Construction of EBV-infected epidermal cell and B cell models

By overexpressing EphA2 and RTA in the 293T cell line and CD21 and ZTA in the BJAB cell line, an efficient EBV infection model was constructed, solving the problem of EBV infection and improving the efficiency and accuracy of research and drug screening.

CN120574783BActive Publication Date: 2026-05-05SHANGHAI INSTITUTE OF MATERIA MEDICA CHINESE ACADEMY OF SCIENCES
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510775393.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-11
Publication Date
2026-05-05
Estimated Expiration
2045-06-11

AI Technical Summary

Technical Problem

In existing technologies, EBV is difficult to infect routine laboratory cell lines efficiently, which affects research and drug development. There is a lack of efficient EBV infection models for epidermal cells and B cells, resulting in low accuracy of experimental results and low screening efficiency.

Method used

EBV-sensitive cell lines overexpressing EBV receptors and transcription switch proteins were constructed, including the 293T cell line overexpressing EphA2 and RTA, and the BJAB cell line overexpressing CD21 and ZTA, which significantly improved EBV infection efficiency.

Benefits of technology

It significantly improved the EBV infection rate, provided an efficient platform for studying the EBV infection mechanism and screening antiviral drugs and vaccines, and enhanced the accuracy and efficiency of experiments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005444202550000101
    Figure BDA0005444202550000101
  • Figure BDA0005444202550000111
    Figure BDA0005444202550000111
  • Figure HDA0005444202560000011
    Figure HDA0005444202560000011
Patent Text Reader

Abstract

This invention provides EBV-susceptible 293T cells that simultaneously express the epidermal cell receptor EphA2 and the key protein RTA for lysis and replication, and EBV-susceptible BJAB cells that simultaneously express the B cell receptor CD21 and the key protein ZTA for lysis and replication, significantly enhancing the infectivity of these cells for EBV. The EBV infection titer of the cell lines of this invention is more than three times that of the normal control under the same conditions. These EBV-susceptible cells are of great significance for studying the mechanism of EBV infection, screening antiviral drugs, and developing vaccines.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bioengineering, specifically relating to the construction of EBV-infected epidermal cell and B cell models. Background Technology

[0002] Epstein-Barr virus (EBV) is a human herpesvirus that is widespread in the human population, with a global infection rate exceeding 90%. EBV infection is closely associated with a variety of serious human diseases, including infectious mononucleosis, nasopharyngeal carcinoma, gastric cancer, Burkitt lymphoma, and other types of lymphoproliferative disorders.

[0003] During primary EBV infection, it primarily infects epidermal cells, causing them to lyse and replicate. Subsequently, it infects B cells and establishes latent infection within them, resulting in lifelong EBV carriage. However, EBV research and antiviral drug development face a significant challenge: EBV is difficult to efficiently infect routine laboratory cell lines. This limitation severely hinders in-depth research into its infection mechanisms, high-throughput screening of effective antiviral drugs, and vaccine evaluation.

[0004] Currently, Raji cells are the most commonly used B-cell infection model in laboratories for analyzing EBV neutralizing antibodies. However, because these cells naturally carry EBV, exogenous viral infection may interfere with endogenous viral products, affecting the accuracy of experimental results, and the infection efficiency is also low. Furthermore, there is a lack of epidermal cell and B-cell models that efficiently infect EBV, possibly related to the receptor and EBV replication characteristics.

[0005] Therefore, in order to overcome the research bottlenecks related to EBV infection, it is urgent to provide EBV-sensitive cells to facilitate the screening of effective antiviral drugs and the evaluation of vaccine efficacy. Summary of the Invention

[0006] This invention provides an EBV-sensitive epidermal cell line 293T that simultaneously overexpresses the EBV receptor EphA2 for epidermal cell infection and the switch protein RTA activated by viral gene cleavage replication transcription, and an EBV-sensitive B cell line BJAB that simultaneously overexpresses the B cell receptor CD21 and the switch protein ZTA activated by viral gene cleavage replication transcription, and provides applications of the aforementioned epidermal cell line and the aforementioned B cell line.

[0007] In a first aspect of the invention, an EBV-susceptible cell line is provided, said cell line overexpressing the EBV receptor and a transcription switch protein.

[0008] In another preferred embodiment, the cell line comprises: an epidermal cell line and / or a B cell line.

[0009] In another preferred embodiment, the EBV receptor comprises: a CD21 receptor, an EphA2 receptor, or a combination thereof.

[0010] In another preferred embodiment, the transcription switch protein is a viral gene cleavage replication transcription activator.

[0011] In another preferred embodiment, the transcription switch protein comprises: RTA encoded by the BRLF1 gene, ZTA encoded by the BZLF1 gene, or a combination thereof.

[0012] In another preferred embodiment, the cell line is an epidermal cell line, the EBV receptor is adrenaline receptor A2, and the transcription switch protein is replication transcription activator RTA.

[0013] In another preferred embodiment, the epidermal cell line is the 293T cell line.

