Construction and application of streptococcus suis serotype 2 cps2C gene knockout mutant strain

By constructing the cps2C knockout mutant strain of Streptococcus suis type 2, the problem of unknown pathogenic mechanism of S.suis 2 in the existing technology was solved, and the effects of capsular reduction and virility reduction were achieved, providing important support for vaccine development and preventive measures.

CN120173847APending Publication Date: 2025-06-20CENT FOR DISEASE CONTROL & PREVENTION OF THE EASTERN THEATER COMMAND OF THE CHINESE PEOPLES LIBERATION ARMY
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510198445.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-22
Publication Date
2025-06-20

AI Technical Summary

Technical Problem

The prior art has not yet clarified the molecular mechanism of S.suis 2 infecting the host and causing the disease, and lacks functional studies on its pathogenic genes, which affects the effectiveness of vaccine development and preventive measures.

Method used

By constructing Streptococcus succumbens type 2 cps2C knockout mutant strain 05ZYH33Δcps2C, the spectacular mycin resistance gene cassette SpcR was inserted into the coding region of the cps2C gene using gene homologous recombination technology, and the cps2C knockout mutant strain was successfully obtained.

Benefits of technology

The capsule of this mutant strain has a significant reduction in its anti-phagocytosis ability and a significant reduction in virility. It provides materials for the development of attenuated vaccines and multivalent subunit vaccines, helps to reveal the pathogenic mechanism of S.suis 2 and improves the prevention and treatment levels.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120173847A_ABST
    Figure CN120173847A_ABST
Patent Text Reader

Abstract

The invention discloses construction and application of a streptococcus suis serotype 2 cps2C gene knockout mutant strain. The invention relates to a streptococcus suis serotype 2 cps2C gene knockout mutant strain 05ZYH33 delta cps2C. A coding gene, from the 31st site to the 1000th site, of the cps2C gene in the strain 05ZYH33 is replaced by a spectinomycin resistance gene cassette SpcR. The mutant strain 05ZYH33 delta cps2C is applied to preparation of a streptococcus suis type 2 attenuated vaccine and a subunit vaccine. The capsule of the mutant strain 05ZYH33 delta cps2C is obviously reduced; in-vitro experiments show that the macrophage phagocytosis resistance of the mutant strain 05ZYH33 delta cps2C is reduced, and animal toxicity test results show that the toxicity of the mutant strain is obviously reduced. The mutant strain provides an important clue for screening of protective antigens of multivalent subunit vaccines, and can be applied to development of S.suis attenuated vaccines and multivalent subunit vaccines.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering and relates to the construction and application of a cps2C gene knockout mutant strain of Streptococcus suis type 2. Background Art

[0002] Streptococcus suis (S. suis) belongs to the family of cocci and the genus of Streptococcus. It is a Gram-positive bacterium with a capsule and no spores. Single bacteria are round or oval, and multiple bacteria are paired or arranged in chains. The length of the bacterial chains varies. It is an aerobic or facultative anaerobic bacterium. This bacterium is the main pathogen causing S. suis disease worldwide and can cause diseases such as meningitis and septicemia in pigs. S. suis infection in humans can lead to meningitis, septicemia, endocarditis, etc. In severe cases, multiple organ failure can occur due to streptococcal toxic shock syndrome and death. Early, S. suis could be divided into 35 serotypes (types 1-34 and type 1 / 2) according to the different components of capsular polysaccharide antigens. However, the latest research believes that types 20, 22, 26, 32, 33, and 34 do not belong to the genus Streptococcus suis. Among different serotypes of S. suis, Streptococcus suis type 2 (S. suis 2) has the strongest pathogenicity and the highest clinical detection rate. Approximately 97% of human S. suis infection cases are caused by S. suis 2 infection. From 1998 to 1999, an epidemic of Streptococcus suis type 2 broke out in some areas of Jiangsu Province, China, resulting in 25 people being infected and 14 people dying. In June 2005, Streptococcus suis type 2 broke out again on a large scale in Sichuan, with 215 reported cases and 38 deaths, which not only caused huge economic losses to the pig breeding industry but also seriously threatened the health of industry practitioners and the general public. In addition, outbreaks of human S. suis infection have been reported in many countries and regions around the world. In particular, the high fatality rate of S. suis 2 infection in humans has attracted extensive attention from all sectors of society. Therefore, carrying out relevant basic and applied research on the pathogenic mechanism of S. suis 2 is of great significance for preventing and controlling the epidemic of S. suis 2 infection in humans and animals. However, the molecular mechanism of S. suis 2 infecting the host and causing disease is still unclear. Therefore, further exploring and studying the functions of new pathogenic-related genes and their roles in the interaction between S. suis and the host is of great significance for screening potential vaccine candidate molecules, revealing the precise molecular mechanism of its occurrence and development, and further improving the prevention and treatment level of S. suis in China.

[0003] The study of virulence factors of Streptococcus suis has always been a hot topic. Among the many known virulence factors of S. suis, capsular polysaccharides (CPS) are currently recognized as one of the important virulence factors of S. suis. CPS synthesis is catalyzed and coordinated by a variety of glycosyltransferases, flip enzymes and transporters, and the related coding genes are clustered on the genome to form a CPS synthesis gene cluster. S. suis 2 gene sequencing showed that it has 25 genes responsible for encoding glycosyltransferases, CPS polymerases, and sialic acid synthases, of which 7 enzymes may play a key role in the CPS synthesis process. Zhang et al. constructed Δcps2E, Δcps2G, Δcps2J and Δcps2L mutants and found that the capsular polysaccharide content of the mutants was significantly reduced, the anti-phagocytic ability was significantly reduced, and the virulence was significantly reduced in the mouse infection model. Although CPS is closely related to bacterial virulence, non-capsulated strains also play an important role in the adhesion, invasion and biofilm formation of host cells. Nattakan et al. studied the non-capsulated isolates from porcine endocarditis and found that the mutation frequencies of two glycosyltransferases Cps2E and Cps2F were high in the non-capsulated isolates, while mutations in genes involved in capsule side chain formation (cps2J and cps2N), polymerase gene (cps2I) and flippase gene (cps2O) were harmful or lethal. It can be seen that CPS, as a key virulence factor, is subject to precise and complex regulation in S.suis 2 infected hosts. The CPS of S.suis 2 is composed of glucose, galactose, N-acetylglucosamine, rhamnose and sialic acid. CPS can block the killing effect of antimicrobial peptides by reducing complement deposition and regulating phagocytosis to counteract the host's immune system, thereby promoting bacterial survival, migration and spread in cells. The CPS of S.suis2 can evade the recognition and elimination of the host immune system by interfering with the stability of host cell lipid microdomains and signal transduction. In addition, multiple phosphorylation signaling systems play an important regulatory role in the regulation of capsule synthesis and bacterial growth. Previous studies have shown that the binary signal transduction system and the eukaryotic serine threonine kinase / phosphatase signaling system in the phosphorylation signaling system of S.suis 2 play an important regulatory role in bacterial phenotype, growth, virulence, etc. The previous research of the research group showed that the tyrosine kinase / phosphatase signaling system of S.suis 2 played an important role in CPS synthesis, so the construction of an attenuated strain lacking CPS capsule is of great significance for the prevention and control of S.suis 2.

