, ***P<0.001;

[0023] Figure 5 The figure shows the effect of miR-3032-z on the feeding behavior of brown planthoppers provided by the present invention; wherein, A: the amount of honeydew secreted by female adults of brown planthoppers injected with agomir-3032 after feeding on YHY15 rice plants for 48 hours; B: the weight change of female adults of brown planthoppers injected with agomir-3032 after feeding on YHY15 rice plants for 48 hours; the data represent the mean value (the honeydew secretion of 30 brown planthoppers was measured) ± standard error, and the T test was used for statistical analysis. DETAILED DESCRIPTION

[0024] The present invention provides the use of miR-3032-z or an agent overexpressing miR-3032-z in the preparation of a product for inhibiting the expression of the CYP15A1 gene of brown planthoppers; the product includes a drug or a kit. In the present invention, the nucleotide sequence of the miR-3032-z is shown in SEQ ID NO.1: TGTTAGTATAACTCTTAGTAACA. In the present invention, the CYP15A1 gene is numbered as XM_039430744.1. As an important post-transcriptional regulatory factor in insects, the miRNA-target gene regulatory network formed by miRNA directly or indirectly participates in almost all biological processes such as embryonic development, digestion metabolism, cell apoptosis, and maintenance of body balance. One of the main strategies of herbivorous insects in response to the defense of plants is to evolve a complete metabolic digestive system to detoxicate the ingested plant secondary metabolites through oxidation, hydrolysis, molecular cross-linking and other means. Cytochrome P450 can participate in the metabolism of endogenous and exogenous compounds in insects, including ingested plant secondary metabolites and exogenous compounds such as pesticides. It has a wide range of effects and is one of the most important detoxification systems of insects. It plays a very important role in the process of co-evolution between insects and plants. The present invention found that miR-3032-z is related to the cytochrome P450 family gene CYP15A1. The cytochrome P450 family gene CYP15A1 is the target gene of miR-3032-z. The present invention has found that miR-3032-z can reversely regulate the expression of the detoxification metabolism gene CYP15A1 to mediate the adaptation process of brown planthoppers to insect-resistant rice. In the embodiment of the present invention, the dual luciferase test confirmed in vitro that miR-3032-z can significantly inhibit the expression of CYP15A1. In the present invention, the product preferably includes a product that enhances the sensitivity of different biotypes of brown planthoppers to different insect-resistant rice; more preferably, it includes a product that enhances the sensitivity of biotype Y brown planthoppers to insect-resistant rice YHY15. In the present invention, the reagent for overexpressing miR-3032-z preferably includes a miR-3032-z agonist. In the present invention, the miR-3032-z agonist preferably includes agomiR-3032. In the present invention, the nucleotide sequence of the sense strand of agomiR-3032 is preferably as shown in SEQ ID NO.2, and the nucleotide sequence of the antisense strand of agomiR-3032 is preferably as shown in SEQ ID NO.3.

[0025] The present invention also provides the use of an agent for inhibiting the expression of the CYP15A1 gene of brown planthoppers in the preparation of a drug for restoring the sensitivity of brown planthoppers to insect-resistant rice; the agent for inhibiting the expression of the CYP15A1 gene of brown planthoppers includes an agent for overexpressing miR-3032-z. In the present invention, the insect-resistant rice preferably includes the insect-resistant rice YHY15. In the present invention, the brown planthoppers preferably include the harmful type brown planthoppers. In the present invention, the harmful type brown planthoppers preferably include the biological type Y brown planthoppers. The biological type Y brown planthopper is a laboratory biological type population gradually formed by forced feeding on the YHY15 insect-resistant rice containing the Bph15 brown planthopper resistance gene, which can harm the YHY15 rice. The agent for overexpressing miR-3032-z can restore the sensitivity of brown planthoppers to insect-resistant rice by inhibiting the expression of the CYP15A1 gene of brown planthoppers. Specifically, the reagent overexpressing miR-3032-z can restore the sensitivity of biological Y-type brown planthopper to insect-resistant rice YHY15 by inhibiting the expression of biological Y-type brown planthopper CYP15A1 gene. The present invention uses the in vitro synthesized miR-3032-z agonist agomir-3032 to inject brown planthoppers, and finds that agomir-3032 can inhibit the expression of CYP15A1, proving that miR-3032-z can regulate the reading and metabolism function of brown planthoppers and affect the adaptation process of brown planthoppers to insect-resistant rice.

[0026] The present invention also provides the use of an agent for inhibiting the expression of brown planthopper CYP15A1 gene in the preparation of a drug for destroying the detoxification metabolic ability of brown planthopper to insect-resistant rice; the agent for inhibiting the expression of brown planthopper CYP15A1 gene includes an agent for overexpressing miR-3032-z.

[0027] The present invention also provides the use of an agent for inhibiting the expression of the CYP15A1 gene of brown planthoppers in the preparation of a drug for reducing the honeydew secretion and / or insect weight gain of brown planthoppers; the agent for inhibiting the expression of the CYP15A1 gene of brown planthoppers includes an agent for overexpressing miR-3032-z. Overexpressing miR-3032-z can reduce the honeydew secretion and / or insect weight gain of biotype Y brown planthoppers on insect-resistant rice YHY15.

[0028] The present invention also provides the use of an agent for inhibiting the expression of the CYP15A1 gene of brown planthoppers in the preparation of a drug for inhibiting the feeding behavior of brown planthoppers; the agent for inhibiting the expression of the CYP15A1 gene of brown planthoppers includes an agent for overexpressing miR-3032-z. Overexpressing miR-3032-z can significantly inhibit the feeding behavior of biotype Y brown planthoppers on insect-resistant rice YHY15.