[0014] In another preferred embodiment, the cell line is a B cell line, the EBV receptor is a CD21 receptor, and the transcription switch protein is the replication transcription activator ZTA.

[0015] In another preferred embodiment, the B cell line is BJAB cell.

[0016] In another preferred embodiment, the EBV infection titer Y1 of the cell line is significantly higher than that of the normal control EBV infection titer Y0.

[0017] In another preferred embodiment, the normal control refers to a wild-type cell line that does not overexpress the EBV receptor and does not overexpress the transcription switch protein under the same culture conditions.

[0018] In another preferred embodiment, the ratio of the EBV infection titer Y1 of the cell line to the EBV infection titer Y0 of the normal control is Y1 / Y0 ≥ 3, preferably ≥ 5, and most preferably ≥ 8.

[0019] In another preferred embodiment, the EBV infection rate X1 of the cell line is significantly higher than the EBV infection rate X0 of the normal control.

[0020] In another preferred embodiment, the ratio of the EBV infection rate X1 of the cell line to the EBV infection rate X0 of the normal control is X1 / X0 ≥ 2, preferably ≥ 3.

[0021] In a second aspect of the invention, the use of the cell line described in the first aspect of the invention is provided for one or more of the following uses:

[0022] (Z1) is used to study the mechanism of EBV infection of host cells;

[0023] (Z2) was used to screen for EBV neutralizing antibodies;

[0024] (Z3) is used to screen anti-EBV drugs;

[0025] (Z4) is used to screen EBV vaccines;

[0026] (Z5) is used to prepare a live cell preparation for detecting EBV neutralizing antibodies in a sample.

[0027] In another preferred embodiment, the use is for non-diagnostic and non-therapeutic purposes.

[0028] In a third aspect of the invention, a live cell preparation is provided, the live cell preparation comprising the cell line described in the first aspect of the invention.

[0029] In another preferred embodiment, the live cell preparation also includes an instruction manual for guiding the use of the live cell preparation in detecting EBV neutralizing antibodies in a sample.

[0030] In a fourth aspect of the invention, a method for preparing the cell line described in the first aspect of the invention is provided, comprising the following steps:

[0031] (A1) Provides pLVX-puro-RTA plasmid and pLVX-hygro-EphA2 plasmid;

[0032] (A2) Transfect the pLVX-puro-RTA plasmid and the pLVX-hygro-EphA2 plasmid into the epidermal cell line to obtain the cell line described in the first aspect of the present invention.

[0033] In another preferred embodiment, in step (A2), the pLVX-puro-RTA plasmid is first transfected into the epidermal cell line, and then the pLVX-hygro-EphA2 plasmid is transfected into the epidermal cell line to obtain the cell line described in the first aspect of the present invention.

[0034] In another preferred embodiment, in step (A2), the pLVX-hygro-EphA2 plasmid is first transfected into the epidermal cell line, and then the pLVX-puro-RTA plasmid is transfected into the epidermal cell line to obtain the cell line described in the first aspect of the present invention.

[0035] In a fifth aspect of the invention, a method for preparing the cell line described in the first aspect of the invention is provided, comprising the following steps:

[0036] (B1) Provide pLVX-hygro-CD21 plasmid and pLVX-puro-ZTA plasmid;

[0037] (B2) Electroporate the pLVX-hygro-CD21 plasmid into the B cell line to obtain BJAB-CD21 cells;

[0038] (B3) The pLVX-puro-ZTA is packaged into a lentivirus and introduced into the BJAB-CD21 cells to obtain the cell line described in the first aspect of the present invention.

[0039] In another preferred embodiment, the method includes the following steps:

[0040] (B1') provides pLVX-hygro-CD21 plasmid and pLVX-puro-ZTA plasmid;

[0041] (B2') The pLVX-puro-ZTA plasmid is packaged into a lentivirus and introduced into the B cell line;

[0042] (B3') Electroporate the pLVX-hygro-CD21 plasmid into the B cell line obtained in step (C2) to obtain the cell line described in the first aspect of the present invention.

[0043] In a sixth aspect of the invention, a method for evaluating the EBV neutralizing activity of a sample is provided, comprising the following steps:

[0044] (S1) Provide the cell line described in the first aspect of the present invention;

[0045] (S2) The sample is co-incubated with the cell line described in step (S1) to provide the sample with EBV neutralizing activity.

[0046] In another preferred embodiment, the neutralizing activity includes: EBV neutralizing titer and / or neutralizing percentage.

[0047] In another preferred embodiment, co-incubation refers to incubation at 37°C.

[0048] In another preferred embodiment, the incubation time is 1-3 hours, preferably 2 hours.

[0049] In another preferred embodiment, the sample is a serum sample from a mammal.

[0050] In another preferred embodiment, the mammal is a mammal that has been vaccinated against EBV.

[0051] In another preferred embodiment, the mammal is a non-human mammal or a human.

[0052] In a seventh aspect of the invention, a platform is provided for screening anti-EBV drugs and / or developing EBV vaccines, the platform comprising an EBV-susceptible cell line, the EBV-susceptible cell line comprising:

[0053] (i) an epidermal cell line in which adrenaline receptor A2 and replication-activating factor RTA are overexpressed; and / or

[0054] (ii) B cell line, wherein CD21 receptor and replication transcription activator ZTA are overexpressed.

