A rs338618851 site snp molecular marker related to pork production efficiency of pigs and application thereof

By discovering the rs338618851 SNP molecular marker in the promoter region of the pig FHL3 gene, the problem of low breeding efficiency of pig meat production traits in existing technologies has been solved, realizing efficient and precise molecular marker-assisted selection, and improving the growth performance and meat quality characteristics of pigs.

CN119120723BActive Publication Date: 2026-07-07HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HUAZHONG AGRI UNIV
Filing Date
2024-09-23
Publication Date
2026-07-07

Smart Images

  • Figure CN119120723B_ABST
    Figure CN119120723B_ABST
Patent Text Reader

Abstract

The application discloses a SNP molecular marker of a site rs338618851 related to pork production efficiency of pigs and application. The genetic marker is cloned from a 93991071 site of a chromosome 6 of pigs. American Landrace pigs are selected as test materials, whole genome DNA is extracted from blood of the pigs, and a primer is designed according to a pig genome sequence NC_010448.4 published in an NCBI database. A base substitution of T or C exists at a 172th position of a primer amplification sequence, the substitution causes polymorphism at the position. The SNP site is typed through a direct sequencing technology, and correlation analysis shows that, compared with other gene individuals, a TT genotype individual at the 172th position is large in birth weight, large in eye muscle area and short in time to reach 100 kg at a certain age. The application provides a new marker for molecular breeding of pork production traits of pigs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and molecular marker technology, specifically relating to a SNP molecular marker in the promoter region of the FHL3 gene related to porcine meat production efficiency, and also to the application of this SNP molecular marker in the promoter region of the FHL3 gene related to porcine meat production efficiency. This genetic marker was cloned from nucleotide 93991071 of porcine chromosome 6. Background Technology

[0002] In animal genetics and breeding, the control mechanisms of traits can be divided into two main categories: simple traits controlled by a single gene and complex traits controlled by multiple genes [1]. Lander, ES, & Schork, NJ (1994). Genetic dissection of complex traits. Science, 265 (5181), 2037-2048. Traits controlled by a single gene are usually dominated by one or a few genes, which express a simple Mendelian inheritance pattern through dominant or recessive alleles, such as flower color in peas or certain hereditary diseases. However, traits that have important economic value in agriculture, such as milk production in dairy cows, backfat thickness in pigs, and eye muscle area, are usually controlled by multiple genes. These complex traits do not follow simple Mendelian inheritance laws, but are caused by the combined effects of multiple genes [2] Flint, J., & Mott, R. (2001). Finding the molecular basis of quantitative traits: successes and pitfalls. Nature Reviews Genetics, 2(6), 437-445. Each gene has a small influence on the trait, resulting in continuous variation in the phenotype. These genes are usually called quantitative trait loci (QTLs) [3] Mackay, TFC (2001). The genetic architecture of quantitative traits. Annual Review of Genetics, 35(1), 303-339. Compared with single-gene traits, the inheritance pattern of polygenic traits is more complex, involving multiple genes and their interactions with the environment.Studying the genetic mechanisms of these complex traits usually requires the use of complex statistical models and genome-wide association studies (GWAS) [4] Dekkers, JCM, & Hospital, F. (2002). The use of molecular genetics in the improvement of agricultural populations. Nature Reviews Genetics, 3(1), 22-32. [5] Meuwissen, TH, Hayes, BJ, & Goddard, ME (2001). Prediction of total genetic value using genome-wide dense marker maps. Genetics, 157(4), 1819-1829.

[0003] A key reason for conducting GWAS studies in livestock is to select superior livestock using validated markers through marker-assisted selection (MAS) technology. MAS is a breeding method that selects individuals with desired traits by using marker genotypes that are closely linked to target genes. [6] Goddard, ME, & Hayes, BJ (2009). Mapping genes for complex traits in domestic animals and their use in breeding programmes. Nature Reviews Genetics, 10(6), 381-391. Traditionally, selection of economically valuable traits relies on phenotypic records of individuals and their relatives, and breeding values ​​are estimated using Best Linear Unbiased Prediction (BLUP) [7] Zhao, Y., Zhao, H., Wang, C., Lan, H., & Chen, L. (2021). Integrating GWAS and GBLUP to Improve GenomicPrediction Accuracy for Complex Traits in Livestock. Frontiers in Genetics, 12, 645800. However, this approach often neglects the direct identification of relevant genes and is less efficient for selecting traits that are difficult to measure, such as milk yield, meat quality, and lifespan.