[0029] In a specific embodiment of the present invention, the in vitro synthesized miR-3032-z agonist agomir-3032 was injected into the brown planthopper, which inhibited the expression of the CYP15A1 gene in the brown planthopper, destroyed the detoxification metabolic ability of the brown planthopper to the resistant rice, and then inhibited the feeding behavior of the brown planthopper, reduced the honeydew secretion and insect weight gain of the brown planthopper, and restored the sensitivity of the biotype Y brown planthopper to the insect-resistant rice YHY15.

[0030] To further illustrate the present invention, the application of miR-3032-z provided by the present invention in preparing a product for inhibiting the expression of the CYP15A1 gene of brown planthopper is described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0031] This invention is based on the National Key R&D Program, and the project information is as follows:

[0032] Project type: National Key R&D Program.

[0033] Project number: 2021YFD1401100.

[0034] Project name: Research on the disaster mechanism and sustainable prevention and control technology of rice planthoppers.

[0035] Example 1

[0036] Materials and Methods

[0037] 1. Brown Planthopper and Rice Materials

[0038] 1.1 Test insects and their rearing

[0039] The sources of biotype 1 and biotype Y brown planthoppers are conventional sources. Biotype 1 brown planthoppers were collected from natural populations in the wild in Wuhan and were isolated and raised on the insect-susceptible rice variety TN1 without insect resistance genes for a long time. Biotype Y brown planthoppers originated from the laboratory biotype formed after biotype 1 brown planthoppers were forced to be raised on the YHY15 rice material containing the brown planthopper resistance gene Bph15 for 33 generations.

[0040] The brown planthoppers were raised in the greenhouse of Wuhan University. The temperature was controlled at 27±1℃, the relative humidity was between 70 and 80%, and the photoperiod was 16h light / 8h dark per day. Rice seedlings that were in the vegetative growth stage and in good condition were used for brown planthopper breeding, and the rice seedlings were replaced in time according to the brown planthopper population density and the growth status of the fed rice.

[0041] 1.2 Rice materials

[0042] The insect-susceptible rice material used in the present invention is the Taichung Native 1 (TN1) rice variety that does not contain any brown planthopper resistance gene; the insect-resistant rice material is the YHY15 rice strain that contains the brown planthopper resistance gene Bph15.

[0043] The rice materials for the test were planted at the Institute of Genetics of Wuhan University. They were cultivated outdoors under natural conditions from May to October and in a plant greenhouse in the remaining months. The cultivation temperature was controlled at 28°C, the relative humidity was between 70 and 80%, and the photoperiod was 16 h light / 8 h dark per day.

[0044] 2. qRT-PCR verification of miRNA expression

[0045] 2.1 Total RNA extraction from samples

[0046] RNA was extracted using RNAiso Plus (TaKaRa #9109) reagent. The specific steps are as follows:

[0047] (1) A single brown planthopper sample was placed in a 1.5 mL RNase-free centrifuge tube, 500 μL RNAiso Plus reagent was added, and the brown planthopper body was fully ground using a tissue grinding rod soaked in chloroform. Then 500 μL RNAisoPlus reagent was added to rinse the tissue grinding rod, and the mixture was fully shaken and placed in a -80°C refrigerator and allowed to stand at low temperature for more than 30 min. Separately, the obtained whole brown planthopper sample was placed in RNase-free PBS buffer and cleaned, dissected under a stereo microscope, and the obtained tissue sample was transferred to a 1.5 mL RNase-free centrifuge tube containing 500 μL RNAiso Plus reagent. The subsequent operations were the same as those for the single brown planthopper sample.

[0048] (2) Centrifuge at 15,000 rpm, 4°C for 15 min, and transfer 800 μL of supernatant to a new 1.5 mL RNase-free centrifuge tube;

[0049] (3) Add 200 μL of chloroform and shake vigorously for 1 min to form an emulsion. Let stand at room temperature for 15 min to separate the layers. Centrifuge at 15,000 rpm and 4°C for 15 min. Take 400-500 μL of the supernatant and transfer it to a new 1.5 mL RNase-free centrifuge tube.

[0050] (5) Add an equal volume of -20°C precooled isopropanol to the retained supernatant, mix by inversion, let stand at -20°C for more than 10 min, centrifuge at 15,000 rpm, 4°C for 15 min, and discard the supernatant;

[0051] (6) Add 1 mL of 75% ethanol prepared with RNase-free H2O to wash the precipitate, centrifuge at 15000 rpm, 4°C for 15 min, and discard the supernatant;

[0052] (7) Add 1 mL of 75% ethanol prepared with RNase-free H2O to wash the precipitate again, centrifuge at 15000 rpm, 4°C for 15 min, and discard the supernatant;

[0053] (8) Place the precipitate in a clean bench and air dry it for 5 minutes;

[0054] (9) Add 50 μL RNase-free H2O to dissolve the precipitate. Aliquot a small amount for agarose electrophoresis and Nanodrop2000 UV spectrophotometer to detect RNA integrity and concentration, and store the rest in a -80°C refrigerator.

[0055] 2.2 Synthesis of miRNA first-strand cDNA

[0056] Use the miRNA 1st Strand cDNA Synthesis Kit (by stem-loop) (Vazyme #MR101) to synthesize the first strand of miRNA cDNA, and follow the instructions for subsequent operations:

[0057] (1) Removal of genomic DNA: Prepare the reaction system on ice. The main components are shown in Table 1.

[0058] Table 1 Reaction system

[0059] Reagents volume Total RNA 1.0 μg 5×gDNAWiperMix 2.0μL <![CDATA[RNaseFreeH2O]]> Make up to 10 μL

[0060] Use a pipette to gently blow and mix, centrifuge the prepared mixture instantly, put it into the PCR instrument, incubate at 42℃ for 2min, and store at 4℃.