[0055] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0056] Figure 1 A schematic diagram of the EphA2 and CD21 expression plasmids pLVX-hygro-EphA2 and pLVX-hygro-CD21 is shown.

[0057] Figure 2 A schematic diagram of the EphA2 and CD21 expression plasmids pLVX-puro-RTA-Flag and pLVX-puro-ZTA-flag is shown.

[0058] Figure 3 The successful construction of the 293T-RTA-EphA2 monoclonal cell line and the BJAB-ZTA-CD21 monoclonal cell line was demonstrated.

[0059] in, Figure 3 A shows the results of Western Blot analysis of RTA and EphA2 after the pLVX-puro-RTA and pLVX-hygro-EphA2 plasmids were transformed into epidermal cell-like 293T cells and stable monoclonal cell lines were selected. Figure 3 B shows the expression of ZTA and CD21 in the screened monoclonal BJAB-ZTA-CD21 cells as detected by Western blotting.

[0060] Figure 4 The cell line 293T-RTA-EphA2 was shown to be susceptible to EBV.

[0061] in, Figure 4 A shows the fluorescence imaging results of the 293T-RTA-EphA2 cell line and the wild-type 293T-WT cell line after co-incubation with EBV-GFP. Figure 4 B shows the corresponding fluorescence quantification results.

[0062] Figure 5 The cell line BJAB-ZTA-CD21 was shown to be susceptible to EBV.

[0063] in, Figure 5 A shows the fluorescence imaging results of the BJAB-ZTA-CD21 cell line and the wild-type BJAB-WT cell line after co-incubation with EBV-GFP; Figure 5 B shows the FACS analysis results 72 hours after infection; Figure 5 C shows the results of replicate experiments on the BJAB-ZTA-CD21 cell line infected with low-dose EBV-GFP and the wild-type BJAB-WT cell line; Figure 5 D shows Figure 5 Quantitative results of C; Figure 5 E shows the FACS analysis results of the BJAB-ZTA-CD21 cell line and the Raji cell line commonly used in EBV neutralization experiments.

[0064] Figure 6 The results showed that 293T-RTA-EphA2 cells and BJAB-ZTA-CD21 cells exhibited clear neutralization curves in the EBV neutralization assay, which can be used to evaluate the neutralizing efficacy of antibodies or serum.

[0065] in, Figure 6 A and Figure 6 B shows the neutralization curves for cell line BJAB-ZTA-CD21 and epithelial cell line 293T-RTA-EphA2, respectively. Detailed Implementation

[0066] Through extensive and in-depth research, the inventors unexpectedly discovered for the first time that overexpressing specific EBV receptors on the cell surface via genetic modification, while simultaneously overexpressing specific transcriptional switch proteins that promote EBV replication (e.g., overexpressing the cell receptor EphA2 and the key protein RTA for lysis replication in epidermal cells, and, for example, overexpressing the B cell receptor CD21 and the key protein ZTA for lysis replication in B cells), can more than double the EBV infection rate and enhance viral replication, thereby obtaining cells that are more susceptible to and easily detectable by EBV. These EBV-susceptible cells are of great significance for studying the EBV infection mechanism, screening antiviral drugs, and developing vaccines. This invention was completed based on this discovery.

[0067] Specifically, constructing 293T cells that simultaneously express the epidermal cell receptor EphA2 and the key protein RTA for lysis and replication, and BJAB cells that dually express the B cell receptor CD21 and the key protein ZTA for lysis and replication, significantly enhanced the infectivity of these cells for EBV. These modified cell models not only contribute to a deeper understanding of the EBV infection mechanism but also provide an efficient platform for antiviral drug screening and vaccine development, thereby greatly improving the efficiency and success rate of development.

[0068] the term

[0069] To facilitate a clearer understanding of this disclosure, certain terms are first defined. As used herein, unless otherwise expressly specified herein, each of the following terms shall have the meaning given below. Other definitions are set forth throughout the application.

[0070] As used herein, the term “and / or” refers to and covers any and all possible combinations of one or more of the related listed items.

[0071] As used herein, the terms “comprising,” “including,” and “containing” are used interchangeably and include not only closed definitions but also semi-closed and open definitions. In other words, the terms include “consisting of” and “substantially consisting of”.

[0072] Where a numerical range is provided, unless the context clearly indicates otherwise, it should be understood that every intermediate integer of the value 20, every tenth of every intermediate integer of the value, any other intermediate value between the upper and lower limits of the range, and any other intermediate value within the specified range are included in this invention. The upper and lower limits of these smaller ranges may be independently included within the smaller range and also covered by this invention, but are subject to any express exclusions within the specified range. For example, "1 to 50" includes "2 to 25", "5 to 20", "25 to 50", "1 to 10", etc.

[0073] As used in this article, the term "vaccine" includes both preventative and therapeutic vaccines.