[0004] MAS technology significantly improves these traits by identifying and selecting individuals carrying ideal alleles, thereby shortening the breeding cycle. MAS includes two main types: one is to use pathogenic mutations in identified genes or regulatory regions, which usually have a significant impact on traits; the other is to use single nucleotide polymorphisms (SNPs) in linkage disequilibrium (LD) state with QTLs [8] Li, X., Huang, Y., & Cheng, Y. (2022). Advances in Marker-Assisted Selection and Genomic Selection in Animal Breeding: Current Status and Future Prospects. Animal Frontiers, 12(2), 50-57. The latter estimates the breeding value of selected candidates by combining pedigree, marker and phenotypic information. This type of MAS has been successfully applied to improve several important traits of livestock, such as fertility, feed intake, growth rate and meat quality [9] Wang, X., Zhang, Y., Li, J., & Liu, L. (2021). Recent Advances in Quantitative Trait Loci Mapping and Genome-Wide Association Study in Livestock. Biomolecules, 11(10), 1516.

[0005] The porcine FHL3 gene (Four and a Half LIM Domains Protein 3) is a gene that is widely involved in muscle development and regulation, and its expression level may directly affect the growth performance of pigs

[10] . Bai,W.,Zhang,Y.,Ma,J.,Du,M.,Xu,H.,Wang,J.,Zhang,L.,Li,W.,Hou,Y.,Liu,X.,Zhang,X.,Peng,Y.,Li,J.,Zhan,X.,Jiang,W.,Liu,S.,Liu,X.,Li,Q.,Miao,Y.,Sui,M.,Yang,Y.,Zhang,S.,Xu,Z.,&Zuo,B.(2023).FHL3 promotes the formation of fast glycolytic muscle fibers by interacting with YY1 and muscle glycolytic metabolism. Cellular and Molecular Life Sciences, 80(1), 2023. Therefore, functional variations of the FHL3 gene are an important aspect of studying the genetic basis of pork production traits. Summary of the Invention

[0006] The purpose of this invention is to provide a molecular marker for the rs338618851 SNP locus associated with pig meat production efficiency. This genetic marker is cloned from the 93991071 locus on pig chromosome 6. Direct sequencing is used to find SNP loci and genotyping methods to analyze its association with pig meat production traits, thereby establishing a new marker-assisted selection locus for pig meat production traits.

[0007] Another objective of this invention is to provide an application of the rs338618851 SNP molecular marker in improving pig meat production efficiency. Given the important role of rs338618851 in pig growth and meat production traits, this SNP can serve as an effective molecular marker for pig genetic improvement. By utilizing this SNP for marker-assisted selection, breeding efficiency can be significantly improved, leading to the selection of breeding pigs with excellent growth performance and meat quality characteristics, providing an efficient and precise genetic improvement tool for pork production. This discovery provides a new target for molecular breeding of pigs, with broad application prospects and significant economic value. Incorporating rs338618851 into breeding strategies can further optimize the genetic structure of pigs and enhance the competitiveness of the pork industry.

[0008] This invention is achieved through the following technical solution:

[0009] In this study, the inventors of this application discovered a SNP site, rs338618851, located in the promoter region of the FHL3 gene. Statistical analysis and experimental verification showed that this SNP site is significantly associated with growth rate and meat yield in pigs. Specifically, different genotypes of rs338618851 exhibit significant differences in traits such as birth weight, lean meat percentage, and growth rate. This SNP may influence the growth and differentiation of muscle cells by altering the expression level of the FHL3 gene.