[0061] (2) Synthesis of the first-strand cDNA: Design and synthesize stem-loop structure primers for miRNA reverse transcription according to Table 2.

[0062] Table 2 miRNA reverse transcription primer sequences

[0063] miRNA miRNA reverse transcription primer (Stem-loopprimer) miR-3032-z GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGTTAC(SEQ ID NO.4) U6 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGAAAAATGTGGAA(SEQ ID NO.5)

[0064] Prepare the reaction mixture on ice according to the system shown in Table 3, and mix it gently with a pipette. To ensure the accuracy of the content of each component in the reaction system, prepare the premix according to the number of reactions, and then dispense 10 μL into the reaction tube in the previous step to reduce the error;

[0065] Table 3 Reaction system

[0066]

[0067]

[0068] After instant centrifugation, the prepared reaction system was immediately placed in a PCR instrument for reaction. The reaction conditions were: 25°C, 5 min; 50°C, 15 min; 85°C, 5 min; and stored at 4°C.

[0069] 2.3qRT-PCR

[0070] The qRT-PCR experiment was performed using the miRNAUniversal SYBR qPCR MasterMix (Vazyme#MQ101) kit. First, 5 μL of the cDNA obtained in the previous step was taken out and diluted 10 times with RNase Free H2O. The remaining cDNA was stored at -20°C for later use. The miRNA quantitative primers were designed and synthesized according to Table 4.

[0071] Table 4 miRNA quantitative primer sequences

[0072]

[0073] Prepare the reaction solution on ice according to the system described in Table 5. To ensure the accuracy of the content of each component in the reaction system, prepare the premix according to the number of reactions, mix thoroughly and dispense into each reaction well to reduce the error;

[0074] Table 5 Reaction system

[0075] Reagents volume 2×miRNAUniversalSYBRqPCRMasterMix 5.0μL Specific Primer (10 μM) 0.2μL mQPrimerR (10 μM) 0.2μL TemplateDNA / cDNA 0.5μL <![CDATA[ddH2O]]> 4.1μL

[0076] The prepared reaction system was centrifuged instantaneously and placed in a CFX96 Real-Time System (Bio-Rad) instrument for detection. The reaction conditions are shown in Table 6:

[0077] Table 6 Reaction conditions

[0078]

[0079] After the reaction, Bio-Rad CFX Manager software was used for data analysis.

[0080] 3qRT-PCR verification of gene expression

[0081] 3.1 cDNA Synthesis

[0082] The extracted total RNA was reverse transcribed to synthesize cDNA using the PrimeScriptTM RT reagent Kit with gDNA Eraser (Perfect Real Time) (TaKaRat#RR047A) kit. The following steps were performed according to the instructions:

[0083] (1) Reaction for removing genomic DNA: Prepare the reaction system on ice. To ensure the accuracy of the content of each component in the reaction system, prepare the premix according to the number of reactions. Mix the premix thoroughly and dispense it into 200 μL RNase-free PCR tubes to reduce errors. Finally, add the RNA sample. The main components of the reaction solution are shown in Table 7.

[0084] Table 7 Main components of the reaction solution

[0085] Reagents volume 5×gDNAEraserBuffer 2.0μL gDNAEraser 1.0μL Total RNA 1.0 μg <![CDATA[RNaseFreeH2O]]> Make up to 10 μL

[0086] Use a pipette to gently blow and mix, centrifuge the prepared mixture instantly, put it into the PCR instrument, incubate at 42℃ for 2min, and store at 4℃.

[0087] (2) Reverse transcription reaction: Prepare the reaction mixture on ice according to the system described in Table 8. To ensure the accuracy of the content of each component in the reaction system, prepare the premix according to the number of reactions, mix thoroughly and dispense 10 μL into the reaction tube in the previous step to reduce errors.

[0088] Table 8 Reaction system

[0089] Reagents volume PrimeScript RT Enzyme Mix I 1.0μL RTPrimerMix 1.0μL 5×PrimeScriptBuffer2(forRealTime) 4.0μL <![CDATA[RNaseFreeH2O]]> 4.0μL

[0090] Use a pipette to gently blow and mix, centrifuge the prepared mixture instantly, and immediately put it into the PCR instrument and store it at 37℃ for 15min; 85℃ for 5s; and 4℃.

[0091] 3.2qRT-PCR

[0092] TB Green Premix Ex TaqTMⅡ(Tli RNaseH Plus)(TaKaRa#RR820A) kit was used for qRT-PCR experiment. First, 5 μL of cDNA obtained by reverse transcription was taken out, and RNase Free H2O was added to dilute 10 times, and the remaining cDNA was stored at -20℃ for later use. qRT-PCR primers were designed and synthesized according to Table 9.

[0093] Table 9 Quantitative PCR primers

[0094]

[0095] Prepare the reaction solution on ice according to the system described in Table 10. To ensure the accuracy of the content of each component in the reaction system, prepare the premix according to the number of reactions, mix thoroughly and dispense into each reaction well to reduce the error;

[0096] Table 10 Reaction system

[0097] Reagents volume TaKaRa-TBGreenPremixExTaqTMⅡ(TliRNaseHPlus)(2×) 5.0μL Forward Primer (10 μM) 0.4μL Reverse Primer (10 μM) 0.4μL cDNA 0.8μL <![CDATA[RNaseFreeH2O]]> 3.4μL

[0098] The prepared reaction system was centrifuged instantaneously and placed in a CFX96 Real-Time System (Bio-Rad) instrument for detection. The reaction conditions are shown in Table 11:

[0099] Table 11 Reaction conditions

[0100]

[0101]

[0102] After the reaction, Bio-Rad CFX Manager software was used for data analysis.

