Plant glandular hair development regulation gene NtJAZ11, encoding protein thereof, expression vector and application of plant glandular hair development regulation gene NtJAZ11

Abstract

The invention discloses a plant glandular hair development regulation gene NtJAZ11 as well as an encoding protein, an expression vector and application thereof, and aims to solve the technical problems that at present, different development mechanisms for glandular hair and protection hair of plants (such as tobacco) are unknown, and effective regulation means and utilization ways are lacked. A gene NtJAZ11 capable of regulating glandular hair and protecting hair development is identified, an overexpression vector and a gene editing vector of the gene NtJAZ11 are constructed, and a corresponding overexpression strain and a corresponding gene editing strain are obtained through transformation; subcellular localization, tissue expression, MeJA response mode analysis, plant phenotypic characteristic identification and the like show that NtJAZ11-2 can negatively regulate and control the development of tobacco glandular hair, and has important application value in regulating and controlling the development process of plant epidermal hair.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and specifically to a plant glandular hair development regulating gene NtJAZ11 , its encoded protein, expression vector and its application. Background Art

[0002] Epidermal hairs are a kind of specialized hair-like appendages extending from the epidermal tissue of the above-ground part of most plants. They can not only protect plants from biotic and abiotic stresses, but also have high economic and medicinal value. Epidermal hairs are divided into two types according to whether they have the ability to secrete. One type has a secretory function, called glandular hairs; the other type has no secretory function and only has a protective function, called non-glandular hairs (protective hairs). Plant glandular hairs are distributed on the surface of stems, leaves, flower organs and even fruits. They can produce glandular hair secretions with the ability to resist biotic and abiotic stresses, and are known as "biosynthesis factories". As an important component of epidermal hairs, the secondary metabolites produced by glandular hairs play an important role in improving the aroma quality of tobacco leaves and resisting external stresses. Non-glandular hairs play an important role in improving plant resistance.

[0003] Epidermal hairs are a natural barrier for plants to resist external damage, and their formation is induced by jasmonic acid. Jasmonic acid (JA) is an important natural plant endogenous hormone that participates in controlling plant growth and development and stress response. Among them, JA regulates plant epidermal hairs mainly by restoring the activity of downstream transcription factors after degradation of JAZ proteins to regulate the development of epidermal hairs. The regulatory network of JA signaling pathway is complex and diverse. JAZ, as the core part, achieves the effect of balancing plant physiological activities and defense responses by regulating downstream related transcription factors, such as root and stem growth, chlorophyll degradation, anthocyanin accumulation and stress tolerance. Among them, JA regulates plant epidermal hairs mainly by restoring the activity of downstream transcription factors after degradation of JAZ proteins to regulate the development of epidermal hairs. bHLH transcription factors are important downstream regulatory genes in the JA signaling pathway and are also involved in the development of epidermal hairs. For example: Arabidopsis AtMYC1 affects the changes in epidermal hair density. Tomato SlMYC1 activates the formation of JA-mediated tomato type VI glandular hairs. Cucumber CsMYC2 participates in the occurrence of glandular hairs as a negative regulatory factor.

[0004] In addition, other JA pathway-related genes are also involved in the formation and occurrence of plant epidermal hairs. AtMYB82 Positively regulates the development of epidermal hair. AaGL3-like JA induction positively regulates the density of epidermal hairs in Artemisia annua; AaMIXTA1 Affects the initiation of glandular hairs in Artemisia annua. AaHD8 / AaMIXTA1 Able to form complexes to promote AaHD1 Gene expression regulates trichome formation in Artemisia annua. SlHD8-SlJAZ4 As a key module, it mediates JA signaling to promote tomato trichome elongation;SlWo Positive regulation of tomato type I epidermal trichome density, and SlCycB2 As Wo The downstream genes of α-terminal β ... MIXTA and MIXTA-like The density of epidermal hairs on tobacco leaves and stems increased significantly. MIXTA cotton ovule gene CotMYB , after being transferred into tobacco, the density of its epidermal hairs is increased. NbWo and NbCycB2 Forming a negative feedback regulatory loop to regulate glandular hair development. NtHD-ZIP-IV-1 As Wo Homologous gene of , which induces glandular trichomes in tobacco in response to jasmonic acid. NtHD9 and NtHD12 Regulates the development of tobacco long-stalked glandular hairs through the JA signaling pathway. NtHD8 The interaction between the two also affects the density of tobacco long-stalked glandular hairs. NtCycB2 The jasmonic acid pathway regulates glandular hair growth. NtCycB2 and NtJAZ1 Gene co-knockout can increase the density of glandular hairs and promote the development of glandular heads.