[0004] Vaccines, as a safe and effective means of preventing and controlling pathogenic bacteria, have become a research hotspot in dealing with S. suis 2 infections today. Attenuated live vaccines are traditional vaccines based on whole bacteria. They have a small inoculation dose, good immune effects, and relatively long-lasting immunity. Recently, subunit vaccines targeting bacterial surface proteins have been favored by researchers due to their high safety and low production costs. Subunit vaccines have the advantages of clear components, good safety, mature technology, and convenience for industrialization. Such vaccines often consist of multiple different components, and each component is encoded by different genes of the pathogenic bacteria, thus avoiding the failure of the vaccine caused by the mutation or loss of a single gene. Therefore, the research on multivalent vaccines has become the trend of the development of new S. suis vaccines. The screening of more protective antigens is extremely important for the development of multivalent subunit vaccines. The mutant strain of the present invention provides important value for the development of attenuated vaccines and multivalent subunit vaccines. Summary of the Invention

[0005] The object of the present invention is to provide a cps2C gene knockout mutant strain of Streptococcus suis serotype 2 in view of the above deficiencies of the prior art.

[0006] Another object of the present invention is to provide the application of this mutant strain.

[0007] The object of the present invention can be achieved by the following technical solutions:

[0008] A cps2C gene knockout mutant strain 05ZYH33Δcps2C of Streptococcus suis serotype 2, in which the coding gene (SEQ ID NO.1) of the cps2C gene in the 05ZYH33 strain between the 8th and 673rd positions is replaced by the spectinomycin resistance gene cassette Spc R instead.

[0009] The construction method of the cps2C gene knockout mutant strain 05ZYH33Δcps2C of the above-mentioned Streptococcus suis serotype 2 comprises the following steps:

[0010] (1) According to the upstream DNA sequence of the cps2C coding gene of the S. suis 2 wild strain 05ZYH33 genome, PCR specific primers LA1 and LA2 are designed; according to the downstream DNA sequence of the cps2C coding gene of the S. suis 2 wild strain 05ZYH33 genome, PCR specific primers RA1 and RA2 are designed; taking the pSET2 plasmid as a template, a pair of specific primers Spc1 and Spc2 are designed;

[0011] (2) Using the 05ZYH33 genomic DNA as a template, and LA1 / LA2 and RA1 / RA2 as primers respectively, the upstream DNA sequence LA fragment of the target gene cps2C containing EcoR I / Sma I restriction sites at both ends and the downstream DNA sequence RA fragment of the target gene cps2C containing Sal I / Sph I restriction sites at both ends were amplified; using the pSET2 plasmid as a template and Spc1 / Spc2 as specific primers, the spectinomycin resistance gene cassette containing Sma I / Sal I restriction sites at both ends was amplified; the sizes of the target fragments obtained by 1% agarose gel electrophoresis of the PCR products amplified by the three pairs of primers LA1 / LA2, RA1 / RA2 and Spc1 / Spc2 were 1030 bp (LA fragment, SEQ ID NO.2), 1093 bp (RA fragment, SEQ ID NO.4) and 1130 bp (Spc R , SEQ ID NO.3) respectively. The PCR products were recovered, purified, double digested with EcoR I / Sma I, Sal I / Sph I and Sma I / Sal I respectively, and the double digested products were recovered, purified and stored frozen for later use;

[0012] (3) Construction of the gene knockout vector pUC::cps2C: The LA fragment - spectinomycin resistance gene cassette - RA fragment was inserted between the EcoR I / Sph I restriction sites of the pUC19 vector to obtain the gene knockout vector pUC::cps2C;

[0013] (4) Identification of the gene knockout vector pUC::cps2C: The obtained positive recombinant gene knockout vector pUC::cps2C was sequenced (BGI-Shenzhen), and the sequencing results showed that the target gene cps2C with homologous sequences on both sides of the Spc R gene, and the construction of the gene knockout vector pUC::cps2C was completely correct;

[0014] (5) Electrotransformation of the gene knockout vector pUC::cps2C into the competent cells of 05ZYH33;

[0015] (6) Preliminary screening of the Δcps2C mutant strain: Pick Streptococcus suis colonies from the spectinomycin THB plate and culture them in 2 mL of liquid THB (100 mg / mL spc r) Culture medium, take the bacterial solution as a template, and use primers CheckIn1 / CheckIn2 (located inside the cps2C gene) for preliminary PCR screening: If the cps2C gene is knocked out, the PCR amplification will yield a negative result. If a product of the expected size (375 bp) can still be amplified, it indicates that the cps2C gene has not been knocked out. Through this method, a cps2C gene knockout mutant strain was preliminarily screened and named Δcps2C;

[0016] (7) Identification of the Δcps2C mutant strain:

[0017] ① Identification by combined PCR: Design another pair of primers Out1 / Out2 on the two outer sides of LA and RA, the homologous sequences upstream and downstream of the target gene cps2C for knockout. If recombination occurs between the gene knockout vector pUC::cps2C and the bacterial chromosome, three situations will occur: a. Double cross-over homologous recombination event, that is, allelic replacement, at this time the Spc R gene replaces the cps2C gene; b. 3′ single cross-over recombination event, at this time the entire vector DNA sequence is integrated into the bacterial chromosome along with the 3′-end homologous sequence; c. 5′ single cross-over recombination event, at this time the vector sequence is integrated into the bacterial chromosome along with the 5′-end homologous sequence. If allelic replacement occurs, PCR with primers Out1 / Spc2 can amplify a 2266 bp fragment, PCR with primers Spc1 / Out2 can amplify a 2245 bp fragment, and PCR with primers Spc1 / Spc2 can amplify the Spc R gene, while a negative result should be obtained in 05ZYH33. Using the 05ZYH33 genome as a template, a 375 bp target fragment can be amplified with primers CheckIn1 / CheckIn2. The sizes of the PCR products are consistent with the theoretical values and are verified by DNA sequencing, confirming the successful construction of the 05ZYH33Δcps2C mutant strain at the gene level;

[0018] ② RT-PCR identification: To further verify the 05ZYH33Δcps2C mutant strain, use primers CheckIn1 / CheckIn2 to perform PCR amplification on the cDNA obtained by reverse transcription of the mutant strain and the wild strain respectively. The result is positive in the wild strain 05ZYH33, indicating normal transcription of cps2C; while it is negative in the mutant strain 05ZYH33Δcps2C. Through the identification at the transcriptional level, a cps2C gene knockout mutant strain was successfully obtained and named 05ZYH33Δcps2C.