[0010] The objective of this invention is to screen genetic markers associated with the meat production trait in pigs. By cloning the gene sequence of the 939990900-93991758 segment of pig chromosome 6, and using direct sequencing to identify SNP sites and genotyping methods, the association between these markers and the meat production trait in pigs is analyzed. This aims to establish new marker-assisted selection sites for the meat production trait in pigs, thereby increasing muscle yield.

[0011] This invention obtained the gene sequence of segment 939990900-93991758 of pig chromosome 6, with a fragment length of 859 bp. Its nucleotide sequence is shown in SEQ ID NO.1. BLAST alignment on the NCBI website revealed a single nucleotide polymorphism (SNP) site within this amplified fragment, as detailed below. Figure 2 As shown. The mutation at this SNP site is specifically located at base 93991071 on chromosome 6, where the base changes from T to C. According to the naming rules of the Ensembl database, this mutation site is named rs338618851.

[0012] The experimental material was American Large White pigs. Whole-genome DNA was extracted from the blood of American Large White pigs, and primer pairs were designed based on the porcine genome sequence (NC_010448.4) published in the NCBI database. The primer pair sequences are as follows:

[0013] Forward primer (SEQ ID NO.2): 5'-CTACCATTCCTGTTCCTTATCT-3',

[0014] Reverse primer (SEQ ID NO.3): 5'-ACATCCACCGCCTATCAG-3'.

[0015] The primer pairs described above can be used to detect and genotype SNP sites in the gene region of chromosome 6 of pig, specifically the segment from 939990900 to 93991758.

[0016] After PCR amplification, purification of the PCR product, cloning and sequencing, and sequence alignment analysis using the primer pairs described above, a genetic marker associated with the meat production trait in pigs was screened. The nucleotide sequence of this genetic marker is shown below, with the mutation site located at position 172 of the sequence, specifically as described in SEQ ID NO.1: CTACCATTCCTGTTCCTTATCTTGTGGTGGAAGGGGGCTTGCTTGGGGTCTCCCAGCTCTTCTT TCACTTTGGCAGTGTTTTCAAAAGGAGGCCCTGGGTGACTGAAGGCTGGCAGGCCTCTCGT GGTTTCCTCTGGGTGCTGAATCACTCCTGATGCTTGTAACCACAAGR(T / C)CCTCCCCCTCCCC CCAGTGAGAAAACTTCCTTCTTTCTCTGGGTGTATTGCTCACTCTTATCCACTGGGCTGAATACAGCCCCTGCAGTCCTCCTGGCTAAGCAGACACCCTCTTTCAGATTGCCCAGAAGCACTTTCCTTGTGAGCCCAAGCCTGGCATTGGGTCTGTGGGTGCAGAATGT TAAGTGAGTGACTTCTACAGAGTGTGGGGAGGAATGGTAGAGGGAAAATAACCTATGGTTTGGGTTTTTTTCATCTTTTTGCCATTTTCTTGGGCCACTCCCACGGCATATGGAGGTTCCCAGGCTAGAGGTCTAATCGGAGCTGTAGGCACCGGCCTACGCCAGAGC CACAGCAATGCAGGTTCCGAGCCGCGTCTGCGACCTACACCACAGCTCATGGCAATGCCGGATCCTTAACCCACTGAGCAAGACCAGGGATCGAACCTGCAACCTCACGGTTCCTAGTCGGATTCATTAATCACTGCGCCACGACAGGAACTCCACCTATGGTTAAAT GCCAGCTACATGCATGGTACAATGCTAAGTAACAGTCATTCCTTCCCTCAGTTCTCACAAAAGCCGTAAGAAATGCTTATTATATTATTGCTATTTTACAGAGTAGGATATGGGGCTCAGAAGGTTTGACAGTGTGGCCCTAAATCACAAGCTGATAGGCGGTGGATGT

[0017] A method for screening genetic markers associated with meat production traits in pigs, comprising the following steps:

[0018] 1. Extract genomic DNA from the blood of American Large White pigs.