[0005] Methyl jasmonate (MeJA) is a derivative of jasmonic acid (JA) and is often used to replace JA to enhance plant resistance to biotic and abiotic stresses. Currently, the mechanism of glandular trichome development in common tobacco is unclear and there is a lack of effective regulatory means and utilization pathways. In addition, there are few studies on the response to MeJA-mediated glandular trichome development and the synthesis of alkaloids.

[0006] The information disclosed in this background technology section is only used to deepen the understanding of the background technology of the present disclosure, and should not be regarded as acknowledging or suggesting in any form that the information constitutes the prior art known to those skilled in the art. Summary of the invention

[0007] The present invention aims to provide a plant glandular hair development regulating gene NtJAZ11 , and use it to construct overexpression and gene editing vectors and then transform plants, in order to solve the current technical problems that the development mechanism of common tobacco glandular hairs is unclear and there is a lack of effective regulatory means and utilization methods, thereby achieving the purpose of targeted improvement of plant glandular hair types and / or increasing the content of glandular hair secretions.

[0008] The first aspect disclosed in the present application provides a plant glandular hair development regulating gene NtJAZ11 , whose nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.2.

[0009] The second aspect disclosed in the present application provides a coded protein, whose amino acid sequence is shown in SEQ ID NO. 3 or SEQ ID NO. 4.

[0010] The third aspect disclosed in the present application provides an expression vector containing the plant glandular hair development regulating gene NtJAZ11 or fragments thereof.

[0011] In some embodiments of the present application, the expression vector is an overexpression vector pCAMIA2300-GFP- NtJAZ11-1 and pCAMIA2300-GFP- NtJAZ11-2 , gene editing vector NtJAZ11-1 -CasPF and NtJAZ11-2 -Any of CasPF.

[0012] In a fourth aspect disclosed in the present application, the plant glandular hair development regulatory gene NtJAZ11 , and its encoded protein or expression vector is used in creating plant materials with different glandular hair densities.

[0013] In a fifth aspect disclosed in the present application, the plant glandular hair development regulatory gene NtJAZ11 Or the expression vector is used to regulate the density of plant glandular hairs and / or the density of guard hairs.

[0014] In a sixth aspect disclosed in the present application, the plant glandular hair development regulatory gene NtJAZ11 Or the expression vector is used in the selection of plant varieties / lines related to glandular hair density and / or protective hair density traits.

[0015] In some embodiments of the present application, based on the plant glandular hair development regulatory gene NtJAZ11 The open reading frame sequence of the gene was combined with the CaMV35S promoter and the reporter gene GFP to construct an overexpression vector, which was transformed into recipient plants and cultivated to obtain plant materials with significantly reduced density of long-stalked and short-stalked glandular hairs and significantly increased density of protective hairs.

[0016] In some embodiments of the present application, the plant glandular hair development regulatory gene NtJAZ11 The fragment TCCTCAATACCTCTCTTTCAAGG at the 126-148 bp position in the open reading frame sequence was used as the target site, and a gene editing vector was constructed, which was transformed into recipient plants and cultivated to obtain plant materials with significantly increased density of long-stalked and short-stalked glandular hairs.

[0017] In some embodiments of the present application, the recipient plant is tobacco.

[0018] One or more technical solutions provided in the embodiments of the present application have at least any of the following technical effects or advantages: 1. Screening and identification of plant glandular hair-specific expression genes NtJAZ11 Based on the phenotypic and physiological characteristics of its overexpression and knockout strains, the detection studies showed that NtJAZ11-2 It can negatively regulate the development of long-stalked and short-stalked glandular hairs in tobacco, and has important application value in regulating and increasing the secretion content of glandular hairs and directionally improving the types of glandular hairs.