[0019] As one of the aspects of the present invention, the construction of the gene knockout vector pUC::cps2C in step (3) specifically includes the following steps:

[0020] (a) Cloning of LA: The LA fragment after double digestion with EcoR I / Sma I was ligated to the pUC19 vector double-digested with the same restriction enzymes. After overnight incubation at 16 °C, the ligation product was transformed into DH5α Escherichia coli competent cells. After screening with ampicillin, the clones on the LB plate were picked and cultured in LB liquid medium with shaking at 37 °C overnight. The next day, plasmid DNA was extracted and identified by double digestion with EcoR I / Sma I. The recombinant plasmid with a DNA fragment of about 1030 bp was named pUC19-LA;

[0021] (b) Cloning of the spectinomycin resistance gene Spc R : The product after double digestion with Sma I / Sal I was ligated to the recombinant plasmid pUC19-LA double-digested with the same restriction enzymes. After overnight incubation at 16 °C, the ligation product was transformed into DH5α Escherichia coli competent cells. After double screening with spectinomycin and ampicillin, the clones on the LB plate were picked and cultured in LB liquid medium with shaking at 37 °C overnight. The next day, plasmid DNA was extracted and identified by double digestion with Sma I / Sal I. The recombinant plasmid with a DNA fragment of about 1130 bp was named pUC19-LS; (c) Cloning of RA: The RA fragment after double digestion with Sal I / Sph I was ligated to the recombinant plasmid pUC19-LS double-digested with the same restriction enzymes. After overnight incubation at 16 °C, the ligation product was transformed into DH5α Escherichia coli competent cells. After double screening with spectinomycin and ampicillin, the clones on the LB plate were picked and cultured in LB liquid medium with shaking at 37 °C overnight. The next day, plasmid DNA was extracted and identified by double digestion with Sal I / Sph I. The positive plasmid with a DNA fragment of about 1093 bp was screened out; and plasmid PCR identification was performed using six pairs of primers, namely LA1 / LA2, RA1 / RA2, Spc1 / Spc2, LA1 / Spc2, Spc1 / RA2, and LA1 / RA2, respectively. The obtained positive recombinant plasmid was named pUC::cps2C.

[0022] Use of the Streptococcus suis serotype 2 cps2C gene knockout mutant 05ZYH33Δcps2C in the preparation of a Streptococcus suis serotype 2 attenuated vaccine and a subunit vaccine.

[0023] The method for constructing the gene knockout vector pUC::cps2C specifically includes the following steps:

[0024] (a) Cloning of LA: The LA fragment digested with EcoR I / Sma I was ligated to the pUC19 vector digested with the same restriction enzymes. After overnight incubation at 16 °C, the ligation product was transformed into DH5α Escherichia coli competent cells. After screening with ampicillin, the clones on the LB plate were picked and cultured in LB liquid medium with shaking at 37 °C overnight. The next day, plasmid DNA was extracted and identified by double digestion with EcoR I / Sma I. The recombinant plasmid with a DNA fragment of about 1030 bp was named pUC19-LA;

[0025] (b) Cloning of the spectinomycin resistance gene Spc R : The product digested with Sma I / Sal I was ligated to the recombinant plasmid pUC19-LA digested with the same restriction enzymes. After overnight incubation at 16 °C, the ligation product was transformed into DH5α Escherichia coli competent cells. After double screening with spectinomycin and ampicillin, the clones on the LB plate were picked and cultured in LB liquid medium with shaking at 37 °C overnight. The next day, plasmid DNA was extracted and identified by double digestion with Sma I / Sal I. The recombinant plasmid with a DNA fragment of about 1130 bp was named pUC19-LS. (c) Cloning of RA: The RA fragment digested with Sal I / Sph I was ligated to the recombinant plasmid pUC19-LS digested with the same restriction enzymes. After overnight incubation at 16 °C, the ligation product was transformed into DH5α Escherichia coli competent cells. After double screening with spectinomycin and ampicillin, the clones on the LB plate were picked and cultured in LB liquid medium with shaking at 37 °C overnight. The next day, plasmid DNA was extracted and identified by double digestion with Sal I / Sph I. The positive plasmid with a DNA fragment of about 1093 bp was screened out; and plasmid PCR identification was performed with six pairs of primers, namely LA1 / LA2, RA1 / RA2, Spc1 / Spc2, LA1 / Spc2, Spc1 / RA2, and LA1 / RA2, respectively. The obtained positive recombinant plasmid was named pUC::cps2C.

[0026] The Streptococcus suis serotype 2 cps2C gene knockout vector pUC::cps2C constructed by the described method.

[0027] Application of the Streptococcus suis serotype 2 cps2C gene knockout vector pUC::cps2C in constructing a Streptococcus suis serotype 2 cps2C gene knockout mutant strain.

[0028] Application of the Streptococcus suis serotype 2 cps2C gene knockout vector pUC::cps2C in preparing a Streptococcus suis serotype 2 attenuated vaccine or subunit vaccine.

[0029] Beneficial effects:

[0030] 1. By applying the principle of homologous recombination, the present invention constructs a gene knockout vector with a spectinomycin resistance gene in the middle and homologous sequences of the upstream and downstream of the cps2C gene on both sides. The constructed pUC::cps2C gene knockout plasmid is electrotransformed into the competent cells of the highly pathogenic strain 05ZYH33 of Streptococcus suis type 2. Through in vivo homologous recombination, and screening and identification at the gene level, transcriptional level and DNA sequencing, a mutant strain is successfully obtained, named 05ZYH33Δcps2C mutant strain.

[0031] 2. The present invention analyzes the related biological characteristics and pathogenicity of the cps2C gene knockout mutant strain, and clarifies the relationship between the cps2C gene and the pathogenicity of S. suis 2. The Gram staining results of 05ZYH33Δcps2C (05ZYH33Δcps2C) and the wild strain show that compared with the wild strain, the chain arrangement of the mutant strain Δcps2C is more scattered, and the length of the chain is significantly shorter than that of the wild strain, indicating that the chain-forming ability of the mutant strain 05ZYH33Δcps2C (05ZYH33Δcps2C) is weakened; the capsule staining results prove that the capsule of the mutant strain 05ZYH33Δcps2C (05ZYH33Δcps2C) is significantly reduced; and in vitro experiments show that the ability of the mutant strain 05ZYH33Δcps2C

[0032] (05ZYH33Δcps2C) to resist macrophage phagocytosis is reduced, and the results of animal virulence tests show that the virulence of the mutant strain is significantly decreased. This mutant strain provides an important clue for the screening of protective antigens of multivalent subunit vaccines and can be applied to the development of S. suis attenuated vaccines and multivalent subunit vaccines.

[0033] 3. The 05ZYH33Δcps2C (05ZYH33Δcps2C) constructed by the present invention lays a foundation for further studying the pathogenic mechanism of Streptococcus suis type 2 and provides technical support for more effective prevention and control of Streptococcus suis disease. Description of the drawings

[0034] Figure 1 : Construction strategy diagram of cps2C gene deletion mutant strain of Streptococcus suis type 2.

[0035] Primers LA1 / LA2 and RA1 / RA2 are respectively used for PCR amplification of the left arm (LA) and right arm (RA) of the cps2C gene; primers Spc1 / Spc2 are used for PCR amplification of the SpcR gene. Flanking primers Out1 / Out2 are used for combined PCR detection to determine double crossover recombination of the mutant.

[0036] Figure 2 : Identification result diagram of double enzyme digestion of gene knockout vector pUC::LA-Spc-RA combination

[0037] M: Standard DNA molecular marker; Lane 1: Digested with EcoR I / Sma I, obtaining pUC19::Spc-RA and LA fragments respectively; Lane 2: Digested with Sma I / Sal I, obtaining pUC19::LA-RA and Spc fragments respectively; Lane 3: Digested with Sal I / Sph I, obtaining pUC19::LA-Spc and RA fragments respectively; Lane 4: Digested with EcoR I / Sal I, obtaining pUC19::RA and LA-Spc fragments respectively; Lane 5: Digested with Sma I / Sph I, obtaining pUC19::LA and Spc-RA fragments respectively; Lane 6: Digested with EcoR I / Sph I, obtaining pUC19 and LA-Spc-RA fragments respectively.

