Wheat drought resistance related haplotype molecular marker, primer, kit and application thereof

Abstract

The invention discloses haplotype molecular markers related to wheat drought resistance, primers, a kit and application of the haplotype molecular markers, and aims to solve the technical problem that molecular markers capable of identifying excellent haplotypes of TaXTH-2B gene promoters are lacked at present. It is confirmed that the TaXTH-2B gene promoter has two haplotypes, and the Hap II haplotype is an excellent haplotype endowing wheat with a high drought resistance index and has high promoter activity; meanwhile, the invention develops molecular marker primers for distinguishing the two haplotypes, and the molecular marker primers have wide application prospects in the aspects of identifying and screening bred wheat varieties or breeding intermediate generation materials, assisting in selecting wheat materials with high drought resistance indexes and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular breeding, and in particular to a haplotype molecular marker, primer, kit and application thereof related to wheat drought resistance. Background Art

[0002] As one of the three major food crops in the world, wheat supplies food for nearly one-fifth of the world's population, with an annual output of up to 720 million tons. In China, wheat, as one of the main food crops, has an annual output of about 130 million tons. High and stable wheat yields are of great significance to ensuring national food security. However, with global warming, extreme climate events such as droughts occur frequently, posing a severe challenge to wheat production. According to statistics, more than half of the world's wheat-producing areas are affected by drought. In recent years, the reduction in wheat production caused by drought has reached 13.7%. Therefore, improving wheat drought resistance and cultivating highly drought-resistant wheat varieties are the key to solving the impact of drought on wheat yields.

[0003] Xyloglucan endotransglucosylase / hydrolase (XTH) is one of the important enzymes for plant cell wall reconstruction. It belongs to the glycosidehydrolase 16 (GH16) family and can catalyze the hydrolysis or transfer of xyloglucan molecules. It participates in the construction, extension, reconstruction and response to stress of plant cell walls. Many studies have shown that XTH genes play an important role in the response and adaptation of plants to stress. For example, when the persimmon gene was transferred into Arabidopsis thaliana, DkXTH1 Genes can improve their tolerance to salt, ABA and drought stress; in rice, low temperature stress can significantly induce OsXET9 Gene expression, promoting leaf and ear development; in corn, improving ZmXTH The expression of the gene can reduce the accumulation of aluminum in plant roots and cell walls and enhance the plant's resistance to aluminum.

[0004] The expression regulation of XTH gene is not only affected by the internal sequence of the gene, but also strictly regulated by its upstream promoter region. The promoter is a key element for the initiation of gene transcription, which determines when, where and at what level the gene is expressed. Therefore, the promoter region of the XTH gene is of great significance for regulating its expression pattern, thereby affecting the response and adaptation of plants to adverse stress. However, although the role of XTH gene and its promoter in plant stress resistance has received increasing attention, there is currently no research on the identification of TaXTH-2B Related reports on molecular markers of excellent haplotypes of gene promoters. In addition, there are very few reported molecular markers for wheat drought resistance.

[0005] As a crop directly exposed to variable climate conditions, genetic improvement of wheat drought resistance is of great significance to ensuring global food security. At present, genetic improvement of wheat drought resistance mainly relies on traditional phenotypic selection and hybrid breeding. Although these methods are effective, they are time-consuming and have limited efficiency. Therefore, it is necessary to develop methods that can be used to identify drought resistance. TaXTH-2B Molecular markers of superior haplotypes of gene promoters are of great significance for accelerating the breeding of drought-resistant wheat varieties.

[0006] The information disclosed in this background technology section is only used to deepen the understanding of the background technology of the present disclosure, and should not be regarded as acknowledging or suggesting in any form that the information constitutes the prior art known to those skilled in the art. Summary of the invention

[0007] The present invention aims to provide a haplotype molecular marker, primer, kit and application thereof related to wheat drought resistance. TaXTH-2B The promoter region of the gene can distinguish different wheat varieties TaXTH-2B The haplotype of the gene promoter is used to identify and screen wheat with a high drought resistance index, thereby assisting wheat breeding.