[0019] 2. Primers were designed based on the genomic sequence from +2332 to +3190 bp upstream of the FHL3 transcription start site. The porcine genomic DNA was amplified by PCR using these primers, and the nucleotide sequence from +2332 to +3190 bp upstream of the FHL3 transcription start site was obtained by direct sequencing (see SEQ ID NO.1 for the sequence details). This sequence contains one SNP site.

[0020] 3. This mutation site can be used as a genetic marker to conduct association analysis on the meat yield and growth rate traits of American Large White pigs.

[0021] A genotyping method for detecting SNP sites in the above sequence.

[0022] This invention further provides an application of direct sequencing to determine the association between different genotypes and meat yield and growth rate.

[0023] The application of an rs338618851 SNP molecular marker in improving pork meat production efficiency involves the following steps:

[0024] 1. To determine the correlation between SNPs in the region 939990900-93991758 of pig chromosome 6 and phenotypic differences in pigs, American Large White pigs were selected as the experimental material.

[0025] 2. Polymorphism was detected using direct sequencing, and the correlation between polymorphic sites and porcine meat production traits was analyzed. A mixed linear model in SAS statistical software was used to analyze the association between genotype and phenotypic values.

[0026] Sequence SEQ ID NO.1 is the nucleotide sequence of segment 939990900-93991758 of pig chromosome 6, which serves as the nucleotide sequence for the genetic marker of this invention. A mutation site exists at the 172nd base of this sequence, where an allele is mutated from "T" to "C". The base at the mutation site in the sequence is the original base; the mutation method is described in this specification.

[0027] The sequence SEQ ID NO.2 is a primer pair sequence used to amplify the segment 939990900-93991758 of pig chromosome 6, which is used to detect the genetic marker of the present invention.

[0028] For more detailed technical solutions, please refer to the "Detailed Implementation".

[0029] Compared with the prior art, the present invention has the following advantages and effects:

[0030] Based on preliminary omics data analysis conducted in the laboratory, a SNP locus, rs338618851, located in the promoter region of the FHL3 gene, was identified. Statistical analysis and experimental validation showed that the polymorphic locus rs338618851 was significantly correlated with birth weight, eye muscle area, and age at 100 kg in American Large White pigs (P<0.05). Specifically, individuals with the TT genotype had significantly higher birth weight and eye muscle area than those with the CC genotype (P<0.01); regarding the age at 100 kg, individuals with the TT genotype reached 100 kg at a significantly shorter age than those with the CC genotype (P<0.01). From the perspectives of genetic stability and genetic progression, the TT genotype showed a clear advantage in shortening the age at 100 kg and increasing birth weight and eye muscle area. In summary, the polymorphic locus rs338618851 can serve as a molecular breeding marker for increasing meat production traits in pigs. The present invention aims to discover and identify SNP loci associated with meat production traits in pigs, thereby providing important guidance for pig genetic breeding. Attached Figure Description

[0031] Figure 1 This invention describes the cloning detection results of the 939990900-93991758 segment of porcine chromosome 6. The agarose gel concentration was 1.5%. Figure labeling: Lanes 1-4: PCR amplification products; Lane M: DL2000 Maker.

[0032] Figure 2 The nucleotide sequence of segment 939990900-93991758 of porcine chromosome 6. The accompanying diagram illustrates that there is one mutation site in the sequence shown, which is the specific site causing the polymorphism in this segment.

[0033] Figure 3 The sequencing results of the genetic marker sequence of this invention show a bimodal pattern, where the base "T" is mutated to "C". Detailed Implementation

[0034] Example 1: Obtaining DNA fragments from region 939990900-93991758 of porcine chromosome 6 and establishing a method for SNP detection.

[0035] A method for screening genetic markers associated with meat production traits in pigs, comprising the following steps:

[0036] 1. American Large White pigs were selected for the experiment. Primer pairs were designed based on the genome sequence of the 939990900-93991758 segment of chromosome 6. The specific sequences are as follows:

[0037] Forward primer: 5'-CTACCATTCCTGTTCCTTATCT-3',

[0038] Reverse primer: 5'-ACATCCACCGCCTATCAG-3'.