[0038] Figure 3 : Identification result diagram of combined PCR of 05ZYH33Δcps2C mutant strain.

[0039] M: Standard DNA molecular marker; Lanes 1 and 2: Using CheckIn1 / CheckIn2 primers, PCR amplification was carried out with the genomic DNA of 05ZYH33 and the genomic DNA of Δcps2C knockout strain as templates respectively, and the product was 375 bp; Lanes 3 and 4: Using Spc1 / Spc2 primers, PCR amplification was carried out with the genomic DNA of 05ZYH33 and the genomic DNA of Δcps2C knockout strain as templates respectively, and the product was 1130 bp; Lanes 5 and 6: Using Out1 / Spc2 primers, PCR amplification was carried out with the genomic DNA of 05ZYH33 and the genomic DNA of Δcps2C knockout strain as templates respectively, and the product was 2266 bp; Lanes 7 and 8: Using Spc1 / Out2 primers, PCR amplification was carried out with the genomic DNA of 05ZYH33 and the genomic DNA of Δcps2C knockout strain as templates respectively, and the product was 2245 bp; Lanes 9 and 10: Using Out1 / Out2 primers, PCR amplification was carried out with the genomic DNA of 05ZYH33 and the genomic DNA of Δcps2C knockout strain as templates respectively, and the product was 3381 bp.

[0040] Figure 4 : RNA identification and RT-PCR identification diagram of 05ZYH33Δcps2C mutant strain. Left figure: RNA extraction and identification diagram of wild strain 05ZYH33 and Δcps2C mutant strain. M: Standard DNA molecular marker; Lane 1: Total RNA of wild strain 05ZYH33, Lane 2 is total RNA of Δcps2C mutant strain.

[0041] Right figure: RT-PCR identification diagram of 05ZYH33Δcps2C mutant strain. M: Standard DNA molecular marker; Lanes 1-6: PCR amplification using CheckIn1 / CheckIn2 primers; Lanes 7-12: PCR amplification using Spc1 / Spc2 primers; Lane 1 and 7: Using 05ZYH33 genomic DNA as PCR template; Lane 2 and 8: Using genomic DNA of Δcps2C knockout strain as PCR template; Lane 3 and 9: Using cDNA of 05ZYH33 as PCR template; Lane 4 and 10: Using cDNA of Δcps2C knockout strain as PCR template; Lane 5 and 11: Using RNA of 05ZYH33 as PCR template; Lane 6 and 12: Using RNA of Δcps2C knockout strain as template. Specific implementation method

[0043] Example 1: Construction of gene knockout vector

[0044] (1) Based on the principle of gene homologous recombination, the present invention constructs a cps2C gene deletion mutant strain ( Figure 1 ). First, according to the upstream and downstream DNA sequences of the cps2C coding gene in the genome of S.suis 2 wild strain 05ZYH33, specific PCR primers are designed, and the base sequences are as follows:

[0045] LA1: 5′-G GAATTC AGTGATTGCTGCCTTGAT-3′ (The underlined part is the introduced EcoR I restriction site)

[0046] LA2: 5′-TCC CCCGGG TCGCCATATTGTTCTCCTAT-3′ (The underlined part is the introduced Sma I restriction site)

[0047] RA1: 5′-ACG GTCGAC GCCTAATTTCTCAGATAACATAAG-3′ (The underlined part is the introduced SalI restriction site)

[0048] RA2: 5′-ACAT GCATGC TTGAAAGTGCGAAATTATTCTC-3′ (The underlined part is the introduced Sph I restriction site)

[0049] According to the pSET2 plasmid sequence, a pair of specific primers Spc1 / Spc2 are designed to amplify the entire spectinomycin resistance gene cassette using the pSET2 plasmid as a template. The primer sequences are:

[0050] Spc1: 5’-TCC CCCGGGGTTCGTGAATACATGTTATA-3’(The underlined part is the introduced Sma I restriction site)

[0051] Spc2: 5’-ACGC GTCGAC GTTTTCTAAAATCTGATTAC-3’(The underlined part is the introduced SalI restriction site)

[0052] The PCR reaction system is as follows:

[0053]

[0054] The PCR reaction conditions are as follows: pre-denaturation at 95℃ for 5 min, 94℃ for 50 s, 55℃ for 60 s, 72℃ for 2 min, 30 cycles, and finally extension at 72℃ for 10 min, with double-distilled water as the negative control.

[0055] The sizes of the target fragments obtained by 1% agarose gel electrophoresis of the PCR products amplified by the three pairs of primers LA1 / LA2, RA1 / RA2, and Spc1 / Spc2 are 1030 bp (LA), 1093 bp (RA), and 1130 bp (Spc R ). The PCR products are recovered, purified, and double-digested with EcoR I / Sma I, Sal I / Sph I, and Sma I / SalI respectively. The double-digested products are recovered, purified, and stored frozen for later use.

[0056] (2) Cloning of RA: The RA fragment after double digestion with Sal I / Sph I is ligated to the pUC19 vector double-digested with the same restriction enzymes. After incubation overnight at 16℃, the ligation product is transformed into DH5α Escherichia coli competent cells. After screening with ampicillin, the clones on the LB plate are picked and cultured in LB liquid medium with shaking at 37℃ overnight. The plasmid DNA is extracted the next day and identified by double digestion with Sal I / Sph I. The recombinant plasmid with a DNA fragment of about 1093 bp is named pUC19-RA.

[0057] (3) Cloning of the spectinomycin resistance gene cassette Spc R : The product after double digestion with Sma I / SalI is ligated to the recombinant plasmid pUC19-RA double-digested with the same restriction enzymes. After incubation overnight at 16℃, the ligation product is transformed into DH5α Escherichia coli competent cells. After double screening with spectinomycin and ampicillin, the clones on the LB plate are picked and cultured in LB liquid medium with shaking at 37℃ overnight. The plasmid DNA is extracted the next day and identified by double digestion with Sma I / Sal I. The recombinant plasmid with a DNA fragment of about 1130 bp is named pUC19-SR.

[0058] (4) Cloning of LA: The LA fragment after double digestion with EcoR I / Sma I was ligated to the recombinant plasmid pUC19-SR that had been double digested with the same restriction enzymes. After overnight incubation at 16°C, the ligation product was transformed into competent DH5α Escherichia coli cells. After double screening with spectinomycin and ampicillin, clones on the LB plate were picked and cultured in LB liquid medium with shaking at 37°C overnight. The next day, plasmid DNA was extracted and identified by double digestion with EcoR I / Sma I. Positive plasmids with DNA fragments of about 1030 bp were screened out; and plasmid PCR identification was performed using six pairs of primers, namely LA1 / LA2, RA1 / RA2, spc-F / spc-R, LA1 / spc-R, spc-F / RA2, and Out1 / Out2, respectively. The obtained positive recombinant plasmid was named pUC::cps2C.

