Method for increasing carotenoid content in cucumber, related biological material and application

Abstract

The invention discloses a method for increasing the content of carotenoid in cucumbers, a related biological material and application. The invention discloses a method for increasing the content of carotenoid in cucumbers. The content of carotenoid in cucumbers is increased by knocking out CsNCED4 genes. The CsNCED4 gene is as shown in SEQ ID No.1 (Sequence Identifier Number 1). The CsNCED4 gene is knocked out through a CRISPR / Cas9 (clustered regularly interspaced short palindromic repeats / CRISPR associated protein 9) technology, and the used target sequences are shown as SEQ ID NO.3 and SEQ ID NO.4. The recombinant expression vector comprises a complementary sequence of the target spot sequence in the method. The recombinant microorganism comprises the target sequence in the method or the recombinant expression vector. The invention provides a method for rapidly creating a cucumber material with high carotenoid content, and provides a theoretical basis and a practice mode for improving the nutritional quality of cucumbers.

Description

Technical Field

[0001] The present application relates to the field of genetic engineering technology, and in particular to a method for increasing the carotenoid content in cucumbers, related biological materials and applications. Background Art

[0002] Cucumber (Cucumis sativus) is one of the most widely cultivated vegetables in the world. With the continuous improvement of living standards, consumers have a higher demand for high-nutritional quality cucumbers. Carotenoids are fat-soluble metabolites of tetraterpenes that are commonly found in plants. They are important antioxidants and precursors of vitamin A (retinol). However, the human body cannot synthesize carotenoids and can only ingest them through diet, and fruits and vegetables are the main dietary sources of carotenoids. Previous studies have shown that the carotenoid content in cucumber pulp is low. Therefore, increasing the carotenoid content is an important way to improve the nutritional quality of cucumbers.

[0003] It has been found that cucumber can synthesize carotenoids, and genes such as CsPSY, CsZEP and CsChyb jointly regulate the carotenoid synthesis pathway of cucumber. However, the carotenoid content in cucumber has obvious tissue specificity, and the carotenoid content in petals is significantly higher than that in fruits, which is probably related to the high expression of CsNCED4 gene in fruits. Unlike synthesis genes such as CsPSY and CsZEP, CsNCED4 gene is a negative regulator of carotenoid content in cucumber.

[0004] Genome editing technologies represented by CRISPR / Cas9 can accurately knock out target genes without changing the background precursor, thereby achieving targeted improvement of traits. At present, there are few studies in the field on how to increase the carotenoid content in cucumbers, and there are no reports on increasing the carotenoid content in cucumbers through CRISPR / Cas9 technology. The negative regulatory factor CsNCED4 is an ideal target gene. This application uses CRISPR / Cas9 technology to knock out the CsNCED4 gene in a targeted manner to quickly create cucumber varieties with high carotenoid content, which will be of great value to cucumber quality improvement. Summary of the invention

[0005] The purpose of the present application is to provide a method for increasing the carotenoid content in cucumbers, related biological materials and applications, which can significantly increase the carotenoid content in cucumber pulp.

[0006] The technical solutions provided by this application are as follows:

[0007] A method for increasing the carotenoid content in cucumbers, wherein the carotenoid content in cucumber fruits is increased by knocking out the CsNCED4 gene;

[0008] The CsNCED4 gene is shown as SEQ ID No.1.

[0009] Furthermore, the CsNCED4 gene was knocked out by CRISPR / Cas9 technology, using target sequences as shown in SEQ ID NO.3 and SEQ ID NO.4.

[0010] A recombinant expression vector comprises a complementary sequence to the target sequence in the above method.

[0011] A recombinant microorganism comprises the target site in the above method or the above recombinant expression vector.

[0012] A primer pair for cloning the CsNCED4 gene, used for cloning the CsNCED4 gene in the above method, the nucleotide sequence of the primer pair is shown in SEQ ID NO: 5 and SEQ ID NO: 6

[0013] The primer pair used for constructing a recombinant expression vector is used for constructing the recombinant expression vector in the above method, and the nucleotide sequence of the primer pair is shown in SEQ ID NO: 7 and SEQ ID NO: 8.

[0014] The use of the above-mentioned recombinant expression vector, or the above-mentioned recombinant microorganism, or the above-mentioned primer pair for cloning the CsNCED4 gene, or the above-mentioned primer pair for constructing the recombinant expression vector in breeding cucumbers with high carotenoid content.