[0074] As used herein, the term "overexpression" refers to a significant increase in expression levels. For example, overexpression of the EBV receptor in a cell line means the ratio of the EBV receptor level N1 in the cell line to the EBV receptor level N0 in the wild-type cell line, where N1 / N0 ≥ 1.1, preferably ≥ 1.3, more preferably ≥ 1.5, and most preferably ≥ 2.0. In specific embodiments, the EBV receptor level includes protein and / or nucleic acid levels.

[0075] EBV infection

[0076] EBV can establish primary infection in B cells and epithelial cells.

[0077] The key mechanism by which EBV enters B cells is that the viral glycoprotein gp350 binds to complement receptor 2 (CR2, CD21) on the surface of B cells. Subsequently, gp42 binds to the cell receptor HLA2 to form the gH / gL / gp42-HLA2 complex, which triggers a conformational change in the gB protein, thereby promoting the fusion of the viral envelope with the cell membrane.

[0078] In contrast, EBV infects epithelial cells via a different mechanism, primarily through the binding of BMRF2 to integrins. Subsequently, gH / gL binds to adrenaline receptor A2 (EphA2), activating gB protein and thus initiating membrane fusion.

[0079] Because EBV infects B cells and epithelial cells via different mechanisms, vaccines or neutralizing antibodies may exhibit varying inhibitory effects on different cell types. Therefore, using both cell types separately in neutralization experiments not only allows for a comprehensive evaluation of the neutralizing capacity of candidate vaccines but also clarifies their inhibitory effects on different infection routes, thereby optimizing vaccine design and assessing its breadth of protection.

[0080] Once infecting a host, EBV establishes two modes of infection: the lysis phase and the latent phase. The virus establishes a lifelong latent infectious state in the human body, only occasionally reactivating and lysing under certain conditions. Under specific conditions, EBV can be reactivated, entering the lysis-replication cycle, at which point most of the viral genes are expressed, and the virus is able to replicate its genome and generate infective progeny viruses.

[0081] Transcription switch protein

[0082] EBV can promote viral replication and viral gene expression through the regulation of key transcription switch proteins such as RTA (encoded by the BRLF1 gene) and ZTA (encoded by the BZLF1 gene).

[0083] BZLF1 (ZTA / ZEBRA) is a key regulator in the transition of the virus from latent infection to lytic replication. As an immediate early gene product, BZLF1 recognizes ZRE sequences in the viral genome through its bZIP domain, activating its own promoter to form a positive feedback loop and driving the transcription of downstream early genes (such as DNA polymerase BALF5) and late genes (such as capsid protein VP1 and envelope protein gp350). Simultaneously, it remodels the cellular metabolic environment by regulating host NF-κB and MAPK signaling pathways, promoting viral genome replication and progeny particle assembly. Meanwhile, BRLF1 (RTA) binds to RREs through its zinc finger domain, synergistically enhancing the transcription efficiency of target genes with BZLF1 and activating the host MAPK pathway to provide raw materials for viral replication.

[0084] Studies have also shown that RTA is the main cleavage transcription activator of EBV in epithelial cells. When expressed alone, RTA can effectively induce the transcription of most early EBV genes, while ZTA can only activate the BHLF1 and LF3 transcripts related to cleavage initiation. Furthermore, although the expression of late genes requires the synergistic effect of RTA and ZTA, RTA remains the dominant factor, while ZTA mainly acts as a cofactor for DNA replication and, together with RTA, enhances the transcription of some early genes.

[0085] The main advantages of this invention include:

[0086] (a) This invention provides epithelial cells and B cells with high EBV invasion efficiency, increased viral replication, and enhanced EBV infection capacity by overexpressing EBV receptor and transcription switch protein on the cell surface through genetic modification.

[0087] (b) The present invention provides 293T cells that simultaneously overexpress the epidermal cell receptor EphA2 and the key protein RTA for lysis and replication, and BJAB cells that simultaneously overexpress the B cell receptor CD21 and the key protein ZTA for lysis and replication, which significantly improve the infectivity of said cells to EBV.

[0088] (c) The cell lines of the present invention not only help to understand the EBV infection mechanism, but also provide an efficient platform for antiviral drug screening and vaccine development, thereby greatly improving the efficiency and success rate of development.

[0089] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0090] Example 1: Construction and expression identification of 293T-RTA-EphA2 and BJAB-ZTA-CD21 cell lines.

[0091] To construct more EBV-susceptible epithelial and B cell lines, four plasmids—pLVX-puro-RTA, pLVX-hygro-EphA2, pLVX-puro-ZTA, and pLVX-hygro-CD21—were first constructed, each with a FLAG-tag at its C-terminus for subsequent detection. The pLVX-puro-RTA and pLVX-hygro-EphA2 plasmids were transformed into epidermal cell-like 293T cells, and stable monoclonal cell lines expressing these plasmids were selected. Similarly, the pLVX-puro-ZTA and pLVX-hygro-CD21 plasmids were transformed into BJAB cells, and stable monoclonal cell lines expressing these plasmids were also selected.