[0059] (5) Identification of the gene knockout vector pUC::cps2C: The knockout vector pUC::cps2C was identified by combined double digestion using EcoR I, Sma I, Sal I, and Sph I. The results are as Figure 2 shown. The obtained recombinant gene knockout vector pUC::cps2C was sequenced (BGI-Shenzhen Co., Ltd.). The sequencing results showed that the cps2C target gene with homologous sequences on both sides of the Spc R gene, and the construction of the gene knockout vector pUC::cps2C was completely correct.

[0060] Example 2: Screening and identification of mutants

[0061] (1) Electrotransformation of the gene knockout vector pUC::cps2C into competent

[0062] ① Preparation of competent cells of the S. suis 2 wild strain 05ZYH33: A single colony of 05ZYH33 was picked and inoculated into 3 mL of THB medium, and cultured with shaking at 37°C overnight. The next day, it was transferred at a ratio of 1:50 to THY containing DL-threonine and cultured with shaking at 37°C until the OD 600 was about 0.3 - 0.4. The bacteria were harvested by low-speed centrifugation at 4°C and washed 4 times with pre-cooled 10% glycerol, with each wash being no less than 25 mL. Finally, the bacterial pellet was resuspended in 0.5 mL of 0.3 M sucrose containing 15% glycerol, and aliquoted into 50 μL / tube and stored at -80°C for later use.

[0063] ②Electroporation: Add 10 μL of pUC::cps2C plasmid to 50 μL of competent cells prepared as described above and transfer to an electroporation cuvette (operate on ice). After electroporation at 22.5 kV / cm, 200 Ω, and 25 μF, add 940 μL of THB medium (preheated to 37°C) containing 0.3 M sucrose, incubate at 37°C with shaking at 160 rpm for 2 h, then spread on THB plates containing spectinomycin resistance, culture at 37°C for 24 - 48 h, and pick single colonies for identification;

[0064] (2) Preliminary screening of 05ZYH33Δcps2C mutant: Pick Streptococcus suis colonies from spectinomycin THB plates and culture them in 2 mL of liquid THB (100 mg / mL spc r ) medium. Use the bacterial solution as a template and perform preliminary PCR screening with primers CheckIn1 and CheckIn2 (located within the cps2C gene). The primer sequences are: CheckIn1: 5′-TCTCGCTATTGCCTATGC-3′

[0065] CheckIn2: 5′-TTGCCTGCTTCTACTACTG-3′

[0066] If the cps2C gene is knocked out, the PCR amplification will yield a negative result. If a product of the expected size (375 bp) can still be amplified, it indicates that the cps2C gene has not been knocked out. Through this method, cps2C gene knockout mutants were preliminarily screened and named 05ZYH33Δcps2C.

[0067] (3) Identification of 05ZYH33Δcps2C mutant:

[0068] ① Identification by combined PCR: Design another pair of primers Out1 / Out2 outside the LA and RA of the upstream and downstream homologous sequences of the cps2C knockout target gene. The primer sequences are: Out-F: 5′-TCCCTGTTGGACAAGTTCA-3′

[0069] Out-R: 5′-AATACACGGCACCACGTC-3′

[0070] If recombination occurs between the gene knockout vector pUC::cps2C and the bacterial chromosome ( Figure 2 ), three situations will occur: a. Double cross-over homologous recombination event, that is, allelic replacement. At this time, spc RReplace the cps2C gene with a gene; b. 3′ single cross-over recombination event, at this time the entire vector DNA sequence is integrated into the bacterial chromosome along with the 3′ homologous sequence; c. 5′ single cross-over recombination event, at this time the vector sequence is integrated into the bacterial chromosome along with the 5′ homologous sequence. If allelic replacement occurs, a 2266bp fragment can be amplified by PCR using primers Out1 / Spc2, a 2245bp fragment can be amplified by PCR using primers Spc1 / Out2, and the Spc gene can be amplified by PCR using primers Spc1 / Spc2 R gene, and a negative result should be obtained in 05ZYH33. Using the 05ZYH33 genome as a template, a 375bp target fragment can be amplified by PCR using primers CheckIn1 / CheckIn2. The sizes of the PCR products are consistent with the theoretical values ( Figure 3 ), and are verified by DNA sequencing (sequenced by BGI), confirming the successful construction of the 05ZYH33Δcps2C mutant strain at the gene level.

[0071] ② RT-PCR identification: To further verify the 05ZYH33Δcps2C mutant strain, PCR amplification was performed on the cDNA obtained by reverse transcription of the mutant strain and the wild strain using primers CheckIn1 / CheckIn2. The result was positive in the wild strain 05ZYH33, indicating normal transcription of cps2C; while it was negative in the mutant strain 05ZYH33Δcps2C ( Figure 4 ). Through identification at the transcriptional level, a cps2C gene knockout mutant strain was successfully obtained and named 05ZYH33Δcps2C.

[0072] Example 3: In vitro experiments

[0073] (1) Gram staining

[0074] According to the instructions of the Gram staining solution produced by Beijing Solarbio Science & Technology Co., Ltd., Gram staining was performed on 05ZYH33 and 05ZYH33Δcps2C respectively. It was found that the chain arrangement of the mutant strain 05ZYH33Δcps2C was more scattered than that of the wild strain, and the length of the chain was significantly shorter than that of the wild strain, indicating that the chain-forming ability of the mutant strain 05ZYH33Δcps2C was weakened.

[0075] (2) Growth characteristics

[0076] Under the same culture conditions, single colonies of 05ZYH33Δcps2C and the wild strain 05ZYH33 were separately picked and inoculated into 3 mL of THB medium containing spectinomycin (100 mg / mL) and THB medium without spectinomycin, and cultured overnight at 37°C with shaking. The bacteria cultured overnight were taken out the next day, the absorbance value at 600 nm was measured, and both were diluted to a concentration of about 1×10 8 CFU / mL with THB medium. Then, 60 μL of the mutant strain and the wild strain were separately taken and inoculated into 3 mL of THB medium, and cultured at 37°C with shaking at 200 r / min. Samples were taken every 1 h to measure OD 600 , with the culture time as the abscissa and the OD 600 value as the ordinate, the growth curves of the mutant strain and the wild strain were plotted, and it was found that there was no significant difference between the two.

[0077] (3) Anti-macrophage phagocytosis experiment

[0078] 05ZYH33 and 05ZYH33Δcps2C labeled with CFSE dye (10 7 CFU) were added to macrophages Raw264.7 (10:1), centrifuged at 800 g for 10 min, and gently shaken in the dark for a total incubation of 2 h. After washing 3 times with mild PBS, fresh medium containing 100 μg / ml gentamicin and 5 μg / ml penicillin was added and incubated for 1 h. Finally, an equal volume of paraformaldehyde (4%) was added for fixation, and the intracellular CFSE fluorescence intensity was detected by flow cytometry. Flow cytometry detection showed that the anti-macrophage phagocytosis and killing ability of 05ZYH33Δcps2C was reduced compared with that of 05ZYH33.

[0079] (4) Adhesion experiment

[0080] 05ZYH33 and 05ZYH33Δcps2C labeled with CFSE dye (10 7 CFU) were co-incubated with the human laryngeal epithelial cell line HEP-2 (10:1) for 2 h, then washed 3 times with mild PBS, and finally fixed with an equal volume of paraformaldehyde (4%). The intracellular CFSE fluorescence intensity was detected by flow cytometry. The results of flow cytometry detection showed that 05ZYH33Δcps2C adhered to HEP-2 cells more easily than 05ZYH33.