[0019] 2. This application is about the regulation gene of glandular hair development NtJAZ11 The cloning and functional studies revealed the regulatory mechanism of the growth and development of glandular hairs and guard hairs, and provided a way to utilize them in agricultural production. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 In one embodiment of this application NtJAZ11-1 and NtJAZ11-2 Agarose gel electrophoresis results, protein sequence alignment and phylogenetic tree analysis.

[0021] Figure 2 In one embodiment of this application NtJAZ11-1 and NtJAZ11-2 Relative expression levels in different tobacco tissues.

[0022] Figure 3 In one embodiment of this application NtJAZ11-1 and NtJAZ11-2 Expression analysis in response to different concentrations of MeJA treatment.

[0023] Figure 4 In one embodiment of this application NtJAZ11-1 and NtJAZ11-2 Subcellular localization map of the fusion protein.

[0024] Figure 5 In one embodiment of this application NtJAZ11-2 Figure 2. Screening and identification results of overexpression lines.

[0025] Figure 6 In one embodiment of this application NtJAZ11-2 Figure 2. Results of sequence analysis of homozygous gene-edited strains.

[0026] Figure 7 For the control strain in one embodiment of this application, NtJAZ11-2 Observation of leaf epidermal hair morphology and data statistics of overexpression strains and gene-edited strains.

[0027] Figure 8 It is the relative expression level of the glandular hair formation related gene in one embodiment of the present application.

[0028] above Figure 7 , Figure 8 In the experiment, K326 was used as the control. NtJAZ11 -OE4 is an overexpression strain; NtJAZ11 -KO13 is a gene-edited strain. DETAILED DESCRIPTION

[0029] The specific implementation modes of the present invention are described below in conjunction with the accompanying drawings and examples. However, the following examples are only used to illustrate the present invention in detail and do not limit the scope of the present invention in any way.

[0030] Unless otherwise specified, the plasmid vectors involved in the following examples are all conventional commercial vectors; the biochemical reagents involved are all commercially available conventional reagents unless otherwise specified; the tests and detection methods involved are all conventional methods unless otherwise specified.

[0031] The preliminary research of this application found that NtJAZ11 It is expressed in tobacco epidermal hairs and other tissues and is activated by MeJA induction. NtJAZ11 Gene sequence, completed NtJAZ11 Bioinformatics analysis confirmed its localization in the cell membrane and nucleus, and identification using tobacco transgenic materials NtJAZ11 Involved in regulating the development of tobacco glandular hairs. The implementation of this application will help to clarify NtJAZ11 The function of genes in the formation and development of tobacco glandular hairs, and provide a theoretical and material basis for the later creation of tobacco materials with different glandular hair densities.

[0032] Embodiment 1: NtJAZ11 Gene cloning and bioinformatics analysis In this case, homologous cloning technology was used to amplify the negative regulatory gene of glandular hair development of K326 for the first time based on the genome sequence of Solanaceae genome website and the first strand of cDNA synthesized by reverse transcription of total RNA from leaves of common tobacco K326 was used as template. NtJAZ11 Two homologous sequences NtJAZ11-1 (Nitab4.5_0001264g0110.1) and NtJAZ11-2 (Nitab4.5_0002046g0020.1) (see Figure 1 ),in, NtJAZ11-1 The coding region is 1143 bp in length, encoding 380 amino acids. NtJAZ11-2 The coding region is 1182 bp in length, encoding 393 amino acids, with a nucleotide similarity of 92.81% and an amino acid sequence similarity of 89.31%. Protein multiple sequence alignment results show that NtJAZ11-1 and NtJAZ11-2 They all contain the typical TIFY and Jas domains of JAZ proteins.