[0092] Construction of the 293T-RTA-EphA2 cell line. Following the relevant kit instructions and referring to the human EphA2 gene (Gene Bank: NM_004431.5) in NCBI, and using self-designed primers EphA2-F: gcctcgagatggagctccaggcagcccgcgcctg (SEQ ID NO:1) and EphA2-R-Flag: cgtctagattacttatcgtcgtcatccttgtaatcgatggggatccccacagtgttcacctggtccttgag (SEQ ID NO:2), and using a plasmid containing EphA2 already constructed in another vector as a template, EphA2 was amplified by PCR, and a Flag tag was added to the end of the gene for fusion expression with the EphA2 gene (EphA2-Flag) for easy detection. After obtaining the EphA2-Flag gene fragment, it was cloned into the pLVX-hygro vector to obtain pLVX-hygro-EphA2. Figure 1 As shown, the constructed pLVX-hygro-EphA2 plasmid was double-digested with enzymes. Electrophoresis confirmed that the size of the digested gene fragments met expectations, and further DNA sequencing analysis showed that the plasmid construction was correct. The pLVX-puro-RTA plasmid map is shown below. Figure 2 As shown.

[0093] Healthy 293T cells were evenly seeded into 6-well plates and cultured until the cell density reached approximately 70%-80%. The original culture medium was then removed and replaced with fresh complete culture medium. Using Tenfect transfection reagent, pLVX-hygro-EphA2 and pLVX-puro-RTA plasmids were transfected according to the manufacturer's instructions. After 48 hours, the original culture medium was replaced with fresh complete culture medium, and hygromycin at a final concentration of 400 μg / ml and puromycin at a final concentration of 2 μg / ml were added for resistance selection. The resulting positive clone was named 293T-RTA-EphA2.

[0094] Construction of the BJAB-ZTA-CD21 cell line. Following the relevant kit instructions and referring to the human CD21 in NCBI (Gene Bank: NM_001006658.3), and using self-designed primers CD21-F: gcactagtatgggcgccgcgggcctgctcgg (SEQ ID NO:3) and CD21-R-Flag: atagttagcggccgctcacttatcgtcgtcatccttgtaatcgctggctgggttgtatggatcaacagaatatactt ctcgtgctt (SEQ ID NO:4), RNA was extracted from Raji lymphoma cells and reversed to cDNA as a template. CD21 was amplified by PCR, and a Flag tag was added to the end of the gene for fusion expression (CD21-Flag) to facilitate detection. After obtaining the CD21-Flag gene fragment, it was cloned into the pLVX-hygro vector to obtain pLVX-hygro-CD21. Figure 1 As shown, the constructed pLVX-hygro-CD21 plasmid was double-digested with enzymes. Electrophoresis confirmed that the size of the digested gene fragments met expectations, and further DNA sequencing analysis showed that the plasmid construction was correct. The plasmid map of pLVX-puro-ZTA expression is shown below. Figure 2 As shown.

[0095] Collect healthy BJAB cells by centrifugation at 1500 rpm for 5 min, discard the supernatant, resuspend the cell pellet in PBS buffer, count the cells, and take 2 × 10⁶ cells. 6 Centrifuge cells to remove supernatant. Add 100 μL of electroporation buffer to a 1.5 mL centrifuge tube, add 4 μg of pLVX-hygro-CD21 plasmid, mix well by pipetting, and resuspend the cell pellet in the electroporation buffer using a pipette. Place the electroporation cuvette in the electroporator, set the corresponding program, and start the program. Electroporation is complete when the electroporator displays "OK". Resuspend the electroporated cells in preheated (37°C) complete culture medium and add to a cell culture plate. After culturing for 48 hours, add hygromycin at a final concentration of 200 μg / mL for resistance selection. The obtained positive clone is named BJAB-CD21.

[0096] 293T cells were seeded in 10cm diameter culture dishes for lentivirus packaging. Transfection was performed when the cell density reached approximately 80%. Two 1.5mL centrifuge tubes were divided into tube A and tube B. 500μl of Opti-MEM medium and 30μl of PEI were added to tube A and mixed thoroughly. 500μl of Opti-MEM medium was added to tube B, followed by pLVX-puro-ZTA plasmid (5μg), lentivirus packaging helper plasmids psPAX2 (3μg) and PMD2.G (2μg), and mixed thoroughly. The transfection reagent from tube A was then added to tube B and mixed thoroughly. The mixture was incubated at room temperature for 30 min. After incubation, the mixture from tubes A and B was added dropwise to the 293T cells, gently shaken to mix, and then incubated at 37°C in a 5% CO2 incubator. After culturing for 24 hours, sodium butyrate was added to the culture medium to a final concentration of 2.5 μM, and the culture was continued for another 48 hours before the cell culture supernatant was collected. After collecting the viral supernatant, cell debris was removed by centrifugation at 4000 rpm at 4°C for 30 min. The supernatant was then aliquoted and frozen at -80°C to obtain packaged ZTA-expressing lentivirus.