[0039] 2. PCR amplification was performed on the genomic DNA of different experimental groups of pigs using the primer pairs mentioned above.

[0040] The PCR reaction system is shown in Table 1.

[0041] Table 1 PCR reaction system

[0042]

[0043] The PCR reaction conditions are shown in Table 2.

[0044] Table 2 PCR reaction conditions

[0045]

[0046] After purification and cloning, the obtained PCR product was sent to Wuhan Hece Gene Technology Co., Ltd. for sequencing. BLAST alignment analysis revealed a T / C base mutation at position 172 of the sequence.

[0047] Example 2: Association Analysis and Application of Genetic Markers of the Present Invention with Meat Production Traits in American Large White Pigs. The application of an rs338618851 SNP molecular marker in improving pork meat production efficiency includes the following steps:

[0048] 1. In order to determine the correlation between SNPs in the region 939990900-93991758 of pig chromosome 6 and phenotypic differences in pigs, this example selected American Large White pigs (640 heads) as experimental materials.

[0049] 2. Polymorphism was detected using direct sequencing, and the correlation between polymorphic sites and porcine meat production traits was analyzed. A mixed linear model in SAS statistical software was used to analyze the association between genotype and phenotypic values.

[0050] The analytical model for American Large White pigs is as follows: Y ijkl =u+G i +F j +S k +B l +ε ijklm In the formula, Y ijkl G represents the observed trait value; u represents the overall trait mean; G represents the observed trait value. i This is a genotype effect; F j Sk B l For fixed effects, ε represents pedigree, sex, and batch effects. ijklm The error is random, assumed to follow the pattern N(0, σ). 2 )distributed.

[0051] Polymorphism detection was performed on the rs338618851 locus in the 939990900-93991758 region of porcine chromosome 6, and three genotypes were detected in the aforementioned American Large White pig population. The genotype frequencies and their distribution are shown in Table 3.

[0052] Table 3. Genotype and allele frequencies of the polymorphic locus rs338618851 in Large White pig populations.

[0053]

[0054] Table 3 shows that the C allele frequency of the polymorphic site rs338618851 is higher than the T allele frequency in the American Large White pig population.

[0055] Table 4. Association analysis of polymorphic locus rs338618851 with meat production traits.

[0056]

[0057] Note: The above values ​​are the least squares mean ± standard error; within each pig breed, the same letter in the same column indicates no significant difference (P>0.05), different letters indicate significant difference (P<0.05), and no label indicates no significant difference (P>0.05). The number in parentheses indicates the number of pigs.

[0058] Analysis of Table 4 revealed that the polymorphic locus rs338618851 was significantly correlated with birth weight, eye muscle area, and age at 100 kg in American Large White pigs (P<0.05). Specifically, individuals with the TT genotype (non-mutant genotype) had significantly higher birth weight and eye muscle area than those with the CC genotype (mutant genotype) (P<0.01); regarding the age at 100 kg, individuals with the TT genotype reached 100 kg at a significantly shorter age than those with the CC genotype (P<0.01). From the perspectives of genetic stability and genetic progression, the TT genotype showed a clear advantage in shortening the age at 100 kg and increasing birth weight and eye muscle area. In summary, the polymorphic locus rs338618851 can be used as a molecular breeding marker for increasing meat production traits in pigs.

Claims

1. The application of a molecular marker at the rs338618851 site, associated with porcine meat production efficiency, in improving porcine meat production efficiency, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein there is a mutation site of an allele at the 172nd base of the sequence, which is mutated from T to C; the pig is an American Large White pig; the primer pair sequence of the SNP molecular marker is shown in SEQ ID NO.2 and SEQ ID NO.3; the birth weight and eye muscle area of ​​the TT genotype individuals are significantly higher than those of the CC genotype individuals; in terms of the age at which they reach 100 kg body weight, the age at which the TT genotype individuals reach 100 kg body weight is significantly shorter than that of the CC genotype individuals.