[0033] The cloned NtJAZ11 protein sequence was compared with homologous proteins from various plants ( Figure 1 ), the results show that: NtJAZ11-1 Probably from the parent Nicotiana velutipes NtomJAZ11 , the similarity between the two is 100%, NtJAZ11-2 Probably from the parent forest Nicotiana tabacum NsylJAZ11 The similarity between the two is 94.4%. Two genes were found in the burley tobacco TN90 genome. NtJAZ11 homologous genes, NtJAZ11-1 and TN90JAZ11-1 , TN90JAZ11-2 The similarities are 96.69% and 83.91% respectively. NtJAZ11-2 and TN90JAZ11-1 , TN90JAZ11-2 The similarities are 89.31 and 100% respectively. There are also two copies in the spiced tobacco Basma. NtJAZ11-1 and BXJAZ11-1 , BXJAZ11-2 The similarities are 96.69% and 89.57% respectively. NtJAZ11-2 and BXJAZ11-1 , BXJAZ11-2 The similarities of are 89.31% and 99.75% respectively. NtJAZ11- 1 , NtJAZ11-2 and NbJAZ11 The similarity is 88.3%. Compared with other species, NtJAZ11-1 , NtJAZ11-2 With tomato SlNtJAZ11 , Artemisia annua AaNtJAZ11 , Arabidopsis AtNtJAZ11 The similarities are 74.52%, 27.16%, and 30.29% respectively. The above results show that NtJAZ11 The gene is highly conserved in different types and varieties of cultivated tobacco and is similar to that in Nicotiana benthamiana. NbJAZ11 It is closely related to tomato, Artemisia annua and Arabidopsis thaliana, but more distantly related to tomato, Artemisia annua and Arabidopsis thaliana.

[0034] Analysis of tissue expression patterns revealed that ( Figure 2 ), NtJAZ11-1 and NtJAZ11-2 It is expressed in tobacco roots, stems, leaves, flowers, and epidermal hairs. NtJAZ11-1 and NtJAZ11-2 The relative expression trends in various tobacco tissues were consistent, with the highest expression levels in leaves, followed by epidermal hairs, stems, flowers, and the lowest expression levels in roots, indicating that the gene has tissue expression specificity. NtJAZ11-2 The relative expression levels in the above tissues were higher than NtJAZ11-1 The above results show that NtJAZ11-2It may play a more critical role in the growth and development of tobacco.

[0035] After treatment with different concentrations of MeJA, it was found that ( Figure 3 ), NtJAZ11-1 and NtJAZ11-2 The expression level of β-catenin gradually increased and first increased and then decreased with time, and reached the highest level 3 h after treatment. NtJAZ11 is strongly induced by MeJA, and MeJA has an NtJAZ11 The induction effect of the gene is time-sensitive.

[0036] The results of subcellular localization experiments showed that ( Figure 4 ), NtJAZ11-1 and NtJAZ11-2 They can be localized in the cell nucleus and cell membrane respectively.

[0037] Embodiment 2: NtJAZ11-2 Acquisition of genetically modified material In this example, pCAMIA2300-GFP- NtJAZ11-2 Overexpression vectors and NtJAZ11-2-CasPF The gene editing vector was introduced into tobacco through the leaf disc transformation method.

[0038] First, 8 positive plants were obtained by PCR screening ( Figure 5 ), qRT-PCR analysis revealed NtJAZ11 The expression level of the target gene in the -OE4 line was 5.83 times that of K326, and the progeny of this single line and its T1 generation were selected for subsequent in-depth gene function analysis.

[0039] Secondly, 9 T0 generation plants were obtained from 20 positive plants by hygromycin screening and sequencing detection. NtJAZ11 Gene-edited seedlings, with a gene editing efficiency of 45% ( Figure 6 ). Sequencing of the T1 generation of gene mutation plants revealed that NtJAZ11 -KO13 NtJAZ11-1 and NtJAZ11-2 The sgRNA regions all had homozygous base deletion mutations. NtJAZ11-1 and NtJAZ11-2 The KO-13 homozygous mutant (T2 generation) was used for further analysis. NtJAZ11-2 Gene function studies.