[0097] BJAB-CD21 cells in good growth condition were used at a rate of 4 × 10⁻⁶ 5 Cells / ml were seeded into 6-well plates and transduced using packaged pLVX-puro-ZTA recombinant lentivirus. After incubation for 2 hours, complete culture medium was added and cultured for another 48 hours. Then, 1 μg / ml of puromycin was added for resistance selection. The obtained positive clone was named BJAB-ZTA-CD21.

[0098] Stable monoclonal cell lines expressing pLVX-puro-RTA and pLVX-hygro-EphA2 plasmids were obtained by transfecting epidermal cell-like 293T cells, and the results were detected by Western blotting. Figure 3 As shown in Figure A, a monoclonal cell line stably expressing pLVX was obtained by transfecting pLVX-puro-ZTA and pLVX-hygro-CD21 lentivirus into BJAB cells. The expression was verified by Western blotting, and the results are as follows. Figure 3 As shown in Figure B, the successful construction of the 293T-RTA-EphA2 and BJAB-ZTA-CD21 cell lines was confirmed. The reproducibility of the construction of both the 293T-RTA-EphA2 and BJAB-ZTA-CD21 cell lines was relatively high.

[0099] Furthermore, this embodiment also attempted to introduce the ZTA gene into epithelial cells and the RTA gene into BJAB cells. However, after applying selection pressure, significant cell death was observed, indicating that the 293T-ZTA-EphA2 and BJAB-RTA-CD21 cell lines were not successfully constructed. This may be because the key role of ZTA in EBV DNA replication may cause DNA replication stress in epithelial cells, thereby inducing cell cycle arrest or apoptosis, making it difficult for stable transfected cells to survive. This conclusion confirms that the construction of EBV-susceptible 293T cells simultaneously expressing the epidermal cell receptor EphA2 and the key protein RTA for cleavage replication, and EBV-susceptible BJAB cells simultaneously expressing the B cell receptor CD21 and the key protein ZTA for cleavage replication, are both non-obvious.

[0100] Example 2: EBV infection experiments of cell line 293T-RTA-EphA2 and cell line BJAB-ZTA-CD21.

[0101] To test whether the constructed cell lines were more susceptible to EBV, the 293T-RTA-EphA2 cell line and the wild-type 293T-WT cell line constructed in six-well plates were infected with the same amount of EBV-GFP.

[0102] 293T and 293T-RTA-EphA2 cells were seeded into cell culture plates one day in advance. Before viral infection, the supernatant was aspirated, and the cells were covered with EBV-GFP diluted in DMEM medium. The plates were incubated at 37°C with 5% CO2 for 1 hour, during which time the plates were gently shaken every 15 minutes to ensure the virus suspension evenly covered the cells. After infection, the inoculum was aspirated, and the plates were replaced with complete culture medium. Green fluorescence in the cell wells was observed and recorded at 24, 48, and 72 hours post-infection.

[0103] The results were observed using a fluorescence microscope. Figure 4 As shown in A, the corresponding quantitative results are as follows: Figure 4 As shown in B.

[0104] The results showed that GFP fluorescence, representing EBV infection, was significantly more abundant and stronger in the 293T-RTA-EphA2 cell line than in the 293T-WT cell line.

[0105] To more accurately determine the efficiency of the constructed cell lines in infecting EBV, the same experiment was performed in 96-well plates, with three replicates for each sample. The cells were infected 48 hours later... The S6 universal M2 analyzer was used to scan the plate and count the number of EBV-infected cells expressing GFP. Results are as follows: Figure 4 As shown in Figure B and Table 1.

[0106] Table 1. Infection rate of EBV in epithelial cell lines

[0107]

[0108] The results showed that the number of cells infected with EBV in the 293T-RTA-EphA2 cell line was significantly higher than that in the 293T-WT cell line.

[0109] The results above indicate that the 293T-RTA-EphA2 cell line is significantly more susceptible to EBV than the corresponding wild-type 293T cell line.

[0110] BJAB and BJAB-ZTA-CD21 cells in good growth condition were collected by centrifugation at 1500 rpm for 5 min, the supernatant was discarded, and the cell pellet was resuspended in PBS buffer and counted. The required number of cells were then centrifuged and the supernatant was removed. Cells were resuspended in EBV-GFP diluted with RPMI 1640 medium and added to cell culture plates. The cells were incubated at 37°C and 5% CO2 for 2 h for adsorption. After infection, the supernatant was removed by centrifugation, and the cells were resuspended in complete RPMI 1640 medium and added to cell culture plates. The cells were then incubated at 37°C and 5% CO2. After 72 h of culture, the cells were collected by centrifugation, fixed with 4% PFA, and then analyzed by flow cytometry for EBV-GFP positive cells.

[0111] Both the BJAB-ZTA-CD21 cell line and the wild-type BJAB-WT cell line were infected with the same titer of EBV-GFP (2000 FFU).

[0112] The results were observed using a fluorescence microscope. Figure 5 As shown in Figure A.

[0113] The results showed that GFP fluorescence, representing EBV infection, was significantly more abundant and stronger in the BJAB-ZTA-CD21 cell line than in the BJAB-WT cell line.