[0103] 4. Dual luciferase assay to verify the binding of miRNA to target gene

[0104] 4.1 Construction of pmirGLO vector

[0105] 4.1.1 PCR amplification

[0106] The predicted miRNA target gene was verified by dual luciferase reporter gene. Referring to the sequence of the target gene, the restriction site recognition sequence and the protective base were added to the 3'UTR target fragment containing the miRNA binding site, and the synthetic primers were designed using SnapGene software following the primer design principles (see Table 12 for details).

[0107] Table 12 Primers required for dual luciferase reporter gene detection

[0108]

[0109] Note: The underline indicates the location of restriction endonuclease cutting sites.

[0110] PCR amplification was performed using brown planthopper cDNA as a template, and a 50 μL reaction system was prepared, as shown in Table 13:

[0111] Table 13 Reaction system

[0112] Reagents volume GloriaNovaHS2×MasterMix(ABclonal#RK20717) 25.0μL Forward Primer (10 μM) 1.0μL Reverse Primer (10 μM) 1.0μL cDNA 2.0μL <![CDATA[ddH2O]]> 21.0μL

[0113] After mixing, centrifuge briefly and place in a PCR instrument to perform the reaction according to the conditions described in Table 14:

[0114] Table 14 Reaction conditions

[0115]

[0116]

[0117] 4.1.2 PCR product gel recovery

[0118] Weigh 0.7g agarose, add 70mL 0.5×TBE buffer, mix the two and heat until the agarose is completely dissolved, cool to about 50℃, add 7μL nucleic acid dye Gelred, shake gently, and be careful to avoid bubbles during shaking. Pour the gel into a mold of appropriate size so that it evenly covers the entire gel plate, insert a sample comb of appropriate size and number of holes, let it stand for 15-20min, and remove the comb after the agarose gel is completely solidified. Add an appropriate amount of 6×LoadingBuffer to the PCR reaction well, mix well and apply the sample, set the electrophoresis voltage to 180V, and the electrophoresis time to 15min. After the electrophoresis is completed, quickly cut the gel containing the target band under ultraviolet light, weigh it and place it in a 2mL centrifuge tube.

[0119] Use FastPure Gel DNA Extraction Mini Kit (Vazyme #DC301) to recover the PCR product and perform the following operations according to the instructions:

[0120] (1) Add 100 μL of Buffer GDP to every 100 mg of agarose gel and incubate in a 50-55°C water bath for 7-10 min, inverting and mixing twice until the gel is completely dissolved.

[0121] (2) Place the FastPure DNAMini Columns-G adsorption column in a 2 mL CollationTubes collection tube, transfer the gel solution to the adsorption column, and centrifuge at 12000 rpm for 30-60 seconds;

[0122] (3) Discard the filtrate, put the adsorption column back into the collection tube, add 300 μL Buffer GDP, and centrifuge at 12000 rpm for 30-60 seconds;

[0123] (4) Discard the filtrate, put the adsorption column back into the collection tube, add 700 μL of Buffer GW pre-added with anhydrous ethanol along the wall of the adsorption column, close the tube cap, gently invert 2 to 3 times, and centrifuge at 12,000 rpm for 30 to 60 seconds;

[0124] (5) Repeat step (4);

[0125] (6) Discard the filtrate, put the adsorption column back into the collection tube, and centrifuge at 12000 rpm for 2 min;

[0126] (7) Place the adsorption column in a new 1.5 mL centrifuge tube, add 30 μL of 55°C preheated ddH2O to the center of the adsorption column, let stand for 2 min, centrifuge at 12000 rpm for 1 min, discard the adsorption column, and obtain the purified PCR product;

[0127] (8) The concentration and purity of the recovered product were measured using a Nanodrop 2000 UV spectrophotometer.

[0128] 4.1.3 Double restriction enzyme digestion reaction between target fragment and vector

[0129] The vector pmirGLO (Promega # E1330) was used for the dual luciferase assay. The target fragment and the pmirGLO empty vector ( Figure 1 ) Perform double enzyme digestion reaction according to the system described in Table 15 to obtain the target fragment with sticky end segment and the linearized vector large fragment;

[0130] Table 15 Reaction system

[0131] Reagents volume Target fragment / vector 17.0μL Enzyme① 0.5μL Enzyme ② 0.5μL 10×Mbuffer 2.0μL

[0132] Reaction conditions: 37°C, 3h. After the reaction is completed, an appropriate amount of 10× Loading Buffer is added to the system to terminate the reaction, and then agarose gel electrophoresis is performed to purify and recover the enzyme cleavage product.

[0133] 4.1.4 Ligation reaction between target fragment and vector

[0134] The pmirGLO vector and the digested product of the target fragment were ligated according to the system described in Table 16:

[0135] Table 16 Reaction system

[0136]

[0137] Reaction conditions: 16°C overnight, stored at 4°C.

[0138] 4.1.5 Transformation and bacterial culture PCR

[0139] Take out the DH5α E. coli competent cells from the -80℃ refrigerator, place them on ice to completely dissolve, and transfer them to the clean bench. Add 10μL of the ligation product to 100μL of the competent cells, flick the tube wall to mix the two thoroughly, and let it stand on ice for 30min. Heat shock at 42℃ for 90s, and after the heat shock, quickly place the centrifuge tube on ice for 2min. Then add 300μL of LB liquid culture medium without antibiotics to the tube, and shake and culture at 37℃, 220r / min for 1h. Pipette 100μL of the culture solution and evenly spread it on the LB solid culture dish containing ampicillin, and invert and culture overnight at 37℃.