[0008] Specifically, the present disclosure provides a haplotype molecular marker for wheat TaXTH-2B There are differential sites in the gene promoter sequence as shown in the comparison between SEQ ID NO.1 and SEQ ID NO.2.

[0009] According to a second aspect of the present disclosure, there is provided an identification TaXTH-2B The primers for promoter haplotypes are designed based on the differential sites shown by comparison between SEQ ID NO.1 and SEQ ID NO.2.

[0010] In some embodiments of the present disclosure, the primer pair sequences are as follows: Forward primer sequence: CGTTTGTTGAACGTTTGCGG, The reverse primer sequence was GTGCATGTCGACTGACGAGT.

[0011] According to a third aspect of the present disclosure, a kit containing the above-mentioned primers is provided.

[0012] According to a fourth aspect of the present disclosure, the haplotype molecular marker, the primer or the kit is used in screening / identifying drought resistance traits of wheat varieties.

[0013] In some embodiments of the present disclosure, the application is to use the above primers to amplify the TaXTH- 2BThe gene promoter was expressed in 100 amino acids. The PCR band size of 1827 bp was haplotype TaXTH-2B Hap I with low drought resistance index, and the PCR band size of 1389 bp was haplotype TaXTH-2B Hap II with high drought resistance index.

[0014] According to the fifth aspect of the present disclosure, the haplotype molecular marker, the primer or the kit is used in screening / identifying wheat TaXTH-2B Gene promoter activity.

[0015] According to a sixth aspect of the present disclosure, the haplotype molecular marker, the primer or the kit is applied to breeding wheat varieties with high drought resistance traits.

[0016] One or more technical solutions provided in the embodiments of the present application have at least any of the following technical effects or advantages: 1. Confirmed TaXTH-2B The gene promoter has two haplotypes, among which the Hap II haplotype is an excellent haplotype that confers a high drought resistance index to wheat and has higher promoter activity than the Hap I haplotype.

[0017] 2. Developed a method to distinguish different TaXTH-2B The molecular marker primers for the haplotype of the gene promoter generate a PCR band of 1827 bp in size when the molecular marker primers are used to identify wheat varieties containing Hap I type promoters, and generate a PCR band of 1389 bp in size when the molecular marker primers are used to identify wheat varieties containing Hap II type promoters.

[0018] 3. The developed molecular markers and primers have broad application prospects in identifying and screening bred wheat varieties or intermediate breeding generations, and assisting in the selection of wheat materials with high drought resistance index. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 In one embodiment of this application TaXTH-2B The difference sites of the two haplotypes in the gene promoter (2000 bp upstream of the start codon); ATG is the start codon and the numbers indicate the positions of the difference sites.

[0020] Figure 2 In one embodiment of this application TaXTH-2B Drought resistance index of two haplotypes of gene promoter in population materials; among them, 08 / 09 HS represents Hengshui in 2008-2009; 09 / 10 HS represents Hengshui in 2009-2010; 09 / 10 JY represents Jiyuan in 2009-2010.

[0021] Figure 3 In one embodiment of the present application, a tobacco transient expression system was used. TaXTH-2B Comparison of promoter activities of two haplotypes; LUC / REN is the ratio of the fluorescence intensity of firefly luciferase to that of Renilla luciferase.

[0022] Figure 4 In one embodiment of this application TaXTH-2B PCR amplification banding pattern of gene promoter molecular marker. DETAILED DESCRIPTION

[0023] The specific implementation methods of the present invention are described below in conjunction with examples, but the following examples are only used to illustrate the present application in detail and do not limit the scope of the present application in any way.

[0024] Unless otherwise specified, the instruments and equipment involved in the following embodiments are all conventional instruments and equipment; the reagents involved, unless otherwise specified, are all commercially available conventional reagents; the detection methods involved, unless otherwise specified, are all conventional methods.