[0015] Cucumber is an important horticultural crop and is widely cultivated throughout the world. With the continuous development of the economy and the improvement of living standards, the consumer market has a higher demand for high-quality cucumbers. Carotenoids are important antioxidants, and the carotenoid content is one of the important indicators of nutritional quality. However, the carotenoid content in the pulp of cultivated cucumbers is generally low. The present application provides a method for quickly creating a cucumber material with a high carotenoid content, and the procedure is few, which provides a theoretical basis and a practical method for improving the nutritional quality of cucumbers. In the prior art, there is a method of increasing the carotenoid content by overexpressing other genes, but exogenous genes will be introduced. The method of the present application is to increase the carotenoid content by knocking out negative regulatory factors, and no exogenous genes are introduced during the creation process.

[0016] This application involves biological materials such as recombinant expression vectors, recombinant microorganisms, and primer pairs. This application uses genetic engineering and other technical means to regulate the CsNCED4 gene and efficiently improve fruit quality. This application can be widely used in breeding cucumbers with high carotenoid content to cultivate cucumbers with higher nutritional quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1This is the map of the pCUA-CsNCED4 vector.

[0018] Figure 2 Schematic diagram of the mutant DNA sequence obtained by CRISPR / Cas9 knockout of the CsNCED4 gene target sequence.

[0019] Figure 3 Analysis of carotenoid content in the flesh of CR-nced4 mutant. DETAILED DESCRIPTION

[0020] The technical solution of the present application will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present application, not all of the embodiments. The experimental methods in the following embodiments, unless otherwise specified, are conventional methods, and are carried out according to the techniques or conditions described in the literature in the field or according to the product instructions.

[0021] A method for increasing the carotenoid content in cucumbers, wherein the CsNCED4 gene is knocked out by CRISPR / Cas9 technology to increase the carotenoid content in cucumbers;

[0022]

[0023] The CsNCED4 gene was knocked out using target sequences as shown in SEQ ID NO. 3 and SEQ ID NO. 4. Target 1: 5'-GTCTGGTAGAAGAGACCCT-3' (SEQ ID NO. 3), Target 2: 5'-CGTTGCCTTCATCTCTCAA-3' (SEQ ID NO. 4).

[0024] Example 1

[0025] 1. Construction of pCUA-CsNCED4 vector

[0026] The RNA of cucumber inbred line '9930' was extracted, and the reverse transcribed cDNA was used as a template to design primers NCED4-F and NCED4-R for cloning using high-fidelity enzyme.

[0027] The primer sequences are:

[0028] NCED4-F: 5'-ATGGATTCATTTCTTTCCCTTTC-3' (SEQ ID NO: 5),

[0029] NCED4-R: 5'-TAGCTTATTGAGGTCGCTTTCTTTC-3' (SEQ ID NO: 6).

[0030] The PCR reaction product was purified using FastPure Gel DNA Extraction Mini Kit (Vazyme) and ligated into pCE2 TA / Blunt-Zero (Vazyme). The plasmid was sequenced, and the nucleotide sequence of the CsNCED4 gene was shown in SEQ ID No. 1, and the amino acid sequence encoded by the sequence was shown in SEQ ID No. 2.

[0031] Two 19 bp target sites were screened on the coding sequence of CsNCED4, and the corresponding primers CR-NCED4-F (SEQ ID NO: 7) and CR-NCED4-R (SEQ ID NO: 8) were designed as shown in Table 1, and plasmid pCBC-DT1T2 (Addgene) was used as a template.

[0032] Table 1

[0033]

[0034] After the PCR product was recovered, it was connected to the pCUACas9 vector through the Golden Gate system. After the sequencing was correct, the plasmid was extracted using a plasmid extraction kit (Takara) and named pCUA-CsNCED4 ( Figure 1 ). The corresponding E. coli strains were added with glycerol and then quickly frozen with liquid nitrogen and stored at -80°C.