[0140] Pick 12 single colonies from each dish and inoculate them into 300 μL LB liquid culture medium containing ampicillin, and culture at 37°C, 220 r / min shaking for more than 3 hours. Take 1 μL of the bacterial solution and perform the bacterial solution PCR reaction as described in Table 17:

[0141] Table 17 Reaction system

[0142] Reagents volume 2×TaqPlusMasterMixⅡ(DyePlus)(Vazyme#P213) 7.0μL Forward Primer (10 μM) 1.0μL Reverse Primer (10 μM) 1.0μL Bacterial liquid 1.0μL <![CDATA[ddH2O]]> 10.0μL

[0143] After mixing, centrifuge briefly and place in a PCR instrument to perform the reaction according to the conditions described in Table 18:

[0144] Table 18 Reaction conditions

[0145]

[0146] Agarose gel electrophoresis was performed and 200 μL of the positive clone bacterial solution with the correct band was taken for testing.

[0147] 4.1.6 Plasmid extraction

[0148] 10 μL of the positive clone solution with correct sequencing results was inoculated into 30 mL of LB liquid culture medium containing ampicillin, and cultured at 37°C and 220 r / min for 12 to 16 h.

[0149] Use FastPure PlasmidMini Kit (Vazyme#DC201) to extract plasmid and follow the instructions as follows:

[0150] (1) Aliquot the overnight culture into centrifuge tubes, with each tube not exceeding 5 mL, centrifuge at 10,000 rpm for 1 min, and discard the supernatant;

[0151] (2) Add 250 μL of Buffer P1 pre-added with RNase A into the centrifuge tube and vortex to mix;

[0152] (3) Add 250 μL of Buffer P2 and gently invert for 8 to 10 times to obtain a viscous and clear mixed solution;

[0153] (4) Add 350 μL Buffer P3 and mix by gently inverting 8 to 10 times. A white flocculent precipitate is produced and centrifuged at 12,000 rpm for 10 min.

[0154] (5) Place the FastPure DNAMini Columns adsorption column in a 2 mL collection tube, transfer the supernatant to the adsorption column, and centrifuge at 12000 rpm for 30-60 seconds;

[0155] (6) Discard the waste liquid, add 500 μL Buffer PW1 to the adsorption column, and centrifuge at 12000 rpm for 30-60 s;

[0156] (7) Discard the waste liquid, add 600 μL of Buffer PW2 diluted with anhydrous ethanol into the adsorption column, and centrifuge at 12000 rpm for 30-60 seconds;

[0157] (8) Repeat step (7);

[0158] (9) Discard the waste liquid, put the adsorption column back into the collection tube, and centrifuge at 12000 rpm for 1 min to completely dry the adsorption column;

[0159] (10) Place the adsorption column in a new 1.5 mL centrifuge tube, add 50 μL of preheated ddH2O to the center of the adsorption column, let stand at room temperature for 2 min, centrifuge at 12000 rpm for 1 min, discard the adsorption column, and obtain the recombinant plasmid;

[0160] (11) The concentration and purity of the recombinant plasmid were measured using a Nanodrop 2000 UV spectrophotometer.

[0161] 4.2 Cell culture

[0162] 4.2.1 Preparation of complete medium for S2 cells

[0163] Thaw fetal bovine serum (FBS) at 4°C overnight in advance, transfer 5 mL FBS to 45 mL Schneide's Drosophila medium in a clean bench, add 500 μL 10000 U / mL penicillin-streptomycin, and mix gently. Store the prepared complete medium at 4°C away from light and use within one week. Incubate in advance before use.

[0164] 4.2.2 S2 cell recovery

[0165] Quickly remove the S2 cell cryovial from the liquid nitrogen tank and immediately place it in a clean 30°C water bath for 1 minute to thaw quickly. Gently shake the cryovial during the thawing process to accelerate thawing. Disinfect the outer wall of the cryovial with 75% alcohol and transfer it to the clean bench. Completely aspirate the cell fluid in the cryovial and transfer it to a centrifuge tube containing 5mL preheated Schneide's Drosophila medium. Centrifuge at 200rpm for 5 minutes and discard the supernatant. Add an appropriate amount of preheated complete medium, gently blow with a pipette to resuspend the cells, and transfer them to a cell culture bottle. Gently shake to evenly spread the cells on the bottom of the bottle. Place the cell culture bottle in a cell culture incubator at 28°C for culture. After cell activation, subculture 2 to 3 generations until cell growth returns to normal.

[0166] 4.2.3 S2 cell passaging

[0167] S2 cells are semi-suspended cells. Use a pipette to gently blow and suspend the cells completely. Use a hemocytometer to count the cells. When the cell density in the culture flask is about 2×10 7 Cells were passaged when the number of cells / mL was 4 mL. 4 mL of cell suspension was transferred to 20 mL of preheated complete medium. The cells were gently blown with a pipette to resuspend the cells and transferred to a cell culture bottle. The cells were gently shaken to evenly spread the cells on the bottom of the bottle. The cell culture bottle was placed in a cell culture incubator and cultured at 28°C.

[0168] 4.3 Cell transfection

[0169] 4.3.1 Cell seeding

[0170] The cells were passaged about 24 h before transfection and seeded in 24-well cell culture plates at a seeding density of 0.3 to 1 × 10 5 Each well was placed in a cell culture incubator at 28°C for about 24 hours. The ExFect Transfection Reagent (Vazyme#T101) kit was used for cell transfection, and subsequent operations were performed according to the instructions.

[0171] 4.3.2 Formation of EcFect / DNA complex

[0172] Add 50 μL of serum-free cell culture medium to a 1.5 mL sterile centrifuge tube, then add 1 μL Express and mix gently by pipetting.