[0114] FACS analysis was performed 72 hours after infection, and the results were as follows: Figure 5 As shown in B.

[0115] After EBV infection, the number of GFP-positive cells representing EBV infection in the BJAB-ZTA-CD21 cell line was significantly higher than that in BJAB-WT cells.

[0116] The experiment was then repeated by infecting the BJAB-ZTA-CD21 cell line and the wild-type BJAB-WT cell line with 1000 FFU of EBV-GFP, with three replicates for each sample. FACS analysis 72 hours after infection showed the following results: Figure 5 C and Figure 5 As shown in D, where... Figure 5The results corresponding to D are shown in Table 2.

[0117] Table 2. EBV infection rate in BJAB cell line

[0118]

[0119] The results further confirmed that EBV infection efficiency in the BJAB-ZTA-CD21 cell line was significantly higher than that in BJAB-WT cells, and it also showed good stability and reproducibility.

[0120] Furthermore, this embodiment compared the BJAB-ZTA-CD21 cell line with the Raji cell line commonly used in EBV neutralization experiments. The FACS analysis results are as follows: Figure 5 As shown in Figure E, the results indicate that EBV infection efficiency in the BJAB-ZTA-CD21 cell line is significantly higher than in Raji cells.

[0121] The results of this embodiment show that the BJAB-ZTA-CD21 cell line is significantly more susceptible to EBV than the corresponding wild-type BJAB cell line and the commonly used Raji cell line.

[0122] Example 3: EBV neutralization experiment of cell lines.

[0123] To evaluate the applicability of the B cells and epithelial cells of the present invention in EBV neutralization experiments, positive serum samples from the immunized gHgL group and negative control serum samples from the PBS group were used. Figure 6 A and Figure 6 B shows the neutralization curves for cell line BJAB-ZTA-CD21 and epithelial cell line 293T-RTA-EphA2, respectively.

[0124] B cell neutralization experiments were performed in BJAB-ZTA-CD21 cells. 12.5 μL of serially diluted serum samples (5-fold) were mixed with 12.5 μL of EBV-GFP virus (diluted to a final infection frequency of 1-5%), incubated at 37°C for 1 hour, and then 25 μL of 2x10 EBV-GFP virus was added to each well. 4 BJAB-ZTA-CD21 cells in each well were incubated again at 37°C for 2 hours. Subsequently, the cells were centrifuged, the supernatant discarded, and the cells resuspended in 10% FBS and 1% PS1640. After incubation at 37°C for 3 days, the cells were fixed with 2% paraformaldehyde. The percentage of GFP-positive (GFP+) BJAB-ZTA-CD21 cells was determined using a BD LSRII flow cytometer. The neutralization percentage was calculated using the following formula: 100 × (mean percentage of GFP cells in the given sample - mean percentage of GFP cells in the cell-only control sample) / (mean percentage of GFP cells in the virus-only control sample - mean percentage of GFP cells in the cell-only control sample).

[0125] For B cell neutralization, the neutralizing effect gradually decreased with increasing gHgL serum dilution, showing a typical dose-dependent effect. Lower dilutions showed strong neutralizing activity, but at higher dilutions, the antibody's neutralizing capacity weakened. This indicates that gHgL-positive serum also possesses strong neutralizing activity in B cells, and the neutralizing effect is inversely proportional to the dilution factor. PBS serum remained at low levels at lower dilutions, and while the neutralizing effect fluctuated slightly with increasing dilution, it did not decrease significantly, suggesting that PBS serum had no significant neutralizing effect on EBV infection in B cells.

[0126] The epithelial cell neutralization assay was performed in 293T-RTA-EphA2 cells. 2 × 10⁶ cells were seeded per well. 4 293T-RTA-EphA2 cells were cultured in 96-well tissue culture plates. After 24 h, 25 μL of serially diluted serum samples (5-fold) and 25 μL of EBV-GFP virus (diluted to approximately 200 FFU / well, FFU-fluorescent focus units) were added and incubated at 37°C for 1 hour. The culture medium was then aspirated from the cells and replaced with a serum-virus mixture. After incubation at 37°C for 1 hour, equal volumes of 10% FBS and 1% PSDMEM were added to the cells, and the cells were incubated at 37°C for 48 hours. After 48 hours, the cell supernatant was discarded, and the cells were... The S6 universal M2 analyzer scanned the plate and counted the cells expressing GFP, denoted as FFU. The neutralization percentage was calculated using the following formula: 100 × (FFU of the given sample - FFU of the cell control sample alone) / (FFU of the virus control sample alone - FFU of the cell control sample alone). Serum samples were collected from mice after immunization, with the mice inoculated with EBV gHgL protein and PBS as controls.

[0127] For epithelial cell neutralization, the curve remained at a high level as the dilution factor of gHgL serum increased, indicating that the antibody could effectively neutralize EBV infection in epithelial cells at lower dilutions (i.e., higher serum concentrations). However, as the dilution factor continued to increase, the curve dropped sharply at high dilutions, indicating that the antibody's neutralizing ability was lost at higher dilutions. The serum curve in the PBS group showed almost no change and remained stable at different dilution factors, indicating that the antibody or serum had no significant neutralizing effect on EBV in epithelial cells, even at higher concentrations (lower dilutions).