[0081] Example 4: Animal pathogenicity experiment

[0082] To detect the pathogenicity of the mutant strain 05ZYH33Δcps2C, single colonies of 05ZYH33 and the mutant strain 05ZYH33Δcps2C were separately picked on the plate and cultured in THB medium at 37°C with shaking until the mid-logarithmic growth phase (OD 600 ≈0.4, about 108 Centrifuge to collect the bacteria according to the CFU dose, and resuspend the bacteria with sterile PBS buffer. Thirty 4-week-old SPF-grade BALB / c mice were randomly divided into 3 groups, and 1 mL (about 10 8 CFU / mouse) of the wild-type and mutant strain bacterial solutions were intraperitoneally injected respectively, and a THB negative control group (1 mL / mouse) was set up. Observe and record in time whether there are obvious changes in the onset and survival time of the mice. The results showed that after attacking the mice with the lethal dose of the wild strain 05ZYH33 for 24 h, all 10 mice died, while after attacking the mice with the same dose of the knockout strain 05ZYH33Δcps2C for 12 h, all survived, and 8 still survived after 24 h. By 48 h, a total of 3 died and 7 survived; when the surviving mice were observed until the end of the 7-day experiment, no symptoms of illness were found. The 10 mice in the negative control group were in good condition. It shows that the knockout of the cps2C gene has an impact on the virulence of 05ZYH33, and it can be applied to the research and development of attenuated vaccines and multivalent subunit vaccines for Streptococcus suis type 2.

[0083] <110>Nanjing Institute of Military Medicine, Nanjing Military Region, Chinese People's Liberation Army

[0084] <120>Construction and application of cps2C gene knockout mutant strain of Streptococcus suis type 2

[0085] <160>14

[0086] <210>1

[0087] <211>666

[0088] <212>DNA

[0089] <213>Streptococcus suis 05ZYH33

[0090] <220>

[0091] <221>CDS

[0092] <223>The coding gene between the 8th and 673rd positions encoding the histidine trimer protein cps2C

[0093] <400>1

[0094] TGTTAGAAATTGCACGTACAAAAAGAGAGGGAGTAAATAAAACCGAGGAG

[0095] TATTTCAATGCTATCCGTACCAATATTCAGCTTAGCGGAGCAGATATTAAGGT

[0096] TGTTGGTATTACCTCTGTTAAATCGAATGAAGGTAAGAGTACAACTGCGGCT

[0097] AGTCTCGCTATTGCCTATGCTCGTTCAGGTTATAAGACCGTCTTGGTGGATG

[0098] CAGATATCCGAAATTCAGTCATGCCTGGTTTCTTCAAGCCAATTACAAAGAT

[0099] TACAGGTTTGACGGATTACCTAGCAGGGACAACAGACTTGTCTCAAGGATT

[0100] ATGCGATACAGATATTCCAAACTTGACCGTAATTGAGTCAGGAAAGGTTTCT

[0101] CCCAACCCTACTGCCCTTTTACAAAGTAAGAATTTTGAAAATCTACTTGCGA

[0102] CTCTTCGTCGCTATTATGATTATGTTATCGTTGACTGTCCACCATTAGGACTG

[0103] GTAGTTGATGCAGCTATCATTGCACAAAAATGTGATGCGATGGTTGCAGTAG

[0104] TAGAAGCAGGCAATGTTAAGTGCTCATCTTTGAAAAAAGTAAAAGAGCAG

[0105] TTGGAAAAAACAGGCACACCGTTCTTAGGCGTTATCTTGAACAAATATGAT

[0106] ATTGCCACTGAGAAGTATAGTGAATACGGAAATTACGGCAAAGAAA

[0107] <210>2

[0108] <211>1030

[0109] <212>DNA

[0110] <213>Streptococcus suis 05ZYH33

[0111] <220>

[0112] <221>CDS

[0113] <223>The upstream DNA sequence of the coding gene cps2C, which is the homologous left arm for gene knockout