[0025] Embodiment 1 TaXTH-2B Gene promoter haplotype acquisition and analysis The genomic DNA of 91 wheat materials was extracted by CTAB method, and PCR amplification was performed using CGATCGGATCGACATGCAC as forward primer and TTGTCGTAGAAGCCACCAGC as reverse primer. TaXTH-2B Gene promoter sequence, PCR products were sequenced, and 91 materials were obtained (Table 3) TaXTH-2B Gene promoter sequence, the sequence obtained by sequencing was subjected to multiple sequence alignment, the results are as follows Figure 1 As shown, TaXTH-2B The gene promoter (2000 bp upstream of the start codon) has two haplotypes, and there are 45 different sites between the two haplotypes, including 35 SNPs and 10 InDels. These differences include: Hap I has GGCTCGA at -14 bp upstream of the start codon ATG, while Hap II has C at this site; Hap I has A at -25 bp upstream of the start codon, while Hap II has T at this site, etc. The sequences of the two haplotypes are shown in SEQ ID NO.1 and SEQ ID NO.2, where SEQID NO.1 is the sequence of Hap I type TaXTH-2B The promoter sequence of the gene, SEQ ID NO.2 is the Hap II type TaXTH-2B The promoter sequence of a gene.

[0026] The method for extracting wheat leaf genomic DNA using the CTAB method is as follows: (1) Place the cut wheat leaf samples in a 2 mL centrifuge tube pre-filled with two 5 mm steel balls. After freezing with liquid nitrogen, quickly crush the samples thoroughly using a sampler.

[0027] (2) Add 0.7 mL of CTAB extract, shake vigorously up and down, and place in a 65°C oven for 60 min, shaking up and down every 15 min to mix.

[0028] (3) Add 0.7 mL of chloroform:isoamyl alcohol (24:1), mix thoroughly, and centrifuge at 10,000 rpm for 10 min at room temperature.

[0029] (4) Prepare a 1.5 mL centrifuge tube in advance, write a label, add 0.5 ml of pre-cooled isopropanol, aspirate the supernatant after centrifugation into the 1.5 mL centrifuge tube, invert to mix, and place in a -20℃ refrigerator for 30 min.

[0030] (5) Centrifuge at 10,000 rpm for 10 min.

[0031] (6) After centrifugation, carefully discard the supernatant, add 0.8 mL of 75% alcohol, and centrifuge at 7500 rpm for 5 min.

[0032] (7) Repeat step (6).

[0033] (8) Place the tube in a clean bench at room temperature for about 10 min to evaporate the alcohol, then air dry. Finally, add 0.2 ml of sterile water and store at -20°C.

[0034] The gene fragment was amplified using KOD FX, and the PCR reaction system is shown in Table 1.

[0035] Table 1 PCR reaction system .

[0036] The PCR reaction program is shown in Table 2.

[0037] Table 2 PCR reaction procedure .

[0038] Embodiment 2 TaXTH-2B Correlation analysis between gene promoter haplotype and drought resistance index In order to explore the genetic effect of haplotype differences, a natural population of 91 wheat varieties was used to conduct a correlation analysis between haplotypes and drought resistance index.

[0039] The drought resistance index of 91 wheat materials was calculated by using the yield traits obtained from the plant survey in Hengshui in 2008-2009, Hengshui in 2009-2010, and Jiyuan in 2009-2010. Drought resistance index = dryland yield of a certain variety / dryland yield of the control variety × drought resistance coefficient of a certain variety / drought resistance coefficient of the control variety. Drought resistance coefficient refers to the ratio of dryland yield (drought stress) to waterland yield (non-stress) of the same variety. The results are shown in Table 3 and Figure 2 As shown, the drought resistance index of Hap II type wheat varieties was significantly higher than that of Hap I type wheat varieties in the three-point test in two years, which indicates that Hap II type wheat varieties have stronger drought resistance.

[0040] Table 3 91 varieties TaXTH-2B Gene promoter haplotype and drought resistance index

[0041] Example 3: TaXTH-2B Analysis of promoter activity of two haplotypes of gene promoter because TaXTH-2B There are up to 45 differences between the two haplotypes of the gene promoter, including insertions and deletions of longer fragments. The inventors speculated that there might be differences in the promoter activity of the two haplotypes. To verify this speculation, a dual luciferase experiment was conducted using the tobacco transient expression system. TaXTH-2B The promoter sequences of the two haplotypes of the gene were constructed into the pGreenII0800-Dual LUC vector, and the constructed vector was transformed into Agrobacterium, which was used to infect tobacco leaves. The infected tobacco was cultured in the dark for 24 h, and then sampled after 48 h of culture under light. The reverse side of the sample was evenly coated with LUC luminescent substrate, and the sample was left in the dark for 5 min. The fluorescence signal was observed with a live imager. The part with fluorescence signal was sampled with a puncher, quickly placed in a 2 ml centrifuge tube, frozen with liquid nitrogen, and stored at -80 for later measurement of LUC / REN value.