[0173] Take another 1.5 mL sterile centrifuge tube, add 50 μL of serum-free cell culture medium, then add 0.5 μg of pmirGLO recombinant plasmid and 1 μL of 100 nM miRNAagomir / antagomir, and mix gently by pipetting.

[0174] Add the mixed ExFect dropwise into the DNA mixture, gently pipette to mix, and let stand at room temperature for 15 to 20 minutes before use. The formed ExFect / DNA complex solution should be used within 30 minutes.

[0175] 4.3.3 Transient cell transfection

[0176] When the cell confluence reaches 70% to 80%, cell transfection is performed. The ExFect / DNA complex solution is added dropwise to the culture medium, and the culture dish is gently shaken to evenly disperse the ExFect / DNA complex in the culture medium. After culturing in a 28°C cell culture incubator for 24 to 48 hours, the cells are collected for subsequent experiments.

[0177] 4.4 Dual luciferase assay

[0178] Use Dual Luciferase Reporter Assay Kit (Vazyme #DL101) to detect the fluorescence intensity of Luciferin substrate after cell transfection, determine the expression level of Luciferase, and then infer the regulatory effect of the gene. Follow the instructions to perform the following operations:

[0179] 4.4.1 Pretreatment of detection reagents

[0180] Transfer all Reaction Buffer Ⅱ (Luciferase) components to Luciferase Substrate components, mix the two components thoroughly, divide them into packages according to experimental requirements, and store them at -80℃ in the dark.

[0181] Before each experiment, mix 5× Cell Lysis Buffer and ddH2O in a ratio of 1:4 according to the number of experimental samples and store on ice for later use.

[0182] After centrifugation of the Renilla Substrate component, mix it with Stop&Reaction Buffer at a ratio of 1:50 according to experimental requirements and use it at room temperature away from light.

[0183] Before adding samples for testing, the reagents must be equilibrated to room temperature before use to prevent the enzymatic reaction from being affected by temperature and causing errors in the measurement results.

[0184] 4.4.2 Cell lysis

[0185] Collect the cell culture fluid in the 24-well plate into a 1.5 mL centrifuge tube, centrifuge at 11200 rpm for 2 min, and discard the supernatant; wash twice with PBS, centrifuge at 11200 rpm for 2 min, and discard the supernatant; add 100 μL of diluted 1× Cell Lysis Buffer to the tube, gently pipet and mix, let stand at room temperature for 5 min, centrifuge at 11200 rpm for 2 min, and take the supernatant for subsequent detection.

[0186] 4.4.3 Firefly luciferase reaction detection

[0187] Pipette 20 μL of cell lysis supernatant into a black ELISA plate, add 100 μL of Luciferase Substrate equilibrated to room temperature to each well, mix quickly, and immediately detect the activity of the Fireflyluciferase reporter gene on a full-wavelength ELISA reader.

[0188] 4.4.4 Renilla luciferase reaction detection

[0189] Add 100 μL of Renilla Substrate equilibrated to room temperature to the reaction solution in the previous step, mix quickly, and immediately detect the activity of the Renilla luciferase reporter gene on a full-wavelength microplate reader.

[0190] The dual luciferase activity was determined by calculating the ratio of the fluorescence expression of Firefly luciferase to that of Renilla luciferase.

[0191] 5. Microinjection of miRNA agonists (agomir) and antagonists (antagomir)

[0192] Wuhan Tianyi Huayu Gene Technology Co., Ltd. was commissioned to synthesize miRNA agonists (agomir) and antagonists (antagomir) according to Table 19.

[0193] Table 19 miRNA agonist and antagonist sequences

[0194]

[0195]

[0196] Agonists (agomir) are modified double-stranded RNA molecules that can mimic the functional mode of miRNA complexes in the body and upregulate miRNA expression by transfecting cells or administering drugs in animals. Usually, one strand of agomir is almost completely identical to the sequence of the miRNA molecule, and the 3' end of the antisense strand is modified with high-affinity cholesterol and 4 thio backbones, the 5' end has 2 thio backbone modifications, and the entire strand is methylated. Antagonists (antagomir) can interfere with the expression of endogenous miRNA and are one of the important tools for studying the loss of miRNA function. It is a modified single-stranded RNA molecule with a sequence that is almost completely identical to the reverse complementary sequence of miRNA, and the modification method is exactly the same as the modified strand of agomir.

[0197] 5.1 Microinjection of agomir and antagomir

[0198] 5.1.1 Preparation before the experiment

[0199] Weigh 1.5 g agar powder, add 100 mL ddH2O, and heat in a microwave oven until the agar powder is completely dissolved. Transfer the dissolved agar gel to a clean glass dish and let it stand at room temperature until it is completely solidified.

[0200] Place the capillary glass needle used for microinjection on a glass slide and observe it under a stereo microscope. Use a clean scalpel to gently cut the tip of the needle to clear the tip and form a port of appropriate size and a section with an appropriate angle. Use a syringe to inject liquid paraffin from the tail end of the capillary glass needle until droplets can be seen overflowing from the tip of the needle. Fix the capillary glass needle on the microinjection instrument and ensure that the sealing rubber plug is completely tightened and no air enters to ensure airtightness.

[0201] 5.1.2 Microinjection

[0202] Select brown planthoppers of appropriate size according to the experimental requirements, put them into a clean glass test tube, and introduce CO2 for 15s, or place them on ice for 30s to temporarily incapacitate them. Gently transfer the brown planthoppers to the agar gel stage with their abdomen facing upwards, adjust the angle of the microinjector so that the needle tip gently pierces the intersegmental membrane between the prothorax and mesothorax of the brown planthopper. Inject 50nL of 10μM miRNA agonist or antagonist into each test insect. Transfer the injected brown planthoppers to a clean plate with clean filter paper and fresh rice plants for 24h before conducting subsequent experiments.