[0040] Embodiment three: NtJAZ11-2 Functional verification of negative regulation of tobacco glandular hair development Under normal growth conditions, compared with the control K326 ( Figure 7 ), NtJAZ11 The total density of leaf epidermal hairs in the overexpression strains increased. NtJAZ11 The total density of epidermal hairs in the knockout strain was significantly increased. The results showed that different types of epidermal hairs were observed. NtJAZ11- The number of long-stalked glandular hairs and short-stalked glandular hairs in the OE4 strain decreased by 22.23% and 33.34%, respectively, and the number of guard hairs increased significantly, which was 7 times higher than that in K326. NtJAZ11- The density of long-stalked and short-stalked glandular hairs in the KO13 strain increased significantly, by 44.44% and 66.67%, respectively, while there was no significant difference in the guard hairs. NtJAZ11 The gene negatively regulates the growth and development of long-stalked and short-stalked glandular hairs in tobacco.

[0041] RT-PCR analysis revealed that NeA , NtCycB2 , MIXTA , NtMYC2 , NtD8 , NhD9 and NtHD12 exist NtJAZ11 -KO13 were up-regulated. NtJAZ11 -OE4 showed different degrees of down-regulation. NtMYC2 The relative expression of the gene with the largest upregulation ( Figure 8 ), it increased significantly by 231.17% in KO13 and decreased significantly by 43.36% in OE4. NeA , NhD9 and NtHD12 The relative expression level of KO13 was significantly higher than that of the control and overexpression lines, which were 2.52, 2.02 and 2.75 times that of K326, respectively. NtCycB2 and MIXTA The relative expression levels in KO13 changed slightly, which were 1.50 and 1.26 times that of K326, respectively, and were also higher than the control and overexpression strains. NtMYC2 Possibly a key factor NtJAZ11 Coordinated regulation of glandular hair growth, NeA , NhD9 and NtHD12 Possible participation NtJAZ11 Negatively regulates the process of glandular hair development. NtCycB2 and MIXTA right NtJAZ11 The effect of regulating glandular hair development is relatively small. NtD8 May not be related NtJAZ11 interaction.

[0042] The above embodiments are preferred implementations of the present invention. However, those skilled in the art will appreciate that the implementations of the present invention are not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A plant glandular hair development regulatory gene NtJAZ11 , characterized in that, The nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.

2.

2. A coding protein, characterized in that Its amino acid sequence is shown in SEQ ID NO.3 or SEQ ID NO.

4.

3. An expression vector containing the plant glandular hair development regulating gene according to claim 1 NtJAZ11 or fragments thereof.

4. The expression vector according to claim 3, characterized in that It is an overexpression vector pCAMIA2300-GFP- NtJAZ11-1 and pCAMIA2300-GFP- NtJAZ11-2 , gene editing vector NtJAZ11-1 -CasPF and NtJAZ11-2 -Any of CasPF.

5. The plant glandular hair development regulating gene according to claim 1 NtJAZ11 , use of the coding protein described in claim 2 or the expression vector described in claim 3 in creating plant materials with different glandular hair densities.

6. The plant glandular hair development regulating gene according to claim 1 NtJAZ11 Or use of the expression vector according to claim 3 in regulating the density of glandular hairs and / or the density of protective hairs in plants.

7. The plant glandular hair development regulating gene according to claim 1 NtJAZ11 Or use of the expression vector according to claim 3 in breeding plant varieties / lines with different glandular hair density and / or protective hair density traits.

8. The use according to claim 7, characterized in that: Based on the plant glandular hair development regulatory gene NtJAZ11 The open reading frame sequence of the gene was combined with the CaMV35S promoter and the reporter gene GFP to construct an overexpression vector, which was transformed into recipient plants and cultivated to obtain plant materials with significantly reduced density of long-stalked and short-stalked glandular hairs and significantly increased density of protective hairs.

9. The use according to claim 7, characterized in that: The plant glandular hair development regulatory gene NtJAZ11 The fragment TCCTCAATACCTCTCTTTCAAGG at the 126-148 bp position in the open reading frame sequence was used as the target site, and a gene editing vector was constructed, which was transformed into recipient plants and cultivated to obtain plant materials with significantly increased density of long-stalked and short-stalked glandular hairs.

10. The use according to claim 7 or 8, characterized in that: The recipient plant is tobacco.

Images