[0128] The results of this embodiment demonstrate a typical dose-dependent response in epithelial cells and B cells, where the neutralizing effect gradually weakens with increasing gHgL serum dilution. This indicates that the cells of the present invention accurately reflect the neutralizing effect of antibodies against EBV infection. The PBS serum-treated epithelial cells and B cells showed almost no significant neutralizing effect, indicating that the modified cells can distinguish between samples with neutralizing activity and control samples without neutralizing activity, demonstrating the reliability of the experiment. Therefore, the epithelial cells and B cells of the present invention exhibit well-defined neutralization curves in the EBV neutralization experiment, proving their suitability for evaluating the neutralizing potency of antibodies or serum.

[0129] In summary, co-expression of the EBV receptor EphA2 and the viral gene cleavage and replication transcriptional activation switch protein RTA in the 293T cell line significantly improved the efficiency of EBV infection in 293T cells. Similarly, co-expression of the B cell receptor CD21 and the viral gene cleavage and replication transcriptional activation infection-related protein ZTA in the BJAB cell line significantly improved the efficiency of EBV infection in B cells. These two novel cell lines are preferred cell models for studying the mechanisms of EBV infection, EBV vaccine evaluation, and antiviral drug screening.

[0130] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. A stable cell line susceptible to EBV, characterized in that, The cell line overexpresses the EBV receptor and a transcription switch protein, wherein the transcription switch protein is a transcription activator for viral gene cleavage and replication. The cell line is: an epidermal cell line or a B cell line; The ratio of the EBV infection rate X1 of the cell line to the EBV infection rate X0 of the normal control is X1 / X0 ≥ 3; in, If the cell line is an epidermal cell line, then the EBV receptor is EphA2, and the transcription switch protein is the replication transcription activator RTA. If the cell line is a B cell line, then the EBV receptor is the CD21 receptor, and the transcription switch protein is the replication transcription activator ZTA. in, The Genbank login number for EphA2 is NP_004422.2; The Genbank accession number for the CD21 receptor is NP_001006659.

1.

2. The cell line as described in claim 1, characterized in that, The normal control refers to a wild-type cell line that does not overexpress the EBV receptor or the transcription switch protein under the same culture conditions.

3. The cell line as described in claim 1, characterized in that, The ratio of the EBV infection titer Y1 of the cell line to the EBV infection titer Y0 of the normal control is Y1 / Y0 ≥ 3.

4. The cell line as described in claim 1, characterized in that, The epidermal cell line mentioned is the 293T cell line.

5. The cell line as described in claim 1, characterized in that, The B cell line is BJAB cell.

6. The use of the cell line according to claim 1, characterized in that, For one or more of the following purposes: (Z1) is used to study the mechanism of EBV infection of host cells; (Z2) is used to screen for EBV neutralizing antibodies; (Z3) is used to screen anti-EBV drugs; (Z4) is used to screen EBV vaccines; (Z5) is used to prepare a live cell preparation for detecting EBV neutralizing antibodies in a sample.

7. A live cell preparation, characterized in that, The live cell preparation comprises the cell line of claim 1.

8. The method for preparing the cell line according to claim 1, characterized in that, Includes the following steps: (A1) Provide pLVX-puro-RTA plasmid and pLVX-hygro-EphA2 plasmid; and (A2) Transfect the pLVX-puro-RTA plasmid and the pLVX-hygro-EphA2 plasmid into an epidermal cell line to obtain a stable epidermal cell line susceptible to EBV. or (B1) Provide pLVX-hygro-CD21 plasmid and pLVX-puro-ZTA plasmid; (B2) Electroporate the pLVX-hygro-CD21 plasmid into the B cell line to obtain BJAB-CD21 cells; and (B3) The pLVX-puro-ZTA is packaged into a lentivirus and introduced into the BJAB-CD21 cells to obtain a stable B cell line susceptible to EBV.

9. A method for evaluating the EBV neutralizing activity of samples for non-diagnostic and non-therapeutic purposes, characterized in that, Includes the following steps: (S1) Provide the cell line according to any one of claims 1-5; (S2) Co-incubate the sample with the cell line from step (S1) to provide the sample with EBV neutralizing activity.

10. A platform for screening anti-EBV drugs and / or developing EBV vaccines, said platform comprising an EBV-susceptible cell line, said EBV-susceptible cell line being: (i) an epidermal cell line in which EphA2 and the replication-transcription activator RTA are overexpressed; or (ii) B cell lines in which CD21 receptor and replication transcription activator ZTA are overexpressed; in, The Genbank login number for EphA2 is NP_004422.2; The Genbank accession number for the CD21 receptor is NP_001006659.1.

Citation Information

Patent Citations

  • Method for establishing EBV virus infected artificial respiratory tract epithelium model

    CN112048477A