[0203] 5.3 Detection of brown planthopper weight gain and honeydew secretion after microinjection

[0204] Several 5th instar biotype Y brown planthopper nymphs were selected and injected with miRNA agonists. After recovery, they were transferred to clean rice plants and raised until they emerged. Before the experiment, the weight of the newly emerged brown planthoppers was weighed and recorded using an electronic balance, and then the weighed brown planthoppers were placed in a pre-prepared wax bag and fixed on the stem at the base of the YHY15 rice plant. After the brown planthoppers fed on the rice material for 48 hours, the wax bag was removed from the stem and the brown planthoppers were taken out of the wax bag. The wax bag contained honeydew secreted by the brown planthoppers during feeding. Careful operation was performed during the experiment to avoid scratching. The weight of the brown planthoppers and the wax bag after feeding was weighed and recorded respectively. The change in the weight of the brown planthoppers and the wax bag before and after feeding is the weight gain and honeydew secretion of the brown planthoppers.

[0205] 5.4 Fluorescence quantitative PCR detection of changes in target gene and miRNA expression levels after injection

[0206] Several short-winged female adults of the newly emerged biotype Y brown planthopper were injected with miRNA agonists and antagonists. After recovery, samples were taken, quickly frozen in liquid nitrogen, and stored in a -80°C refrigerator. RNA was extracted from each sample using RNAiso Plus (TaKaRa #9109) reagent. Fluorescence quantitative PCR was used to detect changes in the expression of miRNA and target genes in the samples after injection of miRNA agonists and antagonists.

[0207] Results Analysis

[0208] 1. Screening of differentially expressed miRNAs and target genes and qPCR verification

[0209] miRNAs are involved in the regulation of various physiological and biochemical processes in insects. By performing high-throughput sequencing on the expression of miRNAs in two different biotypes of brown planthoppers, differentially expressed miRNAs were identified, and the gene functions obtained by sequencing were classified using bioinformatics analysis methods; miRNAs were matched one-to-one with target genes, and based on the study of the molecular mechanism of brown planthoppers adapting to insect-resistant rice, miR-3032-z related to the detoxification metabolic pathway was selected for study. miRNAs mainly exercise biological functions by targeting and regulating the expression of target genes, so qRT-PCR technology was used to detect the expression of miR-3032-z and the corresponding target gene cytochrome P450 family gene CYP15A1 in two biotypes of brown planthoppers. The results showed that compared with biotype 1, the expression of miR-3032-z in the more harmful biotype Y brown planthopper was significantly reduced ( Figure 2 A in the figure), while the expression of the corresponding target gene CYP15A1 increased significantly ( Figure 2In B), miR-3032-z was negatively correlated with CYP15A1. The qRT-PCR verification results were basically consistent with the sequencing results, so it was speculated that miR-3032-z and its corresponding target gene CYP15A1 may be involved in the detoxification metabolism-related pathways of brown planthoppers and play an important role in the evolution of brown planthopper virulence and the formation of new biotypes.

[0210] 2. Dual luciferase assay to verify the binding of miRNA to target gene

[0211] In order to confirm the binding of miRNA to target gene, dual luciferase reporter gene detection system was used for analysis. The 3'UTR region containing target gene and miRNA binding site was inserted into pmirGLO vector to construct recombinant plasmid, and co-transfected with miRNA agonist agomir into S2 Drosophila embryonic cells as experimental group, and its relative fluorescence value was significantly lower than that of blank control group transfected with empty plasmid pmirGLO and negative control group transfected with agomir-NC ( Figure 3 ), Figure 3 The results showed that miR-3032-z targeted the CYP15A1 gene and specifically, miRNA regulated gene expression by targeting the 3'UTR region of the target gene.

[0212] 3. miR-3032-z regulates the expression of CYP15A1

[0213] In order to further reveal whether the change in miR-3032-z expression in brown planthoppers affects the expression of CYP15A1, the expression of miR-3032-z was overexpressed or inhibited by injecting artificially synthesized miR-3032-z agomir and antagomir into newly emerged female brown planthoppers, and then the expression of CYP15A1 was detected. The results showed that compared with the NC control, in brown planthoppers injected with agomir-3032, the expression of miR-3032-z increased significantly by 3.462 times at 24h, while the expression of the target gene CYP15A1 decreased significantly by 0.239 times ( Figure 4 A and Figure 4 In brown planthoppers injected with antagomir-3032, the expression of miR-3032-z was significantly reduced, 0.672 times that of the NC control, while the expression of CYP15A1 increased by 1.48 times ( Figure 4 C and Figure 4 D).

[0214] 4. Effect of miR-3032-z on feeding behavior of brown planthopper

[0215] In order to further clarify whether the increase in miR-3032-z expression can affect the feeding behavior of brown planthoppers, the expression level of miR-3032-z in brown planthoppers was increased by injecting artificially synthesized miRNA agonists into newly emerged female brown planthoppers, and then the honeydew secretion and insect weight gain of brown planthoppers after feeding on YHY15 rice material for 48 hours were detected. Figure 5 A and Figure 5 As shown in Figure B, after microinjection of agomir-NC, the weight gain and honeydew secretion of brown planthoppers after feeding on rice plants for 48 hours were 0.3263 mg and 12.074 mg, respectively. After injection of agomir-3032, the weight gain and honeydew secretion of brown planthoppers after feeding on rice plants for 48 hours were 0.1497 mg and 9.2733 mg, respectively. Figure 5 ).