[0035] 2. Construction and testing of genome editing materials

[0036] pCUA-CsNCED4 was transferred into Agrobacterium strain EHA105 (purchased from Weidi Biotechnology), and positive clones were screened by PCR. The positive colonies were used to infect the cotyledons of the cucumber inbred line '9930', and tissue culture seedlings were obtained after bud induction and rooting culture. The positive plants were further tested for editing sites, and the amplification primer sequences were NCED4-F: ATGGATTCCATTTCTTCCCCTTTC (SEQ ID NO: 5) and NCED4-genotyping-R: CTTGACATAACGACTACACAGAAC (SEQ ID NO: 9). After Sanger sequencing, 9 successfully edited plants were finally obtained. The above 9 plants were kept as seeds to obtain T1 generation seeds for sowing, self-pollination was carried out to keep seeds, and 2 homozygous T2 generation mutant strains that did not contain Cas9 gene sequences (this sequence was used to detect whether it was a positive plant) were selected and named CR-nced4-1 and CR-nced4-2, respectively. The gene editing site sequences are as shown in Figure 2 As shown, Figure 2 The antisense strand of the target sequence is shown, in which CR-nced4-1 has a 1bp deletion at the first target site, and CR-nced4-2 has a 5bp deletion at the second target site. Due to the deletion of bases, the open reading frames of CR-nced4-1 and CR-nced4-2 are changed, resulting in premature termination of protein translation.

[0037] 3. Carotenoid content and composition analysis:

[0038] The pulp of CR-nced4-1, CR-nced4-2 and '9930' was used for carotenoid composition and content analysis. The fruit samples were crushed into powder, and 0.5g of powder was taken for carotenoid extraction. The extract was a mixed solution of hexane: acetone: ethanol (1:1:1, volume ratio). Shake at 150r / min for 30min to mix thoroughly, add 15mL ddH2O, and centrifuge for 10min. The supernatant was aspirated, filtered, and concentrated by nitrogen blowing. 0.5mL of dissolving solution (tetrahydrofuran: acetonitrile: methanol = 15:30:55, volume ratio) was used to dissolve the residue each time, for a total of three times. The above solutions were mixed into sample bottles for high performance liquid chromatography analysis. Carotenoids were determined using a Shimadzu HPLC instrument (Shimadzu) with a SPD-M20A diode array detector. The carotenoid content was calculated using a carotenoid standard (Sigma) as a standard. The results showed that, Figure 3 As shown, the total carotenoid content in CR-nced4-1 and CR-nced4-2 was significantly higher than that in the control '9930', the β-cryptoxanthin content in the components was significantly higher than that in the control '9930', and the β-carotene content was slightly higher than that in the control '9930'.

[0039] The above description of the disclosed embodiments enables professionals and technicians in the field to implement or use the present application. Although the present application provides specific embodiments, it should be understood that further improvements can be made to the present application. Various modifications to these embodiments will be obvious to professionals and technicians in the field, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present application. The embodiments are merely examples made to clearly illustrate the technical solutions of the present application, and are not limitations of the present application.

Claims

1. A method for increasing the carotenoid content in cucumbers, characterized in that: Increasing the carotenoid content in cucumber by knocking out the CsNCED4 gene; The CsNCED4 gene is shown as SEQ ID No.

1.

2. The method for increasing the carotenoid content in cucumbers according to claim 1, characterized in that: The CsNCED4 gene was knocked out by CRISPR / Cas9 technology, and the target sequences used were shown in SEQ ID NO.3 and SEQ ID NO.

4.

3. A recombinant expression vector, characterized in that: It comprises a complementary sequence to the target sequence in the method of claim 2.

4. A recombinant microorganism, characterized in that It comprises the target sequence in the method of claim 2 or the recombinant expression vector of claim 3.

5. A primer pair for cloning the CsNCED4 gene, characterized in that: The primer pair used for cloning the CsNCED4 gene in the method of claim 1, the nucleotide sequences of which are shown in SEQ ID NO: 5 and SEQ ID NO:

6.

6. A primer pair for constructing a recombinant expression vector, characterized in that: Used to construct the recombinant expression vector of claim 3, the nucleotide sequences of the primer pair are shown as SEQ ID NO: 7 and SEQ ID NO:

8.

7. Use of the recombinant expression vector according to claim 3, or the recombinant microorganism according to claim 4, or the primer pair for cloning the CsNCED4 gene according to claim 5, or the primer pair for constructing a recombinant expression vector according to claim 6 in breeding cucumbers with a high carotenoid content.

Images