[0114] <400>2

[0115] AGTGATTGCTGCCTTGATTAAAAAGATGAGTACGCCAGAGAATCTAAAAAA

[0116] TTACCAGGCAATCCTATCTGGATTGGAAGGCTCAATTCAAACGGATTTGAG

[0117] CTTAGAAACGATTATGAGTTTAGTGAATACCCAACTAGAATCAGGAACACA

[0118] ATTTACAGTAGAGTCACAAGCATTGACAGGAACAGGACGCTCAGACTTATC

[0119] TTCTTATGCGATGCCTGGATCACAACTTTATATGATGGAAATTAACCAAGATA

[0120] GTCTGGAGCAATCAAAGGCAGCGATTCAGTCCGTACTTGTTGAAAAATAAA

[0121] GATTTTAGGAGAAAATATGAACAATCAAGAAGTAAATGCAATCGAAATCGA

[0122] TGTTTTATTCTTACTAAAAACAATTTGGAGAAAGAAATTTTTAATTCTCTTAA

[0123] CTGCAGTGTTGACTGCGGGGTTGGCATTTGTCTACAGTAGTTTTTTAGTGAC

[0124] ACCTCAATATGACTCCACTACCCGTATCTATGTAGTGAGTCAAAATGTTGAA

[0125] GCCGGTGCGGGCTTGACTAACCAAGAGTTACAAGCGGGTACCTATTTGGCA

[0126] AAAGACTATCGGGAAATTATCCTATCACAAGATGTATTGACACAAGTAGCA

[0127] ACGGAATTGAATCTGAAAGAGAGTTTGAAAGAAAAAATATCAGTTTCTATT

[0128] CCTGTTGATACTCGTATCGTTTCTATTTCTGTGCGTGATGCGGATCCAAATGA

[0129] AGCGGCACGTATTGCAAATAGCCTTCGCACCTTTGCAGTGCAAAAGGTTGT

[0130] TGAGGTCACCAAGGTAAGCGATGTGACGACACTTGAAGAAGCAGTCCCAG

[0131] CGGAAGAACCAACCACTCCAAATACAAAACGAAATATCTTGCTTGGTTTAT

[0132] TAGCTGGAGGTATCTTGGCAACAGGTCTTGTACTGGTTATGGAGGTTTTGGA

[0133] TGACCGTGTAAAACGTCCTCAGGACATCGAAGAGGTAATGGGATTGACATT

[0134] GCTAGGTATAGTACCAGATTCGAAGAAATTAAAATAGGAGAACAATATGGC

[0135] GA

[0136] <210>3

[0137] <211>1130

[0138] <212>DNA

[0139] <213>Artificial Sequence

[0140] <220>

[0141] DNA sequence encoding a spectinomycin resistance cassette

[0142] <400>3

[0143] gttcgtgaat acatgttata ataactataa ctaataacgt aacgtgactg gcaagagata60

[0144] tttttaaaac aatgaatagg tttacactta ctttagtttt atggaaatga aagatcatat120

[0145] catatataat ctagaataaa attaactaaa ataattatta tctagataaa aaatttagaa180

[0146] gccaatgaaa tctataaata aactaaatta agtttattta attaacaact atggatataa240

[0147] aataggtact aatcaaaata gtgaggagga tatatttgaa tacatacgaa caaattaata300

[0148] aagtgaaaaa aatacttcgg aaacatttaa aaaataacct tattggtact tacatgtttg360

[0149] gatcaggagt tgagagtgga ctaaaaccaa atagtgatct tgacttttta gtcgtcgtat420

[0150] ctgaaccatt gacagatcaa agtaaagaaa tacttataca aaaaattaga cctatttcaa480

[0151] aaaaaatagg agataaaagc aacttacgat atattgaatt aacaattatt attcagcaag540

[0152] aaatggtacc gtggaatcat cctcccaaac aagaatttat ttatggagaa tggttacaag600

[0153] agctttatga acaaggatac attcctcaga aggaattaaa ttcagattta accataatgc660

[0154] tttaccaagc aaaacgaaaa aataaaagaa tatacggaaa ttatgactta gaggaattac720

[0155] tacctgatat tccattttct gatgtgagaa gagccattat ggattcgtca gaggaattaa780

[0156] tagataatta tcaggatgat gaaaccaact ctatattaac tttatgccgt atgattttaa840

[0157] ctatggacac gggtaaaatc ataccaaaag atattgcggg aaatgcagtg gctgaatctt900

[0158] ctccattaga acatagggag agaattttgt tagcagttcg tagttatctt ggagagaata960

[0159] ttgaatggac taatgaaaat gtaaatttaa ctataaacta tttaaataac agattaaaaa1020

[0160] aattataaaa aaattgaaaa aatggtggaa acactttttt caattttttt gttttattat1080

[0161] ttaatatttg ggaaatattc attctaattg gtaatcagat tttagaaaac1130

[0163] <210>4

[0164] <211>1093

[0165] <212>DNA

[0166] <213>Streptococcus suis 05ZYH33

[0167] <220>

[0168] <223>The downstream DNA sequence of the coding gene cps2C, which is the homologous right arm for gene knockout

[0169] <400>4

[0170] GCCTAATTTCTCAGATAACATAAGTTTGATAAGTAGGTATTAATATGATTGATA

[0171] TCCATTCGCATATCATATTTGGTGTGGGATGACGGTCCCAAAACTATTGAAGA

[0172] GAGCCTGAGTTTGATAAGCGAAGCTTATCGTCAAGGTGTTCGCTATATCGTA

[0173] GCGACATCTCATAGACGAAAAGGGATGTTTGAAACACCAGAAAAAATCATC

[0174] ATGATTAACTTTCTTCAACTTAAAGAGGCAGTAGCAGAAGTTTATCCTGAAA

[0175] TACGATTGTGCTATGGTGCTGAATTGTATTATAGTAAAGATATCTTAAGCAAA

[0176] CTTGAAAAAAAGAAAGTACCAACACTTAATGGCTCGTGCTATATTCTCTTGG

[0177] AGTTCAGTACGGATACTCCTTGGAAAGAGATTCAAGAAGCAGTGAACGAAA

[0178] TGACGCTACTTGGGCTAACTCCCGTACTTGCCCATATAGAGCGTTATGATGCT

[0179] CTGGCATTTCAGTCAGAGAGAGTAGAAAAGCTAATTGACAAGGGATGCTAC

[0180] ACTCAGGTAAATAGTAACCATGTGTTGAAGCCTGCTTTAATTGGCGAACGAG

[0181] CAAAAGAATTTAAAAAACGTACTCGATATTTTTTAGAGCAGGATTTAGTACA

[0182] TTGTGTTGCTAGCGATATGCATAATTTATATAGTAGACCTCCGTTTATGAGGG

[0183] AGGCGTATCAGCTTGTAAAAAAAGAGTATGGTGAGGATAGAGCGAAGGCTT

[0184] TGTTCAAGAAAAATCCTTTGTTGATATTGAAAAATCAAGTACAGTAACCTCA

[0185] TAGAAATAGTGGAGGAGCTATGAATATTGAAATAGGATATCGCCAAACGAAA

[0186] TTGGCATTGTTTGATATGATAGCAGTTACGATTTCTGCAATCTTAACAAGTCA

[0187] TATACCAAATGCTGATTTAAATCGTTCTGGAATTTTTATCATAATGATGGTTCA

[0188] TTATTTTGCATTTTTTATATCTCGTATGCCGGTTGAATTTGAGTATAGAGGTAA

[0189] TCTGATAGAGTTTGAAAAAACATTTAACTATAGTATAATATTTGTAATTTTTCT

[0190] TATGGCAGTTTCATTTATGTTAGAGAATAATTTCGCACTTTCAA

Claims

1. A Streptococcus suisserotype 2 cps2C gene knockout mutant strain 05ZYH33Δcps2C, characterized in that: The cps2C gene in strain 05ZYH33 was replaced by the spectinomycin resistance gene cassette Spc from position 31 to 1000. R replaced by.

2. The method for constructing the type 2 Streptococcus suis cps2C gene knockout mutant 05ZYH33Δcps2C according to claim 1, comprising the following steps: (1) Based on the upstream DNA sequence of the cps2C coding gene in the genome of the wild strain 05ZYH33 of S. suis 2, PCR specific primers LA1 and LA2 were designed; based on the downstream DNA sequence of the cps2C coding gene in the genome of the wild strain 05ZYH33 of S. suis 2, PCR specific primers RA1 and RA2 were designed; using the pSET2 plasmid as a template, a pair of specific primers spc-F and spc-R were designed; (2) Using 05ZYH33 genomic DNA as a template and LA1 / LA2 and RA1 / RA2 as primers, the target gene cps2C upstream DNA sequence LA fragment containing EcoR I / Sma I restriction sites at both ends and the target gene cps2C downstream DNA sequence RA fragment containing SalI / Sph I restriction sites at both ends were amplified; using pSET2 plasmid as a template and spc-F / spc-R as specific primers, the spectinomycin resistance gene cassette containing Sma I / Sal I restriction sites at both ends was amplified; the PCR products amplified by the three pairs of primers LA1 / LA2, RA1 / RA2 and spc-F / spc-R were detected by 1% agarose gel electrophoresis, and the sizes of the target fragments were 1030 bp (LA fragment), 1093 bp (RA fragment) and 1130 bp (Spc fragment). R ), the PCR product was recovered and purified, and double-digested with EcoRI / Sma I, SalI / Sph I and Sma I / Sal I, respectively, and the double-digested product was recovered, purified, and frozen for later use; (3) Construction of gene knockout vector pUC::cps2C: insert the LA fragment-spectinomycin resistance gene cassette-RA fragment into the EcoR I / Sph I restriction site of pUC19 vector to obtain gene knockout vector pUC::cps2C; (4) Identification of gene knockout vector pUC::cps2C: The positive recombinant gene knockout vector pUC::cps2C was sequenced (BGI Genomics Co., Ltd.). The sequencing results showed that in Spc R The construction of the cps2C target gene with homologous sequences on both sides of the gene and the gene knockout vector pUC::cps2C was completely correct; (5) The gene knockout vector pUC::cps2C was electroporated into 05ZYH33 competent cells; (6) Preliminary screening of Δcps2C mutants: S. suis colonies were selected from spectinomycin THB plates and cultured in 2 mL of liquid THB (100 mg / mL spc r ) medium, take the bacterial solution as a template, and use primers CheckIn-F / R (located inside the cps2C gene) for preliminary PCR screening: If the cps2C gene is knocked out, PCR amplification will give a negative result. If the expected size (375bp) can still be amplified, it means that the cps2C gene has not been knocked out. Through this method, the cps2C gene knockout mutant strain was initially screened and named Δcps2C; (7) Identification of the Δcps2C mutant strain: ①Combined PCR identification: Design a pair of primers Out-F / Out-R on the outside of LA and RA of the upstream and downstream homologous sequences of the cps2C knockout target gene; if the gene knockout vector pUC::cps2C recombines with the bacterial chromosome, three situations will occur: a. Double cross-over homologous recombination event (double cross-over), that is, allele replacement, at this time spc R The gene replaces the cps2C gene; b. 3′ end single cross-over recombination event (3′ single cross-over), at this time the entire vector DNA sequence is integrated into the bacterial chromosome along with the 3′ end homologous sequence; c. 5′ end single cross-over recombination event (5′ single cross-over), at this time the vector sequence is integrated into the bacterial chromosome along with the 5′ end homologous sequence. If allele replacement occurs, PCR with primers Out-F / Spc-R can amplify a fragment of 2266bp, PCR with primers Spc-F / Out-R can amplify a fragment of 2245bp, and PCR with primers Spc-F / Spc-R can amplify a fragment of spc R gene, while a negative result should be obtained in 05ZYH33. Using the 05ZYH33 genome as a template, primers CheckIn-F / R can amplify a target fragment of 375 bp. The size of each PCR product is consistent with the theoretical value and verified by DNA sequencing. The construction of the 05ZYH33Δcps2C mutant strain was confirmed to be successful at the gene level. ②RT-PCR identification: In order to further verify the 05ZYH33Δcps2C mutant strain, the cDNA obtained by reverse transcription of the mutant strain and the wild strain was PCR amplified using CheckIn-F / R primers. The result was positive in the wild strain 05ZYH33, indicating that cps2C was transcribed normally; while it was negative in the mutant strain 05ZYH33Δcps2C. After identification of the transcription level, the cps2C gene knockout mutant strain was successfully obtained and named 05ZYH33Δcps2C.