[0216] Compared with the injection of agomir-NC, the weight gain and honeydew secretion of brown planthoppers injected with the agonist agomir-3032 were downregulated, indicating that the increase in the expression of miR-3032-z affects the feeding behavior of brown planthoppers. Measuring the amount of honeydew secretion and the change in body weight of brown planthoppers can reflect the amount of feeding of brown planthoppers, and then reflect the resistance of the rice variety they feed on, which is an important indicator for phenotypic identification of brown planthoppers and rice varieties. The less honeydew secreted by brown planthoppers, the lower the weight gain, and even negative weight gain, indicating that the resistance of rice materials is stronger, which has an inhibitory effect on the feeding behavior of brown planthoppers. At the same time, the reduction in honeydew secretion indicates that the digestion and metabolism of brown planthoppers are affected, and the reduction in insect weight gain indicates that the growth and development process of brown planthoppers is inhibited. The results showed that by injecting agomir-3032 to inhibit the expression of the cytochrome P450 family gene CYP15A1, the honeydew secretion and insect weight gain of the biotype Y brown planthopper on the insect-resistant rice YHY15 were reduced, and the feeding behavior was significantly inhibited, making the harmful brown planthopper regain its sensitivity to the resistant rice YHY15.

[0217] Conclusion: Functional miRNA can bind to the 3'UTR region of the target gene to inhibit or degrade mRNA, thereby regulating the expression of the target gene (Asgari S. 2013. MicroRNA functions in insects. Insect Biochemistry and Molecular Biology, 43: 388-397. Bartel DP. 2009. MicroRNAs: target recognition and regulatory functions. Cell, 136: 215-233. Fabian MR, Sonenberg N, Filipowicz W. 2010. Regulation of mRNA translation and stability by microRNAs. Annual Review of Biochemistry, 79: 351-379.). In order to explore the post-transcriptional regulatory mechanism of functional genes involved in the digestion metabolism and detoxification of brown planthoppers, the present invention uses experimental methods such as fluorescence quantification and dual luciferase reporter gene detection to confirm that miR-3032-z targets the 3'UTR region of the CYP15A1 gene to regulate gene expression. In order to further reveal the relationship between miRNA and target genes, the expression of miRNA in brown planthoppers was regulated by artificially synthesizing microinjection of miRNA agonists (agomir) and antagonists (antagomir). The results showed that after the injection of agonists, the expression of miRNA in brown planthoppers increased significantly, while the expression of corresponding target genes was significantly downregulated. In contrast, the expression of corresponding target genes was significantly enhanced after the injection of miRNA antagonists. At the same time, further phenotypic identification experiments of brown planthoppers found that the honeydew secretion and insect weight gain of brown planthoppers after the injection of agonists were significantly reduced. In summary, miR-3032-z reversely regulates the expression of the CYP15A1 gene and mediates the adaptation process of brown planthoppers to insect-resistant rice.

[0218] The present invention provides new insights into the molecular genetic mechanism of miRNA involvement in the virulence of brown planthoppers, deepens the understanding of the digestive metabolism and detoxification process of brown planthoppers from the perspective of miRNA, provides a reference for the study of detoxification metabolism of brown planthoppers, provides an important theoretical basis for revealing the adaptation of brown planthoppers to insect-resistant rice, deepens the understanding of the molecular mechanism of plant-insect interactions, and provides a reference for the formulation of future control strategies for brown planthoppers.

[0219] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Use of miR-3032-z or an agent overexpressing miR-3032-z in the preparation of a product for inhibiting the expression of the CYP15A1 gene of brown planthopper; the product includes a drug or a kit.

2. Use of an agent for inhibiting the expression of the CYP15A1 gene of brown planthopper in the preparation of a drug for restoring the sensitivity of brown planthopper to insect-resistant rice; the agent for inhibiting the expression of the CYP15A1 gene of brown planthopper comprises an agent for overexpressing miR-3032-z.

3. Use of an agent for inhibiting the expression of the CYP15A1 gene of brown planthopper in the preparation of a drug for destroying the detoxification metabolic ability of brown planthopper to insect-resistant rice; the agent for inhibiting the expression of the CYP15A1 gene of brown planthopper includes an agent for overexpressing miR-3032-z.

4. The use according to claim 2 or 3, It is characterized in that The insect-resistant rice includes insect-resistant rice YHY15.

5. Use of an agent for inhibiting the expression of the CYP15A1 gene of brown planthoppers in the preparation of a drug for reducing the honeydew secretion and / or insect weight gain of brown planthoppers; the agent for inhibiting the expression of the CYP15A1 gene of brown planthoppers comprises an agent for overexpressing miR-3032-z.

6. Use of an agent for inhibiting the expression of the CYP15A1 gene of brown planthoppers in the preparation of a drug for inhibiting the feeding behavior of brown planthoppers; the agent for inhibiting the expression of the CYP15A1 gene of brown planthoppers comprises an agent for overexpressing miR-3032-z.

7. The use according to any one of claims 1 to 3, 5 and 6, It is characterized in that The brown planthopper includes the harmful type brown planthopper.

8. The use according to claim 7, It is characterized in that The harmful brown planthopper includes biological Y-type brown planthopper.

9. The use according to any one of claims 1 to 3, 5 and 6, It is characterized in that The agent for overexpressing miR-3032-z includes a miR-3032-z agonist.

10. The use according to claim 9, It is characterized in that The miR-3032-z agonist includes agomiR-3032; the nucleotide sequence of the sense chain of agomiR-3032 is preferably as shown in SEQ ID NO.2, and the nucleotide sequence of the antisense chain of agomiR-3032 is preferably as shown in SEQ ID NO.3.

Images