[0042] Before measurement, the sample was first broken up with a sampler, and then an appropriate amount of diluted 1X Passive Lysis Buffer was added for lysis. The reaction was carried out on ice for 30 min, and then centrifuged at 12000 rpm for 15 min at 4°C. 100 µl of the supernatant was aspirated into a 1.5ml centrifuge tube, and then inserted into ice. 10 µl of the sample was taken, and 50 µl of LARII was added, and the mixture was mixed by pipetting, and then tested. Then 50 µl of Stop&Glo was added, and the mixture was mixed by pipetting, and then tested. The LUC / REN value was recorded. The specific experimental method was carried out according to the Dual-Luciferase® ReporterAssay System kit of Promega. The results are shown in the figure. Figure 3 As shown, tobacco injected with the Hap II type promoter had a higher LUC / REN value than tobacco injected with the Hap I type promoter, indicating that the promoter of the Hap II haplotype has higher activity than the promoter of the Hap I haplotype.

[0043] Embodiment 4: TaXTH-2B Development of Gene Promoter Molecular Markers In order to be used for molecular marker-assisted selection breeding, this example TaXTH-2B Primers are designed in the conserved region of gene promoters to distinguish TaXTH-2B Two haplotypes of gene promoter, as well as identification and screening of bred wheat varieties or intermediate generation materials in the breeding process.

[0044] The forward primer sequence of the molecular marker designed in this example is CGTTTGTTGAACGTTTGCGG, and the reverse primer is GTGCATGTCGACTGACGAGT. Using this pair of primers to amplify the wheat material with Hap I type promoter, a PCR band of 1827 bp can be obtained, and using this pair of primers to amplify the wheat material with Hap II type promoter, a PCR band of 1389 bp can be obtained ( Figure 4 ).

[0045] Although some preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present application.

[0046] Obviously, those skilled in the art can make various changes and modifications to the present application without departing from the spirit and scope of the inventive concept. Thus, if these modifications and variations of the present application fall within the scope of the claims of the present application and their equivalents, the present application is also intended to include these modifications and variations.

Claims

1. A haplotype molecular marker, characterized in that: In wheat TaXTH-2B There are differential sites in the gene promoter sequence as shown in the comparison between SEQ ID NO.1 and SEQ ID NO.

2.

2. An identification TaXTH-2B A primer for a promoter haplotype, characterized in that It is designed based on the differential sites shown in the comparison between SEQ ID NO.1 and SEQ ID NO.

2.

3. The primer according to claim 2, characterized in that The following primer pairs: Forward primer sequence: CGTTTGTTGAACGTTTGCGG, The reverse primer sequence was GTGCATGTCGACTGACGAGT.

4. A kit comprising the primers according to claim 2.

5. Use of the haplotype molecular marker according to claim 1, the primer according to claim 2 or the kit according to claim 4 in screening / identifying drought resistance traits of wheat varieties.

6. The use according to claim 5, characterized in that: Amplify the wheat variety to be tested using the primers described in claim 2 TaXTH-2B gene promoter, the obtained PCR band size of 1827 bp was the haplotype TaXTH-2B Hap I with low drought resistance index, and the obtained PCR band size of 1389 bp was the excellent haplotype TaXTH-2B HapII with high drought resistance index of wheat.

7. The haplotype molecular marker according to claim 1, the primer according to claim 2 or the kit according to claim 4 in screening / identifying wheat TaXTH-2B Application in gene promoter activity.

8. Use of the haplotype molecular marker according to claim 1, the primer according to claim 2 or the kit according to claim 4 in breeding wheat varieties with high drought resistance traits.

Images