3. The construction method according to claim 2, characterized in that: Step (3) Construction of the gene knockout vector pUC::cps2C specifically comprises the following steps: (a) Cloning of LA: The LA fragment after double digestion with EcoR I / Sma I was ligated to the pUC19 vector treated with the same endonuclease double digestion. After incubation at 16°C overnight, the ligation product was transformed into DH5a E. coli competent cells. After selection with ampicillin, clones on the LB plate were picked and cultured in LB liquid medium at 37°C with shaking overnight. The next day, plasmid DNA was extracted and identified by double digestion with EcoR I / Sma I. The recombinant plasmid with a DNA fragment of about 1000 bp was named pUC19-LA. (b) Spectinomycin resistance gene Spc R Cloning: The product after Sma I / Sal I double digestion was connected with the recombinant plasmid pUC19-LA treated with the same endonuclease double digestion. After overnight at 16°C, the ligation product was transformed into DH5a Escherichia coli competent cells. After double screening with spectinomycin and ampicillin, the clones on the LB plate were picked and cultured in LB liquid culture medium at 37°C with shaking overnight. The plasmid DNA was extracted the next day and double digested with Sma I / Sal I for identification. The recombinant plasmid with a DNA fragment of about 1100 bp was named pUC19-LS. (c) Cloning of RA: The RA fragment after double digestion with Sal I / Sph I was ligated with the recombinant plasmid pUC19-LS treated with the same endonuclease double digestion. After incubation at 16°C overnight, the ligation product was transformed into DH5a Escherichia coli competent cells. After double screening with spectinomycin and ampicillin, clones on the LB plate were picked and cultured in LB liquid culture medium at 37°C with shaking overnight. The next day, plasmid DNA was extracted and identified by double digestion with Sal I / Sph I to screen out positive plasmids with DNA fragments of about 1000 bp in size. Plasmid PCR was also performed using six pairs of primers, LA1 / LA2, RA1 / RA2, spc-F / spc-R, LA1 / spc-R, spc-F / RA2, and LA1 / RA2, respectively. The resulting positive recombinant plasmid was named pUC::cps2C.

4. Use of the Streptococcus suis serotype 2 cps2C gene knockout mutant 05ZYH33Δcps2C according to claim 1 in the preparation of attenuated vaccines and subunit vaccines of Streptococcus suis serotype 2.

5. The method for constructing the gene knockout vector pUC::cps2C according to claim 2, characterized in that: The specific steps include: (a) Cloning of LA: The LA fragment after double digestion with EcoR I / Sma I was ligated to the pUC19 vector treated with the same endonuclease double digestion. After incubation at 16°C overnight, the ligation product was transformed into DH5a E. coli competent cells. After selection with ampicillin, clones on the LB plate were picked and cultured in LB liquid medium at 37°C with shaking overnight. The next day, plasmid DNA was extracted and identified by double digestion with EcoR I / Sma I. The recombinant plasmid with a DNA fragment of about 1000 bp was named pUC19-LA. (b) Spectinomycin resistance gene Spc R Cloning: The product after Sma I / Sal I double digestion was connected with the recombinant plasmid pUC19-LA treated with the same endonuclease double digestion. After incubation at 16°C overnight, the ligation product was transformed into DH5a Escherichia coli competent cells. After double screening with spectinomycin and ampicillin, the clones on the LB plate were picked and cultured in LB liquid culture medium at 37°C with shaking overnight. The plasmid DNA was extracted the next day and double digested with Sma I / Sal I for identification. The recombinant plasmid with a DNA fragment of about 1100 bp was named pUC19-LS. (c) Cloning of RA: The RA fragment after double digestion with Sal I / Sph I was ligated with the recombinant plasmid pUC19-LS treated with the same endonuclease double digestion. After incubation at 16°C overnight, the ligation product was transformed into DH5a Escherichia coli competent cells. After double screening with spectinomycin and ampicillin, clones on the LB plate were picked and cultured in LB liquid culture medium at 37°C with shaking overnight. The next day, plasmid DNA was extracted and identified by double digestion with Sal I / Sph I to screen out positive plasmids with DNA fragments of about 1000 bp in size. Plasmid PCR was also performed using six pairs of primers, LA1 / LA2, RA1 / RA2, spc-F / spc-R, LA1 / spc-R, spc-F / RA2, and LA1 / RA2, respectively. The resulting positive recombinant plasmid was named pUC::cps2C.

6. The Streptococcus suis type 2 cps2C gene knockout vector pUC::cps2C constructed according to the method of claim 5.

7. Use of the Streptococcus suis serotype 2 cps2C gene knockout vector pUC::cps2C according to claim 6 in constructing a Streptococcus suis serotype 2 cps2C gene knockout mutant strain.

8. Use of the Streptococcus suis type 2 cps2C gene knockout vector pUC::cps2C according to claim 6 in the preparation of a Streptococcus suis type 2 attenuated vaccine or subunit vaccine.

Citation Information

Cited By

  • Streptococcus suis type 2 capsular polysaccharide high-yield strain and application thereof

    CN120399980A